#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ZC3H12A	80149	broad.mit.edu	37	1	37945952	37945952	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr1:37945952G>A	ENST00000373087.6	+	3	621	c.505G>A	c.(505-507)Gag>Aag	p.E169K		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A									p.E169K(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTGGTTTCTGGAGCGGGGCCA	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											88.0	76.0	80.0					1																	37945952		2203	4300	6503	37718539	SO:0001583	missense	80149				CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.505G>A	1.37:g.37945952G>A	ENSP00000362179:p.Glu169Lys		37718539		Missense_Mutation	SNP	ENST00000373087.6	37	CCDS417.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.735931	0.96865	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.40756	1.02	4.8	4.8	0.61643	Ribonuclease Zc3h12a-like (1);	0.173078	0.49916	D	0.000126	T	0.30916	0.0780	N	0.05050	-0.12	0.80722	D	1	B	0.33379	0.41	B	0.41174	0.349	T	0.20405	-1.0276	10	0.27082	T	0.32	-33.2722	18.2296	0.89929	0.0:0.0:1.0:0.0	.	169	Q5D1E8	ZC12A_HUMAN	K	169	ENSP00000362179:E169K	ENSP00000362174:E169K	E	+	1	0	ZC3H12A	37718539	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.428000	0.80296	2.387000	0.81309	0.563000	0.77884	GAG		0.622	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079		Missense_Mutation
SNX7	51375	broad.mit.edu	37	1	99156719	99156719	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr1:99156719C>G	ENST00000306121.3	+	3	461	c.452C>G	c.(451-453)gCa>gGa	p.A151G	SNX7_ENST00000529992.1_Missense_Mutation_p.A151G|SNX7_ENST00000370189.5_Missense_Mutation_p.A87G	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	87	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.A87G(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		CTGGAAGAAGCACACCCCACT	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											83.0	79.0	80.0					1																	99156719		2203	4300	6503	98929307	SO:0001583	missense	51375			AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.452C>G	1.37:g.99156719C>G	ENSP00000304429:p.Ala151Gly		98929307	A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Missense_Mutation	SNP	ENST00000306121.3	37	CCDS755.2	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653451	0.47362	.	.	ENSG00000162627	ENST00000370189;ENST00000529992;ENST00000306121;ENST00000454199	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.98	5.07	0.68467	.	0.200083	0.53938	D	0.000052	T	0.44329	0.1288	L	0.49513	1.565	0.52099	D	0.999942	D;B;B	0.58970	0.984;0.364;0.251	P;B;B	0.59487	0.858;0.238;0.124	T	0.41893	-0.9483	10	0.46703	T	0.11	-14.4262	15.1792	0.72941	0.0:0.9329:0.0:0.0671	.	151;151;87	E9PNL2;Q9UNH6-3;Q9UNH6-2	.;.;.	G	87;151;151;87	ENSP00000359208:A87G;ENSP00000434731:A151G;ENSP00000304429:A151G;ENSP00000388266:A87G	ENSP00000304429:A151G	A	+	2	0	SNX7	98929307	0.872000	0.30054	0.989000	0.46669	0.895000	0.52256	1.672000	0.37523	1.544000	0.49359	0.650000	0.86243	GCA		0.363	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029609.2			Missense_Mutation
CELSR2	1952	broad.mit.edu	37	1	109793755	109793755	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr1:109793755C>T	ENST00000271332.3	+	1	1115	c.1054C>T	c.(1054-1056)Cgt>Tgt	p.R352C		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	352	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.R352C(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GATCCGAACCCGTGGCCCTGT	0.627																																					NSCLC(158;1285 2011 34800 34852 42084)											1	Substitution - Missense(1)	ovary(1)	1											49.0	53.0	52.0					1																	109793755		2203	4300	6503	109595278	SO:0001583	missense	1952			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.1054C>T	1.37:g.109793755C>T	ENSP00000271332:p.Arg352Cys		109595278	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	N	12.96	2.095815	0.36952	.	.	ENSG00000143126	ENST00000271332	T	0.01745	4.66	4.99	4.06	0.47325	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01558	0.0050	M	0.76727	2.345	0.31192	N	0.700803	B	0.24426	0.103	B	0.25140	0.058	T	0.21552	-1.0242	9	0.59425	D	0.04	.	13.875	0.63647	0.3518:0.6482:0.0:0.0	.	352	Q9HCU4	CELR2_HUMAN	C	352	ENSP00000271332:R352C	ENSP00000271332:R352C	R	+	1	0	CELSR2	109595278	0.100000	0.21855	0.976000	0.42696	0.996000	0.88848	1.166000	0.31834	1.321000	0.45227	0.555000	0.69702	CGT		0.627	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408		Missense_Mutation
CD1D	912	broad.mit.edu	37	1	158152681	158152681	+	Silent	SNP	C	C	T	rs371162796		TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr1:158152681C>T	ENST00000368171.3	+	5	1120	c.621C>T	c.(619-621)gcC>gcT	p.A207A		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	207	Ig-like.				antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)	p.A207A(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					AGCCCAAGGCCTGGCTGTCCC	0.552																																																1	Substitution - coding silent(1)	ovary(1)	1						C		0,4406		0,0,2203	74.0	78.0	77.0		621	2.3	1.0	1		77	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CD1D	NM_001766.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		207/336	158152681	1,13005	2203	4300	6503	156419305	SO:0001819	synonymous_variant	912			BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.621C>T	1.37:g.158152681C>T			156419305	D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Silent	SNP	ENST00000368171.3	37	CCDS1173.1	SNP	24	Broad																																																																																				0.552	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1	NM_001766		Silent
CACNA1E	777	broad.mit.edu	37	1	181726188	181726188	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr1:181726188G>C	ENST00000367573.2	+	30	4255	c.4255G>C	c.(4255-4257)Gtg>Ctg	p.V1419L	CACNA1E_ENST00000526775.1_Missense_Mutation_p.V1400L|CACNA1E_ENST00000360108.3_Missense_Mutation_p.V1400L|CACNA1E_ENST00000358338.5_Missense_Mutation_p.V1351L|CACNA1E_ENST00000367567.4_Missense_Mutation_p.V1026L|CACNA1E_ENST00000357570.5_Missense_Mutation_p.V1370L|CACNA1E_ENST00000367570.1_Missense_Mutation_p.V1419L	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1419					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.V1419L(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CAATATCTTTGTGGCTCTCAT	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											157.0	155.0	155.0					1																	181726188		1942	4160	6102	179992811	SO:0001583	missense	777			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4255G>C	1.37:g.181726188G>C	ENSP00000356545:p.Val1419Leu		179992811	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.430319	0.96150	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98329	-4.87;-4.87;-4.87;-4.87;-4.87;-4.87;-4.87	5.75	5.75	0.90469	Ion transport (1);	0.061993	0.64402	D	0.000003	D	0.98520	0.9506	L	0.49699	1.58	0.80722	D	1	P;D;D	0.67145	0.653;0.987;0.996	D;D;D	0.78314	0.917;0.991;0.987	D	0.99461	1.0943	10	0.52906	T	0.07	.	19.5549	0.95342	0.0:0.0:1.0:0.0	.	1400;1419;1419	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	L	1419;1400;1370;1351;1026;1400;1419	ENSP00000356542:V1419L;ENSP00000434814:V1400L;ENSP00000350183:V1370L;ENSP00000351101:V1351L;ENSP00000356539:V1026L;ENSP00000353222:V1400L;ENSP00000356545:V1419L	ENSP00000350183:V1370L	V	+	1	0	CACNA1E	179992811	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.731000	0.98807	2.716000	0.92895	0.655000	0.94253	GTG		0.478	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		Missense_Mutation
PFKFB3	5209	broad.mit.edu	37	10	6261552	6261552	+	Silent	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr10:6261552G>A	ENST00000379775.4	+	7	849	c.519G>A	c.(517-519)ccG>ccA	p.P173P	PFKFB3_ENST00000540253.1_Silent_p.P187P|PFKFB3_ENST00000360521.2_Silent_p.P173P|PFKFB3_ENST00000379782.3_Silent_p.P173P|PFKFB3_ENST00000379789.4_Silent_p.P153P|PFKFB3_ENST00000379785.1_Silent_p.P173P|PFKFB3_ENST00000317350.4_Silent_p.P173P|PFKFB3_ENST00000536985.1_Missense_Mutation_p.R170Q	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	173	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)	p.P173P(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						TCTCCAGCCCGGATTACAAAG	0.507																																																1	Substitution - coding silent(1)	ovary(1)	10											81.0	81.0	81.0					10																	6261552		2203	4300	6503	6301558	SO:0001819	synonymous_variant	5209				CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.519G>A	10.37:g.6261552G>A			6301558	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Silent	SNP	ENST00000379775.4	37	CCDS7078.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595999	0.46318	.	.	ENSG00000170525	ENST00000536985	.	.	.	5.37	-3.91	0.04168	.	.	.	.	.	T	0.45478	0.1344	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53486	-0.8432	5	0.54805	T	0.06	-13.7832	2.015	0.03496	0.4323:0.0909:0.1288:0.348	.	.	.	.	Q	170	.	ENSP00000443319:R170Q	R	+	2	0	PFKFB3	6301558	0.002000	0.14202	0.990000	0.47175	0.599000	0.36880	-1.171000	0.03115	-0.220000	0.09988	-0.216000	0.12614	CGG		0.507	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046647.1			Silent
ATAD1	84896	broad.mit.edu	37	10	89514454	89514454	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr10:89514454C>A	ENST00000308448.7	-	10	1454	c.1076G>T	c.(1075-1077)tGt>tTt	p.C359F	ATAD1_ENST00000328142.3_Missense_Mutation_p.C359F|ATAD1_ENST00000400215.3_Missense_Mutation_p.C271F	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	359					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.C359F(1)		kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		TTAATCTAAACAAACATGTGT	0.373																																																1	Substitution - Missense(1)	ovary(1)	10											99.0	85.0	90.0					10																	89514454		2203	4300	6503	89504434	SO:0001583	missense	84896			AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.1076G>T	10.37:g.89514454C>A	ENSP00000339017:p.Cys359Phe		89504434	D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	ENST00000308448.7	37	CCDS7386.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767869	0.31320	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215	D;D;D	0.96104	-3.29;-3.29;-3.91	5.48	4.57	0.56435	.	0.320888	0.37577	N	0.002038	D	0.88134	0.6355	N	0.08118	0	0.80722	D	1	B;B	0.11235	0.004;0.001	B;B	0.08055	0.003;0.003	D	0.83471	0.0059	10	0.39692	T	0.17	-4.1679	10.545	0.45056	0.1396:0.789:0.0:0.0714	.	271;359	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	F	359;359;271	ENSP00000339017:C359F;ENSP00000339016:C359F;ENSP00000412968:C271F	ENSP00000339017:C359F	C	-	2	0	ATAD1	89504434	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.211000	0.51137	1.441000	0.47550	0.563000	0.77884	TGT		0.373	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049235.1	NM_032810		Missense_Mutation
TRAF6	7189	broad.mit.edu	37	11	36511561	36511561	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr11:36511561G>A	ENST00000526995.1	-	7	1642	c.1396C>T	c.(1396-1398)Cgg>Tgg	p.R466W	TRAF6_ENST00000348124.5_Missense_Mutation_p.R466W|TRAF6_ENST00000529150.1_5'Flank	NM_004620.3	NP_004611.1	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6, E3 ubiquitin protein ligase	466	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of protein kinase activity (GO:0032147)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic signaling pathway (GO:0097190)|bone resorption (GO:0045453)|cell development (GO:0048468)|cellular response to lipopolysaccharide (GO:0071222)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein autoubiquitination (GO:0051865)|protein complex assembly (GO:0006461)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of immunoglobulin secretion (GO:0051023)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	histone deacetylase binding (GO:0042826)|ligase activity (GO:0016874)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R466W(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)	27	all_lung(20;0.211)	all_hematologic(20;0.107)				TTTGGGTTCCGTGGGATTGTG	0.438																																																1	Substitution - Missense(1)	ovary(1)	11											87.0	83.0	85.0					11																	36511561		2202	4295	6497	36468137	SO:0001583	missense	7189				CCDS7901.1	11p12	2013-01-09	2012-02-23		ENSG00000175104	ENSG00000175104		"""RING-type (C3HC4) zinc fingers"""	12036	protein-coding gene	gene with protein product		602355	"""TNF receptor-associated factor 6"""			8837778	Standard	NM_004620		Approved	RNF85	uc001mws.2	Q9Y4K3	OTTHUMG00000166391	ENST00000526995.1:c.1396C>T	11.37:g.36511561G>A	ENSP00000433623:p.Arg466Trp		36468137	A6NKI7|A8KAB3|D3DR16|Q8NEH5	Missense_Mutation	SNP	ENST00000526995.1	37	CCDS7901.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033496	0.75504	.	.	ENSG00000175104	ENST00000526995;ENST00000348124	D;D	0.83506	-1.73;-1.73	5.46	4.54	0.55810	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	D	0.90930	0.7149	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.92051	0.5648	10	0.72032	D	0.01	-20.8278	13.5832	0.61915	0.0:0.0:0.7169:0.2831	.	466	Q9Y4K3	TRAF6_HUMAN	W	466	ENSP00000433623:R466W;ENSP00000337853:R466W	ENSP00000337853:R466W	R	-	1	2	TRAF6	36468137	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	6.577000	0.74027	1.428000	0.47296	0.555000	0.69702	CGG		0.438	TRAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389530.1	NM_145803		Missense_Mutation
CNTN5	53942	broad.mit.edu	37	11	99715587	99715587	+	Missense_Mutation	SNP	G	G	A	rs201704992		TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr11:99715587G>A	ENST00000524871.1	+	5	571	c.281G>A	c.(280-282)aGt>aAt	p.S94N	CNTN5_ENST00000527185.1_Missense_Mutation_p.S94N|CNTN5_ENST00000279463.3_Missense_Mutation_p.S94N|CNTN5_ENST00000418526.2_Missense_Mutation_p.S20N|CNTN5_ENST00000528682.1_Missense_Mutation_p.S94N	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	94					cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.S94N(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TTTACAGAAAGTGTGGACTAT	0.323																																																1	Substitution - Missense(1)	ovary(1)	11											139.0	127.0	131.0					11																	99715587		1825	4074	5899	99220797	SO:0001583	missense	53942			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.281G>A	11.37:g.99715587G>A	ENSP00000435637:p.Ser94Asn		99220797	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	9.792	1.178209	0.21787	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.56776	0.44;0.5;0.5;0.5;0.5	5.33	5.33	0.75918	.	0.092578	0.85682	D	0.000000	T	0.39759	0.1090	N	0.19112	0.55	0.49389	D	0.99978	B;B;B	0.23128	0.048;0.08;0.015	B;B;B	0.23716	0.021;0.048;0.01	T	0.18903	-1.0322	10	0.15952	T	0.53	.	18.3699	0.90403	0.0:0.0:1.0:0.0	.	94;20;94	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	N	94;94;94;20;94	ENSP00000433575:S94N;ENSP00000436185:S94N;ENSP00000435637:S94N;ENSP00000393229:S20N;ENSP00000279463:S94N	ENSP00000279463:S94N	S	+	2	0	CNTN5	99220797	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	2.685000	0.46959	2.653000	0.90120	0.650000	0.86243	AGT		0.323	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		Missense_Mutation
C11orf87	399947	broad.mit.edu	37	11	109294829	109294829	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr11:109294829C>G	ENST00000327419.6	+	2	873	c.470C>G	c.(469-471)cCg>cGg	p.P157R	RP11-708B6.2_ENST00000532992.1_RNA|RP11-708B6.2_ENST00000532929.1_RNA	NM_207645.3	NP_997528.2	Q6NUJ2	CK087_HUMAN	chromosome 11 open reading frame 87	157						integral component of membrane (GO:0016021)		p.P157R(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17						CCTGGCCTCCCGTGCCAGGGT	0.672																																																1	Substitution - Missense(1)	ovary(1)	11											43.0	47.0	46.0					11																	109294829		2201	4296	6497	108800039	SO:0001583	missense	399947			AB096240, BC035798	CCDS31672.1	11q22.3	2013-12-13	2013-12-13	2013-12-13	ENSG00000185742	ENSG00000185742			33788	protein-coding gene	gene with protein product	"""neuronal integral membrane protein 1"""					12477932	Standard	NM_207645		Approved	LOH11CR1A, LOC399947, NEURIM1	uc010rwb.2	Q6NUJ2		ENST00000327419.6:c.470C>G	11.37:g.109294829C>G	ENSP00000331581:p.Pro157Arg		108800039	B4E169	Missense_Mutation	SNP	ENST00000327419.6	37	CCDS31672.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	3.883	-0.025515	0.07589	.	.	ENSG00000185742	ENST00000327419	.	.	.	3.7	1.7	0.24286	.	0.117442	0.31601	U	0.007380	T	0.14743	0.0356	N	0.08118	0	0.21933	N	0.999467	B	0.22983	0.078	B	0.23275	0.045	T	0.11665	-1.0578	9	0.54805	T	0.06	-2.6201	1.527	0.02527	0.2459:0.4406:0.1849:0.1286	.	157	Q6NUJ2	CK087_HUMAN	R	157	.	ENSP00000331581:P157R	P	+	2	0	C11orf87	108800039	0.116000	0.22171	0.926000	0.36857	0.972000	0.66771	-0.299000	0.08254	0.469000	0.27268	0.655000	0.94253	CCG		0.672	C11orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390403.1	NM_207645		Missense_Mutation
STYK1	55359	broad.mit.edu	37	12	10775266	10775266	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr12:10775266C>A	ENST00000075503.3	-	9	1458	c.938G>T	c.(937-939)gGg>gTg	p.G313V		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	313	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.G313V(1)		breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						GAGCAGGATCCCAAAAGACCA	0.383										HNSCC(73;0.22)																																						1	Substitution - Missense(1)	ovary(1)	12											146.0	137.0	140.0					12																	10775266		2203	4300	6503	10666533	SO:0001583	missense	55359			AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.938G>T	12.37:g.10775266C>A	ENSP00000075503:p.Gly313Val		10666533	B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Missense_Mutation	SNP	ENST00000075503.3	37	CCDS8629.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	19.89	3.910224	0.72983	.	.	ENSG00000060140	ENST00000075503	D	0.93906	-3.31	5.38	5.38	0.77491	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.98153	0.9390	H	0.98883	4.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99253	1.0888	10	0.87932	D	0	-16.8521	14.6237	0.68605	0.0:1.0:0.0:0.0	.	313	Q6J9G0	STYK1_HUMAN	V	313	ENSP00000075503:G313V	ENSP00000075503:G313V	G	-	2	0	STYK1	10666533	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.656000	0.61483	2.503000	0.84419	0.650000	0.86243	GGG		0.383	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399622.1	NM_018423		Missense_Mutation
CASC1	55259	broad.mit.edu	37	12	25297493	25297493	+	Missense_Mutation	SNP	G	G	A	rs369607694		TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr12:25297493G>A	ENST00000320267.9	-	8	871	c.790C>T	c.(790-792)Cac>Tac	p.H264Y	CASC1_ENST00000545133.1_Missense_Mutation_p.H205Y|CASC1_ENST00000395990.2_Missense_Mutation_p.H224Y|CASC1_ENST00000354189.5_Missense_Mutation_p.H328Y|CASC1_ENST00000557684.1_5'UTR|CASC1_ENST00000537577.1_Missense_Mutation_p.H152Y|CASC1_ENST00000395987.3_Missense_Mutation_p.H270Y	NM_001082973.1	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1	264								p.H270Y(1)		breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(3)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			GAAACAGGGTGCAGTGCAGAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	12											194.0	177.0	182.0					12																	25297493		2203	4300	6503	25188760	SO:0001583	missense	55259			AK093102	CCDS31759.2, CCDS41762.1, CCDS41763.1, CCDS55810.1, CCDS55811.1	12p12.1	2012-04-17			ENSG00000118307	ENSG00000118307		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 54"""					14583591	Standard	NM_018272		Approved	LAS1, FLJ10921, PPP1R54	uc001rgk.3	Q6TDU7	OTTHUMG00000150195	ENST00000320267.9:c.790C>T	12.37:g.25297493G>A	ENSP00000313141:p.His264Tyr		25188760	B4DNP2|F5H6T6|Q17RL2|Q4G171|Q5U5K5|Q9NV50	Missense_Mutation	SNP	ENST00000320267.9	37	CCDS41762.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.831554	0.00584	.	.	ENSG00000118307	ENST00000354189;ENST00000395987;ENST00000320267;ENST00000395990;ENST00000537577;ENST00000395992;ENST00000545133	T;T;T;T;T	0.43688	0.94;1.55;1.55;0.97;0.97	4.53	-9.05	0.00730	Casc1 domain (1);	3.469510	0.00397	N	0.000056	T	0.14356	0.0347	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.33904	-0.9850	10	0.02654	T	1	23.2443	1.3321	0.02137	0.2059:0.2479:0.1225:0.4237	.	152;205;328;264;270	F5H555;F5H6T6;Q6TDU7-3;Q6TDU7;F8W8F9	.;.;.;CASC1_HUMAN;.	Y	328;270;264;224;152;270;205	ENSP00000346126:H328Y;ENSP00000379310:H270Y;ENSP00000313141:H264Y;ENSP00000379313:H224Y;ENSP00000437373:H205Y	ENSP00000313141:H264Y	H	-	1	0	CASC1	25188760	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.227000	0.02950	-3.599000	0.00134	0.643000	0.83706	CAC		0.403	CASC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316761.1	NM_018272		Missense_Mutation
TMEM132D	121256	broad.mit.edu	37	12	129566316	129566316	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr12:129566316C>T	ENST00000422113.2	-	7	2237	c.1911G>A	c.(1909-1911)atG>atA	p.M637I	TMEM132D_ENST00000389441.4_Missense_Mutation_p.M175I	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	637					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.M637I(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GAATGGTGGTCATCCCAAGCT	0.488																																																1	Substitution - Missense(1)	ovary(1)	12											41.0	40.0	40.0					12																	129566316		2203	4299	6502	128132269	SO:0001583	missense	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1911G>A	12.37:g.129566316C>T	ENSP00000408581:p.Met637Ile		128132269	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	6.136	0.393256	0.11638	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.13196	2.61;2.61	4.53	3.62	0.41486	.	0.000000	0.85682	D	0.000000	T	0.14141	0.0342	L	0.51422	1.61	0.42232	D	0.991894	B;B	0.28584	0.041;0.216	B;B	0.27887	0.011;0.084	T	0.04454	-1.0950	9	.	.	.	-63.2651	14.3573	0.66745	0.0:0.8504:0.1496:0.0	.	637;175	Q14C87;Q14C87-2	T132D_HUMAN;.	I	175;637	ENSP00000374092:M175I;ENSP00000408581:M637I	.	M	-	3	0	TMEM132D	128132269	1.000000	0.71417	1.000000	0.80357	0.675000	0.39556	1.103000	0.31062	0.851000	0.35264	0.561000	0.74099	ATG		0.488	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		Missense_Mutation
RPGRIP1	57096	broad.mit.edu	37	14	21785911	21785911	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr14:21785911C>A	ENST00000400017.2	+	10	1208	c.1208C>A	c.(1207-1209)gCg>gAg	p.A403E	RPGRIP1_ENST00000382933.4_Missense_Mutation_p.A45E|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.A403E|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.A376E|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.A376E	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	403					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)		p.A19E(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		GAGCTCATAGCGGAACAGCTA	0.542																																																1	Substitution - Missense(1)	ovary(1)	14											27.0	27.0	27.0					14																	21785911		1989	4164	6153	20855751	SO:0001583	missense	57096			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.1208C>A	14.37:g.21785911C>A	ENSP00000382895:p.Ala403Glu		20855751	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	37	CCDS45080.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	0.003	-2.536105	0.00143	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933;ENST00000557351	T;T;T;T;T	0.70164	0.4;-0.43;-0.46;-0.46;0.13	4.44	-1.19	0.09585	.	0.651851	0.15129	N	0.278925	T	0.26448	0.0646	N	0.02802	-0.49	0.09310	N	0.999999	P;P;B	0.41748	0.761;0.53;0.357	B;B;B	0.35413	0.202;0.198;0.071	T	0.46707	-0.9172	10	0.02654	T	1	-0.0669	4.1201	0.10101	0.0993:0.4767:0.2744:0.1495	.	45;19;403	Q96KN7-4;Q96KN7-5;Q96KN7	.;.;RPGR1_HUMAN	E	376;376;403;403;45;45	ENSP00000450445:A376E;ENSP00000451219:A376E;ENSP00000382895:A403E;ENSP00000206660:A403E;ENSP00000372391:A45E	ENSP00000206660:A403E	A	+	2	0	RPGRIP1	20855751	0.000000	0.05858	0.004000	0.12327	0.101000	0.19017	-0.241000	0.08940	-0.094000	0.12374	-1.465000	0.01017	GCG		0.542	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366		Missense_Mutation
DACT1	51339	broad.mit.edu	37	14	59112483	59112483	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr14:59112483C>T	ENST00000335867.4	+	4	1166	c.1142C>T	c.(1141-1143)cCg>cTg	p.P381L	DACT1_ENST00000541264.2_Missense_Mutation_p.P100L|DACT1_ENST00000556859.1_Missense_Mutation_p.P100L|DACT1_ENST00000395153.3_Missense_Mutation_p.P344L			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	381					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)	p.P381L(1)		endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						GTCAGAGCCCCGGGCGGTGTC	0.537																																																1	Substitution - Missense(1)	ovary(1)	14											58.0	63.0	61.0					14																	59112483		2203	4300	6503	58182236	SO:0001583	missense	51339			AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1142C>T	14.37:g.59112483C>T	ENSP00000337439:p.Pro381Leu		58182236	A8MYJ2|Q86TY0	Missense_Mutation	SNP	ENST00000335867.4	37	CCDS9736.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	7.522	0.656940	0.14580	.	.	ENSG00000165617	ENST00000556859;ENST00000421793;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92	5.46	4.57	0.56435	.	0.854545	0.10717	N	0.642183	T	0.24967	0.0606	N	0.12887	0.27	0.09310	N	0.999991	P;P	0.37330	0.59;0.59	B;B	0.30855	0.121;0.084	T	0.05386	-1.0888	10	0.22109	T	0.4	0.5645	14.1646	0.65469	0.0:0.9278:0.0:0.0722	.	344;381	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	L	100;100;100;344;381;100	ENSP00000451598:P100L;ENSP00000404297:P100L;ENSP00000378581:P100L;ENSP00000378582:P344L;ENSP00000337439:P381L;ENSP00000442850:P100L	ENSP00000337439:P381L	P	+	2	0	DACT1	58182236	0.156000	0.22821	0.002000	0.10522	0.044000	0.14063	2.855000	0.48333	1.324000	0.45282	0.563000	0.77884	CCG		0.537	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651		Missense_Mutation
AHNAK2	113146	broad.mit.edu	37	14	105412407	105412407	+	Silent	SNP	C	C	A	rs374653111	byFrequency	TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr14:105412407C>A	ENST00000333244.5	-	7	9500	c.9381G>T	c.(9379-9381)ggG>ggT	p.G3127G	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3127						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.G3127G(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGACAGGTCCCCCTCCAGCC	0.622													.|||	3	0.000599042	0.0008	0.0	5008	,	,		18147	0.001		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	14						A		0,3924		0,0,1962	152.0	129.0	136.0		9381	-6.6	0.0	14		136	2,8232		0,2,4115	no	coding-synonymous	AHNAK2	NM_138420.2		0,2,6077	AA,AC,CC		0.0243,0.0,0.0165		3127/5796	105412407	2,12156	1962	4117	6079	104483452	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9381G>T	14.37:g.105412407C>A			104483452	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1	SNP	22	Broad																																																																																				0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Silent
THBS1	7057	broad.mit.edu	37	15	39880771	39880771	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr15:39880771G>C	ENST00000260356.5	+	10	1681	c.1516G>C	c.(1516-1518)Gtc>Ctc	p.V506L		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	506	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)	p.V506L(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		CATCTGTTCTGTCACCTGTGG	0.498																																																1	Substitution - Missense(1)	ovary(1)	15											81.0	79.0	80.0					15																	39880771		2200	4297	6497	37668063	SO:0001583	missense	7057				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.1516G>C	15.37:g.39880771G>C	ENSP00000260356:p.Val506Leu		37668063	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	CCDS32194.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	18.00	3.524903	0.64747	.	.	ENSG00000137801	ENST00000260356	T	0.64438	-0.1	5.87	5.87	0.94306	.	0.000000	0.32802	N	0.005635	T	0.62466	0.2430	M	0.61703	1.905	0.45594	D	0.998534	B	0.02656	0.0	B	0.04013	0.001	T	0.56183	-0.8021	10	0.24483	T	0.36	-37.1278	20.1976	0.98245	0.0:0.0:1.0:0.0	.	506	P07996	TSP1_HUMAN	L	506	ENSP00000260356:V506L	ENSP00000260356:V506L	V	+	1	0	THBS1	37668063	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.621000	0.54210	2.772000	0.95346	0.655000	0.94253	GTC		0.498	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246		Missense_Mutation
RPLP1	6176	broad.mit.edu	37	15	69745309	69745309	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr15:69745309G>A	ENST00000260379.6	+	1	187	c.22G>A	c.(22-24)Gcc>Acc	p.A8T	RPLP1_ENST00000357790.5_Missense_Mutation_p.A8T|RPLP1_ENST00000560274.1_Missense_Mutation_p.A8T	NM_001003.2	NP_000994.1	P05386	RLA1_HUMAN	ribosomal protein, large, P1	8					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.A8T(1)		ovary(1)	1						CTCCGAGCTCGCCTGCATCTA	0.692																																																1	Substitution - Missense(1)	ovary(1)	15											11.0	9.0	10.0					15																	69745309		2189	4272	6461	67532363	SO:0001583	missense	6176				CCDS10233.1, CCDS10234.1	15q22	2011-07-29			ENSG00000137818	ENSG00000137818		"""L ribosomal proteins"""	10372	protein-coding gene	gene with protein product		180520					Standard	NM_001003		Approved	LP1	uc002asd.1	P05386	OTTHUMG00000133359	ENST00000260379.6:c.22G>A	15.37:g.69745309G>A	ENSP00000346037:p.Ala8Thr		67532363	A6NIB2	Missense_Mutation	SNP	ENST00000260379.6	37	CCDS10233.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	16.43	3.120862	0.56613	.	.	ENSG00000137818	ENST00000260379;ENST00000357790	.	.	.	4.54	3.62	0.41486	.	0.120570	0.56097	N	0.000033	T	0.57562	0.2062	M	0.89715	3.055	0.29880	N	0.826094	B;B	0.11235	0.001;0.004	B;B	0.09377	0.001;0.004	T	0.59364	-0.7468	9	0.45353	T	0.12	.	9.9929	0.41883	0.0989:0.0:0.9011:0.0	.	8;8	A6NIB2;P05386	.;RLA1_HUMAN	T	8	.	ENSP00000346037:A8T	A	+	1	0	RPLP1	67532363	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	8.907000	0.92634	1.125000	0.41998	0.455000	0.32223	GCC		0.692	RPLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257195.2	NM_001003		Missense_Mutation
MYH8	4626	broad.mit.edu	37	17	10302910	10302910	+	Missense_Mutation	SNP	C	C	T	rs536291125		TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr17:10302910C>T	ENST00000403437.2	-	28	3906	c.3812G>A	c.(3811-3813)cGg>cAg	p.R1271Q	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1271					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.R1271Q(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						ATTGATCAGCCGCTGCTGCTC	0.483									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling				C|||	1	0.000199681	0.0	0.0	5008	,	,		17183	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	17											140.0	129.0	133.0					17																	10302910		2203	4300	6503	10243635	SO:0001583	missense	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3812G>A	17.37:g.10302910C>T	ENSP00000384330:p.Arg1271Gln		10243635	Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	CCDS11153.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.584790	0.96578	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.83673	-1.75	5.38	5.38	0.77491	Myosin tail (1);	0.000000	0.38548	U	0.001656	D	0.84275	0.5436	M	0.78637	2.42	0.54753	D	0.99998	P	0.39883	0.693	B	0.38458	0.274	D	0.84164	0.0430	10	0.37606	T	0.19	.	19.317	0.94218	0.0:1.0:0.0:0.0	.	1271	P13535	MYH8_HUMAN	Q	1271	ENSP00000384330:R1271Q	ENSP00000252173:R1271Q	R	-	2	0	MYH8	10243635	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.573000	0.82421	2.806000	0.96561	0.655000	0.94253	CGG		0.483	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		Missense_Mutation
TRIM16	10626	broad.mit.edu	37	17	15535020	15535020	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr17:15535020C>A	ENST00000578237.1	-	10	1879	c.1024G>T	c.(1024-1026)Gac>Tac	p.D342Y	RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.D342Y|TRIM16_ENST00000336708.7_Missense_Mutation_p.D342Y|TRIM16_ENST00000416464.2_Missense_Mutation_p.D212Y|TRIM16_ENST00000579219.1_Intron|TRIM16_ENST00000577886.1_Missense_Mutation_p.D126Y			O95361	TRI16_HUMAN	tripartite motif containing 16	342					histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)	p.D342Y(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		GTTCTGATGTCATACTCCTCT	0.493																																																1	Substitution - Missense(1)	ovary(1)	17											123.0	103.0	110.0					17																	15535020		2203	4300	6503	15475745	SO:0001583	missense	10626			AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.1024G>T	17.37:g.15535020C>A	ENSP00000463188:p.Asp342Tyr		15475745	Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Missense_Mutation	SNP	ENST00000578237.1	37	CCDS11171.1	SNP	29	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	10.55|10.55	1.382675|1.382675	0.25031|0.25031	.|.	.|.	ENSG00000221926|ENSG00000251537	ENST00000336708;ENST00000416464|ENST00000455584	T;T|.	0.68181|.	-0.08;-0.31|.	4.61|4.61	2.58|2.58	0.30949|0.30949	.|.	0.204224|.	0.40728|.	N|.	0.001031|.	T|T	0.44953|0.44953	0.1318|0.1318	L|L	0.44542|0.44542	1.39|1.39	0.32820|0.32820	D|D	0.502673|0.502673	P;P;P|.	0.51653|.	0.947;0.906;0.94|.	P;P;P|.	0.50231|.	0.556;0.459;0.635|.	T|T	0.54118|0.54118	-0.8341|-0.8341	10|5	0.45353|.	T|.	0.12|.	.|.	9.4925|9.4925	0.38969|0.38969	0.0:0.8101:0.0:0.1899|0.0:0.8101:0.0:0.1899	.|.	212;342;356|.	B3KP96;O95361;Q59EB2|.	.;TRI16_HUMAN;.|.	Y|I	342;212|356	ENSP00000338989:D342Y;ENSP00000399918:D212Y|.	ENSP00000338989:D342Y|.	D|M	-|-	1|3	0|0	TRIM16|RP11-385D13.1	15475745|15475745	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	1.923000|1.923000	0.40055|0.40055	1.061000|1.061000	0.40601|0.40601	0.555000|0.555000	0.69702|0.69702	GAC|ATG		0.493	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130700.2	NM_006470		Missense_Mutation
NSF	4905	broad.mit.edu	37	17	44828913	44828913	+	Silent	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr17:44828913G>A	ENST00000398238.4	+	19	2195	c.2088G>A	c.(2086-2088)caG>caA	p.Q696Q	NSF_ENST00000225282.8_Silent_p.Q602Q|NSF_ENST00000575068.1_Silent_p.Q691Q	NM_006178.3	NP_006169.2	P46459	NSF_HUMAN	N-ethylmaleimide-sensitive factor	696					exocytosis (GO:0006887)|plasma membrane fusion (GO:0045026)|positive regulation of receptor recycling (GO:0001921)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|syntaxin-1 binding (GO:0017075)	p.Q696Q(1)		kidney(2)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	14		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)		CAATTGCACAGCAAGTCAAAG	0.403																																					Ovarian(25;472 742 1472 36813 50223)											1	Substitution - coding silent(1)	ovary(1)	17											111.0	104.0	106.0					17																	44828913		1922	4131	6053	42184080	SO:0001819	synonymous_variant	4905				CCDS42354.1	17q21	2010-04-21			ENSG00000073969	ENSG00000073969		"""ATPases / AAA-type"""	8016	protein-coding gene	gene with protein product	"""N-ethylmaleimide-sensitive factor-like protein"""	601633				1315316, 8875895	Standard	NM_006178		Approved	SKD2	uc002iku.3	P46459	OTTHUMG00000134315	ENST00000398238.4:c.2088G>A	17.37:g.44828913G>A			42184080	A8K2D9|B4DFA2|Q8N6D7|Q9UKZ2	Silent	SNP	ENST00000398238.4	37	CCDS42354.1	SNP	34	Broad																																																																																				0.403	NSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259348.2	NM_006178		Silent
THOC1	9984	broad.mit.edu	37	18	223447	223447	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr18:223447C>G	ENST00000261600.6	-	17	1370	c.1363G>C	c.(1363-1365)Gag>Cag	p.E455Q		NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	455					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)	p.E455Q(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TGCCTTGTCTCTGATTTACAG	0.358																																																1	Substitution - Missense(1)	ovary(1)	18											62.0	56.0	58.0					18																	223447		1821	4078	5899	213447	SO:0001583	missense	9984			AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.1363G>C	18.37:g.223447C>G	ENSP00000261600:p.Glu455Gln		213447	B2RBP6|Q15219|Q64I72|Q64I73	Missense_Mutation	SNP	ENST00000261600.6	37	CCDS45820.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930292	0.73327	.	.	ENSG00000079134	ENST00000261600	.	.	.	5.43	5.43	0.79202	.	0.153404	0.64402	D	0.000017	T	0.60196	0.2250	L	0.52364	1.645	0.80722	D	1	P	0.42584	0.784	P	0.45829	0.494	T	0.55134	-0.8188	9	0.25106	T	0.35	-3.8444	19.254	0.93938	0.0:1.0:0.0:0.0	.	455	Q96FV9	THOC1_HUMAN	Q	455	.	ENSP00000261600:E455Q	E	-	1	0	THOC1	213447	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.135000	0.77276	2.538000	0.85594	0.655000	0.94253	GAG		0.358	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440348.5	NM_005131		Missense_Mutation
DSG4	147409	broad.mit.edu	37	18	28968372	28968372	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr18:28968372A>T	ENST00000308128.4	+	4	394	c.259A>T	c.(259-261)Att>Ttt	p.I87F	RP11-534N16.1_ENST00000578477.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.I87F|RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	87	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I87F(1)		NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AACATACCGGATTTCTGGAGT	0.408																																																1	Substitution - Missense(1)	ovary(1)	18											111.0	98.0	102.0					18																	28968372		2203	4299	6502	27222370	SO:0001583	missense	147409			AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.259A>T	18.37:g.28968372A>T	ENSP00000311859:p.Ile87Phe		27222370	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	37	CCDS11897.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	13.88	2.369993	0.42003	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.59083	0.29;0.29	5.73	5.73	0.89815	Cadherin (4);Cadherin-like (1);	0.000000	0.35378	N	0.003256	T	0.79100	0.4389	M	0.87900	2.915	0.42532	D	0.993043	D;P	0.76494	0.999;0.933	D;P	0.97110	1.0;0.838	D	0.83371	0.0007	10	0.87932	D	0	.	14.5944	0.68395	1.0:0.0:0.0:0.0	.	87;87	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	F	87	ENSP00000311859:I87F;ENSP00000352785:I87F	ENSP00000311859:I87F	I	+	1	0	DSG4	27222370	1.000000	0.71417	0.993000	0.49108	0.080000	0.17528	3.702000	0.54800	2.184000	0.69523	0.528000	0.53228	ATT		0.408	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986		Missense_Mutation
TSHZ3	57616	broad.mit.edu	37	19	31768452	31768452	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr19:31768452C>T	ENST00000240587.4	-	2	2574	c.2247G>A	c.(2245-2247)atG>atA	p.M749I		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	749					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M566I(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TCTTGAAAAGCATGCTCATGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											60.0	62.0	61.0					19																	31768452		2203	4300	6503	36460292	SO:0001583	missense	57616			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2247G>A	19.37:g.31768452C>T	ENSP00000240587:p.Met749Ile		36460292	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457511	0.84317	.	.	ENSG00000121297	ENST00000240587	T	0.42900	0.96	5.37	5.37	0.77165	.	0.038250	0.85682	D	0.000000	T	0.62696	0.2449	M	0.70595	2.14	0.80722	D	1	P	0.45126	0.851	P	0.58391	0.838	T	0.60944	-0.7162	10	0.44086	T	0.13	-33.5602	19.1085	0.93307	0.0:1.0:0.0:0.0	.	749	Q63HK5	TSH3_HUMAN	I	749	ENSP00000240587:M749I	ENSP00000240587:M749I	M	-	3	0	TSHZ3	36460292	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.461000	0.80834	2.501000	0.84356	0.655000	0.94253	ATG		0.602	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		Missense_Mutation
ZNF274	10782	broad.mit.edu	37	19	58724491	58724491	+	Silent	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr19:58724491G>A	ENST00000326804.4	+	9	2400	c.1941G>A	c.(1939-1941)aaG>aaA	p.K647K	ZNF274_ENST00000597818.1_3'UTR|ZNF274_ENST00000424679.2_Silent_p.K542K|ZNF274_ENST00000345813.3_Silent_p.K615K	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	648					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.K615K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		AGCGAAAGAAGAAACAGCCTA	0.493																																																1	Substitution - coding silent(1)	ovary(1)	19											46.0	47.0	47.0					19																	58724491		2027	4225	6252	63416303	SO:0001819	synonymous_variant	10782			AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.1941G>A	19.37:g.58724491G>A			63416303	Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Silent	SNP	ENST00000326804.4	37		SNP	33	Broad																																																																																				0.493	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_133502		Silent
GMCL1	64395	broad.mit.edu	37	2	70076786	70076786	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr2:70076786G>T	ENST00000282570.3	+	8	1097	c.846G>T	c.(844-846)tgG>tgT	p.W282C		NM_178439.3	NP_848526.1	Q96IK5	GMCL1_HUMAN	germ cell-less, spermatogenesis associated 1	282					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)	nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)		p.W282C(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	15						TAACTTAGTGGATGTTCCTTC	0.294																																																1	Substitution - Missense(1)	ovary(1)	2											64.0	67.0	66.0					2																	70076786		2202	4300	6502	69930290	SO:0001583	missense	64395			AK023119	CCDS1895.1	2p13.3	2013-01-09	2012-08-20		ENSG00000087338	ENSG00000087338		"""BTB/POZ domain containing"""	23843	protein-coding gene	gene with protein product	"""spermatogenesis associated 29"""		"""germ cell-less homolog 1 (Drosophila)"""				Standard	NM_178439		Approved	FLJ13057, BTBD13, GCL1, SPATA29	uc002sfu.3	Q96IK5	OTTHUMG00000129643	ENST00000282570.3:c.846G>T	2.37:g.70076786G>T	ENSP00000282570:p.Trp282Cys		69930290	Q9H826|Q9H8V7|Q9H927	Missense_Mutation	SNP	ENST00000282570.3	37	CCDS1895.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	13.38	2.218863	0.39201	.	.	ENSG00000087338	ENST00000282570	D	0.85702	-2.02	5.56	5.56	0.83823	BTB/Kelch-associated (2);	0.116625	0.64402	D	0.000006	D	0.92554	0.7635	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.93267	0.6648	10	0.87932	D	0	-23.8515	17.0154	0.86418	0.0:0.0:1.0:0.0	.	282	Q96IK5	GMCL1_HUMAN	C	282	ENSP00000282570:W282C	ENSP00000282570:W282C	W	+	3	0	GMCL1	69930290	1.000000	0.71417	1.000000	0.80357	0.006000	0.05464	8.658000	0.91110	2.605000	0.88082	0.655000	0.94253	TGG		0.294	GMCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251841.2	NM_178439		Missense_Mutation
M1AP	130951	broad.mit.edu	37	2	74787347	74787347	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr2:74787347G>T	ENST00000290536.5	-	9	1469	c.1353C>A	c.(1351-1353)caC>caA	p.H451Q	M1AP_ENST00000409585.1_Missense_Mutation_p.H451Q|M1AP_ENST00000358434.2_Missense_Mutation_p.H100Q|M1AP_ENST00000536235.1_Missense_Mutation_p.H451Q|M1AP_ENST00000464686.1_5'UTR	NM_001281296.1|NM_138804.3	NP_001268225.1|NP_620159.2	Q8TC57	M1AP_HUMAN	meiosis 1 associated protein	451					cell differentiation (GO:0030154)|chromatin assembly (GO:0031497)|female gamete generation (GO:0007292)|male meiosis chromosome separation (GO:0051308)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.H451Q(1)									TGCTGCTCAGGTGTGAGTACA	0.597																																																1	Substitution - Missense(1)	ovary(1)	2											94.0	87.0	89.0					2																	74787347		2203	4300	6503	74640855	SO:0001583	missense	130951				CCDS33229.1, CCDS62941.1	2p13.1	2013-02-05	2013-02-05	2013-01-16	ENSG00000159374	ENSG00000159374			25183	protein-coding gene	gene with protein product	"""meiosis 1 arresting protein"", ""spermatogenesis associated 37"""		"""chromosome 2 open reading frame 65"""	C2orf65		16881047, 23269666	Standard	NM_138804		Approved	D6Mm5e, SPATA37	uc002smy.3	Q8TC57	OTTHUMG00000152918	ENST00000290536.5:c.1353C>A	2.37:g.74787347G>T	ENSP00000290536:p.His451Gln		74640855	B7Z6E7|E9PGG8|Q6ZP30|Q96L07	Missense_Mutation	SNP	ENST00000290536.5	37	CCDS33229.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	16.99	3.274004	0.59649	.	.	ENSG00000159374	ENST00000290536;ENST00000409585;ENST00000536235;ENST00000358434	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	5.41	1.52	0.23074	.	0.172164	0.51477	D	0.000096	T	0.56499	0.1989	M	0.62723	1.935	0.34805	D	0.737134	P;D;P;D	0.76494	0.925;0.999;0.925;0.963	P;D;P;P	0.64776	0.649;0.929;0.649;0.698	T	0.62553	-0.6830	10	0.40728	T	0.16	-2.0389	7.1867	0.25803	0.3773:0.0:0.6227:0.0	.	451;100;451;207	E9PGG8;Q8TC57-3;Q8TC57;B3KX03	.;.;CB065_HUMAN;.	Q	451;451;451;100	ENSP00000290536:H451Q;ENSP00000386793:H451Q;ENSP00000445662:H451Q;ENSP00000351213:H100Q	ENSP00000290536:H451Q	H	-	3	2	C2orf65	74640855	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	0.368000	0.20399	0.407000	0.25591	-0.258000	0.10820	CAC		0.597	M1AP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328569.1	NM_138804		Missense_Mutation
SEMA4F	10505	broad.mit.edu	37	2	74889904	74889904	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr2:74889904G>A	ENST00000357877.2	+	5	651	c.502G>A	c.(502-504)Ggg>Agg	p.G168R	SEMA4F_ENST00000339773.5_Intron	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	168	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)	p.G168R(1)		biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						GAGTGGCCGGGGGAAATGTCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	2											174.0	170.0	171.0					2																	74889904		2203	4300	6503	74743412	SO:0001583	missense	10505			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.502G>A	2.37:g.74889904G>A	ENSP00000350547:p.Gly168Arg		74743412	Q542Y7|Q9NS35	Missense_Mutation	SNP	ENST00000357877.2	37	CCDS1955.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495035	0.85069	.	.	ENSG00000135622	ENST00000357877;ENST00000434486	T;T	0.36157	1.27;1.27	5.46	5.46	0.80206	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.66713	0.2817	M	0.89840	3.065	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.79108	0.992;0.911	T	0.73886	-0.3841	10	0.87932	D	0	.	14.8228	0.70085	0.0:0.0:1.0:0.0	.	135;168	C9K0A1;O95754	.;SEM4F_HUMAN	R	168;135	ENSP00000350547:G168R;ENSP00000407698:G135R	ENSP00000350547:G168R	G	+	1	0	SEMA4F	74743412	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.811000	0.62606	2.557000	0.86248	0.655000	0.94253	GGG		0.522	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263		Missense_Mutation
STAM2	10254	broad.mit.edu	37	2	152988652	152988652	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr2:152988652T>G	ENST00000263904.4	-	11	1350	c.1001A>C	c.(1000-1002)gAt>gCt	p.D334A		NM_005843.4	NP_005834.4	O75886	STAM2_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	334	Interaction with HGS. {ECO:0000250}.				endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.D334A(1)		endometrium(3)|large_intestine(4)|lung(8)|ovary(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.22)		AAGTTTTTCATCTATCATTGG	0.323																																																1	Substitution - Missense(1)	ovary(1)	2											82.0	85.0	84.0					2																	152988652		2202	4297	6499	152696898	SO:0001583	missense	10254			AF042274	CCDS2196.1	2q23.3	2009-04-29			ENSG00000115145	ENSG00000115145			11358	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	606244				10899310, 10993906	Standard	NM_005843		Approved	Hbp	uc002tyc.4	O75886	OTTHUMG00000131885	ENST00000263904.4:c.1001A>C	2.37:g.152988652T>G	ENSP00000263904:p.Asp334Ala		152696898	A8K8A0|D3DPA1|Q7LDQ0|Q9UF58	Missense_Mutation	SNP	ENST00000263904.4	37	CCDS2196.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	23.8	4.463446	0.84425	.	.	ENSG00000115145	ENST00000263904	T	0.20463	2.07	5.02	5.02	0.67125	.	0.094070	0.64402	D	0.000001	T	0.49184	0.1542	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;0.994	D;P	0.79784	0.993;0.887	T	0.53092	-0.8487	10	0.20046	T	0.44	-9.8091	14.7409	0.69455	0.0:0.0:0.0:1.0	.	334;334	O75886-2;O75886	.;STAM2_HUMAN	A	334	ENSP00000263904:D334A	ENSP00000263904:D334A	D	-	2	0	STAM2	152696898	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.185000	0.77714	1.879000	0.54435	0.533000	0.62120	GAT		0.323	STAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254835.2	NM_005843		Missense_Mutation
ZNF804A	91752	broad.mit.edu	37	2	185800524	185800524	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr2:185800524G>A	ENST00000302277.6	+	4	995	c.401G>A	c.(400-402)gGc>gAc	p.G134D		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	134							metal ion binding (GO:0046872)	p.G134D(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CCTGGAAGTGGCCCCATGTTC	0.338																																																1	Substitution - Missense(1)	ovary(1)	2											54.0	53.0	53.0					2																	185800524		2203	4299	6502	185508769	SO:0001583	missense	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.401G>A	2.37:g.185800524G>A	ENSP00000303252:p.Gly134Asp		185508769	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362149	0.82353	.	.	ENSG00000170396	ENST00000302277	T	0.23754	1.89	5.18	5.18	0.71444	.	0.000000	0.53938	D	0.000059	T	0.54271	0.1848	M	0.78049	2.395	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.59595	-0.7425	10	0.87932	D	0	-10.6493	17.6772	0.88234	0.0:0.0:1.0:0.0	.	134	Q7Z570	Z804A_HUMAN	D	134	ENSP00000303252:G134D	ENSP00000303252:G134D	G	+	2	0	ZNF804A	185508769	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.476000	0.97823	2.418000	0.82041	0.467000	0.42956	GGC		0.338	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		Missense_Mutation
PNKD	25953	broad.mit.edu	37	2	219208278	219208278	+	Silent	SNP	G	G	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr2:219208278G>T	ENST00000273077.4	+	8	888	c.837G>T	c.(835-837)ctG>ctT	p.L279L	PNKD_ENST00000258362.3_Silent_p.L255L|AC021016.8_ENST00000411433.1_RNA|PNKD_ENST00000436005.2_Silent_p.L219L	NM_015488.4	NP_056303.3	Q8N490	PNKD_HUMAN	paroxysmal nonkinesigenic dyskinesia	279					glutathione biosynthetic process (GO:0006750)|neuromuscular process controlling posture (GO:0050884)|regulation of dopamine metabolic process (GO:0042053)|regulation of synaptic transmission, dopaminergic (GO:0032225)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)	p.L279L(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	10		Renal(207;0.0474)		Epithelial(149;7.33e-07)|all cancers(144;0.000133)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACACTGTGCTGGGGCTAGGGG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	2											187.0	141.0	156.0					2																	219208278		2203	4300	6503	218916522	SO:0001819	synonymous_variant	25953				CCDS2411.1, CCDS2413.1, CCDS42816.1	2q35	2011-01-21	2007-07-12		ENSG00000127838	ENSG00000127838			9153	protein-coding gene	gene with protein product	"""myofibrillogenesis regulator 1"""	609023	"""paroxysmal nonkinesiogenic dyskinesia"""			8659518	Standard	NM_015488		Approved	DYT8, PDC, DKFZp564N1362, FPD1, MR-1, BRP17, FKSG19, TAHCCP2, KIAA1184, KIPP1184, MGC31943, PKND1	uc002vhn.3	Q8N490	OTTHUMG00000133110	ENST00000273077.4:c.837G>T	2.37:g.219208278G>T			218916522	A8K1F2|Q96A48|Q9BU26|Q9NSX4|Q9ULN6|Q9Y4T1	Silent	SNP	ENST00000273077.4	37	CCDS2411.1	SNP	47	Broad																																																																																				0.617	PNKD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256775.2			Silent
PASK	23178	broad.mit.edu	37	2	242078140	242078140	+	Missense_Mutation	SNP	G	G	A	rs145741558	byFrequency	TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr2:242078140G>A	ENST00000405260.1	-	5	1368	c.670C>T	c.(670-672)Cgc>Tgc	p.R224C	PASK_ENST00000358649.4_Missense_Mutation_p.R224C|PASK_ENST00000544142.1_Missense_Mutation_p.R38C|PASK_ENST00000403638.3_Missense_Mutation_p.R224C|PASK_ENST00000234040.4_Missense_Mutation_p.R224C|PASK_ENST00000539818.1_Missense_Mutation_p.R8C	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	224					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)	p.R224C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CATAGGCGGCGCTCCTGCCGC	0.577													G|||	2	0.000399361	0.0008	0.0	5008	,	,		16617	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2						G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	109.0	96.0	101.0		670	1.8	0.5	2	dbSNP_134	101	0,8600		0,0,4300	yes	missense	PASK	NM_015148.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	224/1324	242078140	1,13005	2203	4300	6503	241726813	SO:0001583	missense	23178			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.670C>T	2.37:g.242078140G>A	ENSP00000384016:p.Arg224Cys		241726813	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	37	CCDS2545.1	SNP	38	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	12.93	2.086872	0.36855	2.27E-4	0.0	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638;ENST00000415234	D;T;D;D;T;D;T	0.99607	-6.27;-0.54;-6.27;-6.27;-0.54;-6.27;-0.54	4.65	1.8	0.24995	PAS (1);PAS fold (1);	1.160130	0.06318	N	0.704032	D	0.97133	0.9063	N	0.04880	-0.145	0.09310	N	1	B;B;B;B;B	0.09022	0.0;0.001;0.0;0.002;0.0	B;B;B;B;B	0.06405	0.001;0.001;0.001;0.002;0.001	D	0.96768	0.9566	10	0.41790	T	0.15	.	7.9221	0.29852	0.2691:0.0:0.7309:0.0	.	224;38;224;224;224	B7Z7R6;F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.;.;.;.;PASK_HUMAN	C	224;38;224;224;8;224;8	ENSP00000234040:R224C;ENSP00000441374:R38C;ENSP00000384016:R224C;ENSP00000351475:R224C;ENSP00000443083:R8C;ENSP00000384438:R224C;ENSP00000400734:R8C	ENSP00000234040:R224C	R	-	1	0	PASK	241726813	0.005000	0.15991	0.505000	0.27651	0.928000	0.56348	1.165000	0.31822	0.957000	0.37930	0.591000	0.81541	CGC		0.577	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148		Missense_Mutation
CFAP61	26074	broad.mit.edu	37	20	20232314	20232314	+	Silent	SNP	C	C	T	rs370294355		TCGA-13-1410-01	TCGA-13-1410-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr20:20232314C>T	ENST00000245957.5	+	20	2311	c.2235C>T	c.(2233-2235)acC>acT	p.T745T	C20orf26_ENST00000377293.1_Silent_p.T101T|C20orf26_ENST00000389656.3_Silent_p.T101T|C20orf26_ENST00000377309.2_Silent_p.T101T	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		745								p.T745T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		GTAGAATGACCGGCATAGACC	0.527																																																1	Substitution - coding silent(1)	ovary(1)	20											196.0	164.0	175.0					20																	20232314		2203	4300	6503	20180314	SO:0001819	synonymous_variant	26074																														ENST00000245957.5:c.2235C>T	20.37:g.20232314C>T			20180314	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Silent	SNP	ENST00000245957.5	37	CCDS33447.1	SNP	23	Broad																																																																																				0.527	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3			Silent
GTSE1	51512	broad.mit.edu	37	22	46709817	46709817	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr22:46709817C>T	ENST00000454366.1	+	6	1170	c.958C>T	c.(958-960)Ccc>Tcc	p.P320S		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	301					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)		p.P301S(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		GTTAAAAGCACCCGGCTCTAC	0.517											OREG0026653	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(153;542 1915 12487 29016 50495)											1	Substitution - Missense(1)	ovary(1)	22											76.0	80.0	79.0					22																	46709817		2203	4300	6503	45088481	SO:0001583	missense	51512			AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.958C>T	22.37:g.46709817C>T	ENSP00000415430:p.Pro320Ser	941	45088481	B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	ENST00000454366.1	37	CCDS14074.2	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	16.76	3.210977	0.58343	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.19938	2.11	4.42	3.39	0.38822	.	0.379479	0.29159	N	0.012963	T	0.24353	0.0590	L	0.47190	1.495	0.09310	N	1	D	0.56287	0.975	P	0.48795	0.59	T	0.06023	-1.0850	10	0.66056	D	0.02	-16.9978	9.9781	0.41797	0.2014:0.7986:0.0:0.0	.	301	Q9NYZ3	GTSE1_HUMAN	S	320;280	ENSP00000415430:P320S	ENSP00000354634:P280S	P	+	1	0	GTSE1	45088481	0.002000	0.14202	0.018000	0.16275	0.163000	0.22366	0.372000	0.20467	1.434000	0.47414	0.655000	0.94253	CCC		0.517	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2	NM_016426		Missense_Mutation
CSRNP1	64651	broad.mit.edu	37	3	39185035	39185035	+	Silent	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr3:39185035G>A	ENST00000273153.5	-	5	1458	c.1281C>T	c.(1279-1281)gaC>gaT	p.D427D	CSRNP1_ENST00000514182.1_Silent_p.D427D	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	427					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D427D(1)		central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						TACCAAAGATGTCAGCTGGAT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	3											69.0	70.0	69.0					3																	39185035		2203	4300	6503	39160039	SO:0001819	synonymous_variant	64651			AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.1281C>T	3.37:g.39185035G>A			39160039	Q69YY5	Silent	SNP	ENST00000273153.5	37	CCDS2682.1	SNP	48	Broad																																																																																				0.567	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254061.1	NM_033027		Silent
RAD54L2	23132	broad.mit.edu	37	3	51663424	51663424	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr3:51663424G>A	ENST00000409535.2	+	4	541	c.416G>A	c.(415-417)cGc>cAc	p.R139H	RAD54L2_ENST00000296477.3_5'UTR	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	139						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)	p.R139H(1)		NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		AGAAGGAAGCGCCTGGAGCAG	0.512																																																1	Substitution - Missense(1)	ovary(1)	3											106.0	99.0	102.0					3																	51663424		2203	4300	6503	51638464	SO:0001583	missense	23132			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.416G>A	3.37:g.51663424G>A	ENSP00000386520:p.Arg139His		51638464	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361172	0.82353	.	.	ENSG00000164080	ENST00000409535	T	0.24908	1.83	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.51449	0.1675	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.52253	-0.8600	10	0.72032	D	0.01	-10.4571	18.2757	0.90083	0.0:0.0:1.0:0.0	.	139	Q9Y4B4	ARIP4_HUMAN	H	139	ENSP00000386520:R139H	ENSP00000386520:R139H	R	+	2	0	RAD54L2	51638464	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.405000	0.97313	2.543000	0.85770	0.655000	0.94253	CGC		0.512	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106		Missense_Mutation
PHLDB2	90102	broad.mit.edu	37	3	111603606	111603606	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr3:111603606G>A	ENST00000431670.2	+	2	1093	c.682G>A	c.(682-684)Gag>Aag	p.E228K	PHLDB2_ENST00000481953.1_Missense_Mutation_p.E228K|PHLDB2_ENST00000393923.3_Missense_Mutation_p.E255K|PHLDB2_ENST00000412622.1_Missense_Mutation_p.E228K|PHLDB2_ENST00000393925.3_Missense_Mutation_p.E228K|PHLDB2_ENST00000477695.1_Missense_Mutation_p.E228K|PHLDB2_ENST00000478922.1_Missense_Mutation_p.E228K	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	228						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.E228K(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TAGACACAAGGAGCTTGCATC	0.512																																																1	Substitution - Missense(1)	ovary(1)	3											71.0	74.0	73.0					3																	111603606		2203	4300	6503	113086296	SO:0001583	missense	90102				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.682G>A	3.37:g.111603606G>A	ENSP00000405405:p.Glu228Lys		113086296	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	ENST00000431670.2	37	CCDS46886.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	12.97	2.096605	0.36952	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000478922;ENST00000477695;ENST00000393925;ENST00000481953	T;T;T;T;T;T	0.37915	1.17;1.21;1.19;1.22;1.21;1.19	5.61	5.61	0.85477	.	0.275897	0.31450	N	0.007630	T	0.31734	0.0806	L	0.36672	1.1	0.34145	D	0.666822	B;P;P;B;B	0.41848	0.039;0.675;0.763;0.073;0.277	B;B;B;B;B	0.39840	0.024;0.273;0.311;0.053;0.053	T	0.35649	-0.9780	10	0.26408	T	0.33	.	16.9138	0.86146	0.0:0.0:1.0:0.0	.	228;228;228;228;255	Q86SQ0;G5E9V3;E9PDY7;Q86SQ0-2;Q86SQ0-3	PHLB2_HUMAN;.;.;.;.	K	255;255;228;228;228;228;228;228;228	ENSP00000377500:E255K;ENSP00000405405:E228K;ENSP00000405292:E228K;ENSP00000418296:E228K;ENSP00000377502:E228K;ENSP00000418319:E228K	ENSP00000352764:E255K	E	+	1	0	PHLDB2	113086296	1.000000	0.71417	0.844000	0.33320	0.233000	0.25261	6.763000	0.74955	2.813000	0.96785	0.655000	0.94253	GAG		0.512	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753		Missense_Mutation
PHLDB2	90102	broad.mit.edu	37	3	111693368	111693368	+	Silent	SNP	T	T	C			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr3:111693368T>C	ENST00000431670.2	+	18	4131	c.3720T>C	c.(3718-3720)gtT>gtC	p.V1240V	PHLDB2_ENST00000393923.3_Silent_p.V1224V|PHLDB2_ENST00000495180.1_Silent_p.V731V|PHLDB2_ENST00000481953.1_Silent_p.V1197V|PHLDB2_ENST00000412622.1_Silent_p.V1197V|PHLDB2_ENST00000393925.3_Silent_p.V1240V	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	1240	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.V1197V(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						GGATGGATGTTATAGTTACGG	0.458																																																1	Substitution - coding silent(1)	ovary(1)	3											134.0	136.0	135.0					3																	111693368		2203	4300	6503	113176058	SO:0001819	synonymous_variant	90102				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.3720T>C	3.37:g.111693368T>C			113176058	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Silent	SNP	ENST00000431670.2	37	CCDS46886.1	SNP	61	Broad																																																																																				0.458	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753		Silent
ACAD11	84129	broad.mit.edu	37	3	132378535	132378535	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr3:132378535C>T	ENST00000264990.6	-	1	1032	c.61G>A	c.(61-63)Gac>Aac	p.D21N	ACAD11_ENST00000481970.2_Missense_Mutation_p.D21N|UBA5_ENST00000473651.1_5'Flank|ACAD11_ENST00000355458.3_Missense_Mutation_p.D21N|ACAD11_ENST00000545291.1_5'UTR|UBA5_ENST00000356232.4_5'UTR|ACAD11_ENST00000489991.1_5'UTR|UBA5_ENST00000494238.2_5'Flank|UBA5_ENST00000264991.4_Intron|UBA5_ENST00000493720.2_5'Flank	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	21					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)	p.D21N(1)		breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						GACTTGCTGTCGAACTTGTGC	0.592											OREG0015804	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	3											95.0	96.0	95.0					3																	132378535		2203	4300	6503	133861225	SO:0001583	missense	84129			BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.61G>A	3.37:g.132378535C>T	ENSP00000264990:p.Asp21Asn	1594	133861225	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Missense_Mutation	SNP	ENST00000264990.6	37	CCDS3074.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196958	0.79015	.	.	ENSG00000240303	ENST00000355458;ENST00000264990;ENST00000481970	D;D;T	0.98362	-4.89;-4.86;1.18	5.86	5.86	0.93980	Protein kinase-like domain (1);	.	.	.	.	D	0.96648	0.8906	M	0.66939	2.045	0.80722	D	1	B;P	0.35363	0.256;0.497	B;B	0.24006	0.05;0.032	D	0.95855	0.8878	8	.	.	.	.	18.3824	0.90455	0.0:1.0:0.0:0.0	.	21;21	D6RDI8;Q709F0	.;ACD11_HUMAN	N	21	ENSP00000347636:D21N;ENSP00000264990:D21N;ENSP00000420907:D21N	.	D	-	1	0	ACAD11	133861225	1.000000	0.71417	0.991000	0.47740	0.832000	0.47134	4.459000	0.60102	2.776000	0.95493	0.655000	0.94253	GAC		0.592	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357279.2	NM_032169		Missense_Mutation
SLITRK3	22865	broad.mit.edu	37	3	164906421	164906421	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1410-01	TCGA-13-1410-10			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr3:164906421G>T	ENST00000475390.1	-	2	2641	c.2198C>A	c.(2197-2199)gCc>gAc	p.A733D	SLITRK3_ENST00000241274.3_Missense_Mutation_p.A733D			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	733					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.A733D(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CACGGGAGGGGCCTTCTCTGG	0.577										HNSCC(40;0.11)																																						1	Substitution - Missense(1)	ovary(1)	3											70.0	59.0	63.0					3																	164906421		2203	4300	6503	166389115	SO:0001583	missense	22865			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2198C>A	3.37:g.164906421G>T	ENSP00000420091:p.Ala733Asp		166389115	Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	CCDS3197.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	8.235	0.805614	0.16467	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.53206	0.63;0.63	5.44	5.44	0.79542	.	0.000000	0.37623	N	0.002018	T	0.39279	0.1072	L	0.36672	1.1	0.44816	D	0.997826	P	0.48911	0.917	B	0.38655	0.278	T	0.21211	-1.0252	10	0.33940	T	0.23	-13.8677	18.1971	0.89826	0.0:0.0:1.0:0.0	.	733	O94933	SLIK3_HUMAN	D	733	ENSP00000420091:A733D;ENSP00000241274:A733D	ENSP00000241274:A733D	A	-	2	0	SLITRK3	166389115	0.864000	0.29904	0.994000	0.49952	0.756000	0.42949	2.792000	0.47837	2.832000	0.97577	0.655000	0.94253	GCC		0.577	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		Missense_Mutation
PEX5L	51555	broad.mit.edu	37	3	179527346	179527346	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr3:179527346T>G	ENST00000467460.1	-	12	1595	c.1265A>C	c.(1264-1266)aAg>aCg	p.K422T	PEX5L_ENST00000392649.3_Missense_Mutation_p.K314T|PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000468741.1_Missense_Mutation_p.K230T|PEX5L_ENST00000476138.1_Missense_Mutation_p.K379T|PEX5L_ENST00000485199.1_Missense_Mutation_p.K387T|PEX5L_ENST00000263962.8_Missense_Mutation_p.K420T|PEX5L_ENST00000472994.1_Missense_Mutation_p.K363T|PEX5L_ENST00000464614.1_Missense_Mutation_p.K314T|PEX5L_ENST00000465751.1_Missense_Mutation_p.K398T	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	422					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)	p.K422T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TGGATTTTGCTTAATCCAATT	0.463																																																1	Substitution - Missense(1)	ovary(1)	3											149.0	137.0	141.0					3																	179527346		2203	4300	6503	181010040	SO:0001583	missense	51555			AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.1265A>C	3.37:g.179527346T>G	ENSP00000419975:p.Lys422Thr		181010040	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	ENST00000467460.1	37	CCDS3236.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	14.20	2.465854	0.43839	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	T;T;T;T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	6.03	-0.0835	0.13694	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.329403	0.32401	N	0.006151	T	0.64843	0.2635	L	0.38175	1.15	0.41702	D	0.989409	B;B;B;B;B;B	0.20780	0.048;0.048;0.009;0.019;0.007;0.011	B;B;B;B;B;B	0.21151	0.031;0.031;0.011;0.033;0.022;0.014	T	0.56306	-0.8001	10	0.39692	T	0.17	-14.3543	10.3339	0.43839	0.0:0.3146:0.0:0.6854	.	363;398;314;420;387;422	E7EUZ0;E9PH97;E9PEC1;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;.;PEX5R_HUMAN	T	422;420;387;420;314;230;379;310;363;314;398	ENSP00000419975:K422T;ENSP00000263962:K420T;ENSP00000418440:K387T;ENSP00000376420:K314T;ENSP00000418665:K230T;ENSP00000420555:K379T;ENSP00000418054:K363T;ENSP00000417270:K314T;ENSP00000419348:K398T	ENSP00000263962:K420T	K	-	2	0	PEX5L	181010040	0.940000	0.31905	1.000000	0.80357	0.996000	0.88848	0.102000	0.15272	0.187000	0.20147	0.455000	0.32223	AAG		0.463	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559		Missense_Mutation
UBXN7	26043	broad.mit.edu	37	3	196118689	196118689	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr3:196118689C>G	ENST00000296328.4	-	5	537	c.463G>C	c.(463-465)Gaa>Caa	p.E155Q	RNU6-1279P_ENST00000383917.1_RNA|UBXN7_ENST00000428095.1_Intron|UBXN7_ENST00000535858.1_Missense_Mutation_p.E7Q	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	155						Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.E155Q(1)		NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						CTTACTGTTTCAAAGCTGCCT	0.368																																																1	Substitution - Missense(1)	ovary(1)	3											152.0	140.0	144.0					3																	196118689		1868	4104	5972	197603086	SO:0001583	missense	26043			AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.463G>C	3.37:g.196118689C>G	ENSP00000296328:p.Glu155Gln		197603086	D3DXB3|Q6ZP77|Q86X20|Q8N327	Missense_Mutation	SNP	ENST00000296328.4	37	CCDS43191.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	18.27	3.588065	0.66105	.	.	ENSG00000163960	ENST00000296328;ENST00000535858	T;T	0.51071	0.72;0.72	5.37	5.37	0.77165	UAS (1);	0.000000	0.85682	D	0.000000	T	0.65678	0.2714	M	0.64080	1.96	0.80722	D	1	D	0.67145	0.996	D	0.68353	0.957	T	0.61357	-0.7079	10	0.30854	T	0.27	-14.4135	18.7235	0.91704	0.0:1.0:0.0:0.0	.	155	O94888	UBXN7_HUMAN	Q	155;7	ENSP00000296328:E155Q;ENSP00000440716:E7Q	ENSP00000296328:E155Q	E	-	1	0	UBXN7	197603086	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	7.045000	0.76585	2.512000	0.84698	0.655000	0.94253	GAA		0.368	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340938.2	XM_087353		Missense_Mutation
ADAMTS19	171019	broad.mit.edu	37	5	128797400	128797400	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr5:128797400C>A	ENST00000274487.4	+	2	824	c.679C>A	c.(679-681)Ctg>Atg	p.L227M	ADAMTS19-AS1_ENST00000502827.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	227						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L227M(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CGGAGCTGTGCTGCGGCACCC	0.672																																																1	Substitution - Missense(1)	ovary(1)	5											48.0	51.0	50.0					5																	128797400		2203	4300	6503	128825299	SO:0001583	missense	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.679C>A	5.37:g.128797400C>A	ENSP00000274487:p.Leu227Met		128825299		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	13.17	2.155811	0.38021	.	.	ENSG00000145808	ENST00000274487	T	0.05855	3.38	3.47	1.63	0.23807	Peptidase M12B, propeptide (1);	0.324591	0.20923	N	0.083242	T	0.12987	0.0315	L	0.41415	1.275	0.33986	D	0.648517	D	0.71674	0.998	D	0.72338	0.977	T	0.15378	-1.0439	9	.	.	.	.	8.2681	0.31827	0.1549:0.7576:0.0:0.0876	.	227	Q8TE59	ATS19_HUMAN	M	227	ENSP00000274487:L227M	.	L	+	1	2	ADAMTS19	128825299	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	1.245000	0.32790	0.452000	0.26830	0.591000	0.81541	CTG		0.672	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638		Missense_Mutation
HAVCR1	26762	broad.mit.edu	37	5	156482480	156482480	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr5:156482480G>C	ENST00000339252.3	-	2	643	c.111C>G	c.(109-111)caC>caG	p.H37Q	HAVCR1_ENST00000522693.1_Missense_Mutation_p.H37Q|HAVCR1_ENST00000544197.1_Missense_Mutation_p.H37Q|HAVCR1_ENST00000523175.1_Missense_Mutation_p.H37Q|HAVCR1_ENST00000425854.1_Missense_Mutation_p.H37Q	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	Ig-like V-type.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)	p.H37Q(1)		endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTCCACTGTAGTGGCAGGGTA	0.483																																																1	Substitution - Missense(1)	ovary(1)	5											69.0	68.0	69.0					5																	156482480		1966	4160	6126	156415058	SO:0001583	missense	26762			AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.111C>G	5.37:g.156482480G>C	ENSP00000344844:p.His37Gln		156415058	O43656	Missense_Mutation	SNP	ENST00000339252.3	37	CCDS43392.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	9.707	1.156084	0.21454	.	.	ENSG00000113249	ENST00000522693;ENST00000523175;ENST00000339252;ENST00000425854;ENST00000544197;ENST00000518745	T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	5.44	-4.85	0.03142	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.795960	0.02300	N	0.071087	T	0.34048	0.0884	N	0.08118	0	0.09310	N	1	B;B	0.16603	0.018;0.018	B;B	0.04013	0.001;0.001	T	0.07195	-1.0785	10	0.28530	T	0.3	-0.7794	1.1636	0.01810	0.2407:0.2771:0.2952:0.1869	.	37;37	F1CME6;Q96D42	.;HAVR1_HUMAN	Q	37	ENSP00000428524:H37Q;ENSP00000427898:H37Q;ENSP00000344844:H37Q;ENSP00000403333:H37Q;ENSP00000440258:H37Q;ENSP00000428422:H37Q	ENSP00000344844:H37Q	H	-	3	2	HAVCR1	156415058	0.000000	0.05858	0.004000	0.12327	0.005000	0.04900	-0.596000	0.05720	-0.616000	0.05671	0.650000	0.86243	CAC		0.483	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1			Missense_Mutation
ASCC3	10973	broad.mit.edu	37	6	100957917	100957917	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr6:100957917T>C	ENST00000369162.2	-	41	6696	c.6352A>G	c.(6352-6354)Ata>Gta	p.I2118V		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	2118	SEC63 2.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.I2118V(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TCTCCTAATATCAAAAACCAT	0.353																																																1	Substitution - Missense(1)	ovary(1)	6											194.0	216.0	209.0					6																	100957917		2203	4300	6503	101064638	SO:0001583	missense	10973			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.6352A>G	6.37:g.100957917T>C	ENSP00000358159:p.Ile2118Val		101064638	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	5.420	0.262597	0.10294	.	.	ENSG00000112249	ENST00000369162	T	0.52754	0.65	5.51	5.51	0.81932	Sec63 domain (3);	0.113755	0.64402	D	0.000015	T	0.12347	0.0300	N	0.10664	0.02	0.80722	D	1	B	0.10296	0.003	B	0.23574	0.047	T	0.12656	-1.0539	10	0.02654	T	1	.	15.9194	0.79547	0.0:0.0:0.0:1.0	.	2118	Q8N3C0	HELC1_HUMAN	V	2118	ENSP00000358159:I2118V	ENSP00000358159:I2118V	I	-	1	0	ASCC3	101064638	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.024000	0.41049	2.230000	0.72887	0.528000	0.53228	ATA		0.353	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828		Missense_Mutation
UST	10090	broad.mit.edu	37	6	149285592	149285592	+	Missense_Mutation	SNP	G	G	A	rs377151286		TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr6:149285592G>A	ENST00000367463.4	+	5	677	c.574G>A	c.(574-576)Gtc>Atc	p.V192I	RP11-162J8.2_ENST00000413845.1_RNA	NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	192					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.V192I(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		TAGAGACCCCGTCAACCGGTT	0.502																																																1	Substitution - Missense(1)	ovary(1)	6						G	ILE/VAL	0,4406		0,0,2203	104.0	95.0	98.0		574	5.0	1.0	6		98	1,8599	1.2+/-3.3	0,1,4299	no	missense	UST	NM_005715.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	192/407	149285592	1,13005	2203	4300	6503	149327285	SO:0001583	missense	10090			AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.574G>A	6.37:g.149285592G>A	ENSP00000356433:p.Val192Ile		149327285	B2RCX6	Missense_Mutation	SNP	ENST00000367463.4	37	CCDS5213.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	11.89	1.774427	0.31411	0.0	1.16E-4	ENSG00000111962	ENST00000367463	T	0.73789	-0.78	5.87	5.0	0.66597	.	0.110649	0.64402	N	0.000008	T	0.36468	0.0968	N	0.11724	0.165	0.40747	D	0.982885	B	0.32396	0.369	B	0.25759	0.063	T	0.38457	-0.9660	10	0.23891	T	0.37	-19.6816	12.1449	0.54018	0.1369:0.0:0.8631:0.0	.	192	Q9Y2C2	UST_HUMAN	I	192	ENSP00000356433:V192I	ENSP00000356433:V192I	V	+	1	0	UST	149327285	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	5.447000	0.66606	1.500000	0.48636	0.650000	0.86243	GTC		0.502	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043363.1	NM_005715		Missense_Mutation
PDE10A	10846	broad.mit.edu	37	6	165806284	165806284	+	Splice_Site	SNP	A	A	C			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr6:165806284A>C	ENST00000366882.1	-	17	1631	c.1477T>G	c.(1477-1479)Ttt>Gtt	p.F493V	PDE10A_ENST00000354448.4_Splice_Site_p.F493V|PDE10A_ENST00000539869.2_Splice_Site_p.F503V			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	493					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.F493V(1)|p.F493L(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	TCAAGCTCAAAGCTGCATGGA	0.403																																					Esophageal Squamous(22;308 615 5753 12038 40624)											2	Substitution - Missense(2)	ovary(1)|endometrium(1)	6											101.0	93.0	96.0					6																	165806284		2203	4300	6503	165726274	SO:0001630	splice_region_variant	10846			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1476-1T>G	6.37:g.165806284A>C			165726274	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37		SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	17.22	3.333728	0.60853	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.75589	-0.95;-0.95	5.43	5.43	0.79202	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.000000	0.85682	D	0.000000	T	0.73156	0.3551	L	0.35644	1.08	0.80722	D	1	D;D	0.60160	0.978;0.987	D;P	0.72982	0.979;0.882	T	0.71642	-0.4531	10	0.25106	T	0.35	.	15.5012	0.75700	1.0:0.0:0.0:0.0	.	503;493	Q9ULW9;Q9Y233	.;PDE10_HUMAN	V	493;521;503;493;492	ENSP00000355847:F493V;ENSP00000346435:F493V	ENSP00000341187:F503V	F	-	1	0	PDE10A	165726274	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	8.584000	0.90798	2.058000	0.61347	0.477000	0.44152	TTT		0.403	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		Missense_Mutation	Missense_Mutation
PSMB1	5689	broad.mit.edu	37	6	170846365	170846365	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr6:170846365C>G	ENST00000262193.6	-	5	595	c.497G>C	c.(496-498)gGa>gCa	p.G166A	PSMB1_ENST00000462957.1_5'UTR	NM_002793.3	NP_002784.1	P20618	PSB1_HUMAN	proteasome (prosome, macropain) subunit, beta type, 1	166					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)	p.G166A(1)		endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.0563)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;7.5e-23)|BRCA - Breast invasive adenocarcinoma(81;4.88e-06)|GBM - Glioblastoma multiforme(31;0.00643)	Bortezomib(DB00188)|Carfilzomib(DB08889)	TGCTGAGCCTCCAGCCTTGAA	0.458																																																1	Substitution - Missense(1)	ovary(1)	6											104.0	83.0	90.0					6																	170846365		2203	4300	6503	170688290	SO:0001583	missense	5689			D00761	CCDS34577.1	6q27	2008-02-05			ENSG00000008018	ENSG00000008018		"""Proteasome (prosome, macropain) subunits"""	9537	protein-coding gene	gene with protein product		602017				2025653	Standard	NM_002793		Approved	PMSB1, HC5	uc011ehe.2	P20618	OTTHUMG00000016087	ENST00000262193.6:c.497G>C	6.37:g.170846365C>G	ENSP00000262193:p.Gly166Ala		170688290	B5BU76|Q9BWA8	Missense_Mutation	SNP	ENST00000262193.6	37	CCDS34577.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	c	15.56	2.870286	0.51588	.	.	ENSG00000008018	ENST00000262193;ENST00000392093	T	0.20463	2.07	4.88	4.88	0.63580	.	0.098055	0.64402	D	0.000001	T	0.10937	0.0267	N	0.12611	0.24	0.80722	D	1	P	0.44578	0.838	P	0.47251	0.542	T	0.13255	-1.0516	10	0.35671	T	0.21	-11.1154	18.3975	0.90504	0.0:1.0:0.0:0.0	.	166	P20618	PSB1_HUMAN	A	166;171	ENSP00000262193:G166A	ENSP00000262193:G166A	G	-	2	0	PSMB1	170688290	1.000000	0.71417	0.979000	0.43373	0.992000	0.81027	4.262000	0.58847	2.412000	0.81896	0.455000	0.32223	GGA		0.458	PSMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043278.2	NM_002793		Missense_Mutation
DNAH11	8701	broad.mit.edu	37	7	21726772	21726772	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr7:21726772G>T	ENST00000409508.3	+	33	5708	c.5677G>T	c.(5677-5679)Ggc>Tgc	p.G1893C	DNAH11_ENST00000328843.6_Missense_Mutation_p.G1900C	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1900	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G1900C(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GGCTCCTGCTGGCCCAGCTGG	0.433									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	7											82.0	82.0	82.0					7																	21726772		1874	4133	6007	21693297	SO:0001583	missense	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.5677G>T	7.37:g.21726772G>T	ENSP00000475939:p.Gly1893Cys		21693297	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	24.0	4.478947	0.84747	.	.	ENSG00000105877	ENST00000328843	D	0.93604	-3.25	5.84	5.84	0.93424	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97071	0.9043	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97163	0.9839	9	0.87932	D	0	.	19.7538	0.96281	0.0:0.0:1.0:0.0	.	1900	Q96DT5	DYH11_HUMAN	C	1900	ENSP00000330671:G1900C	ENSP00000330671:G1900C	G	+	1	0	DNAH11	21693297	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	9.756000	0.98918	2.769000	0.95229	0.563000	0.77884	GGC		0.433	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		Missense_Mutation
FZD1	8321	broad.mit.edu	37	7	90894996	90894996	+	Silent	SNP	C	C	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr7:90894996C>T	ENST00000287934.2	+	1	1214	c.801C>T	c.(799-801)ggC>ggT	p.G267G		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	267					autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.G267G(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			GGGGCGCCGGCGCGTCGGAGC	0.701																																																1	Substitution - coding silent(1)	ovary(1)	7											7.0	7.0	7.0					7																	90894996		2159	4226	6385	90732932	SO:0001819	synonymous_variant	8321			AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.801C>T	7.37:g.90894996C>T			90732932	A4D1E8|O94815|Q549T8	Silent	SNP	ENST00000287934.2	37	CCDS5620.1	SNP	27	Broad																																																																																				0.701	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505		Silent
FOXP2	93986	broad.mit.edu	37	7	114302155	114302155	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr7:114302155T>A	ENST00000393494.2	+	14	1962	c.1683T>A	c.(1681-1683)tgT>tgA	p.C561*	FOXP2_ENST00000403559.4_Nonsense_Mutation_p.C578*|FOXP2_ENST00000393498.2_Nonsense_Mutation_p.C540*|FOXP2_ENST00000393491.3_Nonsense_Mutation_p.C376*|FOXP2_ENST00000393489.3_Nonsense_Mutation_p.C469*|FOXP2_ENST00000350908.4_Nonsense_Mutation_p.C561*|FOXP2_ENST00000393500.3_3'UTR|FOXP2_ENST00000408937.3_Nonsense_Mutation_p.C586*			O15409	FOXP2_HUMAN	forkhead box P2	561					camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C586*(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						TGCACAAGTGTTTTGTTCGAG	0.373																																																1	Substitution - Nonsense(1)	ovary(1)	7											130.0	121.0	124.0					7																	114302155		2203	4300	6503	114089391	SO:0001587	stop_gained	93986			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1683T>A	7.37:g.114302155T>A	ENSP00000377132:p.Cys561*		114089391	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Nonsense_Mutation	SNP	ENST00000393494.2	37	CCDS5760.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	40	8.427185	0.98806	.	.	ENSG00000128573	ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000393489;ENST00000393491	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1778	0.81874	0.0:0.0:0.0:1.0	.	.	.	.	X	561;586;578;561;538;469;376	.	ENSP00000265436:C561X	C	+	3	2	FOXP2	114089391	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.891000	0.63185	2.279000	0.76181	0.533000	0.62120	TGT		0.373	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491		Nonsense_Mutation
OR6B1	135946	broad.mit.edu	37	7	143701920	143701920	+	Silent	SNP	C	C	T	rs534528176		TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr7:143701920C>T	ENST00000408922.2	+	1	899	c.831C>T	c.(829-831)gcC>gcT	p.A277A		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A277A(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					TCTTCTATGCCATTGTCACTC	0.423													C|||	1	0.000199681	0.0	0.0014	5008	,	,		23312	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	7											102.0	97.0	99.0					7																	143701920		1934	4125	6059	143332853	SO:0001819	synonymous_variant	135946				CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.831C>T	7.37:g.143701920C>T			143332853	A4D2G2|B9EH47|Q6IFP6|Q96R38	Silent	SNP	ENST00000408922.2	37	CCDS43667.1	SNP	21	Broad																																																																																				0.423	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349566.1			Silent
CNTNAP2	26047	broad.mit.edu	37	7	147914436	147914436	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr7:147914436G>A	ENST00000361727.3	+	19	3583	c.3067G>A	c.(3067-3069)Gca>Aca	p.A1023T	CNTNAP2_ENST00000538075.1_Missense_Mutation_p.A82T	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1023					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.A1023T(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TCAGGCACCAGCAACAAATGC	0.498										HNSCC(39;0.1)																																						1	Substitution - Missense(1)	ovary(1)	7											122.0	122.0	122.0					7																	147914436		2203	4300	6503	147545369	SO:0001583	missense	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3067G>A	7.37:g.147914436G>A	ENSP00000354778:p.Ala1023Thr		147545369	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	7.374	0.627356	0.14257	.	.	ENSG00000174469	ENST00000361727;ENST00000538075	T;T	0.80123	-1.34;-1.34	5.25	-0.695	0.11291	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.909960	0.09478	N	0.796778	T	0.65943	0.2740	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44390	-0.9331	10	0.12766	T	0.61	.	5.4806	0.16721	0.4203:0.0:0.4529:0.1267	.	1023	Q9UHC6	CNTP2_HUMAN	T	1023;82	ENSP00000354778:A1023T;ENSP00000440732:A82T	ENSP00000354778:A1023T	A	+	1	0	CNTNAP2	147545369	0.012000	0.17670	0.000000	0.03702	0.027000	0.11550	1.791000	0.38744	-0.498000	0.06632	-0.258000	0.10820	GCA		0.498	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			Missense_Mutation
PRKDC	5591	broad.mit.edu	37	8	48841678	48841678	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr8:48841678C>T	ENST00000314191.2	-	19	2169	c.2113G>A	c.(2113-2115)Gct>Act	p.A705T	PRKDC_ENST00000338368.3_Missense_Mutation_p.A705T|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	705					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.A705T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ACAAATAAAGCAAAGCAAGAA	0.308								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)											1	Substitution - Missense(1)	ovary(1)	8											39.0	36.0	37.0					8																	48841678		1806	4066	5872	49004231	SO:0001583	missense	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.2113G>A	8.37:g.48841678C>T	ENSP00000313420:p.Ala705Thr		49004231	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026160	0.54683	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.68624	4.38;-0.34	5.28	5.28	0.74379	Armadillo-type fold (1);	0.141960	0.46442	D	0.000283	T	0.74650	0.3744	.	.	.	0.49389	D	0.999782	P;P;P	0.51057	0.939;0.941;0.941	P;P;P	0.52481	0.7;0.656;0.656	T	0.73811	-0.3865	9	0.37606	T	0.19	.	18.9571	0.92662	0.0:1.0:0.0:0.0	.	705;705;705	P78527-2;E7EUY0;P78527	.;.;PRKDC_HUMAN	T	705	ENSP00000313420:A705T;ENSP00000345182:A705T	ENSP00000313420:A705T	A	-	1	0	PRKDC	49004231	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	2.772000	0.47678	2.452000	0.82932	0.460000	0.39030	GCT		0.308	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640		Missense_Mutation
ZNF706	51123	broad.mit.edu	37	8	102213962	102213962	+	Missense_Mutation	SNP	C	C	G	rs202198915	byFrequency	TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr8:102213962C>G	ENST00000520347.1	-	2	2964	c.8G>C	c.(7-9)cGt>cCt	p.R3P	ZNF706_ENST00000520984.1_Missense_Mutation_p.R3P|ZNF706_ENST00000519744.1_Missense_Mutation_p.R3P|ZNF706_ENST00000521272.1_Missense_Mutation_p.R3P|ZNF706_ENST00000518336.1_Missense_Mutation_p.R3P|ZNF706_ENST00000517844.1_Missense_Mutation_p.R3P|ZNF706_ENST00000311212.4_Missense_Mutation_p.R3P|ZNF706_ENST00000519882.1_Missense_Mutation_p.R3P			Q9Y5V0	ZN706_HUMAN	zinc finger protein 706	3							metal ion binding (GO:0046872)	p.R3P(2)		large_intestine(1)|ovary(2)	3	all_cancers(14;3.3e-07)|all_epithelial(15;3.47e-09)|Lung NSC(17;3.44e-05)|all_lung(17;0.000117)		Epithelial(11;8.57e-11)|all cancers(13;1.43e-08)|OV - Ovarian serous cystadenocarcinoma(57;1.43e-05)			CTGCTGTCCACGAGCCATATC	0.398																																																2	Substitution - Missense(2)	ovary(2)	8											66.0	63.0	64.0					8																	102213962		2203	4300	6503	102283138	SO:0001583	missense	51123			AF125099	CCDS6291.1	8q22.3	2005-09-22				ENSG00000120963			24992	protein-coding gene	gene with protein product						11042152	Standard	NM_001042510		Approved	HSPC038	uc031tbv.1	Q9Y5V0		ENST00000520347.1:c.8G>C	8.37:g.102213962C>G	ENSP00000430823:p.Arg3Pro		102283138	A8K362	Missense_Mutation	SNP	ENST00000520347.1	37	CCDS6291.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	16.61	3.171479	0.57584	.	.	ENSG00000120963	ENST00000520984;ENST00000311212;ENST00000519744;ENST00000517844;ENST00000520347;ENST00000519882;ENST00000521272;ENST00000518336;ENST00000523922;ENST00000520454	.	.	.	5.39	3.58	0.41010	.	0.000000	0.85682	D	0.000000	T	0.45498	0.1345	.	.	.	0.80722	D	1	P	0.35944	0.529	B	0.27796	0.083	T	0.52704	-0.8540	8	0.87932	D	0	-0.2165	12.1205	0.53889	0.0:0.8596:0.0:0.1404	.	3	Q9Y5V0	ZN706_HUMAN	P	3	.	ENSP00000311768:R3P	R	-	2	0	ZNF706	102283138	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.963000	0.63694	1.292000	0.44672	0.655000	0.94253	CGT		0.398	ZNF706-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380477.1	NM_016096		Missense_Mutation
RIMS2	9699	broad.mit.edu	37	8	104973342	104973342	+	Silent	SNP	T	T	C			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr8:104973342T>C	ENST00000436393.2	+	13	2326	c.2085T>C	c.(2083-2085)gaT>gaC	p.D695D	RIMS2_ENST00000507740.1_Silent_p.D709D|RIMS2_ENST00000406091.3_Silent_p.D917D|RIMS2_ENST00000262231.10_Silent_p.D756D			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	979	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.D695D(1)|p.D709D(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ACTGTGATGATGGAATTGGTG	0.274										HNSCC(12;0.0054)																																						2	Substitution - coding silent(2)	ovary(2)	8											104.0	112.0	110.0					8																	104973342		1799	4056	5855	105042518	SO:0001819	synonymous_variant	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2085T>C	8.37:g.104973342T>C			105042518	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000436393.2	37		SNP	51	Broad																																																																																				0.274	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		Silent
PKHD1L1	93035	broad.mit.edu	37	8	110457675	110457675	+	Silent	SNP	C	C	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr8:110457675C>T	ENST00000378402.5	+	38	5681	c.5577C>T	c.(5575-5577)ggC>ggT	p.G1859G		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1859	IPT/TIG 11.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G1861G(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCTATCCAGGCAACACTACAG	0.502										HNSCC(38;0.096)																																						1	Substitution - coding silent(1)	ovary(1)	8											64.0	67.0	66.0					8																	110457675		1972	4158	6130	110526851	SO:0001819	synonymous_variant	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5577C>T	8.37:g.110457675C>T			110526851	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	CCDS47911.1	SNP	25	Broad																																																																																				0.502	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		Silent
KIAA0196	9897	broad.mit.edu	37	8	126091119	126091119	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr8:126091119C>A	ENST00000318410.7	-	6	921	c.572G>T	c.(571-573)cGa>cTa	p.R191L	KIAA0196_ENST00000517845.1_Missense_Mutation_p.R43L	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	191					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)		p.R191L(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			ACCTGTACTTCGAAGCAGCTT	0.423																																																1	Substitution - Missense(1)	ovary(1)	8											186.0	159.0	168.0					8																	126091119		2203	4300	6503	126160301	SO:0001583	missense	9897				CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.572G>T	8.37:g.126091119C>A	ENSP00000318016:p.Arg191Leu		126160301	A8K4R7|Q3KQX5|Q8TBQ2	Missense_Mutation	SNP	ENST00000318410.7	37	CCDS6355.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708908	0.89018	.	.	ENSG00000164961	ENST00000318410;ENST00000517845;ENST00000523297	D;D;D	0.88664	-2.41;-2.41;-2.41	5.13	4.25	0.50352	.	0.000000	0.85682	D	0.000000	D	0.88840	0.6546	M	0.86268	2.805	0.80722	D	1	P	0.39665	0.682	B	0.33799	0.17	D	0.89735	0.3929	10	0.87932	D	0	-9.8625	14.0108	0.64495	0.0:0.9261:0.0:0.0739	.	191	Q12768	STRUM_HUMAN	L	191;43;43	ENSP00000318016:R191L;ENSP00000429676:R43L;ENSP00000427946:R43L	ENSP00000318016:R191L	R	-	2	0	KIAA0196	126160301	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.687000	0.84139	1.298000	0.44778	0.591000	0.81541	CGA		0.423	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846		Missense_Mutation
KIAA2026	158358	broad.mit.edu	37	9	5923129	5923129	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr9:5923129C>T	ENST00000399933.3	-	8	2866	c.2867G>A	c.(2866-2868)aGc>aAc	p.S956N	KIAA2026_ENST00000381461.2_Missense_Mutation_p.S926N	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	956								p.S131N(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		CTCATTTGTGCTTAACTTTGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	9											202.0	191.0	195.0					9																	5923129		1927	4152	6079	5913129	SO:0001583	missense	158358			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2867G>A	9.37:g.5923129C>T	ENSP00000382815:p.Ser956Asn		5913129	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	37		SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399388	0.62177	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000001	T	0.65015	0.2651	L	0.32530	0.975	0.33243	D	0.557478	D	0.76494	0.999	D	0.83275	0.996	T	0.73477	-0.3970	9	0.72032	D	0.01	-5.9612	18.8849	0.92372	0.0:1.0:0.0:0.0	.	956	Q5HYC2	K2026_HUMAN	N	956;926	.	ENSP00000370870:S926N	S	-	2	0	KIAA2026	5913129	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.343000	0.44001	2.455000	0.83008	0.313000	0.20887	AGC		0.403	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969		Missense_Mutation
ZNF462	58499	broad.mit.edu	37	9	109687547	109687547	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chr9:109687547C>T	ENST00000277225.5	+	3	1643	c.1354C>T	c.(1354-1356)Cgt>Tgt	p.R452C	ZNF462_ENST00000457913.1_Missense_Mutation_p.R452C|ZNF462_ENST00000441147.2_5'Flank			Q96JM2	ZN462_HUMAN	zinc finger protein 462	452					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R452C(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CATGCATCGACGTAGCATCTC	0.433																																																1	Substitution - Missense(1)	ovary(1)	9											139.0	133.0	135.0					9																	109687547		2203	4300	6503	108727368	SO:0001583	missense	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.1354C>T	9.37:g.109687547C>T	ENSP00000277225:p.Arg452Cys		108727368	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	16.70	3.194605	0.58017	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.06933	3.24;3.68	5.93	5.93	0.95920	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.17450	0.0419	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.08310	-1.0728	9	.	.	.	.	18.5243	0.90965	0.0:1.0:0.0:0.0	.	452;452	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	C	452	ENSP00000277225:R452C;ENSP00000414570:R452C	.	R	+	1	0	ZNF462	108727368	1.000000	0.71417	0.989000	0.46669	0.964000	0.63967	5.572000	0.67411	2.815000	0.96918	0.561000	0.74099	CGT		0.433	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224		Missense_Mutation
MAGEB16	139604	broad.mit.edu	37	X	35820780	35820780	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chrX:35820780T>G	ENST00000399989.1	+	2	746	c.467T>G	c.(466-468)cTg>cGg	p.L156R	MAGEB16_ENST00000399992.1_Missense_Mutation_p.L188R|MAGEB16_ENST00000399988.1_Missense_Mutation_p.L156R|MAGEB16_ENST00000399985.1_Missense_Mutation_p.L156R|MAGEB16_ENST00000399987.1_Missense_Mutation_p.L156R	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	156	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.L323R(1)|p.L323Q(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						GAGATCCTCCTGAGAGCTTCT	0.468																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	X											82.0	80.0	80.0					X																	35820780		2040	4177	6217	35730701	SO:0001583	missense	139604				CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.467T>G	X.37:g.35820780T>G	ENSP00000382871:p.Leu156Arg		35730701	A8MU30	Missense_Mutation	SNP	ENST00000399989.1	37	CCDS43927.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	0.154	-1.088258	0.01873	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.04317	3.65;3.65;3.65;3.65;3.65	2.91	-3.71	0.04424	.	1.151770	0.06335	N	0.706920	T	0.01320	0.0043	N	0.01140	-0.99	0.09310	N	1	B	0.06786	0.001	B	0.14023	0.01	T	0.42916	-0.9423	10	0.05351	T	0.99	.	3.7445	0.08542	0.596:0.1302:0.0:0.2738	.	156	A2A368	MAGBG_HUMAN	R	156;188;156;156;156	ENSP00000382870:L156R;ENSP00000382874:L188R;ENSP00000382869:L156R;ENSP00000382871:L156R;ENSP00000382867:L156R	ENSP00000382867:L156R	L	+	2	0	MAGEB16	35730701	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	-0.267000	0.08619	-0.885000	0.03971	0.423000	0.28283	CTG		0.468	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1			Missense_Mutation
IL1RAPL2	26280	broad.mit.edu	37	X	104440384	104440384	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1410-01	TCGA-13-1410-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chrX:104440384C>A	ENST00000372582.1	+	3	1066	c.310C>A	c.(310-312)Cac>Aac	p.H104N	IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.H104N	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	104	Ig-like C2-type 1.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.H104N(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AATATGGTTTCACTCAGCTGA	0.428																																																1	Substitution - Missense(1)	ovary(1)	X											106.0	87.0	93.0					X																	104440384		2203	4300	6503	104327040	SO:0001583	missense	26280			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.310C>A	X.37:g.104440384C>A	ENSP00000361663:p.His104Asn		104327040	Q2M3U3|Q9NZN0	Missense_Mutation	SNP	ENST00000372582.1	37	CCDS14517.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432641	0.62844	.	.	ENSG00000189108	ENST00000372582;ENST00000344799	T;T	0.11821	2.74;2.74	5.45	5.45	0.79879	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000023	T	0.12774	0.0310	N	0.14661	0.345	0.80722	D	1	P	0.38280	0.625	B	0.43754	0.43	T	0.26780	-1.0093	10	0.24483	T	0.36	.	17.2402	0.87011	0.0:1.0:0.0:0.0	.	104	Q9NP60	IRPL2_HUMAN	N	104	ENSP00000361663:H104N;ENSP00000344976:H104N	ENSP00000344976:H104N	H	+	1	0	IL1RAPL2	104327040	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.607000	0.54102	2.282000	0.76494	0.600000	0.82982	CAC		0.428	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416		Missense_Mutation
ZBTB33	10009	broad.mit.edu	37	X	119388045	119388045	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1410-01	TCGA-13-1410-10	g.chrX:119388045A>G	ENST00000326624.2	+	2	1003	c.775A>G	c.(775-777)Agc>Ggc	p.S259G	ZBTB33_ENST00000557385.1_Missense_Mutation_p.S259G	NM_006777.3	NP_006768.1	Q86T24	KAISO_HUMAN	zinc finger and BTB domain containing 33	259					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding (GO:0043565)	p.S259G(1)		breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	26						GGCAACTTTGAGCCAAACACA	0.403																																																1	Substitution - Missense(1)	ovary(1)	X											92.0	85.0	88.0					X																	119388045		2203	4300	6503	119272073	SO:0001583	missense	10009			BC042753	CCDS14596.1	Xq23	2013-01-09			ENSG00000177485	ENSG00000177485		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16682	protein-coding gene	gene with protein product		300329					Standard	NM_001184742		Approved	ZNF-kaiso, kaiso, WUGSC:H_DJ525N14.1, KAISO, ZNF348	uc004esn.1	Q86T24	OTTHUMG00000171159	ENST00000326624.2:c.775A>G	X.37:g.119388045A>G	ENSP00000314153:p.Ser259Gly		119272073	B2R5U6|O00319|Q7Z361|Q8IVP6|Q8N3P0	Missense_Mutation	SNP	ENST00000326624.2	37	CCDS14596.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	11.77	1.736776	0.30774	.	.	ENSG00000177485;ENSG00000177485;ENSG00000258974	ENST00000326624;ENST00000540105;ENST00000557385	T;T	0.11712	2.75;2.75	5.67	5.67	0.87782	.	0.427525	0.27866	N	0.017540	T	0.11707	0.0285	L	0.44542	1.39	0.41778	D	0.989805	B	0.29162	0.235	B	0.29077	0.098	T	0.10314	-1.0635	10	0.30854	T	0.27	-1.8266	14.1924	0.65646	1.0:0.0:0.0:0.0	.	259	Q86T24	KAISO_HUMAN	G	259	ENSP00000314153:S259G;ENSP00000450969:S259G	ENSP00000314153:S259G	S	+	1	0	ZBTB33;AC002086.1	119272073	1.000000	0.71417	0.989000	0.46669	0.988000	0.76386	3.514000	0.53422	2.018000	0.59344	0.486000	0.48141	AGC		0.403	ZBTB33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058085.2	NM_006777		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578541	7578542	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-1410-01	TCGA-13-1410-10	g.chr17:7578541_7578542insGG	ENST00000269305.4	-	5	577_578	c.388_389insCC	c.(388-390)ctcfs	p.L130fs	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Ins_p.L130fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.L130fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.L130fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.L130fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.L130fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	130	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in a sporadic cancer; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L130F(16)|p.L130V(11)|p.0?(8)|p.L130R(7)|p.Y126_K132delYSPALNK(6)|p.L130H(3)|p.L37F(3)|p.Y126_N131delYSPALN(3)|p.L130fs*19(2)|p.N131fs*27(2)|p.L130fs*41(2)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.A129_L130insXX(1)|p.A129_N131delALN(1)|p.L130P(1)|p.V73fs*9(1)|p.Y126fs*18(1)|p.L130fs*39(1)|p.L130fs*16(1)|p.A129_K132delALNK(1)|p.L130_M133delLNKM(1)|p.P13fs*18(1)|p.L130fs*40(1)|p.S127fs*36(1)|p.L130del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATCTTGTTGAGGGCAGGGGAG	0.554		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	78	Substitution - Missense(41)|Deletion - In frame(14)|Deletion - Frameshift(10)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	large_intestine(11)|breast(11)|haematopoietic_and_lymphoid_tissue(7)|upper_aerodigestive_tract(6)|central_nervous_system(6)|lung(6)|ovary(6)|urinary_tract(4)|oesophagus(4)|prostate(4)|bone(4)|adrenal_gland(2)|stomach(2)|liver(2)|biliary_tract(1)|endometrium(1)|skin(1)	17																																								7519267	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.387_388dupCC	17.37:g.7578542_7578543dupGG	ENSP00000269305:p.Leu130fs		7519266	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	37	CCDS11118.1	INS	11	Broad																																																																																				0.554	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Ins
LPAR3	23566	broad.mit.edu	37	1	85331281	85331281	+	Frame_Shift_Del	DEL	C	C	-			TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-1410-01	TCGA-13-1410-10	g.chr1:85331281delC	ENST00000440886.1	-	1	561	c.523delG	c.(523-525)gccfs	p.A175fs	LPAR3_ENST00000370611.3_Frame_Shift_Del_p.A175fs|LPAR3_ENST00000491034.1_Intron			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	175					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)	p.A175fs*61(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						GAAGAGCAGGCAGAGATGTTG	0.537																																																1	Deletion - Frameshift(1)	ovary(1)	1											112.0	108.0	109.0					1																	85331281		2203	4300	6503	85103869	SO:0001589	frameshift_variant	23566			AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.523delG	1.37:g.85331281delC	ENSP00000395389:p.Ala175fs		85103869	A0AVA3	Frame_Shift_Del	DEL	ENST00000440886.1	37	CCDS700.1	DEL	25	Broad																																																																																				0.537	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027467.1	NM_012152		Frame_Shift_Del
CT47B1	643311	broad.mit.edu	37	X	120008797	120008823	+	In_Frame_Del	DEL	TCCTCTGTGGCCTCCTCTGTGAGCTTC	TCCTCTGTGGCCTCCTCTGTGAGCTTC	-	rs200284270		TCGA-13-1410-01	TCGA-13-1410-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-1410-01	TCGA-13-1410-10	g.chrX:120008797_120008823delTCCTCTGTGGCCTCCTCTGTGAGCTTC	ENST00000371311.3	-	1	956_982	c.702_728delGAAGCTCACAGAGGAGGCCACAGAGGA	c.(700-729)gagaagctcacagaggaggccacagaggaa>gaa	p.234_243EKLTEEATEE>E		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	234								p.K235_E243delKLTEEATEE(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						TGCGGCCGGTtcctctgtggcctcctctgtgagcttctcctctgcgg	0.692																																																1	Deletion - In frame(1)	ovary(1)	X																																								119892851	SO:0001651	inframe_deletion	643311				CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.702_728delGAAGCTCACAGAGGAGGCCACAGAGGA	X.37:g.120008797_120008823delTCCTCTGTGGCCTCCTCTGTGAGCTTC	ENSP00000360360:p.Glu234_Glu242del		119892825	A6NM97	In_Frame_Del	DEL	ENST00000371311.3	37	CCDS48161.1	DEL	62	Broad																																																																																				0.692	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058121.1	NM_001145718		In_Frame_Del
