#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACADVL	37	hgsc.bcm.edu	37	17	7127691	7127692	+	In_Frame_Ins	INS	-	-	TCC			TCGA-13-0906-01	TCGA-13-0906-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr17:7127691_7127692insTCC	ENST00000356839.5	+	16	1763_1764	c.1584_1585insTCC	c.(1585-1587)ttg>TCCttg	p.528_529insS	ACADVL_ENST00000543245.2_In_Frame_Ins_p.551_552insS|MIR324_ENST00000362183.1_RNA|ACADVL_ENST00000350303.5_In_Frame_Ins_p.506_507insS	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	528					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)	p.E528_L529insS(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						TCCACCCGGAGTTGAGTCGGAG	0.644																																																1	Insertion - In frame(1)	ovary(1)	17																																								7068416	SO:0001652	inframe_insertion	37			BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	Exception_encountered	17.37:g.7127691_7127692insTCC	ENSP00000349297:p.Glu528_Leu529insSer		7068415	B4DEB6|F5H2A9|O76056|Q8WUL0	In_Frame_Ins	INS	ENST00000356839.5	37	CCDS11090.1	INS	36	Baylor																																																																																				0.644	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220001.5	NM_000018		In_Frame_Ins
ACBD4	79777	hgsc.bcm.edu	37	17	43214805	43214808	+	Frame_Shift_Del	DEL	GGCA	GGCA	-			TCGA-13-0906-01	TCGA-13-0906-10	GGCA	GGCA	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr17:43214805_43214808delGGCA	ENST00000376955.4	+	6	783_786	c.486_489delGGCA	c.(484-489)ccggcafs	p.PA162fs	ACBD4_ENST00000586346.1_Frame_Shift_Del_p.PA162fs|ACBD4_ENST00000321854.8_Frame_Shift_Del_p.PA162fs|ACBD4_ENST00000398322.3_Frame_Shift_Del_p.PA162fs|ACBD4_ENST00000592162.1_Frame_Shift_Del_p.PA162fs|ACBD4_ENST00000591136.1_3'UTR|ACBD4_ENST00000431281.1_Frame_Shift_Del_p.PA162fs|ACBD4_ENST00000591859.1_Frame_Shift_Del_p.PA162fs	NM_001135707.1	NP_001129179.1	Q8NC06	ACBD4_HUMAN	acyl-CoA binding domain containing 4	162							fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			kidney(1)|lung(3)|ovary(1)	5						CCAAGGAACCGGCACCCCCAAGCC	0.627																																																0			17																																								40570334	SO:0001589	frameshift_variant	79777			BC029164	CCDS42348.1, CCDS45710.1, CCDS45711.1	17q21.31	2012-10-02	2010-04-30		ENSG00000181513	ENSG00000181513			23337	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 4"""				Standard	NM_001135704		Approved	FLJ13322	uc002iie.3	Q8NC06	OTTHUMG00000180111	ENST00000376955.4:c.486_489delGGCA	17.37:g.43214805_43214808delGGCA	ENSP00000366154:p.Pro162fs		40570331	D3DX64|Q8IUT1|Q9H8Q4	Frame_Shift_Del	DEL	ENST00000376955.4	37	CCDS45711.1	DEL	39	Baylor																																																																																				0.627	ACBD4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000449816.1	NM_024722		Frame_Shift_Del
ACOT4	122970	hgsc.bcm.edu	37	14	74062308	74062308	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr14:74062308T>A	ENST00000326303.4	+	3	1470	c.1216T>A	c.(1216-1218)Ttc>Atc	p.F406I		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	406					acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		TCTAGCCTTCTTCTGCAAACA	0.448																																																0			14											72.0	75.0	74.0					14																	74062308		2203	4300	6503	73132061	SO:0001583	missense	122970			BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	ENST00000326303.4:c.1216T>A	14.37:g.74062308T>A	ENSP00000323071:p.Phe406Ile		73132061	Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Missense_Mutation	SNP	ENST00000326303.4	37	CCDS9817.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.2	3.955658	0.73902	.	.	ENSG00000177465	ENST00000326303	T	0.47528	0.84	5.74	4.59	0.56863	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.050796	0.85682	D	0.000000	T	0.68970	0.3059	M	0.86864	2.845	0.58432	D	0.99999	D	0.89917	1.0	D	0.77557	0.99	T	0.73668	-0.3910	10	0.87932	D	0	-15.293	8.9911	0.36024	0.0:0.1449:0.0:0.8551	.	406	Q8N9L9	ACOT4_HUMAN	I	406	ENSP00000323071:F406I	ENSP00000323071:F406I	F	+	1	0	ACOT4	73132061	0.999000	0.42202	0.498000	0.27564	0.809000	0.45718	2.300000	0.43620	2.196000	0.70406	0.459000	0.35465	TTC		0.448	ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404298.2	NM_152331		Missense_Mutation
ADAM22	53616	hgsc.bcm.edu	37	7	87563789	87563789	+	Silent	SNP	G	G	A	rs368425480		TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr7:87563789G>A	ENST00000265727.7	+	1	88	c.9G>A	c.(7-9)gcG>gcA	p.A3A	ADAM22_ENST00000398209.3_Silent_p.A3A|ADAM22_ENST00000315984.7_Silent_p.A3A|ADAM22_ENST00000439864.1_Silent_p.A3A|ADAM22_ENST00000398204.4_Silent_p.A3A|ADAM22_ENST00000398201.4_Silent_p.A3A			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	3					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A3A(2)		endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			CCATGCAGGCGGCAGTGGCTG	0.716																																																2	Substitution - coding silent(2)	ovary(2)	7											12.0	18.0	16.0					7																	87563789		2079	4189	6268	87401725	SO:0001819	synonymous_variant	53616			AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.9G>A	7.37:g.87563789G>A			87401725	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Silent	SNP	ENST00000265727.7	37	CCDS47637.1	SNP	39	Baylor																																																																																				0.716	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723		Silent
ADAMTS5	11096	hgsc.bcm.edu	37	21	28305211	28305211	+	Silent	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr21:28305211G>A	ENST00000284987.5	-	5	1963	c.1842C>T	c.(1840-1842)cgC>cgT	p.R614R	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	614	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.		R -> H (in dbSNP:rs2830585). {ECO:0000269|PubMed:10464288}.		defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R614R(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						GACTGCAGGAGCGGTAGATGG	0.507																																					Esophageal Squamous(53;683 1080 10100 14424 45938)											1	Substitution - coding silent(1)	ovary(1)	21											151.0	105.0	120.0					21																	28305211		2203	4300	6503	27227082	SO:0001819	synonymous_variant	11096			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1842C>T	21.37:g.28305211G>A			27227082	Q52LV4|Q9UKP2	Silent	SNP	ENST00000284987.5	37	CCDS13579.1	SNP	34	Baylor																																																																																				0.507	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1			Silent
ADCY4	196883	hgsc.bcm.edu	37	14	24787968	24787968	+	Silent	SNP	G	G	T	rs370081321		TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr14:24787968G>T	ENST00000310677.4	-	25	3086	c.2973C>A	c.(2971-2973)ccC>ccA	p.P991P	ADCY4_ENST00000554068.2_Silent_p.P991P|ADCY4_ENST00000418030.2_Silent_p.P991P	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	991					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.P991P(2)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		CAGCTACTACGGGTCCATGGT	0.532																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	14											93.0	91.0	92.0					14																	24787968		2203	4300	6503	23857808	SO:0001819	synonymous_variant	196883			AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.2973C>A	14.37:g.24787968G>T			23857808	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Silent	SNP	ENST00000310677.4	37	CCDS9627.1	SNP	39	Baylor																																																																																				0.532	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4			Silent
ADCY9	115	hgsc.bcm.edu	37	16	4164092	4164092	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr16:4164092C>G	ENST00000294016.3	-	2	1890	c.1352G>C	c.(1351-1353)tGt>tCt	p.C451S		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	451	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GGGCTCGGGACAGCCCGCCAC	0.597																																																0			16											80.0	87.0	84.0					16																	4164092		2197	4300	6497	4104093	SO:0001583	missense	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1352G>C	16.37:g.4164092C>G	ENSP00000294016:p.Cys451Ser		4104093	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	CCDS32382.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.75	3.689932	0.68271	.	.	ENSG00000162104	ENST00000294016	D	0.84223	-1.82	5.28	5.28	0.74379	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.94414	0.8203	M	0.93062	3.375	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95345	0.8441	10	0.66056	D	0.02	.	18.9505	0.92640	0.0:1.0:0.0:0.0	.	451	O60503	ADCY9_HUMAN	S	451	ENSP00000294016:C451S	ENSP00000294016:C451S	C	-	2	0	ADCY9	4104093	1.000000	0.71417	0.990000	0.47175	0.791000	0.44710	7.814000	0.86154	2.481000	0.83766	0.555000	0.69702	TGT		0.597	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1			Missense_Mutation
ADD1	118	hgsc.bcm.edu	37	4	2928383	2928383	+	Intron	SNP	A	A	C			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr4:2928383A>C	ENST00000398129.1	+	13	1881				ADD1_ENST00000398123.2_Silent_p.R657R|ADD1_ENST00000446856.1_Intron|ADD1_ENST00000503455.2_Silent_p.R658R|ADD1_ENST00000264758.7_Intron|ADD1_ENST00000513328.2_Silent_p.R627R|ADD1_ENST00000398125.1_Silent_p.R657R|ADD1_ENST00000355842.3_Silent_p.R657R			P35611	ADDA_HUMAN	adducin 1 (alpha)						actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CGGATGCGCTAGAGAGTACCT	0.498																																					Esophageal Squamous(71;505 1201 20414 34538 37449)											0			4											62.0	64.0	63.0					4																	2928383		2051	4212	6263	2898181	SO:0001627	intron_variant	118			L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.1861+544A>C	4.37:g.2928383A>C			2898181	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Silent	SNP	ENST00000398129.1	37	CCDS43205.1	SNP	15	Baylor																																																																																				0.498	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189		Silent
AHNAK	79026	hgsc.bcm.edu	37	11	62300598	62300598	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr11:62300598C>T	ENST00000378024.4	-	5	1565	c.1291G>A	c.(1291-1293)Gtg>Atg	p.V431M	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	431					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.V431M(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ATCTTGGGCACATTCAGTTTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	11											82.0	84.0	83.0					11																	62300598		2202	4299	6501	62057174	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.1291G>A	11.37:g.62300598C>T	ENSP00000367263:p.Val431Met		62057174	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.956480	0.00465	.	.	ENSG00000124942	ENST00000378024	T	0.00625	6.14	5.65	-11.3	0.00108	.	0.910928	0.09119	N	0.845979	T	0.00178	0.0005	N	0.00224	-1.81	0.09310	N	1	B	0.24092	0.097	B	0.21917	0.037	T	0.49716	-0.8910	10	0.22706	T	0.39	-1.67	1.9372	0.03339	0.2644:0.3999:0.1784:0.1573	.	431	Q09666	AHNK_HUMAN	M	431	ENSP00000367263:V431M	ENSP00000367263:V431M	V	-	1	0	AHNAK	62057174	0.000000	0.05858	0.000000	0.03702	0.411000	0.31082	-1.541000	0.02198	-2.522000	0.00497	-0.156000	0.13503	GTG		0.537	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		Missense_Mutation
ALOXE3	59344	hgsc.bcm.edu	37	17	8021174	8021174	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr17:8021174G>T	ENST00000448843.2	-	2	475	c.135C>A	c.(133-135)ttC>ttA	p.F45L	ALOXE3_ENST00000318227.3_Missense_Mutation_p.F177L|ALOXE3_ENST00000380149.1_Missense_Mutation_p.F201L	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	45	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)	p.F45L(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						ATCCAGGGGCGAAGTCCCTGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	17											50.0	36.0	41.0					17																	8021174		2203	4300	6503	7961899	SO:0001583	missense	59344			AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.135C>A	17.37:g.8021174G>T	ENSP00000400581:p.Phe45Leu		7961899	B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Missense_Mutation	SNP	ENST00000448843.2	37	CCDS11130.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426493	0.83667	.	.	ENSG00000179148	ENST00000380149;ENST00000318227;ENST00000448843	T;T;T	0.50813	0.73;0.73;0.73	4.8	1.62	0.23740	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.047852	0.85682	D	0.000000	T	0.64638	0.2616	M	0.80422	2.495	0.47009	D	0.999286	D;D;D	0.69078	0.99;0.997;0.997	D;D;D	0.72625	0.973;0.978;0.978	T	0.64153	-0.6474	10	0.54805	T	0.06	-25.3122	9.1359	0.36875	0.2533:0.0:0.7467:0.0	.	177;45;45	B7Z3W0;Q9BYJ1;B3KVD2	.;LOXE3_HUMAN;.	L	201;177;45	ENSP00000369494:F201L;ENSP00000314879:F177L;ENSP00000400581:F45L	ENSP00000314879:F177L	F	-	3	2	ALOXE3	7961899	0.002000	0.14202	0.944000	0.38274	0.953000	0.61014	-0.102000	0.10956	0.413000	0.25759	0.561000	0.74099	TTC		0.617	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441475.1			Missense_Mutation
ANK3	288	hgsc.bcm.edu	37	10	61847934	61847934	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr10:61847934G>C	ENST00000280772.2	-	29	3702	c.3511C>G	c.(3511-3513)Cta>Gta	p.L1171V	ANK3_ENST00000373827.2_Missense_Mutation_p.L1165V|ANK3_ENST00000503366.1_Missense_Mutation_p.L1172V|ANK3_ENST00000355288.2_Missense_Mutation_p.L305V	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1171	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.L1171V(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CTTTTAGTTAGGGCACCCTCT	0.483																																																1	Substitution - Missense(1)	ovary(1)	10											107.0	109.0	108.0					10																	61847934		2203	4300	6503	61517940	SO:0001583	missense	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.3511C>G	10.37:g.61847934G>C	ENSP00000280772:p.Leu1171Val		61517940	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964270	0.53507	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000544789;ENST00000536348	T;T;T;T	0.73897	-0.24;-0.79;-0.79;-0.79	6.17	3.85	0.44370	.	0.000000	0.33110	N	0.005278	T	0.81833	0.4906	M	0.62088	1.915	0.80722	D	1	D;D;D;D;D;P;D	0.89917	0.978;0.998;0.999;1.0;0.997;0.854;0.997	D;D;D;D;D;P;D	0.87578	0.918;0.99;0.996;0.998;0.991;0.747;0.978	T	0.79907	-0.1605	10	0.54805	T	0.06	.	8.6014	0.33747	0.7507:0.0:0.2493:0.0	.	1172;305;704;1165;1171;406;305	E9PE32;A8KA62;Q59G01;Q5CZH9;Q12955;F5GXK0;B1AQT2	.;.;.;.;ANK3_HUMAN;.;.	V	1171;1165;305;305;1172;1151;406;806;806;304;704	ENSP00000280772:L1171V;ENSP00000362933:L1165V;ENSP00000347436:L305V;ENSP00000425236:L1172V	ENSP00000280772:L1171V	L	-	1	2	ANK3	61517940	0.973000	0.33851	0.996000	0.52242	0.998000	0.95712	1.730000	0.38125	0.567000	0.29293	0.655000	0.94253	CTA		0.483	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987		Missense_Mutation
AP3S1	1176	hgsc.bcm.edu	37	5	115230798	115230800	+	In_Frame_Del	DEL	ATT	ATT	-			TCGA-13-0906-01	TCGA-13-0906-10	ATT	ATT	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr5:115230798_115230800delATT	ENST00000316788.7	+	4	845_847	c.288_290delATT	c.(286-291)acatta>aca	p.L97del	AP3S1_ENST00000505423.1_3'UTR	NM_001284.2	NP_001275.1	Q92572	AP3S1_HUMAN	adaptor-related protein complex 3, sigma 1 subunit	97					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transport (GO:0006886)	AP-3 adaptor complex (GO:0030123)|AP-type membrane coat adaptor complex (GO:0030119)|Golgi apparatus (GO:0005794)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.L97delL(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)	12		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;1.08e-07)|Epithelial(69;1.11e-06)|all cancers(49;5.2e-05)		TTGTGGAAACATTAGACAAATGT	0.271																																																1	Deletion - In frame(1)	ovary(1)	5																																								115258699	SO:0001651	inframe_deletion	1176			D63643	CCDS4123.1	5q22	2010-06-29			ENSG00000177879	ENSG00000177879			2013	protein-coding gene	gene with protein product		601507		CLAPS3		8697810, 9118953	Standard	NM_001284		Approved		uc003krl.3	Q92572	OTTHUMG00000128887	ENST00000316788.7:c.288_290delATT	5.37:g.115230798_115230800delATT	ENSP00000325369:p.Leu97del		115258697	O00647|O00676|O00721|O00727|Q53XL4|Q6ICQ2	In_Frame_Del	DEL	ENST00000316788.7	37	CCDS4123.1	DEL	8	Baylor																																																																																				0.271	AP3S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250847.2			In_Frame_Del
ATP13A4	84239	hgsc.bcm.edu	37	3	193210932	193210932	+	Silent	SNP	C	C	A			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:193210932C>A	ENST00000342695.4	-	4	721	c.399G>T	c.(397-399)gtG>gtT	p.V133V	ATP13A4_ENST00000295548.3_Silent_p.V133V|ATP13A4_ENST00000392443.3_Silent_p.V133V	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	133						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.V133V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TTATTTTCTGCACTTTGATGC	0.358																																																1	Substitution - coding silent(1)	ovary(1)	3											87.0	83.0	84.0					3																	193210932		2201	4298	6499	194693626	SO:0001819	synonymous_variant	84239			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.399G>T	3.37:g.193210932C>A			194693626	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Silent	SNP	ENST00000342695.4	37	CCDS3304.2	SNP	25	Baylor																																																																																				0.358	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279		Silent
AVPR2	554	hgsc.bcm.edu	37	X	153171454	153171463	+	Frame_Shift_Del	DEL	CCTTCTCGCT	CCTTCTCGCT	-	rs367681688		TCGA-13-0906-01	TCGA-13-0906-10	CCTTCTCGCT	CCTTCTCGCT	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chrX:153171454_153171463delCCTTCTCGCT	ENST00000358927.2	+	3	703_712	c.494_503delCCTTCTCGCT	c.(493-504)gccttctcgctcfs	p.AFSL165fs	AVPR2_ENST00000370049.1_Frame_Shift_Del_p.AFSL165fs|AVPR2_ENST00000337474.5_Frame_Shift_Del_p.AFSL165fs			P30518	V2R_HUMAN	arginine vasopressin receptor 2	165					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|excretion (GO:0007588)|hemostasis (GO:0007599)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-gamma production (GO:0032609)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of systemic arterial blood pressure (GO:0003084)|response to cytokine (GO:0034097)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	vasopressin receptor activity (GO:0005000)	p.A165A(2)|p.L168fs*41(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	26	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Desmopressin(DB00035)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	GTGGCTTGGGCCTTCTCGCTCCTTCTCAGC	0.671																																																3	Substitution - coding silent(2)|Deletion - Frameshift(1)	lung(2)|ovary(1)	X	GRCh37	CM001627|CM014890|CM025909|CM940157|CM940158	AVPR2	M																																				152824657	SO:0001589	frameshift_variant	554			Z11687	CCDS14735.1, CCDS55539.1	Xq28	2014-09-17	2008-08-01		ENSG00000126895	ENSG00000126895		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	897	protein-coding gene	gene with protein product	"""nephrogenic diabetes insipidus"""	300538		DIR3, DIR		1324225	Standard	NM_000054		Approved	V2R	uc004fjh.4	P30518	OTTHUMG00000024227	ENST00000358927.2:c.494_503delCCTTCTCGCT	X.37:g.153171454_153171463delCCTTCTCGCT	ENSP00000351805:p.Ala165fs		152824648	C5HF20|O43192|Q3MJD3|Q9UCV9	Frame_Shift_Del	DEL	ENST00000358927.2	37	CCDS14735.1	DEL	26	Baylor																																																																																				0.671	AVPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061127.2			Frame_Shift_Del
B4GALNT4	338707	hgsc.bcm.edu	37	11	380167	380167	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr11:380167T>C	ENST00000329962.6	+	17	2680	c.2680T>C	c.(2680-2682)Tcc>Ccc	p.S894P		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	894					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)	p.S894P(1)		endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTTCGAGCGCTCCGCCGGGCT	0.706																																																1	Substitution - Missense(1)	ovary(1)	11											17.0	22.0	20.0					11																	380167		2198	4298	6496	370167	SO:0001583	missense	338707			AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.2680T>C	11.37:g.380167T>C	ENSP00000328277:p.Ser894Pro		370167	Q96LV2	Missense_Mutation	SNP	ENST00000329962.6	37	CCDS7694.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	t	21.2	4.114259	0.77210	.	.	ENSG00000182272	ENST00000329962	T	0.37915	1.17	4.45	3.23	0.37069	.	0.139955	0.50627	D	0.000120	T	0.55893	0.1949	M	0.81802	2.56	0.46149	D	0.998897	D	0.58970	0.984	P	0.61533	0.89	T	0.62407	-0.6861	10	0.62326	D	0.03	-26.3008	11.5529	0.50731	0.0:0.0:0.1484:0.8516	.	894	Q76KP1	B4GN4_HUMAN	P	894	ENSP00000328277:S894P	ENSP00000328277:S894P	S	+	1	0	B4GALNT4	370167	1.000000	0.71417	0.989000	0.46669	0.782000	0.44232	5.743000	0.68655	1.769000	0.52152	0.459000	0.35465	TCC		0.706	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239289.2	NM_178537		Missense_Mutation
BMP2K	55589	hgsc.bcm.edu	37	4	79786720	79786720	+	Silent	SNP	T	T	C			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr4:79786720T>C	ENST00000335016.5	+	10	1243	c.1077T>C	c.(1075-1077)gaT>gaC	p.D359D	BMP2K_ENST00000502871.1_Silent_p.D359D	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	359					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)	p.D359D(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						GAATAACAGATACCATTGGAC	0.363																																																1	Substitution - coding silent(1)	ovary(1)	4											96.0	90.0	92.0					4																	79786720		2203	4300	6503	80005744	SO:0001819	synonymous_variant	55589			AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1077T>C	4.37:g.79786720T>C			80005744	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Silent	SNP	ENST00000335016.5	37	CCDS47083.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.025	0.985794	0.18889	.	.	ENSG00000138756	ENST00000502613	.	.	.	5.26	2.82	0.32997	.	.	.	.	.	T	0.58892	0.2154	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52170	-0.8611	4	.	.	.	-15.5031	9.6777	0.40050	0.0:0.1418:0.0:0.8582	.	.	.	.	H	52	.	.	Y	+	1	0	BMP2K	80005744	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.660000	0.37397	0.413000	0.25759	0.533000	0.62120	TAC		0.363	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593		Silent
BOC	91653	hgsc.bcm.edu	37	3	113002293	113002293	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:113002293C>A	ENST00000495514.1	+	16	3171	c.2467C>A	c.(2467-2469)Ccc>Acc	p.P823T	BOC_ENST00000273395.4_Missense_Mutation_p.P824T|BOC_ENST00000355385.3_Missense_Mutation_p.P823T			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	823					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.P823T(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			TCGACTGCCACCCCCAACTCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	3											95.0	111.0	105.0					3																	113002293		2203	4300	6503	114484983	SO:0001583	missense	91653			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.2467C>A	3.37:g.113002293C>A	ENSP00000418663:p.Pro823Thr		114484983	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	5.556	0.287371	0.10513	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.60040	0.22;0.23;0.22	5.85	5.85	0.93711	.	0.394019	0.28365	N	0.015612	T	0.52025	0.1709	L	0.46157	1.445	0.43342	D	0.995391	B;B;B	0.16166	0.016;0.004;0.002	B;B;B	0.24006	0.05;0.008;0.004	T	0.41980	-0.9478	10	0.23302	T	0.38	.	14.9374	0.70967	0.1429:0.8571:0.0:0.0	.	640;824;823	Q9BWV1-2;Q9BWV1-3;Q9BWV1	.;.;BOC_HUMAN	T	823;824;823	ENSP00000418663:P823T;ENSP00000273395:P824T;ENSP00000347546:P823T	ENSP00000273395:P824T	P	+	1	0	BOC	114484983	0.895000	0.30542	0.991000	0.47740	0.020000	0.10135	1.624000	0.37018	2.767000	0.95098	0.655000	0.94253	CCC		0.557	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254		Missense_Mutation
CFAP54	144535	hgsc.bcm.edu	37	12	97150244	97150244	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr12:97150244G>C	ENST00000524981.4	+	57	7872	c.7849G>C	c.(7849-7851)Gaa>Caa	p.E2617Q				Q96N23	CL055_HUMAN		0								p.E1042Q(1)									AGGCAAAATAGAACGTCAAAT	0.308																																																1	Substitution - Missense(1)	ovary(1)	12											51.0	55.0	54.0					12																	97150244		2202	4299	6501	95674375	SO:0001583	missense	374467																														ENST00000524981.4:c.7849G>C	12.37:g.97150244G>C	ENSP00000431759:p.Glu2617Gln		95674375		Missense_Mutation	SNP	ENST00000524981.4	37		SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.26	2.483243	0.44147	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	5.55	5.55	0.83447	.	0.174400	0.40302	N	0.001121	T	0.67998	0.2953	L	0.41824	1.3	0.36009	D	0.837959	D	0.89917	1.0	D	0.87578	0.998	T	0.65784	-0.6084	9	0.20519	T	0.43	-22.2594	18.0566	0.89365	0.0:0.0:1.0:0.0	.	1042	Q6ZTY8	CL063_HUMAN	Q	2617;1042	.	ENSP00000345466:E1042Q	E	+	1	0	C12orf63	95674375	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.165000	0.58196	2.768000	0.95171	0.655000	0.94253	GAA		0.308	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000395046.4			Missense_Mutation
C19orf44	84167	hgsc.bcm.edu	37	19	16620461	16620463	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-13-0906-01	TCGA-13-0906-10	AGC	AGC	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr19:16620461_16620463delAGC	ENST00000221671.3	+	5	1457_1459	c.1301_1303delAGC	c.(1300-1305)gagcat>gat	p.434_435EH>D	CTD-3222D19.2_ENST00000409035.1_Intron|C19orf44_ENST00000594035.1_In_Frame_Del_p.434_435EH>D	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	434								p.E434_H435>D(1)		endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						GAGGTCTCGGAGCATCTCAGTGC	0.635																																																1	Complex - deletion inframe(1)	ovary(1)	19																																								16481463	SO:0001651	inframe_deletion	84167			AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.1301_1303delAGC	19.37:g.16620461_16620463delAGC	ENSP00000221671:p.Glu434_His435delinsAsp		16481461	Q8N6Y7	In_Frame_Del	DEL	ENST00000221671.3	37	CCDS12345.1	DEL	11	Baylor																																																																																				0.635	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461218.1	NM_032207		In_Frame_Del
TMEM259	91304	hgsc.bcm.edu	37	19	1011130	1011130	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr19:1011130delT	ENST00000356663.3	-	10	1403	c.1282delA	c.(1282-1284)agcfs	p.S428fs	TMEM259_ENST00000333175.5_Intron	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259	428						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.S428fs*15(1)									AGGGCCAGGCTGCTATACTGC	0.642																																																1	Deletion - Frameshift(1)	ovary(1)	19											42.0	39.0	40.0					19																	1011130		2196	4296	6492	962130	SO:0001589	frameshift_variant	91304			BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3		ENST00000356663.3:c.1282delA	19.37:g.1011130delT	ENSP00000349087:p.Ser428fs		962130	O60392|Q8NF79|Q96H30	Frame_Shift_Del	DEL	ENST00000356663.3	37	CCDS32862.1	DEL	55	Baylor																																																																																				0.642	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458236.1	NM_033420		Frame_Shift_Del
C1orf101	257044	hgsc.bcm.edu	37	1	244747203	244747203	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr1:244747203C>A	ENST00000366534.4	+	13	2101	c.2047C>A	c.(2047-2049)Cct>Act	p.P683T	C1orf101_ENST00000473875.1_3'UTR|C1orf101_ENST00000366531.3_Missense_Mutation_p.P532T|C1orf101_ENST00000366533.4_Missense_Mutation_p.P683T	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	683						CatSper complex (GO:0036128)		p.P683T(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			TCAGTTTCGACCTAGTGAATA	0.433																																																1	Substitution - Missense(1)	ovary(1)	1											96.0	78.0	84.0					1																	244747203		2203	4300	6503	242813826	SO:0001583	missense	257044			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.2047C>A	1.37:g.244747203C>A	ENSP00000355492:p.Pro683Thr		242813826	B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	ENST00000366534.4	37	CCDS44340.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431175	0.43122	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000428042;ENST00000366531	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	4.87	2.97	0.34412	.	0.102825	0.43416	D	0.000567	T	0.39708	0.1088	L	0.59436	1.845	0.09310	N	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.76071	0.967;0.955;0.987;0.972	T	0.10989	-1.0606	10	0.33940	T	0.23	.	6.6177	0.22786	0.0:0.7225:0.1804:0.0971	.	603;683;683;532	B1AQM6;Q5SY80;Q5SY80-2;B4DZR4	.;CA101_HUMAN;.;.	T	683;683;683;603;532	ENSP00000355492:P683T;ENSP00000355491:P683T;ENSP00000395796:P603T;ENSP00000355489:P532T	ENSP00000355489:P532T	P	+	1	0	C1orf101	242813826	0.391000	0.25221	0.036000	0.18154	0.017000	0.09413	1.868000	0.39509	0.621000	0.30232	0.561000	0.74099	CCT		0.433	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096701.1	NM_173807		Missense_Mutation
C4B	721	hgsc.bcm.edu	37	6	31996571	31996571	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr6:31996571A>C	ENST00000435363.2	+	26	3416	c.3332A>C	c.(3331-3333)cAg>cCg	p.Q1111P	C4B_ENST00000425700.2_Missense_Mutation_p.Q1111P	NM_001002029.3	NP_001002029.3	P0C0L5	CO4B_HUMAN	complement component 4B (Chido blood group)	1111					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|detection of molecule of bacterial origin (GO:0032490)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|complement binding (GO:0001848)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	CTGTCCCAGCAGCAGGCTGAC	0.602																																																0			6											39.0	41.0	40.0					6																	31996571		1529	3496	5025	32104549	SO:0001583	missense	720			AF019413	CCDS47405.1	6p21.3	2014-09-17	2009-01-06		ENSG00000224389	ENSG00000224389		"""Blood group antigens"", ""Complement system"""	1324	protein-coding gene	gene with protein product		120820	"""complement component 4B"""				Standard	NM_001002029		Approved	CPAMD3, C4F, CO4, C4B1, C4B3, CH	uc011jpm.2	P0C0L5	OTTHUMG00000031187	ENST00000435363.2:c.3332A>C	6.37:g.31996571A>C	ENSP00000415941:p.Gln1111Pro		32104549	A2BHY4|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q6U2E9|Q6U2G1|Q6U2I5|Q6U2L1|Q6U2L7|Q6U2L9|Q6U2M5|Q6VCV8|Q96SA7|Q9NPK5|Q9UIP5	Missense_Mutation	SNP	ENST00000435363.2	37	CCDS47405.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.75	3.465447	0.63513	.	.	ENSG00000224389	ENST00000435363;ENST00000425700	T;T	0.26810	1.71;1.71	4.45	4.45	0.53987	.	0.510643	0.19549	N	0.111610	T	0.54775	0.1879	H	0.96748	3.875	0.53688	D	0.999976	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.68119	-0.5493	10	0.87932	D	0	.	10.1402	0.42730	1.0:0.0:0.0:0.0	.	1111;1111	F5GXS0;Q6U2E9	.;.	P	1111	ENSP00000415941:Q1111P;ENSP00000391933:Q1111P	ENSP00000391933:Q1111P	Q	+	2	0	C4B	32104549	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	5.415000	0.66411	1.647000	0.50633	0.456000	0.33151	CAG		0.602	C4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076368.5	NM_001002029		Missense_Mutation
UQCC2	84300	hgsc.bcm.edu	37	6	33668284	33668284	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr6:33668284G>A	ENST00000607484.1	-	3	260	c.220C>T	c.(220-222)Cgc>Tgc	p.R74C	MIR3934_ENST00000579806.1_RNA|UQCC2_ENST00000374214.3_Missense_Mutation_p.R49C	NM_032340.3	NP_115716.1	Q9BRT2	UQCC2_HUMAN	ubiquinol-cytochrome c reductase complex assembly factor 2	74					regulation of insulin secretion (GO:0050796)|regulation of oxidative phosphorylation (GO:0002082)|regulation of skeletal muscle cell differentiation (GO:2001014)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											TCTCTGGGGCGAGGGTACTGG	0.552											OREG0017352	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			6											154.0	153.0	153.0					6																	33668284		2203	4300	6503	33776262	SO:0001583	missense	84300				CCDS4784.1	6p21.31	2013-09-20	2013-09-20	2013-09-20	ENSG00000137288	ENSG00000137288		"""Mitochondrial respiratory chain complex assembly factors"""	21237	protein-coding gene	gene with protein product	"""cytochrome B protein synthesis 6 homolog (S. cerevisiae)"""	614461	"""chromosome 6 open reading frame 125"", ""mitochondrial nucleoid factor 1"""	C6orf125, MNF1		19643811	Standard	NM_032340		Approved	MGC14833, bA6B20.2, M19, Cbp6	uc003ofa.2	Q9BRT2	OTTHUMG00000014534	ENST00000607484.1:c.220C>T	6.37:g.33668284G>A	ENSP00000476140:p.Arg74Cys	841	33776262	B2R4I0	Missense_Mutation	SNP	ENST00000607484.1	37	CCDS4784.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	25.1	4.607097	0.87157	.	.	ENSG00000137288	ENST00000374231;ENST00000374214	.	.	.	6.02	6.02	0.97574	.	0.232370	0.43110	D	0.000609	T	0.77177	0.4092	M	0.80616	2.505	0.58432	D	0.999999	D	0.89917	1.0	D	0.66196	0.942	T	0.78932	-0.2009	9	0.87932	D	0	.	18.7276	0.91720	0.0:0.0:1.0:0.0	.	74	Q9BRT2	CF125_HUMAN	C	74;49	.	ENSP00000363331:R49C	R	-	1	0	C6orf125	33776262	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.360000	0.73064	2.850000	0.98022	0.650000	0.86243	CGC		0.552	UQCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040207.2	NM_032340		Missense_Mutation
CACNA1F	778	hgsc.bcm.edu	37	X	49084785	49084785	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chrX:49084785G>C	ENST00000376265.2	-	7	1003	c.942C>G	c.(940-942)gaC>gaG	p.D314E	CACNA1F_ENST00000323022.5_Missense_Mutation_p.D314E|CACNA1F_ENST00000376251.1_Missense_Mutation_p.D249E	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	314					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.D314E(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	AGAAGAAGTTGTCAAAGTTGG	0.607																																																1	Substitution - Missense(1)	ovary(1)	X											81.0	67.0	72.0					X																	49084785		2203	4300	6503	48971729	SO:0001583	missense	778			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.942C>G	X.37:g.49084785G>C	ENSP00000365441:p.Asp314Glu		48971729	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	CCDS35253.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.81	2.944626	0.53079	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.97430	-4.38;-4.38;-4.38	5.08	4.21	0.49690	Ion transport (1);	0.095587	0.64402	D	0.000001	D	0.98273	0.9428	M	0.88031	2.925	0.37529	D	0.91785	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.99659	1.0993	10	0.87932	D	0	.	8.3255	0.32153	0.1896:0.0:0.8104:0.0	.	314;314	F5CIQ9;O60840	.;CAC1F_HUMAN	E	249;314;314	ENSP00000365427:D249E;ENSP00000321618:D314E;ENSP00000365441:D314E	ENSP00000321618:D314E	D	-	3	2	CACNA1F	48971729	0.999000	0.42202	1.000000	0.80357	0.971000	0.66376	1.131000	0.31406	0.939000	0.37446	0.436000	0.28706	GAC		0.607	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183		Missense_Mutation
CAMSAP2	23271	hgsc.bcm.edu	37	1	200818158	200818158	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr1:200818158G>T	ENST00000236925.4	+	12	2343	c.2294G>T	c.(2293-2295)aGg>aTg	p.R765M	CAMSAP2_ENST00000358823.2_Missense_Mutation_p.R754M|CAMSAP2_ENST00000413307.2_Missense_Mutation_p.R738M			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	765					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)	p.R754M(1)									GTGCATCTTAGGATGAAACTA	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											74.0	80.0	78.0					1																	200818158		2203	4300	6503	199084781	SO:0001583	missense	23271			AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.2294G>T	1.37:g.200818158G>T	ENSP00000236925:p.Arg765Met		199084781	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	ENST00000236925.4	37		SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.30	3.085867	0.55861	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	T;T;T	0.70282	-0.47;-0.47;-0.47	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.81211	0.4775	M	0.68317	2.08	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.996;0.999	D;P;D	0.66716	0.922;0.885;0.946	T	0.82623	-0.0366	10	0.66056	D	0.02	-17.2843	13.4879	0.61377	0.0752:0.0:0.9248:0.0	.	738;765;754	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	M	754;738;765	ENSP00000351684:R754M;ENSP00000416800:R738M;ENSP00000236925:R765M	ENSP00000236925:R765M	R	+	2	0	CAMSAP1L1	199084781	1.000000	0.71417	0.992000	0.48379	0.939000	0.58152	4.948000	0.63590	2.527000	0.85204	0.484000	0.47621	AGG		0.463	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459		Missense_Mutation
CCDC39	339829	hgsc.bcm.edu	37	3	180366022	180366022	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:180366022T>A	ENST00000442201.2	-	10	1412	c.1293A>T	c.(1291-1293)aaA>aaT	p.K431N	CCDC39_ENST00000273654.4_Missense_Mutation_p.K515N	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	431					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.K515N(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GGTTGAGATGTTTCAGAGAGG	0.353																																																1	Substitution - Missense(1)	ovary(1)	3											121.0	112.0	115.0					3																	180366022		1834	4082	5916	181848716	SO:0001583	missense	339829			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1293A>T	3.37:g.180366022T>A	ENSP00000405708:p.Lys431Asn		181848716	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	17.70	3.453849	0.63290	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.78595	-1.19;-1.19	5.37	-1.19	0.09585	.	0.318283	0.34580	N	0.003849	T	0.72095	0.3418	M	0.82323	2.585	0.30352	N	0.784672	P	0.39352	0.669	B	0.30943	0.122	T	0.70226	-0.4930	10	0.41790	T	0.15	-23.213	11.8579	0.52449	0.0:0.6163:0.0:0.3837	.	431	Q9UFE4	CCD39_HUMAN	N	515;431	ENSP00000273654:K515N;ENSP00000405708:K431N	ENSP00000273654:K515N	K	-	3	2	CCDC39	181848716	0.995000	0.38212	0.992000	0.48379	0.961000	0.63080	0.169000	0.16641	-0.085000	0.12573	-0.379000	0.06801	AAA		0.353	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028		Missense_Mutation
CCDC57	284001	hgsc.bcm.edu	37	17	80151998	80151998	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr17:80151998T>G	ENST00000389641.4	-	5	672	c.636A>C	c.(634-636)aaA>aaC	p.K212N	CCDC57_ENST00000392347.1_Missense_Mutation_p.K212N|CCDC57_ENST00000392343.3_Missense_Mutation_p.K212N			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	212								p.K212N(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			CCTCCAGCTCTTTGTGCAGTA	0.493																																																1	Substitution - Missense(1)	ovary(1)	17											67.0	70.0	69.0					17																	80151998		1917	4128	6045	77745287	SO:0001583	missense	284001			BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.636A>C	17.37:g.80151998T>G	ENSP00000374292:p.Lys212Asn		77745287	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	ENST00000389641.4	37		SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	t	10.25	1.298272	0.23650	.	.	ENSG00000176155	ENST00000389641;ENST00000392347;ENST00000392343	T;T;T	0.29142	2.77;2.77;1.58	4.69	-3.22	0.05125	.	0.270108	0.30791	N	0.008875	T	0.35828	0.0945	L	0.59436	1.845	0.80722	D	1	D;D	0.57571	0.979;0.98	P;P	0.57152	0.801;0.814	T	0.23476	-1.0187	10	0.72032	D	0.01	-14.5749	6.525	0.22297	0.0:0.4822:0.1632:0.3546	.	212;212	Q2TAC2-2;Q2TAC2	.;CCD57_HUMAN	N	212	ENSP00000374292:K212N;ENSP00000376158:K212N;ENSP00000376154:K212N	ENSP00000374292:K212N	K	-	3	2	CCDC57	77745287	0.062000	0.20869	0.272000	0.24630	0.842000	0.47809	-1.292000	0.02772	-0.637000	0.05516	0.456000	0.33151	AAA		0.493	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082		Missense_Mutation
CCDC87	55231	hgsc.bcm.edu	37	11	66359437	66359438	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-13-0906-01	TCGA-13-0906-10	CC	CC	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr11:66359437_66359438delCC	ENST00000333861.3	-	1	1116_1117	c.1049_1050delGG	c.(1048-1050)gggfs	p.G350fs	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	350					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)			p.G350fs*5(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						CCACGATGAGCCCAGTCAGCTC	0.594																																																1	Deletion - Frameshift(1)	ovary(1)	11																																								66116014	SO:0001589	frameshift_variant	55231			BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.1049_1050delGG	11.37:g.66359437_66359438delCC	ENSP00000328487:p.Gly350fs		66116013	Q8NE76	Frame_Shift_Del	DEL	ENST00000333861.3	37	CCDS8145.1	DEL	26	Baylor																																																																																				0.594	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	NM_018219		Frame_Shift_Del
CDK1	983	hgsc.bcm.edu	37	10	62539961	62539961	+	Splice_Site	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr10:62539961G>A	ENST00000395284.3	+	2	179		c.e2+1		CDK1_ENST00000519760.1_Splice_Site|CDK1_ENST00000448257.2_Splice_Site|CDK1_ENST00000373809.2_Splice_Site|CDK1_ENST00000316629.4_Splice_Site	NM_001786.4	NP_001777.1	P06493	CDK1_HUMAN	cyclin-dependent kinase 1						activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell aging (GO:0007569)|cell migration (GO:0016477)|cellular response to hydrogen peroxide (GO:0070301)|centrosome cycle (GO:0007098)|chromosome condensation (GO:0030261)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|pronuclear fusion (GO:0007344)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|Ras protein signal transduction (GO:0007265)|regulation of embryonic development (GO:0045995)|regulation of Schwann cell differentiation (GO:0014038)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to activity (GO:0014823)|response to amine (GO:0014075)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organic cyclic compound (GO:0014070)|response to toxic substance (GO:0009636)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|histone kinase activity (GO:0035173)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.?(1)		ovary(1)	1						ATTGGAGAAGGTGAGTGGTTT	0.279																																																1	Unknown(1)	ovary(1)	10											63.0	64.0	64.0					10																	62539961		2202	4299	6501	62209967	SO:0001630	splice_region_variant	983			BC014563	CCDS7260.1, CCDS44408.1	10q21.2	2011-11-08	2009-12-16	2009-12-16	ENSG00000170312	ENSG00000170312		"""Cyclin-dependent kinases"""	1722	protein-coding gene	gene with protein product		116940	"""cell division cycle 2, G1 to S and G2 to M"""	CDC2		3553962, 19884882	Standard	NM_001786		Approved	CDC28A	uc001jld.3	P06493	OTTHUMG00000018290	ENST00000395284.3:c.37+1G>A	10.37:g.62539961G>A			62209967	A8K7C4|C9J497|O60764	Splice_Site_SNP	SNP	ENST00000395284.3	37	CCDS44408.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153507	0.78114	.	.	ENSG00000170312	ENST00000519078;ENST00000395284;ENST00000316629;ENST00000448257;ENST00000373809	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3119	0.94192	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDK1	62209967	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	8.550000	0.90675	2.882000	0.98803	0.655000	0.94253	.		0.279	CDK1-007	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048211.2	NM_001786	Intron	Splice_Site_SNP
ARHGAP31	57514	hgsc.bcm.edu	37	3	119133583	119133583	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:119133583G>C	ENST00000264245.4	+	12	3339	c.2807G>C	c.(2806-2808)gGt>gCt	p.G936A		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	936					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GGCCTTCAGGGTCACCAGTTG	0.592																																					Pancreas(7;176 297 5394 51128 51241)											0			3											121.0	120.0	120.0					3																	119133583		1913	4133	6046	120616273	SO:0001583	missense	57514				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2807G>C	3.37:g.119133583G>C	ENSP00000264245:p.Gly936Ala		120616273	Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	37	CCDS43135.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.537	-0.855176	0.02630	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.05786	3.39	4.87	0.749	0.18381	.	1.115620	0.06751	N	0.780055	T	0.04998	0.0134	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43814	-0.9368	10	0.33940	T	0.23	.	3.5661	0.07900	0.2053:0.1246:0.5429:0.1272	.	936	Q2M1Z3	RHG31_HUMAN	A	936	ENSP00000264245:G936A	ENSP00000264245:G936A	G	+	2	0	ARHGAP31	120616273	0.006000	0.16342	0.006000	0.13384	0.055000	0.15305	1.562000	0.36353	0.598000	0.29829	-0.291000	0.09656	GGT		0.592	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2			Missense_Mutation
CHD4	1108	hgsc.bcm.edu	37	12	6705263	6705263	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr12:6705263G>C	ENST00000357008.2	-	13	2096	c.1933C>G	c.(1933-1935)Cgg>Ggg	p.R645G	CHD4_ENST00000309577.6_Missense_Mutation_p.R645G|CHD4_ENST00000544040.1_Missense_Mutation_p.R638G|CHD4_ENST00000544484.1_Missense_Mutation_p.R642G	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	645	Chromo 2. {ECO:0000255|PROSITE- ProRule:PRU00053}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.R645G(1)		central_nervous_system(2)	2						GGTAAGTCCCGCCACTTGATC	0.512																																					Colon(32;586 792 4568 16848 45314)											1	Substitution - Missense(1)	ovary(1)	12											136.0	111.0	120.0					12																	6705263		2203	4300	6503	6575524	SO:0001583	missense	1108			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.1933C>G	12.37:g.6705263G>C	ENSP00000349508:p.Arg645Gly		6575524	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.03	3.533316	0.64972	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75	4.89	3.9	0.45041	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.000000	0.85682	D	0.000000	D	0.86070	0.5845	M	0.82630	2.6	0.58432	D	0.999997	D;D;D	0.71674	0.998;0.991;0.996	D;D;D	0.80764	0.994;0.932;0.992	D	0.88486	0.3072	10	0.87932	D	0	-4.1325	14.2823	0.66221	0.0:0.0:0.7964:0.2036	.	645;645;638	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	G	642;638;645;645;619	ENSP00000440392:R642G;ENSP00000440542:R638G;ENSP00000312419:R645G;ENSP00000349508:R645G	ENSP00000312419:R645G	R	-	1	2	CHD4	6575524	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.745000	0.47459	2.243000	0.73865	0.655000	0.94253	CGG		0.512	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273		Missense_Mutation
CHUK	1147	hgsc.bcm.edu	37	10	101978563	101978563	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0906-01	TCGA-13-0906-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr10:101978563T>G	ENST00000370397.7	-	8	795	c.709A>C	c.(709-711)Aag>Cag	p.K237Q		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	237	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)	p.K237Q(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	TTTGGATCCTTCTTCTTAATC	0.323																																					Ovarian(159;52 1904 10536 35305 37148)											1	Substitution - Missense(1)	ovary(1)	10											117.0	110.0	112.0					10																	101978563		2203	4300	6503	101968553	SO:0001583	missense	1147			AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.709A>C	10.37:g.101978563T>G	ENSP00000359424:p.Lys237Gln		101968553	O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	ENST00000370397.7	37	CCDS7488.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	22.7	4.319368	0.81469	.	.	ENSG00000213341	ENST00000370397	T	0.65549	-0.16	5.92	5.92	0.95590	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79364	0.4433	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81984	-0.0682	10	0.87932	D	0	-16.8521	14.3262	0.66523	0.0:0.0:0.0:1.0	.	237	O15111	IKKA_HUMAN	Q	237	ENSP00000359424:K237Q	ENSP00000359424:K237Q	K	-	1	0	CHUK	101968553	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.661000	0.83786	2.263000	0.75096	0.533000	0.62120	AAG		0.323	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1	NM_001278		Missense_Mutation
CLEC16A	23274	hgsc.bcm.edu	37	16	11065059	11065059	+	Silent	SNP	A	A	G			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr16:11065059A>G	ENST00000409790.1	+	5	800	c.570A>G	c.(568-570)gtA>gtG	p.V190V	CLEC16A_ENST00000409552.3_Silent_p.V190V	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.V190V(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GAATTGCTGTAAGAACCATAA	0.428											OREG0023609	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	16											121.0	113.0	116.0					16																	11065059		1940	4143	6083	10972560	SO:0001819	synonymous_variant	23274			AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.570A>G	16.37:g.11065059A>G		669	10972560		Silent	SNP	ENST00000409790.1	37	CCDS45409.1	SNP	13	Baylor																																																																																				0.428	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226		Silent
COBL	23242	hgsc.bcm.edu	37	7	51095861	51095861	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr7:51095861G>T	ENST00000265136.7	-	10	3097	c.2932C>A	c.(2932-2934)Ctg>Atg	p.L978M	COBL_ENST00000395542.2_Missense_Mutation_p.L1060M	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	978					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.L978M(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					GACTGAACCAGTGAGAAACAG	0.557																																					NSCLC(189;2119 2138 12223 30818 34679)											1	Substitution - Missense(1)	ovary(1)	7											73.0	68.0	70.0					7																	51095861		2203	4300	6503	51063355	SO:0001583	missense	23242			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.2932C>A	7.37:g.51095861G>T	ENSP00000265136:p.Leu978Met		51063355	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.10	2.134880	0.37728	.	.	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	T;T;T;T	0.14022	2.54;2.54;2.55;2.55	5.31	2.41	0.29592	.	1.963370	0.02672	N	0.108703	T	0.22859	0.0552	L	0.29908	0.895	0.09310	N	1	D;D;D;D;D	0.65815	0.986;0.986;0.976;0.993;0.995	P;P;P;P;P	0.59487	0.855;0.855;0.556;0.858;0.834	T	0.20075	-1.0286	10	0.33940	T	0.23	.	7.8977	0.29717	0.1496:0.1316:0.7188:0.0	.	978;1035;978;1060;520	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	M	978;870;863;1060	ENSP00000265136:L978M;ENSP00000401204:L870M;ENSP00000413498:L863M;ENSP00000378912:L1060M	ENSP00000265136:L978M	L	-	1	2	COBL	51063355	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.756000	0.26419	0.586000	0.29626	0.563000	0.77884	CTG		0.557	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198		Missense_Mutation
COL6A6	131873	hgsc.bcm.edu	37	3	130340682	130340690	+	In_Frame_Del	DEL	AGGAGAGGC	AGGAGAGGC	-	rs201892096	byFrequency	TCGA-13-0906-01	TCGA-13-0906-10	AGGAGAGGC	AGGAGAGGC	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:130340682_130340690delAGGAGAGGC	ENST00000358511.6	+	23	4864_4872	c.4833_4841delAGGAGAGGC	c.(4831-4842)ggaggagaggca>gga	p.GEA1612del	COL6A6_ENST00000453409.2_In_Frame_Del_p.GEA1612del	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1612	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.E1613_G1615del(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CAGGACCCGGAGGAGAGGCAGGGAATCAA	0.431																																																1	Deletion - In frame(1)	ovary(1)	3																																								131823380	SO:0001651	inframe_deletion	131873			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.4833_4841delAGGAGAGGC	3.37:g.130340682_130340690delAGGAGAGGC	ENSP00000351310:p.Gly1612_Ala1614del		131823372	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	In_Frame_Del	DEL	ENST00000358511.6	37	CCDS46911.1	DEL	11	Baylor																																																																																				0.431	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608		In_Frame_Del
CPT2	1376	hgsc.bcm.edu	37	1	53676140	53676140	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr1:53676140G>C	ENST00000371486.3	+	4	1309	c.794G>C	c.(793-795)aGc>aCc	p.S265T	RP5-1024G6.2_ENST00000452466.1_RNA	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2	265					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	AACATTGTGAGCCCCTCGGAA	0.502																																																0			1											59.0	63.0	62.0					1																	53676140		2203	4300	6503	53448728	SO:0001583	missense	1376			BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.794G>C	1.37:g.53676140G>C	ENSP00000360541:p.Ser265Thr		53448728	B2R6S0|Q5SW68|Q9BQ26	Missense_Mutation	SNP	ENST00000371486.3	37	CCDS575.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.10	1.539664	0.27563	.	.	ENSG00000157184	ENST00000371486	D	0.88896	-2.44	5.5	-1.72	0.08107	.	0.446761	0.27836	N	0.017643	T	0.74129	0.3676	N	0.20304	0.555	0.09310	N	1	B	0.27264	0.173	B	0.29440	0.102	T	0.61153	-0.7120	10	0.13470	T	0.59	-2.5242	5.7959	0.18387	0.3866:0.3866:0.2268:0.0	.	265	P23786	CPT2_HUMAN	T	265	ENSP00000360541:S265T	ENSP00000360541:S265T	S	+	2	0	CPT2	53448728	0.045000	0.20229	0.056000	0.19401	0.971000	0.66376	0.419000	0.21247	-0.013000	0.14199	0.650000	0.86243	AGC		0.502	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024757.1	NM_000098		Missense_Mutation
CYP11B2	1585	hgsc.bcm.edu	37	8	143996483	143996483	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr8:143996483delT	ENST00000323110.2	-	3	576	c.574delA	c.(574-576)atcfs	p.I192fs		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	192					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.I192fs*6(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	TAGTGGAAGATGCTGGGCTGG	0.637									Familial Hyperaldosteronism type I																																							1	Deletion - Frameshift(1)	ovary(1)	8											47.0	44.0	45.0					8																	143996483		2203	4300	6503	143993485	SO:0001589	frameshift_variant	1585	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.574delA	8.37:g.143996483delT	ENSP00000325822:p.Ile192fs		143993485	B0ZBE4|Q16726	Frame_Shift_Del	DEL	ENST00000323110.2	37	CCDS6393.1	DEL	51	Baylor																																																																																				0.637	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1			Frame_Shift_Del
DLEC1	9940	hgsc.bcm.edu	37	3	38139130	38139130	+	Splice_Site	SNP	T	T	A			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:38139130T>A	ENST00000308059.6	+	17	2586		c.e17+2		DLEC1_ENST00000346219.3_Splice_Site|DLEC1_ENST00000452631.2_Splice_Site					deleted in lung and esophageal cancer 1									p.?(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		GTCTTTAAGGTGCTGCAGGTG	0.627																																																1	Unknown(1)	ovary(1)	3											43.0	47.0	46.0					3																	38139130		2087	4223	6310	38114134	SO:0001630	splice_region_variant	9940			AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.2565+2T>A	3.37:g.38139130T>A			38114134		Splice_Site_SNP	SNP	ENST00000308059.6	37	CCDS2672.2	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	14.53	2.562034	0.45590	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.562	0.61795	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DLEC1	38114134	1.000000	0.71417	0.992000	0.48379	0.312000	0.27988	5.551000	0.67274	1.909000	0.55274	0.456000	0.33151	.		0.627	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	Intron	Splice_Site_SNP
DUOX2	50506	hgsc.bcm.edu	37	15	45397933	45397933	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr15:45397933C>T	ENST00000603300.1	-	18	2444	c.2242G>A	c.(2242-2244)Gag>Aag	p.E748K	DUOX2_ENST00000389039.6_Missense_Mutation_p.E748K	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	748					adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)	p.E748K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TCGCTCATCTCAGCCACATGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	15											114.0	106.0	109.0					15																	45397933		2198	4298	6496	43185225	SO:0001583	missense	50506			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.2242G>A	15.37:g.45397933C>T	ENSP00000475084:p.Glu748Lys		43185225	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	CCDS10117.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557062	0.65425	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.36	2.24	0.28232	.	0.275077	0.40222	N	0.001159	T	0.59824	0.2222	M	0.68593	2.085	0.51233	D	0.999912	P;P	0.41420	0.658;0.749	B;P	0.46543	0.24;0.52	T	0.61744	-0.7000	9	0.72032	D	0.01	-20.0981	9.66	0.39950	0.0:0.5148:0.4117:0.0735	.	748;310	Q9NRD8;Q59GU9	DUOX2_HUMAN;.	K	748	.	ENSP00000373691:E748K	E	-	1	0	DUOX2	43185225	0.949000	0.32298	0.028000	0.17463	0.224000	0.24922	2.254000	0.43214	0.587000	0.29643	-0.165000	0.13383	GAG		0.562	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080		Missense_Mutation
DZIP1	22873	hgsc.bcm.edu	37	13	96293581	96293581	+	Silent	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr13:96293581G>A	ENST00000376829.2	-	5	1416	c.565C>T	c.(565-567)Ctg>Ttg	p.L189L	DZIP1_ENST00000347108.3_Silent_p.L189L|DZIP1_ENST00000361396.2_Silent_p.L189L|DZIP1_ENST00000466027.1_5'UTR|DZIP1_ENST00000361156.3_Silent_p.L189L	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	189					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			TCGATCATCAGCTGCTGGGTG	0.532																																																0			13											147.0	96.0	113.0					13																	96293581		2203	4300	6503	95091582	SO:0001819	synonymous_variant	22873			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.565C>T	13.37:g.96293581G>A			95091582	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Silent	SNP	ENST00000376829.2	37	CCDS9478.1	SNP	34	Baylor																																																																																				0.532	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045496.3	NM_014934		Silent
ELFN2	114794	hgsc.bcm.edu	37	22	37770642	37770642	+	Silent	SNP	C	C	A			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr22:37770642C>A	ENST00000402918.2	-	3	1718	c.933G>T	c.(931-933)ctG>ctT	p.L311L	ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.5_ENST00000430883.1_RNA|RP1-63G5.8_ENST00000609322.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	311	Fibronectin type-III.				negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)	p.L311L(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					TGATGACCACCAGGGTGGCCG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	22											305.0	272.0	284.0					22																	37770642		2203	4300	6503	36100588	SO:0001819	synonymous_variant	114794			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.933G>T	22.37:g.37770642C>A			36100588	Q96PY3	Silent	SNP	ENST00000402918.2	37	CCDS33642.1	SNP	21	Baylor																																																																																				0.587	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318900.2	NM_052906		Silent
EPN2	22905	hgsc.bcm.edu	37	17	19215404	19215404	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr17:19215404A>T	ENST00000314728.5	+	6	1403	c.919A>T	c.(919-921)Atg>Ttg	p.M307L	EPN2_ENST00000347697.2_Missense_Mutation_p.M250L|EPN2_ENST00000395626.1_Missense_Mutation_p.M307L|EPN2_ENST00000575595.1_Missense_Mutation_p.M22L|EPN2_ENST00000571254.1_Missense_Mutation_p.M250L|EPN2_ENST00000395618.3_Missense_Mutation_p.M22L|EPN2_ENST00000395620.2_Missense_Mutation_p.M250L	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	307					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					CAGATTACAGATGGCCCTGGA	0.463																																																0			17											141.0	146.0	145.0					17																	19215404		2203	4300	6503	19155997	SO:0001583	missense	22905			AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.919A>T	17.37:g.19215404A>T	ENSP00000320543:p.Met307Leu		19155997	A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Missense_Mutation	SNP	ENST00000314728.5	37	CCDS11203.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.21	3.573554	0.65765	.	.	ENSG00000072134	ENST00000347697;ENST00000395618;ENST00000314728;ENST00000395628;ENST00000395620;ENST00000395626	T;T;T;T;T;T	0.31510	2.5;2.27;2.48;1.53;2.5;1.49	5.39	5.39	0.77823	Ubiquitin interacting motif (2);	0.100518	0.85682	N	0.000000	T	0.42743	0.1216	L	0.28740	0.885	0.58432	D	0.999999	P;P;D;D;B;P;P;B	0.71674	0.902;0.733;0.998;0.998;0.049;0.812;0.902;0.131	P;B;D;D;B;P;P;B	0.80764	0.904;0.316;0.994;0.994;0.04;0.801;0.904;0.085	T	0.18840	-1.0324	10	0.29301	T	0.29	-27.8665	15.4121	0.74933	1.0:0.0:0.0:0.0	.	250;250;22;22;307;250;250;307	Q52LD0;B7ZKM5;B7Z3A5;A8MTV8;E9PBC1;E7EMC3;E9PBC2;O95208	.;.;.;.;.;.;.;EPN2_HUMAN	L	250;22;307;250;250;307	ENSP00000261495:M250L;ENSP00000378980:M22L;ENSP00000320543:M307L;ENSP00000378990:M250L;ENSP00000378982:M250L;ENSP00000378988:M307L	ENSP00000320543:M307L	M	+	1	0	EPN2	19155997	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.695000	0.91298	2.053000	0.61076	0.533000	0.62120	ATG		0.463	EPN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132283.3	NM_014964		Missense_Mutation
FANCA	2175	hgsc.bcm.edu	37	16	89815135	89815135	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0906-01	TCGA-13-0906-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr16:89815135T>C	ENST00000389301.3	-	33	3310	c.3280A>G	c.(3280-3282)Agc>Ggc	p.S1094G	FANCA_ENST00000568369.1_Missense_Mutation_p.S1094G	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1094					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.S1094G(1)		breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GCCTGGAAGCTGCTGCCGCAG	0.592			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	1	Substitution - Missense(1)	ovary(1)	16											89.0	63.0	72.0					16																	89815135		2198	4300	6498	88342636	SO:0001583	missense	2175	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3280A>G	16.37:g.89815135T>C	ENSP00000373952:p.Ser1094Gly		88342636	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	CCDS32515.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	6.555	0.470749	0.12461	.	.	ENSG00000187741	ENST00000389301;ENST00000305699	D	0.84370	-1.84	0.235	0.235	0.15431	.	1.389500	0.04507	N	0.382292	T	0.75324	0.3834	N	0.22421	0.69	0.09310	N	1	B;B;B	0.15473	0.008;0.013;0.005	B;B;B	0.11329	0.004;0.006;0.006	T	0.60786	-0.7194	9	0.45353	T	0.12	-2.1199	.	.	.	.	71;1094;1094	B7Z6Y4;B4DRI7;O15360	.;.;FANCA_HUMAN	G	1094;71	ENSP00000373952:S1094G	ENSP00000306281:S71G	S	-	1	0	FANCA	88342636	0.000000	0.05858	0.002000	0.10522	0.341000	0.28922	-0.395000	0.07287	0.263000	0.21812	0.260000	0.18958	AGC		0.592	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1			Missense_Mutation
FBXO25	26260	hgsc.bcm.edu	37	8	418740	418740	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr8:418740C>A	ENST00000276326.5	+	11	1159	c.1040C>A	c.(1039-1041)gCc>gAc	p.A347D	FBXO25_ENST00000382824.1_Missense_Mutation_p.A271D|FBXO25_ENST00000350302.3_Missense_Mutation_p.A338D|FBXO25_ENST00000352684.2_Missense_Mutation_p.A271D	NM_183421.1	NP_904357.1	Q8TCJ0	FBX25_HUMAN	F-box protein 25	347					protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.A347D(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)		TGCACGGCGGCCGACCCTGAC	0.602																																																1	Substitution - Missense(1)	ovary(1)	8											56.0	54.0	55.0					8																	418740		2203	4300	6503	408740	SO:0001583	missense	26260			AF174605	CCDS5952.1, CCDS5953.1, CCDS5954.1	8p23.3	2007-03-30	2004-06-15		ENSG00000147364	ENSG00000147364		"""F-boxes /  ""other"""""	13596	protein-coding gene	gene with protein product		609098	"""F-box only protein 25"""			10531035, 10531037	Standard	NM_012173		Approved	FBX25	uc003wox.3	Q8TCJ0	OTTHUMG00000090341	ENST00000276326.5:c.1040C>A	8.37:g.418740C>A	ENSP00000276326:p.Ala347Asp		408740	Q6PJ83|Q7Z4V4|Q9UKB8	Missense_Mutation	SNP	ENST00000276326.5	37	CCDS5953.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	7.207	0.594580	0.13875	.	.	ENSG00000147364	ENST00000350302;ENST00000352684;ENST00000276326;ENST00000447233;ENST00000382824	T;T	0.17528	2.33;2.27	5.73	3.79	0.43588	.	0.461465	0.25944	N	0.027297	T	0.08358	0.0208	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.002;0.002	T	0.29243	-1.0018	10	0.17832	T	0.49	-14.8882	7.6524	0.28356	0.2822:0.5751:0.1427:0.0	.	271;338;347	Q8TCJ0-3;Q8TCJ0-2;Q8TCJ0	.;.;FBX25_HUMAN	D	338;271;347;310;271	ENSP00000342077:A338D;ENSP00000276326:A347D	ENSP00000276326:A347D	A	+	2	0	FBXO25	408740	0.885000	0.30320	0.029000	0.17559	0.672000	0.39443	2.790000	0.47821	2.702000	0.92279	0.467000	0.42956	GCC		0.602	FBXO25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206710.2	NM_012173		Missense_Mutation
FLG2	388698	hgsc.bcm.edu	37	1	152323539	152323539	+	Silent	SNP	T	T	C			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr1:152323539T>C	ENST00000388718.5	-	3	6795	c.6723A>G	c.(6721-6723)acA>acG	p.T2241T	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	2241					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.T2241T(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCCTCTCTGTGTGGATTGTC	0.522																																																1	Substitution - coding silent(1)	ovary(1)	1											379.0	355.0	363.0					1																	152323539		2203	4300	6503	150590163	SO:0001819	synonymous_variant	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.6723A>G	1.37:g.152323539T>C			150590163	Q9H4U1	Silent	SNP	ENST00000388718.5	37	CCDS30861.1	SNP	59	Baylor																																																																																				0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		Silent
FLNB	2317	hgsc.bcm.edu	37	3	58108886	58108886	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:58108886A>C	ENST00000295956.4	+	21	3358	c.3193A>C	c.(3193-3195)Acc>Ccc	p.T1065P	FLNB_ENST00000429972.2_Missense_Mutation_p.T1065P|FLNB_ENST00000419752.2_Missense_Mutation_p.T896P|FLNB_ENST00000348383.5_Missense_Mutation_p.T1065P|FLNB_ENST00000490882.1_Missense_Mutation_p.T1065P|FLNB_ENST00000358537.3_Missense_Mutation_p.T1065P|FLNB_ENST00000493452.1_Missense_Mutation_p.T896P|FLNB_ENST00000357272.4_Missense_Mutation_p.T1065P	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1065					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.T1065P(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CACCATCGATACCAAAGGAGC	0.567																																																1	Substitution - Missense(1)	ovary(1)	3											147.0	134.0	138.0					3																	58108886		2203	4300	6503	58083926	SO:0001583	missense	2317			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.3193A>C	3.37:g.58108886A>C	ENSP00000295956:p.Thr1065Pro		58083926	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	SNP	14	Baylor	.	.	.	.	.	.	.	.	.	.	A	28.1	4.890346	0.91889	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.86164	-2.08;-2.08;-2.08;-2.08;-2.08;-2.08;-2.08;-2.08	5.66	5.66	0.87406	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.96297	0.8792	H	0.98507	4.25	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;0.999;0.996;0.999;0.999	D	0.97747	1.0212	10	0.62326	D	0.03	.	16.1911	0.81989	1.0:0.0:0.0:0.0	.	1065;1065;896;896;1065;1065	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	P	1065;1065;1065;1065;1065;1065;896;896	ENSP00000295956:T1065P;ENSP00000420213:T1065P;ENSP00000351339:T1065P;ENSP00000415599:T1065P;ENSP00000232447:T1065P;ENSP00000349819:T1065P;ENSP00000418510:T896P;ENSP00000414532:T896P	ENSP00000295956:T1065P	T	+	1	0	FLNB	58083926	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.283000	0.95860	2.278000	0.76064	0.533000	0.62120	ACC		0.567	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457		Missense_Mutation
FRS3	10817	hgsc.bcm.edu	37	6	41740590	41740590	+	Missense_Mutation	SNP	G	G	A	rs545980178		TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr6:41740590G>A	ENST00000373018.3	-	5	612	c.361C>T	c.(361-363)Cgc>Tgc	p.R121C	FRS3_ENST00000259748.2_Missense_Mutation_p.R121C	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	121					fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)	p.R121C(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGGCTATTGCGGGTGATGATG	0.547													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16216	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	6											124.0	125.0	125.0					6																	41740590		2203	4300	6503	41848568	SO:0001583	missense	10817			AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.361C>T	6.37:g.41740590G>A	ENSP00000362109:p.Arg121Cys		41848568	Q5T3D5	Missense_Mutation	SNP	ENST00000373018.3	37	CCDS4860.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337540	0.81911	.	.	ENSG00000137218	ENST00000373018;ENST00000259748;ENST00000426290	D;D	0.82711	-1.64;-1.64	5.46	3.49	0.39957	.	0.207707	0.33875	N	0.004468	D	0.86847	0.6031	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86363	0.1718	10	0.52906	T	0.07	-37.7643	12.373	0.55265	0.0:0.0:0.6461:0.3539	.	121	O43559	FRS3_HUMAN	C	121;121;145	ENSP00000362109:R121C;ENSP00000259748:R121C	ENSP00000259748:R121C	R	-	1	0	FRS3	41848568	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	4.032000	0.57274	2.573000	0.86826	0.655000	0.94253	CGC		0.547	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040532.2	NM_006653		Missense_Mutation
GATA5	140628	hgsc.bcm.edu	37	20	61040480	61040480	+	Silent	SNP	G	G	C			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr20:61040480G>C	ENST00000252997.2	-	6	1015	c.954C>G	c.(952-954)gcC>gcG	p.A318A		NM_080473.4	NP_536721.1	Q9BWX5	GATA5_HUMAN	GATA binding protein 5	318					blood coagulation (GO:0007596)|cellular response to BMP stimulus (GO:0071773)|intestinal epithelial cell differentiation (GO:0060575)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			kidney(1)|lung(3)|ovary(1)|stomach(1)	6	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)			TGTCAGTGCTGGCGACAGCAG	0.647																																																0			20											35.0	35.0	35.0					20																	61040480		2203	4300	6503	60473875	SO:0001819	synonymous_variant	140628			BC047790, BC117356	CCDS13499.1	20q13.33	2013-07-17	2001-11-28		ENSG00000130700	ENSG00000130700		"""GATA zinc finger domain containing"""	15802	protein-coding gene	gene with protein product		611496	"""GATA-binding protein 5"""			9566909	Standard	NM_080473		Approved	bB379O24.1, GATAS	uc002ycx.1	Q9BWX5	OTTHUMG00000032919	ENST00000252997.2:c.954C>G	20.37:g.61040480G>C			60473875	D9ZGF7|Q17RE2|Q86VU4	Silent	SNP	ENST00000252997.2	37	CCDS13499.1	SNP	47	Baylor																																																																																				0.647	GATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080038.2	NM_080473		Silent
GGA3	23163	hgsc.bcm.edu	37	17	73235513	73235513	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr17:73235513T>A	ENST00000245541.6	-	14	1939	c.1723A>T	c.(1723-1725)Aag>Tag	p.K575*	GGA3_ENST00000582486.1_Nonsense_Mutation_p.K503*|GGA3_ENST00000351904.7_Nonsense_Mutation_p.K542*|GGA3_ENST00000578348.1_Nonsense_Mutation_p.K453*|GGA3_ENST00000538886.1_Nonsense_Mutation_p.K453*|GGA3_ENST00000582717.1_Nonsense_Mutation_p.K503*	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	575	Unstructured hinge.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)	p.K575*(1)		breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			TCAGGCCCCTTCGGGGGGCTG	0.682											OREG0024729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Nonsense(1)	ovary(1)	17											21.0	24.0	23.0					17																	73235513		2203	4299	6502	70747108	SO:0001587	stop_gained	23163			AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.1723A>T	17.37:g.73235513T>A	ENSP00000245541:p.Lys575*	1143	70747108	B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Nonsense_Mutation	SNP	ENST00000245541.6	37	CCDS11717.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	38	7.260231	0.98171	.	.	ENSG00000125447	ENST00000245541;ENST00000351904;ENST00000537584;ENST00000538886	.	.	.	5.32	3.09	0.35607	.	0.174936	0.46145	D	0.000320	.	.	.	.	.	.	0.21527	N	0.999655	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.3062	7.0349	0.24987	0.0:0.0753:0.1489:0.7759	.	.	.	.	X	575;542;503;453	.	ENSP00000245541:K575X	K	-	1	0	GGA3	70747108	0.872000	0.30054	0.051000	0.19133	0.782000	0.44232	1.415000	0.34748	0.467000	0.27218	0.460000	0.39030	AAG		0.682	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446645.1	NM_138619		Nonsense_Mutation
GIMAP7	168537	hgsc.bcm.edu	37	7	150217607	150217607	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr7:150217607T>A	ENST00000313543.4	+	2	702	c.545T>A	c.(544-546)gTg>gAg	p.V182E		NM_153236.3	NP_694968.1	Q8NHV1	GIMA7_HUMAN	GTPase, IMAP family member 7	182	AIG1-type G.				GTP catabolic process (GO:0006184)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAAAGTCAAGTGCAGGAGTTG	0.488																																																0			7											75.0	66.0	69.0					7																	150217607		2203	4300	6503	149848540	SO:0001583	missense	168537			BC027613	CCDS5903.1	7q36.1	2014-04-04			ENSG00000179144	ENSG00000179144		"""GTPases, IMAP"""	22404	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 7"""					15474311	Standard	NM_153236		Approved	MGC27027, IAN7	uc003whk.3	Q8NHV1	OTTHUMG00000157626	ENST00000313543.4:c.545T>A	7.37:g.150217607T>A	ENSP00000315474:p.Val182Glu		149848540		Missense_Mutation	SNP	ENST00000313543.4	37	CCDS5903.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.62	2.290096	0.40494	.	.	ENSG00000179144	ENST00000313543	T	0.63744	-0.06	5.09	3.88	0.44766	AIG1 (1);	0.246709	0.33834	N	0.004518	D	0.82742	0.5103	H	0.97103	3.94	0.31540	N	0.660089	D	0.69078	0.997	D	0.68621	0.959	D	0.84940	0.0865	10	0.87932	D	0	.	8.2322	0.31605	0.1762:0.0:0.0:0.8238	.	182	Q8NHV1	GIMA7_HUMAN	E	182	ENSP00000315474:V182E	ENSP00000315474:V182E	V	+	2	0	GIMAP7	149848540	0.989000	0.36119	0.270000	0.24601	0.005000	0.04900	3.061000	0.49963	2.159000	0.67721	0.533000	0.62120	GTG		0.488	GIMAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349277.1	NM_153236		Missense_Mutation
GLRA3	8001	hgsc.bcm.edu	37	4	175710033	175710033	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr4:175710033C>G	ENST00000274093.3	-	2	635	c.133G>C	c.(133-135)Gat>Cat	p.D45H	GLRA3_ENST00000340217.5_Missense_Mutation_p.D45H	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	45					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.D45H(1)		endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	TCCAGAAAATCAGAAGGTGAC	0.348																																																1	Substitution - Missense(1)	ovary(1)	4											99.0	95.0	96.0					4																	175710033		2203	4300	6503	175946608	SO:0001583	missense	8001			AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.133G>C	4.37:g.175710033C>G	ENSP00000274093:p.Asp45His		175946608	D3DP44|O75816|Q5D0E3	Missense_Mutation	SNP	ENST00000274093.3	37	CCDS3822.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	25.4	4.637059	0.87760	.	.	ENSG00000145451	ENST00000274093;ENST00000340217	T;T	0.78481	-1.18;-1.18	5.01	5.01	0.66863	Neurotransmitter-gated ion-channel ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.87091	0.6091	M	0.69358	2.11	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.983;0.984	D	0.87391	0.2363	10	0.59425	D	0.04	.	18.8584	0.92262	0.0:1.0:0.0:0.0	.	45;45	O75311-2;O75311	.;GLRA3_HUMAN	H	45	ENSP00000274093:D45H;ENSP00000345284:D45H	ENSP00000274093:D45H	D	-	1	0	GLRA3	175946608	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.220000	0.78008	2.765000	0.95021	0.555000	0.69702	GAT		0.348	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313427.1			Missense_Mutation
GRIN2A	2903	hgsc.bcm.edu	37	16	9857734	9857734	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0906-01	TCGA-13-0906-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr16:9857734T>A	ENST00000396573.2	-	14	3976	c.3667A>T	c.(3667-3669)Acc>Tcc	p.T1223S	GRIN2A_ENST00000404927.2_Missense_Mutation_p.T1223S|GRIN2A_ENST00000562109.1_Missense_Mutation_p.T1223S|GRIN2A_ENST00000396575.2_Missense_Mutation_p.T1223S|GRIN2A_ENST00000330684.3_Missense_Mutation_p.T1223S|GRIN2A_ENST00000535259.1_Missense_Mutation_p.T1066S	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1223					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.T1223S(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCTGAATAGGTGGGCATGTTG	0.562																																																1	Substitution - Missense(1)	ovary(1)	16											208.0	205.0	206.0					16																	9857734		2197	4300	6497	9765235	SO:0001583	missense	2903				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3667A>T	16.37:g.9857734T>A	ENSP00000379818:p.Thr1223Ser		9765235	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	8.723	0.914825	0.17907	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.10477	2.89;2.87;2.88;2.89;2.89	5.32	5.32	0.75619	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.317034	0.38111	N	0.001819	T	0.06325	0.0163	N	0.08118	0	0.25125	N	0.990613	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.14023	0.006;0.01;0.008	T	0.34650	-0.9820	9	.	.	.	.	14.4725	0.67526	0.0:0.0:0.0:1.0	.	1066;1223;1223	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	S	1223;1223;1066;1223;1223	ENSP00000379818:T1223S;ENSP00000385872:T1223S;ENSP00000441572:T1066S;ENSP00000332549:T1223S;ENSP00000379820:T1223S	.	T	-	1	0	GRIN2A	9765235	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.903000	0.56318	2.005000	0.58758	0.533000	0.62120	ACC		0.562	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			Missense_Mutation
HDAC6	10013	hgsc.bcm.edu	37	X	48663925	48663925	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chrX:48663925T>G	ENST00000334136.5	+	5	570	c.392T>G	c.(391-393)tTt>tGt	p.F131C	HDAC6_ENST00000444343.2_Missense_Mutation_p.F145C|HDAC6_ENST00000413163.2_Missense_Mutation_p.F76C|HDAC6_ENST00000469223.1_3'UTR|HDAC6_ENST00000376619.2_Missense_Mutation_p.F131C			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	131	Histone deacetylase 1.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	TGCGTGTCCTTTCAGGTAAGG	0.597																																					Pancreas(112;205 1675 2305 8976 15959)											0			X											78.0	58.0	65.0					X																	48663925		2203	4300	6503	48548869	SO:0001583	missense	10013			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.392T>G	X.37:g.48663925T>G	ENSP00000334061:p.Phe131Cys		48548869	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	ENST00000334136.5	37	CCDS14306.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.86	3.239943	0.58995	.	.	ENSG00000094631	ENST00000423941;ENST00000376643;ENST00000444343;ENST00000376610;ENST00000334136;ENST00000376619;ENST00000436813;ENST00000413163;ENST00000441703;ENST00000426196;ENST00000443563;ENST00000440653	T;T;T;T	0.64260	0.19;0.2;0.2;-0.09	4.16	2.95	0.34219	Histone deacetylase domain (2);	0.379228	0.23422	N	0.048352	T	0.61565	0.2357	N	0.20445	0.575	0.31904	N	0.615513	D;B;D;D	0.76494	0.998;0.003;0.998;0.999	D;B;D;D	0.70487	0.969;0.021;0.969;0.927	T	0.65709	-0.6102	10	0.87932	D	0	-7.3413	7.8087	0.29217	0.189:0.0:0.0:0.811	.	121;76;131;131	B4DZN1;E7EUZ1;Q9UBN7;Q9BRX7	.;.;HDAC6_HUMAN;.	C	131;131;145;131;131;131;131;76;131;131;131;131	ENSP00000398566:F145C;ENSP00000334061:F131C;ENSP00000365804:F131C;ENSP00000398801:F76C	ENSP00000334061:F131C	F	+	2	0	HDAC6	48548869	1.000000	0.71417	0.985000	0.45067	0.880000	0.50808	4.167000	0.58209	0.532000	0.28657	0.242000	0.17961	TTT		0.597	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044		Missense_Mutation
IGHMBP2	3508	hgsc.bcm.edu	37	11	68696765	68696765	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr11:68696765C>T	ENST00000255078.3	+	8	1286	c.1175C>T	c.(1174-1176)gCc>gTc	p.A392V		NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	392	Leu-rich.				ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTGCTGAAGGCCAGAAAGTGC	0.632																																																0			11											100.0	89.0	93.0					11																	68696765		2200	4294	6494	68453341	SO:0001583	missense	3508			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.1175C>T	11.37:g.68696765C>T	ENSP00000255078:p.Ala392Val		68453341	A0PJD2|Q00443|Q14177	Missense_Mutation	SNP	ENST00000255078.3	37	CCDS8187.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.4	4.826225	0.90955	.	.	ENSG00000132740	ENST00000255078	D	0.83506	-1.73	4.98	4.98	0.66077	DEAD-like helicase (1);	0.063428	0.64402	D	0.000006	D	0.90013	0.6882	M	0.67569	2.06	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90763	0.4666	10	0.59425	D	0.04	-19.1775	17.052	0.86521	0.0:1.0:0.0:0.0	.	392	P38935	SMBP2_HUMAN	V	392	ENSP00000255078:A392V	ENSP00000255078:A392V	A	+	2	0	IGHMBP2	68453341	1.000000	0.71417	0.984000	0.44739	0.664000	0.39144	5.601000	0.67606	2.310000	0.77875	0.655000	0.94253	GCC		0.632	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396862.1	NM_002180		Missense_Mutation
IL17RD	54756	hgsc.bcm.edu	37	3	57135314	57135314	+	Frame_Shift_Del	DEL	G	G	-			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:57135314delG	ENST00000296318.7	-	11	1145	c.1057delC	c.(1057-1059)cggfs	p.R353fs	IL17RD_ENST00000320057.5_Frame_Shift_Del_p.R209fs|IL17RD_ENST00000463523.1_Frame_Shift_Del_p.R209fs|IL17RD_ENST00000427856.2_Frame_Shift_Del_p.R329fs	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	353					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R209fs*19(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		GGCCGCGGCCGGAGCCTCTCT	0.463																																																1	Deletion - Frameshift(1)	ovary(1)	3											37.0	40.0	39.0					3																	57135314		2203	4300	6503	57110354	SO:0001589	frameshift_variant	54756			AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.1057delC	3.37:g.57135314delG	ENSP00000296318:p.Arg353fs		57110354	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Frame_Shift_Del	DEL	ENST00000296318.7	37	CCDS2880.2	DEL	39	Baylor																																																																																				0.463	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1	NM_017563		Frame_Shift_Del
INTS9	55756	hgsc.bcm.edu	37	8	28625766	28625766	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr8:28625766A>T	ENST00000521022.1	-	17	1955	c.1874T>A	c.(1873-1875)cTc>cAc	p.L625H	INTS9_ENST00000521777.1_Missense_Mutation_p.L601H|INTS9_ENST00000397363.4_Missense_Mutation_p.L519H|INTS9_ENST00000416984.2_Missense_Mutation_p.L604H	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9	625					snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		AATCTGGATGAGCGTCTCAGC	0.507																																																0			8											276.0	265.0	269.0					8																	28625766		2203	4300	6503	28681685	SO:0001583	missense	55756			BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.1874T>A	8.37:g.28625766A>T	ENSP00000429065:p.Leu625His		28681685	B7Z560|B7Z6M5|O00224|Q8TB16	Missense_Mutation	SNP	ENST00000521022.1	37	CCDS34873.1	SNP	11	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.89|18.89	3.719826|3.719826	0.68844|0.68844	.|.	.|.	ENSG00000104299|ENSG00000104299	ENST00000521022;ENST00000416984;ENST00000541706;ENST00000521777;ENST00000397363|ENST00000517383	T;T;T;T|.	0.53640|.	0.61;0.61;0.61;0.61|.	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	0.071281|.	0.64402|.	N|.	0.000020|.	T|T	0.72953|0.72953	0.3525|0.3525	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	D;D|.	0.69078|.	0.997;0.982|.	P;P|.	0.54629|.	0.757;0.673|.	T|T	0.73467|0.73467	-0.3973|-0.3973	10|5	0.45353|.	T|.	0.12|.	-24.419|-24.419	14.9228|14.9228	0.70854|0.70854	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	604;625|.	B7Z6M5;Q9NV88|.	.;INT9_HUMAN|.	H|T	625;604;469;601;519|117	ENSP00000429065:L625H;ENSP00000398208:L604H;ENSP00000430943:L601H;ENSP00000380520:L519H|.	ENSP00000380520:L519H|.	L|S	-|-	2|1	0|0	INTS9|INTS9	28681685|28681685	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.964000|0.964000	0.63967|0.63967	9.194000|9.194000	0.94962|0.94962	1.918000|1.918000	0.55548|0.55548	0.533000|0.533000	0.62120|0.62120	CTC|TCA		0.507	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376846.1	NM_018250		Missense_Mutation
INVS	27130	hgsc.bcm.edu	37	9	103015295	103015295	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr9:103015295C>G	ENST00000262457.2	+	10	1526	c.1341C>G	c.(1339-1341)atC>atG	p.I447M	INVS_ENST00000541287.1_Missense_Mutation_p.I351M|INVS_ENST00000262456.2_Missense_Mutation_p.I447M	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	447					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.I447M(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				AAAATAAGATCAATCCAAATG	0.428																																																1	Substitution - Missense(1)	ovary(1)	9											100.0	100.0	100.0					9																	103015295		2203	4300	6503	102055116	SO:0001583	missense	27130			AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.1341C>G	9.37:g.103015295C>G	ENSP00000262457:p.Ile447Met		102055116	A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Missense_Mutation	SNP	ENST00000262457.2	37	CCDS6746.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.87	2.665292	0.47677	.	.	ENSG00000119509	ENST00000262457;ENST00000541287;ENST00000262456	T;T;T	0.16196	2.36;2.36;2.36	5.84	4.94	0.65067	Ankyrin repeat-containing domain (4);	0.042797	0.85682	D	0.000000	T	0.27765	0.0683	L	0.37897	1.145	0.50632	D	0.999882	D;D;D	0.71674	0.996;0.998;0.994	D;D;D	0.78314	0.968;0.991;0.975	T	0.03306	-1.1050	10	0.62326	D	0.03	.	7.1994	0.25873	0.1383:0.722:0.0:0.1397	.	351;447;447	F5GZH2;Q9Y283;Q9Y283-2	.;INVS_HUMAN;.	M	447;351;447	ENSP00000262457:I447M;ENSP00000444454:I351M;ENSP00000262456:I447M	ENSP00000262456:I447M	I	+	3	3	INVS	102055116	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	1.866000	0.39489	1.492000	0.48499	-0.122000	0.15005	ATC		0.428	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053407.1	NM_014425		Missense_Mutation
IRAK3	11213	hgsc.bcm.edu	37	12	66638320	66638320	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0906-01	TCGA-13-0906-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr12:66638320G>T	ENST00000261233.4	+	9	1363	c.942G>T	c.(940-942)atG>atT	p.M314I	IRAK3_ENST00000457197.2_Missense_Mutation_p.M253I	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3									p.M314I(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		ATTTTGCCATGGCACACTTCC	0.413																																																1	Substitution - Missense(1)	ovary(1)	12											128.0	118.0	121.0					12																	66638320		2203	4300	6503	64924587	SO:0001583	missense	11213			AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.942G>T	12.37:g.66638320G>T	ENSP00000261233:p.Met314Ile		64924587		Missense_Mutation	SNP	ENST00000261233.4	37	CCDS8975.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.32	1.903657	0.33628	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	T;T	0.32515	1.45;1.45	5.64	3.77	0.43336	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.521480	0.21259	N	0.077507	T	0.13670	0.0331	N	0.05078	-0.115	0.29379	N	0.863442	B;B	0.18610	0.023;0.029	B;B	0.15870	0.008;0.014	T	0.16070	-1.0415	9	.	.	.	-9.3021	9.5106	0.39074	0.1708:0.0:0.8292:0.0	.	253;314	Q9Y616-2;Q9Y616	.;IRAK3_HUMAN	I	314;253	ENSP00000261233:M314I;ENSP00000409852:M253I	.	M	+	3	0	IRAK3	64924587	1.000000	0.71417	1.000000	0.80357	0.664000	0.39144	2.858000	0.48356	1.359000	0.45940	0.655000	0.94253	ATG		0.413	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1			Missense_Mutation
ITGA2B	3674	hgsc.bcm.edu	37	17	42453020	42453020	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr17:42453020C>A	ENST00000262407.5	-	26	2697	c.2666G>T	c.(2665-2667)cGc>cTc	p.R889L	ITGA2B_ENST00000353281.4_Missense_Mutation_p.R889L	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	889					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.R889L(1)		biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	GATCTGTCTGCGATCCCGCTT	0.677																																																1	Substitution - Missense(1)	ovary(1)	17											38.0	37.0	37.0					17																	42453020		2203	4300	6503	39808546	SO:0001583	missense	3674				CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.2666G>T	17.37:g.42453020C>A	ENSP00000262407:p.Arg889Leu		39808546	B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	ENST00000262407.5	37	CCDS32665.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.64	3.179658	0.57800	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	T;T	0.53857	0.6;0.6	3.66	3.66	0.41972	Integrin alpha-2 (1);	0.513347	0.13595	U	0.376332	T	0.72087	0.3417	M	0.85197	2.74	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.69479	0.927;0.964	T	0.72184	-0.4367	10	0.45353	T	0.12	.	11.1529	0.48469	0.0:1.0:0.0:0.0	.	487;889	Q59FA8;P08514	.;ITA2B_HUMAN	L	889	ENSP00000262407:R889L;ENSP00000340536:R889L	ENSP00000262407:R889L	R	-	2	0	ITGA2B	39808546	0.995000	0.38212	0.934000	0.37439	0.074000	0.17049	1.545000	0.36169	2.335000	0.79485	0.491000	0.48974	CGC		0.677	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439823.1			Missense_Mutation
KIAA0195	9772	hgsc.bcm.edu	37	17	73491049	73491049	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr17:73491049C>G	ENST00000314256.7	+	20	3056	c.2662C>G	c.(2662-2664)Cct>Gct	p.P888A	KIAA0195_ENST00000375248.5_Missense_Mutation_p.P898A|AC100787.1_ENST00000579379.1_RNA|KIAA0195_ENST00000579208.1_Missense_Mutation_p.P539A	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	888						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGGTGACATGCCTGGCTCCGA	0.602																																																0			17											65.0	70.0	68.0					17																	73491049		2203	4300	6503	71002644	SO:0001583	missense	9772				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.2662C>G	17.37:g.73491049C>G	ENSP00000313885:p.Pro888Ala		71002644	O75536|Q86XF1	Missense_Mutation	SNP	ENST00000314256.7	37	CCDS32732.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.41	1.930990	0.34096	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.47528	0.84;0.84	5.66	5.66	0.87406	.	0.055575	0.64402	D	0.000001	T	0.49355	0.1552	L	0.61218	1.895	0.80722	D	1	P;P;P	0.40731	0.608;0.728;0.608	B;B;B	0.39339	0.115;0.297;0.156	T	0.42816	-0.9429	10	0.23302	T	0.38	-9.8898	19.7417	0.96234	0.0:1.0:0.0:0.0	.	898;898;888	B4DGC6;C9JL75;Q12767	.;.;K0195_HUMAN	A	888;898	ENSP00000313885:P888A;ENSP00000364397:P898A	ENSP00000313885:P888A	P	+	1	0	KIAA0195	71002644	1.000000	0.71417	0.993000	0.49108	0.348000	0.29142	7.210000	0.77924	2.667000	0.90743	0.563000	0.77884	CCT		0.602	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738		Missense_Mutation
KIAA0430	9665	hgsc.bcm.edu	37	16	15729640	15729640	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr16:15729640C>A	ENST00000396368.3	-	3	910	c.704G>T	c.(703-705)gGg>gTg	p.G235V	KIAA0430_ENST00000551742.1_Missense_Mutation_p.G235V|KIAA0430_ENST00000540441.2_Missense_Mutation_p.G235V|KIAA0430_ENST00000548025.1_Missense_Mutation_p.G235V|KIAA0430_ENST00000602337.1_Missense_Mutation_p.G235V|KIAA0430_ENST00000344181.3_Missense_Mutation_p.G57V	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	235					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.G235V(1)		breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TTCCAAATGCCCTGGAGCCCC	0.517																																																1	Substitution - Missense(1)	ovary(1)	16											65.0	67.0	67.0					16																	15729640		1959	4143	6102	15637141	SO:0001583	missense	9665			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.704G>T	16.37:g.15729640C>A	ENSP00000379654:p.Gly235Val		15637141	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	ENST00000396368.3	37	CCDS10562.2	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.91	3.503931	0.64410	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	5.91	5.91	0.95273	.	0.079920	0.53938	D	0.000049	T	0.69663	0.3136	L	0.51422	1.61	0.45690	D	0.998601	D;D;D;D;D	0.89917	1.0;0.996;0.996;0.996;0.993	D;D;D;D;P	0.71656	0.974;0.944;0.944;0.944;0.881	T	0.70769	-0.4782	9	0.72032	D	0.01	.	13.4829	0.61348	0.0:0.9291:0.0:0.0708	.	234;234;235;234;234	Q9Y4F3-6;Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;.;LKAP_HUMAN	V	235;235;234;57;235;235;235	.	ENSP00000315718:G234V	G	-	2	0	KIAA0430	15637141	1.000000	0.71417	0.996000	0.52242	0.972000	0.66771	2.341000	0.43983	2.793000	0.96121	0.655000	0.94253	GGG		0.517	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647		Missense_Mutation
KIAA0430	9665	hgsc.bcm.edu	37	16	15729646	15729646	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr16:15729646G>A	ENST00000396368.3	-	3	904	c.698C>T	c.(697-699)gCt>gTt	p.A233V	KIAA0430_ENST00000551742.1_Missense_Mutation_p.A233V|KIAA0430_ENST00000540441.2_Missense_Mutation_p.A233V|KIAA0430_ENST00000548025.1_Missense_Mutation_p.A233V|KIAA0430_ENST00000602337.1_Missense_Mutation_p.A233V|KIAA0430_ENST00000344181.3_Missense_Mutation_p.A55V	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	233					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						ATGCCCTGGAGCCCCGCTTGT	0.512																																																0			16											66.0	68.0	67.0					16																	15729646		1966	4146	6112	15637147	SO:0001583	missense	9665			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.698C>T	16.37:g.15729646G>A	ENSP00000379654:p.Ala233Val		15637147	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	ENST00000396368.3	37	CCDS10562.2	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.56	3.418872	0.62622	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	5.91	4.96	0.65561	.	0.169319	0.42053	D	0.000780	T	0.38348	0.1037	L	0.51422	1.61	0.23192	N	0.998141	B;P;P;P;P	0.45531	0.001;0.86;0.86;0.86;0.78	B;B;B;B;B	0.41271	0.003;0.352;0.352;0.352;0.192	T	0.37709	-0.9694	9	0.59425	D	0.04	-6.2626	11.1106	0.48230	0.1398:0.0:0.8602:0.0	.	232;232;233;232;232	Q9Y4F3-6;Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;.;LKAP_HUMAN	V	233;233;232;55;233;233;233	.	ENSP00000315718:A232V	A	-	2	0	KIAA0430	15637147	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	4.305000	0.59110	1.509000	0.48786	-0.136000	0.14681	GCT		0.512	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647		Missense_Mutation
KIAA0430	9665	hgsc.bcm.edu	37	16	15730002	15730005	+	Frame_Shift_Del	DEL	CATT	CATT	-	rs376034508		TCGA-13-0906-01	TCGA-13-0906-10	CATT	CATT	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr16:15730002_15730005delCATT	ENST00000396368.3	-	3	545_548	c.339_342delAATG	c.(337-342)ccaatgfs	p.PM113fs	KIAA0430_ENST00000551742.1_Frame_Shift_Del_p.PM113fs|KIAA0430_ENST00000540441.2_Frame_Shift_Del_p.PM113fs|KIAA0430_ENST00000548025.1_Frame_Shift_Del_p.PM113fs|KIAA0430_ENST00000602337.1_Frame_Shift_Del_p.PM113fs|KIAA0430_ENST00000344181.3_5'UTR	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	113					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.M114fs*15(1)		breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						CACCAAAACGCATTGGCGAAGTGG	0.52																																																1	Deletion - Frameshift(1)	ovary(1)	16																																								15637506	SO:0001589	frameshift_variant	9665			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.339_342delAATG	16.37:g.15730002_15730005delCATT	ENSP00000379654:p.Pro113fs		15637503	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Del	DEL	ENST00000396368.3	37	CCDS10562.2	DEL	25	Baylor																																																																																				0.520	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647		Frame_Shift_Del
EFCAB14	9813	hgsc.bcm.edu	37	1	47183744	47183744	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr1:47183744C>T	ENST00000371933.3	-	1	992	c.16G>A	c.(16-18)Gag>Aag	p.E6K	EFCAB14_ENST00000544071.1_Missense_Mutation_p.E6K	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	6							calcium ion binding (GO:0005509)										GCATTGAGCTCTTTGCGCTTT	0.567																																																0			1											74.0	75.0	75.0					1																	47183744		2203	4300	6503	46956331	SO:0001583	missense	9813			AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.16G>A	1.37:g.47183744C>T	ENSP00000361001:p.Glu6Lys		46956331	D3DQ23|Q5SXB8	Missense_Mutation	SNP	ENST00000371933.3	37	CCDS30706.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	37	5.991983	0.97179	.	.	ENSG00000159658	ENST00000544071;ENST00000371933	T;T	0.76060	-0.99;-0.63	5.65	5.65	0.86999	.	0.050197	0.85682	D	0.000000	T	0.81163	0.4765	L	0.59436	1.845	0.80722	D	1	P;P;P	0.51791	0.948;0.911;0.911	P;P;P	0.52823	0.71;0.634;0.634	T	0.82121	-0.0614	10	0.87932	D	0	.	19.9142	0.97043	0.0:1.0:0.0:0.0	.	6;6;6	F5H7K3;B7Z444;O75071	.;.;K0494_HUMAN	K	6	ENSP00000442465:E6K;ENSP00000361001:E6K	ENSP00000361001:E6K	E	-	1	0	KIAA0494	46956331	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.334000	0.72944	2.941000	0.99782	0.655000	0.94253	GAG		0.567	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021931.1	NM_014774		Missense_Mutation
KIF5A	3798	hgsc.bcm.edu	37	12	57975255	57975255	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr12:57975255C>G	ENST00000455537.2	+	25	3087	c.2813C>G	c.(2812-2814)aCc>aGc	p.T938S	KIF5A_ENST00000286452.5_Missense_Mutation_p.T849S	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	938	Globular.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.T938S(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						CCCTATGGCACCCGGAGCCCT	0.547																																																1	Substitution - Missense(1)	ovary(1)	12											99.0	95.0	96.0					12																	57975255		2203	4300	6503	56261522	SO:0001583	missense	3798			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.2813C>G	12.37:g.57975255C>G	ENSP00000408979:p.Thr938Ser		56261522	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	37	CCDS8945.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905001	0.52333	.	.	ENSG00000155980	ENST00000455537;ENST00000286452;ENST00000547989	T;T	0.74002	-0.8;-0.79	4.52	4.52	0.55395	.	0.371732	0.26800	N	0.022423	T	0.53594	0.1806	N	0.24115	0.695	0.32402	N	0.551848	B;B	0.16802	0.009;0.019	B;B	0.20184	0.004;0.028	T	0.51521	-0.8695	10	0.07325	T	0.83	.	6.9694	0.24640	0.0:0.8124:0.0:0.1876	.	849;938	B7Z2M7;Q12840	.;KIF5A_HUMAN	S	938;849;32	ENSP00000408979:T938S;ENSP00000286452:T849S	ENSP00000286452:T849S	T	+	2	0	KIF5A	56261522	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.412000	0.44609	2.528000	0.85240	0.561000	0.74099	ACC		0.547	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984		Missense_Mutation
KTI12	112970	hgsc.bcm.edu	37	1	52498572	52498572	+	Missense_Mutation	SNP	C	C	A	rs78775514	byFrequency	TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr1:52498572C>A	ENST00000371614.1	-	1	916	c.862G>T	c.(862-864)Gcg>Tcg	p.A288S	RP11-91A18.4_ENST00000425802.1_RNA|TXNDC12_ENST00000371626.4_Intron	NM_138417.2	NP_612426.1	Q96EK9	KTI12_HUMAN	KTI12 homolog, chromatin associated (S. cerevisiae)	288							ATP binding (GO:0005524)	p.A288S(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)|urinary_tract(1)	12						CTCTTCTGCGCTTCCATCAAT	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											102.0	109.0	107.0					1																	52498572		2203	4300	6503	52271160	SO:0001583	missense	112970				CCDS562.1	1p32.3	2008-02-05			ENSG00000198841	ENSG00000198841			25160	protein-coding gene	gene with protein product						11929532	Standard	NM_138417		Approved	TOT4, MGC20419, SBBI81	uc001ctj.1	Q96EK9	OTTHUMG00000008630	ENST00000371614.1:c.862G>T	1.37:g.52498572C>A	ENSP00000360676:p.Ala288Ser		52271160		Missense_Mutation	SNP	ENST00000371614.1	37	CCDS562.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399162	0.62177	.	.	ENSG00000198841	ENST00000371614	T	0.33216	1.42	4.79	4.79	0.61399	.	0.195038	0.31847	U	0.006963	T	0.39937	0.1097	L	0.53249	1.67	0.41425	D	0.987828	D	0.52996	0.957	P	0.57324	0.818	T	0.08868	-1.0701	10	0.15952	T	0.53	.	10.5846	0.45275	0.0:0.9129:0.0:0.0871	.	288	Q96EK9	KTI12_HUMAN	S	288	ENSP00000360676:A288S	ENSP00000360676:A288S	A	-	1	0	KTI12	52271160	1.000000	0.71417	0.995000	0.50966	0.656000	0.38851	3.573000	0.53856	2.473000	0.83533	0.557000	0.71058	GCG		0.612	KTI12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023821.1	NM_138417		Missense_Mutation
LDOC1L	84247	hgsc.bcm.edu	37	22	44892879	44892879	+	Frame_Shift_Del	DEL	G	G	-	rs111640081		TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr22:44892879delG	ENST00000341255.3	-	2	1067	c.558delC	c.(556-558)cgcfs	p.R186fs		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	186								p.A187fs*>53(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		TGATTTGGGCGCGCCGCGCAT	0.632																																																1	Deletion - Frameshift(1)	ovary(1)	22																																								43271543	SO:0001589	frameshift_variant	84247			CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.558delC	22.37:g.44892879delG	ENSP00000340434:p.Arg186fs		43271543	Q6ZTR1	Frame_Shift_Del	DEL	ENST00000341255.3	37	CCDS33662.1	DEL	38	Baylor																																																																																				0.632	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287		Frame_Shift_Del
LRP10	26020	hgsc.bcm.edu	37	14	23344860	23344860	+	Missense_Mutation	SNP	C	C	G	rs374479224		TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr14:23344860C>G	ENST00000359591.4	+	5	1394	c.703C>G	c.(703-705)Cgc>Ggc	p.R235G	LRP10_ENST00000546834.1_Missense_Mutation_p.R235G	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	235	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.R235G(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		GCTGGCCGTGCGCTTCACAGC	0.622																																																1	Substitution - Missense(1)	ovary(1)	14											73.0	69.0	71.0					14																	23344860		2203	4300	6503	22414700	SO:0001583	missense	26020			AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.703C>G	14.37:g.23344860C>G	ENSP00000352601:p.Arg235Gly		22414700	A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Missense_Mutation	SNP	ENST00000359591.4	37	CCDS9578.1	SNP	27	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.84|13.84	2.357329|2.357329	0.41801|0.41801	.|.	.|.	ENSG00000197324|ENSG00000197324	ENST00000551466|ENST00000359591;ENST00000546834	.|T;T	.|0.18657	.|2.2;2.2	5.73|5.73	5.73|5.73	0.89815|0.89815	.|CUB (5);	.|0.238786	.|0.48286	.|D	.|0.000186	T|T	0.30572|0.30572	0.0769|0.0769	M|M	0.68317|0.68317	2.08|2.08	0.33096|0.33096	D|D	0.538591|0.538591	.|P	.|0.37038	.|0.579	.|B	.|0.38803	.|0.282	T|T	0.43507|0.43507	-0.9387|-0.9387	5|10	.|0.62326	.|D	.|0.03	-16.4179|-16.4179	18.6739|18.6739	0.91521|0.91521	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|235	.|Q7Z4F1	.|LRP10_HUMAN	G|G	136|235	.|ENSP00000352601:R235G;ENSP00000447559:R235G	.|ENSP00000352601:R235G	A|R	+|+	2|1	0|0	LRP10|LRP10	22414700|22414700	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	3.407000|3.407000	0.52644|0.52644	2.722000|2.722000	0.93159|0.93159	0.655000|0.655000	0.94253|0.94253	GCG|CGC		0.622	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071663.3			Missense_Mutation
MCM3	4172	hgsc.bcm.edu	37	6	52138563	52138563	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr6:52138563G>A	ENST00000229854.7	-	10	1602	c.1526C>T	c.(1525-1527)gCa>gTa	p.A509V	MCM3_ENST00000596288.1_Missense_Mutation_p.A554V|MCM3_ENST00000419835.2_Missense_Mutation_p.A463V|MCM3_ENST00000476448.1_5'Flank			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	509					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.A509V(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					CTCCCCAGGTGCTCTGTAACG	0.507																																																1	Substitution - Missense(1)	ovary(1)	6											125.0	97.0	107.0					6																	52138563		2203	4300	6503	52246522	SO:0001583	missense	4172			X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.1526C>T	6.37:g.52138563G>A	ENSP00000229854:p.Ala509Val		52246522	B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	ENST00000229854.7	37		SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.82	2.945369	0.53079	.	.	ENSG00000112118	ENST00000229854;ENST00000340349;ENST00000419835;ENST00000421471	T;T;T	0.32515	3.25;3.25;1.45	5.31	5.31	0.75309	.	0.206693	0.49305	D	0.000155	T	0.14743	0.0356	L	0.34521	1.04	0.39497	D	0.968143	B;B	0.30727	0.034;0.292	B;B	0.33121	0.044;0.158	T	0.03761	-1.1006	10	0.30078	T	0.28	-9.576	14.977	0.71281	0.0:0.0:0.8487:0.1513	.	463;509	B4DUQ9;P25205	.;MCM3_HUMAN	V	509;6;463;4	ENSP00000229854:A509V;ENSP00000388647:A463V;ENSP00000407651:A4V	ENSP00000229854:A509V	A	-	2	0	MCM3	52246522	0.994000	0.37717	0.987000	0.45799	0.982000	0.71751	2.742000	0.47434	2.759000	0.94783	0.563000	0.77884	GCA		0.507	MCM3-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470784.1			Missense_Mutation
MCM3AP	8888	hgsc.bcm.edu	37	21	47662804	47662805	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-13-0906-01	TCGA-13-0906-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr21:47662804_47662805insGG	ENST00000397708.1	-	26	5591_5592	c.5337_5338insCC	c.(5335-5340)tttaaafs	p.K1780fs	MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP_ENST00000291688.1_Frame_Shift_Ins_p.K1780fs|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1780	Acetyltransferase.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.K1780fs*5(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AAATCGTTTTTAAAAAAATACA	0.436																																																1	Insertion - Frameshift(1)	ovary(1)	21																																								46487233	SO:0001589	frameshift_variant	8888			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.5337_5338insCC	21.37:g.47662804_47662805insGG	ENSP00000380820:p.Lys1780fs		46487232	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Frame_Shift_Ins	INS	ENST00000397708.1	37	CCDS13734.1	INS	61	Baylor																																																																																				0.436	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906		Frame_Shift_Ins
MEIS2	4212	hgsc.bcm.edu	37	15	37388540	37388540	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr15:37388540C>T	ENST00000561208.1	-	3	755	c.337G>A	c.(337-339)Gtc>Atc	p.V113I	MEIS2_ENST00000559085.1_Missense_Mutation_p.V100I|MEIS2_ENST00000219869.9_Intron|RP11-128A17.1_ENST00000559509.1_RNA|MEIS2_ENST00000444725.1_Missense_Mutation_p.V113I|MEIS2_ENST00000338564.5_Missense_Mutation_p.V113I|MEIS2_ENST00000559561.1_Missense_Mutation_p.V113I|MEIS2_ENST00000424352.2_Missense_Mutation_p.V113I|MEIS2_ENST00000397620.2_Missense_Mutation_p.V25I|MEIS2_ENST00000557796.2_Missense_Mutation_p.V100I|MEIS2_ENST00000382766.2_Missense_Mutation_p.V113I|MEIS2_ENST00000340545.5_Missense_Mutation_p.V100I|MEIS2_ENST00000397624.3_Missense_Mutation_p.V25I			O14770	MEIS2_HUMAN	Meis homeobox 2	113	Required for interaction with PBX1. {ECO:0000250}.				eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.V113I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		GAGGAGCAGACGTCTCCGCCA	0.607																																																1	Substitution - Missense(1)	ovary(1)	15											40.0	38.0	39.0					15																	37388540		2201	4297	6498	35175832	SO:0001583	missense	4212			AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.337G>A	15.37:g.37388540C>T	ENSP00000453793:p.Val113Ile		35175832	A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	ENST00000561208.1	37	CCDS10044.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	26.9	4.778218	0.90195	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766;ENST00000424352;ENST00000444725;ENST00000340545;ENST00000397624;ENST00000397620	T;T;T;T;T;T;T;T	0.34275	1.54;1.37;1.37;1.54;1.54;1.54;1.43;1.54	5.64	3.73	0.42828	.	0.055231	0.64402	D	0.000001	T	0.59932	0.2230	M	0.83774	2.66	0.80722	D	1	P;D;D;D;D;P;P	0.89917	0.943;0.997;0.977;0.965;1.0;0.934;0.887	B;P;P;P;D;P;B	0.83275	0.435;0.895;0.488;0.767;0.996;0.582;0.435	T	0.60737	-0.7204	10	0.48119	T	0.1	-4.8259	10.8283	0.46647	0.1309:0.8011:0.0:0.068	.	100;113;113;113;113;25;100	Q96DI2;O14770-4;O14770;O14770-3;O14770-2;B3KPQ6;B3KP98	.;.;MEIS2_HUMAN;.;.;.;.	I	113;113;113;113;113;100;100;25	ENSP00000326296:V113I;ENSP00000341400:V113I;ENSP00000372216:V113I;ENSP00000404185:V113I;ENSP00000391887:V113I;ENSP00000339549:V100I;ENSP00000380749:V100I;ENSP00000380745:V25I	ENSP00000326296:V113I	V	-	1	0	MEIS2	35175832	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.790000	0.85794	0.706000	0.31912	0.650000	0.86243	GTC		0.607	MEIS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252003.2	NM_170677		Missense_Mutation
MGA	23269	hgsc.bcm.edu	37	15	42058784	42058784	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr15:42058784A>C	ENST00000570161.1	+	23	8504	c.8504A>C	c.(8503-8505)cAa>cCa	p.Q2835P	MGA_ENST00000219905.7_Missense_Mutation_p.Q2835P|MGA_ENST00000566586.1_Missense_Mutation_p.Q2626P|MGA_ENST00000389936.4_Missense_Mutation_p.Q2796P|MGA_ENST00000545763.1_Missense_Mutation_p.Q2626P			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.Q2884P(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTTCTTAATCAACAACTAAAT	0.453																																																1	Substitution - Missense(1)	ovary(1)	15											122.0	120.0	121.0					15																	42058784		2021	4191	6212	39846076	SO:0001583	missense	23269			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.8504A>C	15.37:g.42058784A>C	ENSP00000457035:p.Gln2835Pro		39846076	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.3	4.266506	0.80358	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.90197	-2.58;-2.56;-2.63	5.49	5.49	0.81192	.	0.130592	0.34314	N	0.004071	D	0.92293	0.7555	L	0.29908	0.895	0.34826	D	0.739222	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	D	0.95394	0.8484	10	0.87932	D	0	.	15.7597	0.78070	1.0:0.0:0.0:0.0	.	2626;2835	F5H7K2;E7ENI0	.;.	P	2835;2796;2626	ENSP00000219905:Q2835P;ENSP00000374586:Q2796P;ENSP00000442467:Q2626P	ENSP00000219905:Q2835P	Q	+	2	0	MGA	39846076	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.576000	0.74023	2.304000	0.77564	0.528000	0.53228	CAA		0.453	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		Missense_Mutation
MS4A3	932	hgsc.bcm.edu	37	11	59830067	59830067	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr11:59830067G>T	ENST00000278865.3	+	3	356	c.283G>T	c.(283-285)Ggt>Tgt	p.G95C	MS4A3_ENST00000358152.2_Intron|MS4A3_ENST00000395032.2_Intron|MS4A3_ENST00000534744.1_Intron	NM_006138.4	NP_006129.4	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)	95						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.G95C(1)		endometrium(4)|kidney(2)|lung(9)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		all_epithelial(135;0.245)				CCCGATTTGGGGTGCTGTGTT	0.423																																																1	Substitution - Missense(1)	ovary(1)	11											155.0	144.0	147.0					11																	59830067		2201	4295	6496	59586643	SO:0001583	missense	932			L35848	CCDS31567.1, CCDS31568.1, CCDS41651.1	11q12-q13.1	2008-03-25				ENSG00000149516			7317	protein-coding gene	gene with protein product		606498		CD20L		7524084	Standard	NM_006138		Approved	HTM4	uc001nom.3	Q96HJ5		ENST00000278865.3:c.283G>T	11.37:g.59830067G>T	ENSP00000278865:p.Gly95Cys		59586643	A8MTP8|Q8NHW2	Missense_Mutation	SNP	ENST00000278865.3	37	CCDS31567.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.19	1.863050	0.32884	.	.	ENSG00000149516	ENST00000278865	T	0.03441	3.93	4.59	3.68	0.42216	.	0.312769	0.35495	N	0.003170	T	0.21227	0.0511	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00920	-1.1514	10	0.66056	D	0.02	-3.2261	8.7143	0.34401	0.104:0.0:0.896:0.0	.	95	Q96HJ5	MS4A3_HUMAN	C	95	ENSP00000278865:G95C	ENSP00000278865:G95C	G	+	1	0	MS4A3	59586643	1.000000	0.71417	0.549000	0.28204	0.081000	0.17604	2.358000	0.44134	1.139000	0.42245	0.591000	0.81541	GGT		0.423	MS4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394417.1			Missense_Mutation
MYO9A	4649	hgsc.bcm.edu	37	15	72122642	72122642	+	Missense_Mutation	SNP	C	C	T	rs142345927	byFrequency	TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr15:72122642C>T	ENST00000356056.5	-	40	7320	c.6848G>A	c.(6847-6849)cGt>cAt	p.R2283H	MYO9A_ENST00000444904.1_Missense_Mutation_p.R2264H|MYO9A_ENST00000564571.1_Missense_Mutation_p.R2283H|MYO9A_ENST00000424560.1_Missense_Mutation_p.R2354H	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2283	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)	p.R2283H(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TCGACGAATACGCCCCTTTCC	0.443													C|||	8	0.00159744	0.0	0.0043	5008	,	,		19733	0.0		0.005	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	15						C	HIS/ARG	3,4395	6.2+/-15.9	0,3,2196	84.0	85.0	85.0		6848	3.8	0.9	15	dbSNP_134	85	37,8557	25.1+/-72.6	0,37,4260	yes	missense	MYO9A	NM_006901.2	29	0,40,6456	TT,TC,CC		0.4305,0.0682,0.3079	probably-damaging	2283/2549	72122642	40,12952	2199	4297	6496	69909696	SO:0001583	missense	4649			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.6848G>A	15.37:g.72122642C>T	ENSP00000348349:p.Arg2283His		69909696	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	SNP	19	Baylor	4	0.0018315018315018315	0	0.0	3	0.008287292817679558	0	0.0	1	0.0013192612137203166	C	18.98	3.738190	0.69304	6.82E-4	0.004305	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.84873	-1.9;-1.91;-1.9	4.73	3.81	0.43845	.	.	.	.	.	T	0.72598	0.3480	L	0.36672	1.1	0.40501	D	0.980645	B;B	0.22541	0.071;0.007	B;B	0.14578	0.011;0.002	T	0.73616	-0.3926	9	0.44086	T	0.13	.	13.4795	0.61328	0.0:0.9237:0.0:0.0763	.	2283;2047	B2RTY4;B2RTY4-5	MYO9A_HUMAN;.	H	2283;2354;2264	ENSP00000348349:R2283H;ENSP00000399162:R2354H;ENSP00000398250:R2264H	ENSP00000348349:R2283H	R	-	2	0	MYO9A	69909696	0.958000	0.32768	0.941000	0.38009	0.998000	0.95712	2.206000	0.42779	1.348000	0.45733	0.655000	0.94253	CGT		0.443	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901		Missense_Mutation
NBPF7	343505	hgsc.bcm.edu	37	1	120381827	120381827	+	IGR	SNP	T	T	A			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr1:120381827T>A								REG4 (27544 upstream) : ADAM30 (54328 downstream)														p.D273V(1)									GTTTAGAGCATCCTGCCATTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											156.0	158.0	157.0					1																	120381827		2137	4260	6397	120183350	SO:0001628	intergenic_variant	343505																															1.37:g.120381827T>A			120183350		Missense_Mutation	SNP		37		SNP	50	Baylor																																																																																			0	0.408									Missense_Mutation
OR8B4	283162	hgsc.bcm.edu	37	11	124293927	124293927	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr11:124293927C>T	ENST00000356130.3	-	1	862	c.841G>A	c.(841-843)Gtt>Att	p.V281I		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AGCATGGGAACCACATTGGTG	0.443																																																0			11											97.0	94.0	95.0					11																	124293927		2201	4299	6500	123799137	SO:0001583	missense	283162			AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.841G>A	11.37:g.124293927C>T	ENSP00000348449:p.Val281Ile		123799137	B2RNF8|Q6IFQ7	Missense_Mutation	SNP	ENST00000356130.3	37	CCDS31710.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	c	10.83	1.461532	0.26248	.	.	ENSG00000198657	ENST00000356130	T	0.36878	1.23	4.1	4.1	0.47936	GPCR, rhodopsin-like superfamily (1);	0.330899	0.21268	N	0.077368	T	0.14141	0.0342	N	0.02420	-0.555	0.20764	N	0.999854	B	0.21071	0.051	B	0.30782	0.12	T	0.31081	-0.9956	10	0.13108	T	0.6	.	6.4973	0.22150	0.0:0.6602:0.24:0.0997	.	281	Q96RC9	OR8B4_HUMAN	I	281	ENSP00000348449:V281I	ENSP00000348449:V281I	V	-	1	0	OR8B4	123799137	0.000000	0.05858	1.000000	0.80357	0.956000	0.61745	-0.476000	0.06591	2.579000	0.87056	0.655000	0.94253	GTT		0.443	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387055.1	NM_001005196		Missense_Mutation
PCCB	5096	hgsc.bcm.edu	37	3	136048831	136048845	+	In_Frame_Del	DEL	AACGTCCTTGGAGAA	AACGTCCTTGGAGAA	-			TCGA-13-0906-01	TCGA-13-0906-10	AACGTCCTTGGAGAA	AACGTCCTTGGAGAA	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:136048831_136048845delAACGTCCTTGGAGAA	ENST00000251654.4	+	15	1653_1667	c.1583_1597delAACGTCCTTGGAGAA	c.(1582-1599)caacgtccttggagaaaa>caa	p.RPWRK529del	PCCB_ENST00000483687.1_In_Frame_Del_p.RPWRK510del|PCCB_ENST00000490504.1_In_Frame_Del_p.RPWRK472del|PCCB_ENST00000482086.1_In_Frame_Del_p.RPWRK413del|PCCB_ENST00000478469.1_Intron|PCCB_ENST00000462637.1_In_Frame_Del_p.RPWRK506del|PCCB_ENST00000471595.1_Intron|PCCB_ENST00000468777.1_In_Frame_Del_p.RPWRK560del|PCCB_ENST00000466072.1_In_Frame_Del_p.RPWRK549del|PCCB_ENST00000469217.1_In_Frame_Del_p.RPWRK549del	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide	529	Carboxyltransferase.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)	p.R529_K533delRPWRK(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	AAGAAGGTACAACGTCCTTGGAGAAAACATGCAAA	0.442																																																1	Deletion - In frame(1)	ovary(1)	3	GRCh37	CM981495	PCCB	M																																				137531535	SO:0001651	inframe_deletion	5096				CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	ENST00000251654.4:c.1583_1597delAACGTCCTTGGAGAA	3.37:g.136048831_136048845delAACGTCCTTGGAGAA	ENSP00000251654:p.Arg529_Lys533del		137531521	B7Z2Z4|Q16813|Q96CX0	In_Frame_Del	DEL	ENST00000251654.4	37	CCDS3089.1	DEL	5	Baylor																																																																																				0.442	PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357335.1			In_Frame_Del
CDHR2	54825	hgsc.bcm.edu	37	5	175995802	175995802	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr5:175995802G>T	ENST00000510636.1	+	4	522	c.248G>T	c.(247-249)aGc>aTc	p.S83I	CDHR2_ENST00000261944.5_Missense_Mutation_p.S83I|CDHR2_ENST00000506348.1_Missense_Mutation_p.S83I	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	83	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S83I(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						AAGCTGGCCAGCGCTCTGGAC	0.647																																																1	Substitution - Missense(1)	ovary(1)	5											79.0	81.0	80.0					5																	175995802		2203	4300	6503	175928408	SO:0001583	missense	54825			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.248G>T	5.37:g.175995802G>T	ENSP00000424565:p.Ser83Ile		175928408	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	CCDS34297.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	5.856	0.342059	0.11069	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.61627	0.09;0.09;0.09	4.8	-0.598	0.11649	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.48447	0.1500	M	0.79926	2.475	0.09310	N	1	P	0.34462	0.454	B	0.29785	0.107	T	0.46020	-0.9221	9	0.39692	T	0.17	-6.8967	0.3609	0.00364	0.2366:0.1553:0.292:0.3162	.	83	Q9BYE9	CDHR2_HUMAN	I	83	ENSP00000424565:S83I;ENSP00000261944:S83I;ENSP00000421078:S83I	ENSP00000261944:S83I	S	+	2	0	CDHR2	175928408	0.000000	0.05858	0.741000	0.31004	0.038000	0.13279	-0.465000	0.06680	0.095000	0.17434	-0.314000	0.08810	AGC		0.647	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675		Missense_Mutation
PHACTR1	221692	hgsc.bcm.edu	37	6	12749987	12749987	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr6:12749987T>C	ENST00000379350.1	+	3	344	c.215T>C	c.(214-216)cTc>cCc	p.L72P	PHACTR1_ENST00000379348.2_Missense_Mutation_p.L72P|PHACTR1_ENST00000332995.7_Missense_Mutation_p.L72P			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	72					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)	p.L72P(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			ACGCCGTACCTCGCAGAGGCC	0.677																																																1	Substitution - Missense(1)	ovary(1)	6											29.0	34.0	32.0					6																	12749987		1858	4077	5935	12857973	SO:0001583	missense	221692			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.215T>C	6.37:g.12749987T>C	ENSP00000368655:p.Leu72Pro		12857973	A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	ENST00000379350.1	37		SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	25.2	4.618007	0.87359	.	.	ENSG00000112137	ENST00000379350;ENST00000379348;ENST00000332995;ENST00000432934	T;T;T	0.49139	0.79;0.79;0.79	4.61	4.61	0.57282	.	0.212757	0.30201	N	0.010177	T	0.46328	0.1387	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.71674	0.997;0.998;0.995;0.997	D;D;P;D	0.76575	0.916;0.988;0.829;0.918	T	0.54549	-0.8277	10	0.87932	D	0	.	13.1678	0.59581	0.0:0.0:0.0:1.0	.	72;72;72;72	E7ESR5;Q5R356;Q9C0D0;Q9C0D0-2	.;.;PHAR1_HUMAN;.	P	72	ENSP00000368655:L72P;ENSP00000368653:L72P;ENSP00000329880:L72P	ENSP00000329880:L72P	L	+	2	0	PHACTR1	12857973	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.565000	0.67365	1.704000	0.51252	0.260000	0.18958	CTC		0.677	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039876.1	XM_166420		Missense_Mutation
PKN1	5585	hgsc.bcm.edu	37	19	14580799	14580799	+	Splice_Site	SNP	G	G	T			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr19:14580799G>T	ENST00000242783.6	+	18	2457	c.2292G>T	c.(2290-2292)gaG>gaT	p.E764D	PKN1_ENST00000342216.4_Splice_Site_p.E770D	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	764	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)	p.E764D(1)		breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						TCTGCAAGGAGGGTGAGGGGC	0.607																																					NSCLC(185;2539 2965 10733 52867)											1	Substitution - Missense(1)	ovary(1)	19											72.0	75.0	74.0					19																	14580799		2026	4179	6205	14441799	SO:0001630	splice_region_variant	5585			S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.2293+1G>T	19.37:g.14580799G>T			14441799	A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	ENST00000242783.6	37	CCDS42513.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.47	3.132667	0.56828	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	T;T	0.65732	-0.17;-0.17	4.06	0.717	0.18196	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000002	T	0.60392	0.2265	N	0.17764	0.52	0.35948	D	0.833699	D;D	0.69078	0.996;0.997	D;D	0.76071	0.978;0.987	T	0.65240	-0.6216	10	0.87932	D	0	-24.0166	7.581	0.27965	0.2953:0.0:0.7047:0.0	.	770;764	Q16512-2;Q16512	.;PKN1_HUMAN	D	764;770	ENSP00000242783:E764D;ENSP00000343325:E770D	ENSP00000242783:E764D	E	+	3	2	PKN1	14441799	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	2.161000	0.42358	0.142000	0.18901	-1.185000	0.01705	GAG		0.607	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	NM_002741, NM_213560	Missense_Mutation	Missense_Mutation
PLD3	23646	hgsc.bcm.edu	37	19	40883999	40883999	+	Silent	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr19:40883999C>T	ENST00000409587.1	+	13	1789	c.1392C>T	c.(1390-1392)ttC>ttT	p.F464F	PLD3_ENST00000409281.1_Silent_p.F464F|PLD3_ENST00000409735.4_Silent_p.F464F|PLD3_ENST00000356508.5_Silent_p.F464F|PLD3_ENST00000409419.1_Silent_p.F464F			Q8IV08	PLD3_HUMAN	phospholipase D family, member 3	464					cell death (GO:0008219)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phospholipase D activity (GO:0004630)	p.F411F(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			AGGCCATTTTCCTGAGGGACT	0.652																																																1	Substitution - coding silent(1)	ovary(1)	19											93.0	93.0	93.0					19																	40883999		2203	4300	6503	45575839	SO:0001819	synonymous_variant	23646			BC000553	CCDS33027.1	19q13.2	2014-03-14	2005-05-20		ENSG00000105223	ENSG00000105223			17158	protein-coding gene	gene with protein product		615698	"""phospholipase D3"""			9140189, 15794758	Standard	XM_005258704		Approved	HU-K4	uc002onj.4	Q8IV08	OTTHUMG00000152736	ENST00000409587.1:c.1392C>T	19.37:g.40883999C>T			45575839	Q92853|Q9BW87	Silent	SNP	ENST00000409587.1	37	CCDS33027.1	SNP	30	Baylor																																																																																				0.652	PLD3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327721.1	NM_012268		Silent
PLXNB2	23654	hgsc.bcm.edu	37	22	50721158	50721158	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr22:50721158G>C	ENST00000449103.1	-	18	3109	c.2969C>G	c.(2968-2970)cCg>cGg	p.P990R	PLXNB2_ENST00000496720.1_5'Flank|PLXNB2_ENST00000359337.4_Missense_Mutation_p.P990R			O15031	PLXB2_HUMAN	plexin B2	990	IPT/TIG 3.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.P1033R(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GCTTCGTAGCGGCTCGAAGGC	0.657																																																1	Substitution - Missense(1)	ovary(1)	22											15.0	22.0	20.0					22																	50721158		1975	4135	6110	49063285	SO:0001583	missense	23654				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.2969C>G	22.37:g.50721158G>C	ENSP00000409171:p.Pro990Arg		49063285	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	37	CCDS43035.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.51	2.854010	0.51270	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000427829	D;D	0.89270	-2.49;-2.49	3.66	3.66	0.41972	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000082	D	0.93549	0.7941	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93866	0.7158	10	0.59425	D	0.04	.	12.8931	0.58082	0.0:0.0:1.0:0.0	.	990	O15031	PLXB2_HUMAN	R	990;990;51	ENSP00000409171:P990R;ENSP00000352288:P990R	ENSP00000352288:P990R	P	-	2	0	PLXNB2	49063285	1.000000	0.71417	0.513000	0.27749	0.186000	0.23388	4.090000	0.57693	1.898000	0.54952	0.313000	0.20887	CCG		0.657	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401		Missense_Mutation
PPP1R9A	55607	hgsc.bcm.edu	37	7	94740576	94740576	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr7:94740576C>G	ENST00000433881.1	+	3	1933	c.1401C>G	c.(1399-1401)ttC>ttG	p.F467L	PPP1R9A_ENST00000289495.5_Missense_Mutation_p.F467L|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.F467L|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.F467L|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.F467L|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.F467L			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	467	Interacts with protein phosphatase 1. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)		p.F467L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TACAGGTTTTCAACACATACT	0.373										HNSCC(28;0.073)																																						1	Substitution - Missense(1)	ovary(1)	7											74.0	75.0	75.0					7																	94740576		2203	4300	6503	94578512	SO:0001583	missense	55607			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.1401C>G	7.37:g.94740576C>G	ENSP00000398870:p.Phe467Leu		94578512	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	37	CCDS34683.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.97	3.925414	0.73213	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.18016	2.24;2.28;2.26;2.28;2.28;2.26	4.65	3.6	0.41247	.	0.000000	0.85682	D	0.000000	T	0.41213	0.1149	M	0.80847	2.515	0.58432	D	0.99999	D;D;D;D;D	0.89917	0.998;0.999;0.998;1.0;0.979	D;D;D;D;P	0.79784	0.935;0.984;0.98;0.993;0.759	T	0.36817	-0.9732	10	0.72032	D	0.01	.	10.8992	0.47040	0.0:0.8872:0.0:0.1128	.	467;467;467;467;467	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	L	467	ENSP00000405514:F467L;ENSP00000344524:F467L;ENSP00000411342:F467L;ENSP00000398870:F467L;ENSP00000289495:F467L;ENSP00000402893:F467L	ENSP00000289495:F467L	F	+	3	2	PPP1R9A	94578512	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	0.809000	0.27168	1.077000	0.40990	0.585000	0.79938	TTC		0.373	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160		Missense_Mutation
PPP2R5B	5526	hgsc.bcm.edu	37	11	64699078	64699078	+	Silent	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr11:64699078G>A	ENST00000164133.2	+	10	1615	c.993G>A	c.(991-993)aaG>aaA	p.K331K		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	331					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.K331K(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						GCACCCAGAAGGAGGTATGAA	0.587																																																1	Substitution - coding silent(1)	ovary(1)	11											37.0	35.0	36.0					11																	64699078		2201	4297	6498	64455654	SO:0001819	synonymous_variant	5526			L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.993G>A	11.37:g.64699078G>A			64455654	Q13853	Silent	SNP	ENST00000164133.2	37	CCDS8085.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.304	1.053736	0.19907	.	.	ENSG00000068971	ENST00000359279	.	.	.	4.53	2.65	0.31530	.	.	.	.	.	T	0.60741	0.2292	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59423	-0.7457	5	0.59425	D	0.04	-22.2375	6.6875	0.23154	0.2921:0.0:0.7079:0.0	.	.	.	.	R	357	.	ENSP00000352225:G357R	G	+	1	0	PPP2R5B	64455654	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	0.891000	0.28309	0.648000	0.30732	0.462000	0.41574	GGA		0.587	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244		Silent
SGK223	157285	hgsc.bcm.edu	37	8	8185472	8185472	+	Silent	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr8:8185472C>T	ENST00000520004.1	-	5	3084	c.2820G>A	c.(2818-2820)ctG>ctA	p.L940L	SGK223_ENST00000330777.4_Silent_p.L940L			Q86YV5	SG223_HUMAN		942							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TGATGTTGCTCAGGAGACCGT	0.632																																					GBM(34;731 755 10259 33573 33867)											0			8											41.0	46.0	44.0					8																	8185472		2015	4189	6204	8222882	SO:0001819	synonymous_variant	157285																														ENST00000520004.1:c.2820G>A	8.37:g.8185472C>T			8222882	Q8N3N5	Silent	SNP	ENST00000520004.1	37	CCDS43706.1	SNP	29	Baylor																																																																																				0.632	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1			Silent
PRDM15	63977	hgsc.bcm.edu	37	21	43255630	43255630	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr21:43255630C>T	ENST00000269844.3	-	18	2490	c.2380G>A	c.(2380-2382)Gac>Aac	p.D794N	PRDM15_ENST00000538201.1_Missense_Mutation_p.D428N|PRDM15_ENST00000422911.1_Missense_Mutation_p.D465N|PRDM15_ENST00000447207.2_Missense_Mutation_p.D428N|PRDM15_ENST00000398548.1_Missense_Mutation_p.D465N	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	794					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						TACTCGCCGTCCACCTGGTCA	0.662																																																0			21											77.0	59.0	65.0					21																	43255630		2203	4300	6503	42128699	SO:0001583	missense	63977			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.2380G>A	21.37:g.43255630C>T	ENSP00000269844:p.Asp794Asn		42128699	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	37	CCDS13676.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	c	20.4	3.978670	0.74360	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844;ENST00000380489	T;T;T;T;T	0.09073	3.04;3.05;3.04;3.04;3.02	4.56	4.56	0.56223	.	.	.	.	.	T	0.18173	0.0436	L	0.27053	0.805	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.87578	0.996;0.992;0.998	T	0.03608	-1.1020	9	0.49607	T	0.09	-8.187	16.3479	0.83151	0.0:1.0:0.0:0.0	.	794;465;465	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	N	465;465;428;428;794;428	ENSP00000408592:D465N;ENSP00000381556:D465N;ENSP00000444044:D428N;ENSP00000390245:D428N;ENSP00000269844:D794N	ENSP00000269844:D794N	D	-	1	0	PRDM15	42128699	1.000000	0.71417	0.981000	0.43875	0.176000	0.22953	6.823000	0.75282	2.092000	0.63282	0.651000	0.88453	GAC		0.662	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115		Missense_Mutation
PTPRT	11122	hgsc.bcm.edu	37	20	40790162	40790174	+	Frame_Shift_Del	DEL	GCTCCCCGCGGCT	GCTCCCCGCGGCT	-	rs376797195|rs200718535|rs373191879|rs368946816		TCGA-13-0906-01	TCGA-13-0906-10	GCTCCCCGCGGCT	GCTCCCCGCGGCT	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr20:40790162_40790174delGCTCCCCGCGGCT	ENST00000373187.1	-	17	2499_2511	c.2500_2512delAGCCGCGGGGAGC	c.(2500-2514)agccgcggggagcttfs	p.SRGEL834fs	PTPRT_ENST00000373190.1_Frame_Shift_Del_p.SRGEL833fs|PTPRT_ENST00000373201.1_Frame_Shift_Del_p.SRGEL824fs|PTPRT_ENST00000373198.4_Frame_Shift_Del_p.SRGEL853fs|PTPRT_ENST00000356100.2_Frame_Shift_Del_p.SRGEL843fs|PTPRT_ENST00000373193.3_Frame_Shift_Del_p.SRGEL837fs|PTPRT_ENST00000373184.1_Frame_Shift_Del_p.SRGEL824fs			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	834					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.S856fs*21(1)|p.R857R(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GGCTGGGAAAGCTCCCCGCGGCTGCCATCTGCT	0.606																																																2	Deletion - Frameshift(1)|Substitution - coding silent(1)	ovary(1)|prostate(1)	20																																								40223588	SO:0001589	frameshift_variant	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2500_2512delAGCCGCGGGGAGC	20.37:g.40790162_40790174delGCTCCCCGCGGCT	ENSP00000362283:p.Ser834fs		40223576	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Frame_Shift_Del	DEL	ENST00000373187.1	37	CCDS42874.1	DEL	34	Baylor																																																																																				0.606	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			Frame_Shift_Del
RAB2B	84932	hgsc.bcm.edu	37	14	21931834	21931834	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0906-01	TCGA-13-0906-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr14:21931834G>C	ENST00000397762.1	-	6	555	c.455C>G	c.(454-456)aCa>aGa	p.T152R	RAB2B_ENST00000461909.1_5'UTR	NM_001163380.1|NM_032846.3	NP_001156852.1|NP_116235.2	Q8WUD1	RAB2B_HUMAN	RAB2B, member RAS oncogene family	152					positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.T152R(1)		NS(1)|central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6	all_cancers(95;0.000858)		Epithelial(56;1.53e-06)|all cancers(55;1.44e-05)	GBM - Glioblastoma multiforme(265;0.00391)		ATTGCAGGCTGTTTTGGCTGA	0.433																																					Melanoma(131;1007 1750 28652 34486 42672)											1	Substitution - Missense(1)	ovary(1)	14											144.0	132.0	136.0					14																	21931834		2203	4300	6503	21001674	SO:0001583	missense	84932			AK027730	CCDS9570.1	14q11.1	2006-12-18			ENSG00000129472	ENSG00000129472		"""RAB, member RAS oncogene"""	20246	protein-coding gene	gene with protein product		607466				12376746	Standard	NM_032846		Approved	FLJ14824	uc010tlt.2	Q8WUD1	OTTHUMG00000029693	ENST00000397762.1:c.455C>G	14.37:g.21931834G>C	ENSP00000380869:p.Thr152Arg		21001674	B2RD03|D3DS24|Q6NZ33	Missense_Mutation	SNP	ENST00000397762.1	37	CCDS9570.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144434	0.77888	.	.	ENSG00000129472	ENST00000397762;ENST00000304034	D	0.81821	-1.54	6.01	4.2	0.49525	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	D	0.89030	0.6599	M	0.85462	2.755	0.80722	D	1	P;D;D	0.62365	0.881;0.991;0.984	P;D;P	0.64687	0.771;0.928;0.829	D	0.89636	0.3859	10	0.72032	D	0.01	.	12.2026	0.54335	0.1237:0.0:0.8763:0.0	.	152;106;87	Q8WUD1;B4DUD4;Q6NZ33	RAB2B_HUMAN;.;.	R	152	ENSP00000380869:T152R	ENSP00000302005:T152R	T	-	2	0	RAB2B	21001674	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	6.030000	0.70903	0.884000	0.36064	0.655000	0.94253	ACA		0.433	RAB2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074053.4			Missense_Mutation
RAPGEF1	2889	hgsc.bcm.edu	37	9	134459790	134459790	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0906-01	TCGA-13-0906-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr9:134459790T>C	ENST00000372189.3	-	21	2887	c.2764A>G	c.(2764-2766)Aag>Gag	p.K922E	RAPGEF1_ENST00000372195.1_Missense_Mutation_p.K939E|RAPGEF1_ENST00000372190.3_Missense_Mutation_p.K940E	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	922	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)	p.K940E(1)		NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		TTATTCAGCTTCCGCAAGTGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	9											35.0	40.0	39.0					9																	134459790		1996	4168	6164	133449611	SO:0001583	missense	2889			BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.2764A>G	9.37:g.134459790T>C	ENSP00000361263:p.Lys922Glu		133449611	Q5JUE4|Q8IV73	Missense_Mutation	SNP	ENST00000372189.3	37	CCDS48047.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	22.4	4.289809	0.80914	.	.	ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000429421;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000337036;ENST00000357686	T;T;T	0.28255	1.62;1.62;1.62	5.27	5.27	0.74061	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.35653	0.0939	N	0.11284	0.12	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.71184	0.969;0.972	T	0.40156	-0.9578	10	0.52906	T	0.07	.	14.6483	0.68777	0.0:0.0:0.0:1.0	.	922;940	Q13905;Q13905-3	RPGF1_HUMAN;.	E	922;939;868;922;940;902;900;939	ENSP00000361269:K939E;ENSP00000361263:K922E;ENSP00000361264:K940E	ENSP00000266110:K922E	K	-	1	0	RAPGEF1	133449611	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	7.650000	0.83521	2.110000	0.64415	0.454000	0.30748	AAG		0.647	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054759.2	NM_005312		Missense_Mutation
RIC8B	55188	hgsc.bcm.edu	37	12	107254112	107254112	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr12:107254112T>G	ENST00000392839.2	+	8	1479	c.1373T>G	c.(1372-1374)tTg>tGg	p.L458W	RIC8B_ENST00000392837.4_Missense_Mutation_p.L458W|RIC8B_ENST00000355478.2_Missense_Mutation_p.L418W|RIC8B_ENST00000549643.1_5'UTR	NM_018157.2	NP_060627.2	Q9NVN3	RIC8B_HUMAN	RIC8 guanine nucleotide exchange factor B	458					regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	G-protein alpha-subunit binding (GO:0001965)|guanyl-nucleotide exchange factor activity (GO:0005085)			kidney(2)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	19						AGGGGCCTCTTGGCTGGAGGA	0.433																																																0			12											81.0	79.0	80.0					12																	107254112		2203	4300	6503	105778242	SO:0001583	missense	55188			AK128102	CCDS9109.2	12q23.3	2013-08-05	2013-08-05		ENSG00000111785	ENSG00000111785			25555	protein-coding gene	gene with protein product		609147	"""resistance to inhibitors of cholinesterase 8 homolog B (C. elegans)"""				Standard	XM_005268998		Approved	FLJ10620, hSyn, RIC8	uc001tlx.3	Q9NVN3	OTTHUMG00000144188	ENST00000392839.2:c.1373T>G	12.37:g.107254112T>G	ENSP00000376583:p.Leu458Trp		105778242	A2RTZ0|Q4G103|Q6ZRN4|Q86WD3	Missense_Mutation	SNP	ENST00000392839.2	37	CCDS9109.2	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	29.4	5.001984	0.93227	.	.	ENSG00000111785	ENST00000392837;ENST00000392839;ENST00000355478	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.81103	0.4753	M	0.83483	2.645	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.83855	0.0265	9	0.72032	D	0.01	-2.8174	16.2109	0.82158	0.0:0.0:0.0:1.0	.	418;458;458	Q9NVN3-3;Q9NVN3;B7WPL0	.;RIC8B_HUMAN;.	W	458;458;418	.	ENSP00000347662:L418W	L	+	2	0	RIC8B	105778242	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.230000	0.72887	0.455000	0.32223	TTG		0.433	RIC8B-006	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000291398.2	NM_018157		Missense_Mutation
RNF168	165918	hgsc.bcm.edu	37	3	196230042	196230042	+	Start_Codon_SNP	SNP	C	C	G			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:196230042C>G	ENST00000318037.3	-	1	597	c.3G>C	c.(1-3)atG>atC	p.M1I		NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	1					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		TGGGTAGAGCCATTTCAATAT	0.512																																																0			3											57.0	55.0	56.0					3																	196230042		2203	4300	6503	197714439	SO:0001582	initiator_codon_variant	165918			AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.3G>C	3.37:g.196230042C>G	ENSP00000320898:p.Met1Ile		197714439	Q8NA67|Q96NS4	Missense_Mutation	SNP	ENST00000318037.3	37	CCDS3317.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.80	2.941731	0.53079	.	.	ENSG00000163961	ENST00000318037	T	0.09350	2.99	6.04	5.16	0.70880	.	0.072407	0.64402	N	0.000017	T	0.18964	0.0455	.	.	.	0.80722	D	1	D	0.57899	0.981	P	0.49752	0.621	T	0.00756	-1.1579	9	0.87932	D	0	-16.453	11.0178	0.47701	0.0:0.9154:0.0:0.0846	.	1	Q8IYW5	RN168_HUMAN	I	1	ENSP00000320898:M1I	ENSP00000320898:M1I	M	-	3	0	RNF168	197714439	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	3.711000	0.54868	1.561000	0.49584	0.561000	0.74099	ATG		0.512	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617	Missense_Mutation	Missense_Mutation
RYR2	6262	hgsc.bcm.edu	37	1	237948208	237948208	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr1:237948208A>G	ENST00000366574.2	+	90	13513	c.13196A>G	c.(13195-13197)aAt>aGt	p.N4399S	RYR2_ENST00000542537.1_Missense_Mutation_p.N4383S|RYR2_ENST00000360064.6_Missense_Mutation_p.N4405S|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4399					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.N4397S(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CATAATCCAAATGCTGGGCTC	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											31.0	29.0	29.0					1																	237948208		1923	4133	6056	236014831	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13196A>G	1.37:g.237948208A>G	ENSP00000355533:p.Asn4399Ser		236014831	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	5.830	0.337409	0.11013	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.92647	-3.08;-3.08;-3.08	5.77	5.77	0.91146	Ryanodine Receptor TM 4-6 (1);	0.072721	0.50627	D	0.000110	D	0.83464	0.5260	N	0.08118	0	0.53005	D	0.999968	P;B	0.40578	0.722;0.004	B;B	0.43445	0.42;0.01	T	0.81967	-0.0690	10	0.09590	T	0.72	-20.355	12.0028	0.53241	0.8557:0.1442:0.0:0.0	.	1373;4399	B4DGV4;Q92736	.;RYR2_HUMAN	S	4399;4405;4383;1373	ENSP00000355533:N4399S;ENSP00000353174:N4405S;ENSP00000443798:N4383S	ENSP00000353174:N4405S	N	+	2	0	RYR2	236014831	1.000000	0.71417	0.630000	0.29268	0.421000	0.31385	5.425000	0.66470	2.199000	0.70637	0.533000	0.62120	AAT		0.463	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		Missense_Mutation
SGSM2	9905	hgsc.bcm.edu	37	17	2270633	2270633	+	Intron	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr17:2270633G>A	ENST00000426855.2	+	11	1463				SGSM2_ENST00000268989.3_Missense_Mutation_p.D453N|SGSM2_ENST00000574563.1_Intron	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2						late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		GGAAGAGGAGGATAAACTGCA	0.562											OREG0024082	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			17											134.0	103.0	114.0					17																	2270633		2203	4300	6503	2217383	SO:0001627	intron_variant	9905			BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.1288+1998G>A	17.37:g.2270633G>A		602	2217383	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Missense_Mutation	SNP	ENST00000426855.2	37	CCDS45570.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382044	0.82792	.	.	ENSG00000141258	ENST00000268989	T	0.11495	2.77	5.83	5.83	0.93111	.	0.127105	0.52532	D	0.000075	T	0.14787	0.0357	.	.	.	0.80722	D	1	P	0.42692	0.787	B	0.42959	0.403	T	0.01532	-1.1331	9	0.30854	T	0.27	-18.5657	19.0964	0.93253	0.0:0.0:1.0:0.0	.	453	O43147-2	.	N	453	ENSP00000268989:D453N	ENSP00000268989:D453N	D	+	1	0	SGSM2	2217383	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.388000	0.97237	2.764000	0.94973	0.555000	0.69702	GAT		0.562	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853		Missense_Mutation
SH3GLB2	56904	hgsc.bcm.edu	37	9	131776773	131776773	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr9:131776773G>C	ENST00000372564.3	-	5	623	c.478C>G	c.(478-480)Cgg>Ggg	p.R160G	SH3GLB2_ENST00000372559.1_Missense_Mutation_p.R160G|SH3GLB2_ENST00000417224.1_Missense_Mutation_p.R160G|SH3GLB2_ENST00000372554.4_Missense_Mutation_p.R160G|SH3GLB2_ENST00000416629.1_Missense_Mutation_p.R160G	NM_020145.2	NP_064530.1	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	160	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)				NS(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)	12						TGGAGGAGCCGCCTCTCCTTC	0.627																																																0			9											31.0	26.0	28.0					9																	131776773		2118	4127	6245	130816594	SO:0001583	missense	56904			AF257319	CCDS6916.1, CCDS69680.1	9q34	2008-02-05	2001-12-04		ENSG00000148341	ENSG00000148341			10834	protein-coding gene	gene with protein product		609288	"""SH3-domain, GRB2-like, endophilin B2"""			11161816	Standard	NM_020145		Approved	KIAA1848	uc004bwv.3	Q9NR46	OTTHUMG00000020769	ENST00000372564.3:c.478C>G	9.37:g.131776773G>C	ENSP00000361645:p.Arg160Gly		130816594	A6NC47|A8MPS4|Q8WY61|Q96JH9	Missense_Mutation	SNP	ENST00000372564.3	37	CCDS6916.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.70	2.909586	0.52439	.	.	ENSG00000148341	ENST00000372564;ENST00000372559;ENST00000543311;ENST00000372554;ENST00000417224;ENST00000416629	T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46	6.08	4.17	0.49024	BAR (3);IRSp53/MIM homology domain (IMD) (1);	0.000000	0.85682	D	0.000000	T	0.49372	0.1553	L	0.56199	1.76	0.58432	D	0.999999	D;B	0.89917	1.0;0.128	D;B	0.91635	0.999;0.26	T	0.42085	-0.9472	10	0.45353	T	0.12	-7.7287	13.5871	0.61937	0.0:0.0:0.4657:0.5343	.	160;160	Q9NR46-2;Q9NR46	.;SHLB2_HUMAN	G	160	ENSP00000361645:R160G;ENSP00000361640:R160G;ENSP00000361634:R160G;ENSP00000402566:R160G;ENSP00000388282:R160G	ENSP00000361634:R160G	R	-	1	2	SH3GLB2	130816594	0.890000	0.30428	0.999000	0.59377	0.897000	0.52465	2.698000	0.47068	0.830000	0.34757	0.655000	0.94253	CGG		0.627	SH3GLB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054535.2			Missense_Mutation
SLC16A13	201232	hgsc.bcm.edu	37	17	6941911	6941911	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr17:6941911G>A	ENST00000308027.6	+	3	1092	c.784G>A	c.(784-786)Gac>Aac	p.D262N		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	262						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						TGCTATTTCTGACCTCGTGGG	0.587																																																0			17											127.0	115.0	119.0					17																	6941911		2203	4300	6503	6882635	SO:0001583	missense	201232			BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.784G>A	17.37:g.6941911G>A	ENSP00000309751:p.Asp262Asn		6882635	A3KMG3|A5PKU5|Q2VP92	Missense_Mutation	SNP	ENST00000308027.6	37	CCDS11085.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.186790	0.94923	.	.	ENSG00000174327	ENST00000308027	T	0.56444	0.46	5.59	5.59	0.84812	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.091701	0.64402	D	0.000001	T	0.61652	0.2364	L	0.52759	1.655	0.80722	D	1	P	0.51240	0.943	P	0.54026	0.74	T	0.60752	-0.7201	10	0.48119	T	0.1	.	17.0863	0.86611	0.0:0.0:1.0:0.0	.	262	Q7RTY0	MOT13_HUMAN	N	262	ENSP00000309751:D262N	ENSP00000309751:D262N	D	+	1	0	SLC16A13	6882635	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.108000	0.94275	2.627000	0.88993	0.557000	0.71058	GAC		0.587	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219923.2			Missense_Mutation
SLC29A1	2030	hgsc.bcm.edu	37	6	44197351	44197351	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr6:44197351C>T	ENST00000393841.1	+	5	628	c.137C>T	c.(136-138)tCc>tTc	p.S46F	SLC29A1_ENST00000371755.3_Missense_Mutation_p.S46F|SLC29A1_ENST00000393844.1_Missense_Mutation_p.S46F|SLC29A1_ENST00000371713.1_Missense_Mutation_p.S46F|SLC29A1_ENST00000472176.1_3'UTR|SLC29A1_ENST00000371724.1_Missense_Mutation_p.S46F|SLC29A1_ENST00000313248.7_Missense_Mutation_p.S125F|SLC29A1_ENST00000371740.5_Missense_Mutation_p.S46F|SLC29A1_ENST00000371731.1_Missense_Mutation_p.S46F|SLC29A1_ENST00000427851.2_Missense_Mutation_p.S46F|SLC29A1_ENST00000371708.1_Missense_Mutation_p.S46F	NM_001078177.1	NP_001071645.1	Q99808	S29A1_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 1	46					cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|lactation (GO:0007595)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sleep (GO:0030431)|transmembrane transport (GO:0055085)|uridine transport (GO:0015862)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)	p.S46F(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	17	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Cytarabine(DB00987)|Didanosine(DB00900)|Fludarabine(DB01073)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Pemetrexed(DB00642)|Ribavirin(DB00811)|Zalcitabine(DB00943)	CTGGACATGTCCCAGAATGTG	0.567																																																1	Substitution - Missense(1)	ovary(1)	6											101.0	97.0	98.0					6																	44197351		2203	4300	6503	44305329	SO:0001583	missense	2030			U81375	CCDS4908.1	6p21.1	2013-07-17	2013-07-17		ENSG00000112759	ENSG00000112759		"""Solute carriers"""	11003	protein-coding gene	gene with protein product		602193	"""solute carrier family 29 (nucleoside transporters), member 1"""	ENT1		8986748, 9344680	Standard	NM_004955		Approved		uc003owy.2	Q99808	OTTHUMG00000014759	ENST00000393841.1:c.137C>T	6.37:g.44197351C>T	ENSP00000377424:p.Ser46Phe		44305329	B3KQV7|B3KQY5|Q5T9W9|Q9UJY2	Missense_Mutation	SNP	ENST00000393841.1	37	CCDS4908.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.90	3.502552	0.64298	.	.	ENSG00000112759	ENST00000544345;ENST00000393844;ENST00000313248;ENST00000427851;ENST00000371755;ENST00000371740;ENST00000371731;ENST00000393841;ENST00000371724;ENST00000371713;ENST00000371708	D;D;D;D;D;D;D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95;-1.95;-1.95;-1.95;-1.95;-1.95;-1.95	5.48	3.57	0.40892	.	0.703382	0.14395	N	0.322298	T	0.79028	0.4377	M	0.78637	2.42	0.09310	N	1	P;P;B;B	0.45902	0.797;0.868;0.07;0.07	B;B;B;B	0.43680	0.201;0.427;0.068;0.022	T	0.71823	-0.4476	10	0.62326	D	0.03	-12.3362	9.8198	0.40876	0.1575:0.6907:0.1518:0.0	.	46;65;125;46	B7Z1J8;B7Z914;B3KQV7;Q99808	.;.;.;S29A1_HUMAN	F	65;46;125;46;46;46;46;46;46;46;46	ENSP00000377427:S46F;ENSP00000319152:S125F;ENSP00000392668:S46F;ENSP00000360820:S46F;ENSP00000360805:S46F;ENSP00000360796:S46F;ENSP00000377424:S46F;ENSP00000360789:S46F;ENSP00000360778:S46F;ENSP00000360773:S46F	ENSP00000319152:S125F	S	+	2	0	SLC29A1	44305329	0.000000	0.05858	0.150000	0.22450	0.979000	0.70002	0.266000	0.18534	1.294000	0.44707	0.563000	0.77884	TCC		0.567	SLC29A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040721.1			Missense_Mutation
SLC5A1	6523	hgsc.bcm.edu	37	22	32495226	32495226	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr22:32495226C>G	ENST00000266088.4	+	12	1587	c.1337C>G	c.(1336-1338)tCa>tGa	p.S446*	SLC5A1_ENST00000543737.1_Nonsense_Mutation_p.S319*	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	446					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)	p.S446*(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	ATTGTGCAGTCAGCACAAAGT	0.483																																																1	Substitution - Nonsense(1)	ovary(1)	22											199.0	180.0	187.0					22																	32495226		2203	4300	6503	30825226	SO:0001587	stop_gained	6523				CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.1337C>G	22.37:g.32495226C>G	ENSP00000266088:p.Ser446*		30825226	B2R7E2|B7Z4Q9|B7ZA69	Nonsense_Mutation	SNP	ENST00000266088.4	37	CCDS13902.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	39	7.871404	0.98537	.	.	ENSG00000100170	ENST00000266088;ENST00000543737	.	.	.	5.29	5.29	0.74685	.	0.131977	0.53938	D	0.000053	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	17.9422	0.89028	0.0:1.0:0.0:0.0	.	.	.	.	X	446;319	.	ENSP00000266088:S446X	S	+	2	0	SLC5A1	30825226	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	3.792000	0.55476	2.474000	0.83562	0.557000	0.71058	TCA		0.483	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075656.3	NM_000343		Nonsense_Mutation
SLC7A10	56301	hgsc.bcm.edu	37	19	33702378	33702378	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr19:33702378A>G	ENST00000253188.4	-	6	1000	c.854T>C	c.(853-855)aTt>aCt	p.I285T		NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	285					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)	p.I285T(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					GAAGTAGGCAATGTTGGTGAA	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											167.0	111.0	130.0					19																	33702378		2203	4300	6503	38394218	SO:0001583	missense	56301			AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.854T>C	19.37:g.33702378A>G	ENSP00000253188:p.Ile285Thr		38394218	B2RE84	Missense_Mutation	SNP	ENST00000253188.4	37	CCDS12431.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	10.00	1.233355	0.22626	.	.	ENSG00000130876	ENST00000253188	D	0.91843	-2.92	5.51	4.5	0.54988	Amino acid permease domain (1);	0.211684	0.45867	D	0.000337	D	0.93426	0.7903	M	0.80746	2.51	0.80722	D	1	B	0.27656	0.184	B	0.41088	0.347	D	0.91793	0.5445	10	0.87932	D	0	.	10.5024	0.44813	0.9236:0.0:0.0764:0.0	.	285	Q9NS82	AAA1_HUMAN	T	285	ENSP00000253188:I285T	ENSP00000253188:I285T	I	-	2	0	SLC7A10	38394218	1.000000	0.71417	0.002000	0.10522	0.062000	0.15995	8.919000	0.92770	0.943000	0.37553	-0.326000	0.08463	ATT		0.627	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849		Missense_Mutation
SPHKAP	80309	hgsc.bcm.edu	37	2	228883302	228883302	+	Silent	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr2:228883302C>T	ENST00000392056.3	-	7	2314	c.2268G>A	c.(2266-2268)ccG>ccA	p.P756P	SPHKAP_ENST00000344657.5_Silent_p.P756P	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	756						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.P756P(1)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GACTAGCACCCGGATCAGATG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	2											155.0	154.0	154.0					2																	228883302		2203	4300	6503	228591546	SO:0001819	synonymous_variant	80309				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2268G>A	2.37:g.228883302C>T			228591546	Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	ENST00000392056.3	37	CCDS46537.1	SNP	23	Baylor																																																																																				0.488	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		Silent
SRP72	6731	hgsc.bcm.edu	37	4	57354131	57354131	+	Silent	SNP	A	A	C			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr4:57354131A>C	ENST00000342756.5	+	12	1897	c.1176A>C	c.(1174-1176)gcA>gcC	p.A392A	SRP72_ENST00000510663.1_Silent_p.A331A	NM_006947.3	NP_008878.3	O76094	SRP72_HUMAN	signal recognition particle 72kDa	392					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)	p.A392A(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(7)|ovary(2)	22	Glioma(25;0.08)|all_neural(26;0.101)					TTTCTAAAGCATGTCTAATAT	0.274																																																1	Substitution - coding silent(1)	ovary(1)	4											52.0	54.0	54.0					4																	57354131		2198	4283	6481	57048888	SO:0001819	synonymous_variant	6731			AF069765	CCDS3506.1, CCDS58898.1	4q11	2013-01-10	2002-08-29		ENSG00000174780	ENSG00000174780		"""Tetratricopeptide (TTC) repeat domain containing"""	11303	protein-coding gene	gene with protein product		602122	"""signal recognition particle 72kD"""			9224693, 9857079	Standard	NM_006947		Approved		uc003hbv.3	O76094	OTTHUMG00000128843	ENST00000342756.5:c.1176A>C	4.37:g.57354131A>C			57048888	G5E9Z8|Q7Z3C0	Silent	SNP	ENST00000342756.5	37	CCDS3506.1	SNP	8	Baylor																																																																																				0.274	SRP72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250782.7			Silent
STAB2	55576	hgsc.bcm.edu	37	12	104152993	104152993	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr12:104152993T>G	ENST00000388887.2	+	65	7394	c.7190T>G	c.(7189-7191)cTg>cGg	p.L2397R	RP11-341G23.4_ENST00000551299.1_RNA	NM_017564.9	NP_060034.9			stabilin 2									p.L2397R(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GGCACCACCCTGCAAACGAGG	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											132.0	109.0	117.0					12																	104152993		2203	4300	6503	102677123	SO:0001583	missense	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.7190T>G	12.37:g.104152993T>G	ENSP00000373539:p.Leu2397Arg		102677123		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.78	2.935183	0.52866	.	.	ENSG00000136011	ENST00000388887	D	0.92249	-3.0	4.77	4.77	0.60923	FAS1 domain (4);	0.481250	0.19740	N	0.107144	D	0.95598	0.8569	M	0.84846	2.72	0.27385	N	0.955307	P	0.51147	0.942	P	0.60012	0.867	D	0.91148	0.4951	10	0.87932	D	0	.	13.4377	0.61094	0.0:0.0:0.0:1.0	.	2397	Q8WWQ8	STAB2_HUMAN	R	2397	ENSP00000373539:L2397R	ENSP00000373539:L2397R	L	+	2	0	STAB2	102677123	0.923000	0.31300	0.145000	0.22337	0.139000	0.21198	6.611000	0.74183	1.897000	0.54924	0.533000	0.62120	CTG		0.532	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			Missense_Mutation
TBCCD1	55171	hgsc.bcm.edu	37	3	186276355	186276355	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:186276355C>A	ENST00000424280.1	-	3	822	c.343G>T	c.(343-345)Gtg>Ttg	p.V115L	TBCCD1_ENST00000446782.1_Missense_Mutation_p.V19L|TBCCD1_ENST00000338733.5_Missense_Mutation_p.V115L	NM_001134415.1	NP_001127887.1	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	115					cell morphogenesis (GO:0000902)|cytoskeleton organization (GO:0007010)|maintenance of centrosome location (GO:0051661)|maintenance of Golgi location (GO:0051684)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|spindle pole centrosome (GO:0031616)		p.V115L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|skin(1)	17	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		AGCGTGTCCACTGAAAGCTGT	0.393																																																1	Substitution - Missense(1)	ovary(1)	3											71.0	68.0	69.0					3																	186276355		2203	4300	6503	187759049	SO:0001583	missense	55171			BC025748	CCDS3276.1, CCDS75061.1	3q27.3	2006-03-09			ENSG00000113838	ENSG00000113838			25546	protein-coding gene	gene with protein product						12477932	Standard	NM_001134415		Approved	FLJ10560	uc003fqg.3	Q9NVR7	OTTHUMG00000156613	ENST00000424280.1:c.343G>T	3.37:g.186276355C>A	ENSP00000411253:p.Val115Leu		187759049	B3KW69|D3DNU6|G5E9J4	Missense_Mutation	SNP	ENST00000424280.1	37	CCDS3276.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	33	5.241415	0.95272	.	.	ENSG00000113838	ENST00000424280;ENST00000338733;ENST00000446782;ENST00000413695	T;T;D;T	0.89050	0.99;0.99;-2.46;0.99	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.93455	0.7912	M	0.77103	2.36	0.58432	D	0.999999	D;P	0.61697	0.99;0.929	P;P	0.60173	0.87;0.714	D	0.93326	0.6697	10	0.51188	T	0.08	-13.6493	17.0549	0.86531	0.0:1.0:0.0:0.0	.	19;115	G5E9J4;Q9NVR7	.;TBCC1_HUMAN	L	115;115;19;115	ENSP00000411253:V115L;ENSP00000341652:V115L;ENSP00000397091:V19L;ENSP00000391109:V115L	ENSP00000341652:V115L	V	-	1	0	TBCCD1	187759049	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.660000	0.68018	2.689000	0.91719	0.655000	0.94253	GTG		0.393	TBCCD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344774.1	NM_018138		Missense_Mutation
THADA	63892	hgsc.bcm.edu	37	2	43804363	43804363	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr2:43804363G>A	ENST00000405006.4	-	10	1186	c.835C>T	c.(835-837)Cgt>Tgt	p.R279C	THADA_ENST00000404790.1_Missense_Mutation_p.R279C|THADA_ENST00000415080.2_5'UTR|THADA_ENST00000330266.7_5'Flank|THADA_ENST00000405975.2_Missense_Mutation_p.R279C|THADA_ENST00000403856.1_Missense_Mutation_p.R279C|THADA_ENST00000402360.2_Missense_Mutation_p.R279C	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	279								p.R279C(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TCCACTGAACGAAGCAGCACA	0.433											OREG0014580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	2											23.0	24.0	24.0					2																	43804363		1956	4149	6105	43657867	SO:0001583	missense	63892			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.835C>T	2.37:g.43804363G>A	ENSP00000385995:p.Arg279Cys	919	43657867	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	37	CCDS46268.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.091	1.001823	0.19121	.	.	ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000405006;ENST00000402360;ENST00000404790;ENST00000403856	T;T;T;T;T	0.31510	2.94;2.94;1.53;1.52;1.49	5.28	2.41	0.29592	.	0.819220	0.11135	N	0.595896	T	0.20901	0.0503	L	0.28274	0.84	0.18873	N	0.999986	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.06405	0.002;0.001;0.001;0.0	T	0.23013	-1.0200	10	0.37606	T	0.19	0.1858	8.1433	0.31097	0.1527:0.4762:0.3711:0.0	.	279;279;279;279	B5MC89;Q8IY32;Q6YHU6-5;Q6YHU6	.;.;.;THADA_HUMAN	C	279	ENSP00000386088:R279C;ENSP00000385995:R279C;ENSP00000385441:R279C;ENSP00000384266:R279C;ENSP00000385469:R279C	ENSP00000349464:R279C	R	-	1	0	THADA	43657867	0.000000	0.05858	0.002000	0.10522	0.136000	0.21042	0.542000	0.23222	0.197000	0.20387	0.561000	0.74099	CGT		0.433	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065		Missense_Mutation
THADA	63892	hgsc.bcm.edu	37	2	43804366	43804366	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr2:43804366G>A	ENST00000405006.4	-	10	1183	c.832C>T	c.(832-834)Ctt>Ttt	p.L278F	THADA_ENST00000404790.1_Missense_Mutation_p.L278F|THADA_ENST00000415080.2_5'UTR|THADA_ENST00000330266.7_5'Flank|THADA_ENST00000405975.2_Missense_Mutation_p.L278F|THADA_ENST00000403856.1_Missense_Mutation_p.L278F|THADA_ENST00000402360.2_Missense_Mutation_p.L278F	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	278								p.L278F(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				ACTGAACGAAGCAGCACACTG	0.428											OREG0014580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	2											23.0	24.0	24.0					2																	43804366		1952	4148	6100	43657870	SO:0001583	missense	63892			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.832C>T	2.37:g.43804366G>A	ENSP00000385995:p.Leu278Phe	919	43657870	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	37	CCDS46268.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214064	0.58452	.	.	ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000405006;ENST00000402360;ENST00000404790;ENST00000403856	T;T;T;T;T	0.34072	2.85;2.85;1.43;1.42;1.38	5.28	5.28	0.74379	.	0.507866	0.19950	N	0.102460	T	0.54159	0.1841	M	0.69823	2.125	0.52501	D	0.999953	D;D;D;D	0.89917	0.999;1.0;0.989;0.999	D;D;P;D	0.74348	0.983;0.97;0.843;0.933	T	0.47535	-0.9110	10	0.15066	T	0.55	-0.0021	11.9373	0.52880	0.1255:0.0:0.8745:0.0	.	278;278;278;278	B5MC89;Q8IY32;Q6YHU6-5;Q6YHU6	.;.;.;THADA_HUMAN	F	278	ENSP00000386088:L278F;ENSP00000385995:L278F;ENSP00000385441:L278F;ENSP00000384266:L278F;ENSP00000385469:L278F	ENSP00000349464:L278F	L	-	1	0	THADA	43657870	0.971000	0.33674	0.046000	0.18839	0.121000	0.20230	5.445000	0.66594	2.464000	0.83262	0.561000	0.74099	CTT		0.428	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065		Missense_Mutation
NDC1	55706	hgsc.bcm.edu	37	1	54262676	54262676	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr1:54262676A>T	ENST00000371429.3	-	12	1962	c.1364T>A	c.(1363-1365)gTa>gAa	p.V455E	NDC1_ENST00000540001.1_Missense_Mutation_p.V455E|NDC1_ENST00000234725.8_Missense_Mutation_p.V340E|NDC1_ENST00000537333.1_Missense_Mutation_p.V120E	NM_001168551.1|NM_018087.4	NP_001162023.1|NP_060557.3	Q9BTX1	NDC1_HUMAN	NDC1 transmembrane nucleoporin	455					mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore distribution (GO:0031081)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.V455E(1)									CCGATTCATTACACTAGAGCC	0.448																																																1	Substitution - Missense(1)	ovary(1)	1											82.0	80.0	81.0					1																	54262676		2203	4300	6503	54035264	SO:0001583	missense	55706			AL354613	CCDS583.1	1p32.3	2014-01-28	2013-05-23	2013-05-23	ENSG00000058804	ENSG00000058804			25525	protein-coding gene	gene with protein product	"""nuclear division cycle 1 homolog (S. cerevisiae)"""	610115	"""transmembrane protein 48"""	TMEM48		16779818, 12958361	Standard	NR_033142		Approved	FLJ10407, NET3		Q9BTX1	OTTHUMG00000008073	ENST00000371429.3:c.1364T>A	1.37:g.54262676A>T	ENSP00000360483:p.Val455Glu		54035264	B4DHA3|B4DQQ5|G3XA81|Q8NB76|Q9H9T6|Q9NSG3|Q9NSG4|Q9NVZ7	Missense_Mutation	SNP	ENST00000371429.3	37	CCDS583.1	SNP	14	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.44	2.834248	0.50951	.	.	ENSG00000058804	ENST00000371429;ENST00000540001;ENST00000537333;ENST00000234725	T;T;T	0.53640	0.86;0.61;0.88	5.47	5.47	0.80525	.	0.430610	0.27084	N	0.021016	T	0.26412	0.0645	N	0.08118	0	0.09310	N	1	P;P	0.39920	0.695;0.695	B;P	0.45794	0.392;0.493	T	0.40478	-0.9561	10	0.02654	T	1	.	5.7707	0.18251	0.7458:0.1711:0.0831:0.0	.	415;455	B4DHA3;Q9BTX1	.;NDC1_HUMAN	E	455;455;120;340	ENSP00000360483:V455E;ENSP00000440873:V455E;ENSP00000234725:V340E	ENSP00000234725:V340E	V	-	2	0	TMEM48	54035264	0.985000	0.35326	0.165000	0.22776	0.924000	0.55760	2.664000	0.46783	2.313000	0.78055	0.454000	0.30748	GTA		0.448	NDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022101.1	NM_018087		Missense_Mutation
TMPRSS3	64699	hgsc.bcm.edu	37	21	43803308	43803308	+	Splice_Site	SNP	C	C	A	rs56283966	byFrequency	TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr21:43803308C>A	ENST00000291532.3	-	8	1572		c.e8-1		TMPRSS3_ENST00000380399.1_Splice_Site|TMPRSS3_ENST00000474596.1_Splice_Site|TMPRSS3_ENST00000398405.1_Splice_Site|TMPRSS3_ENST00000398397.3_Splice_Site|TMPRSS3_ENST00000433957.2_Splice_Site	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3						cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)	p.?(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						TGACCACAGGCTATGGAGGGG	0.597																																																2	Unknown(2)	ovary(2)	21											79.0	63.0	68.0					21																	43803308		2203	4300	6503	42676377	SO:0001630	splice_region_variant	64699			AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.617-1G>T	21.37:g.43803308C>A			42676377	D3DSJ6|Q5USC7|Q6ZMC3	Splice_Site_SNP	SNP	ENST00000291532.3	37	CCDS13686.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.95	1.494444	0.26774	.	.	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399;ENST00000398397	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2366	0.89951	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMPRSS3	42676377	1.000000	0.71417	0.934000	0.37439	0.068000	0.16541	4.686000	0.61700	2.363000	0.80096	0.591000	0.81541	.		0.597	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1		Intron	Splice_Site_SNP
TOM1	10043	hgsc.bcm.edu	37	22	35730380	35730380	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr22:35730380G>A	ENST00000449058.2	+	11	1212	c.1087G>A	c.(1087-1089)Gaa>Aaa	p.E363K	TOM1_ENST00000436462.2_Missense_Mutation_p.E325K|TOM1_ENST00000425375.1_Missense_Mutation_p.E318K|MIR3909_ENST00000579518.1_RNA|TOM1_ENST00000447733.1_Missense_Mutation_p.E330K|TOM1_ENST00000411850.1_Missense_Mutation_p.E363K|TOM1_ENST00000382034.5_3'UTR	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	363					endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)	p.E363K(1)		NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						TGGTCGACTGGAAGATGAGTT	0.607																																																1	Substitution - Missense(1)	ovary(1)	22											90.0	86.0	87.0					22																	35730380		2203	4300	6503	34060380	SO:0001583	missense	10043			AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.1087G>A	22.37:g.35730380G>A	ENSP00000394466:p.Glu363Lys		34060380	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	ENST00000449058.2	37	CCDS13913.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.66	2.602626	0.46423	.	.	ENSG00000100284	ENST00000447733;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000412456;ENST00000451197;ENST00000436462	T;T;T;T;T	0.22945	1.94;1.95;1.94;1.93;1.93	4.99	4.99	0.66335	.	0.055128	0.64402	D	0.000001	T	0.34716	0.0907	L	0.50333	1.59	0.80722	D	1	B;D;B;D;P	0.64830	0.42;0.994;0.017;0.99;0.848	B;P;B;P;B	0.55923	0.061;0.787;0.015;0.779;0.437	T	0.04386	-1.0955	10	0.12103	T	0.63	-18.0829	13.9594	0.64170	0.0:0.1519:0.8481:0.0	.	318;325;372;363;363	O60784-3;E7EPD0;B4DKQ5;O60784-2;O60784	.;.;.;.;TOM1_HUMAN	K	330;363;363;318;100;372;325	ENSP00000398876:E330K;ENSP00000394466:E363K;ENSP00000413697:E363K;ENSP00000394924:E318K;ENSP00000402556:E325K	ENSP00000413697:E363K	E	+	1	0	TOM1	34060380	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.580000	0.74040	2.306000	0.77630	0.561000	0.74099	GAA		0.607	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578530	7578530	+	Missense_Mutation	SNP	A	A	C	rs267605077		TCGA-13-0906-01	TCGA-13-0906-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr17:7578530A>C	ENST00000269305.4	-	5	589	c.400T>G	c.(400-402)Ttt>Gtt	p.F134V	TP53_ENST00000445888.2_Missense_Mutation_p.F134V|TP53_ENST00000359597.4_Missense_Mutation_p.F134V|TP53_ENST00000420246.2_Missense_Mutation_p.F134V|TP53_ENST00000413465.2_Missense_Mutation_p.F134V|TP53_ENST00000455263.2_Missense_Mutation_p.F134V|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	134	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F134L(16)|p.F134V(12)|p.0?(8)|p.C135fs*35(5)|p.M133fs*36(3)|p.N131fs*27(2)|p.V73fs*9(1)|p.F2V(1)|p.F41V(1)|p.S127fs*36(1)|p.?(1)|p.Y126fs*11(1)|p.F134fs*39(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.C135T(1)|p.F41L(1)|p.F2L(1)|p.M133fs*13(1)|p.M40fs*36(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGTTGGCAAAACATCTTGTTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	60	Substitution - Missense(33)|Deletion - Frameshift(15)|Whole gene deletion(8)|Deletion - In frame(2)|Insertion - Frameshift(1)|Unknown(1)	breast(13)|haematopoietic_and_lymphoid_tissue(7)|ovary(6)|kidney(5)|large_intestine(4)|central_nervous_system(4)|lung(4)|oesophagus(4)|bone(4)|upper_aerodigestive_tract(2)|stomach(2)|urinary_tract(2)|pancreas(2)|vulva(1)	17											48.0	49.0	49.0					17																	7578530		2203	4300	6503	7519255	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.400T>G	17.37:g.7578530A>C	ENSP00000269305:p.Phe134Val		7519255	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	27.3	4.815196	0.90790	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99841	-7.09;-7.09;-7.09;-7.09;-7.09;-7.09;-7.09;-7.09;-7.09	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.054280	0.64402	D	0.000001	D	0.99825	0.9922	M	0.88906	2.99	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;0.999;0.998;0.965;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.989;0.996;0.99;0.91;0.999;0.999;0.996	D	0.96722	0.9533	10	0.87932	D	0	-24.5315	13.8301	0.63375	1.0:0.0:0.0:0.0	.	95;134;134;41;134;134;134	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	V	134;134;134;134;134;134;123;41;2;41;2;134	ENSP00000410739:F134V;ENSP00000352610:F134V;ENSP00000269305:F134V;ENSP00000398846:F134V;ENSP00000391127:F134V;ENSP00000391478:F134V;ENSP00000425104:F2V;ENSP00000423862:F41V;ENSP00000424104:F134V	ENSP00000269305:F134V	F	-	1	0	TP53	7519255	1.000000	0.71417	0.999000	0.59377	0.804000	0.45430	9.283000	0.95860	2.206000	0.71126	0.533000	0.62120	TTT		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TPO	7173	hgsc.bcm.edu	37	2	1507747	1507747	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr2:1507747A>T	ENST00000345913.4	+	14	2505	c.2414A>T	c.(2413-2415)cAc>cTc	p.H805L	TPO_ENST00000382198.1_Missense_Mutation_p.H632L|TPO_ENST00000349624.3_Missense_Mutation_p.H632L|TPO_ENST00000346956.3_Intron|TPO_ENST00000329066.4_Missense_Mutation_p.H805L|TPO_ENST00000382201.3_Missense_Mutation_p.H748L|TPO_ENST00000497517.2_3'UTR|TPO_ENST00000337415.3_Missense_Mutation_p.H805L	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	805	EGF-like; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.H805L(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GACGGTGCCCACCCCCCCTGC	0.642																																																1	Substitution - Missense(1)	ovary(1)	2											66.0	63.0	64.0					2																	1507747		2203	4300	6503	1486754	SO:0001583	missense	7173				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2414A>T	2.37:g.1507747A>T	ENSP00000318820:p.His805Leu		1486754	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	SNP	6	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.010|0.010	-1.748311|-1.748311	0.00669|0.00669	.|.	.|.	ENSG00000115705|ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000425083|ENST00000446278	T;T;T;T;T;T;T|.	0.69806|.	-0.23;-0.24;-0.01;-0.24;-0.18;-0.01;-0.43|.	4.53|4.53	0.757|0.757	0.18427|0.18427	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);|.	8.100430|.	0.00424|.	N|.	0.000068|.	T|T	0.09468|0.09468	0.0233|0.0233	N|N	0.01482|0.01482	-0.84|-0.84	0.09310|0.09310	N|N	1|1	B;B;B|.	0.06786|.	0.001;0.0;0.001|.	B;B;B|.	0.08055|.	0.003;0.0;0.001|.	T|T	0.35251|0.35251	-0.9796|-0.9796	10|5	0.37606|.	T|.	0.19|.	-9.7089|-9.7089	8.0354|8.0354	0.30488|0.30488	0.7505:0.0:0.2495:0.0|0.7505:0.0:0.2495:0.0	.|.	632;748;805|.	P07202-5;P07202-2;P07202|.	.;.;PERT_HUMAN|.	L|S	805;805;632;805;748;632;26|280	ENSP00000337263:H805L;ENSP00000318820:H805L;ENSP00000332044:H632L;ENSP00000329869:H805L;ENSP00000371636:H748L;ENSP00000371633:H632L;ENSP00000389659:H26L|.	ENSP00000329869:H805L|.	H|T	+|+	2|1	0|0	TPO|TPO	1486754|1486754	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.016000|0.016000	0.09150|0.09150	0.901000|0.901000	0.28445|0.28445	-0.102000|-0.102000	0.12197|0.12197	0.372000|0.372000	0.22366|0.22366	CAC|ACC		0.642	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547		Missense_Mutation
TRIM42	287015	hgsc.bcm.edu	37	3	140406783	140406783	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr3:140406783T>C	ENST00000286349.3	+	3	1450	c.1259T>C	c.(1258-1260)gTg>gCg	p.V420A		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	420						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.V420A(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACCATGAAAGTGAACGAGATG	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											95.0	90.0	91.0					3																	140406783		2203	4300	6503	141889473	SO:0001583	missense	287015			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1259T>C	3.37:g.140406783T>C	ENSP00000286349:p.Val420Ala		141889473	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	37	CCDS3113.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.16	1.854377	0.32791	.	.	ENSG00000155890	ENST00000286349	T	0.39056	1.1	5.33	5.33	0.75918	.	0.238378	0.29212	N	0.012808	T	0.27241	0.0668	N	0.14661	0.345	0.30224	N	0.796555	P	0.42409	0.779	B	0.38755	0.281	T	0.28202	-1.0051	10	0.66056	D	0.02	-28.4811	11.987	0.53153	0.0:0.0:0.0:1.0	.	420	Q8IWZ5	TRI42_HUMAN	A	420	ENSP00000286349:V420A	ENSP00000286349:V420A	V	+	2	0	TRIM42	141889473	0.966000	0.33281	0.926000	0.36857	0.297000	0.27493	4.936000	0.63506	2.162000	0.67917	0.454000	0.30748	GTG		0.473	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616		Missense_Mutation
TRIP12	9320	hgsc.bcm.edu	37	2	230723854	230723854	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr2:230723854C>T	ENST00000283943.5	-	3	713	c.535G>A	c.(535-537)Gct>Act	p.A179T	TRIP12_ENST00000543084.1_Missense_Mutation_p.A221T|TRIP12_ENST00000389044.4_Missense_Mutation_p.A221T|TRIP12_ENST00000389045.3_Intron|TRIP12_ENST00000409677.1_Missense_Mutation_p.A221T	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	179					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.A179T(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GATTTTGAAGCCAGCTTGGTA	0.502																																																1	Substitution - Missense(1)	ovary(1)	2											58.0	54.0	55.0					2																	230723854		2203	4300	6503	230432098	SO:0001583	missense	9320			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.535G>A	2.37:g.230723854C>T	ENSP00000283943:p.Ala179Thr		230432098	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.8	4.866311	0.91511	.	.	ENSG00000153827	ENST00000283943;ENST00000389044;ENST00000543084;ENST00000409677;ENST00000453485	T;T	0.52295	0.68;0.67	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.56934	0.2019	N	0.24115	0.695	0.80722	D	1	D;D;D	0.63880	0.993;0.993;0.993	D;D;D	0.70935	0.971;0.971;0.971	T	0.54463	-0.8290	10	0.37606	T	0.19	.	19.8788	0.96888	0.0:1.0:0.0:0.0	.	179;221;179	D4HL82;Q14CA3;Q14669	.;.;TRIPC_HUMAN	T	179;221;221;221;49	ENSP00000283943:A179T;ENSP00000373696:A221T	ENSP00000283943:A179T	A	-	1	0	TRIP12	230432098	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.456000	0.80751	2.704000	0.92352	0.563000	0.77884	GCT		0.502	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238		Missense_Mutation
TYK2	7297	hgsc.bcm.edu	37	19	10476311	10476311	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr19:10476311A>T	ENST00000525621.1	-	7	1374	c.893T>A	c.(892-894)gTg>gAg	p.V298E	TYK2_ENST00000524462.1_Missense_Mutation_p.V113E|TYK2_ENST00000529370.1_Missense_Mutation_p.V298E|TYK2_ENST00000264818.6_Missense_Mutation_p.V298E	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	298	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.V298E(1)		breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TGTAGGGGCCACCCCACTGTC	0.697																																																1	Substitution - Missense(1)	ovary(1)	19											33.0	40.0	38.0					19																	10476311		2203	4298	6501	10337311	SO:0001583	missense	7297				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.893T>A	19.37:g.10476311A>T	ENSP00000431885:p.Val298Glu		10337311	Q6QB10|Q96CH0	Missense_Mutation	SNP	ENST00000525621.1	37	CCDS12236.1	SNP	6	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.705|7.705	0.693863|0.693863	0.15039|0.15039	.|.	.|.	ENSG00000105397|ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000543792;ENST00000529370|ENST00000525220	T;T;T;T|.	0.80566|.	-0.88;-0.86;-0.86;-1.39|.	4.43|4.43	-0.301|-0.301	0.12800|0.12800	FERM domain (1);|.	0.944567|.	0.08753|.	N|.	0.898770|.	T|T	0.07728|0.07728	0.0194|0.0194	N|N	0.01168|0.01168	-0.975|-0.975	0.09310|0.09310	N|N	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.001;0.0|.	T|T	0.30909|0.30909	-0.9962|-0.9962	10|5	0.02654|.	T|.	1|.	-5.1324|-5.1324	1.2252|1.2252	0.01932|0.01932	0.29:0.0877:0.2925:0.3298|0.29:0.0877:0.2925:0.3298	.|.	298;298|.	E9PPF2;P29597|.	.;TYK2_HUMAN|.	E|R	113;298;298;45;298|77	ENSP00000433203:V113E;ENSP00000431885:V298E;ENSP00000264818:V298E;ENSP00000432728:V298E|.	ENSP00000264818:V298E|.	V|W	-|-	2|1	0|0	TYK2|TYK2	10337311|10337311	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.009000|0.009000	0.06853|0.06853	-0.659000|-0.659000	0.05323|0.05323	-0.362000|-0.362000	0.08113|0.08113	-0.390000|-0.390000	0.06520|0.06520	GTG|TGG		0.697	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1			Missense_Mutation
UBQLN3	50613	hgsc.bcm.edu	37	11	5529137	5529137	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr11:5529137C>T	ENST00000311659.4	-	2	1799	c.1652G>A	c.(1651-1653)gGg>gAg	p.G551E	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_5'Flank|HBE1_ENST00000380237.1_5'Flank|AC104389.28_ENST00000415970.1_RNA	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	551										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTACCCGTCCCTGCTAGGCA	0.577																																					Ovarian(72;684 1260 12332 41642 52180)											0			11											54.0	49.0	50.0					11																	5529137		2201	4297	6498	5485713	SO:0001583	missense	50613			AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1652G>A	11.37:g.5529137C>T	ENSP00000347997:p.Gly551Glu		5485713	Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	CCDS7758.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.057	0.008249	0.07912	.	.	ENSG00000175520	ENST00000311659	T	0.40225	1.04	4.89	3.02	0.34903	.	0.165915	0.29212	N	0.012820	T	0.42607	0.1210	M	0.83312	2.635	0.09310	N	1	B	0.23058	0.079	B	0.18263	0.021	T	0.47611	-0.9104	10	0.72032	D	0.01	-35.3466	6.8599	0.24062	0.0:0.7977:0.0:0.2023	.	551	Q9H347	UBQL3_HUMAN	E	551	ENSP00000347997:G551E	ENSP00000347997:G551E	G	-	2	0	UBQLN3	5485713	0.000000	0.05858	0.024000	0.17045	0.219000	0.24729	0.353000	0.20130	1.434000	0.47414	0.561000	0.74099	GGG		0.577	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481		Missense_Mutation
USO1	8615	hgsc.bcm.edu	37	4	76708345	76708345	+	Missense_Mutation	SNP	T	T	C	rs200526658		TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr4:76708345T>C	ENST00000538159.1	+	10	992	c.992T>C	c.(991-993)aTc>aCc	p.I331T	USO1_ENST00000514213.2_Missense_Mutation_p.I314T			O60763	USO1_HUMAN	USO1 vesicle transport factor	329	Globular head.				ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.I257T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CCTGCTGATATCCTGACTGAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	4						T	THR/ILE	2,3702		0,2,1850	151.0	146.0	147.0		863	5.8	1.0	4		147	3,8215		0,3,4106	yes	missense	USO1	NM_003715.2	89	0,5,5956	CC,CT,TT		0.0365,0.054,0.0419	possibly-damaging	288/922	76708345	5,11917	1852	4109	5961	76927369	SO:0001583	missense	8615			AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.992T>C	4.37:g.76708345T>C	ENSP00000440586:p.Ile331Thr		76927369	B2RAQ0|Q6PK63|Q86TB8|Q8N592	Missense_Mutation	SNP	ENST00000538159.1	37		SNP	50	Baylor	.	.	.	.	.	.	.	.	.	.	T	25.3	4.628905	0.87560	5.4E-4	3.65E-4	ENSG00000138768	ENST00000508939;ENST00000538159;ENST00000514213;ENST00000264904	T;T	0.66995	-0.24;-0.24	5.8	5.8	0.92144	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84023	0.5381	M	0.87758	2.905	0.80722	D	1	D;P	0.61697	0.99;0.954	P;D	0.74674	0.907;0.984	D	0.86936	0.2076	10	0.87932	D	0	.	16.1467	0.81577	0.0:0.0:0.0:1.0	.	331;329	F5GYR8;O60763	.;USO1_HUMAN	T	164;331;314;257	ENSP00000440586:I331T;ENSP00000444850:I314T	ENSP00000264904:I257T	I	+	2	0	USO1	76927369	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	7.401000	0.79962	2.212000	0.71576	0.533000	0.62120	ATC		0.438	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003715		Missense_Mutation
USP49	25862	hgsc.bcm.edu	37	6	41773380	41773380	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0906-01	TCGA-13-0906-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr6:41773380G>T	ENST00000394253.3	-	3	1671	c.1342C>A	c.(1342-1344)Cag>Aag	p.Q448K	USP49_ENST00000373009.3_Missense_Mutation_p.Q448K|USP49_ENST00000373010.1_Missense_Mutation_p.Q448K|USP49_ENST00000297229.2_Missense_Mutation_p.Q448K|USP49_ENST00000373006.1_Missense_Mutation_p.Q448K			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49	448	USP.				histone H2B conserved C-terminal lysine deubiquitination (GO:0035616)|mRNA splicing, via spliceosome (GO:0000398)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.Q448K(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CTGAGCAGCTGCCCATGAAAT	0.522																																																1	Substitution - Missense(1)	ovary(1)	6											91.0	81.0	85.0					6																	41773380		2203	4300	6503	41881358	SO:0001583	missense	25862			AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663		"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""			14715245	Standard	NM_018561		Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.1342C>A	6.37:g.41773380G>T	ENSP00000377797:p.Gln448Lys		41881358	Q5T3D9|Q5T3E0|Q96CK4	Missense_Mutation	SNP	ENST00000394253.3	37		SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.59	2.284042	0.40394	.	.	ENSG00000164663	ENST00000394253;ENST00000373010;ENST00000373009;ENST00000373006;ENST00000297229	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.38374	0.1038	L	0.38649	1.16	0.80722	D	1	D	0.71674	0.998	D	0.87578	0.998	T	0.05500	-1.0881	10	0.36615	T	0.2	-15.2408	18.9158	0.92505	0.0:0.0:1.0:0.0	.	448	Q70CQ1-2	.	K	448	ENSP00000377797:Q448K;ENSP00000362101:Q448K;ENSP00000362100:Q448K;ENSP00000362097:Q448K;ENSP00000297229:Q448K	ENSP00000297229:Q448K	Q	-	1	0	USP49	41881358	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.572000	0.86782	0.655000	0.94253	CAG		0.522	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000316513.3	NM_018561		Missense_Mutation
USP54	159195	hgsc.bcm.edu	37	10	75277306	75277306	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr10:75277306C>T	ENST00000339859.4	-	19	2978	c.2878G>A	c.(2878-2880)Gaa>Aaa	p.E960K	USP54_ENST00000408019.1_Missense_Mutation_p.E960K|RP11-137L10.6_ENST00000597958.1_RNA|RP11-137L10.6_ENST00000600206.1_RNA|USP54_ENST00000497106.1_5'UTR|RP11-137L10.6_ENST00000593790.1_RNA|USP54_ENST00000422491.2_Missense_Mutation_p.E142K|USP54_ENST00000394811.2_Missense_Mutation_p.E48K|RP11-137L10.6_ENST00000595069.1_RNA|USP54_ENST00000428547.1_Missense_Mutation_p.E810K			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	960					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)	p.E48K(1)|p.E960K(1)		breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					TTGTCTACTTCAACCGAAGTC	0.498																																					Colon(195;880 2046 8854 25025 38456)											2	Substitution - Missense(2)	ovary(2)	10											99.0	86.0	90.0					10																	75277306		2203	4300	6503	74947312	SO:0001583	missense	159195			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.2878G>A	10.37:g.75277306C>T	ENSP00000345216:p.Glu960Lys		74947312	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	ENST00000339859.4	37	CCDS7329.2	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.60	1.986492	0.35036	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547;ENST00000394811;ENST00000422491	T;T;T;T;T	0.27402	1.91;1.91;1.91;1.67;1.88	6.03	4.95	0.65309	.	.	.	.	.	T	0.33847	0.0877	L	0.54323	1.7	0.80722	D	1	P;P	0.46142	0.873;0.651	P;B	0.44811	0.461;0.058	T	0.04140	-1.0974	9	0.49607	T	0.09	-10.427	12.5304	0.56111	0.0:0.86:0.0:0.14	.	142;960	E7EW90;Q70EL1	.;UBP54_HUMAN	K	960;960;810;48;142	ENSP00000345216:E960K;ENSP00000386080:E960K;ENSP00000408714:E810K;ENSP00000378290:E48K;ENSP00000407368:E142K	ENSP00000345216:E960K	E	-	1	0	USP54	74947312	1.000000	0.71417	0.998000	0.56505	0.239000	0.25481	2.801000	0.47908	2.861000	0.98227	0.655000	0.94253	GAA		0.498	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586		Missense_Mutation
ZEB2	9839	hgsc.bcm.edu	37	2	145156418	145156418	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0906-01	TCGA-13-0906-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr2:145156418C>T	ENST00000558170.2	-	8	3520	c.2336G>A	c.(2335-2337)aGg>aAg	p.R779K	ZEB2_ENST00000303660.4_Missense_Mutation_p.R779K|ZEB2_ENST00000539609.3_Missense_Mutation_p.R755K|ZEB2_ENST00000409487.3_Missense_Mutation_p.R779K	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	779					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.R779K(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		AGTATTACTCCTGGAGTGGTC	0.418																																					Melanoma(33;1235 1264 5755 16332)											1	Substitution - Missense(1)	ovary(1)	2											149.0	157.0	154.0					2																	145156418		2203	4299	6502	144872888	SO:0001583	missense	9839			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.2336G>A	2.37:g.145156418C>T	ENSP00000454157:p.Arg779Lys		144872888	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226014	0.79576	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.14893	2.49;2.47;2.47	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.42607	0.1210	M	0.71581	2.175	0.80722	D	1	D;P;P;P	0.76494	0.999;0.956;0.956;0.956	D;D;D;D	0.79784	0.993;0.931;0.931;0.931	T	0.05225	-1.0898	10	0.27785	T	0.31	-10.4813	19.5998	0.95557	0.0:1.0:0.0:0.0	.	755;644;778;779	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	K	755;779;779	ENSP00000443792:R755K;ENSP00000302501:R779K;ENSP00000386854:R779K	ENSP00000302501:R779K	R	-	2	0	ZEB2	144872888	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	7.776000	0.85560	2.717000	0.92951	0.655000	0.94253	AGG		0.418	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795		Missense_Mutation
ZNF823	55552	hgsc.bcm.edu	37	19	11833208	11833208	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr19:11833208T>C	ENST00000341191.6	-	4	1294	c.1141A>G	c.(1141-1143)Aca>Gca	p.T381A	ZNF823_ENST00000545749.1_Missense_Mutation_p.T199A	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	381					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T381A(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						CCTGTGTGTGTTATCATGTGA	0.428										HNSCC(68;0.2)																																						1	Substitution - Missense(1)	ovary(1)	19											101.0	107.0	105.0					19																	11833208		2203	4300	6503	11694208	SO:0001583	missense	55552			X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.1141A>G	19.37:g.11833208T>C	ENSP00000340683:p.Thr381Ala		11694208	A0PJL4|B7Z8D4|Q6P4A9	Missense_Mutation	SNP	ENST00000341191.6	37	CCDS45981.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	N	12.62	1.993484	0.35131	.	.	ENSG00000197933	ENST00000545749;ENST00000341191;ENST00000431998	T;T;T	0.20332	2.08;2.08;2.08	0.632	0.632	0.17705	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14227	0.0344	L	0.33710	1.025	0.20563	N	0.999888	B	0.02656	0.0	B	0.04013	0.001	T	0.24835	-1.0149	9	0.52906	T	0.07	.	5.5571	0.17123	0.0:0.0:0.0:1.0	.	381	P16415	ZN823_HUMAN	A	199;381;337	ENSP00000440162:T199A;ENSP00000340683:T381A;ENSP00000410654:T337A	ENSP00000340683:T381A	T	-	1	0	ZNF823	11694208	0.000000	0.05858	0.004000	0.12327	0.954000	0.61252	0.383000	0.20651	0.519000	0.28406	0.248000	0.18094	ACA		0.428	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344516.2	NM_001080493		Missense_Mutation
ZNF573	126231	hgsc.bcm.edu	37	19	38230475	38230475	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0906-01	TCGA-13-0906-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr19:38230475T>C	ENST00000590414.2	-	4	937	c.916A>G	c.(916-918)Aaa>Gaa	p.K306E	ZNF573_ENST00000339503.4_Missense_Mutation_p.K248E|ZNF573_ENST00000536220.1_Missense_Mutation_p.K218E|ZNF573_ENST00000357309.3_Missense_Mutation_p.K218E|ZNF573_ENST00000392138.1_Missense_Mutation_p.K219E			Q86YE8	ZN573_HUMAN	zinc finger protein 573	306					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			TTTCCACATTTCTCACATATG	0.408																																																0			19											90.0	87.0	88.0					19																	38230475		2203	4299	6502	42922315	SO:0001583	missense	126231			AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000590414.2:c.916A>G	19.37:g.38230475T>C	ENSP00000465020:p.Lys306Glu		42922315	B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	Missense_Mutation	SNP	ENST00000590414.2	37	CCDS59381.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	4.015	0.000268	0.07819	.	.	ENSG00000189144	ENST00000392138;ENST00000536220;ENST00000357309;ENST00000339503;ENST00000427026	T;T;T;T	0.07444	3.19;3.19;3.19;3.19	2.4	-0.0258	0.13933	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01976	0.0062	N	0.01505	-0.83	0.20074	N	0.999936	B;B;B;B	0.12630	0.006;0.006;0.003;0.006	B;B;B;B	0.15484	0.007;0.013;0.006;0.013	T	0.48468	-0.9033	9	0.02654	T	1	.	2.6894	0.05116	0.0:0.393:0.2841:0.3229	.	219;248;286;218	Q86YE8-4;Q86YE8-3;Q86YE8;Q86YE8-2	.;.;ZN573_HUMAN;.	E	219;218;218;248;218	ENSP00000375983:K219E;ENSP00000440464:K218E;ENSP00000349861:K218E;ENSP00000340171:K248E	ENSP00000340171:K248E	K	-	1	0	ZNF573	42922315	0.000000	0.05858	0.890000	0.34922	0.691000	0.40173	-2.050000	0.01404	0.964000	0.38108	0.477000	0.44152	AAA		0.408	ZNF573-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459773.2	NM_152360		Missense_Mutation
ZNF546	339327	hgsc.bcm.edu	37	19	40513218	40513218	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr19:40513218C>G	ENST00000347077.4	+	5	425	c.209C>G	c.(208-210)tCc>tGc	p.S70C	ZNF546_ENST00000600094.1_Missense_Mutation_p.S44C|ZNF546_ENST00000596894.1_Intron	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	70	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S70C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					ATAGACCTCTCCCAAGAGGAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	19											114.0	102.0	106.0					19																	40513218		2203	4300	6503	45205058	SO:0001583	missense	339327			BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.209C>G	19.37:g.40513218C>G	ENSP00000339823:p.Ser70Cys		45205058	A8K913	Missense_Mutation	SNP	ENST00000347077.4	37	CCDS12548.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	c	10.66	1.413149	0.25465	.	.	ENSG00000187187	ENST00000347077	T	0.02944	4.1	2.53	1.41	0.22369	Krueppel-associated box (4);	.	.	.	.	T	0.10121	0.0248	H	0.96048	3.76	0.22240	N	0.999264	B;B	0.20459	0.045;0.045	B;B	0.24394	0.053;0.053	T	0.10154	-1.0642	9	0.87932	D	0	.	8.7563	0.34648	0.0:0.7639:0.2361:0.0	.	44;70	B3KVL3;Q86UE3	.;ZN546_HUMAN	C	70	ENSP00000339823:S70C	ENSP00000339823:S70C	S	+	2	0	ZNF546	45205058	0.141000	0.22595	0.489000	0.27452	0.968000	0.65278	1.850000	0.39328	0.341000	0.23771	0.551000	0.68910	TCC		0.428	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	NM_178544		Missense_Mutation
ZNF780B	163131	hgsc.bcm.edu	37	19	40541695	40541695	+	Silent	SNP	A	A	C			TCGA-13-0906-01	TCGA-13-0906-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr19:40541695A>C	ENST00000434248.1	-	5	1136	c.1071T>G	c.(1069-1071)ggT>ggG	p.G357G	ZNF780B_ENST00000221355.6_Silent_p.G209G	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	357					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G357G(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGGGCTTCTCACCCATATGAA	0.423																																																1	Substitution - coding silent(1)	ovary(1)	19											65.0	70.0	69.0					19																	40541695		2202	4300	6502	45233535	SO:0001819	synonymous_variant	163131			AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.1071T>G	19.37:g.40541695A>C			45233535	B9EH00	Silent	SNP	ENST00000434248.1	37	CCDS46077.1	SNP	6	Baylor																																																																																				0.423	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338466.1	NM_001005851		Silent
ZNF460	10794	hgsc.bcm.edu	37	19	57802492	57802492	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0906-01	TCGA-13-0906-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-0906-01	TCGA-13-0906-10	g.chr19:57802492C>A	ENST00000360338.3	+	3	905	c.583C>A	c.(583-585)Ccc>Acc	p.P195T	ZNF460_ENST00000537645.1_Missense_Mutation_p.P154T	NM_006635.3	NP_006626.3	Q14592	ZN460_HUMAN	zinc finger protein 460	195					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCGTGTGAAGCCCTATGATTG	0.448																																																0			19											84.0	82.0	82.0					19																	57802492		2203	4300	6503	62494304	SO:0001583	missense	10794			X78931	CCDS12949.1	19q13.4	2013-01-08				ENSG00000197714		"""Zinc fingers, C2H2-type"", ""-"""	21628	protein-coding gene	gene with protein product		604755	"""zinc finger protein 272"""	ZNF272		15004467	Standard	NM_006635		Approved	HZF8	uc002qog.2	Q14592		ENST00000360338.3:c.583C>A	19.37:g.57802492C>A	ENSP00000353491:p.Pro195Thr		62494304	A4FU64|B4DNX9|Q2VPC7|Q6VSF8	Missense_Mutation	SNP	ENST00000360338.3	37	CCDS12949.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.19	2.462336	0.43736	.	.	ENSG00000197714	ENST00000537645;ENST00000360338	T;T	0.20332	2.08;2.08	1.68	1.68	0.24146	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34483	0.0899	M	0.70595	2.14	0.27765	N	0.943707	D	0.59357	0.985	P	0.54346	0.749	T	0.13818	-1.0495	9	0.72032	D	0.01	.	9.3213	0.37966	0.0:1.0:0.0:0.0	.	195	Q14592	ZN460_HUMAN	T	154;195	ENSP00000446167:P154T;ENSP00000353491:P195T	ENSP00000353491:P195T	P	+	1	0	ZNF460	62494304	0.027000	0.19231	0.025000	0.17156	0.658000	0.38924	1.227000	0.32576	1.227000	0.43598	0.650000	0.86243	CCC		0.448	ZNF460-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465727.1	NM_006635		Missense_Mutation
