#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CAMTA1	23261	broad.mit.edu	37	1	7792592	7792592	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr1:7792592A>C	ENST00000303635.7	+	12	3206	c.2999A>C	c.(2998-3000)aAa>aCa	p.K1000T	CAMTA1_ENST00000439411.2_Missense_Mutation_p.K1000T	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1000					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K1000T(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CAGCAGCACAAACAGGCGAGC	0.627			T	WWTR1	epitheliod hemangioendothelioma																																		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	1	Substitution - Missense(1)	ovary(1)	1											55.0	62.0	59.0					1																	7792592		2203	4299	6502	7715179	SO:0001583	missense	23261			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.2999A>C	1.37:g.7792592A>C	ENSP00000306522:p.Lys1000Thr		7715179	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	15.30	2.794020	0.50102	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738	T;T	0.42131	0.98;0.98	5.52	4.4	0.53042	.	0.291054	0.38111	N	0.001812	T	0.28134	0.0694	N	0.25647	0.755	0.35344	D	0.786765	P;P;B	0.40731	0.702;0.728;0.179	B;B;B	0.37650	0.255;0.095;0.052	T	0.29119	-1.0022	10	0.22109	T	0.4	-13.5629	11.3109	0.49364	0.9288:0.0:0.0712:0.0	.	1000;87;1000	Q9Y6Y1-2;B4DXR3;Q9Y6Y1	.;.;CMTA1_HUMAN	T	1000;1000;87	ENSP00000306522:K1000T;ENSP00000402561:K1000T	ENSP00000306522:K1000T	K	+	2	0	CAMTA1	7715179	1.000000	0.71417	0.860000	0.33809	0.929000	0.56500	7.073000	0.76784	0.936000	0.37367	-0.385000	0.06624	AAA		0.627	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215		Missense_Mutation
FMN2	56776	broad.mit.edu	37	1	240255583	240255583	+	Silent	SNP	C	C	G			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr1:240255583C>G	ENST00000319653.9	+	1	404	c.174C>G	c.(172-174)ggC>ggG	p.G58G		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	58					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G201G(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			gcggcggcggcggggAGTCGG	0.662																																																1	Substitution - coding silent(1)	ovary(1)	1											4.0	6.0	5.0					1																	240255583		2028	3989	6017	238322206	SO:0001819	synonymous_variant	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.174C>G	1.37:g.240255583C>G			238322206	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2	SNP	27	Broad																																																																																				0.662	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		Silent
ARL5B	221079	broad.mit.edu	37	10	18955515	18955515	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0911-01	TCGA-13-0911-10			A	G	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr10:18955515A>G	ENST00000377275.3	+	2	291	c.58A>G	c.(58-60)Att>Gtt	p.I20V		NM_178815.3	NP_848930.1	Q96KC2	ARL5B_HUMAN	ADP-ribosylation factor-like 5B	20					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)	p.I20V(1)		lung(1)|ovary(1)	2						ACACAAAGTAATTATAGTGGG	0.303																																																1	Substitution - Missense(1)	ovary(1)	10											158.0	155.0	156.0					10																	18955515		2203	4295	6498	18995521	SO:0001583	missense	221079			AF494061	CCDS7131.1	10p13	2014-05-09	2005-11-03	2005-11-03	ENSG00000165997	ENSG00000165997		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23052	protein-coding gene	gene with protein product		608909	"""ADP-ribosylation factor-like 8"""	ARL8		12853149	Standard	XM_005252400		Approved		uc001iqd.1	Q96KC2	OTTHUMG00000017765	ENST00000377275.3:c.58A>G	10.37:g.18955515A>G	ENSP00000366487:p.Ile20Val		18995521		Missense_Mutation	SNP	ENST00000377275.3	37	CCDS7131.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	15.76	2.929608	0.52759	.	.	ENSG00000165997	ENST00000377275	T	0.61980	0.06	5.57	5.57	0.84162	Small GTP-binding protein domain (1);	0.044478	0.85682	D	0.000000	T	0.46210	0.1381	N	0.05592	-0.015	0.80722	D	1	B	0.17667	0.023	B	0.23150	0.044	T	0.46062	-0.9218	10	0.87932	D	0	-16.5758	16.0108	0.80402	1.0:0.0:0.0:0.0	.	20	Q96KC2	ARL5B_HUMAN	V	20	ENSP00000366487:I20V	ENSP00000366487:I20V	I	+	1	0	ARL5B	18995521	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.905000	0.92613	2.242000	0.73789	0.482000	0.46254	ATT		0.303	ARL5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047078.1	NM_178815		Missense_Mutation
MS4A3	932	broad.mit.edu	37	11	59834458	59834458	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr11:59834458C>A	ENST00000278865.3	+	5	459	c.386C>A	c.(385-387)gCt>gAt	p.A129D	MS4A3_ENST00000395032.2_Missense_Mutation_p.A6D|MS4A3_ENST00000358152.2_Missense_Mutation_p.A83D|MS4A3_ENST00000534744.1_Missense_Mutation_p.A83D	NM_006138.4	NP_006129.4	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)	129						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.A129D(1)		endometrium(4)|kidney(2)|lung(9)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		all_epithelial(135;0.245)				ATTGCCAGTGCTACAATTGCA	0.368																																																1	Substitution - Missense(1)	ovary(1)	11											82.0	73.0	76.0					11																	59834458		2201	4295	6496	59591034	SO:0001583	missense	932			L35848	CCDS31567.1, CCDS31568.1, CCDS41651.1	11q12-q13.1	2008-03-25				ENSG00000149516			7317	protein-coding gene	gene with protein product		606498		CD20L		7524084	Standard	NM_006138		Approved	HTM4	uc001nom.3	Q96HJ5		ENST00000278865.3:c.386C>A	11.37:g.59834458C>A	ENSP00000278865:p.Ala129Asp		59591034	A8MTP8|Q8NHW2	Missense_Mutation	SNP	ENST00000278865.3	37	CCDS31567.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	14.12	2.439235	0.43326	.	.	ENSG00000149516	ENST00000395032;ENST00000358152;ENST00000278865;ENST00000534744	T;T;T;T	0.02812	4.15;4.15;4.15;4.15	4.21	4.21	0.49690	.	0.440036	0.23470	N	0.047834	T	0.13798	0.0334	M	0.84219	2.685	0.21719	N	0.999571	D;D	0.69078	0.996;0.997	D;D	0.64877	0.93;0.924	T	0.01570	-1.1322	10	0.66056	D	0.02	-2.7717	11.8993	0.52673	0.0:1.0:0.0:0.0	.	83;129	Q96HJ5-2;Q96HJ5	.;MS4A3_HUMAN	D	6;83;129;83	ENSP00000378473:A6D;ENSP00000350872:A83D;ENSP00000278865:A129D;ENSP00000434117:A83D	ENSP00000278865:A129D	A	+	2	0	MS4A3	59591034	0.005000	0.15991	0.040000	0.18447	0.425000	0.31504	1.663000	0.37429	2.154000	0.67381	0.471000	0.43371	GCT		0.368	MS4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394417.1			Missense_Mutation
RPS6KB2	6199	broad.mit.edu	37	11	67200504	67200504	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0911-01	TCGA-13-0911-10			T	C	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr11:67200504T>C	ENST00000312629.5	+	8	743	c.698T>C	c.(697-699)aTt>aCt	p.I233T	RPS6KB2_ENST00000539188.1_3'UTR|AP003419.16_ENST00000535922.1_RNA	NM_003952.2	NP_003943.2	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 2	233	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|signal transduction (GO:0007165)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)	p.I233T(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|salivary_gland(1)|stomach(2)	25			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			TGCGGCACCATTGAGTACATG	0.617																																																1	Substitution - Missense(1)	ovary(1)	11											35.0	40.0	38.0					11																	67200504		2052	4196	6248	66957080	SO:0001583	missense	6199			AB019245	CCDS41677.1	11q13.1	2011-04-05	2002-08-29		ENSG00000175634	ENSG00000175634			10437	protein-coding gene	gene with protein product		608939	"""ribosomal protein S6 kinase, 70kD, polypeptide 2"""			9878560, 9804755	Standard	XM_005274164		Approved	p70S6Kb, P70-BETA, STK14B, KLS	uc001old.3	Q9UBS0	OTTHUMG00000167673	ENST00000312629.5:c.698T>C	11.37:g.67200504T>C	ENSP00000308413:p.Ile233Thr		66957080	B2RMZ9|B4DML8|O94809|Q9UEC1	Missense_Mutation	SNP	ENST00000312629.5	37	CCDS41677.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	21.0	4.083771	0.76642	.	.	ENSG00000175634	ENST00000312629	T	0.25579	1.79	4.76	4.76	0.60689	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.32041	0.0816	N	0.13043	0.29	0.80722	D	1	P;P	0.46457	0.693;0.878	P;D	0.70487	0.908;0.969	T	0.10683	-1.0619	9	.	.	.	.	13.3809	0.60766	0.0:0.0:0.0:1.0	.	233;233	Q9BRS0;Q9UBS0	.;KS6B2_HUMAN	T	233	ENSP00000308413:I233T	.	I	+	2	0	RPS6KB2	66957080	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.331000	0.79192	1.991000	0.58162	0.459000	0.35465	ATT		0.617	RPS6KB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395508.1	NM_003952		Missense_Mutation
FSCB	84075	broad.mit.edu	37	14	44974851	44974851	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0911-01	TCGA-13-0911-10			T	A	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr14:44974851T>A	ENST00000340446.4	-	1	1631	c.1340A>T	c.(1339-1341)gAg>gTg	p.E447V	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	447						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)	p.E447V(1)		breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		TGCAGGGGTCTCCATAGCTGT	0.498																																																1	Substitution - Missense(1)	ovary(1)	14											22.0	23.0	23.0					14																	44974851		2187	4296	6483	44044601	SO:0001583	missense	84075			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1340A>T	14.37:g.44974851T>A	ENSP00000344579:p.Glu447Val		44044601	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	37	CCDS9679.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	8.932	0.963707	0.18583	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.18016	2.24	3.44	-1.06	0.10002	.	.	.	.	.	T	0.13243	0.0321	M	0.62723	1.935	0.09310	N	1	B	0.33044	0.395	B	0.26416	0.069	T	0.21449	-1.0245	9	0.40728	T	0.16	1.7165	3.425	0.07408	0.3859:0.1141:0.0:0.5	.	447	Q5H9T9	FSCB_HUMAN	V	447	ENSP00000344579:E447V	ENSP00000344579:E447V	E	-	2	0	FSCB	44044601	0.996000	0.38824	0.000000	0.03702	0.068000	0.16541	2.471000	0.45127	0.029000	0.15352	0.438000	0.28831	GAG		0.498	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135		Missense_Mutation
LCTL	197021	broad.mit.edu	37	15	66850125	66850125	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr15:66850125C>G	ENST00000341509.5	-	8	988	c.857G>C	c.(856-858)tGt>tCt	p.C286S	LCTL_ENST00000537670.1_Missense_Mutation_p.C113S	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	286					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.C286S(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCAGCCCAGACAGAACTGTAG	0.498																																																1	Substitution - Missense(1)	ovary(1)	15											101.0	106.0	104.0					15																	66850125		2201	4299	6500	64637179	SO:0001583	missense	197021			AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.857G>C	15.37:g.66850125C>G	ENSP00000343490:p.Cys286Ser		64637179	B3KQY0	Missense_Mutation	SNP	ENST00000341509.5	37	CCDS10220.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	10.10	1.258754	0.23051	.	.	ENSG00000188501	ENST00000537670;ENST00000341509	T;T	0.48836	0.8;1.64	5.44	3.5	0.40072	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.382919	0.33235	N	0.005137	T	0.22244	0.0536	N	0.04787	-0.16	0.31941	N	0.610888	B	0.15473	0.013	B	0.17433	0.018	T	0.14727	-1.0462	10	0.22109	T	0.4	-27.6709	5.8369	0.18613	0.0:0.5167:0.3336:0.1497	.	286	Q6UWM7	LCTL_HUMAN	S	113;286	ENSP00000445419:C113S;ENSP00000343490:C286S	ENSP00000343490:C286S	C	-	2	0	LCTL	64637179	0.913000	0.31002	1.000000	0.80357	0.978000	0.69477	0.940000	0.28992	0.628000	0.30357	0.655000	0.94253	TGT		0.498	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256921.2	NM_207338		Missense_Mutation
PITPNM3	83394	broad.mit.edu	37	17	6373654	6373654	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr17:6373654T>G	ENST00000262483.8	-	13	1786	c.1699A>C	c.(1699-1701)Acc>Ccc	p.T567P	PITPNM3_ENST00000576664.1_5'UTR|PITPNM3_ENST00000421306.3_Missense_Mutation_p.T531P	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	567	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)	p.T567P(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		AGGGCCACGGTGGGGAAGGCC	0.627																																																1	Substitution - Missense(1)	ovary(1)	17											126.0	87.0	100.0					17																	6373654		2203	4300	6503	6314378	SO:0001583	missense	83394			AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.1699A>C	17.37:g.6373654T>G	ENSP00000262483:p.Thr567Pro		6314378	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	ENST00000262483.8	37	CCDS11076.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	19.02	3.746816	0.69418	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.47528	0.84;0.84	4.65	3.57	0.40892	DDHD (2);	0.101306	0.64402	N	0.000003	T	0.59335	0.2186	L	0.53249	1.67	0.50813	D	0.99989	P;D	0.89917	0.513;1.0	P;D	0.91635	0.52;0.999	T	0.57751	-0.7757	10	0.51188	T	0.08	-26.7609	8.492	0.33106	0.0:0.0936:0.0:0.9064	.	531;567	F8WEW5;Q9BZ71	.;PITM3_HUMAN	P	567;531	ENSP00000262483:T567P;ENSP00000407882:T531P	ENSP00000262483:T567P	T	-	1	0	PITPNM3	6314378	1.000000	0.71417	0.985000	0.45067	0.800000	0.45204	6.139000	0.71728	0.923000	0.37045	0.460000	0.39030	ACC		0.627	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220		Missense_Mutation
NETO1	81832	broad.mit.edu	37	18	70526214	70526214	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0911-01	TCGA-13-0911-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr18:70526214C>A	ENST00000327305.6	-	4	973	c.316G>T	c.(316-318)Gga>Tga	p.G106*	NETO1_ENST00000397929.1_Nonsense_Mutation_p.G105*|NETO1_ENST00000583169.1_Nonsense_Mutation_p.G106*|NETO1_ENST00000299430.2_Nonsense_Mutation_p.G105*|NETO1_ENST00000580049.1_5'UTR	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	106	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.G106*(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		CCAAAAGGTCCATCTCGAACT	0.378																																																1	Substitution - Nonsense(1)	ovary(1)	18											95.0	94.0	94.0					18																	70526214		2203	4300	6503	68677194	SO:0001587	stop_gained	81832			AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.316G>T	18.37:g.70526214C>A	ENSP00000313088:p.Gly106*		68677194	Q86W85|Q8ND78|Q8TDF4	Nonsense_Mutation	SNP	ENST00000327305.6	37	CCDS12000.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	41	9.099600	0.99066	.	.	ENSG00000166342	ENST00000327305;ENST00000299430;ENST00000397929	.	.	.	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	6.4416	19.438	0.94806	0.0:1.0:0.0:0.0	.	.	.	.	X	106;105;105	.	ENSP00000299430:G105X	G	-	1	0	NETO1	68677194	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.724000	0.84798	2.672000	0.90937	0.655000	0.94253	GGA		0.378	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999		Nonsense_Mutation
OR1I1	126370	broad.mit.edu	37	19	15197970	15197970	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr19:15197970C>G	ENST00000209540.2	+	1	180	c.94C>G	c.(94-96)Ctc>Gtc	p.L32V		NM_001004713.1	NP_001004713.1	O60431	OR1I1_HUMAN	olfactory receptor, family 1, subfamily I, member 1	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L32V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(3)|ovary(2)|stomach(2)	20						CACAATGTTCCTCTCCACATA	0.473																																																1	Substitution - Missense(1)	ovary(1)	19											254.0	217.0	230.0					19																	15197970		2203	4300	6503	15058970	SO:0001583	missense	126370			AC004794	CCDS32937.1	19p13.1	2012-08-09				ENSG00000094661		"""GPCR / Class A : Olfactory receptors"""	8207	protein-coding gene	gene with protein product							Standard	NM_001004713		Approved	OR1I1P, OR19-20, OR1I1Q	uc010xoe.2	O60431		ENST00000209540.2:c.94C>G	19.37:g.15197970C>G	ENSP00000209540:p.Leu32Val		15058970	Q96R92	Missense_Mutation	SNP	ENST00000209540.2	37	CCDS32937.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	c	12.46	1.943246	0.34283	.	.	ENSG00000094661	ENST00000209540	T	0.01902	4.57	4.98	3.92	0.45320	.	0.341387	0.16418	U	0.215284	T	0.15349	0.0370	H	0.99444	4.57	0.29849	N	0.828589	D	0.53885	0.963	P	0.48454	0.578	T	0.42120	-0.9470	10	0.72032	D	0.01	.	11.4678	0.50249	0.0:0.9098:0.0:0.0902	.	32	O60431	OR1I1_HUMAN	V	32	ENSP00000209540:L32V	ENSP00000209540:L32V	L	+	1	0	OR1I1	15058970	0.018000	0.18449	0.988000	0.46212	0.029000	0.11900	0.420000	0.21263	2.590000	0.87494	0.655000	0.94253	CTC		0.473	OR1I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465665.1			Missense_Mutation
PEG3	5178	broad.mit.edu	37	19	57328817	57328817	+	Silent	SNP	T	T	C			TCGA-13-0911-01	TCGA-13-0911-10			T	C	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr19:57328817T>C	ENST00000326441.9	-	10	1356	c.993A>G	c.(991-993)gcA>gcG	p.A331A	PEG3_ENST00000593695.1_Silent_p.A205A|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Silent_p.A331A|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Silent_p.A207A	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	331					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.A331A(1)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TTGACTCCCTTGCTCTTCCCG	0.498																																																1	Substitution - coding silent(1)	ovary(1)	19											75.0	71.0	72.0					19																	57328817		2203	4300	6503	62020629	SO:0001819	synonymous_variant	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.993A>G	19.37:g.57328817T>C			62020629	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	ENST00000326441.9	37	CCDS12948.1	SNP	63	Broad																																																																																				0.498	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			Silent
LRP2	4036	broad.mit.edu	37	2	170063047	170063047	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0911-01	TCGA-13-0911-10			A	G	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr2:170063047A>G	ENST00000263816.3	-	39	7468	c.7183T>C	c.(7183-7185)Tct>Cct	p.S2395P		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2395					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.S2395P(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAGGAATTAGACAAGGCAAAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											83.0	83.0	83.0					2																	170063047		2203	4300	6503	169771293	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7183T>C	2.37:g.170063047A>G	ENSP00000263816:p.Ser2395Pro		169771293	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	6.998	0.554341	0.13374	.	.	ENSG00000081479	ENST00000263816	D	0.91464	-2.85	6.07	3.19	0.36642	Six-bladed beta-propeller, TolB-like (1);	0.842786	0.11103	N	0.599439	T	0.81226	0.4778	N	0.21282	0.65	0.53688	D	0.999978	B	0.33238	0.403	B	0.25140	0.058	T	0.70051	-0.4978	10	0.30854	T	0.27	.	7.7904	0.29116	0.15:0.7109:0.0:0.1391	.	2395	P98164	LRP2_HUMAN	P	2395	ENSP00000263816:S2395P	ENSP00000263816:S2395P	S	-	1	0	LRP2	169771293	0.967000	0.33354	0.002000	0.10522	0.107000	0.19398	2.751000	0.47508	0.369000	0.24510	-0.331000	0.08364	TCT		0.428	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		Missense_Mutation
CALCRL	10203	broad.mit.edu	37	2	188217026	188217026	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr2:188217026C>T	ENST00000409998.1	-	14	1724	c.943G>A	c.(943-945)Gtt>Att	p.V315I	AC007319.1_ENST00000453517.1_RNA|CALCRL_ENST00000392370.3_Missense_Mutation_p.V315I|CALCRL_ENST00000410068.1_Missense_Mutation_p.V315I|AC007319.1_ENST00000412276.1_RNA			Q16602	CALRL_HUMAN	calcitonin receptor-like	315					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)	p.V315I(1)		endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			GTGATGAGAACGCGTACAATA	0.333																																																1	Substitution - Missense(1)	ovary(1)	2											52.0	49.0	50.0					2																	188217026		2203	4299	6502	187925271	SO:0001583	missense	10203			U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.943G>A	2.37:g.188217026C>T	ENSP00000386972:p.Val315Ile		187925271	A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	ENST00000409998.1	37	CCDS2293.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.225145	0.95173	.	.	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068	T;T;T	0.44482	0.92;0.92;0.92	5.82	5.82	0.92795	GPCR, family 2-like (1);	0.000000	0.56097	D	0.000021	T	0.54013	0.1832	L	0.48174	1.505	0.80722	D	1	D	0.65815	0.995	D	0.65443	0.935	T	0.37979	-0.9682	10	0.06891	T	0.86	.	19.0733	0.93148	0.0:1.0:0.0:0.0	.	315	Q16602	CALRL_HUMAN	I	315	ENSP00000376177:V315I;ENSP00000386972:V315I;ENSP00000387190:V315I	ENSP00000376177:V315I	V	-	1	0	CALCRL	187925271	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	7.807000	0.86032	2.758000	0.94735	0.650000	0.86243	GTT		0.333	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795		Missense_Mutation
AGAP1	116987	broad.mit.edu	37	2	236708132	236708132	+	Missense_Mutation	SNP	G	G	A	rs369405118		TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr2:236708132G>A	ENST00000304032.8	+	8	1503	c.923G>A	c.(922-924)cGc>cAc	p.R308H	AGAP1_ENST00000336665.5_Missense_Mutation_p.R308H|AGAP1_ENST00000428334.2_Missense_Mutation_p.R147H|AGAP1_ENST00000409457.1_Missense_Mutation_p.R308H|AGAP1_ENST00000409538.1_Missense_Mutation_p.R573H	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	308					protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)	p.R308H(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						ACGCCCGTTCGCAAGCAGTCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	2						G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	103.0	87.0	92.0		923,923	5.2	1.0	2		92	0,8600		0,0,4300	no	missense,missense	AGAP1	NM_001037131.2,NM_014914.4	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	308/858,308/805	236708132	1,13005	2203	4300	6503	236372871	SO:0001583	missense	116987			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.923G>A	2.37:g.236708132G>A	ENSP00000307634:p.Arg308His		236372871	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	ENST00000304032.8	37	CCDS33408.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	15.97	2.989569	0.53934	2.27E-4	0.0	ENSG00000157985	ENST00000409457;ENST00000304032;ENST00000336665;ENST00000409538;ENST00000428334	T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43	5.19	5.19	0.71726	.	0.137437	0.49305	D	0.000142	T	0.47488	0.1448	L	0.40543	1.245	0.80722	D	1	D;P	0.89917	1.0;0.622	D;B	0.83275	0.996;0.067	T	0.22347	-1.0219	10	0.25751	T	0.34	.	18.7434	0.91782	0.0:0.0:1.0:0.0	.	308;308	Q9UPQ3-2;Q9UPQ3	.;AGAP1_HUMAN	H	308;308;308;573;147	ENSP00000387174:R308H;ENSP00000307634:R308H;ENSP00000338378:R308H;ENSP00000386897:R573H;ENSP00000411824:R147H	ENSP00000307634:R308H	R	+	2	0	AGAP1	236372871	1.000000	0.71417	0.988000	0.46212	0.524000	0.34500	9.712000	0.98738	2.430000	0.82344	0.655000	0.94253	CGC		0.557	AGAP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257076.2	NM_014914		Missense_Mutation
GPR35	2859	broad.mit.edu	37	2	241569540	241569540	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr2:241569540C>G	ENST00000319838.5	+	6	1113	c.171C>G	c.(169-171)atC>atG	p.I57M	GPR35_ENST00000438013.2_Missense_Mutation_p.I88M|GPR35_ENST00000403859.1_Missense_Mutation_p.I57M|GPR35_ENST00000407714.1_Missense_Mutation_p.I57M|GPR35_ENST00000430267.1_Missense_Mutation_p.I57M	NM_001195381.1	NP_001182310.1	Q9HC97	GPR35_HUMAN	G protein-coupled receptor 35	57					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.I57M(1)		NS(2)|breast(1)|cervix(1)|endometrium(1)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	17		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)		AGACCCGCATCTACATGACCA	0.652																																																1	Substitution - Missense(1)	ovary(1)	2											106.0	91.0	96.0					2																	241569540		2203	4300	6503	241218213	SO:0001583	missense	2859				CCDS2541.1, CCDS56174.1	2q37.3	2012-08-21			ENSG00000178623	ENSG00000178623		"""GPCR / Class A : Orphans"""	4492	protein-coding gene	gene with protein product		602646				9479505	Standard	NM_005301		Approved		uc021vze.1	Q9HC97	OTTHUMG00000133356	ENST00000319838.5:c.171C>G	2.37:g.241569540C>G	ENSP00000322731:p.Ile57Met		241218213	J3KR30|O43495|Q17R58|Q4VBN5|Q4ZFV2|Q6FHI8|Q86UH4	Missense_Mutation	SNP	ENST00000319838.5	37	CCDS2541.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	15.25	2.777768	0.49786	.	.	ENSG00000178623	ENST00000319838;ENST00000403859;ENST00000438013;ENST00000407714;ENST00000430267	T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78;-0.78	4.02	2.04	0.26737	GPCR, rhodopsin-like superfamily (1);	0.387393	0.25535	N	0.030013	T	0.80633	0.4660	M	0.67397	2.05	0.36387	D	0.862261	D;D;D	0.67145	0.996;0.988;0.988	D;P;P	0.67382	0.951;0.878;0.839	T	0.81464	-0.0921	10	0.72032	D	0.01	-16.5447	7.0955	0.25307	0.1864:0.4498:0.3637:0.0	.	142;88;57	Q6ZMP9;A8K2J1;Q9HC97	.;.;GPR35_HUMAN	M	57;57;88;57;57	ENSP00000322731:I57M;ENSP00000385140:I57M;ENSP00000415890:I88M;ENSP00000384263:I57M;ENSP00000411788:I57M	ENSP00000322731:I57M	I	+	3	3	GPR35	241218213	0.811000	0.29063	0.889000	0.34880	0.840000	0.47671	0.709000	0.25734	0.389000	0.25086	0.462000	0.41574	ATC		0.652	GPR35-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325631.1	NM_001195382		Missense_Mutation
TOP3B	8940	broad.mit.edu	37	22	22324768	22324768	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr22:22324768G>T	ENST00000398793.2	-	6	829	c.395C>A	c.(394-396)gCt>gAt	p.A132D	TOP3B_ENST00000413067.2_Intron|TOP3B_ENST00000357179.5_Missense_Mutation_p.A132D	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	132	Toprim. {ECO:0000255|PROSITE- ProRule:PRU00995}.				chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)	p.A132D(2)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		GGGCAGAACAGCATCAAGAAC	0.602																																																2	Substitution - Missense(2)	ovary(2)	22											61.0	52.0	55.0					22																	22324768		2203	4300	6503	20654768	SO:0001583	missense	8940			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.395C>A	22.37:g.22324768G>T	ENSP00000381773:p.Ala132Asp		20654768	A0M8Q3|Q9BUP5	Missense_Mutation	SNP	ENST00000398793.2	37	CCDS13797.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139250	0.77775	.	.	ENSG00000100038	ENST00000357179;ENST00000398793;ENST00000424393	T;T;T	0.23754	1.89;1.89;1.89	4.97	2.9	0.33743	DNA topoisomerase, type IA, core domain (1);Toprim domain (2);	0.105878	0.64402	D	0.000005	T	0.43077	0.1231	M	0.87682	2.9	0.80722	D	1	P	0.44380	0.834	P	0.49421	0.61	T	0.48281	-0.9049	10	0.62326	D	0.03	-0.8301	10.9331	0.47230	0.1504:0.0:0.8496:0.0	.	132	O95985	TOP3B_HUMAN	D	132	ENSP00000349705:A132D;ENSP00000381773:A132D;ENSP00000390977:A132D	ENSP00000349705:A132D	A	-	2	0	TOP3B	20654768	1.000000	0.71417	0.150000	0.22450	0.799000	0.45148	9.615000	0.98356	0.706000	0.31912	0.561000	0.74099	GCT		0.602	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320251.1	NM_003935		Missense_Mutation
APOL1	8542	broad.mit.edu	37	22	36661455	36661455	+	Silent	SNP	C	C	T	rs150846072	byFrequency	TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr22:36661455C>T	ENST00000397278.3	+	6	802	c.573C>T	c.(571-573)ctC>ctT	p.L191L	APOL1_ENST00000347595.7_Silent_p.L70L|APOL1_ENST00000426053.1_Silent_p.L173L|APOL1_ENST00000422706.1_Silent_p.L191L|APOL1_ENST00000397279.4_Silent_p.L191L|APOL1_ENST00000319136.4_Silent_p.L207L|APOL1_ENST00000440669.2_3'UTR	NM_003661.3	NP_003652.2	O14791	APOL1_HUMAN	apolipoprotein L, 1	191					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cholesterol metabolic process (GO:0008203)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|intrinsic component of membrane (GO:0031224)|very-low-density lipoprotein particle (GO:0034361)	chloride channel activity (GO:0005254)|lipid binding (GO:0008289)	p.I204fs*52(1)|p.L207L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	14						TCCTGACCCTCGTCGGCATGG	0.577													c|||	13	0.00259585	0.0	0.0	5008	,	,		20282	0.0099		0.003	False		,,,				2504	0.0															2	Deletion - Frameshift(1)|Substitution - coding silent(1)	ovary(1)|breast(1)	22						C	,,,	4,4402	8.1+/-20.4	0,4,2199	149.0	137.0	141.0		573,519,573,621	-0.3	0.0	22	dbSNP_134	141	19,8581	14.6+/-50.1	0,19,4281	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	APOL1	NM_001136540.1,NM_001136541.1,NM_003661.3,NM_145343.2	,,,	0,23,6480	TT,TC,CC		0.2209,0.0908,0.1768	,,,	191/399,173/381,191/399,207/415	36661455	23,12983	2203	4300	6503	34991401	SO:0001819	synonymous_variant	8542			AF019225	CCDS13925.1, CCDS13926.1, CCDS46702.1	22q13.1	2014-09-17			ENSG00000100342	ENSG00000100342		"""Apolipoproteins"""	618	protein-coding gene	gene with protein product		603743		APOL		9325276, 11374903, 16020735	Standard	NM_003661		Approved		uc011amp.2	O14791	OTTHUMG00000030427	ENST00000397278.3:c.573C>T	22.37:g.36661455C>T			34991401	A5PLQ4|B4DU12|E9PF24|O60804|Q5R3P7|Q5R3P8|Q96AB8|Q96PM4|Q9BQ03	Silent	SNP	ENST00000397278.3	37	CCDS13926.1	SNP	31	Broad																																																																																				0.577	APOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319100.4	NM_145343		Silent
CAMKV	79012	broad.mit.edu	37	3	49898959	49898959	+	Silent	SNP	C	C	T	rs142554452		TCGA-13-0911-01	TCGA-13-0911-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr3:49898959C>T	ENST00000477224.1	-	5	832	c.354G>A	c.(352-354)tcG>tcA	p.S118S	CAMKV_ENST00000498324.1_5'UTR|CAMKV_ENST00000488336.1_Silent_p.S118S|CAMKV_ENST00000467248.1_Silent_p.S43S|CAMKV_ENST00000466940.1_Intron|CAMKV_ENST00000296471.7_Silent_p.S118S|CAMKV_ENST00000463537.1_Silent_p.S118S|RN7SL217P_ENST00000584520.1_RNA			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	118	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.S118S(1)		central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TGTCTCGCTCCGAGTAGTAGC	0.612																																																1	Substitution - coding silent(1)	ovary(1)	3						C		1,4405	2.1+/-5.4	0,1,2202	109.0	87.0	95.0		354	-0.7	1.0	3	dbSNP_134	95	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	CAMKV	NM_024046.3		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		118/502	49898959	3,13003	2203	4300	6503	49873963	SO:0001819	synonymous_variant	79012			BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.354G>A	3.37:g.49898959C>T			49873963	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Silent	SNP	ENST00000477224.1	37	CCDS33762.1	SNP	23	Broad																																																																																				0.612	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350584.4	NM_024046		Silent
CD47	961	broad.mit.edu	37	3	107799014	107799014	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0911-01	TCGA-13-0911-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr3:107799014G>C	ENST00000361309.5	-	2	329	c.224C>G	c.(223-225)tCc>tGc	p.S75C	CD47_ENST00000355354.7_Missense_Mutation_p.S75C	NM_001777.3	NP_001768.1	Q08722	CD47_HUMAN	CD47 molecule	75	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|opsonization (GO:0008228)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of inflammatory response (GO:0050729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T cell activation (GO:0050870)|response to bacterium (GO:0009617)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)	p.S75C(1)		endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			GGGGACAGTGGACTTGTTTAG	0.373																																																1	Substitution - Missense(1)	ovary(1)	3											173.0	153.0	159.0					3																	107799014		1876	4108	5984	109281704	SO:0001583	missense	961				CCDS43125.1, CCDS43126.1	3q13.1-q13.2	2013-01-11	2006-03-28		ENSG00000196776	ENSG00000196776		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1682	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibody 1D8"", ""antigenic surface determinant protein OA3"", ""integrin associated protein"", ""Rh-related antigen"", ""leukocyte surface antigen CD47"", ""CD47 glycoprotein"""	601028	"""CD47 antigen (Rh-related antigen, integrin-associated signal transducer)"""	MER6		8294396, 2277087	Standard	XM_005247908		Approved	IAP, OA3	uc003dwt.1	Q08722	OTTHUMG00000044216	ENST00000361309.5:c.224C>G	3.37:g.107799014G>C	ENSP00000355361:p.Ser75Cys		109281704	A8K198|D3DN59|Q53Y71|Q96A60	Missense_Mutation	SNP	ENST00000361309.5	37	CCDS43126.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784168	0.49997	.	.	ENSG00000196776	ENST00000355354;ENST00000361309	T;T	0.02763	4.17;4.17	6.04	3.8	0.43715	Immunoglobulin-like (1);CD47 immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.918616	0.09356	N	0.813410	T	0.05410	0.0143	L	0.55481	1.735	0.09310	N	1	D;D;D;D	0.57899	0.976;0.976;0.981;0.981	P;P;P;P	0.50109	0.497;0.497;0.631;0.631	T	0.41893	-0.9483	10	0.35671	T	0.21	.	3.7915	0.08722	0.1583:0.0:0.6115:0.2302	.	75;75;75;75	Q08722-2;Q08722-3;E9PB22;Q08722	.;.;.;CD47_HUMAN	C	75	ENSP00000347512:S75C;ENSP00000355361:S75C	ENSP00000347512:S75C	S	-	2	0	CD47	109281704	0.000000	0.05858	0.010000	0.14722	0.020000	0.10135	0.036000	0.13819	2.873000	0.98535	0.561000	0.74099	TCC		0.373	CD47-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000102793.1	NM_001777		Missense_Mutation
RAP1GDS1	5910	broad.mit.edu	37	4	99325731	99325731	+	Silent	SNP	T	T	C			TCGA-13-0911-01	TCGA-13-0911-10			T	C	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr4:99325731T>C	ENST00000408927.3	+	7	854	c.741T>C	c.(739-741)gtT>gtC	p.V247V	RAP1GDS1_ENST00000453712.2_Silent_p.V248V|RAP1GDS1_ENST00000380158.4_Silent_p.V199V|RAP1GDS1_ENST00000408900.3_Silent_p.V198V|RAP1GDS1_ENST00000264572.7_Silent_p.V156V|RAP1GDS1_ENST00000339360.5_Silent_p.V248V	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	247					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)	p.V248V(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		TTTTTGAAGTTCTTGCTCCAT	0.318			T	NUP98	T-ALL																																		Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	1	Substitution - coding silent(1)	ovary(1)	4											94.0	93.0	93.0					4																	99325731		1816	4068	5884	99544754	SO:0001819	synonymous_variant	5910				CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.741T>C	4.37:g.99325731T>C			99544754	E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Silent	SNP	ENST00000408927.3	37	CCDS43253.1	SNP	62	Broad																																																																																				0.318	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363273.2	NM_001100426		Silent
FAM134B	54463	broad.mit.edu	37	5	16479054	16479054	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr5:16479054A>G	ENST00000306320.9	-	6	799	c.713T>C	c.(712-714)aTt>aCt	p.I238T	FAM134B_ENST00000399793.2_Missense_Mutation_p.I97T	NM_001034850.2	NP_001030022.1	Q9H6L5	F134B_HUMAN	family with sequence similarity 134, member B	238					sensory perception of pain (GO:0019233)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.I238T(1)		breast(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(1)	16						TTTTTGTCCAATATCATTACA	0.343																																																1	Substitution - Missense(1)	ovary(1)	5											61.0	57.0	58.0					5																	16479054		1818	4062	5880	16532054	SO:0001583	missense	54463			BC053326	CCDS43304.1, CCDS43305.1	5p15.1	2014-09-17			ENSG00000154153	ENSG00000154153			25964	protein-coding gene	gene with protein product		613114				19838196, 24327336	Standard	NM_001034850		Approved	FLJ20152	uc003jfs.3	Q9H6L5	OTTHUMG00000161788	ENST00000306320.9:c.713T>C	5.37:g.16479054A>G	ENSP00000304642:p.Ile238Thr		16532054	Q69YN8|Q9H6K6|Q9H764|Q9NXM8	Missense_Mutation	SNP	ENST00000306320.9	37	CCDS43304.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	15.97	2.990520	0.54041	.	.	ENSG00000154153	ENST00000399793;ENST00000306320	T;T	0.43294	0.95;0.95	5.61	5.61	0.85477	.	0.165970	0.53938	D	0.000049	T	0.37461	0.1004	N	0.19112	0.55	0.36263	D	0.854666	P;P	0.42584	0.784;0.467	P;B	0.45753	0.492;0.143	T	0.49244	-0.8960	10	0.49607	T	0.09	-10.1813	15.8086	0.78538	1.0:0.0:0.0:0.0	.	238;97	Q9H6L5;Q9H6L5-2	F134B_HUMAN;.	T	97;238	ENSP00000382691:I97T;ENSP00000304642:I238T	ENSP00000304642:I238T	I	-	2	0	FAM134B	16532054	1.000000	0.71417	0.975000	0.42487	0.994000	0.84299	6.587000	0.74071	2.147000	0.66899	0.477000	0.44152	ATT		0.343	FAM134B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366090.1	NM_001034850		Missense_Mutation
PCDHGA2	56113	broad.mit.edu	37	5	140718758	140718758	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr5:140718758C>T	ENST00000394576.2	+	1	220	c.220C>T	c.(220-222)Ctc>Ttc	p.L74F	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	74	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L74F(1)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAGGTCCCAGCTCTTTGCTCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	5											64.0	68.0	67.0					5																	140718758		2203	4300	6503	140698942	SO:0001583	missense	56113			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.220C>T	5.37:g.140718758C>T	ENSP00000378077:p.Leu74Phe		140698942	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	CCDS47289.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	.	9.921	1.212230	0.22289	.	.	ENSG00000081853	ENST00000394576	T	0.29142	1.58	5.08	5.08	0.68730	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.418307	0.17351	U	0.177413	T	0.33469	0.0864	L	0.58354	1.805	0.23391	N	0.997773	B;B	0.25809	0.135;0.044	B;B	0.36335	0.222;0.104	T	0.27739	-1.0065	10	0.51188	T	0.08	.	7.2883	0.26352	0.0:0.7863:0.0:0.2137	.	74;74	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	F	74	ENSP00000378077:L74F	ENSP00000378077:L74F	L	+	1	0	PCDHGA2	140698942	0.003000	0.15002	1.000000	0.80357	0.317000	0.28152	0.737000	0.26144	2.525000	0.85131	0.591000	0.81541	CTC		0.592	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915		Missense_Mutation
SOSTDC1	25928	broad.mit.edu	37	7	16505224	16505224	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chr7:16505224A>G	ENST00000307068.4	-	1	250	c.70T>C	c.(70-72)Ttt>Ctt	p.F24L	SOSTDC1_ENST00000396652.1_Missense_Mutation_p.F24L	NM_015464.2	NP_056279.1	Q6X4U4	SOSD1_HUMAN	sclerostin domain containing 1	24					hair follicle morphogenesis (GO:0031069)|mammary gland bud morphogenesis (GO:0060648)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell fate commitment (GO:0010454)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)		p.F24L(1)		central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(2)	6	Lung NSC(10;0.185)			UCEC - Uterine corpus endometrioid carcinoma (126;0.177)		TCATTTTTAAAAGCCAAACAG	0.448																																																1	Substitution - Missense(1)	ovary(1)	7											118.0	115.0	116.0					7																	16505224		2203	4300	6503	16471749	SO:0001583	missense	25928			AB059270	CCDS5360.1	7p21.2	2007-08-01			ENSG00000171243	ENSG00000171243			21748	protein-coding gene	gene with protein product	"""ectodin"""	609675					Standard	NM_015464		Approved	DKFZp564D206, USAG1	uc003stg.3	Q6X4U4	OTTHUMG00000090807	ENST00000307068.4:c.70T>C	7.37:g.16505224A>G	ENSP00000304930:p.Phe24Leu		16471749	A8MUA6|Q96HJ7|Q9Y3U3	Missense_Mutation	SNP	ENST00000307068.4	37	CCDS5360.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	16.13	3.034664	0.54896	.	.	ENSG00000171243	ENST00000307068;ENST00000396652	D;D	0.82526	-1.62;-1.62	5.93	5.93	0.95920	.	0.165232	0.53938	D	0.000053	T	0.75406	0.3845	L	0.29908	0.895	0.52501	D	0.999952	B;B	0.25809	0.135;0.014	B;B	0.26416	0.069;0.026	T	0.70590	-0.4830	10	0.21014	T	0.42	-12.0841	16.3797	0.83452	1.0:0.0:0.0:0.0	.	24;24	A8MUA6;Q6X4U4	.;SOSD1_HUMAN	L	24	ENSP00000304930:F24L;ENSP00000379889:F24L	ENSP00000304930:F24L	F	-	1	0	SOSTDC1	16471749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.376000	0.66178	2.271000	0.75665	0.533000	0.62120	TTT		0.448	SOSTDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207603.1	NM_015464		Missense_Mutation
ATP6AP1	537	broad.mit.edu	37	X	153662578	153662578	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0911-01	TCGA-13-0911-10			G	T	G	G	Unknown	Valid	Somatic	x	x	454_PCR_WGA			x	TCGA-13-0911-01	TCGA-13-0911-10	g.chrX:153662578G>T	ENST00000369762.2	+	7	770	c.709G>T	c.(709-711)Gcc>Tcc	p.A237S	GDI1_ENST00000447750.2_5'Flank|ATP6AP1_ENST00000484908.1_3'UTR	NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	237					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)	p.A237S(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGCCGTGGTGGCCGGAGGGCT	0.572																																																1	Substitution - Missense(1)	ovary(1)	X											96.0	83.0	88.0					X																	153662578		2203	4300	6503	153315772	SO:0001583	missense	537			D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.709G>T	X.37:g.153662578G>T	ENSP00000358777:p.Ala237Ser		153315772	A6ZKI4|Q8NBT4|Q9H0C7	Missense_Mutation	SNP	ENST00000369762.2	37	CCDS35451.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	8.680	0.904943	0.17760	.	.	ENSG00000071553	ENST00000369762;ENST00000422890;ENST00000445849	.	.	.	5.34	-0.399	0.12415	.	0.995023	0.08167	N	0.987573	T	0.22589	0.0545	N	0.12182	0.205	0.24203	N	0.995507	B;B	0.13594	0.002;0.008	B;B	0.17433	0.005;0.018	T	0.24512	-1.0158	9	0.30854	T	0.27	-0.4728	5.9406	0.19192	0.2761:0.0:0.5402:0.1838	.	197;237	B3KR70;Q15904	.;VAS1_HUMAN	S	237;167;61	.	ENSP00000358777:A237S	A	+	1	0	ATP6AP1	153315772	0.972000	0.33761	0.987000	0.45799	0.061000	0.15899	0.229000	0.17833	-0.136000	0.11475	0.529000	0.55759	GCC		0.572	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081639.4	NM_001183		Missense_Mutation
NBPF15	284565	broad.mit.edu	37	1	148753330	148753336	+	Frame_Shift_Del	DEL	TTATCTT	TTATCTT	-			TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0911-01	TCGA-13-0911-10	g.chr1:148753330_148753336delTTATCTT	ENST00000417839.1	+	12	1537_1543	c.1347_1353delTTATCTT	c.(1345-1353)gattatcttfs	p.DYL449fs		NM_001102663.1	NP_001096133	Q5SXJ2	NBPFG_HUMAN		449	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4	all_hematologic(923;0.032)					CTCCTTCAGATTATCTTGAACTGCCTG	0.488																																																0			1								52,918		24,4,457						0.1	0.0			1	124,1206		55,14,596	no	frameshift	NBPF16	NM_001102663.1		79,18,1053	A1A1,A1R,RR		9.3233,5.3608,7.6522				176,2124				147019960	SO:0001589	frameshift_variant	728936																														ENST00000417839.1:c.1347_1353delTTATCTT	1.37:g.148753330_148753336delTTATCTT	ENSP00000395369:p.Asp449fs		147019954	A8MPT6	Frame_Shift_Del	DEL	ENST00000417839.1	37	CCDS41384.1	DEL	52	Broad																																																																																				0.488	NBPF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097693.1			Frame_Shift_Del
RTL1	388015	broad.mit.edu	37	14	101350670	101350671	+	In_Frame_Ins	INS	-	-	TCT	rs55755518|rs397823434|rs35401447	byFrequency	TCGA-13-0911-01	TCGA-13-0911-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0911-01	TCGA-13-0911-10	g.chr14:101350670_101350671insTCT	ENST00000534062.1	-	1	513_514	c.455_456insAGA	c.(454-456)gag>gaAGAg	p.152_152E>EE	MIR136_ENST00000385207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR433_ENST00000384837.1_RNA|MIR432_ENST00000606207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	152					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						TCTGGTTTTGCTCTTGAGGAGT	0.52														784	0.15655	0.0847	0.1902	5008	,	,		20517	0.0575		0.2684	False		,,,				2504	0.2168															0			14								459,3511		59,341,1585						2.5	0.0		dbSNP_126	223	2155,5335		412,1331,2002	no	coding	RTL1	NM_001134888.2		471,1672,3587	A1A1,A1R,RR		28.7717,11.5617,22.8098				2614,8846				100420424	SO:0001652	inframe_insertion	388015				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.453_455dupAGA	14.37:g.101350671_101350673dupTCT	ENSP00000435342:p.Glu152dup		100420423	E9PKS8	In_Frame_Ins	INS	ENST00000534062.1	37	CCDS53910.1	INS	28	Broad																																																																																				0.520	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888		In_Frame_Ins
TP53	7157	broad.mit.edu	37	17	7579556	7579560	+	Frame_Shift_Del	DEL	ATCAA	ATCAA	-			TCGA-13-0911-01	TCGA-13-0911-10			-	ATCAA	ATCAA	ATCAA	Unknown	Valid	Somatic	Phase_I	Capture	none			Illumina GAIIx	TCGA-13-0911-01	TCGA-13-0911-10	g.chr17:7579556_7579560delATCAA	ENST00000269305.4	-	4	316_320	c.127_131delTTGAT	c.(127-132)ttgatgfs	p.LM43fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.LM43fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Frame_Shift_Del_p.LM43fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.LM43fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.LM43fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.LM43fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	43	Interaction with HRMT1L2.|Transcription activation (acidic).		L -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.M44T(1)|p.M44fs*79(1)|p.L43fs*7(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.S37fs*79(1)|p.M44V(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGGGACAGCATCAAATCATCCATT	0.6		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	15	Whole gene deletion(8)|Deletion - Frameshift(5)|Substitution - Missense(2)	bone(4)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(2)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)|prostate(1)	17																																								7520285	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.127_131delTTGAT	17.37:g.7579556_7579560delATCAA	ENSP00000269305:p.Leu43fs		7520281	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	8	Broad																																																																																				0.600	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Del
