#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
Unknown	0	genome.wustl.edu	37	6	239806	239806	+	IGR	SNP	A	A	G	rs79281532	byFrequency	TCGA-13-1404-01	TCGA-13-1404-10	A	A	G	G	G	G	Unknown	Valid	Germline	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr6:239806A>G								RP3-416J7.5 (33414 upstream) : DUSP22 (52290 downstream)																							GGACTTTCCCAGTTCCTCCCT	0.507													A|||	83	0.0165735	0.0023	0.0303	5008	,	,		19366	0.0		0.0537	False		,,,				2504	0.0051															0			6																																								184806	SO:0001628	intergenic_variant	730074																															6.37:g.239806A>G			184806		Missense_Mutation	SNP		37		SNP	7	WashU																																																																																			0	0.507									Missense_Mutation
TPO	7173	genome.wustl.edu	37	2	1507833	1507833	+	Missense_Mutation	SNP	G	G	A	rs368163933		TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr2:1507833G>A	ENST00000345913.4	+	14	2591	c.2500G>A	c.(2500-2502)Gat>Aat	p.D834N	TPO_ENST00000349624.3_Missense_Mutation_p.D661N|TPO_ENST00000346956.3_Intron|TPO_ENST00000329066.4_Missense_Mutation_p.D834N|TPO_ENST00000382201.3_Missense_Mutation_p.D777N|TPO_ENST00000497517.2_3'UTR|TPO_ENST00000337415.3_Missense_Mutation_p.D834N|TPO_ENST00000382198.1_Missense_Mutation_p.D661N	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	834	EGF-like; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.D834N(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GTTAGGAGACGATGGGAGAAC	0.557																																																1	Substitution - Missense(1)	ovary(1)	2						G	ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,,ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	89.0	82.0	85.0		2500,2500,2329,2329,,1981	4.4	0.1	2		85	0,8600		0,0,4300	no	missense,missense,missense,missense,intron,missense	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	23,23,23,23,,23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,,probably-damaging	834/934,834/934,777/877,777/877,,661/761	1507833	1,13005	2203	4300	6503	1486840	SO:0001583	missense	7173				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2500G>A	2.37:g.1507833G>A	ENSP00000318820:p.Asp834Asn		1486840	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	16.44	3.125039	0.56721	2.27E-4	0.0	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000425083	D;D;D;D;D;D;D	0.96334	-3.98;-3.98;-3.98;-3.98;-3.98;-3.98;-3.98	4.4	4.4	0.53042	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.947276	0.08690	N	0.908037	D	0.96965	0.9009	L	0.31526	0.94	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.94646	0.7835	10	0.87932	D	0	-29.9493	16.5588	0.84534	0.0:0.0:1.0:0.0	.	661;777;834	P07202-5;P07202-2;P07202	.;.;PERT_HUMAN	N	834;834;661;834;777;661;55	ENSP00000337263:D834N;ENSP00000318820:D834N;ENSP00000332044:D661N;ENSP00000329869:D834N;ENSP00000371636:D777N;ENSP00000371633:D661N;ENSP00000389659:D55N	ENSP00000329869:D834N	D	+	1	0	TPO	1486840	1.000000	0.71417	0.052000	0.19188	0.234000	0.25298	6.018000	0.70811	2.012000	0.59069	0.297000	0.19635	GAT		0.557	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547		Missense_Mutation
PLIN4	729359	genome.wustl.edu	37	19	4511818	4511818	+	Silent	SNP	A	A	G	rs542160942	byFrequency	TCGA-13-1404-01	TCGA-13-1404-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr19:4511818A>G	ENST00000301286.3	-	3	2111	c.2112T>C	c.(2110-2112)agT>agC	p.S704S		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	704	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)		p.S632S(1)		NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						TGGTGTCCACACTGGTCTGGA	0.607													G|||	33	0.00658946	0.003	0.0331	5008	,	,		42416	0.004		0.0	False		,,,				2504	0.002															1	Substitution - coding silent(1)	ovary(1)	19											256.0	274.0	268.0					19																	4511818		2147	4255	6402	4462818	SO:0001819	synonymous_variant	729359			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2112T>C	19.37:g.4511818A>G			4462818	A6NEI2	Silent	SNP	ENST00000301286.3	37	CCDS45927.1	SNP	6	WashU																																																																																				0.607	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901		Silent
TP53	7157	genome.wustl.edu	37	17	7578403	7578403	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr17:7578403C>T	ENST00000269305.4	-	5	716	c.527G>A	c.(526-528)tGc>tAc	p.C176Y	TP53_ENST00000445888.2_Missense_Mutation_p.C176Y|TP53_ENST00000413465.2_Missense_Mutation_p.C176Y|TP53_ENST00000359597.4_Missense_Mutation_p.C176Y|TP53_ENST00000455263.2_Missense_Mutation_p.C176Y|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.C176Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176F(129)|p.C176Y(63)|p.C83F(9)|p.C44F(9)|p.C176S(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C44Y(3)|p.C83Y(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGTGGGGGCAGCGCCTCAC	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	267	Substitution - Missense(224)|Deletion - Frameshift(18)|Deletion - In frame(13)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	lung(42)|large_intestine(38)|upper_aerodigestive_tract(36)|oesophagus(26)|breast(26)|liver(20)|ovary(19)|haematopoietic_and_lymphoid_tissue(13)|stomach(10)|central_nervous_system(9)|bone(9)|urinary_tract(7)|genital_tract(2)|skin(2)|pancreas(2)|prostate(2)|adrenal_gland(1)|vulva(1)|biliary_tract(1)|endometrium(1)	17											49.0	49.0	49.0					17																	7578403		2203	4300	6503	7519128	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.527G>A	17.37:g.7578403C>T	ENSP00000269305:p.Cys176Tyr		7519128	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497871	0.85069	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62	5.59	4.61	0.57282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.996;0.997;0.998;0.998;0.997;0.997	D	0.96187	0.9135	10	0.87932	D	0	-18.1821	13.8336	0.63395	0.1543:0.8457:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176Y;ENSP00000352610:C176Y;ENSP00000269305:C176Y;ENSP00000398846:C176Y;ENSP00000391127:C176Y;ENSP00000391478:C176Y;ENSP00000425104:C44Y;ENSP00000423862:C83Y	ENSP00000269305:C176Y	C	-	2	0	TP53	7519128	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	7.775000	0.85489	1.472000	0.48140	0.655000	0.94253	TGC		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
COL5A3	50509	genome.wustl.edu	37	19	10085074	10085074	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1404-01	TCGA-13-1404-10	C	C	G	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr19:10085074C>G	ENST00000264828.3	-	46	3438	c.3353G>C	c.(3352-3354)gGg>gCg	p.G1118A		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1118	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.G1118A(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CCCCTGAGCCCCGTCTGCTCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											28.0	32.0	31.0					19																	10085074		2203	4300	6503	9946074	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3353G>C	19.37:g.10085074C>G	ENSP00000264828:p.Gly1118Ala		9946074	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	17.28	3.350194	0.61183	.	.	ENSG00000080573	ENST00000264828	D	0.99158	-5.5	4.56	4.56	0.56223	.	0.000000	0.64402	D	0.000001	D	0.99450	0.9805	H	0.94658	3.565	0.58432	D	0.999999	D	0.76494	0.999	D	0.78314	0.991	D	0.98316	1.0526	10	0.87932	D	0	.	14.8495	0.70286	0.0:1.0:0.0:0.0	.	1118	P25940	CO5A3_HUMAN	A	1118	ENSP00000264828:G1118A	ENSP00000264828:G1118A	G	-	2	0	COL5A3	9946074	1.000000	0.71417	0.785000	0.31869	0.379000	0.30106	5.060000	0.64312	2.070000	0.61991	0.313000	0.20887	GGG		0.592	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719		Missense_Mutation
FGD5	152273	genome.wustl.edu	37	3	14960261	14960261	+	Splice_Site	SNP	G	G	A			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr3:14960261G>A	ENST00000285046.5	+	13	3600	c.3490G>A	c.(3490-3492)Gtc>Atc	p.V1164I	FGD5_ENST00000476851.1_3'UTR|FGD5-AS1_ENST00000430166.1_RNA|FGD5_ENST00000543601.1_Splice_Site_p.V923I	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1164	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.V923I(1)		NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GGTTTTCCAGGTCAGCCGCCC	0.597																																																1	Substitution - Missense(1)	ovary(1)	3											77.0	77.0	77.0					3																	14960261		1992	4164	6156	14935265	SO:0001630	splice_region_variant	152273			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3490-1G>A	3.37:g.14960261G>A			14935265	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	37	CCDS46767.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218184	0.79464	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.75704	-0.96;-0.96	3.86	3.86	0.44501	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.45361	D	0.000374	T	0.77136	0.4086	M	0.64997	1.995	0.80722	D	1	P;P	0.51147	0.942;0.942	P;P	0.51415	0.669;0.669	T	0.77723	-0.2481	9	.	.	.	-31.0389	12.6537	0.56776	0.0:0.0:1.0:0.0	.	923;1164	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	I	1164;923	ENSP00000285046:V1164I;ENSP00000445949:V923I	.	V	+	1	0	FGD5	14935265	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.804000	0.75186	1.988000	0.58038	0.591000	0.81541	GTC		0.597	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	Missense_Mutation	Missense_Mutation
PTER	9317	genome.wustl.edu	37	10	16528617	16528617	+	Splice_Site	SNP	G	G	C			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr10:16528617G>C	ENST00000378000.1	+	4	944		c.e4+1		PTER_ENST00000485788.1_3'UTR|PTER_ENST00000535784.2_Splice_Site|PTER_ENST00000298942.3_Splice_Site|PTER_ENST00000423462.2_Splice_Site	NM_001001484.2|NM_001261838.1|NM_030664.4	NP_001001484.1|NP_001248767.1|NP_109589.2	Q96BW5	PTER_HUMAN	phosphotriesterase related						catabolic process (GO:0009056)|epithelial cell differentiation (GO:0030855)	extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)	p.?(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)	15						ACCTGGATAGGTAAGTAGGCT	0.418																																					Ovarian(2;46 150 15648 38137 47908)											1	Unknown(1)	ovary(1)	10											71.0	72.0	72.0					10																	16528617		2203	4300	6503	16568623	SO:0001630	splice_region_variant	9317			BC015092	CCDS7111.1, CCDS58070.1, CCDS73070.1	10p12	2003-11-05			ENSG00000165983	ENSG00000165983			9590	protein-coding gene	gene with protein product		604446				9925913	Standard	NM_001001484		Approved		uc001ioi.2	Q96BW5	OTTHUMG00000017737	ENST00000378000.1:c.698+1G>C	10.37:g.16528617G>C			16568623	B0YJ77|B3KTF5|D3DRU0|Q9BY46	Splice_Site_SNP	SNP	ENST00000378000.1	37	CCDS7111.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415696	0.62511	.	.	ENSG00000165983	ENST00000343656;ENST00000535784;ENST00000423462;ENST00000378000;ENST00000298942	.	.	.	6.07	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1338	0.72545	0.0672:0.0:0.9328:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTER	16568623	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	8.025000	0.88777	1.586000	0.49944	0.650000	0.86243	.		0.418	PTER-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047001.2	NM_030664	Intron	Splice_Site_SNP
RBM24	221662	genome.wustl.edu	37	6	17284942	17284942	+	Splice_Site	SNP	G	G	A			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr6:17284942G>A	ENST00000379052.5	+	3	583	c.347G>A	c.(346-348)gGg>gAg	p.G116E	RBM24_ENST00000318204.5_Splice_Site_p.G71E|RBM24_ENST00000425446.2_Splice_Site_p.G58E	NM_001143942.1	NP_001137414.1	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24	116					cell differentiation (GO:0030154)|regulation of mRNA stability (GO:0043488)|regulation of myotube differentiation (GO:0010830)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)	p.G71E(1)		endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	13	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			AGACCTTTCGGGTAAGTTGAT	0.358																																																1	Substitution - Missense(1)	ovary(1)	6											194.0	191.0	192.0					6																	17284942		2203	4300	6503	17392921	SO:0001630	splice_region_variant	221662			BC040928	CCDS4538.1, CCDS47378.1, CCDS47379.1	6p22.3	2013-02-12	2004-04-23	2004-04-23	ENSG00000112183	ENSG00000112183		"""RNA binding motif (RRM) containing"""	21539	protein-coding gene	gene with protein product			"""RNA-binding region (RNP1, RRM) containing 6"""	RNPC6			Standard	NM_153020		Approved	FLJ30829, dJ259A10.1	uc003nbz.4	Q9BX46	OTTHUMG00000014306	ENST00000379052.5:c.347+1G>A	6.37:g.17284942G>A			17392921	E9PAY4|Q6QDA4|Q8N9D3|Q96NI3	Missense_Mutation	SNP	ENST00000379052.5	37	CCDS47378.1	SNP	43	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.325157|4.325157	0.81580|0.81580	.|.	.|.	ENSG00000112183|ENSG00000112183	ENST00000379052;ENST00000509686;ENST00000425446;ENST00000318204|ENST00000503965	T;T;T|T	0.23754|0.24538	2.13;1.92;1.89|1.85	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.40956|0.40956	0.1138|0.1138	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.999;0.992;0.992|.	D;D;D|.	0.72338|.	0.977;0.937;0.937|.	T|T	0.15752|0.15752	-1.0426|-1.0426	10|8	0.54805|0.44086	T|T	0.06|0.13	-6.2533|-6.2533	19.119|19.119	0.93355|0.93355	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	71;116;116|.	Q9BX46-2;Q9BX46;A8KAI7|.	.;RBM24_HUMAN;.|.	E|R	116;75;58;71|81	ENSP00000368341:G116E;ENSP00000396898:G58E;ENSP00000319551:G71E|ENSP00000421971:G81R	ENSP00000319551:G71E|ENSP00000421971:G81R	G|G	+|+	2|1	0|0	RBM24|RBM24	17392921|17392921	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.938000|0.938000	0.57974|0.57974	9.843000|9.843000	0.99491|0.99491	2.525000|2.525000	0.85131|0.85131	0.557000|0.557000	0.71058|0.71058	GGG;GGA;GGG;GGG|GGA		0.358	RBM24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039946.2	NM_153020	Missense_Mutation	Missense_Mutation
IL25	64806	genome.wustl.edu	37	14	23844833	23844833	+	Splice_Site	SNP	G	G	A			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr14:23844833G>A	ENST00000329715.2	+	2	536		c.e2-1		CMTM5_ENST00000555731.1_5'Flank|CMTM5_ENST00000359320.3_5'Flank|IL25_ENST00000397242.2_Splice_Site|CMTM5_ENST00000397227.3_5'Flank|CMTM5_ENST00000339180.4_5'Flank|CMTM5_ENST00000342473.4_5'Flank|CMTM5_ENST00000382809.2_5'Flank	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25						eosinophil differentiation (GO:0030222)|inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to fungus (GO:0009620)|response to nematode (GO:0009624)	extracellular space (GO:0005615)	interleukin-17E receptor binding (GO:0030380)	p.?(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		CGCCCCCACAGGTTGGACAGA	0.637																																																1	Unknown(1)	ovary(1)	14											106.0	110.0	109.0					14																	23844833		2203	4300	6503	22914673	SO:0001630	splice_region_variant	64806			AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090		"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E		11058597, 11754819	Standard	NM_172314		Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.279-1G>A	14.37:g.23844833G>A			22914673	Q2M3F0|Q8IZV3|Q8WXB0	Splice_Site_SNP	SNP	ENST00000329715.2	37	CCDS9597.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	18.22	3.576708	0.65878	.	.	ENSG00000166090	ENST00000397242;ENST00000329715	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7287	0.57185	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IL25	22914673	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.629000	0.61290	2.378000	0.81104	0.491000	0.48974	.		0.637	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071789.2		Intron	Splice_Site_SNP
KRT18P55	284085	genome.wustl.edu	37	17	26604021	26604021	+	RNA	SNP	C	C	A			TCGA-13-1404-01	TCGA-13-1404-10	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr17:26604021C>A	ENST00000577198.1	-	0	940				AC061975.8_ENST00000385109.1_RNA	NR_028334.1				keratin 18 pseudogene 55																		CCCTTCTTCTCCAGGTGCTCC	0.547																																																0			17											55.0	59.0	57.0					17																	26604021		2112	4255	6367	23628148			284085					17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26604021C>A			23628148		Nonsense_Mutation	SNP	ENST00000577198.1	37		SNP	30	WashU																																																																																				0.547	KRT18P55-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000446194.1	NR_028334		Nonsense_Mutation
KIAA0319	9856	genome.wustl.edu	37	6	24576596	24576596	+	Splice_Site	SNP	C	C	G			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr6:24576596C>G	ENST00000378214.3	-	10	2258	c.1734G>C	c.(1732-1734)caG>caC	p.Q578H	KIAA0319_ENST00000543707.1_Splice_Site_p.Q578H|KIAA0319_ENST00000430948.2_Splice_Site_p.Q533H|KIAA0319_ENST00000535378.1_Splice_Site_p.Q569H|KIAA0319_ENST00000537886.1_Splice_Site_p.Q578H	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	578	PKD 3. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q578H(1)		breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						GAGAACTTGCCTGCATGACCA	0.473																																																1	Substitution - Missense(1)	ovary(1)	6											222.0	200.0	208.0					6																	24576596		2203	4300	6503	24684575	SO:0001630	splice_region_variant	9856			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.1734+1G>C	6.37:g.24576596C>G			24684575	A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	ENST00000378214.3	37	CCDS34348.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	20.5	4.001475	0.74818	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42	3.9	3.9	0.45041	PKD/Chitinase domain (1);PKD/REJ-like protein (1);PKD domain (3);	0.167911	0.40554	N	0.001080	D	0.82440	0.5037	M	0.92367	3.3	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;P;D	0.66979	0.914;0.878;0.948	D	0.87270	0.2285	9	.	.	.	-12.6337	16.4334	0.83861	0.0:1.0:0.0:0.0	.	578;569;578	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	H	578;569;533;578;578	ENSP00000439700:Q578H;ENSP00000442403:Q569H;ENSP00000401086:Q533H;ENSP00000367459:Q578H;ENSP00000437656:Q578H	.	Q	-	3	2	KIAA0319	24684575	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	6.348000	0.73009	2.153000	0.67306	0.655000	0.94253	CAG		0.473	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040009.1	NM_014809	Missense_Mutation	Missense_Mutation
EFCAB6	64800	genome.wustl.edu	37	22	44022441	44022441	+	Missense_Mutation	SNP	C	C	T	rs184368750		TCGA-13-1404-01	TCGA-13-1404-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr22:44022441C>T	ENST00000262726.7	-	20	2604	c.2351G>A	c.(2350-2352)cGc>cAc	p.R784H	EFCAB6_ENST00000396231.2_Missense_Mutation_p.R632H	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	784					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R784H(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				GCCAAGGAAGCGCTCAAACTC	0.433													C|||	1	0.000199681	0.0	0.0	5008	,	,		18628	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	22											93.0	88.0	90.0					22																	44022441		2203	4300	6503	42353774	SO:0001583	missense	64800			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.2351G>A	22.37:g.44022441C>T	ENSP00000262726:p.Arg784His		42353774	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	CCDS14049.1	SNP	27	WashU	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	17.50	3.404644	0.62288	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.08634	3.07;3.07	4.84	3.79	0.43588	EF-hand-like domain (1);	0.000000	0.64402	D	0.000004	T	0.20455	0.0492	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	0.968;1.0	B;D	0.79108	0.398;0.992	T	0.00632	-1.1635	10	0.25751	T	0.34	-22.0086	10.8576	0.46808	0.0:0.9075:0.0:0.0925	.	632;784	Q5THR3-2;Q5THR3	.;EFCB6_HUMAN	H	632;784	ENSP00000379533:R632H;ENSP00000262726:R784H	ENSP00000262726:R784H	R	-	2	0	EFCAB6	42353774	0.267000	0.24122	0.956000	0.39512	0.567000	0.35839	0.569000	0.23638	2.497000	0.84241	0.563000	0.77884	CGC		0.433	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785		Missense_Mutation
SRF	6722	genome.wustl.edu	37	6	43144302	43144302	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr6:43144302G>T	ENST00000265354.4	+	4	1417	c.1059G>T	c.(1057-1059)caG>caT	p.Q353H	SRF_ENST00000457278.2_Missense_Mutation_p.Q149H	NM_003131.2	NP_003122.1	P11831	SRF_HUMAN	serum response factor (c-fos serum response element-binding transcription factor)	353					angiogenesis involved in wound healing (GO:0060055)|associative learning (GO:0008306)|cardiac myofibril assembly (GO:0055003)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular senescence (GO:0090398)|contractile actin filament bundle assembly (GO:0030038)|developmental growth (GO:0048589)|dorsal aorta morphogenesis (GO:0035912)|epithelial cell-cell adhesion (GO:0090136)|epithelial structure maintenance (GO:0010669)|erythrocyte development (GO:0048821)|eyelid development in camera-type eye (GO:0061029)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|hematopoietic stem cell differentiation (GO:0060218)|hippocampus development (GO:0021766)|long term synaptic depression (GO:0060292)|long-term memory (GO:0007616)|megakaryocyte development (GO:0035855)|mesoderm formation (GO:0001707)|morphogenesis of an epithelial sheet (GO:0002011)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|neuron development (GO:0048666)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|platelet formation (GO:0030220)|positive regulation of cell differentiation (GO:0045597)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription by glucose (GO:0046016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive thymic T cell selection (GO:0045059)|primitive streak formation (GO:0090009)|regulation of cell adhesion (GO:0030155)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of water loss via skin (GO:0033561)|response to cytokine (GO:0034097)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|sarcomere organization (GO:0045214)|skin morphogenesis (GO:0043589)|stress fiber assembly (GO:0043149)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|tight junction assembly (GO:0070830)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)	p.Q353H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	12			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.011)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			CAGTGGCCCAGCAGGTCCCAG	0.622																																																1	Substitution - Missense(1)	ovary(1)	6											112.0	92.0	99.0					6																	43144302		2203	4300	6503	43252280	SO:0001583	missense	6722			J03161	CCDS4889.1	6p	2008-02-05			ENSG00000112658	ENSG00000112658			11291	protein-coding gene	gene with protein product		600589				3203386	Standard	NM_003131		Approved	MCM1	uc003oui.3	P11831	OTTHUMG00000014722	ENST00000265354.4:c.1059G>T	6.37:g.43144302G>T	ENSP00000265354:p.Gln353His		43252280	Q5T648	Missense_Mutation	SNP	ENST00000265354.4	37	CCDS4889.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	13.49	2.251673	0.39797	.	.	ENSG00000112658	ENST00000265354;ENST00000457278	D	0.85088	-1.94	5.17	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.81508	0.4837	L	0.27053	0.805	0.58432	D	0.999994	D	0.61697	0.99	D	0.72982	0.979	T	0.82368	-0.0492	10	0.39692	T	0.17	-17.94	10.998	0.47589	0.1492:0.0:0.8508:0.0	.	353	P11831	SRF_HUMAN	H	353;149	ENSP00000265354:Q353H	ENSP00000265354:Q353H	Q	+	3	2	SRF	43252280	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.094000	0.50227	1.420000	0.47138	0.655000	0.94253	CAG		0.622	SRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040581.1	NM_003131		Missense_Mutation
SETD2	29072	genome.wustl.edu	37	3	47139491	47139491	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr3:47139491G>A	ENST00000409792.3	-	9	5138	c.5096C>T	c.(5095-5097)gCa>gTa	p.A1699V		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1699					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.A1699V(1)|p.A1196V(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CCCTCCTGCTGCTCTGATGCT	0.413			"""N, F, S, Mis"""		clear cell renal carcinoma																																		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Substitution - Missense(2)	ovary(2)	3											115.0	101.0	106.0					3																	47139491		2203	4300	6503	47114495	SO:0001583	missense	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.5096C>T	3.37:g.47139491G>A	ENSP00000386759:p.Ala1699Val		47114495	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	35	5.581620	0.96565	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.90133	-2.62	5.29	5.29	0.74685	.	0.000000	0.52532	D	0.000065	D	0.94424	0.8206	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.986	D	0.94351	0.7579	10	0.62326	D	0.03	.	19.1238	0.93374	0.0:0.0:1.0:0.0	.	1699;1699	F2Z317;Q9BYW2	.;SETD2_HUMAN	V	1699	ENSP00000386759:A1699V	ENSP00000386759:A1699V	A	-	2	0	SETD2	47114495	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.629000	0.98417	2.752000	0.94435	0.557000	0.71058	GCA		0.413	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		Missense_Mutation
NR1H3	10062	genome.wustl.edu	37	11	47290239	47290239	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1404-01	TCGA-13-1404-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr11:47290239C>T	ENST00000467728.1	+	9	2574	c.1336C>T	c.(1336-1338)Cac>Tac	p.H446Y	NR1H3_ENST00000405576.1_Missense_Mutation_p.H341Y|NR1H3_ENST00000407404.1_Missense_Mutation_p.H386Y|NR1H3_ENST00000481889.2_Missense_Mutation_p.H465Y|NR1H3_ENST00000527949.1_Missense_Mutation_p.H295Y|NR1H3_ENST00000405853.3_Missense_Mutation_p.H386Y|MADD_ENST00000342922.4_5'Flank|MADD_ENST00000402192.2_5'Flank|MADD_ENST00000407859.3_5'Flank|NR1H3_ENST00000441012.2_Missense_Mutation_p.H446Y|MADD_ENST00000349238.3_5'Flank|MADD_ENST00000395336.3_5'Flank|MADD_ENST00000311027.5_5'Flank|NR1H3_ENST00000395397.3_Missense_Mutation_p.H401Y|MADD_ENST00000395344.3_5'Flank|NR1H3_ENST00000529540.1_3'UTR|RP11-17G12.3_ENST00000545474.1_RNA|MADD_ENST00000402799.1_5'Flank|MADD_ENST00000406482.1_5'Flank|RP11-17G12.3_ENST00000543925.1_RNA			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	446					apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.H446Y(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						CTGGGATGTGCACGAATGACT	0.557																																																1	Substitution - Missense(1)	ovary(1)	11											111.0	100.0	104.0					11																	47290239		2201	4298	6499	47246815	SO:0001583	missense	10062			U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.1336C>T	11.37:g.47290239C>T	ENSP00000420656:p.His446Tyr		47246815	A8K3J9|D3DQR1|Q8IW13|Q96H87	Missense_Mutation	SNP	ENST00000467728.1	37	CCDS7929.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702530	0.68501	.	.	ENSG00000025434	ENST00000395397;ENST00000405576;ENST00000481889;ENST00000407404;ENST00000441012;ENST00000467728;ENST00000405853;ENST00000527949	D;D;D;D;D;D;D;D	0.94092	-2.92;-3.14;-3.03;-3.15;-2.97;-2.97;-3.15;-3.35	5.8	3.87	0.44632	Nuclear hormone receptor, ligand-binding (1);	0.146357	0.64402	D	0.000010	D	0.92087	0.7492	L	0.29908	0.895	0.58432	D	0.999991	B;D;D;D;D	0.58970	0.097;0.973;0.984;0.967;0.973	B;P;P;B;P	0.53062	0.016;0.525;0.664;0.36;0.717	D	0.92021	0.5626	10	0.72032	D	0.01	.	14.5079	0.67764	0.4065:0.5935:0.0:0.0	.	452;341;446;465;386	B4DXU5;B5MBY7;Q13133;E9PLL4;Q13133-2	.;.;NR1H3_HUMAN;.;.	Y	401;341;465;386;446;446;386;295	ENSP00000378793:H401Y;ENSP00000385073:H341Y;ENSP00000433271:H465Y;ENSP00000385801:H386Y;ENSP00000387946:H446Y;ENSP00000420656:H446Y;ENSP00000384745:H386Y;ENSP00000432073:H295Y	ENSP00000378793:H401Y	H	+	1	0	NR1H3	47246815	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.436000	0.44819	0.729000	0.32403	-0.274000	0.10170	CAC		0.557	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319214.3			Missense_Mutation
ATP8B4	79895	genome.wustl.edu	37	15	50264915	50264915	+	Silent	SNP	T	T	A			TCGA-13-1404-01	TCGA-13-1404-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr15:50264915T>A	ENST00000284509.6	-	13	1248	c.1107A>T	c.(1105-1107)gcA>gcT	p.A369A	ATP8B4_ENST00000559829.1_Silent_p.A369A	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	369						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.A369A(1)		breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CTGCAGGTATTGCTTTTCGAG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	15											73.0	68.0	70.0					15																	50264915		2196	4295	6491	48052207	SO:0001819	synonymous_variant	79895			AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1107A>T	15.37:g.50264915T>A			48052207	Q9H727	Silent	SNP	ENST00000284509.6	37	CCDS32238.1	SNP	63	WashU																																																																																				0.413	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		Silent
ESYT1	23344	genome.wustl.edu	37	12	56528127	56528127	+	Splice_Site	SNP	C	C	G			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr12:56528127C>G	ENST00000394048.5	+	15	1811	c.1547C>G	c.(1546-1548)gCt>gGt	p.A516G	ESYT1_ENST00000267113.4_Splice_Site_p.A526G|ESYT1_ENST00000541590.1_Splice_Site_p.A526G	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	516	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.A516G(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						CATCTCCAGGCTGTCTACAGT	0.502																																																1	Substitution - Missense(1)	ovary(1)	12											192.0	176.0	182.0					12																	56528127		2203	4300	6503	54814394	SO:0001630	splice_region_variant	23344			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.1546-1C>G	12.37:g.56528127C>G			54814394	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	CCDS8904.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102861	0.76983	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.69561	-0.41;-0.41;-0.41	5.28	5.28	0.74379	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.156711	0.56097	D	0.000021	T	0.67618	0.2912	L	0.38175	1.15	0.33934	D	0.642403	D;D	0.57571	0.967;0.98	P;P	0.57324	0.679;0.818	T	0.74763	-0.3555	10	0.44086	T	0.13	-9.6798	10.3549	0.43958	0.0:0.9096:0.0:0.0904	.	526;516	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	G	516;470;526;526	ENSP00000377612:A516G;ENSP00000267113:A526G;ENSP00000445952:A526G	ENSP00000267113:A526G	A	+	2	0	ESYT1	54814394	0.992000	0.36948	0.997000	0.53966	0.958000	0.62258	3.313000	0.51935	2.633000	0.89246	0.655000	0.94253	GCT		0.502	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	Missense_Mutation	Missense_Mutation
MS4A7	58475	genome.wustl.edu	37	11	60161283	60161283	+	Silent	SNP	A	A	T			TCGA-13-1404-01	TCGA-13-1404-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr11:60161283A>T	ENST00000300184.3	+	7	868	c.672A>T	c.(670-672)tcA>tcT	p.S224S	MS4A14_ENST00000531783.1_5'Flank|MS4A14_ENST00000395001.1_5'Flank|MS4A14_ENST00000531787.1_Intron|MS4A14_ENST00000300187.6_5'Flank|MS4A14_ENST00000395005.2_5'Flank|MS4A7_ENST00000358246.1_Silent_p.S179S|MS4A7_ENST00000530234.2_Intron|MS4A7_ENST00000534016.1_Silent_p.S179S	NM_021201.4|NM_206939.1	NP_067024.1|NP_996822.1	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member 7	224						integral component of membrane (GO:0016021)		p.S224S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(8)|ovary(1)|skin(1)	20						CGACCCAGTCACAAGATCATA	0.353																																																1	Substitution - coding silent(1)	ovary(1)	11											114.0	114.0	114.0					11																	60161283		2203	4300	6503	59917859	SO:0001819	synonymous_variant	58475			AB026043	CCDS7985.1, CCDS7986.1	11q12	2008-03-25				ENSG00000166927			13378	protein-coding gene	gene with protein product		606502				11245982, 11401424	Standard	NM_021201		Approved	CD20L4, CFFM4, MS4A8	uc001npf.3	Q9GZW8		ENST00000300184.3:c.672A>T	11.37:g.60161283A>T			59917859	A6NP53|Q6IAG8	Silent	SNP	ENST00000300184.3	37	CCDS7985.1	SNP	6	WashU																																																																																				0.353	MS4A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394299.1			Silent
DDB1	1642	genome.wustl.edu	37	11	61079255	61079256	+	Splice_Site	DNP	CC	CC	AA			TCGA-13-1404-01	TCGA-13-1404-10	CC	CC	CC	AA	CC	CC	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr11:61079255_61079256CC>AA	ENST00000301764.7	-	18	2674_2675	c.2277_2278GG>TT	c.(2275-2280)caGGct>caTTct	p.759_760QA>HS	DDB1_ENST00000545930.1_5'Flank|DDB1_ENST00000450997.2_Intron	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	759	Interaction with CDT1.|WD repeat beta-propeller C.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						ACTGCCCTTACCTGGGTGCTAG	0.579								Nucleotide excision repair (NER)																																								0			11																																								60835832	SO:0001630	splice_region_variant	1642			AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.2277_2278delinsAA	11.37:g.61079255_61079256delinsAA			60835831	A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Missense	DNP	ENST00000301764.7	37	CCDS31576.1	DNP	18	WashU																																																																																				0.579	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1	NM_001923	Missense_Mutation	Missense
LGALS12	85329	genome.wustl.edu	37	11	63283168	63283168	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr11:63283168C>T	ENST00000394618.3	+	8	1138	c.847C>T	c.(847-849)Ccc>Tcc	p.P283S	LGALS12_ENST00000255684.5_Missense_Mutation_p.P274S|LGALS12_ENST00000340246.5_Missense_Mutation_p.P284S|LGALS12_ENST00000415491.2_Missense_Mutation_p.P222S|LGALS12_ENST00000425950.2_Missense_Mutation_p.P213S	NM_001142535.1|NM_033101.3	NP_001136007.1|NP_149092.2	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12	283	Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.				intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)	p.P283S(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	16						CCTCTTTTACCCCCAGAGATT	0.552																																																1	Substitution - Missense(1)	ovary(1)	11											50.0	50.0	50.0					11																	63283168		2201	4298	6499	63039744	SO:0001583	missense	85329			AF222695	CCDS8045.1, CCDS44633.1, CCDS44634.1, CCDS44635.1, CCDS53648.1	11q13	2011-08-04	2008-07-25		ENSG00000133317	ENSG00000133317		"""Lectins, galactoside-binding"""	15788	protein-coding gene	gene with protein product	"""galectin 12"""	606096				11283015, 11435439	Standard	NM_033101		Approved	GRIP1	uc001nxc.2	Q96DT0	OTTHUMG00000167807	ENST00000394618.3:c.847C>T	11.37:g.63283168C>T	ENSP00000378116:p.Pro283Ser		63039744	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000394618.3	37	CCDS8045.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	20.7	4.041394	0.75732	.	.	ENSG00000133317	ENST00000255684;ENST00000394618;ENST00000340246;ENST00000415491;ENST00000425950	T;T;T;T;T	0.05649	3.41;3.41;3.41;3.41;3.41	5.78	5.78	0.91487	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (3);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.64402	D	0.000012	T	0.19927	0.0479	L	0.52364	1.645	0.42717	D	0.993662	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.91635	0.986;0.999;0.979;0.979	T	0.00086	-1.2096	10	0.41790	T	0.15	-22.7932	15.5052	0.75731	0.0:1.0:0.0:0.0	.	243;284;274;283	Q9NZ03;G5E970;Q96DT0-3;Q96DT0	.;.;.;LEG12_HUMAN	S	274;283;284;222;213	ENSP00000255684:P274S;ENSP00000378116:P283S;ENSP00000339374:P284S;ENSP00000394659:P222S;ENSP00000399093:P213S	ENSP00000255684:P274S	P	+	1	0	LGALS12	63039744	0.971000	0.33674	1.000000	0.80357	0.955000	0.61496	2.577000	0.46042	2.739000	0.93911	0.561000	0.74099	CCC		0.552	LGALS12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396378.1	NM_033101		Missense_Mutation
CILP	8483	genome.wustl.edu	37	15	65490133	65490133	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr15:65490133C>G	ENST00000261883.4	-	9	2657	c.2491G>C	c.(2491-2493)Gag>Cag	p.E831Q		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	831					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.E831Q(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						TGCAGTTCCTCCCCAGCCAGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	15											71.0	63.0	66.0					15																	65490133		2200	4296	6496	63277186	SO:0001583	missense	8483			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.2491G>C	15.37:g.65490133C>G	ENSP00000261883:p.Glu831Gln		63277186	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	CCDS10203.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712704	0.68730	.	.	ENSG00000138615	ENST00000261883	T	0.11063	2.81	5.25	5.25	0.73442	.	0.044947	0.85682	D	0.000000	T	0.36635	0.0974	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.11792	-1.0573	10	0.72032	D	0.01	-16.2835	18.1902	0.89805	0.0:1.0:0.0:0.0	.	831	O75339	CILP1_HUMAN	Q	831	ENSP00000261883:E831Q	ENSP00000261883:E831Q	E	-	1	0	CILP	63277186	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.772000	0.85439	2.604000	0.88044	0.462000	0.41574	GAG		0.562	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613		Missense_Mutation
AMER1	139285	genome.wustl.edu	37	X	63412870	63412870	+	Silent	SNP	C	C	A			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chrX:63412870C>A	ENST00000330258.3	-	2	569	c.297G>T	c.(295-297)ctG>ctT	p.L99L	AMER1_ENST00000374869.3_Silent_p.L99L|AMER1_ENST00000403336.1_Silent_p.L99L	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	99					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.L99L(1)									CTGCTTCACTCAGGCCATCGT	0.542																																																68	Whole gene deletion(67)|Substitution - coding silent(1)	kidney(65)|ovary(2)|large_intestine(1)	X											114.0	83.0	94.0					X																	63412870		2203	4300	6503	63329595	SO:0001819	synonymous_variant	139285			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.297G>T	X.37:g.63412870C>A			63329595	A2IB86|Q8N885	Silent	SNP	ENST00000330258.3	37	CCDS14377.2	SNP	29	WashU																																																																																				0.542	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		Silent
COL19A1	1310	genome.wustl.edu	37	6	70881878	70881878	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1404-01	TCGA-13-1404-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr6:70881878T>G	ENST00000322773.4	+	41	2693	c.2591T>G	c.(2590-2592)tTg>tGg	p.L864W	COL19A1_ENST00000393344.1_Missense_Mutation_p.L486W	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	864	Collagen-like 9.|Triple-helical region 5 (COL5).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.L864W(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						GCAATGGGGTTGCCAGGATTA	0.358																																																1	Substitution - Missense(1)	ovary(1)	6											103.0	105.0	105.0					6																	70881878		2203	4300	6503	70938599	SO:0001583	missense	1310				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2591T>G	6.37:g.70881878T>G	ENSP00000316030:p.Leu864Trp		70938599	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	37	CCDS4970.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	16.11	3.030500	0.54790	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.94758	-3.51;-3.51	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000019	D	0.96534	0.8869	M	0.74647	2.275	0.41468	D	0.988083	D	0.89917	1.0	D	0.91635	0.999	D	0.96995	0.9725	10	0.62326	D	0.03	.	15.1804	0.72952	0.0:0.0:0.0:1.0	.	864	Q14993	COJA1_HUMAN	W	864;486	ENSP00000316030:L864W;ENSP00000377013:L486W	ENSP00000316030:L864W	L	+	2	0	COL19A1	70938599	1.000000	0.71417	0.985000	0.45067	0.991000	0.79684	4.513000	0.60476	2.324000	0.78689	0.533000	0.62120	TTG		0.358	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1			Missense_Mutation
ZSWIM8	23053	genome.wustl.edu	37	10	75557650	75557650	+	Silent	SNP	G	G	T	rs202200703		TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr10:75557650G>T	ENST00000605216.1	+	19	3976	c.3759G>T	c.(3757-3759)ggG>ggT	p.G1253G	RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000604729.1_Silent_p.G1258G|ZSWIM8_ENST00000398706.2_Silent_p.G1258G|ZSWIM8_ENST00000603114.1_Silent_p.G1220G|ZSWIM8-AS1_ENST00000456638.2_RNA|ZSWIM8_ENST00000604524.1_Silent_p.G1253G	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1253							zinc ion binding (GO:0008270)	p.G1253G(1)									TCAAGGCAGGGGGCAACAGCA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	10											107.0	116.0	113.0					10																	75557650		2109	4223	6332	75227656	SO:0001819	synonymous_variant	23053			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.3759G>T	10.37:g.75557650G>T			75227656	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Silent	SNP	ENST00000605216.1	37		SNP	43	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.01|12.01	1.810916|1.810916	0.32053|0.32053	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000412198|ENST00000433366	.|.	.|.	.|.	5.74|5.74	2.88|2.88	0.33553|0.33553	.|.	0.000000|0.000000	0.64402|0.64402	U|U	0.000004|0.000004	T|T	0.51092|0.51092	0.1654|0.1654	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.56232|0.56232	-0.8013|-0.8013	6|6	0.87932|0.87932	D|D	0|0	-7.9696|-7.9696	1.4316|1.4316	0.02335|0.02335	0.276:0.1315:0.4398:0.1528|0.276:0.1315:0.4398:0.1528	.|.	.|.	.|.	.|.	V|W	528|969	.|.	ENSP00000415612:G528V|ENSP00000387828:G969W	G|G	+|+	2|1	0|0	KIAA0913|KIAA0913	75227656|75227656	0.991000|0.991000	0.36638|0.36638	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.235000|0.235000	0.17948|0.17948	1.449000|1.449000	0.47699|0.47699	0.655000|0.655000	0.94253|0.94253	GGG|GGG		0.582	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487		Silent
IL7	3574	genome.wustl.edu	37	8	79674056	79674056	+	Intron	SNP	C	C	G			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr8:79674056C>G	ENST00000263851.4	-	3	748				IL7_ENST00000379113.2_Intron|IL7_ENST00000520269.1_Intron	NM_000880.3|NM_001199886.1|NM_001199887.1	NP_000871.1|NP_001186815.1|NP_001186816.1	P13232	IL7_HUMAN	interleukin 7						bone resorption (GO:0045453)|cell-cell signaling (GO:0007267)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|organ morphogenesis (GO:0009887)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell differentiation (GO:0045582)|regulation of gene expression (GO:0010468)|T cell lineage commitment (GO:0002360)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-7 receptor binding (GO:0005139)			endometrium(2)|large_intestine(2)|lung(1)	5						CCAGTAGTGCCTGAAAGTTAT	0.428																																																0			8																																								79836611	SO:0001627	intron_variant				J04156	CCDS6224.1, CCDS56541.1, CCDS75755.1, CCDS75756.1	8q12-q13	2008-07-03				ENSG00000104432		"""Interleukins and interleukin receptors"""	6023	protein-coding gene	gene with protein product		146660					Standard	NM_000880		Approved	IL-7	uc003ybg.3	P13232		ENST00000263851.4:c.148-21739G>C	8.37:g.79674056C>G			79836611	A0N0L3|Q5FBY5|Q5FBY9	Splice_Site_SNP	SNP	ENST00000263851.4	37	CCDS6224.1	SNP	24	WashU																																																																																				0.428	IL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379429.1			Splice_Site_SNP
CEP162	22832	genome.wustl.edu	37	6	84904724	84904724	+	Nonsense_Mutation	SNP	G	G	C			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr6:84904724G>C	ENST00000403245.3	-	10	1019	c.905C>G	c.(904-906)tCa>tGa	p.S302*	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Nonsense_Mutation_p.S226*	NM_014895.2	NP_055710.2												p.S302*(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		ATCTCCCAATGAATGGGCTAT	0.363																																																1	Substitution - Nonsense(1)	ovary(1)	6											161.0	138.0	146.0					6																	84904724		2203	4299	6502	84961443	SO:0001587	stop_gained	22832																														ENST00000403245.3:c.905C>G	6.37:g.84904724G>C	ENSP00000385215:p.Ser302*		84961443		Nonsense_Mutation	SNP	ENST00000403245.3	37	CCDS34494.2	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.672445	0.96754	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	.	.	.	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.6356	17.2476	0.87032	0.0:0.0:1.0:0.0	.	.	.	.	X	226;302	.	ENSP00000257766:S226X	S	-	2	0	KIAA1009	84961443	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	6.309000	0.72825	2.369000	0.80426	0.557000	0.71058	TCA		0.363	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1			Nonsense_Mutation
TMEM126A	84233	genome.wustl.edu	37	11	85366721	85366721	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1404-01	TCGA-13-1404-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr11:85366721G>A	ENST00000304511.2	+	4	473	c.364G>A	c.(364-366)Gct>Act	p.A122T	TMEM126A_ENST00000532180.1_Missense_Mutation_p.A52T|TMEM126A_ENST00000528105.1_Missense_Mutation_p.A52T	NM_032273.3	NP_115649.1	Q9H061	T126A_HUMAN	transmembrane protein 126A	122					optic nerve development (GO:0021554)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)		p.A122T(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(2)|stomach(1)	7		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				TGTTTTCTTGGCTATACCTGT	0.358																																																1	Substitution - Missense(1)	ovary(1)	11											240.0	235.0	236.0					11																	85366721		2203	4299	6502	85044369	SO:0001583	missense	84233				CCDS8268.1, CCDS58165.1	11q14.1	2011-03-25			ENSG00000171202	ENSG00000171202			25382	protein-coding gene	gene with protein product		612988				11230166	Standard	NM_032273		Approved	DKFZp586C1924, OPA7	uc001par.3	Q9H061	OTTHUMG00000166975	ENST00000304511.2:c.364G>A	11.37:g.85366721G>A	ENSP00000306887:p.Ala122Thr		85044369	B2R570|E9PI16	Missense_Mutation	SNP	ENST00000304511.2	37	CCDS8268.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	29.1	4.978202	0.92982	.	.	ENSG00000171202	ENST00000528105;ENST00000304511;ENST00000532180	T;T;T	0.50813	0.73;0.73;0.73	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.73713	0.3622	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75431	-0.3320	9	.	.	.	-17.0021	19.7457	0.96251	0.0:0.0:1.0:0.0	.	122	Q9H061	T126A_HUMAN	T	52;122;52	ENSP00000436590:A52T;ENSP00000306887:A122T;ENSP00000434357:A52T	.	A	+	1	0	TMEM126A	85044369	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	7.698000	0.84413	2.725000	0.93324	0.557000	0.71058	GCT		0.358	TMEM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392177.1	NM_032273		Missense_Mutation
SFTPB	6439	genome.wustl.edu	37	2	85892796	85892796	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1404-01	TCGA-13-1404-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr2:85892796A>C	ENST00000519937.2	-	5	534	c.515T>G	c.(514-516)cTg>cGg	p.L172R	SFTPB_ENST00000409383.1_Missense_Mutation_p.L184R|SFTPB_ENST00000393822.3_Missense_Mutation_p.L184R|SFTPB_ENST00000342375.3_Missense_Mutation_p.L172R			P07988	PSPB_HUMAN	surfactant protein B	172					organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)		p.L172R(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						CTTGTCCAGCAGAGGGTCTGG	0.677																																																1	Substitution - Missense(1)	ovary(1)	2											51.0	54.0	53.0					2																	85892796		2203	4300	6503	85746307	SO:0001583	missense	6439			J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.515T>G	2.37:g.85892796A>C	ENSP00000428719:p.Leu172Arg		85746307	Q96R04	Missense_Mutation	SNP	ENST00000519937.2	37		SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	a	16.28	3.077497	0.55753	.	.	ENSG00000168878	ENST00000519937;ENST00000393822;ENST00000342375;ENST00000409383;ENST00000441838	T;T;T;T	0.70282	0.57;-0.29;-0.47;-0.29	4.84	4.84	0.62591	.	0.000000	0.33650	N	0.004694	T	0.76256	0.3962	M	0.73962	2.25	0.09310	N	1	D;D	0.56287	0.975;0.975	P;P	0.53861	0.736;0.736	T	0.67898	-0.5551	10	0.25751	T	0.34	-13.6503	10.8414	0.46718	1.0:0.0:0.0:0.0	.	184;172	D6W5L6;P07988	.;PSPB_HUMAN	R	174;184;172;184;140	ENSP00000428719:L174R;ENSP00000377409:L184R;ENSP00000345161:L172R;ENSP00000386346:L184R	ENSP00000345161:L172R	L	-	2	0	SFTPB	85746307	0.471000	0.25862	0.061000	0.19648	0.011000	0.07611	3.087000	0.50167	1.820000	0.53075	0.454000	0.30748	CTG		0.677	SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252499.3	NM_198843		Missense_Mutation
CEP290	80184	genome.wustl.edu	37	12	88505038	88505038	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr12:88505038C>A	ENST00000552810.1	-	22	2651	c.2308G>T	c.(2308-2310)Gca>Tca	p.A770S	CEP290_ENST00000309041.7_Missense_Mutation_p.A772S|CEP290_ENST00000397838.3_5'UTR	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	770					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.A772S(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						CTAGATGGTGCTATCCCATCA	0.299																																																1	Substitution - Missense(1)	ovary(1)	12											60.0	53.0	56.0					12																	88505038		1816	4067	5883	87029169	SO:0001583	missense	80184			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.2308G>T	12.37:g.88505038C>A	ENSP00000448012:p.Ala770Ser		87029169	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	9.127	1.010538	0.19277	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998	T;T	0.20069	2.1;2.1	5.86	2.6	0.31112	.	0.605618	0.17358	N	0.177132	T	0.08802	0.0218	N	0.08118	0	0.80722	D	1	B;B	0.12630	0.001;0.006	B;B	0.17722	0.005;0.019	T	0.15896	-1.0421	10	0.09590	T	0.72	.	7.6049	0.28097	0.1152:0.62:0.0:0.2648	.	770;770	Q05BJ6;O15078	.;CE290_HUMAN	S	770;772;770	ENSP00000448012:A770S;ENSP00000308021:A772S	ENSP00000308021:A772S	A	-	1	0	CEP290	87029169	0.793000	0.28825	1.000000	0.80357	0.826000	0.46750	-0.110000	0.10824	0.810000	0.34279	-0.225000	0.12378	GCA		0.299	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114		Missense_Mutation
FOLH1B	219595	genome.wustl.edu	37	11	89429832	89429832	+	RNA	SNP	C	C	A			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr11:89429832C>A	ENST00000532352.1	+	0	1859							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.L360I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						GAATGATCAACTCATGTTTCT	0.313																																																1	Substitution - Missense(1)	ovary(1)	11											102.0	97.0	99.0					11																	89429832		2201	4299	6500	89069480			219595			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89429832C>A			89069480		Missense_Mutation	SNP	ENST00000532352.1	37		SNP	20	WashU																																																																																				0.313	FOLH1B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395421.1	NM_153696		Missense_Mutation
PTCH1	5727	genome.wustl.edu	37	9	98220500	98220500	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1404-01	TCGA-13-1404-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr9:98220500A>T	ENST00000331920.6	-	18	3262	c.2963T>A	c.(2962-2964)gTg>gAg	p.V988E	PTCH1_ENST00000430669.2_Missense_Mutation_p.V922E|PTCH1_ENST00000437951.1_Missense_Mutation_p.V922E|PTCH1_ENST00000421141.1_Missense_Mutation_p.V837E|PTCH1_ENST00000429896.2_Missense_Mutation_p.V837E|PTCH1_ENST00000375274.2_Missense_Mutation_p.V987E|PTCH1_ENST00000418258.1_Missense_Mutation_p.V837E	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	988					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.V988E(2)|p.I963fs*2(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AATTGCCTCCACAAAGTCTGA	0.557																																																3	Substitution - Missense(2)|Deletion - Frameshift(1)	ovary(2)|central_nervous_system(1)	9											54.0	47.0	49.0					9																	98220500		2203	4300	6503	97260321	SO:0001583	missense	5727			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.2963T>A	9.37:g.98220500A>T	ENSP00000332353:p.Val988Glu		97260321	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	CCDS6714.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	20.7	4.027860	0.75390	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000375275;ENST00000430669;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91	5.21	4.05	0.47172	.	0.053822	0.85682	N	0.000000	D	0.90817	0.7116	M	0.73598	2.24	0.80722	D	1	D;D;D	0.76494	0.991;0.999;0.996	D;D;D	0.74023	0.948;0.982;0.958	D	0.90847	0.4728	10	0.62326	D	0.03	-16.1241	11.6751	0.51425	0.8671:0.0:0.0:0.1329	.	922;987;988	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	E	988;922;837;837;424;922;837;987	ENSP00000332353:V988E;ENSP00000389744:V922E;ENSP00000399981:V837E;ENSP00000396135:V837E;ENSP00000410287:V922E;ENSP00000414823:V837E;ENSP00000364423:V987E	ENSP00000332353:V988E	V	-	2	0	PTCH1	97260321	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	8.709000	0.91379	1.074000	0.40909	0.459000	0.35465	GTG		0.557	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264		Missense_Mutation
ARPC1A	10552	genome.wustl.edu	37	7	98941960	98941960	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1404-01	TCGA-13-1404-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr7:98941960G>A	ENST00000262942.5	+	4	338	c.214G>A	c.(214-216)Gca>Aca	p.A72T	ARPC1A_ENST00000432884.2_Missense_Mutation_p.A25T	NM_001190996.1|NM_006409.3	NP_001177925.1|NP_006400.2	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex, subunit 1A, 41kDa	72					actin cytoskeleton organization (GO:0030036)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of actin filament polymerization (GO:0030833)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	actin binding (GO:0003779)	p.A72T(1)		endometrium(3)|large_intestine(5)|liver(2)|lung(7)|ovary(1)|prostate(1)	19	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			CACTTGTGGGGCAGACCGCAA	0.517																																																1	Substitution - Missense(1)	ovary(1)	7											92.0	84.0	87.0					7																	98941960		2203	4300	6503	98779896	SO:0001583	missense	10552			Y08999	CCDS5660.1	7q22.1	2013-03-14	2002-08-29		ENSG00000241685	ENSG00000241685		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	703	protein-coding gene	gene with protein product	"""actin binding protein (Schizosaccharomyces pombe sop2-like)"", ""SOP2-like protein"""	604220	"""actin related protein 2/3 complex, subunit 1A (41 kD)"""			8978670, 9230079	Standard	NM_006409		Approved	SOP2Hs, SOP2L, Arc40	uc003upx.2	Q92747	OTTHUMG00000154553	ENST00000262942.5:c.214G>A	7.37:g.98941960G>A	ENSP00000262942:p.Ala72Thr		98779896	A4D276|B4DLQ7|D6W5S1|Q7Z5U8|Q86WU5|Q8IXQ0	Missense_Mutation	SNP	ENST00000262942.5	37	CCDS5660.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919762	0.52653	.	.	ENSG00000241685	ENST00000432884;ENST00000262942	T;T	0.61510	0.1;0.1	5.41	5.41	0.78517	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.51601	0.1684	L	0.39898	1.24	0.80722	D	1	B;P	0.47409	0.019;0.895	B;B	0.42462	0.05;0.388	T	0.44682	-0.9312	10	0.14656	T	0.56	.	19.5677	0.95401	0.0:0.0:1.0:0.0	.	67;72	Q53GB6;Q92747	.;ARC1A_HUMAN	T	25;72	ENSP00000408578:A25T;ENSP00000262942:A72T	ENSP00000262942:A72T	A	+	1	0	ARPC1A	98779896	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	7.846000	0.86887	2.691000	0.91804	0.655000	0.94253	GCA		0.517	ARPC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335908.1	NM_006409		Missense_Mutation
TMTC4	84899	genome.wustl.edu	37	13	101287301	101287301	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1404-01	TCGA-13-1404-10	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr13:101287301G>C	ENST00000376234.3	-	10	1483	c.1294C>G	c.(1294-1296)Ctg>Gtg	p.L432V	TMTC4_ENST00000342624.5_Missense_Mutation_p.L451V|TMTC4_ENST00000462211.1_5'UTR|TMTC4_ENST00000328767.5_Missense_Mutation_p.L321V	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	432						integral component of membrane (GO:0016021)		p.L451V(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGTTTGCTCAGGGCTCCGAAT	0.512																																																1	Substitution - Missense(1)	ovary(1)	13											83.0	78.0	80.0					13																	101287301		2203	4300	6503	100085302	SO:0001583	missense	84899				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1294C>G	13.37:g.101287301G>C	ENSP00000365408:p.Leu432Val		100085302	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	ENST00000376234.3	37	CCDS41904.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537376	0.65085	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.67523	-0.22;-0.27;0.68	5.5	5.5	0.81552	.	0.312835	0.34156	N	0.004203	T	0.72374	0.3452	M	0.87269	2.87	0.21915	N	0.999473	P;P;P;B	0.42337	0.776;0.684;0.556;0.186	B;P;B;B	0.45343	0.391;0.477;0.232;0.166	T	0.72629	-0.4235	10	0.66056	D	0.02	.	7.352	0.26697	0.1209:0.0:0.7286:0.1506	.	321;432;432;451	B7Z666;Q5T4D3-2;Q5T4D3;Q5T4D3-3	.;.;TMTC4_HUMAN;.	V	432;451;321	ENSP00000365408:L432V;ENSP00000343871:L451V;ENSP00000365409:L321V	ENSP00000365409:L321V	L	-	1	2	TMTC4	100085302	0.998000	0.40836	0.143000	0.22291	0.939000	0.58152	3.196000	0.51020	2.584000	0.87258	0.563000	0.77884	CTG		0.512	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813		Missense_Mutation
SLC25A53	401612	genome.wustl.edu	37	X	103349554	103349554	+	Silent	SNP	G	G	A			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	A	G	A	Unknown	Valid	Germline	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chrX:103349554G>A	ENST00000357421.4	-	2	567	c.387C>T	c.(385-387)gcC>gcT	p.A129A		NM_001012755.3	NP_001012773.2	Q5H9E4	S2553_HUMAN	solute carrier family 25, member 53	129					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											TGAGTGCCACGGCCTCCACCA	0.572													G|||	1	0.000264901	0.0008	0.0	3775	,	,		13560	0.0		0.0	False		,,,				2504	0.0															0			X											75.0	78.0	77.0					X																	103349554		2203	4299	6502	103236210	SO:0001819	synonymous_variant	401612				CCDS35363.1	Xq22.2	2013-05-22	2012-03-29	2012-03-29	ENSG00000176274	ENSG00000269743		"""Solute carriers"""	31894	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 6"""	MCART6			Standard	NM_001012755		Approved		uc004elu.3	Q5H9E4	OTTHUMG00000022124	ENST00000357421.4:c.387C>T	X.37:g.103349554G>A			103236210	B2RTT9	Silent	SNP	ENST00000357421.4	37	CCDS35363.1	SNP	39	WashU																																																																																				0.572	SLC25A53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057761.1	NM_001012755		Silent
RINT1	60561	genome.wustl.edu	37	7	105183036	105183036	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1404-01	TCGA-13-1404-10	T	T	C	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr7:105183036T>C	ENST00000257700.2	+	4	686	c.455T>C	c.(454-456)aTt>aCt	p.I152T		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	152					G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.I152T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						ATTAGCCAGATTGAAGAGATC	0.418																																																1	Substitution - Missense(1)	ovary(1)	7											130.0	115.0	120.0					7																	105183036		2203	4300	6503	104970272	SO:0001583	missense	60561			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.455T>C	7.37:g.105183036T>C	ENSP00000257700:p.Ile152Thr		104970272	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	ENST00000257700.2	37	CCDS34726.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	15.32	2.799687	0.50208	.	.	ENSG00000135249	ENST00000257700;ENST00000493041	T	0.33216	1.42	5.16	5.16	0.70880	.	0.335699	0.33959	N	0.004385	T	0.26846	0.0657	L	0.46157	1.445	0.43467	D	0.995675	B	0.33583	0.418	B	0.24541	0.054	T	0.05616	-1.0874	10	0.48119	T	0.1	-9.2808	14.9865	0.71351	0.0:0.0:0.0:1.0	.	152	Q6NUQ1	RINT1_HUMAN	T	152;121	ENSP00000257700:I152T	ENSP00000257700:I152T	I	+	2	0	RINT1	104970272	1.000000	0.71417	0.835000	0.33067	0.434000	0.31775	7.287000	0.78681	1.929000	0.55896	0.379000	0.24179	ATT		0.418	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930		Missense_Mutation
HENMT1	113802	genome.wustl.edu	37	1	109200122	109200122	+	Missense_Mutation	SNP	T	T	A	rs11540221		TCGA-13-1404-01	TCGA-13-1404-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr1:109200122T>A	ENST00000370032.5	-	3	521	c.101A>T	c.(100-102)cAg>cTg	p.Q34L	HENMT1_ENST00000493676.1_5'UTR|HENMT1_ENST00000402983.1_Missense_Mutation_p.Q34L|HENMT1_ENST00000370031.1_Missense_Mutation_p.Q34L	NM_144584.2	NP_653185.2	Q5T8I9	HENMT_HUMAN	HEN1 methyltransferase homolog 1 (Arabidopsis)	34					gene silencing by RNA (GO:0031047)|piRNA metabolic process (GO:0034587)|RNA methylation (GO:0001510)	P granule (GO:0043186)	metal ion binding (GO:0046872)|O-methyltransferase activity (GO:0008171)|RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.Q34L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	16						CTGGTACCGCTGTCTGTATAG	0.378																																																1	Substitution - Missense(1)	ovary(1)	1											117.0	116.0	116.0					1																	109200122		2203	4300	6503	109001645	SO:0001583	missense	113802				CCDS787.1	1p13.3	2011-01-28	2011-01-28	2011-01-28	ENSG00000162639	ENSG00000162639			26400	protein-coding gene	gene with protein product	"""HEN1 methyltransferase homolog (Arabidopsis)"""	612178	"""chromosome 1 open reading frame 59"""	C1orf59			Standard	NM_144584		Approved	FLJ30525, HEN1	uc001dvt.4	Q5T8I9	OTTHUMG00000011123	ENST00000370032.5:c.101A>T	1.37:g.109200122T>A	ENSP00000359049:p.Gln34Leu		109001645	A8MRR6|B1AM16|B1AM17|Q96EJ7|Q96NN0	Missense_Mutation	SNP	ENST00000370032.5	37	CCDS787.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	17.52	3.409949	0.62399	.	.	ENSG00000162639	ENST00000402983;ENST00000370031;ENST00000370032;ENST00000420055	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.62	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.48370	0.1496	M	0.66560	2.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.52335	-0.8589	10	0.52906	T	0.07	.	9.2622	0.37619	0.0:0.0833:0.0:0.9167	rs11540221;rs11540221	34	Q5T8I9	HENMT_HUMAN	L	34	ENSP00000385655:Q34L;ENSP00000359048:Q34L;ENSP00000359049:Q34L;ENSP00000403953:Q34L	ENSP00000359048:Q34L	Q	-	2	0	HENMT1	109001645	1.000000	0.71417	0.975000	0.42487	0.358000	0.29455	5.387000	0.66243	0.959000	0.37980	0.533000	0.62120	CAG		0.378	HENMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030592.1	NM_144584		Missense_Mutation
HIPK1	204851	genome.wustl.edu	37	1	114483621	114483621	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1404-01	TCGA-13-1404-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr1:114483621A>G	ENST00000369558.1	+	2	848	c.616A>G	c.(616-618)Aag>Gag	p.K206E	HIPK1_ENST00000369561.4_Missense_Mutation_p.K206E|HIPK1_ENST00000369555.2_Missense_Mutation_p.K206E|HIPK1_ENST00000426820.2_Missense_Mutation_p.K206E|HIPK1_ENST00000369559.4_Missense_Mutation_p.K206E|HIPK1_ENST00000369554.2_Missense_Mutation_p.K206E			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	206	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.K206E(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGGTGGCTAAGTGCTGGAA	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											74.0	78.0	76.0					1																	114483621		2203	4300	6503	114285144	SO:0001583	missense	204851			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.616A>G	1.37:g.114483621A>G	ENSP00000358571:p.Lys206Glu		114285144	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	CCDS867.1	SNP	13	WashU	.	.	.	.	.	.	.	.	.	.	A	22.8	4.341488	0.81911	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561	T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92	5.63	5.63	0.86233	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.37100	0.0991	L	0.50919	1.6	0.80722	D	1	D;D	0.69078	0.997;0.974	D;D	0.77004	0.989;0.969	T	0.24048	-1.0171	10	0.87932	D	0	.	15.8458	0.78887	1.0:0.0:0.0:0.0	.	206;206	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	E	277;206;206;206;206;206;206	ENSP00000407442:K277E;ENSP00000358572:K206E;ENSP00000409673:K206E;ENSP00000358567:K206E;ENSP00000358568:K206E;ENSP00000358571:K206E;ENSP00000358574:K206E	ENSP00000358567:K206E	K	+	1	0	HIPK1	114285144	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.249000	0.95470	2.141000	0.66446	0.455000	0.32223	AAG		0.488	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268		Missense_Mutation
DSCAML1	57453	genome.wustl.edu	37	11	117651238	117651238	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1404-01	TCGA-13-1404-10	T	T	A	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr11:117651238T>A	ENST00000321322.6	-	2	515	c.514A>T	c.(514-516)Atc>Ttc	p.I172F	DSCAML1_ENST00000527706.1_Intron	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	112	Ig-like C2-type 2.			H -> N (in Ref. 1; AAL57166 and 4; BAA86446). {ECO:0000305}.	axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.I172F(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GGGCTCCGGATCTTGCCGGCA	0.597																																																1	Substitution - Missense(1)	ovary(1)	11											119.0	117.0	118.0					11																	117651238		2201	4296	6497	117156448	SO:0001583	missense	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.514A>T	11.37:g.117651238T>A	ENSP00000315465:p.Ile172Phe		117156448	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	SNP	50	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.7|23.7	4.447303|4.447303	0.84101|0.84101	.|.	.|.	ENSG00000177103|ENSG00000177103	ENST00000321322|ENST00000525836	T|.	0.39997|.	1.05|.	5.1|5.1	5.1|5.1	0.69264|0.69264	Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.71676|0.71676	0.3368|0.3368	L|L	0.60067|0.60067	1.865|1.865	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.75286|0.75286	-0.3371|-0.3371	9|6	0.59425|0.87932	D|D	0.04|0	.|.	15.212|15.212	0.73230|0.73230	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	112|.	Q8TD84|.	DSCL1_HUMAN|.	F|S	172|13	ENSP00000315465:I172F|.	ENSP00000315465:I172F|ENSP00000436387:R13S	I|R	-|-	1|3	0|2	DSCAML1|DSCAML1	117156448|117156448	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.655000|7.655000	0.83696|0.83696	2.053000|2.053000	0.61076|0.61076	0.460000|0.460000	0.39030|0.39030	ATC|AGA		0.597	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		Missense_Mutation
POLQ	10721	genome.wustl.edu	37	3	121186369	121186369	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr3:121186369G>C	ENST00000264233.5	-	24	7092	c.6964C>G	c.(6964-6966)Cca>Gca	p.P2322A		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2322					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.P2457A(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		ACCTTACCTGGGAAAGGCACA	0.453								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)											1	Substitution - Missense(1)	ovary(1)	3											156.0	139.0	144.0					3																	121186369		2203	4300	6503	122669059	SO:0001583	missense	10721			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.6964C>G	3.37:g.121186369G>C	ENSP00000264233:p.Pro2322Ala		122669059	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	CCDS33833.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	13.63	2.294494	0.40594	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	D	0.96830	-4.14	5.8	2.04	0.26737	DNA-directed DNA polymerase, family A, palm domain (2);	0.314716	0.36200	N	0.002724	D	0.92740	0.7692	L	0.44542	1.39	0.33140	D	0.544261	P;B	0.38617	0.64;0.447	B;B	0.39379	0.298;0.156	D	0.90851	0.4731	10	0.56958	D	0.05	.	7.2445	0.26114	0.1924:0.0:0.687:0.1206	.	2322;1494	O75417;O75417-2	DPOLQ_HUMAN;.	A	1945;2322;2458	ENSP00000264233:P2322A	ENSP00000264233:P2322A	P	-	1	0	POLQ	122669059	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	2.019000	0.41001	0.096000	0.17463	0.591000	0.81541	CCA		0.453	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420		Missense_Mutation
PLXNA4	91584	genome.wustl.edu	37	7	131831327	131831327	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr7:131831327C>T	ENST00000359827.3	-	28	5959	c.4997G>A	c.(4996-4998)gGg>gAg	p.G1666E	PLXNA4_ENST00000321063.4_Missense_Mutation_p.G1666E			Q9HCM2	PLXA4_HUMAN	plexin A4	1666					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.G1666E(1)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CCCCCGGTCCCCCTCCTTCTG	0.572																																																1	Substitution - Missense(1)	ovary(1)	7											200.0	215.0	210.0					7																	131831327		2183	4297	6480	131481867	SO:0001583	missense	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4997G>A	7.37:g.131831327C>T	ENSP00000352882:p.Gly1666Glu		131481867	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	33	5.257019	0.95336	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.11821	2.74;2.74	5.8	5.8	0.92144	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.048346	0.85682	D	0.000000	T	0.44993	0.1320	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.30208	-0.9986	10	0.41790	T	0.15	.	20.0537	0.97638	0.0:1.0:0.0:0.0	.	1666	Q9HCM2	PLXA4_HUMAN	E	1666	ENSP00000323194:G1666E;ENSP00000352882:G1666E	ENSP00000323194:G1666E	G	-	2	0	PLXNA4	131481867	1.000000	0.71417	0.964000	0.40570	0.936000	0.57629	7.670000	0.83925	2.758000	0.94735	0.561000	0.74099	GGG		0.572	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		Missense_Mutation
TMEM71	137835	genome.wustl.edu	37	8	133740207	133740207	+	Silent	SNP	C	C	G			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr8:133740207C>G	ENST00000356838.3	-	6	598	c.456G>C	c.(454-456)ctG>ctC	p.L152L	TMEM71_ENST00000377901.4_Intron|TMEM71_ENST00000523829.1_Silent_p.L171L	NM_144649.2	NP_653250.2	Q6P5X7	TMM71_HUMAN	transmembrane protein 71	171						integral component of membrane (GO:0016021)		p.L152L(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			AGTCATCAGTCAGAGAAGAAC	0.488																																																1	Substitution - coding silent(1)	ovary(1)	8											82.0	79.0	80.0					8																	133740207		2203	4300	6503	133809389	SO:0001819	synonymous_variant	137835			AK057631	CCDS6366.1, CCDS47921.1	8q24.22	2005-09-02				ENSG00000165071			26572	protein-coding gene	gene with protein product						12477932	Standard	NM_144649		Approved	FLJ33069	uc003ytn.3	Q6P5X7		ENST00000356838.3:c.456G>C	8.37:g.133740207C>G			133809389	Q3KRC2|Q8WVZ4|Q96LX9	Silent	SNP	ENST00000356838.3	37	CCDS6366.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	2.693	-0.272696	0.05716	.	.	ENSG00000165071	ENST00000522780	.	.	.	5.91	1.05	0.20165	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.0207	4.8612	0.13585	0.0:0.5368:0.1512:0.312	.	.	.	.	S	9	.	.	X	-	2	2	TMEM71	133809389	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.006000	0.13152	0.404000	0.25506	-0.140000	0.14226	TGA		0.488	TMEM71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379591.1	NM_144649		Silent
C9orf171	389799	genome.wustl.edu	37	9	135447859	135447859	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr9:135447859C>A	ENST00000343036.2	+	7	973	c.925C>A	c.(925-927)Cag>Aag	p.Q309K	C9orf171_ENST00000393216.2_Missense_Mutation_p.Q273K	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	309								p.Q309K(1)		large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						TGCCGTGCGCCAGGGGACCCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	9											50.0	49.0	50.0					9																	135447859		2203	4300	6503	134437680	SO:0001583	missense				AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.925C>A	9.37:g.135447859C>A	ENSP00000343290:p.Gln309Lys		134437680	Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	CCDS6949.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	7.472	0.646954	0.14516	.	.	ENSG00000188523	ENST00000343036;ENST00000393216	T;T	0.20738	2.05;2.05	5.53	5.53	0.82687	.	0.165183	0.34580	N	0.003857	T	0.12817	0.0311	N	0.19112	0.55	0.28139	N	0.929873	B;B	0.14012	0.002;0.009	B;B	0.11329	0.001;0.006	T	0.15636	-1.0430	10	0.05721	T	0.95	.	14.9549	0.71104	0.0:1.0:0.0:0.0	.	273;309	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	K	309;273	ENSP00000343290:Q309K;ENSP00000376909:Q273K	ENSP00000343290:Q309K	Q	+	1	0	C9orf171	134437680	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	3.907000	0.56348	2.617000	0.88574	0.542000	0.68232	CAG		0.607	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417		Missense_Mutation
ETF1	2107	genome.wustl.edu	37	5	137853274	137853274	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr5:137853274C>G	ENST00000360541.5	-	4	599	c.378G>C	c.(376-378)ttG>ttC	p.L126F	ETF1_ENST00000514005.1_5'UTR|ETF1_ENST00000499810.2_Missense_Mutation_p.L93F|ETF1_ENST00000503014.1_Missense_Mutation_p.L112F	NM_004730.3	NP_004721.1	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	126					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)|translation termination factor activity (GO:0008079)	p.L126F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TGTTGTCACACAAATACAATG	0.388																																																1	Substitution - Missense(1)	ovary(1)	5											124.0	115.0	118.0					5																	137853274		2203	4300	6503	137881173	SO:0001583	missense	2107			AF095901	CCDS4207.1, CCDS75313.1, CCDS75314.1	5q31.2	2008-02-05			ENSG00000120705	ENSG00000120705			3477	protein-coding gene	gene with protein product	"""sup45 (yeast omnipotent suppressor 45) homolog-like 1"", ""polypeptide chain release factor 1"""	600285		SUP45L1, ERF1, ERF		1546371, 7990965	Standard	NM_004730		Approved	eRF1, TB3-1, RF1	uc003ldc.5	P62495	OTTHUMG00000129199	ENST00000360541.5:c.378G>C	5.37:g.137853274C>G	ENSP00000353741:p.Leu126Phe		137881173	B2R6B4|D3DQC1|P46055|Q5M7Z7|Q96CG1	Missense_Mutation	SNP	ENST00000360541.5	37	CCDS4207.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	14.44	2.536764	0.45176	.	.	ENSG00000120705	ENST00000499810;ENST00000360541;ENST00000503014;ENST00000507939	.	.	.	5.39	5.39	0.77823	eRF1 domain 1/Pelota-like (1);Peptide Chain Release Factor eRF1/aRF1, N-terminal (2);	0.129206	0.51477	D	0.000098	T	0.75510	0.3859	M	0.78637	2.42	0.80722	D	1	D;B	0.71674	0.998;0.073	D;B	0.64687	0.928;0.057	T	0.74031	-0.3795	9	0.30854	T	0.27	-3.3899	12.1573	0.54085	0.0:0.9208:0.0:0.0792	.	112;126	B7Z7P8;P62495	.;ERF1_HUMAN	F	93;126;112;93	.	ENSP00000353741:L126F	L	-	3	2	ETF1	137881173	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.343000	0.52167	2.526000	0.85167	0.655000	0.94253	TTG		0.388	ETF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251276.2	NM_004730		Missense_Mutation
KMT2C	58508	genome.wustl.edu	37	7	151851443	151851443	+	Silent	SNP	G	G	A			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr7:151851443G>A	ENST00000262189.6	-	47	12266	c.12048C>T	c.(12046-12048)agC>agT	p.S4016S	KMT2C_ENST00000485241.1_5'UTR|KMT2C_ENST00000355193.2_Silent_p.S4073S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4016					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.S4016S(1)									CTGGATACCTGCTCACTTCTA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	7											146.0	144.0	145.0					7																	151851443		2203	4300	6503	151482376	SO:0001819	synonymous_variant	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.12048C>T	7.37:g.151851443G>A			151482376	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	CCDS5931.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	10.52	1.372483	0.24857	.	.	ENSG00000055609	ENST00000360104	.	.	.	5.38	3.52	0.40303	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.2477	0.15506	0.0768:0.2664:0.5196:0.1372	.	.	.	.	X	1577	.	.	Q	-	1	0	MLL3	151482376	1.000000	0.71417	0.993000	0.49108	0.950000	0.60333	0.994000	0.29693	0.717000	0.32145	0.655000	0.94253	CAG		0.488	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			Silent
ZNF275	10838	genome.wustl.edu	37	X	152612477	152612477	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chrX:152612477C>A	ENST00000421401.3	+	4	511	c.334C>A	c.(334-336)Ctt>Att	p.L112I	ZNF275_ENST00000370249.2_Missense_Mutation_p.L59I|ZNF275_ENST00000440091.1_Missense_Mutation_p.L142I|ZNF275_ENST00000370251.3_Missense_Mutation_p.L112I			Q9NSD4	ZN275_HUMAN	zinc finger protein 275	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L59I(1)		endometrium(5)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACCTTTCGGCTTAAAGTCCT	0.542																																																1	Substitution - Missense(1)	ovary(1)	X											68.0	72.0	70.0					X																	152612477		2108	4214	6322	152265671	SO:0001583	missense	10838			BC041602		Xq28	2013-01-08			ENSG00000063587	ENSG00000063587		"""Zinc fingers, C2H2-type"", ""-"""	13069	protein-coding gene	gene with protein product							Standard	NM_001080485		Approved		uc004fhg.2	Q9NSD4	OTTHUMG00000067450	ENST00000421401.3:c.334C>A	X.37:g.152612477C>A	ENSP00000398977:p.Leu112Ile		152265671	A6NE92	Missense_Mutation	SNP	ENST00000421401.3	37		SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	11.95	1.792637	0.31685	.	.	ENSG00000063587	ENST00000370251;ENST00000421401;ENST00000440091;ENST00000370249	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	4.75	3.88	0.44766	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.37178	N	0.002208	T	0.36635	0.0974	L	0.29908	0.895	0.09310	N	1	D;D	0.58268	0.982;0.982	P;P	0.60236	0.76;0.871	T	0.11792	-1.0573	10	0.37606	T	0.19	-24.4642	11.8706	0.52519	0.0:0.8267:0.1733:0.0	.	112;112	Q9NSD4;A6NFS0	ZN275_HUMAN;.	I	112;112;142;59	ENSP00000359271:L112I;ENSP00000398977:L112I;ENSP00000411097:L142I;ENSP00000359269:L59I	ENSP00000359269:L59I	L	+	1	0	ZNF275	152265671	0.000000	0.05858	0.038000	0.18304	0.929000	0.56500	0.036000	0.13819	1.115000	0.41800	0.513000	0.50165	CTT		0.542	ZNF275-201	KNOWN	basic	protein_coding	protein_coding		NM_001080485		Missense_Mutation
VHLL	391104	genome.wustl.edu	37	1	156268743	156268743	+	Missense_Mutation	SNP	A	A	C	rs377259322		TCGA-13-1404-01	TCGA-13-1404-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr1:156268743A>C	ENST00000339922.3	-	1	685	c.238T>G	c.(238-240)Tac>Gac	p.Y80D		NM_001004319.2	NP_001004319.1	Q6RSH7	VHLL_HUMAN	von Hippel-Lindau tumor suppressor-like	80	Beta-domain.							p.Y80D(1)		endometrium(1)|lung(2)|ovary(1)	4	Hepatocellular(266;0.158)					AGCGTCAGGTAGGGCAGCAGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											88.0	79.0	82.0					1																	156268743		2203	4300	6503	154535367	SO:0001583	missense	391104					1q22	2013-09-24			ENSG00000189030	ENSG00000189030			30666	protein-coding gene	gene with protein product			"""VHL pseudogene"""	VHLP		14757845	Standard	NM_001004319		Approved	VLP	uc001fok.3	Q6RSH7	OTTHUMG00000024058	ENST00000339922.3:c.238T>G	1.37:g.156268743A>C	ENSP00000464258:p.Tyr80Asp		154535367	A1L4M4	Missense_Mutation	SNP	ENST00000339922.3	37		SNP	15	WashU																																																																																				0.557	VHLL-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000060590.3	NM_001004319		Missense_Mutation
VEPH1	79674	genome.wustl.edu	37	3	157131725	157131725	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr3:157131725G>A	ENST00000362010.2	-	6	1158	c.851C>T	c.(850-852)cCc>cTc	p.P284L	VEPH1_ENST00000392832.2_Missense_Mutation_p.P284L|VEPH1_ENST00000469007.1_5'UTR|VEPH1_ENST00000543418.1_Missense_Mutation_p.P284L|VEPH1_ENST00000392833.2_Missense_Mutation_p.P284L	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	284						plasma membrane (GO:0005886)		p.P284L(1)		autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			AGTGAGGTAGGGGAATCTCTC	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											162.0	168.0	166.0					3																	157131725		2203	4300	6503	158614419	SO:0001583	missense	79674			AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.851C>T	3.37:g.157131725G>A	ENSP00000354919:p.Pro284Leu		158614419	D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Missense_Mutation	SNP	ENST00000362010.2	37	CCDS3179.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	24.5	4.538031	0.85917	.	.	ENSG00000197415	ENST00000392833;ENST00000362010;ENST00000543418;ENST00000392832	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.8	5.8	0.92144	.	0.212086	0.50627	D	0.000110	T	0.57725	0.2073	M	0.71036	2.16	0.80722	D	1	D;D	0.69078	0.997;0.986	P;P	0.59357	0.856;0.722	T	0.59867	-0.7373	10	0.87932	D	0	-2.7714	18.2522	0.90007	0.0:0.0:1.0:0.0	.	284;284	Q14D04-2;Q14D04	.;MELT_HUMAN	L	284	ENSP00000376578:P284L;ENSP00000354919:P284L;ENSP00000446258:P284L;ENSP00000376577:P284L	ENSP00000354919:P284L	P	-	2	0	VEPH1	158614419	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	6.639000	0.74314	2.741000	0.93983	0.585000	0.79938	CCC		0.443	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351845.3	NM_024621		Missense_Mutation
NUF2	83540	genome.wustl.edu	37	1	163318801	163318801	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1404-01	TCGA-13-1404-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr1:163318801A>T	ENST00000271452.3	+	13	1470	c.1191A>T	c.(1189-1191)gaA>gaT	p.E397D	NUF2_ENST00000367900.3_Missense_Mutation_p.E397D|NUF2_ENST00000524800.1_Missense_Mutation_p.E350D	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	397	Interaction with the C-terminus of NDC80 and the SPBC24-SPBC25 subcomplex.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.E397D(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					TTAATCAAGAAATCCAAAAAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	1											63.0	66.0	65.0					1																	163318801		2203	4299	6502	161585425	SO:0001583	missense	83540			BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.1191A>T	1.37:g.163318801A>T	ENSP00000271452:p.Glu397Asp		161585425	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	37	CCDS1245.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	13.82	2.351351	0.41700	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.36699	1.24;1.32;1.32	5.5	0.496	0.16896	.	0.146062	0.64402	N	0.000010	T	0.06826	0.0174	N	0.14661	0.345	0.45946	D	0.998773	B;B	0.17667	0.009;0.023	B;B	0.12837	0.005;0.008	T	0.19063	-1.0317	9	0.45353	T	0.12	-15.5281	5.3042	0.15795	0.6285:0.14:0.2316:0.0	.	350;397	E9PQC4;Q9BZD4	.;NUF2_HUMAN	D	350;397;397	ENSP00000436888:E350D;ENSP00000356875:E397D;ENSP00000271452:E397D	ENSP00000271452:E397D	E	+	3	2	NUF2	161585425	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	0.495000	0.22483	0.161000	0.19458	0.533000	0.62120	GAA		0.333	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697		Missense_Mutation
TTC21B	79809	genome.wustl.edu	37	2	166770099	166770099	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr2:166770099G>T	ENST00000243344.7	-	16	2333	c.2196C>A	c.(2194-2196)taC>taA	p.Y732*		NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	732					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)		p.Y732*(1)		breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						GAATATTCATGTATGCATCAC	0.318																																																1	Substitution - Nonsense(1)	ovary(1)	2											92.0	93.0	93.0					2																	166770099		2203	4300	6503	166478345	SO:0001587	stop_gained	79809			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.2196C>A	2.37:g.166770099G>T	ENSP00000243344:p.Tyr732*		166478345	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Nonsense_Mutation	SNP	ENST00000243344.7	37	CCDS33315.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	40	7.967002	0.98585	.	.	ENSG00000123607	ENST00000243344	.	.	.	5.23	3.43	0.39272	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.8732	9.6457	0.39865	0.2843:0.0:0.7157:0.0	.	.	.	.	X	732	.	ENSP00000243344:Y732X	Y	-	3	2	TTC21B	166478345	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.071000	0.30666	0.595000	0.29777	0.591000	0.81541	TAC		0.318	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753		Nonsense_Mutation
TTN	7273	genome.wustl.edu	37	2	179643657	179643657	+	Silent	SNP	A	A	G			TCGA-13-1404-01	TCGA-13-1404-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr2:179643657A>G	ENST00000591111.1	-	24	4376	c.4152T>C	c.(4150-4152)gcT>gcC	p.A1384A	TTN_ENST00000342992.6_Silent_p.A1384A|TTN_ENST00000342175.6_Silent_p.A1338A|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000359218.5_Silent_p.A1338A|TTN_ENST00000460472.2_Silent_p.A1338A|TTN_ENST00000360870.5_Silent_p.A1384A|TTN_ENST00000589042.1_Silent_p.A1384A			Q8WZ42	TITIN_HUMAN	titin	33580					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A1384A(2)|p.A1338A(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAGTGGTGCAGCAGGCTCCA	0.403																																																3	Substitution - coding silent(3)	ovary(3)	2											82.0	76.0	78.0					2																	179643657		2203	4300	6503	179351902	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.4152T>C	2.37:g.179643657A>G			179351902	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37		SNP	7	WashU																																																																																				0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Silent
DNAH7	56171	genome.wustl.edu	37	2	196749490	196749490	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1404-01	TCGA-13-1404-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr2:196749490C>A	ENST00000312428.6	-	35	5682	c.5582G>T	c.(5581-5583)tGt>tTt	p.C1861F		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1861					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.C1861F(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						ATCATCTGTACAAGAAGCACC	0.338																																																1	Substitution - Missense(1)	ovary(1)	2											80.0	72.0	74.0					2																	196749490		1851	4097	5948	196457735	SO:0001583	missense	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5582G>T	2.37:g.196749490C>A	ENSP00000311273:p.Cys1861Phe		196457735	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481108	0.63849	.	.	ENSG00000118997	ENST00000312428	T	0.19669	2.13	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.37019	0.0988	M	0.87180	2.865	0.80722	D	1	B	0.30763	0.294	B	0.31495	0.131	T	0.32929	-0.9888	10	0.62326	D	0.03	.	19.8649	0.96801	0.0:1.0:0.0:0.0	.	1861	Q8WXX0	DYH7_HUMAN	F	1861	ENSP00000311273:C1861F	ENSP00000311273:C1861F	C	-	2	0	DNAH7	196457735	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.754000	0.74909	2.854000	0.98071	0.655000	0.94253	TGT		0.338	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		Missense_Mutation
SRGAP2	23380	genome.wustl.edu	37	1	206567008	206567008	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1404-01	TCGA-13-1404-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr1:206567008A>G	ENST00000414007.1	+	3	389	c.389A>G	c.(388-390)cAt>cGt	p.H130R	SRGAP2_ENST00000419187.2_5'UTR			O75044	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	270	F-BAR domain.				actin filament severing (GO:0051014)|axon guidance (GO:0007411)|dendritic spine development (GO:0060996)|extension of a leading process involved in cell motility in cerebral cortex radial glia guided migration (GO:0021816)|filopodium assembly (GO:0046847)|lamellipodium assembly involved in ameboidal cell migration (GO:0003363)|negative regulation of neuron migration (GO:2001223)|neuron projection morphogenesis (GO:0048812)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine head (GO:0044327)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein homodimerization activity (GO:0042803)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			NS(1)|breast(1)|kidney(1)|lung(1)	4	Breast(84;0.137)					TACTACATCCATGACCTATCT	0.468																																																0			1											84.0	76.0	78.0					1																	206567008		1956	4156	6112	204633631	SO:0001583	missense	23380			AB007925	CCDS73017.1	1q32.1	2014-08-13	2004-11-12	2004-11-12	ENSG00000163486	ENSG00000266028		"""Rho GTPase activating proteins"""	19751	protein-coding gene	gene with protein product		606524	"""formin binding protein 2"""	FNBP2		15046868, 11672528	Standard	XM_005277510		Approved	KIAA0456, ARHGAP34, SRGAP2A	uc001hdy.3	O75044	OTTHUMG00000184381	ENST00000414007.1:c.389A>G	1.37:g.206567008A>G	ENSP00000390898:p.His130Arg		204633631		Missense_Mutation	SNP	ENST00000414007.1	37		SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	22.4	4.290497	0.80914	.	.	ENSG00000163486	ENST00000414359;ENST00000414007	T	0.13089	2.62	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.30947	0.0781	.	.	.	0.80722	D	1.000000	D;B;B	0.67145	0.996;0.024;0.242	P;B;B	0.56788	0.806;0.05;0.073	T	0.19192	-1.0313	8	0.46703	T	0.11	.	16.0258	0.80545	1.0:0.0:0.0:0.0	.	117;270;270	B4DDU0;O75044;B7Z3G4	.;FNBP2_HUMAN;.	R	184;130	ENSP00000390898:H130R	ENSP00000390898:H130R	H	+	2	0	SRGAP2	204633631	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.335000	0.96500	2.184000	0.69523	0.454000	0.30748	CAT		0.468	SRGAP2-201	KNOWN	basic	protein_coding	protein_coding		NM_015326		Missense_Mutation
DEPDC5	9681	genome.wustl.edu	37	22	32202135	32202159	+	Frame_Shift_Del	DEL	TTGTAATAGTTTCACCCCACGAATA	TTGTAATAGTTTCACCCCACGAATA	-	rs539081017		TCGA-13-1404-01	TCGA-13-1404-10	TTGTAATAGTTTCACCCCACGAATA	TTGTAATAGTTTCACCCCACGAATA	TTGTAATAGTTTCACCCCACGAATA	-	TTGTAATAGTTTCACCCCACGAATA	TTGTAATAGTTTCACCCCACGAATA	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr22:32202135_32202159delTTGTAATAGTTTCACCCCACGAATA	ENST00000382112.3	+	17	1315_1339	c.1245_1269delTTGTAATAGTTTCACCCCACGAATA	c.(1243-1269)ttttgtaatagtttcaccccacgaatafs	p.FCNSFTPRI415fs	DEPDC5_ENST00000382105.2_Frame_Shift_Del_p.FCNSFTPRI415fs|DEPDC5_ENST00000400242.3_Frame_Shift_Del_p.FCNSFTPRI415fs|DEPDC5_ENST00000536766.1_Frame_Shift_Del_p.FCNSFTPRI387fs|DEPDC5_ENST00000400248.2_Frame_Shift_Del_p.FCNSFTPRI415fs|DEPDC5_ENST00000535622.1_Frame_Shift_Del_p.FCNSFTPRI415fs|DEPDC5_ENST00000266091.3_Frame_Shift_Del_p.FCNSFTPRI415fs|DEPDC5_ENST00000400249.2_Frame_Shift_Del_p.FCNSFTPRI415fs|DEPDC5_ENST00000382111.2_Frame_Shift_Del_p.FCNSFTPRI415fs|DEPDC5_ENST00000400246.1_Frame_Shift_Del_p.FCNSFTPRI415fs	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	415					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)	p.F415fs*35(1)		breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GCCAGCTCTTTTGTAATAGTTTCACCCCACGAATAAAACTGGCAG	0.356																																																1	Deletion - Frameshift(1)	ovary(1)	22																																								30532159	SO:0001589	frameshift_variant	9681			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.1245_1269delTTGTAATAGTTTCACCCCACGAATA	22.37:g.32202135_32202159delTTGTAATAGTTTCACCCCACGAATA	ENSP00000371546:p.Phe415fs		30532135	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Frame_Shift_Del	DEL	ENST00000382112.3	37	CCDS46692.1	DEL	64	WashU																																																																																				0.356	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662		Frame_Shift_Del
CCDC40	55036	genome.wustl.edu	37	17	78032341	78032355	+	In_Frame_Del	DEL	ACATGCAGAACATCG	ACATGCAGAACATCG	-	rs370081372|rs141185078|rs377484770	byFrequency	TCGA-13-1404-01	TCGA-13-1404-10	ACATGCAGAACATCG	ACATGCAGAACATCG	ACATGCAGAACATCG	-	ACATGCAGAACATCG	ACATGCAGAACATCG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr17:78032341_78032355delACATGCAGAACATCG	ENST00000397545.4	+	8	1235_1249	c.1208_1222delACATGCAGAACATCG	c.(1207-1224)tacatgcagaacatcgac>tac	p.MQNID404del	CCDC40_ENST00000374876.4_In_Frame_Del_p.MQNID404del|CCDC40_ENST00000374877.3_In_Frame_Del_p.MQNID404del|CCDC40_ENST00000269318.5_In_Frame_Del_p.MQNID404del	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	404					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.M404_D408del(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CATCTCTTCTACATGCAGAACATCGACCAGGACAT	0.567																																																1	Deletion - In frame(1)	ovary(1)	17																																								75646950	SO:0001651	inframe_deletion	55036			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.1208_1222delACATGCAGAACATCG	17.37:g.78032341_78032355delACATGCAGAACATCG	ENSP00000380679:p.Met404_Asp408del		75646936	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	In_Frame_Del	DEL	ENST00000397545.4	37	CCDS42395.1	DEL	14	WashU																																																																																				0.567	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082		In_Frame_Del
METTL8	79828	genome.wustl.edu	37	2	172195912	172195914	+	In_Frame_Del	DEL	ATG	ATG	-			TCGA-13-1404-01	TCGA-13-1404-10	ATG	ATG	ATG	-	ATG	ATG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr2:172195912_172195914delATG	ENST00000375258.4	-	4	601_603	c.386_388delCAT	c.(385-390)tcatgg>tgg	p.S129del		NM_024770.3	NP_079046.2	Q9H825	METL8_HUMAN	methyltransferase like 8	129						cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)	p.S79del(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	11						ACATGATCCCATGATGATTCTCT	0.369																																																1	Deletion - In frame(1)	ovary(1)	2																																								171904160	SO:0001651	inframe_deletion	79828			AK024046	CCDS2242.1, CCDS2242.2	2q31.1	2012-06-12			ENSG00000123600	ENSG00000123600			25856	protein-coding gene	gene with protein product	"""tension-induced/inhibited protein"""	609525				15992539	Standard	NM_024770		Approved	FLJ13984, TIP	uc010zdo.2	Q9H825	OTTHUMG00000132261	ENST00000375258.4:c.386_388delCAT	2.37:g.172195915_172195917delATG	ENSP00000364407:p.Ser129del		171904158	Q53TM9|Q53TQ0	In_Frame_Del	DEL	ENST00000375258.4	37		DEL	8	WashU																																																																																				0.369	METTL8-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255345.3	NM_024770		In_Frame_Del
FAAH	2166	genome.wustl.edu	37	1	46871457	46871457	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1404-01	TCGA-13-1404-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr1:46871457A>G	ENST00000243167.8	+	5	860	c.776A>G	c.(775-777)aAc>aGc	p.N259S	FAAH_ENST00000493735.1_3'UTR	NM_001441.2	NP_001432.2	O00519	FAAH1_HUMAN	fatty acid amide hydrolase	259					fatty acid catabolic process (GO:0009062)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)	acylglycerol lipase activity (GO:0047372)|carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|fatty acid amide hydrolase activity (GO:0017064)	p.N259S(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	22	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	CCCACAGGGAACCGCCTCAGG	0.657																																																1	Substitution - Missense(1)	ovary(1)	1											21.0	24.0	23.0					1																	46871457		2201	4297	6498	46644044	SO:0001583	missense	2166			U82535	CCDS535.1	1p35-p34	2008-02-05			ENSG00000117480	ENSG00000117480			3553	protein-coding gene	gene with protein product		602935				9122178	Standard	NM_001441		Approved	FAAH-1	uc001cpu.2	O00519	OTTHUMG00000007811	ENST00000243167.8:c.776A>G	1.37:g.46871457A>G	ENSP00000243167:p.Asn259Ser		46644044	D3DQ19|Q52M86|Q5TDF8	Missense_Mutation	SNP	ENST00000243167.8	37	CCDS535.1	SNP	2	WashU	.	.	.	.	.	.	.	.	.	.	A	3.689	-0.063982	0.07273	.	.	ENSG00000117480	ENST00000243167	T	0.62941	-0.01	3.84	1.44	0.22558	Amidase signature domain (2);	0.110340	0.64402	D	0.000008	T	0.38427	0.1040	N	0.21617	0.685	0.23923	N	0.996454	B	0.12013	0.005	B	0.12156	0.007	T	0.11108	-1.0601	10	0.14656	T	0.56	-14.5689	5.0391	0.14449	0.7047:0.0:0.1584:0.1369	.	259	O00519	FAAH1_HUMAN	S	259	ENSP00000243167:N259S	ENSP00000243167:N259S	N	+	2	0	FAAH	46644044	0.974000	0.33945	0.991000	0.47740	0.355000	0.29361	2.566000	0.45948	0.559000	0.29153	0.402000	0.26972	AAC		0.657	FAAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021443.1	NM_001441		Missense_Mutation
JAK3	3718	genome.wustl.edu	37	19	17946849	17946849	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1404-01	TCGA-13-1404-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr19:17946849G>A	ENST00000527670.1	-	13	1827	c.1798C>T	c.(1798-1800)Cag>Tag	p.Q600*	JAK3_ENST00000534444.1_Nonsense_Mutation_p.Q600*|JAK3_ENST00000458235.1_Nonsense_Mutation_p.Q600*|JAK3_ENST00000526008.1_5'Flank			P52333	JAK3_HUMAN	Janus kinase 3	600	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.Q600*(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	ACAAATTCCTGCACCATGGTG	0.587		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	1	Substitution - Nonsense(1)	ovary(1)	19											97.0	91.0	93.0					19																	17946849		2203	4300	6503	17807849	SO:0001587	stop_gained	3718			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1798C>T	19.37:g.17946849G>A	ENSP00000432511:p.Gln600*		17807849	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Nonsense_Mutation	SNP	ENST00000527670.1	37	CCDS12366.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	37	6.582229	0.97680	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-32.9659	15.7013	0.77544	0.0:0.0:1.0:0.0	.	.	.	.	X	600	.	ENSP00000391676:Q600X	Q	-	1	0	JAK3	17807849	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	5.126000	0.64721	2.294000	0.77228	0.455000	0.32223	CAG		0.587	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215		Nonsense_Mutation
CARD10	29775	genome.wustl.edu	37	22	37893155	37893155	+	Silent	SNP	G	G	A			TCGA-13-1404-01	TCGA-13-1404-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1404-01	TCGA-13-1404-10	g.chr22:37893155G>A	ENST00000403299.1	-	13	2034	c.1818C>T	c.(1816-1818)agC>agT	p.S606S	CARD10_ENST00000406271.3_Silent_p.S320S|CARD10_ENST00000251973.5_Silent_p.S606S			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	606					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)	p.S606S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					CCCCTGGGGGGCTCCGGCCAG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	22											57.0	65.0	62.0					22																	37893155		2203	4300	6503	36223101	SO:0001819	synonymous_variant	29775			AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.1818C>T	22.37:g.37893155G>A			36223101	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Silent	SNP	ENST00000403299.1	37	CCDS13948.1	SNP	42	WashU																																																																																				0.577	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550		Silent
