#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
AADACL4	343066	broad.mit.edu	37	1	12726045	12726045	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr1:12726045A>C	ENST00000376221.1	+	4	523	c.523A>C	c.(523-525)Aag>Cag	p.K175Q		NM_001013630.1	NP_001013652.1	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	175						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)	17	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		TCACTTCCTGAAGGCCCTGGA	0.577																																																0			1											87.0	86.0	86.0					1																	12726045		2203	4300	6503	12648632	SO:0001583	missense	343066				CCDS30590.1	1p36.21	2010-12-14			ENSG00000204518	ENSG00000204518			32038	protein-coding gene	gene with protein product							Standard	XM_006710608		Approved	OTTHUMG00000001889	uc001auf.3	Q5VUY2	OTTHUMG00000001889	ENST00000376221.1:c.523A>C	1.37:g.12726045A>C	ENSP00000365395:p.Lys175Gln		12648632		Missense_Mutation	SNP	ENST00000376221.1	37	CCDS30590.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	15.54	2.864712	0.51482	.	.	ENSG00000204518	ENST00000376221	T	0.59502	0.26	4.23	3.08	0.35506	Alpha/beta hydrolase fold-3 (1);	0.446555	0.22950	N	0.053670	T	0.56601	0.1996	L	0.41906	1.305	0.22081	N	0.999374	D	0.61697	0.99	P	0.62649	0.905	T	0.45381	-0.9265	10	0.12766	T	0.61	-11.5104	5.7169	0.17964	0.5817:0.3297:0.0886:0.0	.	175	Q5VUY2	ADCL4_HUMAN	Q	175	ENSP00000365395:K175Q	ENSP00000365395:K175Q	K	+	1	0	AADACL4	12648632	0.864000	0.29904	0.198000	0.23420	0.008000	0.06430	2.052000	0.41316	0.635000	0.30488	0.533000	0.62120	AAG		0.577	AADACL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005328.1	NM_001013630		Missense_Mutation
TRIM63	84676	broad.mit.edu	37	1	26387689	26387689	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr1:26387689C>A	ENST00000374272.3	-	3	607	c.469G>T	c.(469-471)Gcc>Tcc	p.A157S	TRIM63_ENST00000483052.1_5'Flank	NM_032588.3	NP_115977.2	Q969Q1	TRI63_HUMAN	tripartite motif containing 63, E3 ubiquitin protein ligase	157	Interaction with TTN.				cellular response to dexamethasone stimulus (GO:0071549)|muscle contraction (GO:0006936)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression (GO:0010468)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to interleukin-1 (GO:0070555)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|titin binding (GO:0031432)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A157S(1)		kidney(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TGCAATGGGGCCACCTCGCAG	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											102.0	81.0	88.0					1																	26387689		2203	4300	6503	26260276	SO:0001583	missense	84676			AF353673	CCDS273.1	1p34-p33	2014-09-17	2012-02-23	2004-11-17	ENSG00000158022	ENSG00000158022		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	16007	protein-coding gene	gene with protein product	"""muscle-specific RING finger protein 1"", ""iris ring finger protein"", ""striated muscle RING zinc finger protein"""	606131	"""ring finger protein 28"", ""tripartite motif-containing 63"", ""tripartite motif containing 63"""	RNF28		11243782, 11283016	Standard	NM_032588		Approved	MURF-1, IRF, SMRZ	uc001bli.2	Q969Q1	OTTHUMG00000007510	ENST00000374272.3:c.469G>T	1.37:g.26387689C>A	ENSP00000363390:p.Ala157Ser		26260276	B4DN95|Q5T2I1|Q96BD3|Q96KD9|Q9BYV4	Missense_Mutation	SNP	ENST00000374272.3	37	CCDS273.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939488	0.52972	.	.	ENSG00000158022	ENST00000374272	T	0.41065	1.01	5.12	5.12	0.69794	Zinc finger, B-box (2);	0.153352	0.64402	D	0.000018	T	0.45716	0.1356	L	0.37561	1.115	0.52501	D	0.99995	B	0.32382	0.368	P	0.46917	0.531	T	0.35992	-0.9766	10	0.33141	T	0.24	.	13.5014	0.61457	0.1565:0.8435:0.0:0.0	.	157	Q969Q1	TRI63_HUMAN	S	157	ENSP00000363390:A157S	ENSP00000363390:A157S	A	-	1	0	TRIM63	26260276	0.991000	0.36638	1.000000	0.80357	0.852000	0.48524	2.335000	0.43929	2.542000	0.85734	0.591000	0.81541	GCC		0.567	TRIM63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019750.1	NM_032588		Missense_Mutation
RPE65	6121	broad.mit.edu	37	1	68904683	68904683	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr1:68904683G>C	ENST00000262340.5	-	9	993	c.940C>G	c.(940-942)Cac>Gac	p.H314D		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	314					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)	p.H314D(1)		central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						GTGTTGATGTGATGGAAGAGG	0.393																																																1	Substitution - Missense(1)	ovary(1)	1											268.0	262.0	264.0					1																	68904683		2203	4300	6503	68677271	SO:0001583	missense	6121			U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.940C>G	1.37:g.68904683G>C	ENSP00000262340:p.His314Asp		68677271	A8K1L0|Q5T9U3	Missense_Mutation	SNP	ENST00000262340.5	37	CCDS643.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996469	0.74818	.	.	ENSG00000116745	ENST00000262340	D	0.95035	-3.59	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.97620	0.9220	M	0.91406	3.205	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.97808	1.0249	10	0.51188	T	0.08	-1.7492	18.0217	0.89257	0.0:0.0:1.0:0.0	.	314	Q16518	RPE65_HUMAN	D	314	ENSP00000262340:H314D	ENSP00000262340:H314D	H	-	1	0	RPE65	68677271	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.256000	0.74724	0.650000	0.86243	CAC		0.393	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329		Missense_Mutation
PTGFR	5737	broad.mit.edu	37	1	78958855	78958855	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr1:78958855C>A	ENST00000370757.3	+	2	664	c.427C>A	c.(427-429)Cat>Aat	p.H143N	PTGFR_ENST00000370758.1_Missense_Mutation_p.H143N|PTGFR_ENST00000370756.3_Missense_Mutation_p.H143N	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	143					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)	p.H143N(2)		breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	ACCAATATTTCATTCTACGAA	0.413																																																2	Substitution - Missense(2)	ovary(2)	1											163.0	157.0	159.0					1																	78958855		2203	4300	6503	78731443	SO:0001583	missense	5737			AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.427C>A	1.37:g.78958855C>A	ENSP00000359793:p.His143Asn		78731443	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	37	CCDS686.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408424	0.83340	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.37058	1.22;1.22;1.22	5.85	5.85	0.93711	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.54791	0.1880	M	0.62723	1.935	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.51647	-0.8679	10	0.62326	D	0.03	-16.2117	20.5471	0.99284	0.0:1.0:0.0:0.0	.	143;143	P43088;P43088-2	PF2R_HUMAN;.	N	143	ENSP00000359794:H143N;ENSP00000359793:H143N;ENSP00000359792:H143N	ENSP00000359792:H143N	H	+	1	0	PTGFR	78731443	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CAT		0.413	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959		Missense_Mutation
ODF2L	57489	broad.mit.edu	37	1	86822227	86822227	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr1:86822227G>A	ENST00000359242.3	-	14	1699	c.1418C>T	c.(1417-1419)aCg>aTg	p.T473M	ODF2L_ENST00000370566.3_Intron|ODF2L_ENST00000524695.1_5'UTR|ODF2L_ENST00000370567.1_Missense_Mutation_p.T444M|ODF2L_ENST00000394731.1_Missense_Mutation_p.T313M|ODF2L_ENST00000294678.2_Missense_Mutation_p.T444M|ODF2L_ENST00000317336.7_Missense_Mutation_p.T473M	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	473						centrosome (GO:0005813)		p.T444M(1)		endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		TTCCGCCGCCGTCAAGGAATC	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											76.0	69.0	71.0					1																	86822227		2203	4300	6503	86594815	SO:0001583	missense	57489				CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.1418C>T	1.37:g.86822227G>A	ENSP00000359600:p.Thr473Met		86594815	A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Missense_Mutation	SNP	ENST00000359242.3	37	CCDS41354.2	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	5.900	0.350180	0.11182	.	.	ENSG00000122417	ENST00000441121;ENST00000359242;ENST00000460698;ENST00000317336;ENST00000370567;ENST00000394731;ENST00000294678	T;T;T;T;T;T	0.78595	1.93;-1.16;1.93;1.93;1.93;-1.19	6.16	1.92	0.25849	.	0.610713	0.17247	N	0.181325	T	0.48519	0.1504	L	0.44542	1.39	0.09310	N	0.999999	B;B;B	0.22003	0.041;0.063;0.063	B;B;B	0.14578	0.011;0.009;0.005	T	0.46400	-0.9194	10	0.52906	T	0.07	1.2498	6.8467	0.23992	0.1669:0.0:0.6431:0.19	.	444;444;473	Q9ULJ1-4;Q9ULJ1-3;Q9ULJ1	.;.;ODF2L_HUMAN	M	444;473;320;473;444;313;444	ENSP00000359600:T473M;ENSP00000433092:T320M;ENSP00000320165:T473M;ENSP00000359598:T444M;ENSP00000378219:T313M;ENSP00000294678:T444M	ENSP00000294678:T444M	T	-	2	0	ODF2L	86594815	0.992000	0.36948	0.393000	0.26258	0.011000	0.07611	1.672000	0.37523	0.488000	0.27723	-0.961000	0.02630	ACG		0.542	ODF2L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027873.2			Missense_Mutation
ABCA4	24	broad.mit.edu	37	1	94522197	94522197	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0913-01	TCGA-13-0913-10			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr1:94522197G>T	ENST00000370225.3	-	15	2428	c.2342C>A	c.(2341-2343)gCc>gAc	p.A781D	ABCA4_ENST00000535735.1_Intron	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	781					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.A781D(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GTCCTGCCAGGCGAAGCACAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											71.0	60.0	63.0					1																	94522197		2203	4300	6503	94294785	SO:0001583	missense	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.2342C>A	1.37:g.94522197G>T	ENSP00000359245:p.Ala781Asp		94294785	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	25.8	4.680085	0.88542	.	.	ENSG00000198691	ENST00000370225	T	0.78126	-1.15	5.36	5.36	0.76844	.	0.051999	0.85682	D	0.000000	T	0.78855	0.4349	M	0.88450	2.955	0.80722	D	1	B	0.26120	0.142	B	0.36030	0.216	T	0.81324	-0.0984	10	0.87932	D	0	.	13.2323	0.59951	0.0833:0.0:0.9167:0.0	.	781	P78363	ABCA4_HUMAN	D	781	ENSP00000359245:A781D	ENSP00000359245:A781D	A	-	2	0	ABCA4	94294785	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.011000	0.57124	2.673000	0.90976	0.561000	0.74099	GCC		0.582	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350		Missense_Mutation
LCE2C	353140	broad.mit.edu	37	1	152648709	152648709	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr1:152648709T>G	ENST00000368783.1	+	2	273	c.218T>G	c.(217-219)cTg>cGg	p.L73R	LCE2B_ENST00000417924.2_Intron	NM_178429.2	NP_848516.1	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	73	Cys-rich.				keratinization (GO:0031424)			p.L73R(1)		endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	13	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCTGCTCCCTGAGCCACCAC	0.662																																																1	Substitution - Missense(1)	ovary(1)	1											51.0	61.0	58.0					1																	152648709		2203	4300	6503	150915333	SO:0001583	missense	353140				CCDS1019.1	1q21.3	2008-02-05			ENSG00000187180	ENSG00000187180		"""Late cornified envelopes"""	29460	protein-coding gene	gene with protein product		612611				11698679	Standard	NM_178429		Approved	LEP11	uc001fah.4	Q5TA81	OTTHUMG00000012389	ENST00000368783.1:c.218T>G	1.37:g.152648709T>G	ENSP00000357772:p.Leu73Arg		150915333		Missense_Mutation	SNP	ENST00000368783.1	37	CCDS1019.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	3.042	-0.197362	0.06259	.	.	ENSG00000187180	ENST00000368783	T	0.10477	2.87	3.15	3.15	0.36227	.	.	.	.	.	T	0.12433	0.0302	M	0.79805	2.47	0.23238	N	0.998063	D	0.54397	0.966	P	0.52343	0.696	T	0.06338	-1.0832	9	0.87932	D	0	.	7.9444	0.29978	0.0:0.0:0.0:1.0	.	73	Q5TA81	LCE2C_HUMAN	R	73	ENSP00000357772:L73R	ENSP00000357772:L73R	L	+	2	0	LCE2C	150915333	0.994000	0.37717	0.998000	0.56505	0.055000	0.15305	0.418000	0.21230	1.439000	0.47511	0.460000	0.39030	CTG		0.662	LCE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034509.1	NM_178429		Missense_Mutation
LMNA	4000	broad.mit.edu	37	1	156108320	156108320	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr1:156108320C>A	ENST00000368300.4	+	11	1952	c.1740C>A	c.(1738-1740)aaC>aaA	p.N580K	LMNA_ENST00000347559.2_Missense_Mutation_p.N550K|LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000368299.3_Missense_Mutation_p.N580K|LMNA_ENST00000473598.2_Missense_Mutation_p.N481K|LMNA_ENST00000448611.2_Missense_Mutation_p.N468K	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	580	Tail.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)	p.N580K(1)		NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					CTGAGTACAACCTGCGCTCGC	0.701									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																																							1	Substitution - Missense(1)	ovary(1)	1											15.0	16.0	16.0					1																	156108320		2198	4290	6488	154374944	SO:0001583	missense	4000	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.1740C>A	1.37:g.156108320C>A	ENSP00000357283:p.Asn580Lys		154374944	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Missense_Mutation	SNP	ENST00000368300.4	37	CCDS1129.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	25.9	4.685235	0.88639	.	.	ENSG00000160789	ENST00000347559;ENST00000368300;ENST00000368299;ENST00000448611;ENST00000473598;ENST00000508500	D;D;D;D;D;D	0.95171	-2.71;-2.12;-2.1;-1.91;-1.87;-3.63	5.29	5.29	0.74685	.	0.000000	0.64402	D	0.000006	D	0.94394	0.8197	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.97;0.982	D;D;P;P	0.78314	0.991;0.991;0.749;0.831	D	0.95580	0.8645	10	0.72032	D	0.01	.	16.4229	0.83772	0.0:1.0:0.0:0.0	.	580;481;580;550	Q6UYC3;D6RAQ3;P02545;P02545-3	.;.;LMNA_HUMAN;.	K	550;580;580;468;481;176	ENSP00000292304:N550K;ENSP00000357283:N580K;ENSP00000357282:N580K;ENSP00000395597:N468K;ENSP00000421821:N481K;ENSP00000424977:N176K	ENSP00000292304:N550K	N	+	3	2	LMNA	154374944	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.343000	0.59348	2.448000	0.82819	0.655000	0.94253	AAC		0.701	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707		Missense_Mutation
LBR	3930	broad.mit.edu	37	1	225598020	225598020	+	Silent	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr1:225598020G>C	ENST00000338179.2	-	10	1412	c.1287C>G	c.(1285-1287)ctC>ctG	p.L429L	AC092811.1_ENST00000366845.2_5'Flank|LBR_ENST00000272163.4_Silent_p.L429L	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	429					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)	p.L429L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		CCACCACATAGAGAAGCTGGA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	1											116.0	114.0	115.0					1																	225598020		2203	4300	6503	223664643	SO:0001819	synonymous_variant	3930			L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.1287C>G	1.37:g.225598020G>C			223664643	B2R5P3|Q14740|Q53GU7|Q59FE6	Silent	SNP	ENST00000338179.2	37	CCDS1545.1	SNP	33	Broad																																																																																				0.458	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296		Silent
CUBN	8029	broad.mit.edu	37	10	17142218	17142218	+	Silent	SNP	A	A	G			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr10:17142218A>G	ENST00000377833.4	-	14	1616	c.1551T>C	c.(1549-1551)acT>acC	p.T517T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	517	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.T517T(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACCGGAAAAAAGTGAAAGTGA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	10											65.0	66.0	66.0					10																	17142218		2203	4299	6502	17182224	SO:0001819	synonymous_variant	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1551T>C	10.37:g.17142218A>G			17182224	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	CCDS7113.1	SNP	3	Broad																																																																																				0.378	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		Silent
MYPN	84665	broad.mit.edu	37	10	69955245	69955245	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr10:69955245T>G	ENST00000358913.5	+	15	3602	c.3114T>G	c.(3112-3114)agT>agG	p.S1038R	MYPN_ENST00000540630.1_Missense_Mutation_p.S1038R|MYPN_ENST00000354393.2_Missense_Mutation_p.S763R	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	1038	Interaction with ACTN.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.S1038R(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						TGGTACAAAGTTTGCCCATTC	0.448																																																1	Substitution - Missense(1)	ovary(1)	10											105.0	100.0	102.0					10																	69955245		2203	4300	6503	69625251	SO:0001583	missense	84665			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.3114T>G	10.37:g.69955245T>G	ENSP00000351790:p.Ser1038Arg		69625251	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	CCDS7275.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	14.68	2.608238	0.46527	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.41758	0.99;0.99;0.99	5.45	5.45	0.79879	.	0.378995	0.30473	N	0.009554	T	0.31420	0.0796	L	0.40543	1.245	0.34361	D	0.691	P;P;B	0.36909	0.573;0.573;0.357	B;B;B	0.32289	0.143;0.143;0.122	T	0.47736	-0.9094	9	.	.	.	.	11.7531	0.51859	0.0:0.0714:0.0:0.9286	.	1038;763;1038	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	R	763;763;1038;1038	ENSP00000346369:S763R;ENSP00000351790:S1038R;ENSP00000441668:S1038R	.	S	+	3	2	MYPN	69625251	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	2.130000	0.42064	2.197000	0.70478	0.533000	0.62120	AGT		0.448	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578		Missense_Mutation
ADAMTS14	140766	broad.mit.edu	37	10	72500889	72500889	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr10:72500889A>T	ENST00000373207.1	+	12	1895	c.1895A>T	c.(1894-1896)cAc>cTc	p.H632L	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.H635L	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	632	Cys-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.H635L(1)		NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						AATGCCAAGCACAGCTGGGTG	0.642																																																1	Substitution - Missense(1)	ovary(1)	10											65.0	56.0	59.0					10																	72500889		2203	4300	6503	72170895	SO:0001583	missense	140766			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.1895A>T	10.37:g.72500889A>T	ENSP00000362303:p.His632Leu		72170895	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	31	5.069418	0.93950	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.03330	3.97;3.97	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.13243	0.0321	L	0.60067	1.865	0.50632	D	0.999886	D;P;P	0.89917	1.0;0.949;0.949	D;P;P	0.79784	0.993;0.714;0.642	T	0.23868	-1.0176	10	0.16896	T	0.51	.	15.0313	0.71708	1.0:0.0:0.0:0.0	.	565;632;635	Q8WXS8-2;Q8WXS8;Q5T4G1	.;ATS14_HUMAN;.	L	635;632	ENSP00000362304:H635L;ENSP00000362303:H632L	ENSP00000362303:H632L	H	+	2	0	ADAMTS14	72170895	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.761000	0.91691	2.209000	0.71365	0.533000	0.62120	CAC		0.642	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722		Missense_Mutation
PACS1	55690	broad.mit.edu	37	11	65838133	65838133	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr11:65838133C>G	ENST00000320580.4	+	1	209	c.176C>G	c.(175-177)tCc>tGc	p.S59C	RP11-1167A19.2_ENST00000529036.1_5'Flank	NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	59	Ser-rich.				protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.S59C(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						TCGTCCTCGTCCACCTCGGCG	0.766																																																1	Substitution - Missense(1)	ovary(1)	11											8.0	9.0	9.0					11																	65838133		2139	4194	6333	65594709	SO:0001583	missense	55690			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.176C>G	11.37:g.65838133C>G	ENSP00000316454:p.Ser59Cys		65594709	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	ENST00000320580.4	37	CCDS8129.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	13.75	2.330211	0.41297	.	.	ENSG00000175115	ENST00000320580	T	0.22539	1.95	2.86	2.86	0.33363	.	.	.	.	.	T	0.12433	0.0302	N	0.08118	0	0.80722	D	1	P;D	0.53885	0.842;0.963	B;P	0.45310	0.184;0.476	T	0.07309	-1.0779	9	0.59425	D	0.04	-1.859	9.3115	0.37908	0.0:1.0:0.0:0.0	.	59;59	Q6VY07;Q6VY07-2	PACS1_HUMAN;.	C	59	ENSP00000316454:S59C	ENSP00000316454:S59C	S	+	2	0	PACS1	65594709	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	1.439000	0.35013	1.621000	0.50320	0.195000	0.17529	TCC		0.766	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026		Missense_Mutation
SERPINH1	871	broad.mit.edu	37	11	75277634	75277634	+	Silent	SNP	C	C	G	rs367576479		TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr11:75277634C>G	ENST00000524558.1	+	2	1675	c.240C>G	c.(238-240)ctC>ctG	p.L80L	SERPINH1_ENST00000525876.1_5'Flank|SERPINH1_ENST00000358171.3_Silent_p.L80L|SERPINH1_ENST00000533603.1_Silent_p.L80L|SERPINH1_ENST00000530284.1_Silent_p.L80L			P50454	SERPH_HUMAN	serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)	80					chondrocyte development involved in endochondral bone morphogenesis (GO:0003433)|collagen biosynthetic process (GO:0032964)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|protein maturation (GO:0051604)|regulation of proteolysis (GO:0030162)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L80L(1)		endometrium(4)|large_intestine(3)|liver(1)|lung(4)|ovary(2)|stomach(1)	15	Ovarian(111;0.11)					CGCTAGGGCTCGTGTCGCTGG	0.706																																																1	Substitution - coding silent(1)	ovary(1)	11											42.0	31.0	35.0					11																	75277634		2198	4292	6490	74955282	SO:0001819	synonymous_variant	871			X61598	CCDS8239.1	11q13.5	2014-02-18	2005-08-18		ENSG00000149257	ENSG00000149257		"""Serine (or cysteine) peptidase inhibitors"""	1546	protein-coding gene	gene with protein product		600943	"""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2"", ""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)"""	CBP1, CBP2, SERPINH2		7656593, 9533029, 24172014	Standard	NM_001207014		Approved	HSP47, colligen	uc001owr.3	P50454	OTTHUMG00000165362	ENST00000524558.1:c.240C>G	11.37:g.75277634C>G			74955282	B3KVJ3|P29043|Q5XPB4|Q6NSJ6|Q8IY96|Q9NP88	Silent	SNP	ENST00000524558.1	37	CCDS8239.1	SNP	31	Broad																																																																																				0.706	SERPINH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383610.1	NM_004353		Silent
FAT3	120114	broad.mit.edu	37	11	92086995	92086995	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr11:92086995G>A	ENST00000298047.6	+	1	1734	c.1717G>A	c.(1717-1719)Gac>Aac	p.D573N	FAT3_ENST00000409404.2_Missense_Mutation_p.D573N|FAT3_ENST00000541502.1_Missense_Mutation_p.D573N|FAT3_ENST00000525166.1_Missense_Mutation_p.D423N			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	573	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AAATGTCAACGACAACAGCCC	0.448										TCGA Ovarian(4;0.039)																																						0			11											66.0	70.0	69.0					11																	92086995		1883	4119	6002	91726643	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.1717G>A	11.37:g.92086995G>A	ENSP00000298047:p.Asp573Asn		91726643	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	23.4	4.413659	0.83449	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.93	5.93	0.95920	.	.	.	.	.	D	0.84777	0.5547	M	0.92122	3.275	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86737	0.1952	9	0.56958	D	0.05	.	19.3377	0.94326	0.0:0.0:1.0:0.0	.	573	Q8TDW7-3	.	N	573;573;573;423	ENSP00000298047:D573N;ENSP00000387040:D573N;ENSP00000443786:D573N;ENSP00000432586:D423N	ENSP00000298047:D573N	D	+	1	0	FAT3	91726643	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	9.787000	0.99055	2.814000	0.96858	0.591000	0.81541	GAC		0.448	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		Missense_Mutation
WNK1	65125	broad.mit.edu	37	12	939281	939281	+	Silent	SNP	C	C	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr12:939281C>T	ENST00000315939.6	+	4	1909	c.1266C>T	c.(1264-1266)taC>taT	p.Y422Y	WNK1_ENST00000540360.1_3'UTR|WNK1_ENST00000537687.1_Silent_p.Y422Y|WNK1_ENST00000530271.2_Silent_p.Y422Y|WNK1_ENST00000535572.1_Silent_p.Y422Y	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	422	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.Y422Y(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			AATATCCTTACTCGGAGTGCC	0.453																																					Colon(19;451 567 6672 12618 28860)											1	Substitution - coding silent(1)	ovary(1)	12											220.0	183.0	196.0					12																	939281		2203	4300	6503	809542	SO:0001819	synonymous_variant	65125			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1266C>T	12.37:g.939281C>T			809542	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	ENST00000315939.6	37	CCDS8506.1	SNP	20	Broad																																																																																				0.453	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979		Silent
H2AFJ	55766	broad.mit.edu	37	12	14927683	14927683	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr12:14927683G>C	ENST00000544848.1	+	1	414	c.279G>C	c.(277-279)gaG>gaC	p.E93D		NM_177925.2	NP_808760.1	Q9BTM1	H2AJ_HUMAN	H2A histone family, member J	93						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E93D(1)		NS(1)|central_nervous_system(1)|kidney(1)|ovary(1)|skin(1)	5						ACGACGAGGAGTTAAACAAGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	12											78.0	78.0	78.0					12																	14927683		2203	4300	6503	14818950	SO:0001583	missense	55766			AK001765	CCDS31752.1	12p12.3	2012-09-11			ENSG00000246705	ENSG00000246705		"""Histones / Replication-independent"""	14456	protein-coding gene	gene with protein product							Standard	NM_177925		Approved	FLJ10903, MGC921	uc009zia.3	Q9BTM1	OTTHUMG00000168736	ENST00000544848.1:c.279G>C	12.37:g.14927683G>C	ENSP00000438553:p.Glu93Asp		14818950	Q9NV63	Missense_Mutation	SNP	ENST00000544848.1	37	CCDS31752.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	17.84	3.487883	0.64074	.	.	ENSG00000246705	ENST00000544848;ENST00000228929	D;T	0.87729	-2.29;0.68	4.78	2.01	0.26516	Histone-fold (2);Histone H2A (1);	.	.	.	.	D	0.91099	0.7198	M	0.89658	3.05	0.39559	D	0.969106	P	0.51351	0.944	P	0.52424	0.698	D	0.90599	0.4543	9	0.87932	D	0	.	8.5962	0.33716	0.2569:0.0:0.7431:0.0	.	93	Q9BTM1	H2AJ_HUMAN	D	93	ENSP00000438553:E93D;ENSP00000228929:E93D	ENSP00000228929:E93D	E	+	3	2	H2AFJ	14818950	1.000000	0.71417	0.994000	0.49952	0.932000	0.56968	4.654000	0.61469	0.493000	0.27837	0.650000	0.86243	GAG		0.617	H2AFJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400845.1	NM_177925		Missense_Mutation
STK38L	23012	broad.mit.edu	37	12	27470948	27470948	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0913-01	TCGA-13-0913-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr12:27470948C>A	ENST00000389032.3	+	11	1244	c.1075C>A	c.(1075-1077)Ctc>Atc	p.L359I	STK38L_ENST00000539577.1_Missense_Mutation_p.L266I	NM_015000.3	NP_055815.1			serine/threonine kinase 38 like									p.L359I(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12	Colorectal(261;0.0847)					GGACTTAATTCTCAGGTTAGT	0.398																																																1	Substitution - Missense(1)	ovary(1)	12											52.0	53.0	53.0					12																	27470948		2202	4300	6502	27362215	SO:0001583	missense	23012			AB023182	CCDS31761.1	12p11.23	2014-04-23			ENSG00000211455	ENSG00000211455			17848	protein-coding gene	gene with protein product	"""nuclear Dbf2-related 2"""	615836				16488889	Standard	NM_015000		Approved	KIAA0965, NDR2	uc001rhr.3	Q9Y2H1	OTTHUMG00000169284	ENST00000389032.3:c.1075C>A	12.37:g.27470948C>A	ENSP00000373684:p.Leu359Ile		27362215		Missense_Mutation	SNP	ENST00000389032.3	37	CCDS31761.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	13.03	2.114254	0.37339	.	.	ENSG00000211455	ENST00000389032;ENST00000539577	T;T	0.65364	-0.15;-0.15	4.54	3.65	0.41850	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.47746	0.1462	N	0.17800	0.525	0.58432	D	0.999997	B;B	0.17038	0.02;0.009	B;B	0.24701	0.048;0.055	T	0.42378	-0.9455	10	0.34782	T	0.22	.	13.6036	0.62035	0.0:0.9237:0.0:0.0763	.	266;359	B4E3J8;Q9Y2H1	.;ST38L_HUMAN	I	359;266	ENSP00000373684:L359I;ENSP00000446386:L266I	ENSP00000373684:L359I	L	+	1	0	STK38L	27362215	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.957000	0.49137	1.508000	0.48769	0.557000	0.71058	CTC		0.398	STK38L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403297.1	NM_015000		Missense_Mutation
CEP290	80184	broad.mit.edu	37	12	88465654	88465654	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr12:88465654G>C	ENST00000552810.1	-	42	6102	c.5759C>G	c.(5758-5760)gCc>gGc	p.A1920G	CEP290_ENST00000397838.3_Missense_Mutation_p.A980G|CEP290_ENST00000309041.7_Missense_Mutation_p.A1922G|CEP290_ENST00000547691.2_Missense_Mutation_p.A980G	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1920					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.A1922G(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TTCTATTTTGGCTTGCCACTT	0.333																																																1	Substitution - Missense(1)	ovary(1)	12											101.0	90.0	93.0					12																	88465654		1811	4068	5879	86989785	SO:0001583	missense	80184			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.5759C>G	12.37:g.88465654G>C	ENSP00000448012:p.Ala1920Gly		86989785	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878295	0.33162	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.65916	0.4;-0.18;-0.18;0.4	5.34	1.06	0.20224	.	0.564024	0.20852	N	0.084519	T	0.47002	0.1422	L	0.34521	1.04	0.19945	N	0.999949	B	0.27498	0.18	B	0.26310	0.068	T	0.25047	-1.0143	10	0.22706	T	0.39	.	11.9379	0.52884	0.1162:0.6585:0.2253:0.0	.	1920	O15078	CE290_HUMAN	G	980;1920;1922;980	ENSP00000446905:A980G;ENSP00000448012:A1920G;ENSP00000308021:A1922G;ENSP00000380938:A980G	ENSP00000308021:A1922G	A	-	2	0	CEP290	86989785	1.000000	0.71417	0.928000	0.36995	0.806000	0.45545	1.384000	0.34396	-0.094000	0.12374	0.460000	0.39030	GCC		0.333	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114		Missense_Mutation
MYH7	4625	broad.mit.edu	37	14	23901923	23901923	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr14:23901923G>A	ENST00000355349.3	-	5	589	c.427C>T	c.(427-429)Cgg>Tgg	p.R143W		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	143	Myosin motor.		R -> G (in CMH1). {ECO:0000269|PubMed:12820698}.|R -> Q (in CMH1). {ECO:0000269|PubMed:15358028, ECO:0000269|PubMed:15563892}.|R -> W (in CMH1). {ECO:0000269|PubMed:12974739}.		adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.R143W(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TTCTTGCCCCGGTAGGCAGCC	0.597																																																1	Substitution - Missense(1)	ovary(1)	14	GRCh37	CM032601|CM034049	MYH7	M							77.0	75.0	75.0					14																	23901923		2203	4300	6503	22971763	SO:0001583	missense	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.427C>T	14.37:g.23901923G>A	ENSP00000347507:p.Arg143Trp		22971763	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	g	17.13	3.311190	0.60414	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.88277	-2.36	3.61	2.61	0.31194	Myosin head, motor domain (2);	.	.	.	.	D	0.94948	0.8366	M	0.93106	3.38	0.50813	D	0.999898	D	0.89917	1.0	D	0.71656	0.974	D	0.95580	0.8645	9	0.87932	D	0	.	12.7883	0.57518	0.0:0.0:0.8364:0.1636	.	143	P12883	MYH7_HUMAN	W	143	ENSP00000347507:R143W	ENSP00000347507:R143W	R	-	1	2	MYH7	22971763	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	0.556000	0.23438	2.015000	0.59207	0.455000	0.32223	CGG		0.597	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		Missense_Mutation
DLK1	8788	broad.mit.edu	37	14	101201221	101201221	+	Silent	SNP	C	C	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr14:101201221C>T	ENST00000341267.4	+	5	1382	c.1140C>T	c.(1138-1140)gaC>gaT	p.D380D	DLK1_ENST00000331224.6_Silent_p.D307D|RP11-566J3.4_ENST00000608876.1_lincRNA	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	380					cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.D380D(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				AGGCCGGCGACGAGGAGATCT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	14											85.0	86.0	86.0					14																	101201221		2203	4300	6503	100270974	SO:0001819	synonymous_variant	8788			U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.1140C>T	14.37:g.101201221C>T			100270974	P15803|Q96DW5	Silent	SNP	ENST00000341267.4	37	CCDS9963.1	SNP	19	Broad																																																																																				0.547	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414389.1			Silent
THBS1	7057	broad.mit.edu	37	15	39876542	39876542	+	Silent	SNP	T	T	A			TCGA-13-0913-01	TCGA-13-0913-10			T	A	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr15:39876542T>A	ENST00000260356.5	+	6	1110	c.945T>A	c.(943-945)ccT>ccA	p.P315P		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	315					activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)	p.P315P(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		TGAGGCGGCCTCCCCTATGCT	0.483																																																1	Substitution - coding silent(1)	ovary(1)	15											100.0	97.0	98.0					15																	39876542		2200	4297	6497	37663834	SO:0001819	synonymous_variant	7057				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.945T>A	15.37:g.39876542T>A			37663834	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Silent	SNP	ENST00000260356.5	37	CCDS32194.1	SNP	54	Broad																																																																																				0.483	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246		Silent
TTBK2	146057	broad.mit.edu	37	15	43045190	43045190	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr15:43045190G>C	ENST00000267890.6	-	14	2362	c.2254C>G	c.(2254-2256)Caa>Gaa	p.Q752E		NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	752					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q752E(1)		NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		CCCAGGTCTTGAGATTTGTTA	0.418																																																1	Substitution - Missense(1)	ovary(1)	15											204.0	192.0	196.0					15																	43045190		1859	4096	5955	40832482	SO:0001583	missense	146057			AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.2254C>G	15.37:g.43045190G>C	ENSP00000267890:p.Gln752Glu		40832482	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	ENST00000267890.6	37	CCDS42029.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	13.66	2.303755	0.40795	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	T	0.37752	1.18	5.64	5.64	0.86602	.	1.308940	0.04923	N	0.455412	T	0.43567	0.1253	L	0.54323	1.7	0.80722	D	1	P;B	0.36837	0.571;0.435	B;B	0.33392	0.163;0.078	T	0.45160	-0.9280	10	0.44086	T	0.13	.	19.6981	0.96039	0.0:0.0:1.0:0.0	.	683;752	Q6IQ55-2;Q6IQ55	.;TTBK2_HUMAN	E	752;682;1157	ENSP00000267890:Q752E	ENSP00000263802:Q1157E	Q	-	1	0	TTBK2	40832482	0.972000	0.33761	1.000000	0.80357	0.988000	0.76386	1.839000	0.39220	2.651000	0.90000	0.591000	0.81541	CAA		0.418	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2	NM_173500		Missense_Mutation
HAPLN3	145864	broad.mit.edu	37	15	89422472	89422472	+	Silent	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr15:89422472G>A	ENST00000359595.3	-	4	736	c.522C>T	c.(520-522)aaC>aaT	p.N174N	HAPLN3_ENST00000562889.1_Silent_p.N236N	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	174	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)	p.N174N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	GGTAGCGCCCGTTGGGGGACT	0.657											OREG0023445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	15											39.0	45.0	43.0					15																	89422472		2200	4299	6499	87223476	SO:0001819	synonymous_variant	145864			AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.522C>T	15.37:g.89422472G>A		1267	87223476	A8K7P0	Silent	SNP	ENST00000359595.3	37	CCDS10346.1	SNP	40	Broad																																																																																				0.657	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309070.1	NM_178232		Silent
IL4R	3566	broad.mit.edu	37	16	27374402	27374402	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr16:27374402G>A	ENST00000395762.2	+	11	1988	c.1729G>A	c.(1729-1731)Gag>Aag	p.E577K	IL4R_ENST00000543915.2_Missense_Mutation_p.E577K|IL4R_ENST00000170630.2_Missense_Mutation_p.E577K|IL4R_ENST00000380922.3_Missense_Mutation_p.E562K	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	577	Required for IL4-induced gene expression.				defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)	p.E577K(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						TGGCTATCAGGAGTTTGTACA	0.642																																																1	Substitution - Missense(1)	ovary(1)	16											27.0	33.0	31.0					16																	27374402		2197	4300	6497	27281903	SO:0001583	missense	3566			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.1729G>A	16.37:g.27374402G>A	ENSP00000379111:p.Glu577Lys		27281903	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	ENST00000395762.2	37	CCDS10629.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187081	0.38609	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T	0.11169	2.8;2.8;2.8;2.8	4.81	1.39	0.22231	.	4.695580	0.00687	N	0.000700	T	0.13970	0.0338	M	0.62723	1.935	0.09310	N	1	P;P;P	0.39809	0.689;0.689;0.689	B;B;B	0.38954	0.286;0.286;0.286	T	0.21008	-1.0258	10	0.56958	D	0.05	-27.4398	2.1198	0.03723	0.1107:0.1614:0.4751:0.2528	.	562;577;577	B4E076;B9EGC0;P24394	.;.;IL4RA_HUMAN	K	577;577;562;577	ENSP00000379111:E577K;ENSP00000441667:E577K;ENSP00000370309:E562K;ENSP00000170630:E577K	ENSP00000170630:E577K	E	+	1	0	IL4R	27281903	0.992000	0.36948	0.129000	0.21949	0.606000	0.37113	1.806000	0.38892	0.449000	0.26747	0.555000	0.69702	GAG		0.642	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4			Missense_Mutation
TUBB3	10381	broad.mit.edu	37	16	89999963	89999963	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr16:89999963T>C	ENST00000315491.7	+	3	377	c.254T>C	c.(253-255)tTc>tCc	p.F85S	TUBB3_ENST00000555576.1_Missense_Mutation_p.F85S|TUBB3_ENST00000554336.1_Missense_Mutation_p.F85S|TUBB3_ENST00000556922.1_Missense_Mutation_p.F432S|TUBB3_ENST00000304984.5_Missense_Mutation_p.F13S|TUBB3_ENST00000553967.1_Missense_Mutation_p.F85S|TUBB3_ENST00000554444.1_Missense_Mutation_p.F13S	NM_006086.3	NP_006077.2	Q13509	TBB3_HUMAN	tubulin, beta 3 class III	85					'de novo' posttranslational protein folding (GO:0051084)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.F85S(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)	Ixabepilone(DB04845)	GGACATCTCTTCAGGCCTGAC	0.587																																																1	Substitution - Missense(1)	ovary(1)	16											175.0	168.0	170.0					16																	89999963		2198	4300	6498	88527464	SO:0001583	missense	10381			BC000748	CCDS10988.1, CCDS56012.1	16q24.3	2014-02-04	2011-10-10		ENSG00000198211	ENSG00000198211		"""Tubulins"""	20772	protein-coding gene	gene with protein product	"""class III beta-tubulin"""	602661	"""tubulin, beta 3"", ""fibrosis of extraocular muscles, congenital, 3"""	FEOM3		9473684, 8098743, 20074521	Standard	NM_006086		Approved	beta-4, CFEOM3, CFEOM3A	uc002fph.2	Q13509	OTTHUMG00000138985	ENST00000315491.7:c.254T>C	16.37:g.89999963T>C	ENSP00000320295:p.Phe85Ser		88527464	A8K854|Q9BTZ0|Q9BW10	Missense_Mutation	SNP	ENST00000315491.7	37	CCDS10988.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	15.64	2.893819	0.52121	.	.	ENSG00000258947;ENSG00000258947;ENSG00000258947;ENSG00000258947;ENSG00000258947;ENSG00000198211;ENSG00000198211;ENSG00000198211;ENSG00000198211;ENSG00000198211	ENST00000556922;ENST00000555399;ENST00000554336;ENST00000553967;ENST00000304984;ENST00000555810;ENST00000554444;ENST00000556565;ENST00000315491;ENST00000555576	T;T;T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	4.57	4.57	0.56435	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.64402	D	0.000012	D	0.90484	0.7019	H	0.99404	4.55	0.50632	D	0.999881	P;D	0.89917	0.952;1.0	D;D	0.83275	0.983;0.996	D	0.93488	0.6833	9	.	.	.	.	12.1972	0.54305	0.0:0.0:0.0:1.0	.	85;85	Q13509;B2RBD5	TBB3_HUMAN;.	S	432;85;85;85;13;13;13;13;85;85	ENSP00000451560:F432S;ENSP00000450822:F85S;ENSP00000450765:F85S;ENSP00000302777:F13S;ENSP00000450538:F13S;ENSP00000451617:F13S;ENSP00000452166:F13S;ENSP00000320295:F85S;ENSP00000452554:F85S	.	F	+	2	0	RP11-566K11.2;TUBB3	88527464	1.000000	0.71417	0.995000	0.50966	0.581000	0.36288	7.852000	0.86927	1.830000	0.53286	0.528000	0.53228	TTC		0.587	TUBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272874.1	NM_006086		Missense_Mutation
YWHAE	7531	broad.mit.edu	37	17	1303362	1303362	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr17:1303362C>A	ENST00000264335.8	-	1	310	c.43G>T	c.(43-45)Gag>Tag	p.E15*	YWHAE_ENST00000573026.1_Nonsense_Mutation_p.E15*|YWHAE_ENST00000498643.1_5'UTR|YWHAE_ENST00000575977.1_Nonsense_Mutation_p.E15*|YWHAE_ENST00000571732.1_5'UTR	NM_006761.4	NP_006752.1	P62258	1433E_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon	15					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cerebral cortex development (GO:0021987)|G2/M transition of mitotic cell cycle (GO:0000086)|hippo signaling (GO:0035329)|hippocampus development (GO:0021766)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|mitotic cell cycle (GO:0000278)|negative regulation of peptidyl-serine dephosphorylation (GO:1902309)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|substantia nigra development (GO:0021762)|viral process (GO:0016032)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|membrane (GO:0016020)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|ion channel binding (GO:0044325)|MHC class II protein complex binding (GO:0023026)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|poly(A) RNA binding (GO:0044822)|potassium channel regulator activity (GO:0015459)|protein heterodimerization activity (GO:0046982)	p.E15*(1)		kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		TCAGCCTGCTCGGCCAGCTTC	0.652			T	"""FAM22a, FAM22B"""	edometrial stromal sarcoma		Miller-Dieker lissencephaly syndrome																																Dom	yes		17	17p13.3	7531	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (14-3-3 epsilon)"""	yes	M	1	Substitution - Nonsense(1)	ovary(1)	17											69.0	66.0	67.0					17																	1303362		2203	4300	6503	1250112	SO:0001587	stop_gained	7531			U54778	CCDS11001.1	17p13.3	2013-12-03	2013-12-03		ENSG00000108953	ENSG00000108953			12851	protein-coding gene	gene with protein product	"""14-3-3 epsilon"""	605066	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide"""			9371399	Standard	NM_006761		Approved	FLJ45465	uc002fsj.3	P62258	OTTHUMG00000134316	ENST00000264335.8:c.43G>T	17.37:g.1303362C>A	ENSP00000264335:p.Glu15*		1250112	B3KY71|D3DTH5|P29360|P42655|Q4VJB6|Q53XZ5|Q63631|Q7M4R4	Nonsense_Mutation	SNP	ENST00000264335.8	37	CCDS11001.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	40	8.335272	0.98764	.	.	ENSG00000108953	ENST00000264335	.	.	.	4.84	4.84	0.62591	.	0.134298	0.48286	U	0.000186	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-2.4581	15.4763	0.75481	0.0:1.0:0.0:0.0	.	.	.	.	X	15	.	ENSP00000264335:E15X	E	-	1	0	YWHAE	1250112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.546000	0.60705	2.528000	0.85240	0.484000	0.47621	GAG		0.652	YWHAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259354.3	NM_006761		Nonsense_Mutation
TP53	7157	broad.mit.edu	37	17	7577105	7577105	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr17:7577105G>C	ENST00000269305.4	-	8	1022	c.833C>G	c.(832-834)cCt>cGt	p.P278R	TP53_ENST00000455263.2_Missense_Mutation_p.P278R|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.P278R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.P278R|TP53_ENST00000359597.4_Missense_Mutation_p.P278R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	278	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation; dbSNP:rs17849781). {ECO:0000269|PubMed:15489334}.|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:9450901}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P278L(61)|p.P278R(30)|p.P278H(13)|p.0?(8)|p.P278F(3)|p.?(2)|p.P278fs*67(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCTCTCCCAGGACAGGCACA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	128	Substitution - Missense(107)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Unknown(2)	large_intestine(18)|lung(17)|skin(15)|upper_aerodigestive_tract(12)|haematopoietic_and_lymphoid_tissue(11)|breast(9)|kidney(8)|central_nervous_system(7)|oesophagus(7)|ovary(7)|stomach(4)|bone(4)|liver(3)|soft_tissue(2)|thyroid(1)|prostate(1)|urinary_tract(1)|autonomic_ganglia(1)	17	GRCh37	CM961376	TP53	M							72.0	63.0	66.0					17																	7577105		2203	4300	6503	7517830	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.833C>G	17.37:g.7577105G>C	ENSP00000269305:p.Pro278Arg		7517830	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	23.5	4.422173	0.83559	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99885	-7.5;-7.5;-7.5;-7.5;-7.5;-7.5	5.13	4.16	0.48862	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.050655	0.85682	D	0.000000	D	0.99891	0.9948	M	0.92459	3.31	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96442	0.9327	10	0.87932	D	0	-13.7877	11.4227	0.49991	0.0873:0.0:0.9127:0.0	.	278;278;278;278	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	R	278;278;278;278;278;267;146	ENSP00000352610:P278R;ENSP00000269305:P278R;ENSP00000398846:P278R;ENSP00000391127:P278R;ENSP00000391478:P278R;ENSP00000425104:P146R	ENSP00000269305:P278R	P	-	2	0	TP53	7517830	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.573000	0.98181	1.392000	0.46585	0.462000	0.41574	CCT		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TNS4	84951	broad.mit.edu	37	17	38636046	38636046	+	Missense_Mutation	SNP	C	C	T	rs375842965		TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr17:38636046C>T	ENST00000254051.6	-	10	1948	c.1790G>A	c.(1789-1791)gGa>gAa	p.G597E		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	597	Phosphatase tensin-type.				apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)		p.G597E(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GGCCAGGGCTCCAGTCAGGGT	0.632																																																1	Substitution - Missense(1)	ovary(1)	17											87.0	65.0	72.0					17																	38636046		2203	4300	6503	35889572	SO:0001583	missense	84951			AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.1790G>A	17.37:g.38636046C>T	ENSP00000254051:p.Gly597Glu		35889572	A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Missense_Mutation	SNP	ENST00000254051.6	37	CCDS11368.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878492	0.72294	.	.	ENSG00000131746	ENST00000377816;ENST00000254051	T	0.63744	-0.06	4.86	4.86	0.63082	Pleckstrin homology-type (1);Tensin phosphotyrosine-binding domain (1);	0.000000	0.53938	D	0.000058	T	0.82176	0.4980	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86065	0.1534	10	0.87932	D	0	-11.0853	17.6127	0.88059	0.0:1.0:0.0:0.0	.	597	Q8IZW8	TENS4_HUMAN	E	597	ENSP00000254051:G597E	ENSP00000254051:G597E	G	-	2	0	TNS4	35889572	1.000000	0.71417	0.972000	0.41901	0.205000	0.24178	7.736000	0.84948	2.263000	0.75096	0.462000	0.41574	GGA		0.632	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257154.3	NM_032865		Missense_Mutation
WFIKKN2	124857	broad.mit.edu	37	17	48917337	48917337	+	Missense_Mutation	SNP	C	C	T	rs562619882		TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr17:48917337C>T	ENST00000311378.4	+	2	1216	c.688C>T	c.(688-690)Ctc>Ttc	p.L230F	RP11-506D12.5_ENST00000572491.2_RNA|WFIKKN2_ENST00000426127.1_Missense_Mutation_p.L137F	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	230	Ig-like C2-type.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L230F(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			AGTGAGCTTCCTCTGTGATGT	0.632																																																1	Substitution - Missense(1)	ovary(1)	17											84.0	84.0	84.0					17																	48917337		2203	4300	6503	46272336	SO:0001583	missense	124857			AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.688C>T	17.37:g.48917337C>T	ENSP00000311184:p.Leu230Phe		46272336	Q6UXZ9	Missense_Mutation	SNP	ENST00000311378.4	37	CCDS11575.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502893	0.85176	.	.	ENSG00000173714	ENST00000426127;ENST00000311378	T;T	0.67345	-0.26;-0.26	5.44	5.44	0.79542	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.064395	0.64402	D	0.000005	T	0.70046	0.3179	N	0.20986	0.625	0.80722	D	1	P	0.52316	0.952	P	0.57846	0.828	T	0.73528	-0.3954	10	0.62326	D	0.03	.	19.2585	0.93957	0.0:1.0:0.0:0.0	.	230	Q8TEU8	WFKN2_HUMAN	F	137;230	ENSP00000405889:L137F;ENSP00000311184:L230F	ENSP00000311184:L230F	L	+	1	0	WFIKKN2	46272336	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.801000	0.85960	2.533000	0.85409	0.651000	0.88453	CTC		0.632	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	NM_175575		Missense_Mutation
COX11	1353	broad.mit.edu	37	17	53045991	53045991	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr17:53045991C>A	ENST00000299335.3	-	1	155	c.17G>T	c.(16-18)cGt>cTt	p.R6L	STXBP4_ENST00000405898.1_5'Flank|STXBP4_ENST00000376352.2_5'Flank|STXBP4_ENST00000398391.2_5'Flank|COX11_ENST00000571584.1_Missense_Mutation_p.R6L|STXBP4_ENST00000299341.4_5'Flank|STXBP4_ENST00000434978.2_5'Flank	NM_004375.3	NP_004366.1	Q9Y6N1	COX11_HUMAN	cytochrome c oxidase assembly homolog 11 (yeast)	6					hydrogen ion transmembrane transport (GO:1902600)|negative regulation of glucokinase activity (GO:0033132)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)	p.R6L(1)		endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|prostate(1)	9						CCATCCAGGACGCCAGAGCCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	17											62.0	66.0	64.0					17																	53045991		2046	4079	6125	50400990	SO:0001583	missense	1353			AF044321	CCDS11583.1, CCDS58579.1	17q22	2012-10-15	2012-10-15			ENSG00000166260		"""Mitochondrial respiratory chain complex assembly factors"""	2261	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit 11"", ""cytochrome c oxidase assembly protein COX11"""	603648	"""COX11 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX11 cytochrome c oxidase assembly homolog (yeast)"""			9878253	Standard	NM_004375		Approved	COX11P	uc010wng.1	Q9Y6N1		ENST00000299335.3:c.17G>T	17.37:g.53045991C>A	ENSP00000299335:p.Arg6Leu		50400990	D3DTY5|I3L220|Q6FHB7|Q9BRX0|Q9UME8	Missense_Mutation	SNP	ENST00000299335.3	37	CCDS11583.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	c	5.896	0.349467	0.11182	.	.	ENSG00000166260	ENST00000299335	T	0.41758	0.99	4.92	-3.04	0.05412	.	1.106060	0.06884	N	0.803106	T	0.22704	0.0548	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23547	-1.0185	10	0.15066	T	0.55	-8.1474	5.073	0.14617	0.1368:0.4389:0.3402:0.0841	.	6;6	B4DI26;Q9Y6N1	.;COX11_HUMAN	L	6	ENSP00000299335:R6L	ENSP00000299335:R6L	R	-	2	0	COX11	50400990	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.978000	0.03778	-0.281000	0.09141	-0.956000	0.02647	CGT		0.617	COX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439182.1	NM_004375		Missense_Mutation
TTYH2	94015	broad.mit.edu	37	17	72246457	72246457	+	Silent	SNP	C	C	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr17:72246457C>T	ENST00000269346.4	+	10	1151	c.1077C>T	c.(1075-1077)caC>caT	p.H359H	TTYH2_ENST00000441391.2_Silent_p.H38H|TTYH2_ENST00000529107.1_Silent_p.H338H	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	359						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.H359H(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						CCAGCCTTCACCAGCTGACCG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	17											44.0	41.0	42.0					17																	72246457		2203	4300	6503	69758052	SO:0001819	synonymous_variant	94015				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.1077C>T	17.37:g.72246457C>T			69758052	B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Silent	SNP	ENST00000269346.4	37	CCDS32717.1	SNP	18	Broad																																																																																				0.637	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387459.1			Silent
MTCL1	23255	broad.mit.edu	37	18	8825314	8825314	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr18:8825314C>T	ENST00000306329.11	+	13	4763	c.4763C>T	c.(4762-4764)tCc>tTc	p.S1588F	SOGA2_ENST00000518815.1_Missense_Mutation_p.S594F|SOGA2_ENST00000306285.7_Missense_Mutation_p.S594F|SOGA2_ENST00000517570.1_Missense_Mutation_p.S1228F|SOGA2_ENST00000400050.3_Missense_Mutation_p.S1228F|SOGA2_ENST00000359865.3_Missense_Mutation_p.S1269F														p.S1269F(1)									GGGTTTGCCTCCCCACTGCAC	0.627																																																1	Substitution - Missense(1)	ovary(1)	18											50.0	47.0	48.0					18																	8825314		2203	4300	6503	8815314	SO:0001583	missense	23255																														ENST00000306329.11:c.4763C>T	18.37:g.8825314C>T	ENSP00000305027:p.Ser1588Phe		8815314		Missense_Mutation	SNP	ENST00000306329.11	37		SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	16.73	3.204720	0.58234	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	5.24	3.29	0.37713	.	0.000000	0.47852	D	0.000205	T	0.55000	0.1893	M	0.66939	2.045	0.41536	D	0.988485	D;D	0.63880	0.991;0.993	P;D	0.65684	0.786;0.937	T	0.61700	-0.7009	10	0.87932	D	0	-11.1676	13.5881	0.61944	0.2822:0.7178:0.0:0.0	.	1579;1269	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	F	1290;1228;1269;1228;594	ENSP00000429556:S1228F;ENSP00000352927:S1269F;ENSP00000382924:S1228F;ENSP00000303670:S594F	ENSP00000303670:S594F	S	+	2	0	CCDC165	8815314	1.000000	0.71417	0.046000	0.18839	0.797000	0.45037	7.651000	0.83577	1.165000	0.42670	0.655000	0.94253	TCC		0.627	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1			Missense_Mutation
LAMA3	3909	broad.mit.edu	37	18	21419836	21419836	+	Silent	SNP	C	C	G			TCGA-13-0913-01	TCGA-13-0913-10			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr18:21419836C>G	ENST00000313654.9	+	27	3520	c.3279C>G	c.(3277-3279)ccC>ccG	p.P1093P	LAMA3_ENST00000399516.3_Silent_p.P1093P	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1093	Domain IV 1 (domain IV B).				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.P1093P(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CTCACCTGCCCCAGCAGTCGT	0.493																																																1	Substitution - coding silent(1)	ovary(1)	18											106.0	107.0	106.0					18																	21419836		1964	4148	6112	19673834	SO:0001819	synonymous_variant	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.3279C>G	18.37:g.21419836C>G			19673834	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	37	CCDS42419.1	SNP	22	Broad																																																																																				0.493	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		Silent
MUC16	94025	broad.mit.edu	37	19	9083768	9083768	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0913-01	TCGA-13-0913-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr19:9083768C>T	ENST00000397910.4	-	1	8250	c.8047G>A	c.(8047-8049)Gag>Aag	p.E2683K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2683	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.E2683K(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGGTAGTCTCTGGGACTGTG	0.488																																																1	Substitution - Missense(1)	ovary(1)	19											86.0	82.0	83.0					19																	9083768		1969	4149	6118	8944768	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.8047G>A	19.37:g.9083768C>T	ENSP00000381008:p.Glu2683Lys		8944768	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	c	7.307	0.614265	0.14129	.	.	ENSG00000181143	ENST00000397910	T	0.02682	4.2	0.235	0.235	0.15431	.	.	.	.	.	T	0.03434	0.0099	N	0.08118	0	.	.	.	P	0.49696	0.927	P	0.56563	0.801	T	0.45862	-0.9232	7	0.87932	D	0	.	.	.	.	.	2683	B5ME49	.	K	2683	ENSP00000381008:E2683K	ENSP00000381008:E2683K	E	-	1	0	MUC16	8944768	0.047000	0.20315	0.345000	0.25642	0.351000	0.29236	0.673000	0.25203	0.308000	0.22923	0.313000	0.20887	GAG		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Missense_Mutation
ILF3	3609	broad.mit.edu	37	19	10793341	10793341	+	Silent	SNP	C	C	T			TCGA-13-0913-01	TCGA-13-0913-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr19:10793341C>T	ENST00000590261.1	+	12	1509	c.1509C>T	c.(1507-1509)tcC>tcT	p.S503S	ILF3_ENST00000407004.3_Silent_p.S503S|ILF3_ENST00000592763.1_Silent_p.S503S|ILF3_ENST00000318511.3_Silent_p.S503S|ILF3_ENST00000420083.1_Silent_p.S503S|ILF3_ENST00000250241.8_Silent_p.S503S|ILF3_ENST00000589998.1_Silent_p.S503S|ILF3_ENST00000588657.1_Silent_p.S503S|ILF3_ENST00000449870.1_Silent_p.S503S			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa	503					defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S503S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			AAGCTGTCTCCACCCCTAGTG	0.652																																																1	Substitution - coding silent(1)	ovary(1)	19											54.0	47.0	49.0					19																	10793341		2203	4300	6503	10654341	SO:0001819	synonymous_variant	3609			U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.1509C>T	19.37:g.10793341C>T			10654341	A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Silent	SNP	ENST00000590261.1	37	CCDS12246.1	SNP	21	Broad																																																																																				0.652	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452074.1			Silent
GATAD2A	54815	broad.mit.edu	37	19	19612163	19612163	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr19:19612163G>C	ENST00000360315.3	+	9	1750	c.1438G>C	c.(1438-1440)Ggc>Cgc	p.G480R	GATAD2A_ENST00000252577.5_Missense_Mutation_p.G480R|GATAD2A_ENST00000404158.1_Missense_Mutation_p.G481R|GATAD2A_ENST00000537887.1_Missense_Mutation_p.G109R|GATAD2A_ENST00000358713.3_Missense_Mutation_p.G480R|GATAD2A_ENST00000429563.2_Missense_Mutation_p.G308R	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	480	CR2; histone tail-binding.				anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G337R(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						CCTGCAGCAGGGCACGGCCCC	0.682																																																1	Substitution - Missense(1)	ovary(1)	19											17.0	15.0	15.0					19																	19612163		2197	4298	6495	19473163	SO:0001583	missense	54815			AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.1438G>C	19.37:g.19612163G>C	ENSP00000353463:p.Gly480Arg		19473163	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	ENST00000360315.3	37	CCDS12402.2	SNP	43	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.27|13.27	2.188165|2.188165	0.38609|0.38609	.|.	.|.	ENSG00000167491|ENSG00000167491	ENST00000418032|ENST00000360315;ENST00000252577;ENST00000537887;ENST00000404158;ENST00000358713;ENST00000429563	.|T;T;T;T	.|0.44083	.|1.52;1.49;1.52;0.93	5.0|5.0	3.74|3.74	0.42951|0.42951	.|.	0.338625|0.338625	0.34906|0.34906	N|N	0.003582|0.003582	T|T	0.27134|0.27134	0.0665|0.0665	L|L	0.29908|0.29908	0.895|0.895	0.32332|0.32332	N|N	0.560885|0.560885	.|P;P;P	.|0.51351	.|0.779;0.944;0.893	.|B;B;B	.|0.42319	.|0.216;0.383;0.361	T|T	0.38585|0.38585	-0.9654|-0.9654	6|10	.|0.56958	.|D	.|0.05	-21.4974|-21.4974	4.4492|4.4492	0.11612|0.11612	0.2983:0.0:0.7017:0.0|0.2983:0.0:0.7017:0.0	.|.	.|308;500;480	.|B4DKZ7;B5MC40;Q86YP4	.|.;.;P66A_HUMAN	A|R	106|480;480;109;500;480;308	.|ENSP00000353463:G480R;ENSP00000252577:G480R;ENSP00000351552:G480R;ENSP00000388416:G308R	.|ENSP00000252577:G480R	G|G	+|+	2|1	0|0	GATAD2A|GATAD2A	19473163|19473163	1.000000|1.000000	0.71417|0.71417	0.957000|0.957000	0.39632|0.39632	0.031000|0.031000	0.12232|0.12232	3.520000|3.520000	0.53465|0.53465	2.482000|2.482000	0.83794|0.83794	0.645000|0.645000	0.84053|0.84053	GGG|GGC		0.682	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	NM_017660		Missense_Mutation
PRODH2	58510	broad.mit.edu	37	19	36303153	36303153	+	Missense_Mutation	SNP	G	G	T	rs374226189		TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr19:36303153G>T	ENST00000301175.3	-	4	638	c.621C>A	c.(619-621)aaC>aaA	p.N207K		NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	207					proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)	p.N207K(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TAGCACCGAGGTTCCCCTCAT	0.682																																																1	Substitution - Missense(1)	ovary(1)	19											74.0	73.0	73.0					19																	36303153		2203	4299	6502	40994993	SO:0001583	missense	58510			U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.621C>A	19.37:g.36303153G>T	ENSP00000301175:p.Asn207Lys		40994993		Missense_Mutation	SNP	ENST00000301175.3	37	CCDS12478.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064252	0.55432	.	.	ENSG00000250799	ENST00000301175	T	0.27557	1.66	5.34	5.34	0.76211	.	.	.	.	.	T	0.47192	0.1432	M	0.73962	2.25	0.80722	D	1	D	0.76494	0.999	D	0.64144	0.922	T	0.41502	-0.9505	9	0.13108	T	0.6	.	10.0522	0.42223	0.0914:0.0:0.9086:0.0	.	207	Q9UF12	PROD2_HUMAN	K	207	ENSP00000301175:N207K	ENSP00000301175:N207K	N	-	3	2	PRODH2	40994993	1.000000	0.71417	0.996000	0.52242	0.235000	0.25334	3.975000	0.56859	2.493000	0.84123	0.650000	0.86243	AAC		0.682	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452552.2	NM_021232		Missense_Mutation
TEX101	83639	broad.mit.edu	37	19	43920393	43920393	+	Splice_Site	SNP	A	A	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr19:43920393A>T	ENST00000598265.1	+	3	373	c.207A>T	c.(205-207)gcA>gcT	p.A69A	TEX101_ENST00000602198.1_Splice_Site_p.A87A|TEX101_ENST00000601707.1_3'UTR|TEX101_ENST00000253435.7_Splice_Site_p.A87A	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101	69						acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.A87A(1)		large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				TAATTAAAGCAGGTGAAATGA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	19											56.0	57.0	57.0					19																	43920393		2203	4300	6503	48612233	SO:0001630	splice_region_variant	83639			AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.208+1A>T	19.37:g.43920393A>T			48612233	Q7L5R2|Q9BPY7	Silent	SNP	ENST00000598265.1	37	CCDS59393.1	SNP	7	Broad																																																																																				0.488	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000463176.1	NM_031451	Silent	Silent
ZNF610	162963	broad.mit.edu	37	19	52869553	52869553	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr19:52869553G>A	ENST00000403906.3	+	6	1378	c.922G>A	c.(922-924)Gta>Ata	p.V308I	ZNF610_ENST00000601151.1_Missense_Mutation_p.V265I|ZNF610_ENST00000327920.8_Missense_Mutation_p.V308I|ZNF610_ENST00000321287.8_Missense_Mutation_p.V308I	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	308					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V308I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		TACCCATCTTGTAATCCATAC	0.423																																																1	Substitution - Missense(1)	ovary(1)	19											51.0	49.0	50.0					19																	52869553		2203	4300	6503	57561365	SO:0001583	missense	162963			AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.922G>A	19.37:g.52869553G>A	ENSP00000383922:p.Val308Ile		57561365	A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	ENST00000403906.3	37	CCDS12851.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	2.908	-0.225911	0.06022	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T	0.17054	2.3;2.3	1.69	-3.37	0.04898	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09024	0.0223	N	0.17838	0.53	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.30208	-0.9986	9	0.62326	D	0.03	.	4.5667	0.12189	0.5628:0.1681:0.269:0.0	.	265;308	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	I	308;265;308	ENSP00000383922:V308I;ENSP00000327597:V308I	ENSP00000324441:V265I	V	+	1	0	ZNF610	57561365	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.085000	0.11250	-1.083000	0.03097	-0.657000	0.03884	GTA		0.423	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530		Missense_Mutation
ZNF552	79818	broad.mit.edu	37	19	58319475	58319475	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr19:58319475T>C	ENST00000391701.1	-	3	1326	c.1157A>G	c.(1156-1158)gAa>gGa	p.E386G	ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000598885.1_Intron	NM_024762.3	NP_079038.2	Q9H707	ZN552_HUMAN	zinc finger protein 552	386					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E386G(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		AAATTTTTTTTCACATTCACT	0.423																																																1	Substitution - Missense(1)	ovary(1)	19											150.0	145.0	147.0					19																	58319475		2203	4300	6503	63011287	SO:0001583	missense	79818			AK097041	CCDS12963.1	19q13.43	2013-09-20			ENSG00000178935	ENSG00000178935		"""Zinc fingers, C2H2-type"", ""-"""	26135	protein-coding gene	gene with protein product							Standard	XM_005259267		Approved	FLJ21603	uc002qqg.3	Q9H707	OTTHUMG00000183478	ENST00000391701.1:c.1157A>G	19.37:g.58319475T>C	ENSP00000375582:p.Glu386Gly		63011287	B3KUE9|Q6P5A6	Missense_Mutation	SNP	ENST00000391701.1	37	CCDS12963.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	0.099	-1.154461	0.01700	.	.	ENSG00000178935	ENST00000391701	T	0.55234	0.53	1.96	0.862	0.19056	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16557	0.0398	N	0.01277	-0.915	0.22266	N	0.999242	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.30592	-0.9973	9	0.02654	T	1	.	4.1391	0.10184	0.0:0.5959:0.0:0.4041	.	382;386	B7Z1H1;Q9H707	.;ZN552_HUMAN	G	386	ENSP00000375582:E386G	ENSP00000375582:E386G	E	-	2	0	ZNF552	63011287	0.499000	0.26083	0.010000	0.14722	0.320000	0.28249	1.043000	0.30316	0.138000	0.18790	0.172000	0.16884	GAA		0.423	ZNF552-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466829.1	NM_024762		Missense_Mutation
ZSCAN1	284312	broad.mit.edu	37	19	58563899	58563899	+	Silent	SNP	A	A	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr19:58563899A>T	ENST00000282326.1	+	5	754	c.507A>T	c.(505-507)gcA>gcT	p.A169A		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	169					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)	p.A169A(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CAGCCCCAGCACTCCCCGAGG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	19											40.0	42.0	41.0					19																	58563899		2203	4300	6503	63255711	SO:0001819	synonymous_variant	284312			AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.507A>T	19.37:g.58563899A>T			63255711	Q3B798|Q6WLH8|Q86WS8	Silent	SNP	ENST00000282326.1	37	CCDS12969.1	SNP	6	Broad																																																																																				0.657	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572		Silent
ETAA1	54465	broad.mit.edu	37	2	67631703	67631703	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr2:67631703G>C	ENST00000272342.5	+	5	2019	c.1889G>C	c.(1888-1890)aGt>aCt	p.S630T	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	630						cytoplasm (GO:0005737)		p.S630T(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						AGAAAGGACAGTAAGACATCA	0.363																																																1	Substitution - Missense(1)	ovary(1)	2											109.0	113.0	112.0					2																	67631703		2203	4300	6503	67485207	SO:0001583	missense	54465			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.1889G>C	2.37:g.67631703G>C	ENSP00000272342:p.Ser630Thr		67485207	Q05BT7|Q53SC4	Missense_Mutation	SNP	ENST00000272342.5	37	CCDS1882.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	8.354	0.831614	0.16820	.	.	ENSG00000143971	ENST00000272342	T	0.20332	2.08	3.91	-0.432	0.12291	.	.	.	.	.	T	0.10895	0.0266	N	0.08118	0	0.09310	N	1	P	0.42518	0.782	B	0.40375	0.327	T	0.24548	-1.0157	9	0.46703	T	0.11	.	9.5624	0.39378	0.5297:0.0:0.4703:0.0	.	630	Q9NY74	ETAA1_HUMAN	T	630	ENSP00000272342:S630T	ENSP00000272342:S630T	S	+	2	0	ETAA1	67485207	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	0.823000	0.27366	-0.080000	0.12685	-0.150000	0.13652	AGT		0.363	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002		Missense_Mutation
CNGA3	1261	broad.mit.edu	37	2	99013594	99013594	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr2:99013594C>T	ENST00000272602.2	+	7	2000	c.1961C>T	c.(1960-1962)aCc>aTc	p.T654I	CNGA3_ENST00000393504.1_Missense_Mutation_p.T654I|CNGA3_ENST00000409937.1_Missense_Mutation_p.T658I|CNGA3_ENST00000436404.2_Missense_Mutation_p.T636I			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	654					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.T654I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						TACAACGCCACCCAGATGAAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	2											40.0	39.0	39.0					2																	99013594		2203	4300	6503	98380026	SO:0001583	missense	1261			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1961C>T	2.37:g.99013594C>T	ENSP00000272602:p.Thr654Ile		98380026	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	37	CCDS2034.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	7.084	0.570866	0.13623	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.97642	-4.35;-4.28;-4.35;-4.47	5.42	2.6	0.31112	.	1.043490	0.07409	N	0.892010	D	0.96009	0.8700	M	0.71581	2.175	0.09310	N	1	B;B;B	0.20459	0.032;0.01;0.045	B;B;B	0.17098	0.011;0.011;0.017	D	0.88542	0.3110	10	0.44086	T	0.13	.	11.4059	0.49898	0.13:0.4917:0.3783:0.0	.	658;636;654	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	I	654;636;654;658	ENSP00000377140:T654I;ENSP00000410070:T636I;ENSP00000272602:T654I;ENSP00000386761:T658I	ENSP00000272602:T654I	T	+	2	0	CNGA3	98380026	0.000000	0.05858	0.086000	0.20670	0.998000	0.95712	-0.152000	0.10159	0.387000	0.25024	0.563000	0.77884	ACC		0.612	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298		Missense_Mutation
LYG2	254773	broad.mit.edu	37	2	99861869	99861869	+	Silent	SNP	A	A	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr2:99861869A>C	ENST00000409238.1	-	3	257	c.237T>G	c.(235-237)ccT>ccG	p.P79P	LYG2_ENST00000409679.1_Silent_p.P79P|LYG2_ENST00000423800.1_Silent_p.P79P|LYG2_ENST00000333017.2_Silent_p.P79P			Q86SG7	LYG2_HUMAN	lysozyme G-like 2	79					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)	p.P79P(1)		large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|stomach(1)	12						GAGTCTGGTAAGGTTTTATGG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	2											103.0	94.0	97.0					2																	99861869		2203	4300	6503	99228301	SO:0001819	synonymous_variant	254773			AF323919	CCDS2042.1	2q11.2	2008-02-05			ENSG00000185674	ENSG00000185674			29615	protein-coding gene	gene with protein product						8889548, 12574869	Standard	NM_175735		Approved	LYGH	uc002szw.1	Q86SG7	OTTHUMG00000130643	ENST00000409238.1:c.237T>G	2.37:g.99861869A>C			99228301	Q496G2|Q53RW0	Silent	SNP	ENST00000409238.1	37	CCDS2042.1	SNP	3	Broad																																																																																				0.502	LYG2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330307.1	NM_175735		Silent
TANC1	85461	broad.mit.edu	37	2	160086189	160086189	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr2:160086189A>T	ENST00000263635.6	+	27	4489	c.4252A>T	c.(4252-4254)Aaa>Taa	p.K1418*	TANC1_ENST00000454300.1_Nonsense_Mutation_p.K1312*	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1418					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.K1418*(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						AGAGGAGTGCAAACAACTCCA	0.562																																																1	Substitution - Nonsense(1)	ovary(1)	2											52.0	60.0	57.0					2																	160086189		2029	4176	6205	159794435	SO:0001587	stop_gained	85461			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4252A>T	2.37:g.160086189A>T	ENSP00000263635:p.Lys1418*		159794435	C9JD88|Q49AI8	Nonsense_Mutation	SNP	ENST00000263635.6	37	CCDS42766.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	45	11.685874	0.99591	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	.	.	.	5.92	5.92	0.95590	.	0.046336	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3565	0.83236	1.0:0.0:0.0:0.0	.	.	.	.	X	1312;1418	.	.	K	+	1	0	TANC1	159794435	1.000000	0.71417	0.967000	0.41034	0.933000	0.57130	7.147000	0.77382	2.264000	0.75181	0.533000	0.62120	AAA		0.562	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			Nonsense_Mutation
DYTN	391475	broad.mit.edu	37	2	207516606	207516606	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr2:207516606G>A	ENST00000452335.2	-	12	1789	c.1673C>T	c.(1672-1674)gCt>gTt	p.A558V	AC010731.4_ENST00000543490.1_lincRNA	NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	558						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.A558V(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		CACTCGCTGAGCTCCACTGTA	0.473																																																1	Substitution - Missense(1)	ovary(1)	2											65.0	69.0	68.0					2																	207516606		2024	4199	6223	207224851	SO:0001583	missense	391475			ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.1673C>T	2.37:g.207516606G>A	ENSP00000396593:p.Ala558Val		207224851		Missense_Mutation	SNP	ENST00000452335.2	37	CCDS46502.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430472	0.62844	.	.	ENSG00000232125	ENST00000452335	T	0.37752	1.18	5.33	5.33	0.75918	.	.	.	.	.	T	0.49457	0.1558	L	0.29908	0.895	0.33587	D	0.600622	D	0.89917	1.0	D	0.87578	0.998	T	0.59731	-0.7399	9	0.87932	D	0	-5.9583	15.8736	0.79145	0.0:0.0:1.0:0.0	.	558	A2CJ06	DYTN_HUMAN	V	558	ENSP00000396593:A558V	ENSP00000396593:A558V	A	-	2	0	DYTN	207224851	1.000000	0.71417	0.991000	0.47740	0.157000	0.22087	4.650000	0.61440	2.777000	0.95525	0.655000	0.94253	GCT		0.473	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1			Missense_Mutation
SLC4A11	83959	broad.mit.edu	37	20	3215474	3215474	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr20:3215474A>T	ENST00000380056.3	-	2	250	c.203T>A	c.(202-204)tTc>tAc	p.F68Y	SLC4A11_ENST00000539553.2_Missense_Mutation_p.F52Y|SLC4A11_ENST00000380059.3_Missense_Mutation_p.F95Y	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	68					bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)	p.F68Y(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						GGCAGTGTCGAAGGCCTCATC	0.552																																					NSCLC(190;922 2139 10266 10292 38692)											1	Substitution - Missense(1)	ovary(1)	20											122.0	105.0	111.0					20																	3215474		2203	4300	6503	3163474	SO:0001583	missense	83959			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.203T>A	20.37:g.3215474A>T	ENSP00000369396:p.Phe68Tyr		3163474	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	37	CCDS13052.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	12.55	1.972148	0.34754	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553;ENST00000437836	D;D;D;D	0.83755	-1.7;-1.67;-1.63;-1.76	4.76	3.64	0.41730	.	1.138580	0.06812	N	0.790542	D	0.86112	0.5855	L	0.60455	1.87	0.36227	D	0.852405	D;P;D	0.56746	0.977;0.92;0.961	P;B;P	0.52793	0.709;0.265;0.516	T	0.78013	-0.2370	10	0.44086	T	0.13	.	10.5966	0.45341	0.8379:0.1621:0.0:0.0	.	52;95;68	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	Y	95;68;52;52	ENSP00000369399:F95Y;ENSP00000369396:F68Y;ENSP00000441370:F52Y;ENSP00000404271:F52Y	ENSP00000369396:F68Y	F	-	2	0	SLC4A11	3163474	0.874000	0.30092	0.685000	0.30070	0.013000	0.08279	2.227000	0.42972	0.656000	0.30886	0.533000	0.62120	TTC		0.552	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1			Missense_Mutation
WFDC5	149708	broad.mit.edu	37	20	43739361	43739361	+	Silent	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr20:43739361G>A	ENST00000307971.4	-	2	219	c.141C>T	c.(139-141)gaC>gaT	p.D47D	WFDC5_ENST00000372789.4_Silent_p.D47D			Q8TCV5	WFDC5_HUMAN	WAP four-disulfide core domain 5	47	WAP 1. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.D47D(1)		kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				CCACGCACTGGTCAGGCACCG	0.582																																					NSCLC(199;98 2227 9943 13455 41914)											1	Substitution - coding silent(1)	ovary(1)	20											71.0	64.0	66.0					20																	43739361		2203	4300	6503	43172775	SO:0001819	synonymous_variant	149708			AY038181	CCDS33475.1	20q13.11	2013-01-21			ENSG00000175121	ENSG00000175121		"""WAP four-disulfide core domain containing"""	20477	protein-coding gene	gene with protein product		605161				12206714, 10680116	Standard	NM_145652		Approved	WAP1, dJ211D12.5	uc002xne.2	Q8TCV5	OTTHUMG00000046411	ENST00000307971.4:c.141C>T	20.37:g.43739361G>A			43172775	Q5H981|Q6UWE4	Silent	SNP	ENST00000307971.4	37		SNP	44	Broad																																																																																				0.582	WFDC5-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000107192.1			Silent
STAU1	6780	broad.mit.edu	37	20	47736556	47736556	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr20:47736556G>A	ENST00000371856.2	-	9	1486	c.1076C>T	c.(1075-1077)gCg>gTg	p.A359V	STAU1_ENST00000371828.3_Missense_Mutation_p.A284V|STAU1_ENST00000371802.1_Missense_Mutation_p.A284V|STAU1_ENST00000360426.4_Missense_Mutation_p.A278V|STAU1_ENST00000340954.7_Missense_Mutation_p.A278V|STAU1_ENST00000347458.5_Missense_Mutation_p.A278V|STAU1_ENST00000371792.1_Missense_Mutation_p.A276V	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	359				A -> R (in Ref. 1 and 2). {ECO:0000305}.	intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.A359V(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			GGTGGGCTGCGCCTGCGGGAC	0.577																																																1	Substitution - Missense(1)	ovary(1)	20											113.0	82.0	93.0					20																	47736556		2203	4300	6503	47169963	SO:0001583	missense	6780				CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.1076C>T	20.37:g.47736556G>A	ENSP00000360922:p.Ala359Val		47169963	A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Missense_Mutation	SNP	ENST00000371856.2	37	CCDS13414.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043364	0.75732	.	.	ENSG00000124214	ENST00000371828;ENST00000340954;ENST00000371856;ENST00000360426;ENST00000347458;ENST00000371805;ENST00000371802;ENST00000371792	T;T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	5.81	5.81	0.92471	.	0.099661	0.64402	D	0.000001	T	0.47414	0.1444	N	0.08118	0	0.47153	D	0.999332	B;B	0.17038	0.02;0.02	B;B	0.09377	0.004;0.003	T	0.42965	-0.9420	10	0.72032	D	0.01	-5.3093	20.0795	0.97766	0.0:0.0:1.0:0.0	.	359;284	O95793;Q5JW29	STAU1_HUMAN;.	V	284;278;359;278;278;278;284;276	ENSP00000360893:A284V;ENSP00000345425:A278V;ENSP00000360922:A359V;ENSP00000353604:A278V;ENSP00000323443:A278V;ENSP00000360867:A284V;ENSP00000360857:A276V	ENSP00000345425:A278V	A	-	2	0	STAU1	47169963	1.000000	0.71417	0.826000	0.32828	0.785000	0.44390	9.362000	0.97126	2.747000	0.94245	0.650000	0.86243	GCG		0.577	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079633.1	NM_017453		Missense_Mutation
GNAS	2778	broad.mit.edu	37	20	57480494	57480494	+	Nonsense_Mutation	SNP	C	C	G	rs372290095		TCGA-13-0913-01	TCGA-13-0913-10			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr20:57480494C>G	ENST00000371085.3	+	6	913	c.489C>G	c.(487-489)taC>taG	p.Y163*	GNAS_ENST00000371095.3_Nonsense_Mutation_p.Y149*|GNAS_ENST00000265620.7_Nonsense_Mutation_p.Y148*|GNAS_ENST00000354359.7_Nonsense_Mutation_p.Y164*|GNAS_ENST00000371100.4_Nonsense_Mutation_p.Y806*|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371102.4_Nonsense_Mutation_p.Y792*|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000306090.10_Nonsense_Mutation_p.Y149*|GNAS_ENST00000371075.3_3'UTR	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	163					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.Y806*(2)|p.Y163*(2)|p.Y806Y(1)|p.Y163Y(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GTGCCTGCTACGAACGCTCCA	0.468			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	6	Substitution - Nonsense(4)|Substitution - coding silent(2)	ovary(4)|prostate(2)	20	GRCh37	CM002274	GNAS	M							127.0	116.0	120.0					20																	57480494		2203	4300	6503	56913889	SO:0001587	stop_gained	2778			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.489C>G	20.37:g.57480494C>G	ENSP00000360126:p.Tyr163*		56913889	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Nonsense_Mutation	SNP	ENST00000371085.3	37	CCDS13472.1	SNP	19	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	11.68|11.68	1.709782|1.709782	0.30322|0.30322	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000450130|ENST00000371100;ENST00000371102;ENST00000349036;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	.|.	.|.	.|.	5.93|5.93	-11.9|-11.9	0.00025|0.00025	.|.	.|0.299614	.|0.37053	.|N	.|0.002265	T|.	0.43100|.	0.1232|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.58370|.	-0.7648|.	3|.	.|0.10902	.|T	.|0.67	.|.	19.0914|19.0914	0.93228|0.93228	0.0:0.426:0.0:0.574|0.0:0.426:0.0:0.574	.|.	.|.	.|.	.|.	G|X	178|806;792;180;149;163;164;148;149	.|.	.|ENSP00000265620:Y148X	R|Y	+|+	1|3	2|2	GNAS|GNAS	56913889|56913889	0.000000|0.000000	0.05858|0.05858	0.228000|0.228000	0.23943|0.23943	0.653000|0.653000	0.38743|0.38743	-2.176000|-2.176000	0.01262|0.01262	-2.589000|-2.589000	0.00457|0.00457	-2.036000|-2.036000	0.00420|0.00420	CGA|TAC		0.468	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	NM_000516		Nonsense_Mutation
GGT5	2687	broad.mit.edu	37	22	24622670	24622670	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr22:24622670C>T	ENST00000327365.4	-	7	1383	c.967G>A	c.(967-969)Gta>Ata	p.V323I	GGT5_ENST00000263112.7_Missense_Mutation_p.V291I|GGT5_ENST00000398292.3_Missense_Mutation_p.V323I|GGT5_ENST00000418439.2_Missense_Mutation_p.V246I	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	323					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.V323I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						AGCGTCTCTACAAGGTGGTGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	22											128.0	115.0	120.0					22																	24622670		2203	4300	6503	22952670	SO:0001583	missense	2687			M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.967G>A	22.37:g.24622670C>T	ENSP00000330080:p.Val323Ile		22952670	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Missense_Mutation	SNP	ENST00000327365.4	37	CCDS13825.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	10.19	1.283221	0.23392	.	.	ENSG00000099998	ENST00000327365;ENST00000263112;ENST00000438024;ENST00000398292;ENST00000418439	T;T;T;T	0.07216	3.21;3.21;3.21;3.21	3.13	3.13	0.36017	.	0.248834	0.33180	N	0.005189	T	0.16257	0.0391	L	0.39898	1.24	0.24802	N	0.992692	D;B;B;B;B	0.69078	0.997;0.207;0.41;0.379;0.41	D;B;B;B;B	0.64410	0.925;0.279;0.23;0.124;0.23	T	0.03473	-1.1033	10	0.33940	T	0.23	-20.8784	12.1325	0.53950	0.0:1.0:0.0:0.0	.	246;291;323;323;323	E7EUG3;P36269-2;Q53XM9;Q6GMP0;P36269	.;.;.;.;GGT5_HUMAN	I	323;291;238;323;246	ENSP00000330080:V323I;ENSP00000263112:V291I;ENSP00000381340:V323I;ENSP00000392146:V246I	ENSP00000263112:V291I	V	-	1	0	GGT5	22952670	0.985000	0.35326	0.908000	0.35775	0.716000	0.41182	2.774000	0.47694	1.766000	0.52107	0.478000	0.44815	GTA		0.602	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320119.1	NM_004121		Missense_Mutation
WNT7A	7476	broad.mit.edu	37	3	13860896	13860896	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr3:13860896C>G	ENST00000285018.4	-	4	899	c.595G>C	c.(595-597)Gaa>Caa	p.E199Q		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	199					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)	p.E199Q(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						CACTTACATTCCAGCTTCATG	0.622																																																1	Substitution - Missense(1)	ovary(1)	3											100.0	94.0	96.0					3																	13860896		2203	4300	6503	13835897	SO:0001583	missense	7476			D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.595G>C	3.37:g.13860896C>G	ENSP00000285018:p.Glu199Gln		13835897	Q96H90|Q9Y560	Missense_Mutation	SNP	ENST00000285018.4	37	CCDS2616.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	c	19.56	3.850089	0.71603	.	.	ENSG00000154764	ENST00000285018	T	0.77229	-1.08	4.29	4.29	0.51040	.	0.215829	0.46442	D	0.000294	D	0.83198	0.5202	L	0.59967	1.855	0.80722	D	1	D	0.55385	0.971	P	0.57057	0.812	D	0.84312	0.0511	10	0.46703	T	0.11	.	17.1402	0.86750	0.0:1.0:0.0:0.0	.	199	O00755	WNT7A_HUMAN	Q	199	ENSP00000285018:E199Q	ENSP00000285018:E199Q	E	-	1	0	WNT7A	13835897	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	7.810000	0.86072	2.121000	0.65114	0.558000	0.71614	GAA		0.622	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625		Missense_Mutation
CAPN7	23473	broad.mit.edu	37	3	15282118	15282118	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr3:15282118G>C	ENST00000253693.2	+	13	1799	c.1546G>C	c.(1546-1548)Gac>Cac	p.D516H		NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	516	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)	p.D516H(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						TCAGAAAATAGACAACGGTAA	0.284																																																1	Substitution - Missense(1)	ovary(1)	3											42.0	46.0	45.0					3																	15282118		2193	4298	6491	15257122	SO:0001583	missense	23473			AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.1546G>C	3.37:g.15282118G>C	ENSP00000253693:p.Asp516His		15257122		Missense_Mutation	SNP	ENST00000253693.2	37	CCDS2624.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	25.0	4.597614	0.87055	.	.	ENSG00000131375	ENST00000253693	T	0.52057	0.68	5.75	5.75	0.90469	Peptidase C2, calpain, catalytic domain (3);	0.046382	0.85682	D	0.000000	T	0.74756	0.3758	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77816	-0.2447	10	0.62326	D	0.03	-18.1049	19.5399	0.95270	0.0:0.0:1.0:0.0	.	516	Q9Y6W3	CAN7_HUMAN	H	516	ENSP00000253693:D516H	ENSP00000253693:D516H	D	+	1	0	CAPN7	15257122	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	9.861000	0.99562	2.696000	0.92011	0.655000	0.94253	GAC		0.284	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252105.2	NM_014296		Missense_Mutation
DNAH1	25981	broad.mit.edu	37	3	52430634	52430634	+	Splice_Site	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr3:52430634G>A	ENST00000420323.2	+	72	11692	c.11431G>A	c.(11431-11433)Gtg>Atg	p.V3811M		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3876	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V3811M(1)		cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCTCCCCCAGGTGATGGAGTT	0.612																																																1	Substitution - Missense(1)	ovary(1)	3											59.0	60.0	60.0					3																	52430634		2012	4167	6179	52405674	SO:0001630	splice_region_variant	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.11431-1G>A	3.37:g.52430634G>A			52405674	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	9.802	1.180908	0.21787	.	.	ENSG00000114841	ENST00000420323;ENST00000273600	T	0.08370	3.1	4.49	1.55	0.23275	.	0.829404	0.10511	N	0.666176	T	0.10121	0.0248	L	0.27053	0.805	0.80722	D	1	P;P	0.48016	0.865;0.904	P;B	0.53450	0.726;0.346	T	0.41893	-0.9483	9	.	.	.	.	5.535	0.17005	0.1812:0.1623:0.6565:0.0	.	3811;3876	C9JXH6;Q9P2D7-2	.;.	M	3811;564	ENSP00000401514:V3811M	.	V	+	1	0	DNAH1	52405674	0.312000	0.24545	0.597000	0.28824	0.112000	0.19704	0.548000	0.23314	0.525000	0.28522	0.591000	0.81541	GTG		0.612	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	Missense_Mutation	Missense_Mutation
HSPBAP1	79663	broad.mit.edu	37	3	122487638	122487638	+	Silent	SNP	T	T	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr3:122487638T>A	ENST00000306103.2	-	3	485	c.342A>T	c.(340-342)ccA>ccT	p.P114P	HSPBAP1_ENST00000465044.1_5'UTR|HSPBAP1_ENST00000383659.1_Silent_p.P114P	NM_024610.5	NP_078886.2	Q96EW2	HBAP1_HUMAN	HSPB (heat shock 27kDa) associated protein 1	114	Interaction with HSPB1. {ECO:0000250}.					cytoplasm (GO:0005737)		p.P114P(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(114;0.0531)		AATCTCTAAATGGTCCAGAAA	0.383																																																1	Substitution - coding silent(1)	ovary(1)	3											76.0	74.0	75.0					3																	122487638		2203	4300	6503	123970328	SO:0001819	synonymous_variant	79663			AF400663	CCDS3017.1	3q21.1	2008-07-18	2002-08-29		ENSG00000169087	ENSG00000169087			16389	protein-coding gene	gene with protein product		608263	"""HSPB (heat shock 27kD) associated protein 1"""			11978969	Standard	NM_024610		Approved	FLJ22623, PASS1	uc003efu.2	Q96EW2	OTTHUMG00000159550	ENST00000306103.2:c.342A>T	3.37:g.122487638T>A			123970328	Q6P476|Q8N8J4|Q8NHH6|Q8WWF0	Silent	SNP	ENST00000306103.2	37	CCDS3017.1	SNP	51	Broad																																																																																				0.383	HSPBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356161.1	NM_024610		Silent
MB21D2	151963	broad.mit.edu	37	3	192516350	192516350	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr3:192516350G>C	ENST00000392452.2	-	2	1621	c.1301C>G	c.(1300-1302)aCc>aGc	p.T434S		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	434							protein complex binding (GO:0032403)	p.T432S(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						GATGCTGGTGGTGCTACCTCG	0.607																																																1	Substitution - Missense(1)	ovary(1)	3											81.0	82.0	82.0					3																	192516350		2203	4300	6503	193999044	SO:0001583	missense	151963			AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.1301C>G	3.37:g.192516350G>C	ENSP00000376246:p.Thr434Ser		193999044	Q86VD8	Missense_Mutation	SNP	ENST00000392452.2	37	CCDS3302.2	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	2.162	-0.391964	0.04932	.	.	ENSG00000180611	ENST00000392452	T	0.41065	1.01	5.27	5.27	0.74061	.	0.214806	0.49305	D	0.000159	T	0.18882	0.0453	N	0.02539	-0.55	0.49483	D	0.999791	B	0.02656	0.0	B	0.01281	0.0	T	0.18650	-1.0330	10	0.05436	T	0.98	.	17.908	0.88925	0.0:0.0:1.0:0.0	.	434	Q8IYB1	M21D2_HUMAN	S	434	ENSP00000376246:T434S	ENSP00000376246:T434S	T	-	2	0	MB21D2	193999044	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.462000	0.73526	2.450000	0.82876	0.650000	0.86243	ACC		0.607	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341543.1	NM_178496		Missense_Mutation
IL7R	3575	broad.mit.edu	37	5	35861037	35861037	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0913-01	TCGA-13-0913-10			A	T	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr5:35861037A>T	ENST00000303115.3	+	2	295	c.166A>T	c.(166-168)Acc>Tcc	p.T56S	IL7R_ENST00000506850.1_Missense_Mutation_p.T56S|IL7R_ENST00000343305.4_Missense_Mutation_p.T56S|IL7R_ENST00000511982.1_Missense_Mutation_p.T56S|IL7R_ENST00000511031.1_3'UTR	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	56					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)	p.T56S(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			GCACTCACTGACCTGTGCTTT	0.458			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	1	Substitution - Missense(1)	ovary(1)	5											219.0	198.0	205.0					5																	35861037		2203	4300	6503	35896794	SO:0001583	missense	3575			M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.166A>T	5.37:g.35861037A>T	ENSP00000306157:p.Thr56Ser		35896794	B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	CCDS3911.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	11.75	1.730347	0.30684	.	.	ENSG00000168685	ENST00000508941;ENST00000303115;ENST00000343305;ENST00000506850;ENST00000511982	T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97	5.97	4.81	0.61882	.	0.109617	0.64402	N	0.000008	T	0.62539	0.2436	L	0.41236	1.265	0.22489	N	0.999051	B;B	0.29508	0.246;0.123	B;B	0.21151	0.033;0.015	T	0.57625	-0.7779	10	0.59425	D	0.04	-0.766	8.933	0.35682	0.9164:0.0:0.0836:0.0	.	56;56	D6RGV2;P16871	.;IL7RA_HUMAN	S	56	ENSP00000426426:T56S;ENSP00000306157:T56S;ENSP00000345819:T56S;ENSP00000421207:T56S;ENSP00000425309:T56S	ENSP00000306157:T56S	T	+	1	0	IL7R	35896794	0.073000	0.21202	0.334000	0.25495	0.633000	0.38033	1.329000	0.33770	1.083000	0.41159	0.533000	0.62120	ACC		0.458	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			Missense_Mutation
ERBB2IP	55914	broad.mit.edu	37	5	65317215	65317215	+	Splice_Site	SNP	T	T	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr5:65317215T>A	ENST00000284037.5	+	8	986		c.e8+2		ERBB2IP_ENST00000380936.1_Splice_Site|ERBB2IP_ENST00000380943.2_Splice_Site|ERBB2IP_ENST00000380938.2_Splice_Site|ERBB2IP_ENST00000506030.1_Splice_Site|ERBB2IP_ENST00000511297.1_Splice_Site|ERBB2IP_ENST00000380939.2_Splice_Site|ERBB2IP_ENST00000416865.2_Splice_Site|ERBB2IP_ENST00000508515.1_Splice_Site|ERBB2IP_ENST00000380935.1_Splice_Site	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein						basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)	p.?(1)		breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		ACGGAAGTGGTAAGTTCTCAT	0.318																																																1	Unknown(1)	ovary(1)	5											63.0	61.0	61.0					5																	65317215		2203	4299	6502	65352971	SO:0001630	splice_region_variant	55914				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.597+2T>A	5.37:g.65317215T>A			65352971	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Splice_Site_SNP	SNP	ENST00000284037.5	37	CCDS58953.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	24.4	4.524068	0.85600	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000416865;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2287	0.65877	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ERBB2IP	65352971	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.348000	0.79366	1.823000	0.53134	0.482000	0.46254	.		0.318	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215070.1	NM_018695	Intron	Splice_Site_SNP
PJA2	9867	broad.mit.edu	37	5	108717298	108717298	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr5:108717298T>G	ENST00000361189.2	-	3	377	c.138A>C	c.(136-138)aaA>aaC	p.K46N	PJA2_ENST00000361557.3_Missense_Mutation_p.K46N|PJA2_ENST00000511624.1_5'UTR	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	46					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K46N(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		TCATACATGGTTTAAAACTGA	0.443																																																1	Substitution - Missense(1)	ovary(1)	5											114.0	105.0	108.0					5																	108717298		2202	4300	6502	108745197	SO:0001583	missense	9867			AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.138A>C	5.37:g.108717298T>G	ENSP00000354775:p.Lys46Asn		108745197	A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	ENST00000361189.2	37	CCDS4099.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	18.68	3.676655	0.67928	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.13657	2.57;2.57	5.71	2.09	0.27110	.	0.071226	0.56097	D	0.000027	T	0.22166	0.0534	L	0.54323	1.7	0.34899	D	0.74627	D	0.58970	0.984	P	0.55871	0.786	T	0.18808	-1.0325	10	0.87932	D	0	-31.8339	8.1349	0.31048	0.0:0.3012:0.0:0.6988	.	46	O43164	PJA2_HUMAN	N	46	ENSP00000354775:K46N;ENSP00000355284:K46N	ENSP00000354775:K46N	K	-	3	2	PJA2	108745197	0.998000	0.40836	1.000000	0.80357	0.916000	0.54674	0.307000	0.19296	0.134000	0.18681	-0.379000	0.06801	AAA		0.443	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250663.1	NM_014819		Missense_Mutation
PCDHB5	26167	broad.mit.edu	37	5	140515621	140515621	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr5:140515621G>A	ENST00000231134.5	+	1	822	c.605G>A	c.(604-606)cGg>cAg	p.R202Q		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	202	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R202Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGCTGGACCGGGAGGAGCGG	0.547																																																1	Substitution - Missense(1)	ovary(1)	5											71.0	73.0	72.0					5																	140515621		2203	4300	6503	140495805	SO:0001583	missense	26167			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.605G>A	5.37:g.140515621G>A	ENSP00000231134:p.Arg202Gln		140495805	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	17.46	3.393947	0.62066	.	.	ENSG00000113209	ENST00000231134	T	0.59364	0.27	5.18	5.18	0.71444	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.87305	0.6144	H	0.99435	4.565	0.34853	D	0.741885	D	0.89917	1.0	D	0.78314	0.991	D	0.94964	0.8111	9	0.87932	D	0	.	19.0581	0.93074	0.0:0.0:1.0:0.0	.	202	Q9Y5E4	PCDB5_HUMAN	Q	202	ENSP00000231134:R202Q	ENSP00000231134:R202Q	R	+	2	0	PCDHB5	140495805	0.993000	0.37304	0.998000	0.56505	0.139000	0.21198	6.686000	0.74548	2.581000	0.87130	0.555000	0.69702	CGG		0.547	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669		Missense_Mutation
HTR4	3360	broad.mit.edu	37	5	147889226	147889226	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr5:147889226G>C	ENST00000377888.3	-	6	1007	c.869C>G	c.(868-870)cCt>cGt	p.P290R	HTR4_ENST00000517929.1_Missense_Mutation_p.P290R|HTR4_ENST00000354217.2_Missense_Mutation_p.P290R|HTR4_ENST00000362016.2_Missense_Mutation_p.P304R|HTR4_ENST00000314512.6_Missense_Mutation_p.P290R|HTR4_ENST00000521530.1_Missense_Mutation_p.P290R|HTR4_ENST00000520514.1_Missense_Mutation_p.P290R|HTR4_ENST00000360693.3_Missense_Mutation_p.P290R|HTR4_ENST00000521735.1_Missense_Mutation_p.P290R	NM_000870.5	NP_000861.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled	290					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)	p.P290R(1)		endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	CACCTGCCCAGGGACAGTGTA	0.498																																					GBM(120;370 1604 14007 17804 41573)											1	Substitution - Missense(1)	ovary(1)	5											89.0	89.0	89.0					5																	147889226		2203	4300	6503	147869419	SO:0001583	missense	3360			Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000377888.3:c.869C>G	5.37:g.147889226G>C	ENSP00000367120:p.Pro290Arg		147869419	C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Missense_Mutation	SNP	ENST00000377888.3	37	CCDS4291.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	15.76	2.929595	0.52759	.	.	ENSG00000164270	ENST00000521530;ENST00000354217;ENST00000314512;ENST00000521735;ENST00000517929;ENST00000520514;ENST00000377888;ENST00000360693;ENST00000362016	T;T;T;T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1	6.07	6.07	0.98685	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.72011	0.3408	M	0.88570	2.965	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.996;0.993;0.991;1.0;1.0;1.0	D;D;D;D;D;D;D	0.79784	0.993;0.973;0.954;0.965;0.988;0.992;0.993	T	0.75863	-0.3167	10	0.87932	D	0	.	19.2231	0.93806	0.0:0.0:1.0:0.0	.	290;290;290;304;290;290;290	C4WYH4;Q13639;Q712M9;Q13639-6;Q13639-3;Q13639-2;Q684M0	.;5HT4R_HUMAN;.;.;.;.;.	R	290;290;290;290;290;290;290;290;304	ENSP00000428320:P290R;ENSP00000346156:P290R;ENSP00000314906:P290R;ENSP00000430979:P290R;ENSP00000435904:P290R;ENSP00000427913:P290R;ENSP00000367120:P290R;ENSP00000353915:P290R;ENSP00000355037:P304R	ENSP00000314906:P290R	P	-	2	0	HTR4	147869419	1.000000	0.71417	0.641000	0.29422	0.023000	0.10783	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	CCT		0.498	HTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252187.2	NM_000870		Missense_Mutation
PRRC2A	7916	broad.mit.edu	37	6	31603478	31603478	+	Silent	SNP	C	C	T			TCGA-13-0913-01	TCGA-13-0913-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr6:31603478C>T	ENST00000376033.2	+	24	5727	c.5493C>T	c.(5491-5493)cgC>cgT	p.R1831R	PRRC2A_ENST00000376007.4_Silent_p.R1831R	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1831						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R1831R(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CAGGCCAGCGCCTGTATCCTG	0.557																																																1	Substitution - coding silent(1)	ovary(1)	6											35.0	36.0	35.0					6																	31603478		1510	2709	4219	31711457	SO:0001819	synonymous_variant	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.5493C>T	6.37:g.31603478C>T			31711457	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Silent	SNP	ENST00000376033.2	37	CCDS4708.1	SNP	26	Broad																																																																																				0.557	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686		Silent
UHRF1BP1	54887	broad.mit.edu	37	6	34825549	34825549	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr6:34825549T>C	ENST00000192788.5	+	13	1793	c.1622T>C	c.(1621-1623)aTg>aCg	p.M541T	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.M541T	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	541							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						ACATTTACTATGGATCCTGTC	0.423																																																0			6											187.0	173.0	178.0					6																	34825549		1860	4099	5959	34933527	SO:0001583	missense	54887			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.1622T>C	6.37:g.34825549T>C	ENSP00000192788:p.Met541Thr		34933527	Q9NXE0	Missense_Mutation	SNP	ENST00000192788.5	37	CCDS43455.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	14.54	2.565423	0.45694	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.08102	3.13;3.13	6.06	6.06	0.98353	.	0.630577	0.17445	N	0.173983	T	0.02571	0.0078	N	0.08118	0	0.34997	D	0.755582	B	0.06786	0.001	B	0.11329	0.006	T	0.41770	-0.9490	10	0.72032	D	0.01	-0.1179	16.6154	0.84909	0.0:0.0:0.0:1.0	.	541	Q6BDS2	URFB1_HUMAN	T	541	ENSP00000192788:M541T;ENSP00000400628:M541T	ENSP00000192788:M541T	M	+	2	0	UHRF1BP1	34933527	1.000000	0.71417	0.938000	0.37757	0.982000	0.71751	8.036000	0.88901	2.315000	0.78130	0.533000	0.62120	ATG		0.423	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754		Missense_Mutation
ASCC3	10973	broad.mit.edu	37	6	101248260	101248260	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0913-01	TCGA-13-0913-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr6:101248260G>A	ENST00000369162.2	-	6	1387	c.1043C>T	c.(1042-1044)gCc>gTc	p.A348V	ASCC3_ENST00000522650.1_Missense_Mutation_p.A348V	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	348					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.A348V(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TTCTCGTCTGGCAATTCTTTT	0.368																																																1	Substitution - Missense(1)	ovary(1)	6											161.0	150.0	153.0					6																	101248260		2203	4299	6502	101354981	SO:0001583	missense	10973			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.1043C>T	6.37:g.101248260G>A	ENSP00000358159:p.Ala348Val		101354981	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	17.58	3.425331	0.62733	.	.	ENSG00000112249	ENST00000369162;ENST00000522650	T;T	0.53857	0.6;0.6	5.51	5.51	0.81932	.	0.197155	0.44483	D	0.000459	T	0.46210	0.1381	L	0.60455	1.87	0.80722	D	1	B;P	0.51351	0.325;0.944	B;P	0.45310	0.041;0.476	T	0.39901	-0.9591	10	0.33141	T	0.24	.	19.4189	0.94712	0.0:0.0:1.0:0.0	.	348;348	E7EW23;Q8N3C0	.;HELC1_HUMAN	V	348	ENSP00000358159:A348V;ENSP00000430769:A348V	ENSP00000358159:A348V	A	-	2	0	ASCC3	101354981	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.750000	0.55157	2.587000	0.87381	0.561000	0.74099	GCC		0.368	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828		Missense_Mutation
KIAA1919	91749	broad.mit.edu	37	6	111585078	111585078	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr6:111585078T>A	ENST00000368847.4	+	3	595	c.242T>A	c.(241-243)tTt>tAt	p.F81Y		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	81					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.F81Y(1)		large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		CTTGTTCCTTTTTGCAAGACA	0.408																																																1	Substitution - Missense(1)	ovary(1)	6											229.0	214.0	219.0					6																	111585078		2203	4300	6503	111691771	SO:0001583	missense	91749			BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.242T>A	6.37:g.111585078T>A	ENSP00000357840:p.Phe81Tyr		111691771	A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Missense_Mutation	SNP	ENST00000368847.4	37	CCDS5090.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	21.2	4.108872	0.77096	.	.	ENSG00000173214	ENST00000368847	T	0.62941	-0.01	5.8	5.8	0.92144	Major facilitator superfamily domain, general substrate transporter (1);	0.197275	0.56097	D	0.000032	T	0.53802	0.1819	M	0.76574	2.34	0.50313	D	0.999861	B	0.33448	0.412	B	0.39465	0.3	T	0.59150	-0.7508	10	0.38643	T	0.18	-15.8649	11.6057	0.51031	0.0:0.0:0.2665:0.7335	.	81	Q5TF39	NAGT1_HUMAN	Y	81	ENSP00000357840:F81Y	ENSP00000357840:F81Y	F	+	2	0	KIAA1919	111691771	1.000000	0.71417	0.977000	0.42913	0.762000	0.43233	3.698000	0.54771	2.217000	0.71921	0.379000	0.24179	TTT		0.408	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041827.1	NM_153369		Missense_Mutation
FSCN1	6624	broad.mit.edu	37	7	5643564	5643564	+	Silent	SNP	C	C	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr7:5643564C>T	ENST00000382361.3	+	4	1296	c.1182C>T	c.(1180-1182)ttC>ttT	p.F394F	FSCN1_ENST00000340250.6_Silent_p.F373F	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	394					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)	p.F394F(1)		central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		AGCATGGCTTCATCGGCTGCC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	7											63.0	60.0	61.0					7																	5643564		2203	4300	6503	5610090	SO:0001819	synonymous_variant	6624			U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.1182C>T	7.37:g.5643564C>T			5610090	A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Silent	SNP	ENST00000382361.3	37	CCDS5342.1	SNP	29	Broad																																																																																				0.597	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207153.3	NM_003088		Silent
DLX6	1750	broad.mit.edu	37	7	96637053	96637053	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr7:96637053G>T	ENST00000518156.2	+	2	970	c.540G>T	c.(538-540)caG>caT	p.Q180H	DLX6-AS1_ENST00000452769.2_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6-AS1_ENST00000430404.2_RNA|DLX6_ENST00000493273.2_3'UTR|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000437541.1_RNA|DLX6_ENST00000555308.1_Missense_Mutation_p.Q52H|DLX6_ENST00000007660.5_Missense_Mutation_p.Q152H|DLX6-AS1_ENST00000458352.2_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	62					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q152H(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					TGCAGCTCCAGGCTTTAAACC	0.473																																																1	Substitution - Missense(1)	ovary(1)	7											46.0	46.0	46.0					7																	96637053		1862	4104	5966	96474989	SO:0001583	missense	1750				CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.540G>T	7.37:g.96637053G>T	ENSP00000428480:p.Gln180His		96474989	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Missense_Mutation	SNP	ENST00000518156.2	37	CCDS47647.2	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	21.7	4.188756	0.78789	.	.	ENSG00000006377	ENST00000518156;ENST00000007660;ENST00000555308	D;D;D	0.96396	-4.0;-4.0;-4.0	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.96131	0.8739	L	0.41710	1.295	0.80722	D	1	P	0.50710	0.938	P	0.56700	0.804	D	0.94141	0.7397	10	0.15952	T	0.53	-14.5324	19.6519	0.95819	0.0:0.0:1.0:0.0	.	152	P56179-2	.	H	180;152;52	ENSP00000428480:Q180H;ENSP00000007660:Q152H;ENSP00000451635:Q52H	ENSP00000007660:Q152H	Q	+	3	2	DLX6	96474989	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.148000	0.50647	2.639000	0.89480	0.561000	0.74099	CAG		0.473	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334373.4	NM_005222		Missense_Mutation
TRPV5	56302	broad.mit.edu	37	7	142622682	142622682	+	Missense_Mutation	SNP	C	C	A	rs200067461		TCGA-13-0913-01	TCGA-13-0913-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr7:142622682C>A	ENST00000265310.1	-	8	1412	c.1064G>T	c.(1063-1065)cGt>cTt	p.R355L	TRPV5_ENST00000442623.1_Missense_Mutation_p.R355L	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	355					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.R355L(1)|p.R355H(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					GTTGCCACCACGAAACTTAAG	0.517																																																2	Substitution - Missense(2)	ovary(1)|central_nervous_system(1)	7											122.0	106.0	112.0					7																	142622682		2203	4300	6503	142332804	SO:0001583	missense	56302			AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.1064G>T	7.37:g.142622682C>A	ENSP00000265310:p.Arg355Leu		142332804	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Missense_Mutation	SNP	ENST00000265310.1	37	CCDS5875.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	15.41	2.824419	0.50739	.	.	ENSG00000127412	ENST00000265310;ENST00000439304;ENST00000442623	D;D;D	0.84442	-1.85;-1.85;-1.85	5.18	5.18	0.71444	.	0.202656	0.43747	D	0.000525	D	0.82660	0.5085	L	0.58669	1.825	0.09310	N	1	B;B	0.31174	0.007;0.311	B;B	0.28305	0.027;0.088	T	0.72070	-0.4401	10	0.27082	T	0.32	-18.3936	18.0624	0.89381	0.0:1.0:0.0:0.0	.	355;355	E9PBZ6;Q9NQA5	.;TRPV5_HUMAN	L	355;300;355	ENSP00000265310:R355L;ENSP00000406361:R300L;ENSP00000406572:R355L	ENSP00000265310:R355L	R	-	2	0	TRPV5	142332804	0.482000	0.25948	0.012000	0.15200	0.875000	0.50365	2.793000	0.47845	2.575000	0.86900	0.655000	0.94253	CGT		0.517	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841		Missense_Mutation
WDR60	55112	broad.mit.edu	37	7	158672600	158672600	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr7:158672600T>G	ENST00000407559.3	+	5	957	c.799T>G	c.(799-801)Ttt>Gtt	p.F267V		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	267					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.F267V(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		AGGTTTTCATTTTGATGATGA	0.403																																																1	Substitution - Missense(1)	ovary(1)	7											77.0	80.0	79.0					7																	158672600		1876	4092	5968	158365361	SO:0001583	missense	55112				CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.799T>G	7.37:g.158672600T>G	ENSP00000384290:p.Phe267Val		158365361	Q9NW58	Missense_Mutation	SNP	ENST00000407559.3	37	CCDS47757.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	6.611	0.481149	0.12581	.	.	ENSG00000126870	ENST00000407559	T	0.20463	2.07	4.73	-8.46	0.00942	.	1.456230	0.03783	N	0.261710	T	0.10551	0.0258	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20107	-1.0285	10	0.20519	T	0.43	1.8336	9.9266	0.41496	0.0:0.1545:0.6253:0.2202	.	267	Q8WVS4	WDR60_HUMAN	V	267	ENSP00000384290:F267V	ENSP00000384290:F267V	F	+	1	0	WDR60	158365361	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.437000	0.02419	-1.796000	0.01253	-0.331000	0.08364	TTT		0.403	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322668.1	NM_018051		Missense_Mutation
ADAMTSL1	92949	broad.mit.edu	37	9	18776831	18776831	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr9:18776831G>T	ENST00000380548.4	+	19	2943	c.2604G>T	c.(2602-2604)aaG>aaT	p.K868N		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	868	Ig-like C2-type 1.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.K868N(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CCGCCAGGAAGGTCTACATAC	0.672																																																1	Substitution - Missense(1)	ovary(1)	9											10.0	13.0	12.0					9																	18776831		2000	4155	6155	18766831	SO:0001583	missense	92949			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2604G>T	9.37:g.18776831G>T	ENSP00000369921:p.Lys868Asn		18766831	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	12.93	2.086047	0.36855	.	.	ENSG00000178031	ENST00000380548	T	0.63417	-0.04	5.27	3.42	0.39159	Immunoglobulin-like (1);	0.280398	0.14377	U	0.323404	T	0.33177	0.0854	N	0.04508	-0.205	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.14035	-1.0487	10	0.25751	T	0.34	.	3.5474	0.07834	0.2676:0.3189:0.4135:0.0	.	868	Q8N6G6	ATL1_HUMAN	N	868	ENSP00000369921:K868N	ENSP00000369921:K868N	K	+	3	2	ADAMTSL1	18766831	0.441000	0.25626	0.046000	0.18839	0.002000	0.02628	0.272000	0.18644	1.207000	0.43291	0.563000	0.77884	AAG		0.672	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			Missense_Mutation
COL5A1	1289	broad.mit.edu	37	9	137659191	137659191	+	Silent	SNP	A	A	T			TCGA-13-0913-01	TCGA-13-0913-10			A	T	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chr9:137659191A>T	ENST00000371817.3	+	24	2637	c.2223A>T	c.(2221-2223)ccA>ccT	p.P741P		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	741	Triple-helical region.			P -> L (in Ref. 4; AA sequence). {ECO:0000305}.	axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.P741P(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TTGGTCCTCCAGGAGAAAAGG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	9											69.0	71.0	70.0					9																	137659191		2203	4300	6503	136799012	SO:0001819	synonymous_variant	1289			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2223A>T	9.37:g.137659191A>T			136799012	Q15094|Q5SUX4	Silent	SNP	ENST00000371817.3	37	CCDS6982.1	SNP	7	Broad																																																																																				0.632	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093		Silent
SMS	6611	broad.mit.edu	37	X	21996113	21996113	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0913-01	TCGA-13-0913-10			A	T	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chrX:21996113A>T	ENST00000404933.2	+	6	793	c.541A>T	c.(541-543)Atc>Ttc	p.I181F	SMS_ENST00000379404.1_Missense_Mutation_p.I128F|SMS_ENST00000415881.2_Missense_Mutation_p.I85F	NM_004595.4	NP_004586.2	P52788	SPSY_HUMAN	spermine synthase	181	PABS. {ECO:0000255|PROSITE- ProRule:PRU00354}.				cellular nitrogen compound metabolic process (GO:0034641)|methionine metabolic process (GO:0006555)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	spermidine synthase activity (GO:0004766)|spermine synthase activity (GO:0016768)	p.I181F(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(2)	14					Spermine(DB00127)	TACCCGGGCCATCATGGGCAG	0.468																																																1	Substitution - Missense(1)	ovary(1)	X											109.0	102.0	105.0					X																	21996113		2203	4300	6503	21906034	SO:0001583	missense	6611			AD001528	CCDS14203.1, CCDS59161.1	Xp22.1	2014-05-16			ENSG00000102172	ENSG00000102172			11123	protein-coding gene	gene with protein product		300105	"""Snyder-Robinson X-linked mental retardation syndrome"""	SRS		7546290, 9299240, 14508504	Standard	NM_004595		Approved	SPMSY, SpS, MRSR	uc004dag.4	P52788	OTTHUMG00000021239	ENST00000404933.2:c.541A>T	X.37:g.21996113A>T	ENSP00000385746:p.Ile181Phe		21906034	A6NHA7|A6NI34|B2R9M0|O00544|Q9UQS1	Missense_Mutation	SNP	ENST00000404933.2	37	CCDS14203.1	SNP	8	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.0|26.0	4.696472|4.696472	0.88830|0.88830	.|.	.|.	ENSG00000102172|ENSG00000102172	ENST00000457085|ENST00000404933;ENST00000379404;ENST00000415881	.|D;D;D	.|0.82984	.|-1.67;-1.67;-1.67	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91975|0.91975	0.7458|0.7458	M|M	0.86343|0.86343	2.81|2.81	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.998;0.971	D|D	0.93303|0.93303	0.6678|0.6678	5|10	.|0.87932	.|D	.|0	-19.6099|-19.6099	14.7653|14.7653	0.69634|0.69634	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|181;128	.|P52788;P52788-2	.|SPSY_HUMAN;.	L|F	272|181;128;85	.|ENSP00000385746:I181F;ENSP00000368714:I128F;ENSP00000388906:I85F	.|ENSP00000368714:I128F	H|I	+|+	2|1	0|0	SMS|SMS	21906034|21906034	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.832000|0.832000	0.47134|0.47134	8.896000|8.896000	0.92521|0.92521	1.867000|1.867000	0.54127|0.54127	0.486000|0.486000	0.48141|0.48141	CAT|ATC		0.468	SMS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056032.1	NM_004595		Missense_Mutation
POLA1	5422	broad.mit.edu	37	X	24828032	24828032	+	Silent	SNP	A	A	G			TCGA-13-0913-01	TCGA-13-0913-10			A	G	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chrX:24828032A>G	ENST00000379059.3	+	27	2979	c.2964A>G	c.(2962-2964)aaA>aaG	p.K988K	POLA1_ENST00000379068.3_Silent_p.K994K	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	988					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)	p.K988K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	TGCATACGAAAGAGATGGTAC	0.279																																																1	Substitution - coding silent(1)	ovary(1)	X											125.0	108.0	114.0					X																	24828032		2202	4297	6499	24737953	SO:0001819	synonymous_variant	5422				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.2964A>G	X.37:g.24828032A>G			24737953	Q86UQ7	Silent	SNP	ENST00000379059.3	37	CCDS14214.1	SNP	3	Broad																																																																																				0.279	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937		Silent
CLCN5	1184	broad.mit.edu	37	X	49856792	49856792	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chrX:49856792G>T	ENST00000307367.2	+	12	2448	c.2157G>T	c.(2155-2157)ttG>ttT	p.L719F	CLCN5_ENST00000376108.3_Missense_Mutation_p.L719F|CLCN5_ENST00000376091.3_Missense_Mutation_p.L789F|CLCN5_ENST00000376088.3_Missense_Mutation_p.L789F			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	719	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.L719F(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					TTAGGCGATTGCTTGGAATCA	0.358																																																1	Substitution - Missense(1)	ovary(1)	X											116.0	92.0	100.0					X																	49856792		2203	4300	6503	49743532	SO:0001583	missense	1184			X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.2157G>T	X.37:g.49856792G>T	ENSP00000304257:p.Leu719Phe		49743532	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	37	CCDS14328.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	14.08	2.428859	0.43122	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78	5.42	0.286	0.15710	Cystathionine beta-synthase, core (3);	0.000000	0.85682	D	0.000000	D	0.96981	0.9014	M	0.88181	2.935	0.80722	D	1	D;D	0.89917	0.984;1.0	P;D	0.87578	0.887;0.998	D	0.94470	0.7684	10	0.52906	T	0.07	-29.8833	5.3095	0.15823	0.3575:0.2297:0.4128:0.0	.	719;789	P51795;P51795-2	CLCN5_HUMAN;.	F	789;621;789;719;719	ENSP00000365256:L789F;ENSP00000365259:L789F;ENSP00000365276:L719F;ENSP00000304257:L719F	ENSP00000304257:L719F	L	+	3	2	CLCN5	49743532	0.013000	0.17824	0.954000	0.39281	0.997000	0.91878	-1.053000	0.03500	0.193000	0.20303	0.513000	0.50165	TTG		0.358	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1			Missense_Mutation
FGD1	2245	broad.mit.edu	37	X	54482211	54482211	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chrX:54482211C>T	ENST00000375135.3	-	11	2582	c.1849G>A	c.(1849-1851)Gac>Aac	p.D617N		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	617	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.D617N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AGGAGGCGGTCGTTGAACTAG	0.552																																																1	Substitution - Missense(1)	ovary(1)	X											41.0	39.0	40.0					X																	54482211		2195	4283	6478	54498936	SO:0001583	missense	2245			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.1849G>A	X.37:g.54482211C>T	ENSP00000364277:p.Asp617Asn		54498936	Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	CCDS14359.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	12.19	1.864891	0.32977	.	.	ENSG00000102302	ENST00000375135	D	0.88586	-2.4	5.08	5.08	0.68730	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.53938	D	0.000046	T	0.78336	0.4267	N	0.14661	0.345	0.48040	D	0.999578	B;B	0.32040	0.286;0.353	B;B	0.32533	0.147;0.131	T	0.76072	-0.3093	10	0.02654	T	1	-1.4559	16.2729	0.82629	0.0:1.0:0.0:0.0	.	375;617	B4DS99;P98174	.;FGD1_HUMAN	N	617	ENSP00000364277:D617N	ENSP00000364277:D617N	D	-	1	0	FGD1	54498936	0.993000	0.37304	1.000000	0.80357	0.998000	0.95712	1.808000	0.38912	2.360000	0.80028	0.600000	0.82982	GAC		0.552	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463		Missense_Mutation
AMER1	139285	broad.mit.edu	37	X	63410074	63410074	+	Silent	SNP	G	G	C			TCGA-13-0913-01	TCGA-13-0913-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chrX:63410074G>C	ENST00000330258.3	-	2	3365	c.3093C>G	c.(3091-3093)ggC>ggG	p.G1031G	AMER1_ENST00000374869.3_Intron|AMER1_ENST00000403336.1_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	1031	Pro-rich.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TATAGCAAGGGCCCATGGGCA	0.572																																																67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	X											34.0	40.0	38.0					X																	63410074		2074	4182	6256	63326799	SO:0001819	synonymous_variant	139285			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.3093C>G	X.37:g.63410074G>C			63326799	A2IB86|Q8N885	Silent	SNP	ENST00000330258.3	37	CCDS14377.2	SNP	42	Broad																																																																																				0.572	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		Silent
ACRC	93953	broad.mit.edu	37	X	70828950	70828950	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chrX:70828950T>A	ENST00000373695.1	+	9	2131	c.1594T>A	c.(1594-1596)Tcc>Acc	p.S532T	ACRC_ENST00000471950.1_3'UTR|ACRC_ENST00000373696.3_Missense_Mutation_p.S532T			Q96QF7	ACRC_HUMAN	acidic repeat containing	532	SprT-like.					nucleus (GO:0005634)		p.S532T(1)		autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					GTTTAACAGATCCGTCTGTGA	0.388																																																1	Substitution - Missense(1)	ovary(1)	X											63.0	53.0	56.0					X																	70828950		2203	4300	6503	70745675	SO:0001583	missense	93953			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.1594T>A	X.37:g.70828950T>A	ENSP00000362799:p.Ser532Thr		70745675	B9EG62	Missense_Mutation	SNP	ENST00000373695.1	37	CCDS35326.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	8.051	0.766014	0.15983	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.40756	1.02;1.02	4.81	-1.12	0.09808	Domain of unknown function SprT-like (2);	.	.	.	.	T	0.25306	0.0615	N	0.11364	0.135	0.09310	N	1	B	0.24882	0.113	B	0.33254	0.16	T	0.36648	-0.9739	9	0.37606	T	0.19	.	9.7292	0.40350	0.7307:0.0:0.0:0.2693	.	532	Q96QF7	ACRC_HUMAN	T	532	ENSP00000362800:S532T;ENSP00000362799:S532T	ENSP00000362799:S532T	S	+	1	0	ACRC	70745675	0.020000	0.18652	0.003000	0.11579	0.006000	0.05464	0.525000	0.22956	-0.104000	0.12154	-0.799000	0.03217	TCC		0.388	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081856.1			Missense_Mutation
PAK3	5063	broad.mit.edu	37	X	110437553	110437553	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0913-01	TCGA-13-0913-10			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chrX:110437553G>T	ENST00000372010.1	+	15	1504	c.1062G>T	c.(1060-1062)tgG>tgT	p.W354C	PAK3_ENST00000446737.1_Missense_Mutation_p.W339C|PAK3_ENST00000417227.1_Missense_Mutation_p.W360C|PAK3_ENST00000425146.1_Missense_Mutation_p.W339C|PAK3_ENST00000262836.4_Missense_Mutation_p.W354C|PAK3_ENST00000519681.1_Missense_Mutation_p.W360C|PAK3_ENST00000372007.5_Missense_Mutation_p.W339C|PAK3_ENST00000360648.4_Missense_Mutation_p.W375C|PAK3_ENST00000518291.1_Missense_Mutation_p.W375C			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	354	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.W339C(1)		breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						ATGAACTATGGGTAGTCATGG	0.463										TSP Lung(19;0.15)																																						1	Substitution - Missense(1)	ovary(1)	X											268.0	224.0	239.0					X																	110437553		2203	4300	6503	110324209	SO:0001583	missense	5063			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.1062G>T	X.37:g.110437553G>T	ENSP00000361080:p.Trp354Cys		110324209	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	37	CCDS48153.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273165	0.59649	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1	4.85	3.98	0.46160	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.063541	0.64402	D	0.000002	T	0.71341	0.3328	L	0.43646	1.37	0.80722	D	1	D;D;D;D;D	0.89917	0.991;1.0;0.998;1.0;0.998	D;D;D;D;D	0.91635	0.934;0.998;0.982;0.999;0.982	T	0.73232	-0.4048	10	0.87932	D	0	.	12.5617	0.56286	0.0835:0.0:0.9165:0.0	.	360;375;354;339;354	O75914-4;O75914-3;O75914;O75914-2;B1GX77	.;.;PAK3_HUMAN;.;.	C	339;339;354;360;339;375;375;360;354	ENSP00000410853:W339C;ENSP00000401982:W339C;ENSP00000361080:W354C;ENSP00000429113:W360C;ENSP00000361077:W339C;ENSP00000428921:W375C;ENSP00000353864:W375C;ENSP00000389172:W360C;ENSP00000262836:W354C	ENSP00000262836:W354C	W	+	3	0	PAK3	110324209	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.240000	0.78192	0.950000	0.37743	0.600000	0.82982	TGG		0.463	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578		Missense_Mutation
IGSF1	3547	broad.mit.edu	37	X	130417181	130417181	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-0913-01	TCGA-13-0913-10	g.chrX:130417181T>C	ENST00000361420.3	-	6	804	c.725A>G	c.(724-726)gAa>gGa	p.E242G	IGSF1_ENST00000370903.3_Missense_Mutation_p.E242G|IGSF1_ENST00000370910.1_Missense_Mutation_p.E233G|IGSF1_ENST00000370904.1_Missense_Mutation_p.E233G			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	242	Ig-like C2-type 3.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.E242G(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						ATTCAGGCTTTCTCCAGGTGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	X											71.0	68.0	69.0					X																	130417181		2203	4300	6503	130244862	SO:0001583	missense	3547			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.725A>G	X.37:g.130417181T>C	ENSP00000355010:p.Glu242Gly		130244862	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	CCDS14629.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	18.79	3.698007	0.68386	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.00832	5.64;5.64;5.64;5.64	4.46	4.46	0.54185	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.277746	0.25938	N	0.027339	T	0.02455	0.0075	L	0.35793	1.09	0.35336	D	0.786059	D;D	0.69078	0.99;0.997	D;D	0.79108	0.917;0.992	T	0.64188	-0.6466	10	0.33940	T	0.23	.	9.2408	0.37495	0.0:0.0:0.0:1.0	.	233;242	Q8N6C5-2;Q8N6C5	.;IGSF1_HUMAN	G	233;242;233;242	ENSP00000359947:E233G;ENSP00000355010:E242G;ENSP00000359941:E233G;ENSP00000359940:E242G	ENSP00000355010:E242G	E	-	2	0	IGSF1	130244862	0.495000	0.26051	1.000000	0.80357	0.997000	0.91878	1.319000	0.33655	1.782000	0.52362	0.481000	0.45027	GAA		0.473	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			Missense_Mutation
NBPF10	100132406	broad.mit.edu	37	1	145327546	145327550	+	Frame_Shift_Del	DEL	TGAAT	TGAAT	-	rs202019968		TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr1:145327546_145327550delTGAAT	ENST00000342960.5	+	32	4138_4142	c.4103_4107delTGAAT	c.(4102-4107)ctgaatfs	p.LN1368fs	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	711						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CAGGACTCACTGAATAGATGTTATT	0.473																																																0			1																																								144038907	SO:0001589	frameshift_variant	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.4103_4107delTGAAT	1.37:g.145327546_145327550delTGAAT	ENSP00000345684:p.Leu1368fs		144038903	Q5RHC0|Q9NWN6	Frame_Shift_Del	DEL	ENST00000342960.5	37	CCDS53355.1	DEL	55	Broad																																																																																				0.473	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703		Frame_Shift_Del
GPR37L1	9283	broad.mit.edu	37	1	202097212	202097220	+	In_Frame_Del	DEL	CAGTCACCT	CAGTCACCT	-			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr1:202097212_202097220delCAGTCACCT	ENST00000367282.5	+	2	1080_1088	c.974_982delCAGTCACCT	c.(973-984)acagtcacctgc>agc	p.325_328TVTC>S		NM_004767.3	NP_004758.3	O60883	ETBR2_HUMAN	G protein-coupled receptor 37 like 1	325					negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.T325_C328>S(1)|p.T327T(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	18						ATCCTCTTCACAGTCACCTGCCAGCTGGT	0.612																																																2	Complex - deletion inframe(1)|Substitution - coding silent(1)	ovary(1)|large_intestine(1)	1																																								200363843	SO:0001651	inframe_deletion	9283			AJ310210	CCDS1420.1	1q32	2012-08-21	2006-02-15		ENSG00000170075	ENSG00000170075		"""GPCR / Class A : Orphans"""	14923	protein-coding gene	gene with protein product						9539149	Standard	NM_004767		Approved	ETBR-LP-2	uc001gxj.3	O60883	OTTHUMG00000035924	ENST00000367282.5:c.974_982delCAGTCACCT	1.37:g.202097212_202097220delCAGTCACCT	ENSP00000356251:p.Thr325_Cys328delinsSer		200363835	B2R7M9|Q5SXP7|Q86VP7	In_Frame_Del	DEL	ENST00000367282.5	37	CCDS1420.1	DEL	17	Broad																																																																																				0.612	GPR37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087496.2	NM_004767		In_Frame_Del
PRKCQ	5588	broad.mit.edu	37	10	6525538	6525556	+	Frame_Shift_Del	DEL	GACTCCCAGGAAATGCCCT	GACTCCCAGGAAATGCCCT	-			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr10:6525538_6525556delGACTCCCAGGAAATGCCCT	ENST00000263125.5	-	11	1124_1142	c.1025_1043delAGGGCATTTCCTGGGAGTC	c.(1024-1044)cagggcatttcctgggagtctfs	p.QGISWES342fs	PRKCQ_ENST00000397176.2_Frame_Shift_Del_p.QGISWES342fs|PRKCQ_ENST00000539722.1_Frame_Shift_Del_p.QGISWES217fs	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	342					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)	p.Q342R(1)|p.E347K(1)|p.Q342fs*17(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	ATCCAACGGAGACTCCCAGGAAATGCCCTGAGGCTCTGA	0.42																																					Ovarian(50;572 1126 10530 25349 30594)											3	Substitution - Missense(2)|Deletion - Frameshift(1)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	10																																								6565562	SO:0001589	frameshift_variant	5588			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1025_1043delAGGGCATTTCCTGGGAGTC	10.37:g.6525538_6525556delGACTCCCAGGAAATGCCCT	ENSP00000263125:p.Gln342fs		6565544	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Frame_Shift_Del	DEL	ENST00000263125.5	37	CCDS7079.1	DEL	33	Broad																																																																																				0.420	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257		Frame_Shift_Del
OR6X1	390260	broad.mit.edu	37	11	123625130	123625130	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr11:123625130delA	ENST00000327930.2	-	1	123	c.97delT	c.(97-99)tacfs	p.Y33fs		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GTTAATATGTAGGTGAGAAAG	0.428																																																0			11											99.0	95.0	96.0					11																	123625130		2202	4299	6501	123130340	SO:0001589	frameshift_variant	390260			AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.97delT	11.37:g.123625130delA	ENSP00000333724:p.Tyr33fs		123130340	B9EGW9|Q6IFA0	Frame_Shift_Del	DEL	ENST00000327930.2	37	CCDS31695.1	DEL	15	Broad																																																																																				0.428	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387436.1	NM_001005188		Frame_Shift_Del
FOXJ2	55810	broad.mit.edu	37	12	8192607	8192614	+	Frame_Shift_Del	DEL	CAGTGCAC	CAGTGCAC	-	rs369499195		TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr12:8192607_8192614delCAGTGCAC	ENST00000162391.3	+	2	1324_1331	c.179_186delCAGTGCAC	c.(178-186)gcagtgcacfs	p.AVH60fs	FOXJ2_ENST00000428177.2_Frame_Shift_Del_p.AVH60fs	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	60					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		GACGAGGCAGCAGTGCACCAGGACGGCA	0.587																																																0			12																																								8083881	SO:0001589	frameshift_variant	55810			AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.179_186delCAGTGCAC	12.37:g.8192607_8192614delCAGTGCAC	ENSP00000162391:p.Ala60fs		8083874	A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Frame_Shift_Del	DEL	ENST00000162391.3	37	CCDS8587.1	DEL	25	Broad																																																																																				0.587	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400088.1	NM_018416		Frame_Shift_Del
UNC79	57578	broad.mit.edu	37	14	94046550	94046600	+	In_Frame_Del	DEL	ACATTATTTCTATTATAAACAATGTCTTCCAAGCCCCCTGGGGGGGATCCC	ACATTATTTCTATTATAAACAATGTCTTCCAAGCCCCCTGGGGGGGATCCC	-	rs114140274	byFrequency	TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr14:94046550_94046600delACATTATTTCTATTATAAACAATGTCTTCCAAGCCCCCTGGGGGGGATCCC	ENST00000393151.2	+	19	2489_2539	c.2489_2539delACATTATTTCTATTATAAACAATGTCTTCCAAGCCCCCTGGGGGGGATCCC	c.(2488-2541)gacattatttctattataaacaatgtcttccaagccccctgggggggatcccac>gac	p.IISIINNVFQAPWGGSH831del	UNC79_ENST00000256339.4_In_Frame_Del_p.IISIINNVFQAPWGGSH654del|UNC79_ENST00000555664.1_In_Frame_Del_p.IISIINNVFQAPWGGSH831del|UNC79_ENST00000553484.1_In_Frame_Del_p.IISIINNVFQAPWGGSH831del			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	831					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I654_H670del(1)|p.G668fs*34(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TTATCAAAGGACATTATTTCTATTATAAACAATGTCTTCCAAGCCCCCTGGGGGGGATCCCACACCTGCCA	0.442																																																2	Deletion - Frameshift(1)|Deletion - In frame(1)	ovary(1)|breast(1)	14																																								93116353	SO:0001651	inframe_deletion	57578			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.2489_2539delACATTATTTCTATTATAAACAATGTCTTCCAAGCCCCCTGGGGGGGATCCC	14.37:g.94046550_94046600delACATTATTTCTATTATAAACAATGTCTTCCAAGCCCCCTGGGGGGGATCCC	ENSP00000376858:p.Ile831_His847del		93116303	B5MDL6|Q6ZUT7	In_Frame_Del	DEL	ENST00000393151.2	37		DEL	10	Broad																																																																																				0.442	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		In_Frame_Del
MUC16	94025	broad.mit.edu	37	19	9088834	9088848	+	In_Frame_Del	DEL	GCAGAGAGAGAAGTG	GCAGAGAGAGAAGTG	-	rs76966635		TCGA-13-0913-01	TCGA-13-0913-10			-	GCAGAGAGAGAAGTG	GCAGAGAGAGAAGTG	GCAGAGAGAGAAGTG	Unknown	Valid	Somatic	Phase_I	Capture	none			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr19:9088834_9088848delGCAGAGAGAGAAGTG	ENST00000397910.4	-	1	3170_3184	c.2967_2981delCACTTCTCTCTCTGC	c.(2965-2982)gccacttctctctctgct>gct	p.989_994ATSLSA>A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	989	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CATTACAGTAGCAGAGAGAGAAGTGGCAGAGGTTG	0.47																																																0			19																																								8949848	SO:0001651	inframe_deletion	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.2967_2981delCACTTCTCTCTCTGC	19.37:g.9088834_9088848delGCAGAGAGAGAAGTG	ENSP00000381008:p.Ala989_Ser993del		8949834	Q6ZQW5|Q96RK2	In_Frame_Del	DEL	ENST00000397910.4	37	CCDS54212.1	DEL	34	Broad																																																																																				0.470	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		In_Frame_Del
ASNA1	439	broad.mit.edu	37	19	12856512	12856523	+	In_Frame_Del	DEL	TGGAGCGGGGCC	TGGAGCGGGGCC	-			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr19:12856512_12856523delTGGAGCGGGGCC	ENST00000591090.1	+	5	650_661	c.548_559delTGGAGCGGGGCC	c.(547-561)gtggagcggggcctg>gtg	p.ERGL184del	ASNA1_ENST00000357332.3_In_Frame_Del_p.ERGL184del					arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)									p.E184_L187del(1)		endometrium(1)|lung(6)|ovary(3)	10						CCCACCATCGTGGAGCGGGGCCTGGGCCGGCT	0.642																																																1	Deletion - In frame(1)	ovary(1)	19																																								12717523	SO:0001651	inframe_deletion	439			U60276	CCDS32920.1	19p13.13	2010-08-05	2001-12-04			ENSG00000198356			752	protein-coding gene	gene with protein product	"""golgi to ER traffic 3 homolog (S. cerevisiae)"", ""transmembrane domain recognition complex, 40kDa"""	601913	"""arsA (bacterial) arsenite transporter, ATP-binding, homolog 1"""			8884272, 17382883	Standard	NM_004317		Approved	ARSA-I, GET3, TRC40	uc002muv.3	O43681		ENST00000591090.1:c.548_559delTGGAGCGGGGCC	19.37:g.12856512_12856523delTGGAGCGGGGCC	ENSP00000466379:p.Glu184_Leu187del		12717512		In_Frame_Del	DEL	ENST00000591090.1	37	CCDS32920.1	DEL	59	Broad																																																																																				0.642	ASNA1-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450921.1	NM_004317		In_Frame_Del
MYO3B	140469	broad.mit.edu	37	2	171240223	171240252	+	In_Frame_Del	DEL	TCCAGACTTTATCATGGGGTGAAACGCGCC	TCCAGACTTTATCATGGGGTGAAACGCGCC	-	rs551776281|rs10168181|rs201471096|rs11675394	byFrequency	TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr2:171240223_171240252delTCCAGACTTTATCATGGGGTGAAACGCGCC	ENST00000408978.4	+	12	1332_1361	c.1189_1218delTCCAGACTTTATCATGGGGTGAAACGCGCC	c.(1189-1218)tccagactttatcatggggtgaaacgcgccdel	p.SRLYHGVKRA397del	MYO3B_ENST00000334231.6_In_Frame_Del_p.SRLYHGVKRA406del|MYO3B_ENST00000602629.1_3'UTR|MYO3B_ENST00000409044.3_In_Frame_Del_p.SRLYHGVKRA397del	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	397	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)	p.R405L(1)|p.S397_A406del(1)|p.R405C(1)		breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						CCTTCAGTTTTCCAGACTTTATCATGGGGTGAAACGCGCCTCCAATCCCC	0.448																																																3	Substitution - Missense(2)|Deletion - In frame(1)	ovary(1)|lung(1)|large_intestine(1)	2																																								170948498	SO:0001651	inframe_deletion	140469				CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.1189_1218delTCCAGACTTTATCATGGGGTGAAACGCGCC	2.37:g.171240223_171240252delTCCAGACTTTATCATGGGGTGAAACGCGCC	ENSP00000386213:p.Ser397_Ala406del		170948469	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	In_Frame_Del	DEL	ENST00000408978.4	37	CCDS42773.1	DEL	62	Broad																																																																																				0.448	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1			In_Frame_Del
DHX30	22907	broad.mit.edu	37	3	47891104	47891123	+	Splice_Site	DEL	GCCCTGTGTTCCCTAGGGAG	GCCCTGTGTTCCCTAGGGAG	-	rs372320878|rs141645399|rs373981655	byFrequency	TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr3:47891104_47891123delGCCCTGTGTTCCCTAGGGAG	ENST00000445061.1	+	21	3598_3602	c.3191_3195delGCCCTGTGTTCCCTAGGGAG	c.(3190-3195)agccct>a	p.SP1064fs	DHX30_ENST00000457607.1_Splice_Site_p.SP1092fs|DHX30_ENST00000446256.2_Splice_Site_p.SP1025fs|MIR1226_ENST00000408658.1_RNA|DHX30_ENST00000348968.4_Splice_Site_p.SP1036fs	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	1064						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.?(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GGCCTCACCAGCCCTGTGTTCCCTAGGGAGGCCACACGGT	0.591																																																1	Unknown(1)	ovary(1)	3																																								47866127	SO:0001630	splice_region_variant	22907			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.3192-1GCCCTGTGTTCCCTAGGGAG>-	3.37:g.47891104_47891123delGCCCTGTGTTCCCTAGGGAG			47866108	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Splice_Site_Del	DEL	ENST00000445061.1	37	CCDS2759.1	DEL	34	Broad																																																																																				0.591	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615	Frame_Shift_Del	Splice_Site_Del
SYNGAP1	8831	broad.mit.edu	37	6	33411675	33411683	+	In_Frame_Del	DEL	GGGGGCAGC	GGGGGCAGC	-			TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr6:33411675_33411683delGGGGGCAGC	ENST00000418600.2	+	15	3447_3455	c.3346_3354delGGGGGCAGC	c.(3346-3354)gggggcagcdel	p.GGS1119del	SYNGAP1_ENST00000428982.2_In_Frame_Del_p.GGS1060del|SYNGAP1_ENST00000293748.5_In_Frame_Del_p.GGS1119del|SYNGAP1_ENST00000496374.1_3'UTR	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	1119					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.G1101_S1103delGGS(1)|p.G1116_S1118delGGS(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GGGCAGCATTGGGGGCAGCGGGGGCAGCG	0.67																																																2	Deletion - In frame(2)	ovary(2)	6																																								33519661	SO:0001651	inframe_deletion	8831			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.3346_3354delGGGGGCAGC	6.37:g.33411684_33411692delGGGGGCAGC	ENSP00000403636:p.Gly1119_Ser1121del		33519653	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	In_Frame_Del	DEL	ENST00000418600.2	37	CCDS34434.2	DEL	47	Broad																																																																																				0.670	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407		In_Frame_Del
DCAF4L2	138009	broad.mit.edu	37	8	88886199	88886204	+	Start_Codon_Del	DEL	TTTCGT	TTTCGT	-	rs368234415		TCGA-13-0913-01	TCGA-13-0913-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chr8:88886199_88886204delTTTCGT	ENST00000319675.3	-	0	92_97					NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2											breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						TTGCTCTCCATTTCGTTCGGCGGATG	0.529																																																0			8																																								88955320	SO:0001582	initiator_codon_variant	138009			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75			8.37:g.88886199_88886204delTTTCGT			88955315		Nonsense_Mutation	DEL	ENST00000319675.3	37	CCDS6245.1	DEL	52	Broad																																																																																				0.529	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		Nonsense_Mutation
ARMCX2	9823	broad.mit.edu	37	X	100911606	100911628	+	Frame_Shift_Del	DEL	GGCTGCAGCAGCTGCTGCAGCCC	GGCTGCAGCAGCTGCTGCAGCCC	-			TCGA-13-0913-01	TCGA-13-0913-10			-	GGCTGCAGCAGCTGCTGCAGCCC	GGCTGCAGCAGCTGCTGCAGCCC	GGCTGCAGCAGCTGCTGCAGCCC	Unknown	Valid	Somatic	Phase_I	Capture	none			Illumina GAIIx	TCGA-13-0913-01	TCGA-13-0913-10	g.chrX:100911606_100911628delGGCTGCAGCAGCTGCTGCAGCCC	ENST00000328766.5	-	5	1400_1422	c.947_969delGGGCTGCAGCAGCTGCTGCAGCC	c.(946-969)ggggctgcagcagctgctgcagccfs	p.GAAAAAAA316fs	ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000330154.2_Frame_Shift_Del_p.GAAAAAAA316fs|ARMCX2_ENST00000356824.4_Frame_Shift_Del_p.GAAAAAAA316fs	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	316						integral component of membrane (GO:0016021)		p.G316fs*3(1)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						CATTAGCAGAGGCTGCAGCAGCTGCTGCAGCCCCATCTCCAGG	0.592																																																1	Deletion - Frameshift(1)	ovary(1)	X																																								100798284	SO:0001589	frameshift_variant	9823			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.947_969delGGGCTGCAGCAGCTGCTGCAGCC	X.37:g.100911606_100911628delGGCTGCAGCAGCTGCTGCAGCCC	ENSP00000331662:p.Gly316fs		100798262	O60267|Q5H9D9	Frame_Shift_Del	DEL	ENST00000328766.5	37	CCDS14490.1	DEL	35	Broad																																																																																				0.592	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782		Frame_Shift_Del
