#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ABCC5	10057	hgsc.bcm.edu	37	3	183639099	183639099	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr3:183639099C>G	ENST00000334444.6	-	30	4543	c.4303G>C	c.(4303-4305)Gtc>Ctc	p.V1435L	ABCC5_ENST00000265586.6_Missense_Mutation_p.V1392L	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1435					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.V1435L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	CAGCCCTTGACAGCGACCTTG	0.552																																																1	Substitution - Missense(1)	ovary(1)	3											105.0	117.0	113.0					3																	183639099		2163	4271	6434	185121793	SO:0001583	missense	10057			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.4303G>C	3.37:g.183639099C>G	ENSP00000333926:p.Val1435Leu		185121793	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	ENST00000334444.6	37	CCDS43176.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.28	3.079080	0.55753	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	D;D	0.91237	-2.65;-2.81	5.18	5.18	0.71444	.	0.000000	0.47455	D	0.000226	D	0.82669	0.5087	N	0.02802	-0.49	0.49130	D	0.999755	D;B	0.53151	0.958;0.073	P;B	0.45406	0.479;0.027	D	0.87596	0.2494	10	0.62326	D	0.03	-13.0384	18.6841	0.91557	0.0:1.0:0.0:0.0	.	1392;1435	Q86UX3;O15440	.;MRP5_HUMAN	L	1435;1392	ENSP00000333926:V1435L;ENSP00000265586:V1392L	ENSP00000265586:V1392L	V	-	1	0	ABCC5	185121793	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	5.327000	0.65881	2.399000	0.81585	0.655000	0.94253	GTC		0.552	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688		Missense_Mutation
ACBD4	79777	hgsc.bcm.edu	37	17	43213896	43213897	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-13-1408-01	TCGA-13-1408-10	CT	CT	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:43213896_43213897delCT	ENST00000376955.4	+	3	415_416	c.118_119delCT	c.(118-120)ctgfs	p.L40fs	ACBD4_ENST00000591136.1_3'UTR|ACBD4_ENST00000321854.8_Frame_Shift_Del_p.L40fs|ACBD4_ENST00000398322.3_Frame_Shift_Del_p.L40fs|ACBD4_ENST00000592162.1_Frame_Shift_Del_p.L40fs|ACBD4_ENST00000591859.1_Frame_Shift_Del_p.L40fs|ACBD4_ENST00000431281.1_Frame_Shift_Del_p.L40fs|ACBD4_ENST00000586346.1_Frame_Shift_Del_p.L40fs	NM_001135707.1	NP_001129179.1	Q8NC06	ACBD4_HUMAN	acyl-CoA binding domain containing 4	40	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.						fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			kidney(1)|lung(3)|ovary(1)	5						TGAAGAGATGCTGCGATTCTAC	0.619																																																0			17																																								40569423	SO:0001589	frameshift_variant	79777			BC029164	CCDS42348.1, CCDS45710.1, CCDS45711.1	17q21.31	2012-10-02	2010-04-30		ENSG00000181513	ENSG00000181513			23337	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 4"""				Standard	NM_001135704		Approved	FLJ13322	uc002iie.3	Q8NC06	OTTHUMG00000180111	ENST00000376955.4:c.118_119delCT	17.37:g.43213896_43213897delCT	ENSP00000366154:p.Leu40fs		40569422	D3DX64|Q8IUT1|Q9H8Q4	Frame_Shift_Del	DEL	ENST00000376955.4	37	CCDS45711.1	DEL	28	Baylor																																																																																				0.619	ACBD4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000449816.1	NM_024722		Frame_Shift_Del
ADAMTS12	81792	hgsc.bcm.edu	37	5	33881281	33881281	+	Silent	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr5:33881281C>T	ENST00000504830.1	-	2	767	c.432G>A	c.(430-432)acG>acA	p.T144T	ADAMTS12_ENST00000352040.3_Silent_p.T144T|ADAMTS12_ENST00000515401.1_Silent_p.T144T	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	144					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T144T(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GCTGTAGAACCGTGCCACTGA	0.567										HNSCC(64;0.19)																																						1	Substitution - coding silent(1)	ovary(1)	5											60.0	59.0	59.0					5																	33881281		2203	4300	6503	33917038	SO:0001819	synonymous_variant	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.432G>A	5.37:g.33881281C>T			33917038	A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	ENST00000504830.1	37	CCDS34140.1	SNP	23	Baylor																																																																																				0.567	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		Silent
AGAP3	116988	hgsc.bcm.edu	37	7	150837160	150837160	+	Frame_Shift_Del	DEL	C	C	-			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr7:150837160delC	ENST00000397238.2	+	13	1761	c.1761delC	c.(1759-1761)agcfs	p.S587fs	AGAP3_ENST00000463381.1_Intron	NM_031946.4	NP_114152.3	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	551	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)	p.S587fs*104(1)		central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						GGAAAAAGAGCACCGGGACCC	0.642																																																1	Deletion - Frameshift(1)	ovary(1)	7											22.0	29.0	27.0					7																	150837160		1847	4088	5935	150468093	SO:0001589	frameshift_variant	116988			AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000397238.2:c.1761delC	7.37:g.150837160delC	ENSP00000380413:p.Ser587fs		150468093	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Frame_Shift_Del	DEL	ENST00000397238.2	37	CCDS43681.1	DEL	25	Baylor																																																																																				0.642	AGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351908.3	NM_031946		Frame_Shift_Del
AKR1B1	231	hgsc.bcm.edu	37	7	134133850	134133850	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr7:134133850C>T	ENST00000285930.4	-	5	530	c.451G>A	c.(451-453)Gaa>Aaa	p.E151K	AKR1B1_ENST00000489022.1_5'UTR	NM_001628.2	NP_001619.1	P15121	ALDR_HUMAN	aldo-keto reductase family 1, member B1 (aldose reductase)	151					C21-steroid hormone biosynthetic process (GO:0006700)|carbohydrate metabolic process (GO:0005975)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)|glyceraldehyde oxidoreductase activity (GO:0043795)			kidney(1)|large_intestine(5)|lung(2)|ovary(3)|prostate(1)|skin(2)	14					Sulindac(DB00605)	ACCAGCCCTTCATCCACCAGC	0.468																																																0			7											185.0	183.0	183.0					7																	134133850		2203	4300	6503	133784390	SO:0001583	missense	231			J04795	CCDS5831.1	7q35	2010-04-08			ENSG00000085662	ENSG00000085662	1.1.1.21	"""Aldo-keto reductases"""	381	protein-coding gene	gene with protein product		103880		ALDR1		1901827	Standard	NM_001628		Approved	AR	uc003vrp.1	P15121	OTTHUMG00000155322	ENST00000285930.4:c.451G>A	7.37:g.134133850C>T	ENSP00000285930:p.Glu151Lys		133784390	B2R8N3|Q5U031|Q6FGA4|Q6ICP2|Q9BS21|Q9UCI9	Missense_Mutation	SNP	ENST00000285930.4	37	CCDS5831.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.47	2.544485	0.45280	.	.	ENSG00000085662	ENST00000285930	T	0.26660	1.72	5.23	3.37	0.38596	Aldo/keto reductase, conserved site (1);NADP-dependent oxidoreductase domain (3);	0.295622	0.42053	N	0.000776	T	0.15565	0.0375	N	0.16307	0.4	0.27536	N	0.950957	B	0.06786	0.001	B	0.10450	0.005	T	0.13980	-1.0489	10	0.30854	T	0.27	.	11.9373	0.52880	0.0:0.8487:0.0:0.1513	.	151	P15121	ALDR_HUMAN	K	151	ENSP00000285930:E151K	ENSP00000285930:E151K	E	-	1	0	AKR1B1	133784390	0.011000	0.17503	0.873000	0.34254	0.986000	0.74619	2.200000	0.42724	1.319000	0.45190	0.561000	0.74099	GAA		0.468	AKR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339448.2	NM_001628		Missense_Mutation
ANKRD23	200539	hgsc.bcm.edu	37	2	97508245	97508245	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr2:97508245T>C	ENST00000318357.4	-	2	72	c.31A>G	c.(31-33)Agt>Ggt	p.S11G	ANKRD23_ENST00000476975.1_5'Flank|ANKRD23_ENST00000418232.1_Missense_Mutation_p.S11G|ANKRD23_ENST00000331001.2_Missense_Mutation_p.S11G	NM_144994.7	NP_659431.5	Q86SG2	ANR23_HUMAN	ankyrin repeat domain 23	11					fatty acid metabolic process (GO:0006631)|response to mechanical stimulus (GO:0009612)	I band (GO:0031674)|intercalated disc (GO:0014704)|nucleus (GO:0005634)	titin binding (GO:0031432)	p.S11G(1)		endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)	9						CTTTCTCCACTTACCTGTAGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	2											58.0	62.0	61.0					2																	97508245		2203	4300	6503	96871972	SO:0001583	missense	200539				CCDS2027.1	2q11.2	2013-01-10			ENSG00000163126	ENSG00000163126		"""Ankyrin repeat domain containing"""	24470	protein-coding gene	gene with protein product	"""diabetes related ankyrin repeat protein"""	610736				12456686	Standard	NM_144994		Approved	DARP, FLJ32449, MARP3	uc002sxa.3	Q86SG2	OTTHUMG00000130534	ENST00000318357.4:c.31A>G	2.37:g.97508245T>C	ENSP00000321679:p.Ser11Gly		96871972	Q711K7|Q8NAJ7	Missense_Mutation	SNP	ENST00000318357.4	37	CCDS2027.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	14.56	2.571946	0.45798	.	.	ENSG00000163126	ENST00000318357;ENST00000418232;ENST00000331001	T;T;T	0.75050	-0.65;-0.65;-0.9	5.07	1.14	0.20703	.	0.310906	0.23228	N	0.050496	T	0.62109	0.2401	L	0.32530	0.975	0.80722	D	1	P;P	0.39665	0.621;0.682	B;B	0.40165	0.205;0.321	T	0.57929	-0.7726	10	0.66056	D	0.02	-1.1611	8.4641	0.32944	0.5451:0.0:0.0:0.4549	.	11;11	Q86SG2-2;Q86SG2	.;ANR23_HUMAN	G	11	ENSP00000321679:S11G;ENSP00000398987:S11G;ENSP00000333108:S11G	ENSP00000321679:S11G	S	-	1	0	ANKRD23	96871972	1.000000	0.71417	0.997000	0.53966	0.765000	0.43378	0.420000	0.21263	0.033000	0.15463	-0.451000	0.05528	AGT		0.512	ANKRD23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252956.1	NM_144994		Missense_Mutation
AOC2	314	hgsc.bcm.edu	37	17	40997343	40997345	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-13-1408-01	TCGA-13-1408-10	CTT	CTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:40997343_40997345delCTT	ENST00000253799.3	+	1	727_729	c.700_702delCTT	c.(700-702)cttdel	p.L234del	AOC2_ENST00000452774.2_In_Frame_Del_p.L234del	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	234					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)	p.L234delL(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TGGTCTTTTCCTTCACCCCGTGG	0.611																																																1	Deletion - In frame(1)	ovary(1)	17																																								38250871	SO:0001651	inframe_deletion	314			AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.700_702delCTT	17.37:g.40997343_40997345delCTT	ENSP00000253799:p.Leu234del		38250869	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	In_Frame_Del	DEL	ENST00000253799.3	37	CCDS11443.1	DEL	24	Baylor																																																																																				0.611	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158		In_Frame_Del
ARAP1	116985	hgsc.bcm.edu	37	11	72406812	72406812	+	Frame_Shift_Del	DEL	G	G	-			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr11:72406812delG	ENST00000393609.3	-	24	3573	c.3371delC	c.(3370-3372)gctfs	p.A1124fs	ARAP1_ENST00000426523.1_Frame_Shift_Del_p.A879fs|ARAP1_ENST00000455638.2_Frame_Shift_Del_p.A1124fs|ARAP1_ENST00000429686.1_Frame_Shift_Del_p.A818fs|ARAP1_ENST00000334211.8_Frame_Shift_Del_p.A879fs|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000393605.3_Frame_Shift_Del_p.A884fs|ARAP1_ENST00000359373.5_Frame_Shift_Del_p.A1124fs|ARAP1-AS1_ENST00000542022.1_RNA	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1124	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.A884fs*34(1)		cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						CACACGGCCAGCCTTGTAGTC	0.557																																					Ovarian(102;1198 1520 13195 17913 37529)											1	Deletion - Frameshift(1)	ovary(1)	11											123.0	86.0	99.0					11																	72406812		2200	4293	6493	72084460	SO:0001589	frameshift_variant	116985			AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3371delC	11.37:g.72406812delG	ENSP00000377233:p.Ala1124fs		72084460	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Frame_Shift_Del	DEL	ENST00000393609.3	37	CCDS41687.1	DEL	34	Baylor																																																																																				0.557	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118		Frame_Shift_Del
ARHGAP6	395	hgsc.bcm.edu	37	X	11187696	11187696	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chrX:11187696G>A	ENST00000337414.4	-	9	2610	c.1738C>T	c.(1738-1740)Cgg>Tgg	p.R580W	ARHGAP6_ENST00000491514.1_5'UTR|ARHGAP6_ENST00000380732.3_Missense_Mutation_p.R612W|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.R580W|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.R377W|ARHGAP6_ENST00000413512.3_Missense_Mutation_p.R389W|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.R377W|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.R405W	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	580	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)	p.R580R(1)|p.R580W(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TCCTCAGCCCGGGCTGAACTC	0.468																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	X											158.0	126.0	136.0					X																	11187696		2203	4300	6503	11097617	SO:0001583	missense	395			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1738C>T	X.37:g.11187696G>A	ENSP00000338967:p.Arg580Trp		11097617	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	37	CCDS14140.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582707	0.65992	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	T;T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.57	0.163	0.14986	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.000000	0.47093	D	0.000251	T	0.62171	0.2406	M	0.74467	2.265	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.928;0.977;0.976;0.984;0.999	T	0.66143	-0.5997	10	0.62326	D	0.03	.	15.5015	0.75703	0.0:0.0:0.4095:0.5905	.	389;377;580;580;580	B7Z8H7;O43182-5;O43182-2;O43182;A8KAL3	.;.;.;RHG06_HUMAN;.	W	405;377;377;580;416;580;389;612	ENSP00000438135:R405W;ENSP00000370112:R377W;ENSP00000302312:R377W;ENSP00000338967:R580W;ENSP00000370093:R416W;ENSP00000370094:R580W;ENSP00000389394:R389W;ENSP00000370108:R612W	ENSP00000302312:R377W	R	-	1	2	ARHGAP6	11097617	1.000000	0.71417	0.449000	0.26957	0.927000	0.56198	1.369000	0.34227	-0.098000	0.12285	-1.469000	0.01011	CGG		0.468	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427		Missense_Mutation
ASB11	140456	hgsc.bcm.edu	37	X	15306059	15306059	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chrX:15306059G>T	ENST00000480796.1	-	6	841	c.791C>A	c.(790-792)gCg>gAg	p.A264E	ASB11_ENST00000380470.3_Missense_Mutation_p.A247E|ASB11_ENST00000537676.1_Missense_Mutation_p.A243E|ASB11_ENST00000344384.4_Missense_Mutation_p.A243E			Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box containing 11, E3 ubiquitin protein ligase	264					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.A264E(2)|p.A243E(1)		breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(1)	16	Hepatocellular(33;0.183)					CAGATCAAGCGCACTTTTGCC	0.542																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	X											124.0	97.0	106.0					X																	15306059		2203	4300	6503	15215980	SO:0001583	missense	140456			AF425642	CCDS14164.1, CCDS35209.1, CCDS56596.1	Xp22.31	2014-02-10	2014-02-10		ENSG00000165192	ENSG00000165192		"""Ankyrin repeat domain containing"""	17186	protein-coding gene	gene with protein product		300626	"""ankyrin repeat and SOCS box-containing 11"", ""ankyrin repeat and SOCS box containing 11"""			24337577	Standard	NM_080873		Approved	DKFZp779E2460	uc004cwp.2	Q8WXH4	OTTHUMG00000021173	ENST00000480796.1:c.791C>A	X.37:g.15306059G>T	ENSP00000417914:p.Ala264Glu		15215980	E9PEN1|Q3SYC4|Q7Z667	Missense_Mutation	SNP	ENST00000480796.1	37	CCDS14164.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179073	0.78564	.	.	ENSG00000165192	ENST00000537676;ENST00000380470;ENST00000344384;ENST00000480796	T;T;T;T	0.60424	0.19;0.19;0.19;0.19	5.44	5.44	0.79542	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000003	D	0.82683	0.5090	H	0.94503	3.545	0.23620	N	0.997276	D;D;D	0.89917	0.981;0.999;1.0	P;D;D	0.72982	0.9;0.966;0.979	T	0.79325	-0.1850	10	0.87932	D	0	-4.8556	17.2286	0.86978	0.0:0.0:1.0:0.0	.	247;264;243	Q7Z667;Q8WXH4;E9PEN1	.;ASB11_HUMAN;.	E	243;247;243;264	ENSP00000445465:A243E;ENSP00000369837:A247E;ENSP00000343408:A243E;ENSP00000417914:A264E	ENSP00000343408:A243E	A	-	2	0	ASB11	15215980	1.000000	0.71417	0.020000	0.16555	0.980000	0.70556	8.393000	0.90182	2.279000	0.76181	0.523000	0.50628	GCG		0.542	ASB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055852.2			Missense_Mutation
ATP11A	23250	hgsc.bcm.edu	37	13	113487302	113487302	+	Silent	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr13:113487302G>A	ENST00000487903.1	+	14	1612	c.1524G>A	c.(1522-1524)tcG>tcA	p.S508S	ATP11A_ENST00000375645.3_Silent_p.S508S|ATP11A_ENST00000375630.2_Silent_p.S508S|ATP11A_ENST00000283558.8_Silent_p.S508S			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	508					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TCTCATCCTCGCCCGACGAGG	0.627																																																0			13											126.0	136.0	133.0					13																	113487302		2203	4300	6503	112535303	SO:0001819	synonymous_variant	23250			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.1524G>A	13.37:g.113487302G>A			112535303	Q5VXT2	Silent	SNP	ENST00000487903.1	37	CCDS32011.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.915	1.210607	0.22289	.	.	ENSG00000068650	ENST00000418678	.	.	.	5.71	-11.4	0.00090	.	.	.	.	.	T	0.30634	0.0771	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40384	-0.9566	4	.	.	.	.	1.1796	0.01842	0.3915:0.2518:0.1456:0.2111	.	.	.	.	H	483	.	.	R	+	2	0	ATP11A	112535303	0.000000	0.05858	0.165000	0.22776	0.918000	0.54935	-2.824000	0.00747	-2.716000	0.00391	-1.069000	0.02264	CGC		0.627	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205		Silent
ATP6V0D1	9114	hgsc.bcm.edu	37	16	67472908	67472908	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr16:67472908T>C	ENST00000290949.3	-	6	932	c.782A>G	c.(781-783)tAt>tGt	p.Y261C	ATP6V0D1_ENST00000567694.1_5'UTR|ATP6V0D1_ENST00000540149.1_Missense_Mutation_p.Y302C|ATP6V0D1_ENST00000602876.1_Missense_Mutation_p.Y184C	NM_004691.4	NP_004682.2	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1	261					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP hydrolysis coupled proton transport (GO:0015991)|brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|cellular protein metabolic process (GO:0044267)|cilium assembly (GO:0042384)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|synaptic vesicle (GO:0008021)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)			large_intestine(3)|lung(3)|urinary_tract(2)	8		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		GACCTGTTCATAGTCGTCAGC	0.622																																																0			16											109.0	121.0	117.0					16																	67472908		2198	4300	6498	66030409	SO:0001583	missense	9114			X71490	CCDS10838.1	16q22	2010-04-21	2006-01-20	2002-05-10	ENSG00000159720	ENSG00000159720		"""ATPases / V-type"""	13724	protein-coding gene	gene with protein product		607028	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), member D"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D1"""	ATP6D		8250920	Standard	NM_004691		Approved	ATP6DV, VATX, VPATPD, P39, Vma6	uc002ete.1	P61421	OTTHUMG00000137515	ENST00000290949.3:c.782A>G	16.37:g.67472908T>C	ENSP00000290949:p.Tyr261Cys		66030409	P12953|Q02547	Missense_Mutation	SNP	ENST00000290949.3	37	CCDS10838.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	8.650	0.898121	0.17686	.	.	ENSG00000159720	ENST00000290949;ENST00000426604;ENST00000540149	T;T	0.32023	1.47;1.47	4.87	3.76	0.43208	.	0.000000	0.85682	D	0.000000	T	0.58736	0.2143	M	0.90082	3.085	0.80722	D	1	D;B	0.89917	1.0;0.378	D;P	0.85130	0.997;0.449	T	0.61486	-0.7053	10	0.44086	T	0.13	-10.8051	9.9844	0.41832	0.1518:0.0:0.0:0.8482	.	302;261	F5GYQ1;P61421	.;VA0D1_HUMAN	C	261;184;302	ENSP00000290949:Y261C;ENSP00000441282:Y302C	ENSP00000290949:Y261C	Y	-	2	0	ATP6V0D1	66030409	1.000000	0.71417	0.999000	0.59377	0.034000	0.12701	5.977000	0.70492	0.871000	0.35750	-0.341000	0.08007	TAT		0.622	ATP6V0D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268835.1	NM_004691		Missense_Mutation
B3GAT1	27087	hgsc.bcm.edu	37	11	134252642	134252642	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr11:134252642G>A	ENST00000524765.1	-	4	5424	c.880C>T	c.(880-882)Ctc>Ttc	p.L294F	B3GAT1_ENST00000537389.1_Missense_Mutation_p.L307F|B3GAT1_ENST00000392580.1_Missense_Mutation_p.L294F|B3GAT1_ENST00000531510.1_5'Flank|B3GAT1_ENST00000312527.4_Missense_Mutation_p.L294F			Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	294					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		AGGTCGTTGAGGGTGACAAGT	0.577																																																0			11											150.0	111.0	124.0					11																	134252642		2201	4297	6498	133757852	SO:0001583	missense	27087			AB029396	CCDS8500.1	11q25	2014-07-08	2014-07-08		ENSG00000109956	ENSG00000109956	2.4.1.135	"""CD molecules"", ""Beta-1,3-glucuronyltransferases"""	921	protein-coding gene	gene with protein product	"""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1"", ""glucuronosyltransferase P"""	151290	"""CD57 antigen"""	CD57, LEU7			Standard	XM_005271506		Approved	GlcAT-P, HNK-1, NK-1	uc001qhq.3	Q9P2W7	OTTHUMG00000167180	ENST00000524765.1:c.880C>T	11.37:g.134252642G>A	ENSP00000433847:p.Leu294Phe		133757852	Q96FS7	Missense_Mutation	SNP	ENST00000524765.1	37	CCDS8500.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.23	2.773185	0.49680	.	.	ENSG00000109956	ENST00000392580;ENST00000312527;ENST00000524765;ENST00000537389	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.03	4.13	0.48395	.	0.061993	0.64402	D	0.000003	T	0.39627	0.1085	L	0.50333	1.59	0.80722	D	1	B;P	0.43607	0.289;0.812	B;P	0.45138	0.08;0.471	T	0.16512	-1.0400	10	0.09843	T	0.71	-29.9236	13.529	0.61611	0.0751:0.0:0.9249:0.0	.	307;294	F5H0S0;Q9P2W7	.;B3GA1_HUMAN	F	294;294;294;307	ENSP00000376359:L294F;ENSP00000307875:L294F;ENSP00000433847:L294F;ENSP00000445983:L307F	ENSP00000307875:L294F	L	-	1	0	B3GAT1	133757852	1.000000	0.71417	0.996000	0.52242	0.965000	0.64279	2.735000	0.47377	1.357000	0.45904	0.491000	0.48974	CTC		0.577	B3GAT1-002	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393639.1	NM_018644		Missense_Mutation
BAI2	576	hgsc.bcm.edu	37	1	32202314	32202314	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr1:32202314G>T	ENST00000373658.3	-	21	3331	c.2990C>A	c.(2989-2991)aCc>aAc	p.T997N	BAI2_ENST00000398556.3_Missense_Mutation_p.T945N|BAI2_ENST00000527361.1_Missense_Mutation_p.T997N|BAI2_ENST00000465256.1_5'Flank|BAI2_ENST00000398542.1_Missense_Mutation_p.T930N|BAI2_ENST00000398538.1_Missense_Mutation_p.T985N|BAI2_ENST00000440175.2_Missense_Mutation_p.T639N|BAI2_ENST00000373655.2_Missense_Mutation_p.T997N|BAI2_ENST00000257070.4_Missense_Mutation_p.T997N|BAI2_ENST00000398547.1_Missense_Mutation_p.T930N	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	997					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T997N(1)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		AGCCGTCATGGTGCACACGCC	0.672																																																1	Substitution - Missense(1)	ovary(1)	1											74.0	55.0	62.0					1																	32202314		2203	4299	6502	31974901	SO:0001583	missense	576			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.2990C>A	1.37:g.32202314G>T	ENSP00000362762:p.Thr997Asn		31974901	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099017	0.76870	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89	4.66	4.66	0.58398	GPCR, family 2-like (1);	0.000000	0.42172	D	0.000755	T	0.70491	0.3230	M	0.88775	2.98	0.54753	D	0.999989	D;D;D;D;D	0.76494	0.997;0.999;0.996;0.997;0.999	D;D;D;D;D	0.77557	0.947;0.983;0.972;0.974;0.99	T	0.78244	-0.2279	10	0.87932	D	0	.	17.5532	0.87882	0.0:0.0:1.0:0.0	.	997;985;639;997;997	O60241-4;O60241-3;B4DKC3;O60241-2;O60241	.;.;.;.;BAI2_HUMAN	N	945;930;997;997;930;997;997;639;985	ENSP00000381564:T945N;ENSP00000381555:T930N;ENSP00000362762:T997N;ENSP00000362759:T997N;ENSP00000381550:T930N;ENSP00000257070:T997N;ENSP00000435397:T997N;ENSP00000391071:T639N;ENSP00000381548:T985N	ENSP00000257070:T997N	T	-	2	0	BAI2	31974901	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.864000	0.99589	2.312000	0.78011	0.462000	0.41574	ACC		0.672	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703		Missense_Mutation
ENO4	387712	hgsc.bcm.edu	37	10	118616017	118616017	+	Silent	SNP	G	G	T			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr10:118616017G>T	ENST00000341276.5	+	4	367	c.312G>T	c.(310-312)gtG>gtT	p.V104V	ENO4_ENST00000409522.1_Intron|ENO4_ENST00000369207.2_5'Flank	NM_001242699.1	NP_001229628.1	A6NNW6	ENO4_HUMAN	enolase family member 4	104					glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						TATGTTCTGTGGTGATCTCGA	0.488																																																0			10																																								118606007	SO:0001819	synonymous_variant	387712				CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000341276.5:c.312G>T	10.37:g.118616017G>T			118606007	B8ZZN9	Silent	SNP	ENST00000341276.5	37		SNP	47	Baylor																																																																																				0.488	ENO4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001242699		Silent
BNIP3	664	hgsc.bcm.edu	37	10	133787389	133787389	+	Silent	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr10:133787389C>T	ENST00000368636.4	-	2	229	c.105G>A	c.(103-105)tcG>tcA	p.S35S	BNIP3_ENST00000540159.1_Silent_p.S35S	NM_004052.2	NP_004043.2	Q12983	BNIP3_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 3	35					apoptotic process (GO:0006915)|autophagic cell death (GO:0048102)|brown fat cell differentiation (GO:0050873)|cell death (GO:0008219)|cellular response to cobalt ion (GO:0071279)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|intrinsic apoptotic signaling pathway in response to hypoxia (GO:1990144)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrial protein catabolic process (GO:0035694)|negative regulation of apoptotic process (GO:0043066)|negative regulation of membrane potential (GO:0045837)|negative regulation of mitochondrial fusion (GO:0010637)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane permeability (GO:0046902)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTPase binding (GO:0051020)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|skin(1)	7		all_cancers(35;4e-11)|all_epithelial(44;5.07e-08)|Ovarian(717;2.61e-05)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Breast(234;0.023)|all_neural(114;0.0299)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)		Epithelial(32;1.59e-12)|all cancers(32;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(35;2.57e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		AAATAGAAACCGAGGCTGGAA	0.517																																																0			10											86.0	82.0	83.0					10																	133787389		2203	4300	6503	133637379	SO:0001819	synonymous_variant	664			U15174	CCDS7663.1	10q26.3	2003-11-05	2002-08-29		ENSG00000176171	ENSG00000176171			1084	protein-coding gene	gene with protein product		603293	"""BCL2/adenovirus E1B 19kD-interacting protein 3"""			7954800	Standard	NM_004052		Approved	Nip3	uc001lkv.1	Q12983	OTTHUMG00000019278	ENST00000368636.4:c.105G>A	10.37:g.133787389C>T			133637379	O14620|Q96GP0	Silent	SNP	ENST00000368636.4	37	CCDS7663.1	SNP	23	Baylor																																																																																				0.517	BNIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051039.1			Silent
C1QL4	338761	hgsc.bcm.edu	37	12	49726968	49726969	+	Frame_Shift_Ins	INS	-	-	TT	rs144828464	byFrequency	TCGA-13-1408-01	TCGA-13-1408-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr12:49726968_49726969insTT	ENST00000334221.3	-	2	1295_1296	c.585_586insAA	c.(583-588)tacgccfs	p.A196fs		NM_001008223.1	NP_001008224.1	Q86Z23	C1QL4_HUMAN	complement component 1, q subcomponent-like 4	196	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)		p.A196fs*>44(1)		large_intestine(2)|lung(1)|ovary(1)|skin(1)	5						CTGTTGCTGGCGTAGTCGTAGT	0.604																																																1	Insertion - Frameshift(1)	ovary(1)	12																																								48013236	SO:0001589	frameshift_variant	338761				CCDS31793.1	12q13.12	2012-04-12				ENSG00000186897			31416	protein-coding gene	gene with protein product		615229					Standard	NM_001008223		Approved	C1QTNF11, CTRP11	uc001rtz.1	Q86Z23	OTTHUMG00000169515	ENST00000334221.3:c.585_586insAA	12.37:g.49726968_49726969insTT	ENSP00000335285:p.Ala196fs		48013235		Frame_Shift_Ins	INS	ENST00000334221.3	37	CCDS31793.1	INS	27	Baylor																																																																																				0.604	C1QL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404561.1	NM_001008223		Frame_Shift_Ins
HECTD4	283450	hgsc.bcm.edu	37	12	112646341	112646341	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr12:112646341G>A	ENST00000430131.2	-	50	7840	c.6695C>T	c.(6694-6696)gCa>gTa	p.A2232V	HECTD4_ENST00000550722.1_Missense_Mutation_p.A2508V|HECTD4_ENST00000377560.5_Missense_Mutation_p.A2482V			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2232					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										ttcatcatcTGCAATGGGAGG	0.483																																																0			12											116.0	115.0	115.0					12																	112646341		2038	4207	6245	111130724	SO:0001583	missense	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.6695C>T	12.37:g.112646341G>A	ENSP00000404379:p.Ala2232Val		111130724	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		SNP	46	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.86|18.86	3.714070|3.714070	0.68730|0.68730	.|.	.|.	ENSG00000173064|ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722|ENST00000550968	T;T;T|.	0.47177|.	0.85;0.85;0.85|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|.	.|.	.|.	.|.	T|.	0.44871|.	0.1314|.	N|N	0.03608|0.03608	-0.345|-0.345	0.58432|0.58432	D|D	0.999998|0.999998	D|.	0.63880|.	0.993|.	D|.	0.68192|.	0.956|.	T|.	0.41124|.	-0.9526|.	9|.	0.27785|.	T|.	0.31|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2232|.	Q9Y4D8|.	K0614_HUMAN|.	V|X	2482;2232;2508|399	ENSP00000366783:A2482V;ENSP00000404379:A2232V;ENSP00000449784:A2508V|.	ENSP00000366783:A2482V|.	A|Q	-|-	2|1	0|0	C12orf51|C12orf51	111130724|111130724	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	9.187000|9.187000	0.94912|0.94912	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCA|CAG		0.483	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		Missense_Mutation
BPIFB4	149954	hgsc.bcm.edu	37	20	31671213	31671214	+	Frame_Shift_Ins	INS	-	-	C	rs139974951|rs541992483	byFrequency	TCGA-13-1408-01	TCGA-13-1408-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr20:31671213_31671214insC	ENST00000375483.3	+	3	210_211	c.210_211insC	c.(211-213)cccfs	p.P71fs		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	71						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.V35fs*9(1)									ATGTCCGAGGACCCCCCCCAGT	0.495													CCCCCCCC|CCCCCCCC|CCCCCCCCC|insertion	3	0.000599042	0.0015	0.0014	5008	,	,		12507	0.0		0.0	False		,,,				2504	0.0															1	Insertion - Frameshift(1)	ovary(1)	20																																								31134875	SO:0001589	frameshift_variant	149954			AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.218dupC	20.37:g.31671221_31671221dupC	ENSP00000364632:p.Pro71fs		31134874	Q5TDX6	Frame_Shift_Ins	INS	ENST00000375483.3	37	CCDS13213.2	INS	10	Baylor																																																																																				0.495	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519		Frame_Shift_Ins
C2CD2	25966	hgsc.bcm.edu	37	21	43327232	43327232	+	Frame_Shift_Del	DEL	G	G	-			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr21:43327232delG	ENST00000380486.3	-	10	1428	c.1187delC	c.(1186-1188)cctfs	p.P398fs	C2CD2_ENST00000329623.7_Frame_Shift_Del_p.P243fs	NM_015500.1	NP_056315.1	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2	398						cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.P396fs*9(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|stomach(1)	15						AACAGGGGGAGGGATGGGCCA	0.522																																																1	Deletion - Frameshift(1)	ovary(1)	21											68.0	65.0	66.0					21																	43327232		2203	4300	6503	42200301	SO:0001589	frameshift_variant	25966			AB047784	CCDS13677.1, CCDS42933.1	21q22.3	2008-11-24	2007-10-17	2007-10-17	ENSG00000157617	ENSG00000157617			1266	protein-coding gene	gene with protein product	"""TMEM24-like"""		"""chromosome 21 open reading frame 25"""	C21orf25		15289880	Standard	NM_015500		Approved	TMEM24L, DKFZP586F0422, C21orf258	uc002yzw.3	Q9Y426	OTTHUMG00000086779	ENST00000380486.3:c.1187delC	21.37:g.43327232delG	ENSP00000369853:p.Pro398fs		42200301	Q5R2V7|Q6AHX8|Q9NSE6	Frame_Shift_Del	DEL	ENST00000380486.3	37	CCDS42933.1	DEL	35	Baylor																																																																																				0.522	C2CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195228.2	NM_015500		Frame_Shift_Del
C9orf171	389799	hgsc.bcm.edu	37	9	135413034	135413034	+	Frame_Shift_Del	DEL	C	C	-			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr9:135413034delC	ENST00000343036.2	+	5	727	c.679delC	c.(679-681)ctgfs	p.L227fs	C9orf171_ENST00000393216.2_Frame_Shift_Del_p.L191fs	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	227										large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						GTACCTGCAGCTGTGGGTACA	0.562																																																0			9											105.0	106.0	106.0					9																	135413034		2203	4300	6503	134402855	SO:0001589	frameshift_variant	389799			AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.679delC	9.37:g.135413034delC	ENSP00000343290:p.Leu227fs		134402855	Q147X1	Frame_Shift_Del	DEL	ENST00000343036.2	37	CCDS6949.1	DEL	28	Baylor																																																																																				0.562	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417		Frame_Shift_Del
CACNA2D2	9254	hgsc.bcm.edu	37	3	50416992	50416992	+	Frame_Shift_Del	DEL	G	G	-			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr3:50416992delG	ENST00000479441.1	-	11	1022	c.1023delC	c.(1021-1023)tgcfs	p.C341fs	CACNA2D2_ENST00000266039.3_Frame_Shift_Del_p.C341fs|CACNA2D2_ENST00000360963.3_Frame_Shift_Del_p.C272fs|CACNA2D2_ENST00000429770.1_Frame_Shift_Del_p.C341fs|CACNA2D2_ENST00000395083.1_Frame_Shift_Del_p.C341fs|CACNA2D2_ENST00000423994.2_Frame_Shift_Del_p.C341fs|CACNA2D2_ENST00000424201.2_Frame_Shift_Del_p.C341fs|CACNA2D2_ENST00000435965.1_Frame_Shift_Del_p.C341fs			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	341	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.F342fs*54(1)		breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GGTGTGTGAAGCATGACACAG	0.597																																																1	Deletion - Frameshift(1)	ovary(1)	3											97.0	81.0	86.0					3																	50416992		2203	4300	6503	50391996	SO:0001589	frameshift_variant	9254			AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.1023delC	3.37:g.50416992delG	ENSP00000418081:p.Cys341fs		50391996	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Frame_Shift_Del	DEL	ENST00000479441.1	37	CCDS54588.1	DEL	34	Baylor																																																																																				0.597	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346457.1	NM_006030		Frame_Shift_Del
CCDC142	84865	hgsc.bcm.edu	37	2	74708469	74708469	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr2:74708469C>T	ENST00000393965.3	-	3	1535	c.1139G>A	c.(1138-1140)gGg>gAg	p.G380E	TTC31_ENST00000233623.5_5'Flank|CCDC142_ENST00000471713.1_5'UTR|TTC31_ENST00000410003.1_5'Flank|TTC31_ENST00000442235.2_5'Flank|CCDC142_ENST00000290418.4_Missense_Mutation_p.G380E	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	380										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						GCTCTGACCCCCAAGAGCTGA	0.572																																																0			2											106.0	123.0	117.0					2																	74708469		2203	4300	6503	74561977	SO:0001583	missense	84865			AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.1139G>A	2.37:g.74708469C>T	ENSP00000377537:p.Gly380Glu		74561977	B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Missense_Mutation	SNP	ENST00000393965.3	37		SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	1.888	-0.456271	0.04540	.	.	ENSG00000135637	ENST00000393965;ENST00000290418	T;T	0.42900	0.96;0.96	4.65	1.89	0.25635	.	0.677726	0.12822	N	0.436361	T	0.29914	0.0748	L	0.42245	1.32	0.09310	N	1	B;B;B	0.14012	0.008;0.009;0.009	B;B;B	0.16289	0.009;0.011;0.015	T	0.28106	-1.0054	10	0.16420	T	0.52	0.0756	6.3978	0.21622	0.0:0.7091:0.0:0.2909	.	380;380;380	Q17RM4;Q17RM4-2;Q17RM4-3	CC142_HUMAN;.;.	E	380	ENSP00000377537:G380E;ENSP00000290418:G380E	ENSP00000290418:G380E	G	-	2	0	CCDC142	74561977	0.000000	0.05858	0.000000	0.03702	0.908000	0.53690	0.048000	0.14078	0.207000	0.20607	0.563000	0.77884	GGG		0.572	CCDC142-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000328391.1	NM_032779		Missense_Mutation
CAPG	822	hgsc.bcm.edu	37	2	85628985	85628985	+	Missense_Mutation	SNP	C	C	A	rs145323184		TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr2:85628985C>A	ENST00000409921.1	-	3	185	c.119G>T	c.(118-120)gGc>gTc	p.G40V	CAPG_ENST00000263867.4_Missense_Mutation_p.G40V|CAPG_ENST00000409670.1_Missense_Mutation_p.G40V|CAPG_ENST00000483659.1_5'Flank|CAPG_ENST00000409724.1_Missense_Mutation_p.G40V			Q9BPX3	CND3_HUMAN	capping protein (actin filament), gelsolin-like	0					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)	11						GAAGAAGACGCCCTGGTTCTC	0.602																																																0			2											114.0	110.0	111.0					2																	85628985		2203	4300	6503	85482496	SO:0001583	missense	822			M94345	CCDS1974.1, CCDS58715.1	2p11.2	2008-06-04			ENSG00000042493	ENSG00000042493			1474	protein-coding gene	gene with protein product	"""macrophage capping protein"""	153615		AFCP		1322908, 12754261	Standard	NM_001747		Approved	MCP	uc010fgi.2	P40121	OTTHUMG00000130183	ENST00000409921.1:c.119G>T	2.37:g.85628985C>A	ENSP00000387063:p.Gly40Val		85482496	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	ENST00000409921.1	37	CCDS58715.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.88	3.716739	0.68844	.	.	ENSG00000042493	ENST00000542681;ENST00000263867;ENST00000409921;ENST00000409670;ENST00000409724;ENST00000439385;ENST00000449030;ENST00000447219;ENST00000409275	T;T;T;T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94;1.94;1.94;1.94	5.55	5.55	0.83447	Gelsolin domain (1);	0.000000	0.85682	D	0.000000	T	0.61350	0.2340	H	0.96916	3.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.74618	-0.3605	10	0.87932	D	0	.	15.0028	0.71486	0.0:1.0:0.0:0.0	.	40;40	B8ZZS7;P40121	.;CAPG_HUMAN	V	40	ENSP00000263867:G40V;ENSP00000387063:G40V;ENSP00000386315:G40V;ENSP00000386965:G40V;ENSP00000391923:G40V;ENSP00000403330:G40V;ENSP00000398232:G40V;ENSP00000386596:G40V	ENSP00000263867:G40V	G	-	2	0	CAPG	85482496	1.000000	0.71417	0.956000	0.39512	0.323000	0.28346	7.175000	0.77632	2.604000	0.88044	0.563000	0.77884	GGC		0.602	CAPG-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329383.1	NM_001747		Missense_Mutation
CCNJL	79616	hgsc.bcm.edu	37	5	159682681	159682681	+	Silent	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr5:159682681G>A	ENST00000393977.3	-	6	1047	c.762C>T	c.(760-762)gtC>gtT	p.V254V	CCNJL_ENST00000541762.1_Silent_p.V205V|CCNJL_ENST00000257536.7_Silent_p.V206V|CCNJL_ENST00000519673.1_Silent_p.V206V|CCNJL_ENST00000377503.2_5'UTR	NM_024565.5	NP_078841.3	Q8IV13	CCNJL_HUMAN	cyclin J-like	254						nucleus (GO:0005634)				endometrium(2)|kidney(5)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGCCGCAGCGACCACAGAAG	0.552																																																0			5											63.0	70.0	68.0					5																	159682681		1920	4124	6044	159615259	SO:0001819	synonymous_variant	79616			BC013353	CCDS4350.2	5q33.3	2008-10-31			ENSG00000135083	ENSG00000135083			25876	protein-coding gene	gene with protein product						12477932	Standard	XM_005265982		Approved	FLJ14166	uc003lyb.1	Q8IV13	OTTHUMG00000130325	ENST00000393977.3:c.762C>T	5.37:g.159682681G>A			159615259	Q6ZN43|Q9H7W8	Silent	SNP	ENST00000393977.3	37	CCDS4350.2	SNP	37	Baylor																																																																																				0.552	CCNJL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252674.1	NM_024565		Silent
CEACAM6	4680	hgsc.bcm.edu	37	19	42260659	42260659	+	Silent	SNP	A	A	G			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:42260659A>G	ENST00000199764.6	+	2	434	c.216A>G	c.(214-216)agA>agG	p.R72R	AC011513.4_ENST00000601409.1_RNA|CEA_ENST00000598976.1_Intron	NM_002483.4	NP_002474.3	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)	72	Ig-like V-type.				cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.R72R(1)		breast(1)|kidney(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		AAGGCGAAAGAGTGGATGGCA	0.498																																																1	Substitution - coding silent(1)	ovary(1)	19											205.0	187.0	193.0					19																	42260659		2203	4300	6503	46952499	SO:0001819	synonymous_variant	4680			M29541	CCDS12585.1	19q13.1-q13.2	2013-01-29			ENSG00000086548	ENSG00000086548		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1818	protein-coding gene	gene with protein product		163980		NCA			Standard	NM_002483		Approved	CD66c	uc002orm.2	P40199	OTTHUMG00000151064	ENST00000199764.6:c.216A>G	19.37:g.42260659A>G			46952499	Q13774|Q14920|Q53XP7	Silent	SNP	ENST00000199764.6	37	CCDS12585.1	SNP	11	Baylor																																																																																				0.498	CEACAM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321147.1			Silent
CKAP4	10970	hgsc.bcm.edu	37	12	106633844	106633844	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr12:106633844G>C	ENST00000378026.4	-	2	903	c.767C>G	c.(766-768)aCa>aGa	p.T256R	CKAP4_ENST00000552828.1_5'UTR	NM_006825.3	NP_006816.2	Q07065	CKAP4_HUMAN	cytoskeleton-associated protein 4	256						cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|pancreas(1)|urinary_tract(1)	20						CTGGACTTCTGTGAAGATGGC	0.542																																																0			12											146.0	134.0	138.0					12																	106633844		2203	4300	6503	105157974	SO:0001583	missense	10970			X69910	CCDS9103.1	12q23.3	2006-06-23				ENSG00000136026			16991	protein-coding gene	gene with protein product						8314870	Standard	NM_006825		Approved	P63, CLIMP-63, ERGIC-63	uc001tlk.3	Q07065		ENST00000378026.4:c.767C>G	12.37:g.106633844G>C	ENSP00000367265:p.Thr256Arg		105157974	Q504S5|Q53ES6	Missense_Mutation	SNP	ENST00000378026.4	37	CCDS9103.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737490	0.69304	.	.	ENSG00000136026	ENST00000378026	T	0.77750	-1.12	5.8	5.8	0.92144	.	0.051751	0.85682	D	0.000000	D	0.85639	0.5743	M	0.72894	2.215	0.54753	D	0.999989	D	0.89917	1.0	D	0.83275	0.996	T	0.82226	-0.0562	10	0.22109	T	0.4	-12.8003	13.2846	0.60235	0.0719:0.0:0.9281:0.0	.	256	Q07065	CKAP4_HUMAN	R	256	ENSP00000367265:T256R	ENSP00000367265:T256R	T	-	2	0	CKAP4	105157974	1.000000	0.71417	0.967000	0.41034	0.972000	0.66771	5.747000	0.68689	2.758000	0.94735	0.563000	0.77884	ACA		0.542	CKAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407196.1			Missense_Mutation
CLCN4	1183	hgsc.bcm.edu	37	X	10153170	10153170	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chrX:10153170T>A	ENST00000380833.4	+	3	489	c.98T>A	c.(97-99)aTc>aAc	p.I33N	CLCN4_ENST00000421085.2_Intron|CLCN4_ENST00000380829.1_Missense_Mutation_p.I33N	NM_001256944.1|NM_001830.3	NP_001243873.1|NP_001821.2	P51793	CLCN4_HUMAN	chloride channel, voltage-sensitive 4	33					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.I33N(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TTCCACACCATCGACTGGCTA	0.527																																					Melanoma(74;1050 1296 1576 30544 38374)											1	Substitution - Missense(1)	ovary(1)	X											154.0	109.0	124.0					X																	10153170		2203	4300	6503	10113170	SO:0001583	missense	1183			X77197	CCDS14137.1, CCDS59159.1	Xp22.3	2012-09-26	2012-02-23		ENSG00000073464	ENSG00000073464		"""Ion channels / Chloride channels : Voltage-sensitive"""	2022	protein-coding gene	gene with protein product		302910	"""chloride channel 4"""			8069296	Standard	NM_001830		Approved	CLC4, ClC-4	uc004csy.4	P51793	OTTHUMG00000021125	ENST00000380833.4:c.98T>A	X.37:g.10153170T>A	ENSP00000370213:p.Ile33Asn		10113170	A1L3U1|B7Z5Z4|Q9UBU1	Missense_Mutation	SNP	ENST00000380833.4	37	CCDS14137.1	SNP	50	Baylor	.	.	.	.	.	.	.	.	.	.	T	26.6	4.752710	0.89753	.	.	ENSG00000073464	ENST00000380833;ENST00000380829;ENST00000454850	D;D;T	0.92545	-3.06;-3.06;0.85	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.96790	0.8952	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.97637	1.0146	10	0.87932	D	0	-33.4038	13.7972	0.63177	0.0:0.0:0.0:1.0	.	33	P51793	CLCN4_HUMAN	N	33	ENSP00000370213:I33N;ENSP00000370209:I33N;ENSP00000403064:I33N	ENSP00000370209:I33N	I	+	2	0	CLCN4	10113170	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	7.837000	0.86796	1.788000	0.52465	0.481000	0.45027	ATC		0.527	CLCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055730.1			Missense_Mutation
CPAMD8	27151	hgsc.bcm.edu	37	19	17039883	17039884	+	Frame_Shift_Ins	INS	-	-	C			TCGA-13-1408-01	TCGA-13-1408-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:17039883_17039884insC	ENST00000443236.1	-	24	3184_3185	c.3153_3154insG	c.(3151-3156)gggcatfs	p.H1052fs		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1005						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.H1052fs*30(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GTGTTCTGATGCCCCCCCAGGA	0.584																																																1	Insertion - Frameshift(1)	ovary(1)	19																																								16900884	SO:0001589	frameshift_variant	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3154dupG	19.37:g.17039890_17039890dupC	ENSP00000402505:p.His1052fs		16900883	Q8NC09|Q9ULD7	Frame_Shift_Ins	INS	ENST00000443236.1	37	CCDS42519.1	INS	46	Baylor																																																																																				0.584	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692		Frame_Shift_Ins
CSTB	1476	hgsc.bcm.edu	37	21	45194592	45194592	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr21:45194592T>C	ENST00000291568.5	-	2	290	c.115A>G	c.(115-117)Aag>Gag	p.K39E		NM_000100.3	NP_000091.1	P04080	CYTB_HUMAN	cystatin B (stefin B)	39					adult locomotory behavior (GO:0008344)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			lung(1)|prostate(1)	2				STAD - Stomach adenocarcinoma(101;0.168)		GACACGGCCTTAAACACAGGG	0.537																																					Esophageal Squamous(58;831 1093 17019 29789 35147)											0			21											159.0	154.0	155.0					21																	45194592		2203	4300	6503	44019020	SO:0001583	missense	1476			L03558	CCDS13701.1	21q22.3	2014-09-17			ENSG00000160213	ENSG00000160213			2482	protein-coding gene	gene with protein product		601145		EPM1, STFB		8596935	Standard	NM_000100		Approved	CST6, PME	uc002zdr.4	P04080	OTTHUMG00000086886	ENST00000291568.5:c.115A>G	21.37:g.45194592T>C	ENSP00000291568:p.Lys39Glu		44019020		Missense_Mutation	SNP	ENST00000291568.5	37	CCDS13701.1	SNP	61	Baylor	.	.	.	.	.	.	.	.	.	.	T	0.140	-1.102773	0.01828	.	.	ENSG00000160213	ENST00000291568	T	0.24723	1.84	5.61	0.498	0.16908	Proteinase inhibitor I25, cystatin (2);	0.217820	0.45361	D	0.000367	T	0.08313	0.0207	.	.	.	0.20403	N	0.999904	B	0.09022	0.002	B	0.26416	0.069	T	0.35748	-0.9776	9	0.02654	T	1	-13.2751	3.532	0.07779	0.1577:0.2598:0.0:0.5825	.	39	P04080	CYTB_HUMAN	E	39	ENSP00000291568:K39E	ENSP00000291568:K39E	K	-	1	0	CSTB	44019020	0.996000	0.38824	0.109000	0.21407	0.008000	0.06430	1.280000	0.33202	0.057000	0.16193	-0.411000	0.06167	AAG		0.537	CSTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195689.1	NM_000100		Missense_Mutation
DAG1	1605	hgsc.bcm.edu	37	3	49569502	49569502	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr3:49569502T>C	ENST00000539901.1	+	3	2116	c.1558T>C	c.(1558-1560)Tca>Cca	p.S520P	DAG1_ENST00000538711.1_Missense_Mutation_p.S520P|DAG1_ENST00000545947.1_Missense_Mutation_p.S520P|DAG1_ENST00000515359.2_Missense_Mutation_p.S520P|DAG1_ENST00000541308.1_Missense_Mutation_p.S520P|DAG1_ENST00000308775.2_Missense_Mutation_p.S520P	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	520					basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GAAGATCCCGTCAGACACTTT	0.567																																																0			3											76.0	65.0	69.0					3																	49569502		2203	4300	6503	49544506	SO:0001583	missense	1605			L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.1558T>C	3.37:g.49569502T>C	ENSP00000439334:p.Ser520Pro		49544506	A8K6M7|Q969J9	Missense_Mutation	SNP	ENST00000539901.1	37	CCDS2799.1	SNP	58	Baylor	.	.	.	.	.	.	.	.	.	.	T	6.056	0.378681	0.11466	.	.	ENSG00000173402	ENST00000515359;ENST00000308775;ENST00000545947;ENST00000541308;ENST00000539901;ENST00000538711	D;D;D;D;D;D	0.98512	-4.97;-4.97;-4.97;-4.97;-4.97;-4.97	5.76	1.56	0.23342	Dystroglycan-type cadherin-like (1);Cadherin-like (1);Immunoglobulin-like fold (1);	0.355253	0.33591	N	0.004747	D	0.93884	0.8043	L	0.27053	0.805	0.23563	N	0.997407	B	0.02656	0.0	B	0.04013	0.001	D	0.85397	0.1129	9	.	.	.	-2.9327	8.4753	0.33009	0.0:0.3825:0.0:0.6175	.	520	Q14118	DAG1_HUMAN	P	520	ENSP00000440705:S520P;ENSP00000312435:S520P;ENSP00000442600:S520P;ENSP00000440590:S520P;ENSP00000439334:S520P;ENSP00000438421:S520P	.	S	+	1	0	DAG1	49544506	0.876000	0.30132	0.883000	0.34634	0.996000	0.88848	1.653000	0.37323	0.132000	0.18615	0.533000	0.62120	TCA		0.567	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1			Missense_Mutation
DGCR2	9993	hgsc.bcm.edu	37	22	19076948	19076948	+	Silent	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr22:19076948G>A	ENST00000263196.7	-	2	382	c.135C>T	c.(133-135)atC>atT	p.I45I	DGCR2_ENST00000537045.1_Intron|DGCR2_ENST00000545799.1_Silent_p.I45I	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	45	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					AGGGGAGGGGGATGCACTGGA	0.622																																																0			22											88.0	67.0	74.0					22																	19076948		2203	4300	6503	17456948	SO:0001819	synonymous_variant	9993			D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.135C>T	22.37:g.19076948G>A			17456948	A6NIB5|A8K6K5|B5TY34|B7Z935	Silent	SNP	ENST00000263196.7	37	CCDS33598.1	SNP	41	Baylor																																																																																				0.622	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316504.1	NM_005137		Silent
DLGAP3	58512	hgsc.bcm.edu	37	1	35370273	35370273	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr1:35370273G>A	ENST00000373347.1	-	3	980	c.712C>T	c.(712-714)Cac>Tac	p.H238Y	DLGAP3_ENST00000235180.4_Missense_Mutation_p.H238Y|DLGAP3_ENST00000495979.1_5'Flank			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	238					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)	p.H238Y(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CTCTTGCCGTGCCGGGACtgg	0.642																																																1	Substitution - Missense(1)	ovary(1)	1											105.0	90.0	95.0					1																	35370273		2203	4300	6503	35142860	SO:0001583	missense	58512			AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.712C>T	1.37:g.35370273G>A	ENSP00000362444:p.His238Tyr		35142860	Q5TDD5|Q9H3X7	Missense_Mutation	SNP	ENST00000373347.1	37	CCDS30670.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332844	0.41297	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	T;T	0.27720	1.65;1.65	4.72	4.72	0.59763	.	0.369798	0.30611	N	0.009253	T	0.37348	0.1000	L	0.46157	1.445	0.38912	D	0.957561	D	0.53885	0.963	P	0.50082	0.63	T	0.13202	-1.0518	10	0.21014	T	0.42	-9.9763	18.0504	0.89345	0.0:0.0:1.0:0.0	.	238	O95886	DLGP3_HUMAN	Y	238	ENSP00000362444:H238Y;ENSP00000235180:H238Y	ENSP00000235180:H238Y	H	-	1	0	DLGAP3	35142860	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	4.247000	0.58750	2.339000	0.79563	0.563000	0.77884	CAC		0.642	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234		Missense_Mutation
DNAI2	64446	hgsc.bcm.edu	37	17	72278098	72278098	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:72278098G>C	ENST00000311014.6	+	2	209	c.142G>C	c.(142-144)Gac>Cac	p.D48H	DNAI2_ENST00000446837.2_Missense_Mutation_p.D48H|DNAI2_ENST00000579490.1_Missense_Mutation_p.D105H|DNAI2_ENST00000307504.5_5'UTR|DNAI2_ENST00000582036.1_Missense_Mutation_p.D48H			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	48					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.D48H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GAACCCAGTGGACACGGGCAT	0.652									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	17											126.0	109.0	115.0					17																	72278098		2203	4300	6503	69789693	SO:0001583	missense	64446	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.142G>C	17.37:g.72278098G>C	ENSP00000308312:p.Asp48His		69789693	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	37	CCDS11697.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978769	0.34942	.	.	ENSG00000171595	ENST00000311014;ENST00000446837	T;T	0.13657	2.57;2.57	5.22	5.22	0.72569	.	0.100357	0.64402	D	0.000003	T	0.15825	0.0381	L	0.42581	1.335	0.80722	D	1	B	0.22211	0.066	B	0.24155	0.051	T	0.04090	-1.0978	10	0.30854	T	0.27	-69.5797	19.0368	0.92982	0.0:0.0:1.0:0.0	.	48	Q9GZS0	DNAI2_HUMAN	H	48	ENSP00000308312:D48H;ENSP00000400252:D48H	ENSP00000308312:D48H	D	+	1	0	DNAI2	69789693	1.000000	0.71417	1.000000	0.80357	0.614000	0.37383	5.517000	0.67061	2.731000	0.93534	0.644000	0.83932	GAC		0.652	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036		Missense_Mutation
DNAJC11	55735	hgsc.bcm.edu	37	1	6698382	6698386	+	Frame_Shift_Del	DEL	CAGCA	CAGCA	-	rs41278032		TCGA-13-1408-01	TCGA-13-1408-10	CAGCA	CAGCA	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr1:6698382_6698386delCAGCA	ENST00000377577.5	-	12	1415_1419	c.1292_1296delTGCTG	c.(1291-1296)gtgctgfs	p.VL431fs	DNAJC11_ENST00000542246.1_Frame_Shift_Del_p.VL393fs|DNAJC11_ENST00000349363.6_Intron|DNAJC11_ENST00000377573.5_Frame_Shift_Del_p.VL341fs|DNAJC11_ENST00000294401.7_Frame_Shift_Del_p.VL379fs|DNAJC11_ENST00000465508.1_5'UTR	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	431						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)		p.V431fs*22(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		GCTTCTTCTGCAGCACATCGGTGGC	0.62																																																1	Deletion - Frameshift(1)	ovary(1)	1																																								6620973	SO:0001589	frameshift_variant	55735			AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.1292_1296delTGCTG	1.37:g.6698382_6698386delCAGCA	ENSP00000366800:p.Val431fs		6620969	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Frame_Shift_Del	DEL	ENST00000377577.5	37	CCDS87.1	DEL	25	Baylor																																																																																				0.620	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004216.3	NM_018198		Frame_Shift_Del
EFEMP1	2202	hgsc.bcm.edu	37	2	56108754	56108754	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr2:56108754C>A	ENST00000394555.2	-	5	1068	c.633G>T	c.(631-633)caG>caT	p.Q211H	EFEMP1_ENST00000355426.3_Missense_Mutation_p.Q211H|EFEMP1_ENST00000424836.2_Missense_Mutation_p.Q153H|EFEMP1_ENST00000394554.1_Missense_Mutation_p.Q211H	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	211	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)	p.Q211H(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TACCTACGCACTGCTCCCCTC	0.493																																					GBM(92;934 1319 7714 28760 40110)											1	Substitution - Missense(1)	ovary(1)	2											228.0	165.0	186.0					2																	56108754		2203	4300	6503	55962258	SO:0001583	missense	2202			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.633G>T	2.37:g.56108754C>A	ENSP00000378058:p.Gln211His		55962258	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	ENST00000394555.2	37	CCDS1857.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.41	2.227643	0.39399	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000405693;ENST00000424836;ENST00000355426	D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99	5.91	4.12	0.48240	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000013	D	0.83069	0.5174	N	0.11756	0.17	0.31257	N	0.693363	B;B	0.28419	0.211;0.15	B;B	0.31101	0.024;0.124	T	0.78795	-0.2064	10	0.31617	T	0.26	.	9.5218	0.39140	0.0:0.727:0.0:0.273	.	153;211	B4DW75;Q12805	.;FBLN3_HUMAN	H	211;211;67;153;211	ENSP00000378058:Q211H;ENSP00000378057:Q211H;ENSP00000399145:Q153H;ENSP00000347596:Q211H	ENSP00000347596:Q211H	Q	-	3	2	EFEMP1	55962258	0.999000	0.42202	1.000000	0.80357	0.346000	0.29079	0.552000	0.23376	0.843000	0.35070	-0.140000	0.14226	CAG		0.493	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2			Missense_Mutation
EGFR	1956	hgsc.bcm.edu	37	7	55224456	55224456	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr7:55224456delT	ENST00000275493.2	+	10	1315	c.1138delT	c.(1138-1140)tccfs	p.S380fs	EGFR_ENST00000455089.1_Frame_Shift_Del_p.S335fs|EGFR_ENST00000344576.2_Frame_Shift_Del_p.S380fs|EGFR_ENST00000454757.2_Frame_Shift_Del_p.S327fs|EGFR_ENST00000342916.3_Frame_Shift_Del_p.S380fs|EGFR_ENST00000442591.1_Frame_Shift_Del_p.S380fs|EGFR_ENST00000420316.2_Frame_Shift_Del_p.S380fs	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	380					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.S380fs*16(2)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TTTCAGTGACTCCTTCACACA	0.373		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	2	Deletion - Frameshift(2)	ovary(2)	7											115.0	109.0	111.0					7																	55224456		2203	4300	6503	55191950	SO:0001589	frameshift_variant	1956	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.1138delT	7.37:g.55224456delT	ENSP00000275493:p.Ser380fs		55191950	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Frame_Shift_Del	DEL	ENST00000275493.2	37	CCDS5514.1	DEL	54	Baylor																																																																																				0.373	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		Frame_Shift_Del
EPHA7	2045	hgsc.bcm.edu	37	6	93967899	93967899	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr6:93967899C>A	ENST00000369303.4	-	11	2212	c.2028G>T	c.(2026-2028)agG>agT	p.R676S		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	676	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.R676S(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		AAAAGTCTCTCCTTTGTTTTT	0.428																																																1	Substitution - Missense(1)	ovary(1)	6											140.0	140.0	140.0					6																	93967899		2203	4300	6503	94024620	SO:0001583	missense	2045			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2028G>T	6.37:g.93967899C>A	ENSP00000358309:p.Arg676Ser		94024620	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.78	3.890825	0.72524	.	.	ENSG00000135333	ENST00000369303	D	0.82433	-1.61	6.08	2.93	0.34026	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80358	0.4608	L	0.37750	1.13	0.80722	D	1	D;D;D	0.62365	0.988;0.989;0.991	D;P;P	0.67382	0.951;0.827;0.892	T	0.82378	-0.0487	10	0.87932	D	0	.	10.5997	0.45360	0.0:0.7153:0.0:0.2847	.	672;671;676	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	S	676	ENSP00000358309:R676S	ENSP00000358309:R676S	R	-	3	2	EPHA7	94024620	0.992000	0.36948	1.000000	0.80357	0.991000	0.79684	0.402000	0.20965	0.899000	0.36444	0.591000	0.81541	AGG		0.428	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			Missense_Mutation
ERCC2	2068	hgsc.bcm.edu	37	19	45858958	45858958	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:45858958G>C	ENST00000391945.4	-	16	1585	c.1508C>G	c.(1507-1509)gCc>gGc	p.A503G	ERCC2_ENST00000391944.3_Missense_Mutation_p.A425G	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	503	Mediates interaction with MMS19.				7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.A503G(1)		large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GGAGCTGATGGCCACCTGGTC	0.577			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	1	Substitution - Missense(1)	ovary(1)	19											110.0	91.0	98.0					19																	45858958		2203	4300	6503	50550798	SO:0001583	missense	2068	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.1508C>G	19.37:g.45858958G>C	ENSP00000375809:p.Ala503Gly		50550798	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.4	4.141496	0.77775	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944	T;D	0.82984	-1.44;-1.67	5.68	5.68	0.88126	.	0.108147	0.64402	D	0.000007	D	0.84101	0.5398	M	0.88906	2.99	0.80722	D	1	B;B;P	0.41313	0.389;0.016;0.745	B;B;B	0.33454	0.147;0.104;0.164	D	0.86693	0.1924	10	0.54805	T	0.06	-26.8678	15.2892	0.73854	0.0:0.0:1.0:0.0	.	425;503;196	E7EVE9;P18074;Q6ZNQ5	.;ERCC2_HUMAN;.	G	453;479;503;425	ENSP00000375809:A503G;ENSP00000375808:A425G	ENSP00000375805:A453G	A	-	2	0	ERCC2	50550798	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.446000	0.90329	2.692000	0.91855	0.561000	0.74099	GCC		0.577	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400		Missense_Mutation
ERICH1	157697	hgsc.bcm.edu	37	8	642491	642491	+	Silent	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr8:642491C>T	ENST00000262109.7	-	3	368	c.291G>A	c.(289-291)ggG>ggA	p.G97G	ERICH1_ENST00000518277.1_5'UTR|ERICH1_ENST00000522706.1_Intron	NM_207332.1	NP_997215.1	Q86X53	ERIC1_HUMAN	glutamate-rich 1	97										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)	20		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)		CTGTGTCATCCCCGCTGGAGG	0.557																																																0			8											77.0	82.0	80.0					8																	642491		2203	4300	6503	632491	SO:0001819	synonymous_variant	157697				CCDS5955.1	8p23.3	2005-09-01			ENSG00000104714	ENSG00000104714			27234	protein-coding gene	gene with protein product							Standard	NM_207332		Approved		uc003wph.3	Q86X53	OTTHUMG00000129163	ENST00000262109.7:c.291G>A	8.37:g.642491C>T			632491	A8K2J9|Q9P063	Silent	SNP	ENST00000262109.7	37	CCDS5955.1	SNP	22	Baylor																																																																																				0.557	ERICH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251228.3	NM_207332		Silent
EVC2	132884	hgsc.bcm.edu	37	4	5624409	5624409	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr4:5624409C>A	ENST00000344408.5	-	14	2409	c.2356G>T	c.(2356-2358)Gca>Tca	p.A786S	EVC2_ENST00000344938.1_Missense_Mutation_p.A786S|EVC2_ENST00000310917.2_Missense_Mutation_p.A706S	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	786					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A786S(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						TCGGCCCGTGCAGCCATCTCC	0.657																																																1	Substitution - Missense(1)	ovary(1)	4											60.0	47.0	51.0					4																	5624409		2203	4300	6503	5675310	SO:0001583	missense	132884			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2356G>T	4.37:g.5624409C>A	ENSP00000342144:p.Ala786Ser		5675310	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.39	1.623393	0.28889	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.74947	-0.88;-0.88;-0.89	5.44	1.13	0.20643	.	0.684757	0.14477	N	0.317174	T	0.58250	0.2109	L	0.56769	1.78	0.09310	N	1	P	0.40197	0.706	B	0.33454	0.164	T	0.45877	-0.9231	10	0.21540	T	0.41	-6.6339	1.8796	0.03225	0.1343:0.3903:0.2571:0.2183	.	786	Q86UK5	LBN_HUMAN	S	786;706;786	ENSP00000339954:A786S;ENSP00000311683:A706S;ENSP00000342144:A786S	ENSP00000311683:A706S	A	-	1	0	EVC2	5675310	0.000000	0.05858	0.001000	0.08648	0.531000	0.34715	-0.084000	0.11268	0.635000	0.30488	0.462000	0.41574	GCA		0.657	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127		Missense_Mutation
EVC2	132884	hgsc.bcm.edu	37	4	5624411	5624411	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr4:5624411G>A	ENST00000344408.5	-	14	2407	c.2354C>T	c.(2353-2355)gCt>gTt	p.A785V	EVC2_ENST00000344938.1_Missense_Mutation_p.A785V|EVC2_ENST00000310917.2_Missense_Mutation_p.A705V	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	785					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A785V(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						GGCCCGTGCAGCCATCTCCTT	0.662																																																1	Substitution - Missense(1)	ovary(1)	4											60.0	48.0	52.0					4																	5624411		2203	4300	6503	5675312	SO:0001583	missense	132884			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2354C>T	4.37:g.5624411G>A	ENSP00000342144:p.Ala785Val		5675312	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.22	1.872261	0.33069	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.75938	-0.98;-0.98;-0.98	5.44	3.65	0.41850	.	0.360878	0.27896	N	0.017420	T	0.60741	0.2292	L	0.59436	1.845	0.23243	N	0.998052	P	0.42692	0.787	B	0.33121	0.158	T	0.51663	-0.8677	10	0.18276	T	0.48	-15.1878	7.1995	0.25873	0.14:0.0:0.7135:0.1465	.	785	Q86UK5	LBN_HUMAN	V	785;705;785	ENSP00000339954:A785V;ENSP00000311683:A705V;ENSP00000342144:A785V	ENSP00000311683:A705V	A	-	2	0	EVC2	5675312	0.955000	0.32602	0.240000	0.24138	0.596000	0.36781	2.949000	0.49074	1.249000	0.43950	0.462000	0.41574	GCT		0.662	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127		Missense_Mutation
F11R	50848	hgsc.bcm.edu	37	1	160970451	160970451	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr1:160970451C>A	ENST00000368026.6	-	4	632	c.358G>T	c.(358-360)Ggg>Tgg	p.G120W	F11R_ENST00000472573.1_5'UTR|F11R_ENST00000289779.3_3'UTR|F11R_ENST00000537746.1_Intron	NM_016946.4	NP_058642.1	Q9Y624	JAM1_HUMAN	F11 receptor	120	Ig-like V-type 1.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.G120W(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)	12	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)			TTGACCTCCCCATAGCTGTTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											215.0	149.0	171.0					1																	160970451		2203	4300	6503	159237075	SO:0001583	missense	50848			AF111713	CCDS1213.1	1q21.2-q21.3	2013-01-29	2003-02-07	2003-02-14	ENSG00000158769	ENSG00000158769		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14685	protein-coding gene	gene with protein product		605721	"""junctional adhesion molecule 1"""	JAM1		10395639, 7646439	Standard	NM_016946		Approved	PAM-1, JCAM, JAM-1, JAM-A, JAMA, CD321	uc009wtt.3	Q9Y624	OTTHUMG00000028602	ENST00000368026.6:c.358G>T	1.37:g.160970451C>A	ENSP00000357005:p.Gly120Trp		159237075	B7Z941	Missense_Mutation	SNP	ENST00000368026.6	37	CCDS1213.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.1	4.100783	0.76983	.	.	ENSG00000158769	ENST00000368026;ENST00000335772;ENST00000289779;ENST00000436182	T;T	0.71103	-0.54;-0.54	5.36	5.36	0.76844	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.119781	0.56097	D	0.000033	D	0.84129	0.5404	M	0.86651	2.83	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.86862	0.2030	10	0.87932	D	0	.	16.5755	0.84635	0.0:1.0:0.0:0.0	.	124;120;120;120	B7Z5W1;Q6FIB4;Q9Y624;D3DVF0	.;.;JAM1_HUMAN;.	W	120;120;120;124	ENSP00000357005:G120W;ENSP00000394809:G124W	ENSP00000289779:G120W	G	-	1	0	F11R	159237075	0.981000	0.34729	0.964000	0.40570	0.718000	0.41266	4.173000	0.58249	2.495000	0.84180	0.563000	0.77884	GGG		0.537	F11R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071458.3	NM_016946		Missense_Mutation
FAM65A	79567	hgsc.bcm.edu	37	16	67572948	67572948	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr16:67572948G>A	ENST00000379312.3	+	4	446	c.325G>A	c.(325-327)Gag>Aag	p.E109K	FAM65A_ENST00000566522.1_3'UTR|FAM65A_ENST00000422602.2_Missense_Mutation_p.E125K|CTD-2012K14.2_ENST00000567122.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.E105K|FAM65A_ENST00000540839.3_Missense_Mutation_p.E125K|FAM65A_ENST00000428437.2_Missense_Mutation_p.E119K	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	109						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		GCAGATAAGGGAGTCCAAGAG	0.587																																																0			16											76.0	72.0	73.0					16																	67572948		2198	4300	6498	66130449	SO:0001583	missense	79567			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.325G>A	16.37:g.67572948G>A	ENSP00000368614:p.Glu109Lys		66130449	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	SNP	41	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.500895|5.500895	0.96371|0.96371	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839|ENST00000428437	T;T;T|.	0.01981|.	4.52;4.52;4.52|.	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	0.099989|.	0.64402|.	D|.	0.000003|.	T|T	0.73544|0.73544	0.3600|0.3600	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	B;B;B;P|.	0.38597|.	0.349;0.349;0.349;0.639|.	B;B;B;B|.	0.27380|.	0.055;0.055;0.055;0.079|.	T|T	0.72014|0.72014	-0.4418|-0.4418	10|5	0.87932|.	D|.	0|.	-16.5999|-16.5999	18.7008|18.7008	0.91619|0.91619	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	119;125;109;125|.	B4DIM2;E9PBS3;Q6ZS17;B4DEQ9|.	.;.;FA65A_HUMAN;.|.	K|E	109;105;125;119|99	ENSP00000368614:E109K;ENSP00000042381:E105K;ENSP00000400099:E125K|.	ENSP00000042381:E105K|.	E|G	+|+	1|2	0|0	FAM65A|FAM65A	66130449|66130449	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.990000|0.990000	0.78478|0.78478	6.149000|6.149000	0.71795|0.71795	2.439000|2.439000	0.82584|0.82584	0.484000|0.484000	0.47621|0.47621	GAG|GGA		0.587	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519		Missense_Mutation
FBF1	85302	hgsc.bcm.edu	37	17	73922959	73922959	+	Splice_Site	SNP	C	C	G			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:73922959C>G	ENST00000586717.1	-	9	707		c.e9-1		FBF1_ENST00000389570.4_Splice_Site|FBF1_ENST00000319129.5_Splice_Site			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1						apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)		p.?(1)		large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						TCTTCCAAGTCTCACAGCAGA	0.522																																																1	Unknown(1)	ovary(1)	17											39.0	39.0	39.0					17																	73922959		1996	4159	6155	71434554	SO:0001630	splice_region_variant	85302			AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.434-1G>C	17.37:g.73922959C>G			71434554	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Splice_Site_SNP	SNP	ENST00000586717.1	37		SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.42	1.632327	0.29068	.	.	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5089	0.67772	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FBF1	71434554	0.901000	0.30685	0.943000	0.38184	0.121000	0.20230	2.063000	0.41423	2.485000	0.83878	0.655000	0.94253	.		0.522	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542	Intron	Splice_Site_SNP
FBXO6	26270	hgsc.bcm.edu	37	1	11733372	11733372	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr1:11733372T>A	ENST00000376753.4	+	5	683	c.548T>A	c.(547-549)cTc>cAc	p.L183H		NM_018438.5	NP_060908.1	Q9NRD1	FBX6_HUMAN	F-box protein 6	183	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.				DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|proteolysis (GO:0006508)|response to unfolded protein (GO:0006986)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|ubiquitin-protein transferase activity (GO:0004842)	p.L183H(1)		breast(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(2)	6	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.25e-06)|COAD - Colon adenocarcinoma(227;0.000251)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		ACCTACCAACTCAAAGTGCAG	0.627																																					NSCLC(54;506 1562 46490 51389)											1	Substitution - Missense(1)	ovary(1)	1											67.0	59.0	62.0					1																	11733372		2203	4300	6503	11655959	SO:0001583	missense	26270			AF129536	CCDS133.1	1p36.22	2008-05-14	2004-06-15		ENSG00000116663	ENSG00000116663		"""F-boxes /  ""other"""""	13585	protein-coding gene	gene with protein product		605647	"""F-box only protein 6"""			10531035, 10945468	Standard	NM_018438		Approved	FBX6, FBG2, FBS2, Fbx6b	uc001aso.3	Q9NRD1	OTTHUMG00000002229	ENST00000376753.4:c.548T>A	1.37:g.11733372T>A	ENSP00000365944:p.Leu183His		11655959	B1AK42|B2RC88|Q9UKT3	Missense_Mutation	SNP	ENST00000376753.4	37	CCDS133.1	SNP	54	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.29|14.29	2.492055|2.492055	0.44352|0.44352	.|.	.|.	ENSG00000116663|ENSG00000116663	ENST00000376753|ENST00000449067	T|.	0.46819|.	0.86|.	5.69|5.69	5.69|5.69	0.88448|0.88448	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);|.	0.330314|.	0.34507|.	N|.	0.003909|.	T|T	0.67183|0.67183	0.2866|0.2866	M|M	0.86805|0.86805	2.84|2.84	0.09310|0.09310	N|N	0.999994|0.999994	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.64347|0.64347	-0.6429|-0.6429	10|5	0.87932|.	D|.	0|.	.|.	13.3004|13.3004	0.60321|0.60321	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	183|.	Q9NRD1|.	FBX6_HUMAN|.	H|T	183|139	ENSP00000365944:L183H|.	ENSP00000365944:L183H|.	L|S	+|+	2|1	0|0	FBXO6|FBXO6	11655959|11655959	0.291000|0.291000	0.24352|0.24352	0.012000|0.012000	0.15200|0.15200	0.149000|0.149000	0.21700|0.21700	5.059000|5.059000	0.64306|0.64306	2.165000|2.165000	0.68154|0.68154	0.379000|0.379000	0.24179|0.24179	CTC|TCA		0.627	FBXO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006332.1	NM_018438		Missense_Mutation
ARHGEF38	54848	hgsc.bcm.edu	37	4	106510409	106510409	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr4:106510409G>C	ENST00000420470.2	+	2	345	c.201G>C	c.(199-201)aaG>aaC	p.K67N	ARHGEF38_ENST00000265154.2_Missense_Mutation_p.K67N	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	67			K -> N (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.			cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K67N(2)		breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						TAACAGAAAAGATGACTCCAC	0.418																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	4											75.0	74.0	74.0					4																	106510409		2203	4300	6503	106729858	SO:0001583	missense	54848			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.201G>C	4.37:g.106510409G>C	ENSP00000416125:p.Lys67Asn		106729858	C9JIB4	Missense_Mutation	SNP	ENST00000420470.2	37	CCDS56338.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.51	3.143436	0.57044	.	.	ENSG00000236699	ENST00000265154;ENST00000420470	T;T	0.58210	1.75;0.35	5.4	4.55	0.56014	.	0.053466	0.64402	D	0.000001	T	0.65533	0.2700	M	0.71581	2.175	0.42057	D	0.991144	D	0.89917	1.0	D	0.85130	0.997	T	0.63804	-0.6554	10	0.21014	T	0.42	-6.4157	7.8012	0.29176	0.248:0.0:0.752:0.0	.	67	Q9NXL2	ARH38_HUMAN	N	67	ENSP00000265154:K67N;ENSP00000416125:K67N	ENSP00000265154:K67N	K	+	3	2	ARHGEF38	106729858	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	2.981000	0.49329	1.228000	0.43614	0.655000	0.94253	AAG		0.418	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000336934.3	NM_017700		Missense_Mutation
FLRT2	23768	hgsc.bcm.edu	37	14	86088647	86088647	+	Silent	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr14:86088647G>A	ENST00000330753.4	+	2	1556	c.789G>A	c.(787-789)caG>caA	p.Q263Q	FLRT2_ENST00000554746.1_Silent_p.Q263Q	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	263					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		AGGACAACCAGATAAACCACA	0.483																																																0			14											125.0	123.0	123.0					14																	86088647		2203	4300	6503	85158400	SO:0001819	synonymous_variant	23768			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.789G>A	14.37:g.86088647G>A			85158400	A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	37	CCDS9877.1	SNP	33	Baylor																																																																																				0.483	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1			Silent
FRMD4A	55691	hgsc.bcm.edu	37	10	13701407	13701408	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-13-1408-01	TCGA-13-1408-10	CC	CC	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr10:13701407_13701408delCC	ENST00000357447.2	-	21	2349_2350	c.1981_1982delGG	c.(1981-1983)ggcfs	p.G661fs	FRMD4A_ENST00000378503.1_Frame_Shift_Del_p.G661fs|FRMD4A_ENST00000358621.4_Frame_Shift_Del_p.G646fs	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	661	Ser-rich.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)		p.G661fs*45(1)		breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						GTGCGGGAGGCCGCGGATGGGG	0.653																																																1	Deletion - Frameshift(1)	ovary(1)	10																																								13741414	SO:0001589	frameshift_variant	55691			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.1981_1982delGG	10.37:g.13701407_13701408delCC	ENSP00000350032:p.Gly661fs		13741413	A7E2Y3|Q5T377	Frame_Shift_Del	DEL	ENST00000357447.2	37	CCDS7101.1	DEL	26	Baylor																																																																																				0.653	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	NM_018027		Frame_Shift_Del
FXYD3	5349	hgsc.bcm.edu	37	19	35611997	35611997	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:35611997A>G	ENST00000344013.6	+	4	252	c.56A>G	c.(55-57)gAc>gGc	p.D19G	FXYD3_ENST00000604804.1_Missense_Mutation_p.D19G|FXYD3_ENST00000603181.1_Missense_Mutation_p.D19G|FXYD3_ENST00000603524.1_Missense_Mutation_p.D19G|FXYD3_ENST00000603449.1_Missense_Mutation_p.D19G|FXYD3_ENST00000605677.1_Missense_Mutation_p.D19G|FXYD3_ENST00000604621.1_Missense_Mutation_p.D19G|FXYD3_ENST00000605552.1_Missense_Mutation_p.D19G|FXYD3_ENST00000406242.3_Missense_Mutation_p.D19G|FXYD3_ENST00000604255.1_Missense_Mutation_p.D76G|FXYD3_ENST00000605550.1_Missense_Mutation_p.D19G|FXYD3_ENST00000454903.2_Missense_Mutation_p.D19G|FXYD3_ENST00000346446.5_Missense_Mutation_p.D19G|FXYD3_ENST00000535103.1_Missense_Mutation_p.D76G|FXYD3_ENST00000604404.1_Missense_Mutation_p.D19G|FXYD3_ENST00000435734.2_Missense_Mutation_p.D19G|FXYD3_ENST00000406988.1_Missense_Mutation_p.D19G			Q14802	FXYD3_HUMAN	FXYD domain containing ion transport regulator 3	19					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of catalytic activity (GO:0050790)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			endometrium(1)|lung(2)|prostate(1)	4	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CCTGTCCTGGACGCCAATGAC	0.612																																																0			19											119.0	108.0	112.0					19																	35611997		2203	4300	6503	40303837	SO:0001583	missense	5349			X93036	CCDS12442.1, CCDS12443.1, CCDS46048.1, CCDS46049.1, CCDS46050.1	19q13.11-q13.12	2008-05-14	2002-01-14			ENSG00000089356			4027	protein-coding gene	gene with protein product		604996	"""FXYD domain-containing ion transport regulator 3"""	PLML		7836447, 10950925	Standard	NM_005971		Approved	MAT-8	uc010xsm.2	Q14802		ENST00000344013.6:c.56A>G	19.37:g.35611997A>G	ENSP00000339499:p.Asp19Gly		40303837	A6NDE0|C9JDU2|F5H174|F8WB34|Q13211|Q6IB59	Missense_Mutation	SNP	ENST00000344013.6	37	CCDS12442.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.300	1.052771	0.19907	.	.	ENSG00000089356	ENST00000406242;ENST00000454903;ENST00000435734;ENST00000346446;ENST00000344013;ENST00000406988;ENST00000535103	T;T;T;T;T	0.65549	-0.16;-0.13;-0.1;-0.1;-0.14	4.87	2.59	0.31030	.	0.557664	0.16714	N	0.202539	T	0.59169	0.2174	L	0.38175	1.15	0.23859	N	0.996643	P;D;P;P;B	0.56035	0.872;0.974;0.872;0.573;0.267	P;P;B;B;B	0.53861	0.578;0.736;0.439;0.23;0.058	T	0.47058	-0.9146	10	0.30854	T	0.27	-0.3937	8.7391	0.34547	0.6239:0.3761:0.0:0.0	.	76;19;19;19;19	F5H174;F8WB34;C9JDU2;Q14802-2;Q14802	.;.;.;.;FXYD3_HUMAN	G	19;19;76;19;19;19;76	ENSP00000385412:D19G;ENSP00000328259:D19G;ENSP00000339499:D19G;ENSP00000385200:D19G;ENSP00000443953:D76G	ENSP00000339499:D19G	D	+	2	0	FXYD3	40303837	0.700000	0.27796	0.691000	0.30163	0.094000	0.18550	1.100000	0.31025	0.791000	0.33826	0.533000	0.62120	GAC		0.612	FXYD3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000468985.1	NM_021910		Missense_Mutation
GNL3	26354	hgsc.bcm.edu	37	3	52720784	52720784	+	Splice_Site	SNP	G	G	C			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr3:52720784G>C	ENST00000418458.1	+	2	186		c.e2-1		GNL3_ENST00000394799.2_Splice_Site|PBRM1_ENST00000394830.3_5'Flank|GNL3_ENST00000460073.1_Intron|SNORD19B_ENST00000516978.1_RNA|SNORD19_ENST00000391191.1_RNA	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)						cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		TTTCTTTGTAGAGTTAAAGAA	0.378																																																0			3											99.0	96.0	97.0					3																	52720784		2203	4300	6503	52695824	SO:0001630	splice_region_variant	26354			AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.14-1G>C	3.37:g.52720784G>C			52695824	B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Splice_Site_SNP	SNP	ENST00000418458.1	37	CCDS2861.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164432	0.78339	.	.	ENSG00000163938	ENST00000418458	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1903	0.86877	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GNL3	52695824	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	8.551000	0.90678	2.654000	0.90174	0.655000	0.94253	.		0.378	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352032.1	NM_014366	Intron	Splice_Site_SNP
GPATCH8	23131	hgsc.bcm.edu	37	17	42478484	42478484	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:42478484C>T	ENST00000591680.1	-	8	991	c.961G>A	c.(961-963)Gac>Aac	p.D321N	GPATCH8_ENST00000434000.1_Missense_Mutation_p.D243N	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	321							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.D321N(1)		breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		TCCGCATGGTCCTTGAAAACT	0.453											OREG0024461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	17											157.0	170.0	165.0					17																	42478484		2203	4300	6503	39834010	SO:0001583	missense	23131			AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.961G>A	17.37:g.42478484C>T	ENSP00000467556:p.Asp321Asn	909	39834010	B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	ENST00000591680.1	37	CCDS32666.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.24	3.339399	0.60963	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.16597	2.33	5.75	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.38532	0.1044	L	0.58101	1.795	0.53688	D	0.999978	D	0.89917	1.0	D	0.83275	0.996	T	0.09271	-1.0682	10	0.72032	D	0.01	-19.4029	15.579	0.76418	0.1384:0.8616:0.0:0.0	.	321	Q9UKJ3	GPTC8_HUMAN	N	321;243	ENSP00000395016:D243N	ENSP00000335486:D321N	D	-	1	0	GPATCH8	39834010	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.814000	0.69208	2.701000	0.92244	0.557000	0.71058	GAC		0.453	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909		Missense_Mutation
GPC6	10082	hgsc.bcm.edu	37	13	93879740	93879740	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr13:93879740C>T	ENST00000377047.4	+	1	646	c.31C>T	c.(31-33)Ccc>Tcc	p.P11S		NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	11					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				TGTGATTCTTCCCCTCTTGGG	0.637											OREG0022460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			13											116.0	117.0	117.0					13																	93879740		2203	4300	6503	92677741	SO:0001583	missense	10082			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.31C>T	13.37:g.93879740C>T	ENSP00000366246:p.Pro11Ser	1301	92677741	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	37	CCDS9469.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.62	2.292967	0.40594	.	.	ENSG00000183098	ENST00000377047	T	0.36520	1.25	5.49	4.46	0.54185	.	0.221388	0.31301	N	0.007890	T	0.12305	0.0299	N	0.02011	-0.69	0.23845	N	0.99668	B;B	0.06786	0.001;0.0	B;B	0.12837	0.008;0.0	T	0.26395	-1.0104	10	0.10636	T	0.68	.	8.1771	0.31289	0.0:0.6925:0.2114:0.0961	.	11;11	B4E2M1;Q9Y625	.;GPC6_HUMAN	S	11	ENSP00000366246:P11S	ENSP00000366246:P11S	P	+	1	0	GPC6	92677741	0.525000	0.26290	1.000000	0.80357	0.982000	0.71751	-0.088000	0.11198	2.591000	0.87537	0.561000	0.74099	CCC		0.637	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708		Missense_Mutation
GSG2	83903	hgsc.bcm.edu	37	17	3628064	3628065	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-13-1408-01	TCGA-13-1408-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:3628064_3628065insTG	ENST00000325418.4	+	1	854_855	c.835_836insTG	c.(835-837)aatfs	p.N279fs	CTD-3195I5.3_ENST00000571741.1_RNA|ITGAE_ENST00000571185.1_Intron|ITGAE_ENST00000263087.4_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	279					histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										GGTGGTGGGAAATGGACCAGAG	0.545																																																0			17																																								3574814	SO:0001589	frameshift_variant	83903			AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	Exception_encountered	17.37:g.3628064_3628065insTG	ENSP00000325290:p.Asn279fs		3574813	Q5U5K3|Q96MN1|Q9BXS7	Frame_Shift_Ins	INS	ENST00000325418.4	37	CCDS11036.1	INS	1	Baylor																																																																																				0.545	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965		Frame_Shift_Ins
HDAC6	10013	hgsc.bcm.edu	37	X	48673440	48673440	+	Silent	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chrX:48673440G>A	ENST00000334136.5	+	14	1309	c.1131G>A	c.(1129-1131)aaG>aaA	p.K377K	HDAC6_ENST00000444343.2_Silent_p.K391K|HDAC6_ENST00000376619.2_Silent_p.K377K			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	377	Histone deacetylase 1.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	CAGGAGGCAAGCTGATCCTGT	0.607																																					Pancreas(112;205 1675 2305 8976 15959)											0			X											28.0	24.0	26.0					X																	48673440		2198	4293	6491	48558384	SO:0001819	synonymous_variant	10013			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.1131G>A	X.37:g.48673440G>A			48558384	O94975|Q6NT75|Q7L3E5|Q96CY0	Silent	SNP	ENST00000334136.5	37	CCDS14306.1	SNP	34	Baylor																																																																																				0.607	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044		Silent
HDLBP	3069	hgsc.bcm.edu	37	2	242187686	242187686	+	Silent	SNP	G	G	T			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr2:242187686G>T	ENST00000391975.1	-	13	1817	c.1590C>A	c.(1588-1590)atC>atA	p.I530I	HDLBP_ENST00000391976.2_Silent_p.I530I|HDLBP_ENST00000310931.4_Silent_p.I530I|HDLBP_ENST00000476807.1_5'UTR|HDLBP_ENST00000427183.2_Silent_p.I497I|AC104841.1_ENST00000578965.1_RNA	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	530	KH 6. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		GAATTTCACGGATCCGTTCAC	0.378																																																0			2											149.0	145.0	146.0					2																	242187686		2203	4300	6503	241836359	SO:0001819	synonymous_variant	3069				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.1590C>A	2.37:g.242187686G>T			241836359	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Silent	SNP	ENST00000391975.1	37	CCDS2547.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.13	1.548925	0.27652	.	.	ENSG00000115677	ENST00000373292	.	.	.	6.17	2.32	0.28847	.	.	.	.	.	T	0.53351	0.1791	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40308	-0.9570	4	.	.	.	-23.1413	5.5528	0.17099	0.194:0.0:0.5627:0.2432	.	.	.	.	T	339	.	.	P	-	1	0	HDLBP	241836359	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.703000	0.37846	0.148000	0.19059	0.655000	0.94253	CCG		0.378	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346		Silent
HSPA12B	116835	hgsc.bcm.edu	37	20	3721464	3721464	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr20:3721464T>A	ENST00000254963.2	+	3	191	c.46T>A	c.(46-48)Tcc>Acc	p.S16T	HSPA12B_ENST00000542646.1_Intron	NM_001197327.1|NM_052970.4	NP_001184256.1|NP_443202.3	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	16							ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	14						CTCTGCAGGCTCCAGCCCGGA	0.652																																																0			20											38.0	36.0	37.0					20																	3721464		2203	4300	6503	3669464	SO:0001583	missense	116835			AK056712	CCDS13061.1	20p13	2011-09-02	2003-04-10	2003-04-10	ENSG00000132622	ENSG00000132622		"""Heat shock proteins / HSP70"""	16193	protein-coding gene	gene with protein product		610702	"""chromosome 20 open reading frame 60"""	C20orf60		12552099	Standard	NM_052970		Approved	dJ1009E24.2	uc002wjd.3	Q96MM6	OTTHUMG00000031755	ENST00000254963.2:c.46T>A	20.37:g.3721464T>A	ENSP00000254963:p.Ser16Thr		3669464	D3DVX7|Q2TAK3|Q9BR52	Missense_Mutation	SNP	ENST00000254963.2	37	CCDS13061.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.79	2.936728	0.52972	.	.	ENSG00000132622	ENST00000254963	T	0.03441	3.93	4.29	1.78	0.24846	.	.	.	.	.	T	0.01765	0.0056	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47623	-0.9103	9	0.10636	T	0.68	.	6.5236	0.22289	0.3887:0.0:0.0:0.6113	.	16;16	B7ZLP2;Q96MM6	.;HS12B_HUMAN	T	16	ENSP00000254963:S16T	ENSP00000254963:S16T	S	+	1	0	HSPA12B	3669464	0.990000	0.36364	0.950000	0.38849	0.805000	0.45488	0.854000	0.27791	0.773000	0.33404	0.528000	0.53228	TCC		0.652	HSPA12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077756.2	NM_052970		Missense_Mutation
HSPG2	3339	hgsc.bcm.edu	37	1	22163405	22163405	+	Silent	SNP	G	G	A	rs371778068	byFrequency	TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr1:22163405G>A	ENST00000374695.3	-	75	10324	c.10245C>T	c.(10243-10245)gcC>gcT	p.A3415A		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3415	Ig-like C2-type 20.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	ACTCAACGCTGGCCCCAATGC	0.667													G|||	3	0.000599042	0.0	0.0	5008	,	,		17195	0.003		0.0	False		,,,				2504	0.0															0			1											58.0	47.0	50.0					1																	22163405		2189	4288	6477	22035992	SO:0001819	synonymous_variant	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.10245C>T	1.37:g.22163405G>A			22035992	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	37	CCDS30625.1	SNP	47	Baylor																																																																																				0.667	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529		Silent
IFRD2	7866	hgsc.bcm.edu	37	3	50327841	50327841	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1408-01	TCGA-13-1408-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr3:50327841C>G	ENST00000429673.2	-	3	432	c.433G>C	c.(433-435)Gtg>Ctg	p.V145L	IFRD2_ENST00000484043.1_5'UTR|IFRD2_ENST00000436390.1_Missense_Mutation_p.V81L|IFRD2_ENST00000336089.4_Missense_Mutation_p.V247L|IFRD2_ENST00000417626.2_Missense_Mutation_p.V81L			Q12894	IFRD2_HUMAN	interferon-related developmental regulator 2	145						nucleus (GO:0005634)		p.V247L(1)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AGACAGTCCACATACTCCTTC	0.587																																																1	Substitution - Missense(1)	ovary(1)	3											94.0	99.0	97.0					3																	50327841		2088	4209	6297	50302845	SO:0001583	missense	7866			U09585		3p21.3	2008-07-18			ENSG00000214706	ENSG00000214706			5457	protein-coding gene	gene with protein product	"""interferon-related protein"""	602725				9050919	Standard	NM_006764		Approved	SKMc15, SM15, IFNRP	uc011bdp.2	Q12894	OTTHUMG00000156935	ENST00000429673.2:c.433G>C	3.37:g.50327841C>G	ENSP00000398971:p.Val145Leu		50302845	Q9BVB4|Q9UJ88	Missense_Mutation	SNP	ENST00000429673.2	37	CCDS46831.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917091	0.52546	.	.	ENSG00000214706	ENST00000417626;ENST00000436390;ENST00000336089;ENST00000429673	T;T;T;T	0.60040	0.22;0.22;0.22;0.22	5.2	4.2	0.49525	Interferon-related developmental regulator, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.053108	0.64402	D	0.000002	T	0.35970	0.0950	N	0.11560	0.145	0.41292	D	0.986984	P;P	0.39535	0.677;0.677	B;B	0.42882	0.284;0.401	T	0.14531	-1.0469	10	0.30078	T	0.28	-18.655	4.6923	0.12786	0.0:0.7358:0.0:0.2642	.	145;247	Q12894;Q9UJ88	IFRD2_HUMAN;.	L	81;81;247;145	ENSP00000402849:V81L;ENSP00000392316:V81L;ENSP00000336936:V247L;ENSP00000398971:V145L	ENSP00000336936:V247L	V	-	1	0	IFRD2	50302845	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.331000	0.59273	2.402000	0.81655	0.655000	0.94253	GTG		0.587	IFRD2-202	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006764		Missense_Mutation
IGHMBP2	3508	hgsc.bcm.edu	37	11	68676092	68676092	+	Silent	SNP	T	T	C			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr11:68676092T>C	ENST00000255078.3	+	4	651	c.540T>C	c.(538-540)agT>agC	p.S180S	IGHMBP2_ENST00000539224.1_Intron	NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	180					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GTCCTGCCAGTGAAATACGTA	0.443																																																0			11											66.0	65.0	66.0					11																	68676092		2200	4294	6494	68432668	SO:0001819	synonymous_variant	3508			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.540T>C	11.37:g.68676092T>C			68432668	A0PJD2|Q00443|Q14177	Silent	SNP	ENST00000255078.3	37	CCDS8187.1	SNP	59	Baylor																																																																																				0.443	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396862.1	NM_002180		Silent
ITIH4	3700	hgsc.bcm.edu	37	3	52853439	52853439	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr3:52853439C>T	ENST00000266041.4	-	17	2143	c.2047G>A	c.(2047-2049)Gct>Act	p.A683T	ITIH4_ENST00000467462.1_5'Flank|ITIH4_ENST00000406595.1_Missense_Mutation_p.A653T|RP5-966M1.6_ENST00000468472.1_3'UTR|ITIH4_ENST00000346281.5_Missense_Mutation_p.A653T|ITIH4_ENST00000434759.3_3'UTR|ITIH4_ENST00000485816.1_Missense_Mutation_p.A688T	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	683	Proline-rich (PRR) potential bioactive peptide.				acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		GGGTGGTAAGCAGCATGGTCA	0.617																																																0			3											104.0	108.0	107.0					3																	52853439		2203	4300	6503	52828479	SO:0001583	missense	3700			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.2047G>A	3.37:g.52853439C>T	ENSP00000266041:p.Ala683Thr		52828479	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Missense_Mutation	SNP	ENST00000266041.4	37	CCDS2865.1	SNP	25	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.093|3.093	-0.186445|-0.186445	0.06340|0.06340	.|.	.|.	ENSG00000055955|ENSG00000055955	ENST00000266041;ENST00000346281;ENST00000485816;ENST00000406595;ENST00000538421|ENST00000441637	T;T;T;T|.	0.01446|.	4.99;4.88;4.99;4.92|.	2.84|2.84	-1.59|-1.59	0.08453|0.08453	.|.	160.893000|.	0.00166|.	N|.	0.000001|.	T|T	0.18173|0.18173	0.0436|0.0436	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	0.999999|0.999999	B;B;B;B|.	0.32160|.	0.091;0.05;0.358;0.129|.	B;B;B;B|.	0.31946|.	0.015;0.008;0.07;0.138|.	T|T	0.23190|0.23190	-1.0195|-1.0195	10|5	0.14252|.	T|.	0.57|.	.|.	0.5679|0.5679	0.00690|0.00690	0.1621:0.2632:0.263:0.3117|0.1621:0.2632:0.263:0.3117	.|.	653;688;683;653|.	E9PGN5;B7ZKJ8;Q14624;Q14624-2|.	.;.;ITIH4_HUMAN;.|.	T|Y	683;653;688;653;641|510	ENSP00000266041:A683T;ENSP00000340520:A653T;ENSP00000417824:A688T;ENSP00000384425:A653T|.	ENSP00000266041:A683T|.	A|C	-|-	1|2	0|0	ITIH4|ITIH4	52828479|52828479	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-1.330000|-1.330000	0.02675|0.02675	-0.390000|-0.390000	0.07774|0.07774	0.313000|0.313000	0.20887|0.20887	GCT|TGC		0.617	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317715.1	NM_002218		Missense_Mutation
JAKMIP3	282973	hgsc.bcm.edu	37	10	133949538	133949539	+	Frame_Shift_Ins	INS	-	-	T			TCGA-13-1408-01	TCGA-13-1408-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr10:133949538_133949539insT	ENST00000298622.4	+	5	1212_1213	c.1074_1075insT	c.(1075-1077)gaafs	p.E359fs		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	359						Golgi apparatus (GO:0005794)		p.E359fs*1(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TACGCCGAATGGAAAACAAGTT	0.535																																																1	Insertion - Frameshift(1)	ovary(1)	10																																								133799529	SO:0001589	frameshift_variant	282973			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	Exception_encountered	10.37:g.133949538_133949539insT	ENSP00000298622:p.Glu359fs		133799528	A6PW00|Q69YM6|Q6ZT29	Frame_Shift_Ins	INS	ENST00000298622.4	37	CCDS44494.1	INS	47	Baylor																																																																																				0.535	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303		Frame_Shift_Ins
KIAA0226	9711	hgsc.bcm.edu	37	3	197408771	197408771	+	Splice_Site	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr3:197408771C>T	ENST00000296343.5	-	15	2126		c.e15-1		KIAA0226_ENST00000389665.5_Splice_Site|KIAA0226_ENST00000273582.5_Splice_Site	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226						autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)		p.?(2)		NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		AATTTTCCTCCTGAGGAAGGG	0.557																																					Esophageal Squamous(3;167 355 3763 15924)											2	Unknown(2)	ovary(2)	3											87.0	95.0	93.0					3																	197408771		2143	4256	6399	198893168	SO:0001630	splice_region_variant	9711			D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.2127-1G>A	3.37:g.197408771C>T			198893168	Q96CK5	Splice_Site_SNP	SNP	ENST00000296343.5	37	CCDS43195.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.1	4.094231	0.76870	.	.	ENSG00000145016	ENST00000273582;ENST00000413360;ENST00000296343;ENST00000415452;ENST00000389665	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.798	0.88579	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0226	198893168	1.000000	0.71417	0.997000	0.53966	0.670000	0.39368	7.472000	0.80996	2.709000	0.92574	0.655000	0.94253	.		0.557	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340184.1	XM_032901	Intron	Splice_Site_SNP
KRT26	353288	hgsc.bcm.edu	37	17	38926607	38926607	+	Silent	SNP	A	A	G			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:38926607A>G	ENST00000335552.4	-	3	627	c.579T>C	c.(577-579)ctT>ctC	p.L193L		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				ACACTCTGCGAAGACCACTGG	0.493																																																0			17											145.0	137.0	140.0					17																	38926607		2203	4300	6503	36180133	SO:0001819	synonymous_variant	353288			AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.579T>C	17.37:g.38926607A>G			36180133		Silent	SNP	ENST00000335552.4	37	CCDS11374.1	SNP	9	Baylor																																																																																				0.493	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257215.1	NM_181539		Silent
LARP4	113251	hgsc.bcm.edu	37	12	50869496	50869496	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr12:50869496A>G	ENST00000398473.2	+	16	2136	c.2024A>G	c.(2023-2025)gAt>gGt	p.D675G	LARP4_ENST00000429001.3_Missense_Mutation_p.D681G|LARP4_ENST00000518444.1_Missense_Mutation_p.D674G|LARP4_ENST00000293618.8_Missense_Mutation_p.D604G|LARP4_ENST00000347328.5_Missense_Mutation_p.D604G	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	675					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						GCTAGTAAGGATTATTCTGGC	0.502																																																0			12											85.0	86.0	86.0					12																	50869496		1870	4101	5971	49155763	SO:0001583	missense	113251			AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.2024A>G	12.37:g.50869496A>G	ENSP00000381490:p.Asp675Gly		49155763	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Missense_Mutation	SNP	ENST00000398473.2	37	CCDS41782.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	21.5	4.158190	0.78114	.	.	ENSG00000161813	ENST00000293618;ENST00000429001;ENST00000398473;ENST00000518444;ENST00000520064;ENST00000347328	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	5.44	5.44	0.79542	.	0.171052	0.51477	D	0.000085	T	0.61388	0.2343	L	0.59436	1.845	0.80722	D	1	D;D;D;P;P;P;D	0.60575	0.957;0.975;0.975;0.801;0.911;0.785;0.988	P;P;P;P;P;P;P	0.58577	0.841;0.794;0.841;0.521;0.598;0.505;0.794	T	0.64651	-0.6357	10	0.66056	D	0.02	.	15.7951	0.78404	1.0:0.0:0.0:0.0	.	556;85;674;604;604;675;681	Q71RC2-2;Q8WVX5;Q71RC2-3;G3XAA8;G5E976;Q71RC2;Q71RC2-4	.;.;.;.;.;LARP4_HUMAN;.	G	604;681;675;674;556;604	ENSP00000293618:D604G;ENSP00000415464:D681G;ENSP00000381490:D675G;ENSP00000429077:D674G;ENSP00000340901:D604G	ENSP00000293618:D604G	D	+	2	0	LARP4	49155763	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.281000	0.89905	2.202000	0.70862	0.523000	0.50628	GAT		0.502	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374981.1	NM_052879		Missense_Mutation
LILRB3	11025	hgsc.bcm.edu	37	19	54723012	54723015	+	Frame_Shift_Del	DEL	TTGC	TTGC	-			TCGA-13-1408-01	TCGA-13-1408-10	TTGC	TTGC	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:54723012_54723015delTTGC	ENST00000391750.1	-	9	1545_1548	c.1409_1412delGCAA	c.(1408-1413)agcaaafs	p.SK470fs	LILRB3_ENST00000407860.2_Frame_Shift_Del_p.SK487fs|LILRB3_ENST00000346401.6_Frame_Shift_Del_p.SK482fs|LILRB3_ENST00000469273.1_5'UTR|LILRA6_ENST00000391735.3_3'UTR|LILRA6_ENST00000270464.5_Frame_Shift_Del_p.SK470fs|LILRB3_ENST00000245620.9_Frame_Shift_Del_p.SK470fs|LILRA6_ENST00000440558.2_Frame_Shift_Del_p.SK470fs|LILRA6_ENST00000419410.2_Frame_Shift_Del_p.SK470fs|LILRB3_ENST00000424807.1_Frame_Shift_Del_p.SK470fs			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	470					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.S470fs*29(1)		endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGTCCTGTGTTTGCTGTGACGCTG	0.613																																																1	Deletion - Frameshift(1)	ovary(1)	19																																								59414827	SO:0001589	frameshift_variant	11025			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.1409_1412delGCAA	19.37:g.54723012_54723015delTTGC	ENSP00000375630:p.Ser470fs		59414824	C9J1P3|C9JIP1|O15471|Q86U49	Frame_Shift_Del	DEL	ENST00000391750.1	37	CCDS33105.1	DEL	64	Baylor																																																																																				0.613	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864		Frame_Shift_Del
LRP1	4035	hgsc.bcm.edu	37	12	57578193	57578193	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr12:57578193C>G	ENST00000243077.3	+	38	6610	c.6144C>G	c.(6142-6144)aaC>aaG	p.N2048K		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2048					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.N2048K(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TGCTGGTCAACGTCAGCATCA	0.597																																																1	Substitution - Missense(1)	ovary(1)	12											139.0	110.0	119.0					12																	57578193		2203	4300	6503	55864460	SO:0001583	missense	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.6144C>G	12.37:g.57578193C>G	ENSP00000243077:p.Asn2048Lys		55864460	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478418	0.63849	.	.	ENSG00000123384	ENST00000243077	D	0.95518	-3.73	5.3	-9.47	0.00594	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000001	D	0.91185	0.7223	L	0.28694	0.88	0.80722	D	1	P	0.48640	0.913	P	0.50537	0.643	D	0.91070	0.4892	10	0.39692	T	0.17	.	13.978	0.64285	0.0912:0.6501:0.0:0.2587	.	2048	Q07954	LRP1_HUMAN	K	2048	ENSP00000243077:N2048K	ENSP00000243077:N2048K	N	+	3	2	LRP1	55864460	0.000000	0.05858	0.327000	0.25402	0.601000	0.36947	-1.211000	0.02997	-1.931000	0.01055	-1.036000	0.02392	AAC		0.597	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		Missense_Mutation
NCR3	259197	hgsc.bcm.edu	37	6	31555095	31555095	+	IGR	SNP	G	G	C			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr6:31555095G>C	ENST00000340027.5	-	0	1042				LST1_ENST00000376096.1_Splice_Site_p.E7Q|LST1_ENST00000418507.2_Splice_Site_p.V7L|LST1_ENST00000376093.2_Splice_Site_p.D7H|NCR3_ENST00000491161.1_5'Flank|LST1_ENST00000376110.3_Splice_Site_p.V7L|LST1_ENST00000303757.8_Splice_Site_p.D7H|LST1_ENST00000376111.4_5'UTR|LST1_ENST00000376099.1_Splice_Site_p.G7R|LST1_ENST00000376089.2_Splice_Site_p.V7L|LST1_ENST00000376090.2_Splice_Site_p.G7R|LST1_ENST00000376100.3_Splice_Site_p.A7P|LST1_ENST00000396101.3_Splice_Site_p.D7H|LST1_ENST00000376092.3_Splice_Site_p.A7P|LST1_ENST00000438075.2_Splice_Site_p.D7H|LST1_ENST00000339530.4_Splice_Site_p.D7H|LST1_ENST00000376086.3_Splice_Site_p.V7L|LST1_ENST00000419073.1_3'UTR|LST1_ENST00000376102.3_Splice_Site_p.M1I|LST1_ENST00000211921.7_Splice_Site_p.G7R	NM_147130.2	NP_667341.1	O14931	NCTR3_HUMAN	natural cytotoxicity triggering receptor 3						cell recognition (GO:0008037)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	integral component of plasma membrane (GO:0005887)				cervix(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)	9						GCGGAATGATGGTAAGTAAAG	0.507																																																0			6											122.0	94.0	104.0					6																	31555095		2203	4300	6503	31663074	SO:0001628	intergenic_variant	7940			AB055881	CCDS34397.1, CCDS47401.1, CCDS47402.1	6p21.3	2013-01-11	2002-11-13	2002-11-15	ENSG00000204475	ENSG00000204475		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19077	protein-coding gene	gene with protein product		611550	"""lymphocyte antigen 117"""	LY117		8824804, 11782277	Standard	NM_001145466		Approved	1C7, NKp30, CD337	uc003nuv.2	O14931	OTTHUMG00000031123		6.37:g.31555095G>C			31663074	B0S8F2|B0S8F4|B0S8F5|O14930|O14932|O95667|O95668|O95669|Q5ST89|Q5ST90|Q5ST91|Q5ST92|Q5STA3	Missense_Mutation	SNP	ENST00000340027.5	37	CCDS34397.1	SNP	47	Baylor	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	G|G|G|G|G|G	9.091|9.091|9.091|9.091|9.091|9.091	1.001747|1.001747|1.001747|1.001747|1.001747|1.001747	0.19121|0.19121|0.19121|0.19121|0.19121|0.19121	.|.|.|.|.|.	.|.|.|.|.|.	ENSG00000204482|ENSG00000204482|ENSG00000204482|ENSG00000204482|ENSG00000204482|ENSG00000204482	ENST00000376100;ENST00000376092|ENST00000438075;ENST00000339530;ENST00000433492;ENST00000396117;ENST00000303757;ENST00000396112;ENST00000376093;ENST00000396101|ENST00000376096|ENST00000376099;ENST00000211921;ENST00000396107;ENST00000376090|ENST00000376102;ENST00000490742|ENST00000418507;ENST00000376110;ENST00000396114;ENST00000376089;ENST00000376086	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	2.32|2.32|2.32|2.32|2.32|2.32	1.4|1.4|1.4|1.4|1.4|1.4	0.22301|0.22301|0.22301|0.22301|0.22301|0.22301	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	.|.|.|.|.|.	T|T|T|T|T|T	0.12220|0.12220|0.12220|0.12220|0.12220|0.12220	0.0297|0.0297|0.0297|0.0297|0.0297|0.0297	N|N|N|N|N|N	0.14661|0.14661|0.14661|0.14661|0.14661|0.14661	0.345|0.345|0.345|0.345|0.345|0.345	0.23841|0.23841|0.23841|0.23841|0.23841|0.23841	N|N|N|N|N|N	0.996692|0.996692|0.996692|0.996692|0.996692|0.996692	.|D|.|.|.|P	.|0.58620|.|.|.|0.44734	.|0.983|.|.|.|0.842	.|B|.|.|.|P	.|0.38880|.|.|.|0.47981	.|0.284|.|.|.|0.563	T|T|T|T|T|T	0.06862|0.06862|0.06862|0.06862|0.06862|0.06862	-1.0803|-1.0803|-1.0803|-1.0803|-1.0803|-1.0803	6|8|6|6|6|8	0.87932|0.87932|0.87932|0.87932|0.07175|0.87932	D|D|D|D|T|D	0|0|0|0|0.84|0	3.8884|3.8884|3.8884|3.8884|3.8884|3.8884	5.3864|5.3864|5.3864|5.3864|5.3864|5.3864	0.16220|0.16220|0.16220|0.16220|0.16220|0.16220	0.1723:0.0:0.8277:0.0|0.1723:0.0:0.8277:0.0|0.1723:0.0:0.8277:0.0|0.1723:0.0:0.8277:0.0|0.1723:0.0:0.8277:0.0|0.1723:0.0:0.8277:0.0	.|.|.|.|.|.	.|7|.|.|.|7	.|E7EMY3|.|.|.|O00453-6	.|.|.|.|.|.	P|H|Q|R|I|L	7|7|7|7|1|7	.|.|.|.|.|.	ENSP00000365260:A7P|ENSP00000303649:D7H|ENSP00000365264:E7Q|ENSP00000211921:G7R|ENSP00000365270:M1I|ENSP00000365254:V7L	A|D|E|G|M|V	+|+|+|+|+|+	1|1|1|1|3|1	0|0|0|0|0|0	LST1|LST1|LST1|LST1|LST1|LST1	31663074|31663074|31663074|31663074|31663074|31663074	0.000000|0.000000|0.000000|0.000000|0.000000|0.000000	0.05858|0.05858|0.05858|0.05858|0.05858|0.05858	0.002000|0.002000|0.002000|0.002000|0.002000|0.002000	0.10522|0.10522|0.10522|0.10522|0.10522|0.10522	0.008000|0.008000|0.008000|0.008000|0.008000|0.008000	0.06430|0.06430|0.06430|0.06430|0.06430|0.06430	-0.600000|-0.600000|-0.600000|-0.600000|-0.600000|-0.600000	0.05693|0.05693|0.05693|0.05693|0.05693|0.05693	0.486000|0.486000|0.486000|0.486000|0.486000|0.486000	0.27676|0.27676|0.27676|0.27676|0.27676|0.27676	0.561000|0.561000|0.561000|0.561000|0.561000|0.561000	0.74099|0.74099|0.74099|0.74099|0.74099|0.74099	GCA|GAT|GAG|GGC|ATG|GTA		0.507	NCR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076210.2			Missense_Mutation
MAGEB17	645864	hgsc.bcm.edu	37	X	16189394	16189394	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chrX:16189394G>A	ENST00000400004.2	+	2	1241	c.889G>A	c.(889-891)Gtt>Att	p.V297I	MAGEB17_ENST00000400003.1_Missense_Mutation_p.V297I|MAGEB17_ENST00000329538.5_Missense_Mutation_p.V297I|RP11-431J24.2_ENST00000435789.1_RNA	NM_001277307.1	NP_001264236.1	A8MXT2	MAGBH_HUMAN	melanoma antigen family B, 17	297	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.V297I(1)									CAATGATACCGTTGCCAGTAC	0.592																																																1	Substitution - Missense(1)	ovary(1)	X																																								16099315	SO:0001583	missense	645864				CCDS59524.1	Xp22.2	2010-05-26	2005-11-07		ENSG00000182798	ENSG00000182798			17418	protein-coding gene	gene with protein product		300763	"""melanoma antigen family B, 17 (pseudogene)"""			11454705	Standard	NM_001277307		Approved		uc031tgu.1	A8MXT2	OTTHUMG00000021188	ENST00000400004.2:c.889G>A	X.37:g.16189394G>A	ENSP00000382884:p.Val297Ile		16099315	A6NE98	Missense_Mutation	SNP	ENST00000400004.2	37	CCDS59524.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.370	0.835136	0.16820	.	.	ENSG00000182798	ENST00000400004;ENST00000400003;ENST00000329538	T;T;T	0.01560	4.77;4.77;4.77	2.66	0.785	0.18584	.	0.826437	0.10290	N	0.692436	T	0.01870	0.0059	L	0.39692	1.235	0.09310	N	1	.	.	.	.	.	.	T	0.48658	-0.9016	8	0.22706	T	0.39	.	3.2328	0.06754	0.1734:0.2779:0.5487:0.0	.	.	.	.	I	297	ENSP00000382884:V297I;ENSP00000382883:V297I;ENSP00000328274:V297I	ENSP00000328274:V297I	V	+	1	0	MAGEB17	16099315	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.079000	0.11357	0.086000	0.17137	0.513000	0.50165	GTT		0.592	MAGEB17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251018.2	XM_066701		Missense_Mutation
MAGI2	9863	hgsc.bcm.edu	37	7	77764399	77764399	+	Missense_Mutation	SNP	G	G	C	rs151185251		TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr7:77764399G>C	ENST00000354212.4	-	17	3223	c.2970C>G	c.(2968-2970)gaC>gaG	p.D990E	MAGI2_ENST00000522391.1_Missense_Mutation_p.D990E|MAGI2_ENST00000419488.1_Missense_Mutation_p.D976E	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	990	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GCTTCACGATGTCAGCGTGAG	0.532																																																0			7											270.0	200.0	223.0					7																	77764399		2203	4300	6503	77602335	SO:0001583	missense	9863			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2970C>G	7.37:g.77764399G>C	ENSP00000346151:p.Asp990Glu		77602335	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091174	0.76756	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.26223	1.75;1.75;1.75	6.06	5.17	0.71159	PDZ/DHR/GLGF (4);	0.000000	0.37857	U	0.001902	T	0.30727	0.0774	N	0.16602	0.42	0.80722	D	1	D;P;D	0.63046	0.992;0.875;0.992	D;P;D	0.76575	0.988;0.785;0.988	T	0.03818	-1.1001	10	0.56958	D	0.05	.	8.2156	0.31509	0.2316:0.0:0.7684:0.0	.	990;976;990	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	E	976;990;990;990	ENSP00000405766:D976E;ENSP00000346151:D990E;ENSP00000428389:D990E	ENSP00000346151:D990E	D	-	3	2	MAGI2	77602335	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.839000	0.48207	2.882000	0.98803	0.655000	0.94253	GAC		0.532	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301		Missense_Mutation
MAP1A	4130	hgsc.bcm.edu	37	15	43821647	43821647	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr15:43821647A>C	ENST00000300231.5	+	4	8426	c.7976A>C	c.(7975-7977)gAa>gCa	p.E2659A	MAP1A_ENST00000382031.1_Missense_Mutation_p.E2897A|MAP1A_ENST00000399453.1_Missense_Mutation_p.E2659A			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2659					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CCAGCAGAGGAAAAGGATGGA	0.572																																																0			15											42.0	51.0	48.0					15																	43821647		2085	4202	6287	41608939	SO:0001583	missense	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.7976A>C	15.37:g.43821647A>C	ENSP00000300231:p.Glu2659Ala		41608939	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	CCDS42031.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.53	2.561679	0.45590	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01572	4.76;4.76;4.76	5.14	5.14	0.70334	.	.	.	.	.	T	0.02267	0.0070	N	0.03608	-0.345	0.44611	D	0.997587	D	0.55385	0.971	P	0.55749	0.783	T	0.72147	-0.4378	9	0.52906	T	0.07	-8.6959	13.6709	0.62424	1.0:0.0:0.0:0.0	.	2659	P78559	MAP1A_HUMAN	A	2897;2659;2659	ENSP00000371462:E2897A;ENSP00000382380:E2659A;ENSP00000300231:E2659A	ENSP00000300231:E2659A	E	+	2	0	MAP1A	41608939	0.999000	0.42202	1.000000	0.80357	0.952000	0.60782	3.796000	0.55507	2.148000	0.66965	0.379000	0.24179	GAA		0.572	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373		Missense_Mutation
MAST1	22983	hgsc.bcm.edu	37	19	12962779	12962779	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:12962779C>A	ENST00000251472.4	+	8	845	c.806C>A	c.(805-807)gCc>gAc	p.A269D	MAST1_ENST00000591495.1_Missense_Mutation_p.A265D	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1									p.A269D(1)		NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						TTGGAGGTGGCCTTCGTTACT	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											103.0	86.0	92.0					19																	12962779		2203	4300	6503	12823779	SO:0001583	missense	22983			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.806C>A	19.37:g.12962779C>A	ENSP00000251472:p.Ala269Asp		12823779		Missense_Mutation	SNP	ENST00000251472.4	37	CCDS32921.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267344	0.80469	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.30714	1.52	5.06	5.06	0.68205	Microtubule-associated serine/threonine-protein kinase, domain (1);Microtubule-associated serine/threonine-protein kinase, pre-PK domain (2);	0.135532	0.49305	D	0.000156	T	0.42268	0.1195	M	0.71581	2.175	0.38673	D	0.952354	P;B	0.35575	0.51;0.061	B;B	0.41946	0.371;0.139	T	0.50013	-0.8877	10	0.62326	D	0.03	-14.404	16.2983	0.82786	0.0:1.0:0.0:0.0	.	269;269	Q9Y2H9;F5H2S9	MAST1_HUMAN;.	D	269	ENSP00000251472:A269D	ENSP00000251472:A269D	A	+	2	0	MAST1	12823779	0.000000	0.05858	1.000000	0.80357	0.917000	0.54804	0.690000	0.25451	2.529000	0.85273	0.305000	0.20034	GCC		0.622	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975		Missense_Mutation
MED4	29079	hgsc.bcm.edu	37	13	48664501	48664501	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr13:48664501C>G	ENST00000258648.2	-	2	204	c.179G>C	c.(178-180)gGa>gCa	p.G60A	MED4_ENST00000378586.1_Missense_Mutation_p.G14A	NM_014166.3	NP_054885.1	Q9NPJ6	MED4_HUMAN	mediator complex subunit 4	60					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.G60V(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)	8		all_cancers(8;2.93e-25)|all_epithelial(8;4.38e-13)|all_lung(13;7.37e-06)|all_hematologic(8;8.61e-05)|Breast(56;0.000141)|Lung NSC(96;0.000518)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.00559)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;5.18e-07)		GTTTTCCTCTCCAGCCTGTAA	0.303																																					Pancreas(38;399 1016 9170 13426 20145)											1	Substitution - Missense(1)	ovary(1)	13											123.0	142.0	135.0					13																	48664501		2203	4300	6503	47562502	SO:0001583	missense	29079			AF161475	CCDS9408.1, CCDS59241.1	13q14.12	2008-02-05	2007-07-30	2004-11-09	ENSG00000136146	ENSG00000136146			17903	protein-coding gene	gene with protein product		605718	"""vitamin D receptor interacting protein"", ""mediator of RNA polymerase II transcription, subunit 4 homolog (S. cerevisiae)"""	VDRIP		10235266, 11042152	Standard	NM_014166		Approved	HSPC126, DRIP36, TRAP36	uc001vby.2	Q9NPJ6	OTTHUMG00000016891	ENST00000258648.2:c.179G>C	13.37:g.48664501C>G	ENSP00000258648:p.Gly60Ala		47562502	B4DX67|Q53GB4|Q53H68|Q5T912|Q6FHC4|Q6IA79|Q9BS95|Q9NYR5	Missense_Mutation	SNP	ENST00000258648.2	37	CCDS9408.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.994	1.231673	0.22626	.	.	ENSG00000136146	ENST00000258648;ENST00000378594;ENST00000378586;ENST00000417167	.	.	.	6.17	2.3	0.28687	.	0.148370	0.64402	D	0.000008	T	0.32436	0.0829	L	0.39898	1.24	0.48632	D	0.999685	B;B	0.30741	0.293;0.005	B;B	0.25140	0.058;0.015	T	0.10660	-1.0620	9	0.06625	T	0.88	-10.8346	6.3636	0.21443	0.1267:0.6565:0.0:0.2168	.	38;60	E9PDW1;Q9NPJ6	.;MED4_HUMAN	A	60;38;14;38	.	ENSP00000258648:G60A	G	-	2	0	MED4	47562502	1.000000	0.71417	0.990000	0.47175	0.581000	0.36288	2.594000	0.46189	0.429000	0.26202	0.655000	0.94253	GGA		0.303	MED4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044863.1	NM_014166		Missense_Mutation
NTMT1	28989	hgsc.bcm.edu	37	9	132395065	132395065	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr9:132395065delA	ENST00000372486.1	+	2	432	c.83delA	c.(82-84)gacfs	p.D28fs	NTMT1_ENST00000372480.1_Frame_Shift_Del_p.D28fs|NTMT1_ENST00000459968.2_Frame_Shift_Del_p.D28fs|NTMT1_ENST00000372481.3_Frame_Shift_Del_p.D28fs|NTMT1_ENST00000486391.2_3'UTR|NTMT1_ENST00000482347.1_Intron|NTMT1_ENST00000372483.4_Frame_Shift_Del_p.D28fs			Q9BV86	NTM1A_HUMAN	N-terminal Xaa-Pro-Lys N-methyltransferase 1	28					chromosome segregation (GO:0007059)|N-terminal peptidyl-proline dimethylation (GO:0018016)|N-terminal peptidyl-serine dimethylation (GO:0035572)|N-terminal peptidyl-serine trimethylation (GO:0035573)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein methyltransferase activity (GO:0008276)	p.D28fs*26(1)									CCCACGGTGGACGGCATGCTT	0.552																																																1	Deletion - Frameshift(1)	ovary(1)	9											170.0	139.0	149.0					9																	132395065		2203	4300	6503	131434886	SO:0001589	frameshift_variant	28989			AF110776	CCDS35160.1, CCDS69682.1, CCDS75918.1	9q34.2	2012-11-05	2012-06-12	2012-06-12	ENSG00000148335	ENSG00000148335	2.1.1.n5		23373	protein-coding gene	gene with protein product		613560	"""chromosome 9 open reading frame 32"", ""methyltransferase like 11A"""	C9orf32, METTL11A		20481588	Standard	XM_005251939		Approved	AD-003, HOMT1A	uc004byd.1	Q9BV86	OTTHUMG00000020785	ENST00000372486.1:c.83delA	9.37:g.132395065delA	ENSP00000361564:p.Asp28fs		131434886	A8K4J2|A8K8G7|Q5SZB9|Q9UI28	Frame_Shift_Del	DEL	ENST00000372486.1	37	CCDS35160.1	DEL	10	Baylor																																																																																				0.552	NTMT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054589.1	NM_014064		Frame_Shift_Del
METTL12	751071	hgsc.bcm.edu	37	11	62434104	62434104	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr11:62434104G>A	ENST00000532971.1	+	3	561	c.304G>A	c.(304-306)Gat>Aat	p.D102N	SNORA57_ENST00000383870.1_RNA|C11orf48_ENST00000532208.1_Intron|METTL12_ENST00000398922.2_3'UTR|C11orf48_ENST00000431002.2_Intron|C11orf48_ENST00000524958.1_5'Flank|C11orf48_ENST00000525675.1_5'Flank|RP11-831H9.11_ENST00000528405.1_5'Flank|C11orf48_ENST00000354588.3_Intron	NM_001043229.1	NP_001036694.1	A8MUP2	MET12_HUMAN	methyltransferase like 12	102						mitochondrion (GO:0005739)	methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	6						ACACCCAGTGGATGTGCTGGG	0.607																																																0			11											54.0	60.0	58.0					11																	62434104		1955	4149	6104	62190680	SO:0001583	missense	751071			BC041359	CCDS41657.1	11q12.3	2013-09-30			ENSG00000214756	ENSG00000214756			33113	protein-coding gene	gene with protein product							Standard	NM_001043229		Approved	U99HG	uc001nuh.3	A8MUP2	OTTHUMG00000167545	ENST00000532971.1:c.304G>A	11.37:g.62434104G>A	ENSP00000431287:p.Asp102Asn		62190680	B7Z4C1	Missense_Mutation	SNP	ENST00000532971.1	37	CCDS41657.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744866	0.49151	.	.	ENSG00000214756	ENST00000532971	T	0.22336	1.96	4.87	3.96	0.45880	Methyltransferase type 11 (1);	0.660557	0.13156	U	0.409448	T	0.15089	0.0364	L	0.42245	1.32	0.26733	N	0.970551	B	0.16166	0.016	B	0.17433	0.018	T	0.21861	-1.0233	10	0.13470	T	0.59	-14.3888	5.6828	0.17786	0.0968:0.0:0.7075:0.1957	.	102	A8MUP2	MTL12_HUMAN	N	102	ENSP00000431287:D102N	ENSP00000431287:D102N	D	+	1	0	METTL12	62190680	0.274000	0.24191	0.993000	0.49108	0.969000	0.65631	0.621000	0.24418	2.700000	0.92200	0.655000	0.94253	GAT		0.607	METTL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394990.1	NM_001043229		Missense_Mutation
MKL1	57591	hgsc.bcm.edu	37	22	40825764	40825764	+	Silent	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr22:40825764C>T	ENST00000355630.3	-	7	737	c.147G>A	c.(145-147)tcG>tcA	p.S49S	MKL1_ENST00000396617.3_Silent_p.S49S|MKL1_ENST00000407029.1_Silent_p.S49S|MKL1_ENST00000402630.1_Silent_p.S49S|MKL1_ENST00000402042.1_Silent_p.S49S	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	49	Mediates interaction with SCAI and ACTB. {ECO:0000250}.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						ATGGCTCAGCCGAGGTCTCTG	0.592			T	RBM15	acute megakaryocytic leukemia																																		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	0			22											80.0	74.0	76.0					22																	40825764		2203	4300	6503	39155710	SO:0001819	synonymous_variant	57591			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.147G>A	22.37:g.40825764C>T			39155710	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Silent	SNP	ENST00000355630.3	37	CCDS14003.1	SNP	23	Baylor																																																																																				0.592	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831		Silent
MMP28	79148	hgsc.bcm.edu	37	17	34095328	34095329	+	IGR	INS	-	-	GC			TCGA-13-1408-01	TCGA-13-1408-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:34095328_34095329insGC								C17orf50 (3230 upstream) : MMP28 (10179 downstream)														p.D306fs*28(1)									GGCTGTAGGAGTCCCAGGTCTC	0.559																																																1	Insertion - Frameshift(1)	ovary(1)	17																																								31119442	SO:0001628	intergenic_variant	79148																															17.37:g.34095328_34095329insGC			31119441		Frame_Shift_Ins	INS		37		INS	36	Baylor																																																																																			0	0.559									Frame_Shift_Ins
MUM1	84939	hgsc.bcm.edu	37	19	1366312	1366312	+	Missense_Mutation	SNP	C	C	G	rs144294879		TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:1366312C>G	ENST00000415183.3	+	7	1322	c.1296C>G	c.(1294-1296)agC>agG	p.S432R	MUM1_ENST00000591806.1_Missense_Mutation_p.S432R|MUM1_ENST00000344663.3_Missense_Mutation_p.S432R|MUM1_ENST00000311401.5_Missense_Mutation_p.S363R			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	431	PWWP.				chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTCAAAAGCGTCAGGCAGA	0.383																																																0			19											109.0	92.0	98.0					19																	1366312		2203	4300	6503	1317312	SO:0001583	missense	84939			AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.1296C>G	19.37:g.1366312C>G	ENSP00000394925:p.Ser432Arg		1317312	A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Missense_Mutation	SNP	ENST00000415183.3	37		SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.11	1.840930	0.32513	.	.	ENSG00000160953	ENST00000344663;ENST00000311401;ENST00000415183	T;T;T	0.71341	-0.56;-0.56;-0.56	5.04	0.407	0.16371	PWWP (1);	0.173757	0.64402	N	0.000008	T	0.77294	0.4109	M	0.65975	2.015	0.30753	N	0.744923	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.982;0.987;0.963;0.994	T	0.73157	-0.4071	10	0.87932	D	0	.	5.952	0.19253	0.0:0.4342:0.0:0.5658	.	432;432;363;431	B7ZLY8;D6W5Y8;Q2TAK8-2;Q2TAK8	.;.;.;MUM1_HUMAN	R	432;363;432	ENSP00000345789:S432R;ENSP00000309135:S363R;ENSP00000394925:S432R	ENSP00000309135:S363R	S	+	3	2	MUM1	1317312	0.010000	0.17322	0.488000	0.27440	0.115000	0.19883	-2.072000	0.01377	0.218000	0.20820	-0.258000	0.10820	AGC		0.383	MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000449510.1	NM_032853		Missense_Mutation
MYBPC3	4607	hgsc.bcm.edu	37	11	47359110	47359110	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr11:47359110T>G	ENST00000545968.1	-	25	2488	c.2434A>C	c.(2434-2436)Aag>Cag	p.K812Q	MYBPC3_ENST00000399249.2_Missense_Mutation_p.K812Q|MYBPC3_ENST00000256993.4_Missense_Mutation_p.K811Q	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	812	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.K812Q(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		CTCTTCTTCTTCTTGCGCTCC	0.607																																																1	Substitution - Missense(1)	ovary(1)	11											84.0	89.0	87.0					11																	47359110		2138	4245	6383	47315686	SO:0001583	missense	4607			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.2434A>C	11.37:g.47359110T>G	ENSP00000442795:p.Lys812Gln		47315686	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	ENST00000545968.1	37	CCDS53621.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	27.8	4.864919	0.91511	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.56611	0.45;0.45;0.45	4.6	4.6	0.57074	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71467	0.3343	M	0.75615	2.305	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.76038	-0.3105	9	0.87932	D	0	.	14.1697	0.65500	0.0:0.0:0.0:1.0	.	811	Q14896	MYPC3_HUMAN	Q	812;812;811	ENSP00000442795:K812Q;ENSP00000382193:K812Q;ENSP00000256993:K811Q	ENSP00000256993:K811Q	K	-	1	0	MYBPC3	47315686	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.525000	0.81892	1.941000	0.56285	0.459000	0.35465	AAG		0.607	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3			Missense_Mutation
MYL1	4632	hgsc.bcm.edu	37	2	211158973	211158973	+	Silent	SNP	G	G	T	rs377511663		TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr2:211158973G>T	ENST00000352451.3	-	4	621	c.474C>A	c.(472-474)acC>acA	p.T158T	MYL1_ENST00000496436.1_5'UTR|MYL1_ENST00000341685.4_Silent_p.T114T	NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast	158	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)	p.T158T(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		CCTTACCCAGGGTGGCTAGAA	0.453																																																1	Substitution - coding silent(1)	ovary(1)	2						G	,	1,4405	2.1+/-5.4	0,1,2202	92.0	78.0	83.0		474,342	0.6	1.0	2		83	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	MYL1	NM_079420.2,NM_079422.2	,	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	,	158/195,114/151	211158973	1,13005	2203	4300	6503	210867218	SO:0001819	synonymous_variant	4632				CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992	ENST00000352451.3:c.474C>A	2.37:g.211158973G>T			210867218	B2R4N6|B2R4T6|P06741|Q6IBD5	Silent	SNP	ENST00000352451.3	37	CCDS2390.1	SNP	43	Baylor																																																																																				0.453	MYL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256566.2	NM_079420		Silent
MYO18B	84700	hgsc.bcm.edu	37	22	26164303	26164303	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1408-01	TCGA-13-1408-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr22:26164303G>C	ENST00000407587.2	+	4	589	c.420G>C	c.(418-420)aaG>aaC	p.K140N	MYO18B_ENST00000536101.1_Missense_Mutation_p.K140N|MYO18B_ENST00000335473.7_Missense_Mutation_p.K140N			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	140						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.K140N(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CAACCAAAAAGACTGTCCCCT	0.602																																																1	Substitution - Missense(1)	ovary(1)	22											35.0	41.0	39.0					22																	26164303		2033	4173	6206	24494303	SO:0001583	missense	84700			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.420G>C	22.37:g.26164303G>C	ENSP00000386096:p.Lys140Asn		24494303	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.84	1.757458	0.31137	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.89415	-2.49;-2.49;-2.51	4.49	-0.0952	0.13642	.	0.000000	0.36893	N	0.002348	D	0.87245	0.6129	L	0.60455	1.87	0.09310	N	1	P;P;P	0.51351	0.906;0.944;0.944	B;P;P	0.49999	0.425;0.628;0.628	T	0.80082	-0.1531	10	0.87932	D	0	.	7.2095	0.25925	0.3636:0.0:0.6364:0.0	.	140;140;140	Q8IUG5;F5GXR6;F5GYU7	MY18B_HUMAN;.;.	N	140	ENSP00000441229:K140N;ENSP00000334563:K140N;ENSP00000386096:K140N	ENSP00000334563:K140N	K	+	3	2	MYO18B	24494303	0.003000	0.15002	0.000000	0.03702	0.225000	0.24961	0.681000	0.25320	0.086000	0.17137	0.484000	0.47621	AAG		0.602	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		Missense_Mutation
NAV3	89795	hgsc.bcm.edu	37	12	78513199	78513199	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr12:78513199T>C	ENST00000397909.2	+	15	3396	c.3223T>C	c.(3223-3225)Tca>Cca	p.S1075P	NAV3_ENST00000536525.2_Missense_Mutation_p.S1075P|NAV3_ENST00000266692.7_Missense_Mutation_p.S1075P|NAV3_ENST00000228327.6_Missense_Mutation_p.S1075P			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1075	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.S1075P(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TGGAGTAGGGTCATCTGCCAT	0.498										HNSCC(70;0.22)																																						1	Substitution - Missense(1)	ovary(1)	12											65.0	67.0	66.0					12																	78513199		1948	4157	6105	77037330	SO:0001583	missense	89795			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3223T>C	12.37:g.78513199T>C	ENSP00000381007:p.Ser1075Pro		77037330	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		SNP	58	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.824|9.824	1.186455|1.186455	0.21870|0.21870	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692|ENST00000552895	T;T;T;T|.	0.32988|.	1.43;1.43;1.43;1.43|.	5.81|5.81	4.65|4.65	0.58169|0.58169	.|.	0.230357|.	0.21887|.	U|.	0.067648|.	T|T	0.58278|0.58278	0.2111|0.2111	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	B;D;B;B|.	0.71674|.	0.255;0.998;0.374;0.039|.	B;D;B;B|.	0.64877|.	0.302;0.93;0.247;0.093|.	T|T	0.53606|0.53606	-0.8415|-0.8415	10|5	0.62326|.	D|.	0.03|.	-6.1039|-6.1039	12.8736|12.8736	0.57978|0.57978	0.0:0.0:0.1408:0.8592|0.0:0.0:0.1408:0.8592	.|.	1075;1075;1075;1075|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	P|A	1075|146	ENSP00000446132:S1075P;ENSP00000381007:S1075P;ENSP00000228327:S1075P;ENSP00000266692:S1075P|.	ENSP00000228327:S1075P|.	S|V	+|+	1|2	0|0	NAV3|NAV3	77037330|77037330	0.999000|0.999000	0.42202|0.42202	0.102000|0.102000	0.21198|0.21198	0.323000|0.323000	0.28346|0.28346	3.925000|3.925000	0.56484|0.56484	0.998000|0.998000	0.38996|0.38996	0.533000|0.533000	0.62120|0.62120	TCA|GTC		0.498	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		Missense_Mutation
NBAS	51594	hgsc.bcm.edu	37	2	15613442	15613442	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr2:15613442C>G	ENST00000281513.5	-	16	1654	c.1629G>C	c.(1627-1629)ttG>ttC	p.L543F	NBAS_ENST00000441750.1_Missense_Mutation_p.L543F	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	543					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GAGCCAAGGACAAGGCTTCCT	0.428																																																0			2											122.0	110.0	114.0					2																	15613442		2203	4300	6503	15530893	SO:0001583	missense	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.1629G>C	2.37:g.15613442C>G	ENSP00000281513:p.Leu543Phe		15530893	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766626	0.69878	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.19806	2.12;2.26	5.81	5.81	0.92471	.	0.073902	0.56097	N	0.000034	T	0.48696	0.1514	M	0.69248	2.105	0.30774	N	0.742736	D	0.89917	1.0	D	0.85130	0.997	T	0.48833	-0.9000	10	0.87932	D	0	.	20.0826	0.97783	0.0:1.0:0.0:0.0	.	543	A2RRP1	NBAS_HUMAN	F	543	ENSP00000413201:L543F;ENSP00000281513:L543F	ENSP00000281513:L543F	L	-	3	2	NBAS	15530893	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.553000	0.45837	2.746000	0.94184	0.655000	0.94253	TTG		0.428	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		Missense_Mutation
NKTR	4820	hgsc.bcm.edu	37	3	42680647	42680647	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr3:42680647G>A	ENST00000232978.8	+	13	3639	c.3451G>A	c.(3451-3453)Gca>Aca	p.A1151T	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	1151					protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.A1151T(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		TCTAGGAAATGCACGGCTTGA	0.463																																																1	Substitution - Missense(1)	ovary(1)	3											87.0	87.0	87.0					3																	42680647		2203	4300	6503	42655651	SO:0001583	missense	4820				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.3451G>A	3.37:g.42680647G>A	ENSP00000232978:p.Ala1151Thr		42655651		Missense_Mutation	SNP	ENST00000232978.8	37	CCDS2702.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772636	0.31411	.	.	ENSG00000114857	ENST00000232978	T	0.81330	-1.48	5.05	-5.64	0.02466	.	1.176370	0.06238	N	0.689824	T	0.59155	0.2173	N	0.22421	0.69	0.09310	N	0.999998	P;B	0.42248	0.774;0.0	B;B	0.36608	0.229;0.0	T	0.54906	-0.8223	10	0.32370	T	0.25	1.1894	2.4707	0.04563	0.0991:0.3051:0.214:0.3819	.	851;1151	Q6M1B8;P30414	.;NKTR_HUMAN	T	1151	ENSP00000232978:A1151T	ENSP00000232978:A1151T	A	+	1	0	NKTR	42655651	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-0.113000	0.10774	-0.895000	0.03920	-0.474000	0.04947	GCA		0.463	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385		Missense_Mutation
NOM1	64434	hgsc.bcm.edu	37	7	156759098	156759098	+	Splice_Site	SNP	T	T	A			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr7:156759098T>A	ENST00000275820.3	+	8	2181		c.e8+2			NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1							nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.?(1)		endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		AGATTTCAGGTAGCTTAGTGC	0.468																																																1	Unknown(1)	ovary(1)	7											135.0	118.0	124.0					7																	156759098		2203	4300	6503	156451859	SO:0001630	splice_region_variant	64434			AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.2166+2T>A	7.37:g.156759098T>A			156451859	Q96I08	Splice_Site_SNP	SNP	ENST00000275820.3	37	CCDS34787.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.6	4.024788	0.75390	.	.	ENSG00000146909	ENST00000275820	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5316	0.67929	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	NOM1	156451859	1.000000	0.71417	0.993000	0.49108	0.935000	0.57460	7.590000	0.82653	1.830000	0.53286	0.533000	0.62120	.		0.468	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	Intron	Splice_Site_SNP
NOTCH2	4853	hgsc.bcm.edu	37	1	120457989	120457989	+	Silent	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr1:120457989C>T	ENST00000256646.2	-	34	7575	c.7356G>A	c.(7354-7356)caG>caA	p.Q2452Q		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2452					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAGGTCCCCGCTGACCTCCTC	0.552			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																														Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0			1											103.0	101.0	101.0					1																	120457989		2203	4300	6503	120259512	SO:0001819	synonymous_variant	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.7356G>A	1.37:g.120457989C>T			120259512	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1	SNP	28	Baylor																																																																																				0.552	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408		Silent
OSBPL2	9885	hgsc.bcm.edu	37	20	60856178	60856178	+	Silent	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr20:60856178C>T	ENST00000313733.3	+	8	941	c.739C>T	c.(739-741)Ctg>Ttg	p.L247L	OSBPL2_ENST00000439951.2_Silent_p.L155L|OSBPL2_ENST00000358053.2_Silent_p.L235L	NM_144498.1	NP_653081.1	Q9H1P3	OSBL2_HUMAN	oxysterol binding protein-like 2	247					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			CATCGGGAAGCTGTGGATAGA	0.562																																																0			20											139.0	129.0	132.0					20																	60856178		2203	4300	6503	60289573	SO:0001819	synonymous_variant	9885			AB018315	CCDS13494.1, CCDS13495.1, CCDS63323.1	20q13.3	2008-08-01	2001-11-28		ENSG00000130703	ENSG00000130703		"""Oxysterol binding proteins"""	15761	protein-coding gene	gene with protein product		606731	"""oxysterol-binding protein-like 2"""			10588946, 11861666	Standard	NM_144498		Approved	KIAA0772, ORP-2	uc002yck.1	Q9H1P3	OTTHUMG00000032909	ENST00000313733.3:c.739C>T	20.37:g.60856178C>T			60289573	A8K736|Q6IBT0|Q9BZB1|Q9Y4B8	Silent	SNP	ENST00000313733.3	37	CCDS13495.1	SNP	28	Baylor																																																																																				0.562	OSBPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080021.1	NM_014835		Silent
AKAP2	11217	hgsc.bcm.edu	37	9	112899745	112899745	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr9:112899745G>A	ENST00000259318.7	+	2	1435	c.1228G>A	c.(1228-1230)Gcc>Acc	p.A410T	AKAP2_ENST00000434623.2_Missense_Mutation_p.A499T|AKAP2_ENST00000374525.1_Missense_Mutation_p.A499T|AKAP2_ENST00000555236.1_Missense_Mutation_p.A641T|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.A641T|AKAP2_ENST00000510514.5_Missense_Mutation_p.A641T|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.A641T	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	410								p.A499T(1)|p.A641T(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						GGGCAACACAGCCTCTCAGGG	0.622																																																2	Substitution - Missense(2)	ovary(2)	9											60.0	65.0	64.0					9																	112899745		2203	4300	6503	111939566	SO:0001583	missense	445815			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.1228G>A	9.37:g.112899745G>A	ENSP00000259318:p.Ala410Thr		111939566	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000259318.7	37	CCDS48003.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.86	1.470203	0.26423	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.47869	2.17;2.17;2.17;2.17;1.41;0.83;0.84;1.43	5.97	3.17	0.36434	.	0.597033	0.17590	N	0.168803	T	0.25232	0.0613	N	0.08118	0	0.09310	N	0.999999	B;B;B;B;B;B;B;B	0.13145	0.002;0.004;0.007;0.004;0.002;0.006;0.003;0.002	B;B;B;B;B;B;B;B	0.13407	0.003;0.009;0.007;0.009;0.004;0.007;0.007;0.001	T	0.16335	-1.0406	10	0.20519	T	0.43	-11.578	10.0542	0.42235	0.214:0.0:0.786:0.0	.	410;499;493;499;500;641;641;459	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	T	641;641;641;641;499;499;459;410	ENSP00000363654:A641T;ENSP00000305861:A641T;ENSP00000451476:A641T;ENSP00000421522:A641T;ENSP00000404782:A499T;ENSP00000363649:A499T;ENSP00000419268:A459T;ENSP00000259318:A410T	ENSP00000259318:A410T	A	+	1	0	PALM2-AKAP2;AKAP2	111939566	0.000000	0.05858	0.259000	0.24435	0.884000	0.51177	0.359000	0.20233	0.873000	0.35799	0.655000	0.94253	GCC		0.622	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065		Missense_Mutation
PCDHB15	56121	hgsc.bcm.edu	37	5	140625295	140625297	+	In_Frame_Del	DEL	ATG	ATG	-			TCGA-13-1408-01	TCGA-13-1408-10	ATG	ATG	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr5:140625295_140625297delATG	ENST00000231173.3	+	1	149_151	c.149_151delATG	c.(148-153)aatgac>aac	p.D51del		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	51	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.D51delD(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACCTGGCCAATGACCTAGGGCT	0.562																																																1	Deletion - In frame(1)	ovary(1)	5																																								140605481	SO:0001651	inframe_deletion	56121			AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.149_151delATG	5.37:g.140625295_140625297delATG	ENSP00000231173:p.Asp51del		140605479	Q8IUX5	In_Frame_Del	DEL	ENST00000231173.3	37	CCDS4257.1	DEL	4	Baylor																																																																																				0.562	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935		In_Frame_Del
PCNXL3	399909	hgsc.bcm.edu	37	11	65391960	65391960	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr11:65391960C>A	ENST00000355703.3	+	15	3274	c.2735C>A	c.(2734-2736)cCc>cAc	p.P912H		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	912						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CTGTGCTTCCCCTTCGTCTTC	0.632																																																0			11											46.0	57.0	53.0					11																	65391960		2041	4179	6220	65148536	SO:0001583	missense	399909			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.2735C>A	11.37:g.65391960C>A	ENSP00000347931:p.Pro912His		65148536	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	CCDS44650.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552780	0.86127	.	.	ENSG00000197136	ENST00000355703	D	0.84146	-1.81	4.87	4.87	0.63330	.	.	.	.	.	D	0.92466	0.7608	M	0.82823	2.61	0.54753	D	0.999982	D	0.76494	0.999	D	0.77557	0.99	D	0.93627	0.6953	9	0.87932	D	0	.	15.4863	0.75571	0.0:1.0:0.0:0.0	.	912	Q9H6A9	PCX3_HUMAN	H	912	ENSP00000347931:P912H	ENSP00000347931:P912H	P	+	2	0	PCNXL3	65148536	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	7.442000	0.80503	2.266000	0.75297	0.462000	0.41574	CCC		0.632	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223		Missense_Mutation
PDSS2	57107	hgsc.bcm.edu	37	6	107595359	107595359	+	Silent	SNP	T	T	C			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr6:107595359T>C	ENST00000369037.4	-	3	781	c.504A>G	c.(502-504)ttA>ttG	p.L168L	PDSS2_ENST00000369031.4_Silent_p.L168L|PDSS2_ENST00000453874.2_Silent_p.L168L	NM_020381.3	NP_065114.3	Q86YH6	DLP1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 2	168					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|regulation of body fluid levels (GO:0050878)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)	p.L168L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)	19	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		GCAACTCATTTAAATTTACTA	0.368																																																1	Substitution - coding silent(1)	ovary(1)	6											92.0	87.0	88.0					6																	107595359		2203	4300	6503	107702052	SO:0001819	synonymous_variant	57107			AF254956	CCDS5059.1	6q21	2006-02-14	2006-02-14	2006-02-14	ENSG00000164494	ENSG00000164494			23041	protein-coding gene	gene with protein product		610564	"""chromosome 6 open reading frame 210"""	C6orf210		16262699	Standard	NM_020381		Approved	bA59I9.3	uc003prt.2	Q86YH6	OTTHUMG00000059359	ENST00000369037.4:c.504A>G	6.37:g.107595359T>C			107702052	Q33DR4|Q4G158|Q5VU38|Q5VU39|Q9NR58	Silent	SNP	ENST00000369037.4	37	CCDS5059.1	SNP	61	Baylor																																																																																				0.368	PDSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131954.1	NM_020381		Silent
PDZD2	23037	hgsc.bcm.edu	37	5	32090123	32090123	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr5:32090123delT	ENST00000438447.1	+	20	6957	c.6569delT	c.(6568-6570)ctgfs	p.L2190fs	PDZD2_ENST00000282493.3_Frame_Shift_Del_p.L2190fs			O15018	PDZD2_HUMAN	PDZ domain containing 2	2190	Ser-rich.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.L2190fs*64(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						AAATCAAGCCTGATGTCAGAC	0.562																																																1	Deletion - Frameshift(1)	ovary(1)	5											83.0	96.0	91.0					5																	32090123		2203	4300	6503	32125880	SO:0001589	frameshift_variant	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.6569delT	5.37:g.32090123delT	ENSP00000402033:p.Leu2190fs		32125880	Q9BXD4	Frame_Shift_Del	DEL	ENST00000438447.1	37	CCDS34137.1	DEL	55	Baylor																																																																																				0.562	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			Frame_Shift_Del
PELI1	57162	hgsc.bcm.edu	37	2	64322051	64322051	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr2:64322051C>A	ENST00000358912.4	-	7	1484	c.1042G>T	c.(1042-1044)Gga>Tga	p.G348*		NM_020651.3	NP_065702.2	Q96FA3	PELI1_HUMAN	pellino E3 ubiquitin protein ligase 1	348					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|protein K48-linked ubiquitination (GO:0070936)|response to dsRNA (GO:0043331)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G348*(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	19						GCTTCACATCCAAGCCACAGA	0.488																																																1	Substitution - Nonsense(1)	ovary(1)	2											160.0	149.0	153.0					2																	64322051		2203	4300	6503	64175555	SO:0001587	stop_gained	57162				CCDS1876.1	2p13.3	2012-02-23	2012-02-23		ENSG00000197329	ENSG00000197329		"""Pellino homologs"""	8827	protein-coding gene	gene with protein product		614797	"""pellino (Drosophila) homolog 1"", ""pellino homolog 1 (Drosophila)"""			11306823, 16951688	Standard	NM_020651		Approved		uc002sct.4	Q96FA3	OTTHUMG00000129511	ENST00000358912.4:c.1042G>T	2.37:g.64322051C>A	ENSP00000351789:p.Gly348*		64175555	Q96SM0|Q9GZY5|Q9HCX0	Nonsense_Mutation	SNP	ENST00000358912.4	37	CCDS1876.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	40	7.981808	0.98594	.	.	ENSG00000197329	ENST00000358912	.	.	.	5.88	5.88	0.94601	.	0.046228	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.7314	20.2187	0.98312	0.0:1.0:0.0:0.0	.	.	.	.	X	348	.	ENSP00000351789:G348X	G	-	1	0	PELI1	64175555	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.780000	0.95670	0.655000	0.94253	GGA		0.488	PELI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251686.1	NM_020651		Nonsense_Mutation
PER2	8864	hgsc.bcm.edu	37	2	239167255	239167255	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr2:239167255T>C	ENST00000254657.3	-	15	1937	c.1658A>G	c.(1657-1659)aAa>aGa	p.K553R	AC096574.4_ENST00000456601.1_RNA|PER2_ENST00000254658.3_3'UTR	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	553					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)	p.K553R(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		AGGGACAGCTTTCTTCTCAGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											51.0	51.0	51.0					2																	239167255		2203	4300	6503	238831994	SO:0001583	missense	8864			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.1658A>G	2.37:g.239167255T>C	ENSP00000254657:p.Lys553Arg		238831994	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	37	CCDS2528.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	8.618	0.890638	0.17613	.	.	ENSG00000132326	ENST00000254657	T	0.12039	2.72	4.79	-0.977	0.10282	.	1.820900	0.02248	N	0.066373	T	0.09905	0.0243	L	0.27053	0.805	0.09310	N	1	B;B	0.12630	0.006;0.002	B;B	0.09377	0.004;0.004	T	0.28202	-1.0051	10	0.20519	T	0.43	-0.7236	6.2036	0.20590	0.0:0.1626:0.4329:0.4045	.	553;553	B4DH14;O15055	.;PER2_HUMAN	R	553	ENSP00000254657:K553R	ENSP00000254657:K553R	K	-	2	0	PER2	238831994	0.004000	0.15560	0.000000	0.03702	0.039000	0.13416	0.188000	0.17018	-0.338000	0.08413	0.454000	0.30748	AAA		0.498	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817		Missense_Mutation
PFAS	5198	hgsc.bcm.edu	37	17	8170363	8170365	+	In_Frame_Del	DEL	CGG	CGG	-	rs199963268		TCGA-13-1408-01	TCGA-13-1408-10	CGG	CGG	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:8170363_8170365delCGG	ENST00000314666.6	+	24	3118_3120	c.2985_2987delCGG	c.(2983-2988)aacggg>aag	p.995_996NG>K	PFAS_ENST00000545834.1_In_Frame_Del_p.571_572NG>K	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	995					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)	p.N995_G996>K(1)		central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	TGTCAGTGAACGGGGCTGTGGTT	0.64																																																1	Complex - deletion inframe(1)	ovary(1)	17																																								8111090	SO:0001651	inframe_deletion	5198			AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.2985_2987delCGG	17.37:g.8170363_8170365delCGG	ENSP00000313490:p.Asn995_Gly996delinsLys		8111088	A6H8V8	In_Frame_Del	DEL	ENST00000314666.6	37	CCDS11136.1	DEL	19	Baylor																																																																																				0.640	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2			In_Frame_Del
PHKA2	5256	hgsc.bcm.edu	37	X	18915374	18915375	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-13-1408-01	TCGA-13-1408-10	CC	CC	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chrX:18915374_18915375delCC	ENST00000379942.4	-	30	3853_3854	c.3188_3189delGG	c.(3187-3189)cggfs	p.R1063fs	PHKA2-AS1_ENST00000439295.1_RNA|PHKA2-AS1_ENST00000452900.1_RNA|PHKA2_ENST00000481718.1_5'Flank	NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	1063	Calmodulin-binding. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.R1063fs*54(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					ACTGGCCCTGCCGCTCACCCCA	0.634																																																1	Deletion - Frameshift(1)	ovary(1)	X																																								18825296	SO:0001589	frameshift_variant	5256				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.3188_3189delGG	X.37:g.18915374_18915375delCC	ENSP00000369274:p.Arg1063fs		18825295	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Frame_Shift_Del	DEL	ENST00000379942.4	37	CCDS14190.1	DEL	26	Baylor																																																																																				0.634	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292		Frame_Shift_Del
PLCE1	51196	hgsc.bcm.edu	37	10	96058347	96058347	+	Silent	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr10:96058347C>T	ENST00000371380.3	+	23	5614	c.5379C>T	c.(5377-5379)cgC>cgT	p.R1793R	PLCE1_ENST00000371375.1_Silent_p.R1485R|PLCE1_ENST00000371385.3_Silent_p.R1485R|PLCE1_ENST00000260766.3_Silent_p.R1793R			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1793	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				CTGCCACCCGCATCGACTCTT	0.552																																																0			10											105.0	106.0	105.0					10																	96058347		2061	4188	6249	96048337	SO:0001819	synonymous_variant	51196				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.5379C>T	10.37:g.96058347C>T			96048337	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Silent	SNP	ENST00000371380.3	37	CCDS41552.1	SNP	25	Baylor																																																																																				0.552	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341		Silent
PRR16	51334	hgsc.bcm.edu	37	5	120021809	120021809	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1408-01	TCGA-13-1408-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr5:120021809C>A	ENST00000407149.2	+	2	529	c.320C>A	c.(319-321)cCa>cAa	p.P107Q	PRR16_ENST00000446965.1_Missense_Mutation_p.P37Q|PRR16_ENST00000505123.1_Missense_Mutation_p.P37Q|PRR16_ENST00000379551.2_Missense_Mutation_p.P84Q			Q569H4	LARGN_HUMAN	proline rich 16	107	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)			p.P84Q(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		ATTAAACCCCCAGCACACCCG	0.532																																																1	Substitution - Missense(1)	ovary(1)	5											141.0	127.0	132.0					5																	120021809		2203	4300	6503	120049708	SO:0001583	missense	51334			AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.320C>A	5.37:g.120021809C>A	ENSP00000385118:p.Pro107Gln		120049708	D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	ENST00000407149.2	37		SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184157	0.57800	.	.	ENSG00000184838	ENST00000407149;ENST00000379551;ENST00000509923;ENST00000505123;ENST00000446965	T;T;T;T;T	0.55588	0.62;0.57;0.52;0.51;0.51	5.58	4.71	0.59529	.	0.116884	0.64402	D	0.000019	T	0.63177	0.2489	L	0.56769	1.78	0.38553	D	0.949512	D;D	0.59357	0.985;0.985	P;P	0.58391	0.838;0.838	T	0.66056	-0.6018	9	.	.	.	-5.1179	13.2445	0.60016	0.0:0.9223:0.0:0.0777	.	107;84	Q569H4;Q569H4-3	PRR16_HUMAN;.	Q	107;84;37;37;37	ENSP00000385118:P107Q;ENSP00000368869:P84Q;ENSP00000421256:P37Q;ENSP00000423446:P37Q;ENSP00000405491:P37Q	.	P	+	2	0	PRR16	120049708	0.997000	0.39634	0.688000	0.30117	0.964000	0.63967	4.545000	0.60698	1.372000	0.46190	0.549000	0.68633	CCA		0.532	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644		Missense_Mutation
PTK2B	2185	hgsc.bcm.edu	37	8	27293836	27293836	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr8:27293836G>C	ENST00000397501.1	+	20	2120	c.1312G>C	c.(1312-1314)Gag>Cag	p.E438Q	PTK2B_ENST00000346049.5_Missense_Mutation_p.E438Q|PTK2B_ENST00000517339.1_Missense_Mutation_p.E438Q|PTK2B_ENST00000420218.2_Missense_Mutation_p.E438Q|PTK2B_ENST00000338238.4_Missense_Mutation_p.E438Q|PTK2B_ENST00000544172.1_Missense_Mutation_p.E438Q|PTK2B_ENST00000397497.4_Missense_Mutation_p.E184Q	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	438	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)	p.E184Q(1)|p.E438Q(1)		breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	CTTTTTTGGGGAGGTCTATGA	0.488																																																2	Substitution - Missense(2)	ovary(2)	8											293.0	266.0	276.0					8																	27293836		2203	4300	6503	27349753	SO:0001583	missense	2185			U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.1312G>C	8.37:g.27293836G>C	ENSP00000380638:p.Glu438Gln		27349753	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	ENST00000397501.1	37	CCDS6057.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	33	5.254465	0.95336	.	.	ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339;ENST00000397497	D;D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.44	5.44	0.79542	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85902	0.5805	L	0.31420	0.93	0.80722	D	1	D;D;D;D	0.65815	0.982;0.995;0.989;0.995	P;D;P;D	0.66602	0.874;0.945;0.8;0.945	D	0.87576	0.2481	10	0.87932	D	0	.	16.7686	0.85531	0.0:0.0:1.0:0.0	.	443;184;438;438	Q59GM4;E9PBI4;Q14289-2;Q14289	.;.;.;FAK2_HUMAN	Q	438;443;438;438;438;438;438;184	ENSP00000380638:E438Q;ENSP00000342242:E438Q;ENSP00000440926:E438Q;ENSP00000332816:E438Q;ENSP00000391995:E438Q;ENSP00000427931:E438Q;ENSP00000380634:E184Q	ENSP00000342242:E438Q	E	+	1	0	PTK2B	27349753	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.916000	0.92745	2.558000	0.86282	0.655000	0.94253	GAG		0.488	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219916.1	NM_004103		Missense_Mutation
PTPRG	5793	hgsc.bcm.edu	37	3	62142767	62142767	+	Missense_Mutation	SNP	G	G	T	rs200434651		TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr3:62142767G>T	ENST00000474889.1	+	7	1086	c.709G>T	c.(709-711)Gtc>Ttc	p.V237F	PTPRG_ENST00000295874.10_Missense_Mutation_p.V237F	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	237	Alpha-carbonic anhydrase.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.V237F(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		GGATCCTTTCGTCCTCCGGGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	3											124.0	121.0	122.0					3																	62142767		2203	4300	6503	62117807	SO:0001583	missense	5793			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.709G>T	3.37:g.62142767G>T	ENSP00000418112:p.Val237Phe		62117807	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	CCDS2895.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.91	3.251859	0.59212	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.66638	-0.22;-0.22	5.8	2.01	0.26516	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.413567	0.26883	N	0.022001	T	0.66356	0.2781	L	0.39566	1.225	0.49213	D	0.999769	P;P	0.52577	0.928;0.954	P;P	0.54706	0.567;0.759	T	0.64997	-0.6275	10	0.87932	D	0	.	9.719	0.40291	0.3173:0.0:0.6827:0.0	.	237;237	P23470-2;P23470	.;PTPRG_HUMAN	F	237	ENSP00000418112:V237F;ENSP00000295874:V237F	ENSP00000295874:V237F	V	+	1	0	PTPRG	62117807	0.920000	0.31207	0.963000	0.40424	0.994000	0.84299	0.708000	0.25719	0.090000	0.17273	0.563000	0.77884	GTC		0.512	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841		Missense_Mutation
QSER1	79832	hgsc.bcm.edu	37	11	32979495	32979495	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr11:32979495C>A	ENST00000399302.2	+	8	4780	c.4445C>A	c.(4444-4446)tCc>tAc	p.S1482Y	QSER1_ENST00000527788.1_Missense_Mutation_p.S1243Y	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1482								p.S1482Y(1)		breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					AAAGCCCCTTCCGTGAAACCC	0.388																																																1	Substitution - Missense(1)	ovary(1)	11											65.0	61.0	62.0					11																	32979495		1839	4088	5927	32936071	SO:0001583	missense	79832			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.4445C>A	11.37:g.32979495C>A	ENSP00000382241:p.Ser1482Tyr		32936071	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	37	CCDS41631.1	SNP	30	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.64|19.64	3.865672|3.865672	0.71949|0.71949	.|.	.|.	ENSG00000060749|ENSG00000060749	ENST00000524678|ENST00000399302;ENST00000078652;ENST00000527788	.|T;T	.|0.26373	.|2.07;1.74	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	.|0.000000	.|0.64402	.|D	.|0.000006	T|T	0.52322|0.52322	0.1727|0.1727	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.996;0.993;1.0	.|D;P;D	.|0.85130	.|0.939;0.884;0.997	T|T	0.49173|0.49173	-0.8967|-0.8967	5|10	.|0.87932	.|D	.|0	.|.	20.2861|20.2861	0.98535|0.98535	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1243;1243;1482	.|C9JJ88;Q2KHR3-2;Q2KHR3	.|.;.;QSER1_HUMAN	T|Y	503|1482;1243;1243	.|ENSP00000382241:S1482Y;ENSP00000432766:S1243Y	.|ENSP00000078652:S1243Y	P|S	+|+	1|2	0|0	QSER1|QSER1	32936071|32936071	1.000000|1.000000	0.71417|0.71417	0.937000|0.937000	0.37676|0.37676	0.386000|0.386000	0.30323|0.30323	6.267000|6.267000	0.72546|0.72546	2.786000|2.786000	0.95864|0.95864	0.650000|0.650000	0.86243|0.86243	CCG|TCC		0.388	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774		Missense_Mutation
RASA3	22821	hgsc.bcm.edu	37	13	114817542	114817542	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr13:114817542T>A	ENST00000334062.7	-	3	383	c.262A>T	c.(262-264)Agg>Tgg	p.R88W	RASA3_ENST00000389544.4_Missense_Mutation_p.R56W|RASA3_ENST00000542651.1_Missense_Mutation_p.R88W	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	88	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.R88W(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			ATGGAATCCCTCCGGAAAACG	0.463																																																1	Substitution - Missense(1)	ovary(1)	13											93.0	88.0	90.0					13																	114817542		2203	4300	6503	113835644	SO:0001583	missense	22821				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.262A>T	13.37:g.114817542T>A	ENSP00000335029:p.Arg88Trp		113835644	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	ENST00000334062.7	37	CCDS32016.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	21.9	4.215388	0.79352	.	.	ENSG00000185989	ENST00000334062;ENST00000389544;ENST00000542651	T;T;T	0.70749	-0.51;-0.51;2.87	4.96	2.47	0.30058	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.109676	0.64402	D	0.000008	T	0.74030	0.3663	M	0.87682	2.9	0.80722	D	1	P	0.51537	0.946	P	0.46850	0.529	T	0.72290	-0.4337	9	.	.	.	.	6.9454	0.24516	0.0:0.0807:0.1504:0.7689	.	88	Q14644	RASA3_HUMAN	W	88;56;88	ENSP00000335029:R88W;ENSP00000374195:R56W;ENSP00000439008:R88W	.	R	-	1	2	RASA3	113835644	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	4.962000	0.63687	0.237000	0.21200	0.460000	0.39030	AGG		0.463	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368		Missense_Mutation
ROBO1	6091	hgsc.bcm.edu	37	3	78988051	78988051	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr3:78988051G>A	ENST00000464233.1	-	4	312	c.199C>T	c.(199-201)Cca>Tca	p.P67S	ROBO1_ENST00000436010.2_Missense_Mutation_p.P28S|ROBO1_ENST00000495273.1_Missense_Mutation_p.P28S|ROBO1_ENST00000467549.1_Missense_Mutation_p.P28S|RN7SL751P_ENST00000473281.2_RNA	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	67					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ATGCGAGGTGGAAAATCTTCC	0.433																																																0			3											85.0	80.0	81.0					3																	78988051		1843	4096	5939	79070741	SO:0001583	missense	6091			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.199C>T	3.37:g.78988051G>A	ENSP00000420321:p.Pro67Ser		79070741	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318194	0.60524	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.23	5.23	0.72850	Immunoglobulin-like fold (1);	0.118609	0.56097	D	0.000025	T	0.29524	0.0736	N	0.08118	0	0.50039	D	0.999843	P;P;P;P	0.46064	0.833;0.567;0.872;0.671	B;B;B;B	0.38683	0.24;0.049;0.214;0.279	T	0.10613	-1.0622	9	.	.	.	.	19.173	0.93588	0.0:0.0:1.0:0.0	.	67;28;28;28	Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	ROBO1_HUMAN;.;.;.	S	28;28;67;28;28;67	ENSP00000406043:P28S;ENSP00000420321:P67S;ENSP00000420637:P28S;ENSP00000417992:P28S	.	P	-	1	0	ROBO1	79070741	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.541000	0.73865	2.611000	0.88343	0.462000	0.41574	CCA		0.433	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941		Missense_Mutation
RPGRIP1	57096	hgsc.bcm.edu	37	14	21793223	21793223	+	Silent	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr14:21793223C>T	ENST00000400017.2	+	14	2209	c.2209C>T	c.(2209-2211)Ctg>Ttg	p.L737L	RPGRIP1_ENST00000382933.4_Intron|RPGRIP1_ENST00000553500.1_Intron|RPGRIP1_ENST00000556336.1_Intron|RPGRIP1_ENST00000557771.1_Silent_p.L699L|RPGRIP1_ENST00000307974.4_Silent_p.L96L|RPGRIP1_ENST00000206660.6_Silent_p.L737L	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	737					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		CTTGGCCACACTGATTGGTAA	0.502																																																0			14											107.0	100.0	102.0					14																	21793223		1985	4165	6150	20863063	SO:0001819	synonymous_variant	57096			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.2209C>T	14.37:g.21793223C>T			20863063	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Silent	SNP	ENST00000400017.2	37	CCDS45080.1	SNP	20	Baylor																																																																																				0.502	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366		Silent
SALL4	57167	hgsc.bcm.edu	37	20	50408303	50408303	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr20:50408303delT	ENST00000217086.4	-	2	830	c.719delA	c.(718-720)aacfs	p.N240fs	SALL4_ENST00000395997.3_Frame_Shift_Del_p.N240fs|SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	240					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N240fs*18(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GGCCCACATGTTCACCTGGAT	0.617																																																1	Deletion - Frameshift(1)	ovary(1)	20											36.0	37.0	36.0					20																	50408303		2203	4300	6503	49841710	SO:0001589	frameshift_variant	57167			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.719delA	20.37:g.50408303delT	ENSP00000217086:p.Asn240fs		49841710	A2A2D8|Q540H3|Q6Y8G6	Frame_Shift_Del	DEL	ENST00000217086.4	37	CCDS13438.1	DEL	60	Baylor																																																																																				0.617	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3			Frame_Shift_Del
SCN4A	6329	hgsc.bcm.edu	37	17	62022832	62022832	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:62022832A>T	ENST00000435607.1	-	19	3684	c.3608T>A	c.(3607-3609)gTc>gAc	p.V1203D	SCN4A_ENST00000578147.1_Missense_Mutation_p.V1203D	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1203					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.V1203D(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTGTTGTTGACCTCGGAGAT	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											241.0	243.0	242.0					17																	62022832		2194	4299	6493	59376564	SO:0001583	missense	6329			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3608T>A	17.37:g.62022832A>T	ENSP00000396320:p.Val1203Asp		59376564	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	CCDS45761.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	20.9	4.070476	0.76301	.	.	ENSG00000007314	ENST00000435607	D	0.97041	-4.22	3.76	2.63	0.31362	Ion transport (1);	0.000000	0.56097	D	0.000023	D	0.97895	0.9308	M	0.88310	2.945	0.80722	D	1	D	0.56287	0.975	P	0.58577	0.841	D	0.97427	1.0013	10	0.87932	D	0	.	9.5784	0.39472	0.823:0.177:0.0:0.0	.	1203	P35499	SCN4A_HUMAN	D	1203	ENSP00000396320:V1203D	ENSP00000396320:V1203D	V	-	2	0	SCN4A	59376564	1.000000	0.71417	0.984000	0.44739	0.969000	0.65631	9.013000	0.93629	0.594000	0.29761	0.459000	0.35465	GTC		0.542	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334		Missense_Mutation
SERINC4	619189	hgsc.bcm.edu	37	15	44087267	44087267	+	Silent	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr15:44087267G>A	ENST00000319327.6	-	12	1722	c.1488C>T	c.(1486-1488)ccC>ccT	p.P496P	SERF2_ENST00000409646.1_Intron|MIR1282_ENST00000408865.1_RNA|SERINC4_ENST00000299969.6_Missense_Mutation_p.P422L|SERF2_ENST00000409291.1_Intron|HYPK_ENST00000406925.1_5'Flank|SERINC4_ENST00000249714.3_Silent_p.P252P|RP11-296A16.1_ENST00000417761.2_Intron|SERF2_ENST00000594896.1_Intron	NM_001258031.1	NP_001244960.1	A6NH21	SERC4_HUMAN	serine incorporator 4	496					phospholipid biosynthetic process (GO:0008654)	integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	6		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		GBM - Glioblastoma multiforme(94;7.81e-07)		TAAGGGGCTGGGGTTTCTGGG	0.577																																																0			15											60.0	73.0	69.0					15																	44087267		2198	4298	6496	41874559	SO:0001819	synonymous_variant	619189			DQ103711	CCDS58360.1	15q15.3	2013-09-25			ENSG00000184716	ENSG00000184716			32237	protein-coding gene	gene with protein product		614550					Standard	NM_001258031		Approved	FLJ40363	uc031qrp.1	A6NH21	OTTHUMG00000060144	ENST00000319327.6:c.1488C>T	15.37:g.44087267G>A			41874559	B2RN41|Q3YL75	Silent	SNP	ENST00000319327.6	37	CCDS58360.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.17	1.560189	0.27827	.	.	ENSG00000184716	ENST00000299969	T	0.31510	1.49	5.27	-1.76	0.08006	.	0.666340	0.15992	N	0.234747	T	0.12646	0.0307	.	.	.	0.09310	N	0.999997	B	0.02656	0.0	B	0.04013	0.001	T	0.14448	-1.0472	9	0.27785	T	0.31	-0.0194	0.2203	0.00167	0.317:0.1924:0.2617:0.2289	.	422	A6NM42	.	L	422	ENSP00000299969:P422L	ENSP00000299969:P422L	P	-	2	0	SERINC4	41874559	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-0.015000	0.12634	-0.017000	0.14103	-0.145000	0.13849	CCC		0.577	SERINC4-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133485.2			Silent
SF3A3	10946	hgsc.bcm.edu	37	1	38444463	38444463	+	Silent	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr1:38444463G>A	ENST00000373019.4	-	11	1819	c.864C>T	c.(862-864)acC>acT	p.T288T	SF3A3_ENST00000489537.1_5'UTR|SF3A3_ENST00000448721.2_Silent_p.T235T	NM_006802.2	NP_006793.1	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3, 60kDa	288					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|prostate(2)	12	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ACTTTCCTTTGGTACTGAATA	0.498																																																0			1											60.0	53.0	56.0					1																	38444463		2202	4299	6501	38217050	SO:0001819	synonymous_variant	10946			U08815	CCDS428.1	1p34.3	2012-06-07	2002-08-29		ENSG00000183431	ENSG00000183431			10767	protein-coding gene	gene with protein product		605596	"""splicing factor 3a, subunit 3, 60kD"""			7816610, 8022796	Standard	NM_006802		Approved	SF3a60, SAP61, PRP9, PRPF9	uc001cci.3	Q12874	OTTHUMG00000004438	ENST00000373019.4:c.864C>T	1.37:g.38444463G>A			38217050	D3DPT5|Q15460|Q5VT87	Silent	SNP	ENST00000373019.4	37	CCDS428.1	SNP	47	Baylor																																																																																				0.498	SF3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012976.1	NM_006802		Silent
SIGLEC9	27180	hgsc.bcm.edu	37	19	51631680	51631681	+	Frame_Shift_Ins	INS	-	-	T			TCGA-13-1408-01	TCGA-13-1408-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:51631680_51631681insT	ENST00000250360.3	+	6	1183_1184	c.1116_1117insT	c.(1117-1119)tgcfs	p.C373fs	SIGLEC9_ENST00000440804.3_Frame_Shift_Ins_p.C373fs	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	373					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.C373fs*34(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GAGTGAGGTCCTGCAGGAAGAA	0.569																																																1	Insertion - Frameshift(1)	ovary(1)	19																																								56323493	SO:0001589	frameshift_variant	27180			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1117dupT	19.37:g.51631681_51631681dupT	ENSP00000250360:p.Cys373fs		56323492	Q6GTU4|Q9BYI9	Frame_Shift_Ins	INS	ENST00000250360.3	37	CCDS12825.1	INS	24	Baylor																																																																																				0.569	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441		Frame_Shift_Ins
SIM1	6492	hgsc.bcm.edu	37	6	100838725	100838725	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr6:100838725A>T	ENST00000369208.3	-	12	2595	c.1813T>A	c.(1813-1815)Tgt>Agt	p.C605S	SIM1_ENST00000262901.4_Missense_Mutation_p.C605S			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	605	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.C605S(1)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		TTTGCAAAACACAGGGAGTGT	0.488																																																1	Substitution - Missense(1)	ovary(1)	6											78.0	80.0	79.0					6																	100838725		2203	4300	6503	100945446	SO:0001583	missense	6492			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1813T>A	6.37:g.100838725A>T	ENSP00000358210:p.Cys605Ser		100945446	Q5TDP7	Missense_Mutation	SNP	ENST00000369208.3	37	CCDS5045.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.96	2.391704	0.42410	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.03689	3.84;3.84	5.82	5.82	0.92795	Single-minded, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.01092	0.0036	N	0.19112	0.55	0.58432	D	0.999992	B	0.19445	0.036	B	0.19666	0.026	T	0.34800	-0.9814	10	0.06099	T	0.92	.	16.1986	0.82053	1.0:0.0:0.0:0.0	.	605	P81133	SIM1_HUMAN	S	605	ENSP00000358210:C605S;ENSP00000262901:C605S	ENSP00000262901:C605S	C	-	1	0	SIM1	100945446	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.912000	0.63335	2.227000	0.72691	0.455000	0.32223	TGT		0.488	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068		Missense_Mutation
SLC34A2	10568	hgsc.bcm.edu	37	4	25677845	25677845	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr4:25677845A>C	ENST00000382051.3	+	13	1597	c.1547A>C	c.(1546-1548)aAg>aCg	p.K516T	SLC34A2_ENST00000503434.1_Missense_Mutation_p.K515T|SLC34A2_ENST00000504570.1_Missense_Mutation_p.K515T	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	516					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				CGCATGGCCAAGGGGCTGGGC	0.567			T	ROS1	NSCLC																																		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	0			4											158.0	137.0	144.0					4																	25677845		2203	4300	6503	25286943	SO:0001583	missense	10568			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.1547A>C	4.37:g.25677845A>C	ENSP00000371483:p.Lys516Thr		25286943	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	37	CCDS3435.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.44	3.625373	0.66901	.	.	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	T;T;T	0.26223	1.75;1.76;1.75	5.18	3.99	0.46301	.	0.046595	0.85682	D	0.000000	T	0.42539	0.1207	L	0.59912	1.85	0.53688	D	0.999979	D;D	0.69078	0.997;0.981	D;P	0.64687	0.928;0.906	T	0.21999	-1.0229	10	0.51188	T	0.08	-18.2055	11.3369	0.49509	0.9275:0.0:0.0725:0.0	.	515;516	O95436-2;O95436	.;NPT2B_HUMAN	T	515;516;515	ENSP00000425501:K515T;ENSP00000371483:K516T;ENSP00000423021:K515T	ENSP00000371483:K516T	K	+	2	0	SLC34A2	25286943	1.000000	0.71417	0.983000	0.44433	0.853000	0.48598	3.380000	0.52448	0.908000	0.36671	0.459000	0.35465	AAG		0.567	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424		Missense_Mutation
SLC35E1	79939	hgsc.bcm.edu	37	19	16682365	16682365	+	Silent	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:16682365G>A	ENST00000595753.1	-	2	467	c.450C>T	c.(448-450)gtC>gtT	p.V150V	CTD-3222D19.2_ENST00000409035.1_Intron|SLC35E1_ENST00000431408.1_5'UTR	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	150					transport (GO:0006810)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						GGGACAGGAGGACCACCCAGA	0.617																																																0			19											108.0	107.0	107.0					19																	16682365		2203	4300	6503	16543365	SO:0001819	synonymous_variant	79939			AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.450C>T	19.37:g.16682365G>A			16543365	Q8NBQ2|Q96JV7	Silent	SNP	ENST00000595753.1	37	CCDS12346.2	SNP	41	Baylor																																																																																				0.617	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881		Silent
SOAT2	8435	hgsc.bcm.edu	37	12	53498991	53498991	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr12:53498991A>C	ENST00000301466.3	+	3	299	c.239A>C	c.(238-240)aAa>aCa	p.K80T		NM_003578.3	NP_003569.1	O75908	SOAT2_HUMAN	sterol O-acyltransferase 2	80					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|intestinal cholesterol absorption (GO:0030299)|macrophage derived foam cell differentiation (GO:0010742)|very-low-density lipoprotein particle assembly (GO:0034379)	brush border (GO:0005903)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|transferase activity, transferring acyl groups (GO:0016746)			endometrium(5)|kidney(3)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	18					Hesperetin(DB01094)	TCACAAGACAAACCTCTGCCC	0.582																																																0			12											82.0	69.0	74.0					12																	53498991		2203	4300	6503	51785258	SO:0001583	missense	8435			AF059203	CCDS8847.1	12q13.13	2012-09-20			ENSG00000167780	ENSG00000167780	2.3.1.26		11178	protein-coding gene	gene with protein product		601311				9756920	Standard	NM_003578		Approved	ACAT2	uc001sbv.3	O75908	OTTHUMG00000169774	ENST00000301466.3:c.239A>C	12.37:g.53498991A>C	ENSP00000301466:p.Lys80Thr		51785258	F5H7W4|I6L9H9|Q4VB99|Q4VBA1|Q96TD4|Q9UNR2	Missense_Mutation	SNP	ENST00000301466.3	37	CCDS8847.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	8.144	0.785810	0.16189	.	.	ENSG00000167780	ENST00000551896;ENST00000301466	T;T	0.48201	0.82;1.99	4.94	0.708	0.18144	.	1.289060	0.05011	N	0.470985	T	0.26702	0.0653	N	0.14661	0.345	0.09310	N	1	B	0.32245	0.361	B	0.29785	0.107	T	0.14671	-1.0464	10	0.19147	T	0.46	1.2944	3.8004	0.08756	0.3391:0.1819:0.479:0.0	.	80	O75908	SOAT2_HUMAN	T	80	ENSP00000450120:K80T;ENSP00000301466:K80T	ENSP00000301466:K80T	K	+	2	0	SOAT2	51785258	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.712000	0.25779	0.022000	0.15160	-0.242000	0.12053	AAA		0.582	SOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405817.1			Missense_Mutation
SPC24	147841	hgsc.bcm.edu	37	19	11259880	11259880	+	Silent	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:11259880G>A	ENST00000592540.1	-	2	226	c.195C>T	c.(193-195)agC>agT	p.S65S		NM_182513.2	NP_872319.1	Q8NBT2	SPC24_HUMAN	SPC24, NDC80 kinetochore complex component	65	Interaction with the N-terminus of SPBC25.|Interaction with the NDC80-CDCA1 subcomplex.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|Ndc80 complex (GO:0031262)|nucleolus (GO:0005730)|nucleus (GO:0005634)				autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)	5						CATTGAGAAGGCTCTGGGCCA	0.617																																																0			19											24.0	26.0	25.0					19																	11259880		1984	3984	5968	11120880	SO:0001819	synonymous_variant	147841			AK075287	CCDS45974.1	19p13.2	2013-06-05	2013-06-05	2007-03-02		ENSG00000161888			26913	protein-coding gene	gene with protein product		609394	"""spindle pole body component 24 homolog (S. cerevisiae)"", ""SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	SPBC24			Standard	NM_182513		Approved	FLJ90806	uc002mql.2	Q8NBT2		ENST00000592540.1:c.195C>T	19.37:g.11259880G>A			11120880	B4DZZ7|C9JGC4	Silent	SNP	ENST00000592540.1	37	CCDS45974.1	SNP	42	Baylor																																																																																				0.617	SPC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453059.1	NM_182513		Silent
SPG7	6687	hgsc.bcm.edu	37	16	89613094	89613095	+	Frame_Shift_Ins	INS	-	-	G			TCGA-13-1408-01	TCGA-13-1408-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr16:89613094_89613095insG	ENST00000268704.2	+	11	1493_1494	c.1478_1479insG	c.(1477-1482)ctgaagfs	p.K494fs		NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	494					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.K494fs*27(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		GAGCAGCACCTGAAGAGCCTGA	0.574																																																1	Insertion - Frameshift(1)	ovary(1)	16																																								88140596	SO:0001589	frameshift_variant	6687			Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1479dupG	16.37:g.89613095_89613095dupG	ENSP00000268704:p.Lys494fs		88140595	O75756|Q2TB70|Q58F00|Q96IB0	Frame_Shift_Ins	INS	ENST00000268704.2	37	CCDS10977.1	INS	55	Baylor																																																																																				0.574	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119		Frame_Shift_Ins
SPTB	6710	hgsc.bcm.edu	37	14	65262170	65262172	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-13-1408-01	TCGA-13-1408-10	CAT	CAT	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr14:65262170_65262172delCAT	ENST00000389721.5	-	11	1559_1561	c.1527_1529delATG	c.(1525-1530)ctatgg>ctg	p.W510del	SPTB_ENST00000389720.3_In_Frame_Del_p.W510del|SPTB_ENST00000389722.3_In_Frame_Del_p.W510del|SPTB_ENST00000556626.1_In_Frame_Del_p.W510del|SPTB_ENST00000542895.1_In_Frame_Del_p.W510del	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	510					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.W510delW(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CAGGTAGCTCCATAGGCGCAGTA	0.611																																																1	Deletion - In frame(1)	ovary(1)	14																																								64331925	SO:0001651	inframe_deletion	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.1527_1529delATG	14.37:g.65262170_65262172delCAT	ENSP00000374371:p.Trp510del		64331923	Q15510|Q15519	In_Frame_Del	DEL	ENST00000389721.5	37	CCDS32100.1	DEL	21	Baylor																																																																																				0.611	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1			In_Frame_Del
SPTBN2	6712	hgsc.bcm.edu	37	11	66457568	66457568	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr11:66457568C>A	ENST00000533211.1	-	28	6083	c.5752G>T	c.(5752-5754)Gaa>Taa	p.E1918*	SPTBN2_ENST00000309996.2_Nonsense_Mutation_p.E1918*|SPTBN2_ENST00000529997.1_Nonsense_Mutation_p.E1918*			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1918					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)	p.E1918*(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						AGCATCAGTTCCCGGACAGCC	0.647																																																1	Substitution - Nonsense(1)	ovary(1)	11											116.0	116.0	116.0					11																	66457568		2200	4295	6495	66214144	SO:0001587	stop_gained	6712			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.5752G>T	11.37:g.66457568C>A	ENSP00000432568:p.Glu1918*		66214144	O14872|O14873	Nonsense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	47	13.771287	0.99762	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	.	.	.	5.12	5.12	0.69794	.	0.106571	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	17.4906	0.87702	0.0:1.0:0.0:0.0	.	.	.	.	X	1918	.	ENSP00000311489:E1918X	E	-	1	0	SPTBN2	66214144	1.000000	0.71417	1.000000	0.80357	0.485000	0.33311	7.599000	0.82757	2.664000	0.90586	0.655000	0.94253	GAA		0.647	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946		Nonsense_Mutation
SYT5	6861	hgsc.bcm.edu	37	19	55687455	55687455	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:55687455G>T	ENST00000354308.3	-	4	659	c.290C>A	c.(289-291)tCc>tAc	p.S97Y	SYT5_ENST00000592935.1_5'Flank|SYT5_ENST00000590851.1_Missense_Mutation_p.S94Y|CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000537500.1_Missense_Mutation_p.S97Y	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	97					calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CCCTGGCCCGGATGGTGCTGG	0.587																																																0			19											107.0	105.0	106.0					19																	55687455		2203	4300	6503	60379267	SO:0001583	missense	6861			X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.290C>A	19.37:g.55687455G>T	ENSP00000346265:p.Ser97Tyr		60379267	B3KWJ8|B7Z300|Q86X72	Missense_Mutation	SNP	ENST00000354308.3	37	CCDS12919.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	g	12.20	1.866086	0.32977	.	.	ENSG00000129990	ENST00000537500;ENST00000354308;ENST00000543844	T;T	0.55052	0.54;0.54	3.98	1.8	0.24995	.	0.794737	0.11573	N	0.550530	T	0.36110	0.0955	L	0.29908	0.895	0.09310	N	1	P;B;B	0.40534	0.72;0.07;0.004	B;B;B	0.39738	0.308;0.039;0.007	T	0.29701	-1.0003	10	0.62326	D	0.03	.	2.2617	0.04068	0.2672:0.0:0.4786:0.2542	.	94;97;97	B7Z300;Q4FD32;O00445	.;.;SYT5_HUMAN	Y	97;97;94	ENSP00000442896:S97Y;ENSP00000346265:S97Y	ENSP00000346265:S97Y	S	-	2	0	SYT5	60379267	0.042000	0.20092	0.001000	0.08648	0.733000	0.41908	2.447000	0.44917	0.960000	0.38005	0.556000	0.70494	TCC		0.587	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1	NM_003180		Missense_Mutation
SYT5	6861	hgsc.bcm.edu	37	19	55687457	55687458	+	Frame_Shift_Ins	INS	-	-	A			TCGA-13-1408-01	TCGA-13-1408-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:55687457_55687458insA	ENST00000354308.3	-	4	656_657	c.287_288insT	c.(286-288)ccafs	p.P96fs	SYT5_ENST00000592935.1_5'Flank|SYT5_ENST00000590851.1_Frame_Shift_Ins_p.P93fs|CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000537500.1_Frame_Shift_Ins_p.P96fs	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	96					calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.S97fs*12(1)		kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CTGGCCCGGATGGTGCTGGCTC	0.579																																																1	Insertion - Frameshift(1)	ovary(1)	19																																								60379270	SO:0001589	frameshift_variant	6861			X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.287_288insT	19.37:g.55687457_55687458insA	ENSP00000346265:p.Pro96fs		60379269	B3KWJ8|B7Z300|Q86X72	Frame_Shift_Ins	INS	ENST00000354308.3	37	CCDS12919.1	INS	51	Baylor																																																																																				0.579	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1	NM_003180		Frame_Shift_Ins
TAF12	6883	hgsc.bcm.edu	37	1	28931966	28931966	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr1:28931966T>C	ENST00000263974.4	-	5	802	c.368A>G	c.(367-369)cAg>cGg	p.Q123R	TAF12_ENST00000373824.4_Missense_Mutation_p.Q123R|TAF12_ENST00000471683.1_5'UTR	NM_001135218.1	NP_001128690.1	Q16514	TAF12_HUMAN	TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa	123					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.Q123R(1)		ovary(1)|upper_aerodigestive_tract(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Renal(390;0.00121)|Breast(348;0.00502)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)		Colorectal(126;3.21e-08)|COAD - Colon adenocarcinoma(152;1.74e-06)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(1967;0.0109)|BRCA - Breast invasive adenocarcinoma(304;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		CATGTTCCACTGGCGCTCTGC	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											101.0	101.0	101.0					1																	28931966		2203	4300	6503	28804553	SO:0001583	missense	6883			BC011986	CCDS326.1	1p35	2008-02-05	2002-08-29	2001-12-07	ENSG00000120656	ENSG00000120656			11545	protein-coding gene	gene with protein product		600773	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, J, 20kD"""	TAF2J		7729427	Standard	NM_005644		Approved	TAFII20	uc001bqy.3	Q16514	OTTHUMG00000003655	ENST00000263974.4:c.368A>G	1.37:g.28931966T>C	ENSP00000263974:p.Gln123Arg		28804553	D3DPM5|Q15775|Q5T077	Missense_Mutation	SNP	ENST00000263974.4	37	CCDS326.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.6	4.025713	0.75390	.	.	ENSG00000120656	ENST00000373824;ENST00000263974	.	.	.	5.65	5.65	0.86999	Histone-fold (2);Transcription initiation factor TFIID (2);	0.053759	0.85682	D	0.000000	T	0.56804	0.2010	L	0.43152	1.355	0.80722	D	1	P;P	0.43169	0.762;0.8	B;P	0.45232	0.164;0.474	T	0.60546	-0.7242	9	0.59425	D	0.04	-4.3712	14.8357	0.70180	0.0:0.0:0.0:1.0	.	93;123	Q16514-2;Q16514	.;TAF12_HUMAN	R	123	.	ENSP00000263974:Q123R	Q	-	2	0	TAF12	28804553	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.562000	0.82300	2.152000	0.67230	0.477000	0.44152	CAG		0.512	TAF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010367.1	NM_005644		Missense_Mutation
TCF20	6942	hgsc.bcm.edu	37	22	42608310	42608310	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr22:42608310A>C	ENST00000359486.3	-	1	3138	c.3002T>G	c.(3001-3003)aTg>aGg	p.M1001R	TCF20_ENST00000404876.1_5'Flank|TCF20_ENST00000335626.4_Missense_Mutation_p.M1001R	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1001					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						CCGACCCCTCATGCCCTCCCG	0.572																																																0			22											43.0	49.0	47.0					22																	42608310		2203	4300	6503	40938254	SO:0001583	missense	6942			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3002T>G	22.37:g.42608310A>C	ENSP00000352463:p.Met1001Arg		40938254	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	37	CCDS14033.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.34	2.803342	0.50315	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.58940	0.3;0.3	5.92	5.92	0.95590	.	0.170931	0.42053	D	0.000771	T	0.42675	0.1213	N	0.14661	0.345	0.80722	D	1	B;B	0.19445	0.036;0.021	B;B	0.21917	0.037;0.016	T	0.32348	-0.9910	10	0.44086	T	0.13	-9.862	13.888	0.63721	1.0:0.0:0.0:0.0	.	1001;1001	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	R	1001	ENSP00000352463:M1001R;ENSP00000335561:M1001R	ENSP00000335561:M1001R	M	-	2	0	TCF20	40938254	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.832000	0.55783	2.263000	0.75096	0.533000	0.62120	ATG		0.572	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492		Missense_Mutation
TECPR2	9895	hgsc.bcm.edu	37	14	102901037	102901037	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr14:102901037A>T	ENST00000359520.7	+	9	2109	c.1883A>T	c.(1882-1884)gAa>gTa	p.E628V	TECPR2_ENST00000558678.1_Missense_Mutation_p.E628V	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	628					autophagy (GO:0006914)|cell death (GO:0008219)			p.E628V(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						CATGATGGGGAAGACATCCAA	0.562																																																1	Substitution - Missense(1)	ovary(1)	14											68.0	51.0	57.0					14																	102901037		2203	4300	6503	101970790	SO:0001583	missense	9895			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.1883A>T	14.37:g.102901037A>T	ENSP00000352510:p.Glu628Val		101970790	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	37	CCDS32162.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	11.76	1.734430	0.30774	.	.	ENSG00000196663	ENST00000359520	T	0.16457	2.34	5.33	-3.46	0.04767	.	2.197700	0.01621	N	0.023032	T	0.08670	0.0215	N	0.14661	0.345	0.09310	N	1	B;B	0.18610	0.029;0.029	B;B	0.14023	0.01;0.01	T	0.16897	-1.0387	9	.	.	.	.	2.6928	0.05125	0.5134:0.1338:0.2488:0.1041	.	628;628	A5PKY3;O15040	.;TCPR2_HUMAN	V	628	ENSP00000352510:E628V	.	E	+	2	0	TECPR2	101970790	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	0.106000	0.15354	-0.961000	0.03609	0.374000	0.22700	GAA		0.562	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844		Missense_Mutation
TFDP1	7027	hgsc.bcm.edu	37	13	114292203	114292203	+	Silent	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr13:114292203C>T	ENST00000375370.5	+	11	1289	c.1077C>T	c.(1075-1077)ttC>ttT	p.F359F	TFDP1_ENST00000544902.1_Silent_p.F330F|TFDP1_ENST00000538138.1_Intron	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1	359					anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			GCACAAGGTTCTCTGCCAGGT	0.587										TSP Lung(29;0.18)																																						0			13											110.0	96.0	101.0					13																	114292203		2203	4300	6503	113340204	SO:0001819	synonymous_variant	7027			BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.1077C>T	13.37:g.114292203C>T			113340204	B4DLQ9|Q5JSB4|Q8IZL5	Silent	SNP	ENST00000375370.5	37	CCDS9538.1	SNP	32	Baylor																																																																																				0.587	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045918.3	NM_007111		Silent
TMEM120B	144404	hgsc.bcm.edu	37	12	122213582	122213582	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr12:122213582T>G	ENST00000449592.2	+	12	1075	c.974T>G	c.(973-975)gTg>gGg	p.V325G	TMEM120B_ENST00000540377.1_Silent_p.R28R	NM_001080825.2	NP_001074294.2	A0PK00	T120B_HUMAN	transmembrane protein 120B	325						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		CTCAAAGTCGTGCATGCCAAG	0.632											OREG0022207	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			12											70.0	81.0	77.0					12																	122213582		2082	4226	6308	120697965	SO:0001583	missense	144404			BC127768	CCDS41852.1	12q24.31	2007-08-01			ENSG00000188735	ENSG00000188735			32008	protein-coding gene	gene with protein product							Standard	NM_001080825		Approved		uc001ubc.4	A0PK00	OTTHUMG00000169076	ENST00000449592.2:c.974T>G	12.37:g.122213582T>G	ENSP00000404991:p.Val325Gly	1517	120697965	A0PK01|B3KX33	Missense_Mutation	SNP	ENST00000449592.2	37	CCDS41852.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	29.5	5.010644	0.93346	.	.	ENSG00000188735	ENST00000449592	T	0.36340	1.26	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.66713	0.2817	M	0.90595	3.13	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74853	-0.3523	10	0.87932	D	0	-24.1115	14.1755	0.65539	0.0:0.0:0.0:1.0	.	325	A0PK00	T120B_HUMAN	G	325	ENSP00000404991:V325G	ENSP00000345152:V325G	V	+	2	0	TMEM120B	120697965	1.000000	0.71417	0.979000	0.43373	0.972000	0.66771	7.287000	0.78681	1.983000	0.57843	0.533000	0.62120	GTG		0.632	TMEM120B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402158.1	NM_001080825		Missense_Mutation
TNN	63923	hgsc.bcm.edu	37	1	175067580	175067580	+	Silent	SNP	T	T	C	rs61747978	byFrequency	TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr1:175067580T>C	ENST00000239462.4	+	9	2081	c.1968T>C	c.(1966-1968)tcT>tcC	p.S656S		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	656	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCTACACCTCTGCTGGTGGAG	0.612													T|||	51	0.0101837	0.0008	0.0187	5008	,	,		18775	0.0		0.0298	False		,,,				2504	0.0072															0			1						T		27,4379	33.5+/-64.1	0,27,2176	96.0	92.0	93.0		1968	-0.5	0.9	1	dbSNP_129	93	295,8305	108.2+/-168.9	10,275,4015	no	coding-synonymous	TNN	NM_022093.1		10,302,6191	CC,CT,TT		3.4302,0.6128,2.4758		656/1300	175067580	322,12684	2203	4300	6503	173334203	SO:0001819	synonymous_variant	63923			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1968T>C	1.37:g.175067580T>C			173334203	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	37	CCDS30943.1	SNP	55	Baylor																																																																																				0.612	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		Silent
TRIM59	286827	hgsc.bcm.edu	37	3	160156368	160156368	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr3:160156368delT	ENST00000309784.4	-	3	789	c.604delA	c.(604-606)agtfs	p.S202fs	RP11-432B6.3_ENST00000483754.1_Frame_Shift_Del_p.S202fs|TRIM59_ENST00000543469.1_Frame_Shift_Del_p.S202fs	NM_173084.2	NP_775107.1	Q8IWR1	TRI59_HUMAN	tripartite motif containing 59	202					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral entry into host cell (GO:0046597)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S202fs*3(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(3)	15			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GTTAGGAAACTTTTTTTTTTC	0.343																																																1	Deletion - Frameshift(1)	ovary(1)	3											59.0	62.0	61.0					3																	160156368		2195	4299	6494	161639062	SO:0001589	frameshift_variant	286827			AY159379	CCDS3190.1	3q26	2013-01-09	2011-01-25		ENSG00000213186	ENSG00000213186		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	30834	protein-coding gene	gene with protein product			"""tripartite motif-containing 57"", ""tripartite motif-containing 59"""	TRIM57		12095697	Standard	NM_173084		Approved	TSBF1, Mrf1, RNF104	uc003fdm.3	Q8IWR1	OTTHUMG00000159034	ENST00000309784.4:c.604delA	3.37:g.160156368delT	ENSP00000311219:p.Ser202fs		161639062	A8K5G9|D3DNL9	Frame_Shift_Del	DEL	ENST00000309784.4	37	CCDS3190.1	DEL	56	Baylor																																																																																				0.343	TRIM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352963.1	NM_173084		Frame_Shift_Del
TRPM3	80036	hgsc.bcm.edu	37	9	73478010	73478010	+	Frame_Shift_Del	DEL	C	C	-			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr9:73478010delC	ENST00000377111.2	-	3	519	c.276delG	c.(274-276)ctgfs	p.L92fs	TRPM3_ENST00000408909.2_5'Flank|TRPM3_ENST00000377106.1_5'UTR|TRPM3_ENST00000377110.3_Frame_Shift_Del_p.L92fs|TRPM3_ENST00000361823.5_5'UTR|TRPM3_ENST00000437699.3_5'UTR|TRPM3_ENST00000357533.2_Frame_Shift_Del_p.L94fs|TRPM3_ENST00000396283.1_5'UTR|TRPM3_ENST00000396285.1_5'Flank|TRPM3_ENST00000423814.3_Frame_Shift_Del_p.L94fs|TRPM3_ENST00000377105.1_5'UTR|TRPM3_ENST00000360823.2_5'UTR|TRPM3_ENST00000396292.4_5'Flank|TRPM3_ENST00000358082.3_5'Flank|TRPM3_ENST00000377101.1_5'UTR|TRPM3_ENST00000377097.3_5'Flank|TRPM3_ENST00000396280.5_5'Flank	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	92					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.I95fs*1(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GCTGGCCTATCAGACGCCCAC	0.473																																																1	Deletion - Frameshift(1)	ovary(1)	9											78.0	85.0	82.0					9																	73478010		2203	4299	6502	72667830	SO:0001589	frameshift_variant	80036			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.276delG	9.37:g.73478010delC	ENSP00000366315:p.Leu92fs		72667830	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Frame_Shift_Del	DEL	ENST00000377111.2	37		DEL	29	Baylor																																																																																				0.473	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945		Frame_Shift_Del
TTN	7273	hgsc.bcm.edu	37	2	179426390	179426390	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr2:179426390G>T	ENST00000591111.1	-	276	79770	c.79546C>A	c.(79546-79548)Cct>Act	p.P26516T	TTN_ENST00000342175.6_Missense_Mutation_p.P19284T|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P28157T|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P19092T|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P19217T|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P25589T|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26516	Fibronectin type-III 93. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P19284T(1)|p.P25587T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTACCAGGAGGACCTGGGGGA	0.463																																																2	Substitution - Missense(2)	ovary(2)	2											87.0	87.0	87.0					2																	179426390		1899	4109	6008	179134636	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.79546C>A	2.37:g.179426390G>T	ENSP00000465570:p.Pro26516Thr		179134636	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.26	2.482374	0.44147	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	6.01	6.01	0.97437	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79118	0.4392	M	0.85777	2.775	0.80722	D	1	D;D;D;D	0.63880	0.993;0.993;0.993;0.988	D;D;D;P	0.63113	0.911;0.911;0.911;0.875	T	0.80915	-0.1169	9	0.87932	D	0	.	20.5073	0.99209	0.0:0.0:1.0:0.0	.	19092;19217;19284;26516	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	25589;19092;19284;19217;19090	ENSP00000343764:P25589T;ENSP00000434586:P19092T;ENSP00000340554:P19284T;ENSP00000352154:P19217T	ENSP00000340554:P19284T	P	-	1	0	TTN	179134636	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	6.642000	0.74329	2.855000	0.98099	0.585000	0.79938	CCT		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
UBA1	7317	hgsc.bcm.edu	37	X	47060332	47060332	+	Frame_Shift_Del	DEL	C	C	-			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chrX:47060332delC	ENST00000335972.6	+	6	703	c.520delC	c.(520-522)cgafs	p.R174fs	UBA1_ENST00000377351.4_Frame_Shift_Del_p.R174fs	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	174	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)	p.R174fs*33(1)		breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GGACCAGCTGCGAGTGGGTGA	0.632																																																1	Deletion - Frameshift(1)	ovary(1)	X											69.0	51.0	57.0					X																	47060332		2202	4296	6498	46945276	SO:0001589	frameshift_variant	7317			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.520delC	X.37:g.47060332delC	ENSP00000338413:p.Arg174fs		46945276	Q5JRR8|Q96E13	Frame_Shift_Del	DEL	ENST00000335972.6	37	CCDS14275.1	DEL	27	Baylor																																																																																				0.632	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056389.1	NM_003334		Frame_Shift_Del
VMO1	284013	hgsc.bcm.edu	37	17	4688863	4688863	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:4688863C>T	ENST00000328739.5	-	3	482	c.403G>A	c.(403-405)Gac>Aac	p.D135N	VMO1_ENST00000416307.2_3'UTR|VMO1_ENST00000441199.2_3'UTR|VMO1_ENST00000354194.4_3'UTR	NM_182566.2	NP_872372.1	Q7Z5L0	VMO1_HUMAN	vitelline membrane outer layer 1 homolog (chicken)	135						extracellular vesicular exosome (GO:0070062)				kidney(2)|large_intestine(3)|liver(1)|lung(3)|ovary(1)|pancreas(1)	11						GCTGTGTTGTCACCGAGGGTC	0.647																																																0			17											75.0	65.0	68.0					17																	4688863		2203	4300	6503	4635603	SO:0001583	missense	284013			AF521892	CCDS11055.1, CCDS45585.1, CCDS45586.1, CCDS45587.1	17p13.2	2013-03-07	2005-11-14						30387	protein-coding gene	gene with protein product						22025569	Standard	NM_182566		Approved		uc002fyx.3	Q7Z5L0		ENST00000328739.5:c.403G>A	17.37:g.4688863C>T	ENSP00000328397:p.Asp135Asn		4635603	C9JQ15|E9PAU9|E9PGP4|Q3SXP1|Q8IUY1	Missense_Mutation	SNP	ENST00000328739.5	37	CCDS11055.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	25.8	4.674270	0.88445	.	.	ENSG00000182853	ENST00000328739	T	0.60040	0.22	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.81508	0.4837	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86226	0.1634	10	0.87932	D	0	-41.1726	16.1422	0.81534	0.0:1.0:0.0:0.0	.	135	Q7Z5L0	VMO1_HUMAN	N	135	ENSP00000328397:D135N	ENSP00000328397:D135N	D	-	1	0	VMO1	4635603	1.000000	0.71417	0.999000	0.59377	0.532000	0.34746	6.235000	0.72332	2.491000	0.84063	0.561000	0.74099	GAC		0.647	VMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439587.1	NM_182566		Missense_Mutation
USP6	9098	hgsc.bcm.edu	37	17	5037241	5037241	+	Silent	SNP	G	G	A	rs117611547		TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:5037241G>A	ENST00000574788.1	+	15	2674	c.444G>A	c.(442-444)gtG>gtA	p.V148V	USP6_ENST00000332776.4_Silent_p.V148V|USP6_ENST00000304328.5_5'UTR|USP6_ENST00000250066.6_Silent_p.V148V			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	148	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)	p.V148V(3)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						ACCTGGACGTGAGGACGACTC	0.557			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	3	Substitution - coding silent(3)	ovary(2)|skin(1)	17											220.0	174.0	189.0					17																	5037241		2203	4300	6503	4977965	SO:0001819	synonymous_variant	9098			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.444G>A	17.37:g.5037241G>A			4977965	Q15634|Q86WP6|Q8IWT4	Silent	SNP	ENST00000574788.1	37	CCDS11069.2	SNP	45	Baylor																																																																																				0.557	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505		Silent
VPS13B	157680	hgsc.bcm.edu	37	8	100866453	100866453	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr8:100866453G>T	ENST00000358544.2	+	56	11022	c.10911G>T	c.(10909-10911)atG>atT	p.M3637I	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.M3612I	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3637					protein transport (GO:0015031)			p.M3637I(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCCTGGCAATGCACTATGCCG	0.552																																					Colon(161;2205 2542 7338 31318)											1	Substitution - Missense(1)	ovary(1)	8											70.0	57.0	62.0					8																	100866453		2203	4300	6503	100935629	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.10911G>T	8.37:g.100866453G>T	ENSP00000351346:p.Met3637Ile		100935629	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159237	0.57368	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.69806	-0.43;-0.43	5.5	4.62	0.57501	.	0.041837	0.85682	N	0.000000	T	0.65933	0.2739	M	0.66939	2.045	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.63681	-0.6582	10	0.48119	T	0.1	.	15.6996	0.77533	0.0:0.0:0.862:0.138	.	3612;3637	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	I	3612;3637	ENSP00000349685:M3612I;ENSP00000351346:M3637I	ENSP00000349685:M3612I	M	+	3	0	VPS13B	100935629	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.387000	0.79785	1.287000	0.44583	0.650000	0.86243	ATG		0.552	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		Missense_Mutation
WDR33	55339	hgsc.bcm.edu	37	2	128463979	128463980	+	Frame_Shift_Ins	INS	-	-	CACTTCT			TCGA-13-1408-01	TCGA-13-1408-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr2:128463979_128463980insCACTTCT	ENST00000322313.4	-	22	4086_4087	c.3928_3929insAGAAGTG	c.(3928-3930)ggcfs	p.G1310fs		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	1310					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G1310fs*5(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CCAGTTACTGCCACTCCGGCCC	0.609																																																1	Insertion - Frameshift(1)	ovary(1)	2																																								128180450	SO:0001589	frameshift_variant	55339				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.3928_3929insAGAAGTG	2.37:g.128463979_128463980insCACTTCT	ENSP00000325377:p.Gly1310fs		128180449	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Frame_Shift_Ins	INS	ENST00000322313.4	37	CCDS2150.1	INS	26	Baylor																																																																																				0.609	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383		Frame_Shift_Ins
WDR59	79726	hgsc.bcm.edu	37	16	74943516	74943516	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr16:74943516G>A	ENST00000262144.6	-	16	1655	c.1525C>T	c.(1525-1527)Ccc>Tcc	p.P509S		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	509										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						ACAGAGTTGGGGAGTGCAAAC	0.512																																																0			16											99.0	106.0	104.0					16																	74943516		2198	4300	6498	73501017	SO:0001583	missense	79726			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.1525C>T	16.37:g.74943516G>A	ENSP00000262144:p.Pro509Ser		73501017	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Missense_Mutation	SNP	ENST00000262144.6	37	CCDS32488.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	2.174	-0.389099	0.04932	.	.	ENSG00000103091	ENST00000262144	T	0.64260	-0.09	5.86	4.91	0.64330	.	0.273847	0.43110	N	0.000615	T	0.44623	0.1302	N	0.17082	0.46	0.29809	N	0.8318	B	0.09022	0.002	B	0.11329	0.006	T	0.27297	-1.0078	10	0.10902	T	0.67	-5.1621	15.1255	0.72481	0.0686:0.0:0.9314:0.0	.	509	Q6PJI9	WDR59_HUMAN	S	509	ENSP00000262144:P509S	ENSP00000262144:P509S	P	-	1	0	WDR59	73501017	1.000000	0.71417	1.000000	0.80357	0.167000	0.22549	0.883000	0.28200	1.623000	0.50342	0.650000	0.86243	CCC		0.512	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581		Missense_Mutation
WISP2	8839	hgsc.bcm.edu	37	20	43344046	43344046	+	Silent	SNP	G	G	C			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr20:43344046G>C	ENST00000372868.2	+	2	358	c.15G>C	c.(13-15)ccG>ccC	p.P5P	RP11-445H22.4_ENST00000427598.1_RNA|RP11-445H22.4_ENST00000427303.1_RNA|WISP2_ENST00000372865.4_Silent_p.P5P|RP11-445H22.4_ENST00000445420.1_RNA|WISP2_ENST00000190983.4_Silent_p.P5P			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	5					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				GAGGCACACCGAAGACCCACC	0.612																																																0			20											57.0	49.0	52.0					20																	43344046		2202	4300	6502	42777460	SO:0001819	synonymous_variant	8839			AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.15G>C	20.37:g.43344046G>C			42777460	B2R9N4|E1P612|Q6PEG3	Silent	SNP	ENST00000372868.2	37	CCDS13336.1	SNP	37	Baylor																																																																																				0.612	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127824.1	NM_003881		Silent
WSCD1	23302	hgsc.bcm.edu	37	17	5993765	5993767	+	In_Frame_Del	DEL	GGG	GGG	-			TCGA-13-1408-01	TCGA-13-1408-10	GGG	GGG	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr17:5993765_5993767delGGG	ENST00000574946.1	+	4	1057_1059	c.667_669delGGG	c.(667-669)gggdel	p.G223del	WSCD1_ENST00000573634.1_In_Frame_Del_p.G107del|WSCD1_ENST00000539421.1_In_Frame_Del_p.G223del|WSCD1_ENST00000574232.1_In_Frame_Del_p.G223del|WSCD1_ENST00000317744.5_In_Frame_Del_p.G223del			Q658N2	WSCD1_HUMAN	WSC domain containing 1	223	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.G223delG(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						CTCTGTGTGCGGGGCTGTGGACC	0.655																																																1	Deletion - In frame(1)	ovary(1)	17																																								5934491	SO:0001651	inframe_deletion	23302				CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.667_669delGGG	17.37:g.5993765_5993767delGGG	ENSP00000460825:p.Gly223del		5934489	A8K0N8|D3DTM3|O60276|Q96G45	In_Frame_Del	DEL	ENST00000574946.1	37	CCDS32538.1	DEL	39	Baylor																																																																																				0.655	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253		In_Frame_Del
ZMIZ2	83637	hgsc.bcm.edu	37	7	44800159	44800159	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr7:44800159C>G	ENST00000309315.4	+	9	1330	c.1207C>G	c.(1207-1209)Ccc>Gcc	p.P403A	ZMIZ2_ENST00000441627.1_Missense_Mutation_p.P403A|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.P377A|ZMIZ2_ENST00000433667.1_Missense_Mutation_p.P371A|ZMIZ2_ENST00000413916.1_Missense_Mutation_p.P345A	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	403	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)	p.P403A(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TGATCTCAAGCCCAACCTCAA	0.587																																					NSCLC(20;604 852 1948 16908 50522)											1	Substitution - Missense(1)	ovary(1)	7											173.0	180.0	178.0					7																	44800159		2136	4261	6397	44766684	SO:0001583	missense	83637			AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.1207C>G	7.37:g.44800159C>G	ENSP00000311778:p.Pro403Ala		44766684	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.3	4.399754	0.83120	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	5.53	5.53	0.82687	.	0.000000	0.56097	D	0.000037	T	0.57403	0.2051	L	0.29908	0.895	0.80722	D	1	D;D;D	0.69078	0.997;0.995;0.997	D;P;D	0.63877	0.919;0.831;0.919	T	0.58142	-0.7688	10	0.52906	T	0.07	-10.0132	19.0583	0.93076	0.0:1.0:0.0:0.0	.	377;403;345	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	A	345;403;403;371;377;403	ENSP00000409648:P345A;ENSP00000311778:P403A;ENSP00000414723:P403A;ENSP00000396601:P371A;ENSP00000265346:P377A	ENSP00000265346:P377A	P	+	1	0	ZMIZ2	44766684	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.681000	0.54648	2.599000	0.87857	0.561000	0.74099	CCC		0.587	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449		Missense_Mutation
ZMIZ2	83637	hgsc.bcm.edu	37	7	44804074	44804074	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr7:44804074T>A	ENST00000309315.4	+	14	2040	c.1917T>A	c.(1915-1917)tgT>tgA	p.C639*	ZMIZ2_ENST00000441627.1_Nonsense_Mutation_p.C639*|ZMIZ2_ENST00000265346.7_Nonsense_Mutation_p.C613*|ZMIZ2_ENST00000433667.1_Nonsense_Mutation_p.C607*|ZMIZ2_ENST00000413916.1_Nonsense_Mutation_p.C581*	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	639					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)	p.C639*(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CTTGGAGGTGTCCTGTGTGCA	0.517																																					NSCLC(20;604 852 1948 16908 50522)											1	Substitution - Nonsense(1)	ovary(1)	7											109.0	118.0	115.0					7																	44804074		2202	4300	6502	44770599	SO:0001587	stop_gained	83637			AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.1917T>A	7.37:g.44804074T>A	ENSP00000311778:p.Cys639*		44770599	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Nonsense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	SNP	58	Baylor	.	.	.	.	.	.	.	.	.	.	T	38	6.775669	0.97829	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	.	.	.	5.05	0.316	0.15857	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.443	7.4739	0.27365	0.0:0.394:0.0:0.606	.	.	.	.	X	581;639;639;607;613;642	.	ENSP00000265346:C613X	C	+	3	2	ZMIZ2	44770599	0.999000	0.42202	0.997000	0.53966	0.954000	0.61252	0.535000	0.23114	0.191000	0.20236	-0.608000	0.04076	TGT		0.517	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449		Nonsense_Mutation
ZNF281	23528	hgsc.bcm.edu	37	1	200377683	200377683	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1408-01	TCGA-13-1408-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr1:200377683T>C	ENST00000294740.3	-	2	1275	c.1151A>G	c.(1150-1152)aAc>aGc	p.N384S	ZNF281_ENST00000367353.1_Missense_Mutation_p.N384S|ZNF281_ENST00000367352.3_Missense_Mutation_p.N348S	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	384					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.N384S(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						ATTGGTATGGTTTGATGACCC	0.398																																																1	Substitution - Missense(1)	ovary(1)	1											145.0	147.0	147.0					1																	200377683		2203	4300	6503	198644306	SO:0001583	missense	23528			AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.1151A>G	1.37:g.200377683T>C	ENSP00000294740:p.Asn384Ser		198644306	A6NF48|B3KMX2|Q5RKW5|Q9NY92	Missense_Mutation	SNP	ENST00000294740.3	37	CCDS1402.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	2.419	-0.333518	0.05278	.	.	ENSG00000162702	ENST00000294740;ENST00000367353;ENST00000367352;ENST00000537759	T;T;T	0.07688	3.18;3.18;3.17	5.76	2.14	0.27477	.	0.494294	0.22265	N	0.062356	T	0.05044	0.0135	N	0.24115	0.695	0.30667	N	0.753785	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.35773	-0.9775	10	0.18710	T	0.47	-0.495	7.4539	0.27255	0.0:0.0765:0.2406:0.6829	.	348;384	A6NF48;Q9Y2X9	.;ZN281_HUMAN	S	384;384;348;89	ENSP00000294740:N384S;ENSP00000356322:N384S;ENSP00000356321:N348S	ENSP00000294740:N384S	N	-	2	0	ZNF281	198644306	1.000000	0.71417	0.687000	0.30102	0.997000	0.91878	2.344000	0.44010	0.101000	0.17610	0.533000	0.62120	AAC		0.398	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086879.2	NM_012482		Missense_Mutation
ZNF500	26048	hgsc.bcm.edu	37	16	4802736	4802736	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1408-01	TCGA-13-1408-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr16:4802736A>C	ENST00000219478.6	-	6	1383	c.1084T>G	c.(1084-1086)Ttt>Gtt	p.F362V	ZNF500_ENST00000591026.1_5'UTR|RP11-127I20.7_ENST00000588099.1_RNA|ZNF500_ENST00000545009.1_Missense_Mutation_p.F362V			O60304	ZN500_HUMAN	zinc finger protein 500	362					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						CGGTCGCTAAAGCCCTTCCCA	0.617																																																0			16											95.0	80.0	85.0					16																	4802736		2197	4300	6497	4742737	SO:0001583	missense	26048			AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.1084T>G	16.37:g.4802736A>C	ENSP00000219478:p.Phe362Val		4742737	A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Missense_Mutation	SNP	ENST00000219478.6	37	CCDS32383.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	23.6	4.436005	0.83885	.	.	ENSG00000103199	ENST00000545009;ENST00000219478	T;T	0.41758	0.99;0.99	3.92	3.92	0.45320	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.71195	0.3311	H	0.94345	3.525	0.35975	D	0.835637	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82281	-0.0535	9	0.87932	D	0	.	10.7141	0.46002	1.0:0.0:0.0:0.0	.	362;362	B4DNN9;O60304	.;ZN500_HUMAN	V	362	ENSP00000445714:F362V;ENSP00000219478:F362V	ENSP00000219478:F362V	F	-	1	0	ZNF500	4742737	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.436000	0.73417	1.423000	0.47198	0.533000	0.62120	TTT		0.617	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432461.1	XM_085507		Missense_Mutation
ZNF689	115509	hgsc.bcm.edu	37	16	30616582	30616582	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1408-01	TCGA-13-1408-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr16:30616582C>A	ENST00000287461.3	-	3	843	c.506G>T	c.(505-507)tGc>tTc	p.C169F	RP11-146F11.5_ENST00000563540.1_RNA|ZNF689_ENST00000566673.1_5'UTR	NM_138447.1	NP_612456.1	Q96CS4	ZN689_HUMAN	zinc finger protein 689	169					regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(1)	14			Colorectal(24;0.198)			ATTCTGGGCGCACTTGTGGCT	0.617																																																0			16											73.0	79.0	77.0					16																	30616582		2197	4300	6497	30524083	SO:0001583	missense	115509			BC014000	CCDS10686.1	16p11.2	2013-01-08			ENSG00000156853	ENSG00000156853		"""Zinc fingers, C2H2-type"", ""-"""	25173	protein-coding gene	gene with protein product							Standard	NM_138447		Approved	FLJ90415	uc031qvq.1	Q96CS4	OTTHUMG00000132415	ENST00000287461.3:c.506G>T	16.37:g.30616582C>A	ENSP00000287461:p.Cys169Phe		30524083	Q658J5	Missense_Mutation	SNP	ENST00000287461.3	37	CCDS10686.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	c	3.506	-0.100705	0.06967	.	.	ENSG00000156853	ENST00000287461;ENST00000443190	T	0.27256	1.68	4.94	2.96	0.34315	Zinc finger, C2H2-like (1);	0.000000	0.42420	D	0.000713	T	0.15003	0.0362	N	0.16166	0.38	0.09310	N	1	P	0.50710	0.938	B	0.42282	0.382	T	0.08806	-1.0704	10	0.72032	D	0.01	-7.4962	9.5227	0.39145	0.0:0.8235:0.0:0.1765	.	169	Q96CS4	ZN689_HUMAN	F	169	ENSP00000287461:C169F	ENSP00000287461:C169F	C	-	2	0	ZNF689	30524083	0.000000	0.05858	0.997000	0.53966	0.002000	0.02628	-0.779000	0.04659	1.314000	0.45095	-0.259000	0.10710	TGC		0.617	ZNF689-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255552.1	NM_138447		Missense_Mutation
ZNRF4	148066	hgsc.bcm.edu	37	19	5456269	5456269	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1408-01	TCGA-13-1408-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-13-1408-01	TCGA-13-1408-10	g.chr19:5456269G>C	ENST00000222033.4	+	1	844	c.767G>C	c.(766-768)tGg>tCg	p.W256S		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	256						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.W256S(1)		NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		ACCGTGTCCTGGGTGCTGGGC	0.682																																																1	Substitution - Missense(1)	lung(1)	19											44.0	48.0	47.0					19																	5456269		2160	4251	6411	5407269	SO:0001583	missense	148066			AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.767G>C	19.37:g.5456269G>C	ENSP00000222033:p.Trp256Ser		5407269	A8K886|O75866	Missense_Mutation	SNP	ENST00000222033.4	37	CCDS42475.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.83	2.054864	0.36277	.	.	ENSG00000105428	ENST00000222033	T	0.04360	3.64	4.33	3.22	0.36961	.	0.335128	0.27710	U	0.018167	T	0.11281	0.0275	L	0.36672	1.1	0.18873	N	0.999986	D	0.71674	0.998	D	0.77557	0.99	T	0.08432	-1.0722	10	0.38643	T	0.18	.	9.7622	0.40539	0.0:0.0:0.7362:0.2638	.	256	Q8WWF5	ZNRF4_HUMAN	S	256	ENSP00000222033:W256S	ENSP00000222033:W256S	W	+	2	0	ZNRF4	5407269	0.873000	0.30073	0.004000	0.12327	0.090000	0.18270	2.183000	0.42565	0.626000	0.30322	0.491000	0.48974	TGG		0.682	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450924.1	NM_181710		Missense_Mutation
