#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CHD4	1108	genome.wustl.edu	37	12	6701183	6701183	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1412-01	TCGA-13-1412-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr12:6701183G>A	ENST00000357008.2	-	20	3152	c.2989C>T	c.(2989-2991)Ctc>Ttc	p.L997F	CHD4_ENST00000544040.1_Missense_Mutation_p.L990F|CHD4_ENST00000544484.1_Missense_Mutation_p.L994F|CHD4_ENST00000309577.6_Missense_Mutation_p.L997F	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	997					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.L997F(1)		central_nervous_system(2)	2						CGGGCATTGAGTGCTTCAAAA	0.458																																					Colon(32;586 792 4568 16848 45314)											1	Substitution - Missense(1)	ovary(1)	12											153.0	149.0	150.0					12																	6701183		2203	4300	6503	6571444	SO:0001583	missense	1108			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2989C>T	12.37:g.6701183G>A	ENSP00000349508:p.Leu997Phe		6571444	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	28.9	4.964390	0.92791	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	4.73	4.73	0.59995	SNF2-related (1);	0.000000	0.64402	D	0.000001	D	0.87553	0.6206	M	0.71206	2.165	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.83275	0.975;0.995;0.996	D	0.89081	0.3476	10	0.87932	D	0	.	17.8935	0.88879	0.0:0.0:1.0:0.0	.	997;997;990	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	F	994;990;997;997;971	ENSP00000440392:L994F;ENSP00000440542:L990F;ENSP00000312419:L997F;ENSP00000349508:L997F	ENSP00000312419:L997F	L	-	1	0	CHD4	6571444	1.000000	0.71417	0.992000	0.48379	0.980000	0.70556	7.740000	0.84986	2.450000	0.82876	0.563000	0.77884	CTC		0.458	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7577570	7577570	+	Missense_Mutation	SNP	C	C	A	rs587782664		TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr17:7577570C>A	ENST00000269305.4	-	7	900	c.711G>T	c.(709-711)atG>atT	p.M237I	TP53_ENST00000420246.2_Missense_Mutation_p.M237I|TP53_ENST00000445888.2_Missense_Mutation_p.M237I|TP53_ENST00000455263.2_Missense_Mutation_p.M237I|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.M237I|TP53_ENST00000413465.2_Missense_Mutation_p.M237I	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	237	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M237I(109)|p.0?(8)|p.?(5)|p.M144I(4)|p.M237_N239delMCN(4)|p.Y236_M237delYM(1)|p.H233fs*6(1)|p.M144_N146delMCN(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.H233_C242del10(1)|p.M237fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACTGTTACACATGTAGTTGT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	139	Substitution - Missense(113)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)|Insertion - In frame(1)	upper_aerodigestive_tract(23)|ovary(22)|lung(18)|breast(18)|central_nervous_system(11)|haematopoietic_and_lymphoid_tissue(9)|large_intestine(9)|stomach(6)|biliary_tract(5)|bone(5)|oesophagus(4)|urinary_tract(3)|pancreas(2)|thyroid(1)|testis(1)|soft_tissue(1)|liver(1)	17	GRCh37	CM011014	TP53	M							130.0	102.0	112.0					17																	7577570		2203	4300	6503	7518295	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.711G>T	17.37:g.7577570C>A	ENSP00000269305:p.Met237Ile		7518295	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	22.4	4.282984	0.80692	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	4.09	3.12	0.35913	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	M	0.86953	2.85	0.54753	D	0.999982	D;D;D;D;D;D	0.89917	1.0;0.975;0.999;1.0;0.998;1.0	D;P;D;D;D;D	0.91635	0.999;0.864;0.999;0.999;0.999;0.998	D	0.97922	1.0315	10	0.72032	D	0.01	-32.6033	10.0519	0.42221	0.0:0.8993:0.0:0.1007	.	237;237;144;237;237;237	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	I	237;237;237;237;237;237;226;144;105;144	ENSP00000410739:M237I;ENSP00000352610:M237I;ENSP00000269305:M237I;ENSP00000398846:M237I;ENSP00000391127:M237I;ENSP00000391478:M237I;ENSP00000425104:M105I;ENSP00000423862:M144I	ENSP00000269305:M237I	M	-	3	0	TP53	7518295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	1.305000	0.44909	0.462000	0.41574	ATG		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TLR8	51311	genome.wustl.edu	37	X	12938881	12938881	+	Silent	SNP	A	A	T			TCGA-13-1412-01	TCGA-13-1412-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chrX:12938881A>T	ENST00000218032.6	+	2	1809	c.1722A>T	c.(1720-1722)acA>acT	p.T574T	TLR8_ENST00000311912.5_Silent_p.T592T	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	574					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.T592T(1)		breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	CAGGCGTAACACATCATCTAG	0.328																																																1	Substitution - coding silent(1)	ovary(1)	X											42.0	43.0	42.0					X																	12938881		2203	4297	6500	12848802	SO:0001819	synonymous_variant	51311			AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.1722A>T	X.37:g.12938881A>T			12848802	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Silent	SNP	ENST00000218032.6	37	CCDS14152.1	SNP	6	WashU																																																																																				0.328	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610		Silent
BRD4	23476	genome.wustl.edu	37	19	15376429	15376429	+	Silent	SNP	C	C	G	rs183675300		TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr19:15376429C>G	ENST00000263377.2	-	5	806	c.585G>C	c.(583-585)acG>acC	p.T195T	BRD4_ENST00000602230.1_5'Flank|BRD4_ENST00000360016.5_Silent_p.T195T|BRD4_ENST00000371835.4_Silent_p.T195T	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	195					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)	p.T195T(2)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			TGTTTGGTACCGTGGAAACGC	0.567			T	C15orf55	lethal midline carcinoma of young people																																		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	2	Substitution - coding silent(2)	ovary(2)	19											293.0	291.0	292.0					19																	15376429		2203	4300	6503	15237429	SO:0001819	synonymous_variant	23476			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.585G>C	19.37:g.15376429C>G			15237429	O60433|Q4G0X8|Q86YS8|Q96PD3	Silent	SNP	ENST00000263377.2	37	CCDS12328.1	SNP	23	WashU																																																																																				0.567	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243		Silent
MPP7	143098	genome.wustl.edu	37	10	28408644	28408644	+	Splice_Site	SNP	C	C	G			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr10:28408644C>G	ENST00000375732.1	-	11	1147	c.888G>C	c.(886-888)agG>agC	p.R296S	MPP7_ENST00000445954.2_Splice_Site_p.R171S|MPP7_ENST00000540098.1_Splice_Site_p.R296S|MPP7_ENST00000337532.5_Splice_Site_p.R296S|MPP7_ENST00000375719.3_Splice_Site_p.R296S			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	296	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)	p.R296S(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						AAGCCAATCTCCTGGGAGAAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	10											95.0	97.0	96.0					10																	28408644		2203	4300	6503	28448650	SO:0001630	splice_region_variant	143098			BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.888-1G>C	10.37:g.28408644C>G			28448650	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Missense_Mutation	SNP	ENST00000375732.1	37	CCDS7158.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682680	0.68157	.	.	ENSG00000150054	ENST00000375732;ENST00000337532;ENST00000540098;ENST00000375719;ENST00000441595;ENST00000445954	D;D;D;D;T;D	0.82619	-1.63;-1.63;-1.63;-1.63;1.47;-1.63	5.63	5.63	0.86233	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	D	0.87904	0.6295	M	0.90198	3.095	0.80722	D	1	B	0.12013	0.005	B	0.23150	0.044	D	0.85545	0.1218	10	0.72032	D	0.01	.	19.699	0.96045	0.0:1.0:0.0:0.0	.	296	Q5T2T1	MPP7_HUMAN	S	296;296;296;296;57;171	ENSP00000364884:R296S;ENSP00000337907:R296S;ENSP00000438693:R296S;ENSP00000364871:R296S;ENSP00000398319:R57S;ENSP00000405397:R171S	ENSP00000337907:R296S	R	-	3	2	MPP7	28448650	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	4.877000	0.63086	2.655000	0.90218	0.650000	0.86243	AGG		0.368	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047345.1	NM_173496	Missense_Mutation	Missense_Mutation
ZNF658	26149	genome.wustl.edu	37	9	40773969	40773969	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr9:40773969C>T	ENST00000602553.1	-	5	1600	c.1306G>A	c.(1306-1308)Gga>Aga	p.G436R	ZNF658_ENST00000441795.1_Missense_Mutation_p.G434R|ZNF658_ENST00000377626.3_Missense_Mutation_p.G436R			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G436R(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AGTTTGAATCCCACATAAGTT	0.383																																																1	Substitution - Missense(1)	ovary(1)	9											45.0	46.0	46.0					9																	40773969		2195	4278	6473	40763969	SO:0001583	missense	26149			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.1306G>A	9.37:g.40773969C>T	ENSP00000473484:p.Gly436Arg		40763969	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Missense_Mutation	SNP	ENST00000602553.1	37	CCDS35023.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	c	18.13	3.555677	0.65425	.	.	ENSG00000196409	ENST00000441795;ENST00000377626	T;T	0.20332	2.08;2.08	1.96	1.04	0.20106	.	.	.	.	.	T	0.32102	0.0818	L	0.51914	1.62	0.09310	N	1	D;D	0.67145	0.996;0.982	P;P	0.62649	0.905;0.706	T	0.08659	-1.0711	9	0.56958	D	0.05	.	6.5707	0.22537	0.0:0.8355:0.0:0.1645	.	436;436	Q5TYW1-2;Q5TYW1	.;ZN658_HUMAN	R	434;436	ENSP00000408462:G434R;ENSP00000366853:G436R	ENSP00000366853:G436R	G	-	1	0	ZNF658	40763969	0.208000	0.23494	0.000000	0.03702	0.832000	0.47134	2.829000	0.48128	0.411000	0.25702	0.384000	0.25694	GGA		0.383	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467800.1	NM_033160		Missense_Mutation
ZBP1	81030	genome.wustl.edu	37	20	56191346	56191346	+	Silent	SNP	A	A	C			TCGA-13-1412-01	TCGA-13-1412-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr20:56191346A>C	ENST00000371173.3	-	2	390	c.213T>G	c.(211-213)acT>acG	p.T71T	ZBP1_ENST00000395822.3_Intron|ZBP1_ENST00000343535.4_Silent_p.T71T|ZBP1_ENST00000541799.1_Silent_p.T71T|ZBP1_ENST00000340462.4_Silent_p.T71T|ZBP1_ENST00000538947.1_5'UTR	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	71					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)	p.T71T(2)		large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			CTTCAGGATCAGTCCCGCCCA	0.612																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	20											117.0	106.0	110.0					20																	56191346		2203	4300	6503	55624752	SO:0001819	synonymous_variant	81030			AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.213T>G	20.37:g.56191346A>C			55624752	A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Silent	SNP	ENST00000371173.3	37	CCDS13461.1	SNP	7	WashU																																																																																				0.612	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1	NM_030776		Silent
KCNH5	27133	genome.wustl.edu	37	14	63416873	63416873	+	Silent	SNP	C	C	T			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr14:63416873C>T	ENST00000322893.7	-	7	1615	c.1347G>A	c.(1345-1347)tcG>tcA	p.S449S	KCNH5_ENST00000420622.2_Silent_p.S449S|KCNH5_ENST00000394968.1_Silent_p.S391S|KCNH5_ENST00000394964.2_Silent_p.S391S	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	449					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.S449S(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TCATAGCCACCGAAAACATCT	0.368																																																1	Substitution - coding silent(1)	ovary(1)	14											90.0	86.0	87.0					14																	63416873		2203	4300	6503	62486626	SO:0001819	synonymous_variant	27133			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.1347G>A	14.37:g.63416873C>T			62486626	C9JP98	Silent	SNP	ENST00000322893.7	37	CCDS9756.1	SNP	23	WashU																																																																																				0.368	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318		Silent
CILP	8483	genome.wustl.edu	37	15	65490724	65490724	+	Missense_Mutation	SNP	T	T	A	rs201651652		TCGA-13-1412-01	TCGA-13-1412-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr15:65490724T>A	ENST00000261883.4	-	9	2066	c.1900A>T	c.(1900-1902)Aca>Tca	p.T634S		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	634					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.T634S(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						GCTGTGGCTGTGGAAATATTC	0.512																																																1	Substitution - Missense(1)	ovary(1)	15											158.0	156.0	157.0					15																	65490724		2202	4299	6501	63277777	SO:0001583	missense	8483			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.1900A>T	15.37:g.65490724T>A	ENSP00000261883:p.Thr634Ser		63277777	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	CCDS10203.1	SNP	59	WashU	.	.	.	.	.	.	.	.	.	.	T	8.166	0.790585	0.16258	.	.	ENSG00000138615	ENST00000261883	T	0.38560	1.13	5.63	4.44	0.53790	.	0.046080	0.85682	D	0.000000	T	0.23249	0.0562	N	0.25647	0.755	0.52501	D	0.999958	P	0.39809	0.689	B	0.31614	0.133	T	0.05533	-1.0879	10	0.13108	T	0.6	-10.8142	10.9328	0.47228	0.14:0.0:0.0:0.86	.	634	O75339	CILP1_HUMAN	S	634	ENSP00000261883:T634S	ENSP00000261883:T634S	T	-	1	0	CILP	63277777	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.453000	0.52978	2.145000	0.66743	0.533000	0.62120	ACA		0.512	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613		Missense_Mutation
SYT12	91683	genome.wustl.edu	37	11	66811285	66811285	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1412-01	TCGA-13-1412-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr11:66811285G>T	ENST00000393946.2	+	8	1960	c.798G>T	c.(796-798)caG>caT	p.Q266H	SYT12_ENST00000525457.1_Missense_Mutation_p.Q266H|SYT12_ENST00000527043.1_Missense_Mutation_p.Q266H			Q8IV01	SYT12_HUMAN	synaptotagmin XII	266	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)		p.Q266H(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						TCCCGCTGCAGCCCTTCAGTG	0.552																																					Ovarian(65;2862 3307)											1	Substitution - Missense(1)	ovary(1)	11											94.0	72.0	79.0					11																	66811285		2200	4295	6495	66567861	SO:0001583	missense	91683			AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.798G>T	11.37:g.66811285G>T	ENSP00000377520:p.Gln266His		66567861		Missense_Mutation	SNP	ENST00000393946.2	37	CCDS8154.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	17.07	3.293967	0.60086	.	.	ENSG00000173227	ENST00000393946;ENST00000525457;ENST00000527043	T;T;T	0.71934	-0.61;-0.61;-0.61	5.27	5.27	0.74061	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.140375	0.48286	D	0.000181	T	0.60077	0.2241	L	0.29908	0.895	0.37657	D	0.922614	P	0.51240	0.943	B	0.43701	0.428	T	0.65442	-0.6167	10	0.39692	T	0.17	.	11.4945	0.50400	0.0:0.0:0.8207:0.1793	.	266	Q8IV01	SYT12_HUMAN	H	266	ENSP00000377520:Q266H;ENSP00000431400:Q266H;ENSP00000435316:Q266H	ENSP00000377520:Q266H	Q	+	3	2	SYT12	66567861	0.997000	0.39634	1.000000	0.80357	0.853000	0.48598	0.412000	0.21131	2.467000	0.83353	0.462000	0.41574	CAG		0.552	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393129.1	NM_177963		Missense_Mutation
CCAR1	55749	genome.wustl.edu	37	10	70496663	70496663	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1412-01	TCGA-13-1412-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr10:70496663T>C	ENST00000265872.6	+	3	223	c.104T>C	c.(103-105)cTt>cCt	p.L35P	Y_RNA_ENST00000352915.2_RNA|CCAR1_ENST00000535016.1_Missense_Mutation_p.L35P|CCAR1_ENST00000543719.1_Missense_Mutation_p.L35P	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	35					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)	p.L35P(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						CCATCACTCCTTGGAGCATCT	0.373																																																1	Substitution - Missense(1)	ovary(1)	10											108.0	104.0	105.0					10																	70496663		2203	4300	6503	70166669	SO:0001583	missense	55749			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.104T>C	10.37:g.70496663T>C	ENSP00000265872:p.Leu35Pro		70166669	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	ENST00000265872.6	37	CCDS7282.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	19.92	3.916357	0.73098	.	.	ENSG00000060339	ENST00000536391;ENST00000265872;ENST00000535016;ENST00000538031;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000494903	T;T;T;T;T	0.30714	1.52;1.68;1.68;1.69;1.68	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.41971	0.1182	N	0.24115	0.695	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.81914	0.994;0.995	T	0.32534	-0.9903	10	0.45353	T	0.12	-13.2436	15.7693	0.78152	0.0:0.0:0.0:1.0	.	35;35	Q8IX12-2;Q8IX12	.;CCAR1_HUMAN	P	35;35;35;35;35;35;35;94	ENSP00000265872:L35P;ENSP00000441820:L35P;ENSP00000445254:L35P;ENSP00000439252:L35P;ENSP00000438610:L35P	ENSP00000265872:L35P	L	+	2	0	CCAR1	70166669	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.354000	0.79424	2.180000	0.69256	0.533000	0.62120	CTT		0.373	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237		Missense_Mutation
C10orf35	219738	genome.wustl.edu	37	10	71392712	71392712	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr10:71392712C>A	ENST00000373279.4	+	4	422	c.263C>A	c.(262-264)cCg>cAg	p.P88Q	C10orf35_ENST00000491890.1_3'UTR	NM_145306.2	NP_660349.1	Q96D05	CJ035_HUMAN	chromosome 10 open reading frame 35	88						integral component of membrane (GO:0016021)		p.P88Q(1)		breast(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						GCTGTGGAGCCGGTGACCTCC	0.607																																																1	Substitution - Missense(1)	ovary(1)	10											168.0	121.0	137.0					10																	71392712		2203	4300	6503	71062718	SO:0001583	missense	219738			BC013587	CCDS7295.1	10q22.2	2003-11-21			ENSG00000171224	ENSG00000171224			23519	protein-coding gene	gene with protein product						12477932	Standard	NM_145306		Approved		uc001jpq.4	Q96D05	OTTHUMG00000018383	ENST00000373279.4:c.263C>A	10.37:g.71392712C>A	ENSP00000362376:p.Pro88Gln		71062718		Missense_Mutation	SNP	ENST00000373279.4	37	CCDS7295.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226032	0.79576	.	.	ENSG00000171224	ENST00000373279	.	.	.	5.33	5.33	0.75918	.	0.000000	0.64402	D	0.000003	T	0.79251	0.4414	M	0.73962	2.25	0.42767	D	0.99382	D	0.89917	1.0	D	0.91635	0.999	T	0.81974	-0.0687	9	0.87932	D	0	-5.4557	16.526	0.84331	0.0:1.0:0.0:0.0	.	88	Q96D05	CJ035_HUMAN	Q	88	.	ENSP00000362376:P88Q	P	+	2	0	C10orf35	71062718	0.998000	0.40836	0.979000	0.43373	0.941000	0.58515	4.836000	0.62789	2.502000	0.84385	0.561000	0.74099	CCG		0.607	C10orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048454.1	NM_145306		Missense_Mutation
MBTPS1	8720	genome.wustl.edu	37	16	84115432	84115432	+	Silent	SNP	G	G	C			TCGA-13-1412-01	TCGA-13-1412-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr16:84115432G>C	ENST00000343411.3	-	11	1863	c.1368C>G	c.(1366-1368)gtC>gtG	p.V456V	MBTPS1_ENST00000569770.1_5'UTR	NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	456	Peptidase S8.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.V456V(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CAAACATGTTGACCCCGGGGA	0.587																																																1	Substitution - coding silent(1)	ovary(1)	16											88.0	85.0	86.0					16																	84115432		2200	4300	6500	82672933	SO:0001819	synonymous_variant	8720			D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.1368C>G	16.37:g.84115432G>C			82672933	A8K6V8|Q24JQ2|Q9UF67	Silent	SNP	ENST00000343411.3	37	CCDS10941.1	SNP	45	WashU																																																																																				0.587	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791		Silent
SPATA31D5P	347127	genome.wustl.edu	37	9	84533097	84533097	+	RNA	SNP	A	A	C			TCGA-13-1412-01	TCGA-13-1412-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr9:84533097A>C	ENST00000527857.1	+	0	3119					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		CACGCCCCTTAGAAGAGGCAC	0.448																																																0			9																																								83722917			0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84533097A>C			83722917		Silent	SNP	ENST00000527857.1	37		SNP	15	WashU																																																																																				0.448	SPATA31D5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000052810.2	NR_026851		Silent
SNRNP200	23020	genome.wustl.edu	37	2	96969050	96969050	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr2:96969050C>G	ENST00000323853.5	-	3	305	c.228G>C	c.(226-228)gaG>gaC	p.E76D	SNRNP200_ENST00000349783.5_Missense_Mutation_p.E76D	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	76					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.E76D(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CATGCCGGTCCTCATCACGCT	0.493																																																1	Substitution - Missense(1)	ovary(1)	2											294.0	278.0	284.0					2																	96969050		2203	4300	6503	96332777	SO:0001583	missense	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.228G>C	2.37:g.96969050C>G	ENSP00000317123:p.Glu76Asp		96332777	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	11.15	1.554930	0.27739	.	.	ENSG00000144028	ENST00000323853;ENST00000349783	T;T	0.45668	0.89;0.89	5.69	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.29190	0.0726	L	0.28504	0.86	0.58432	D	0.999994	B	0.06786	0.001	B	0.08055	0.003	T	0.07424	-1.0773	10	0.24483	T	0.36	-21.2427	10.0417	0.42162	0.0:0.8439:0.0:0.1561	.	76	O75643	U520_HUMAN	D	76	ENSP00000317123:E76D;ENSP00000326937:E76D	ENSP00000317123:E76D	E	-	3	2	SNRNP200	96332777	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	1.236000	0.32683	1.408000	0.46895	-0.150000	0.13652	GAG		0.493	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014		Missense_Mutation
OR5H6	79295	genome.wustl.edu	37	3	97983667	97983667	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1412-01	TCGA-13-1412-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr3:97983667T>C	ENST00000383696.2	+	1	580	c.539T>C	c.(538-540)tTc>tCc	p.F180S	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F180S(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						GCTTTTTCATTCAGATTAACC	0.328																																																1	Substitution - Missense(1)	ovary(1)	3											78.0	80.0	79.0					3																	97983667		2203	4297	6500	99466357	SO:0001583	missense	79295			BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.539T>C	3.37:g.97983667T>C	ENSP00000373196:p.Phe180Ser		99466357	Q6IF88	Missense_Mutation	SNP	ENST00000383696.2	37	CCDS33800.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	-	9.178	1.022843	0.19433	.	.	ENSG00000230301	ENST00000383696	T	0.00220	8.52	2.19	2.19	0.27852	GPCR, rhodopsin-like superfamily (1);	0.785759	0.11107	N	0.598999	T	0.00178	0.0005	L	0.45422	1.42	0.09310	N	1	B	0.21520	0.057	B	0.27715	0.082	T	0.35724	-0.9777	10	0.72032	D	0.01	.	3.9761	0.09475	0.0:0.1866:0.0:0.8133	.	180	Q8NGV6	OR5H6_HUMAN	S	180	ENSP00000373196:F180S	ENSP00000373196:F180S	F	+	2	0	OR5H6	99466357	0.002000	0.14202	0.889000	0.34880	0.093000	0.18481	0.374000	0.20501	1.006000	0.39211	0.163000	0.16589	TTC		0.328	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2			Missense_Mutation
MUC17	140453	genome.wustl.edu	37	7	100686997	100686997	+	Silent	SNP	A	A	C			TCGA-13-1412-01	TCGA-13-1412-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr7:100686997A>C	ENST00000306151.4	+	3	12364	c.12300A>C	c.(12298-12300)acA>acC	p.T4100T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4100					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T4100T(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACCCAGCACACGGACCACTT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	7											200.0	188.0	192.0					7																	100686997		2203	4300	6503	100473717	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.12300A>C	7.37:g.100686997A>C			100473717	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	6	WashU																																																																																				0.562	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Silent
PKD2L1	9033	genome.wustl.edu	37	10	102059466	102059466	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr10:102059466C>A	ENST00000318222.3	-	3	741	c.359G>T	c.(358-360)gGa>gTa	p.G120V	PKD2L1_ENST00000338519.3_Missense_Mutation_p.G120V|PKD2L1_ENST00000353274.3_Missense_Mutation_p.G120V	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	120					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)	p.G120V(1)		NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		GCTTGTCATTCCATAGGTCAC	0.483																																																1	Substitution - Missense(1)	ovary(1)	10											159.0	136.0	144.0					10																	102059466		2203	4300	6503	102049456	SO:0001583	missense	9033			AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.359G>T	10.37:g.102059466C>A	ENSP00000325296:p.Gly120Val		102049456	O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	ENST00000318222.3	37	CCDS7492.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	26.0	4.699936	0.88924	.	.	ENSG00000107593	ENST00000338519;ENST00000353274;ENST00000318222;ENST00000339977	T;T;T	0.62364	0.14;0.03;0.08	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.81064	0.4745	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.991	T	0.81887	-0.0726	10	0.45353	T	0.12	-10.7716	17.9675	0.89103	0.0:1.0:0.0:0.0	.	73;120	Q1L4F0;Q9P0L9	.;PK2L1_HUMAN	V	120	ENSP00000345068:G120V;ENSP00000266049:G120V;ENSP00000325296:G120V	ENSP00000325296:G120V	G	-	2	0	PKD2L1	102049456	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.441000	0.80485	2.480000	0.83734	0.555000	0.69702	GGA		0.483	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	NM_016112		Missense_Mutation
THOC2	57187	genome.wustl.edu	37	X	122760388	122760388	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1412-01	TCGA-13-1412-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chrX:122760388G>T	ENST00000245838.8	-	24	2914	c.2883C>A	c.(2881-2883)gaC>gaA	p.D961E	THOC2_ENST00000355725.4_Missense_Mutation_p.D961E|THOC2_ENST00000491737.1_Missense_Mutation_p.D846E	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	961					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)	p.D882E(1)		breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						AAAGCCAGTTGTCCTTTTCCA	0.378																																																1	Substitution - Missense(1)	ovary(1)	X											183.0	158.0	166.0					X																	122760388		1840	4083	5923	122588069	SO:0001583	missense	57187			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.2883C>A	X.37:g.122760388G>T	ENSP00000245838:p.Asp961Glu		122588069	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	37	CCDS43988.1	SNP	48	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.89|14.89	2.669780|2.669780	0.47677|0.47677	.|.	.|.	ENSG00000125676|ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737|ENST00000438358	T;T;T|.	0.21191|.	2.02;2.02;2.02|.	5.83|5.83	4.86|4.86	0.63082|0.63082	THO complex, subunitTHOC2, C-terminal (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.49626|0.49626	0.1568|0.1568	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	P|.	0.47191|.	0.891|.	P|.	0.53809|.	0.735|.	T|T	0.52049|0.52049	-0.8627|-0.8627	10|5	0.29301|.	T|.	0.29|.	-11.54|-11.54	3.2962|3.2962	0.06966|0.06966	0.4148:0.0:0.5851:0.0|0.4148:0.0:0.5851:0.0	.|.	961|.	Q8NI27|.	THOC2_HUMAN|.	E|K	961;961;846|34	ENSP00000245838:D961E;ENSP00000347959:D961E;ENSP00000419795:D846E|.	ENSP00000245838:D961E|.	D|Q	-|-	3|1	2|0	THOC2|THOC2	122588069|122588069	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.599000|4.599000	0.61076|0.61076	2.460000|2.460000	0.83146|0.83146	0.600000|0.600000	0.82982|0.82982	GAC|CAA		0.378	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3			Missense_Mutation
MRRF	92399	genome.wustl.edu	37	9	125033218	125033218	+	Silent	SNP	C	C	T			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr9:125033218C>T	ENST00000344641.3	+	2	359	c.48C>T	c.(46-48)cgC>cgT	p.R16R	MRRF_ENST00000546115.1_Silent_p.R16R|MRRF_ENST00000373724.1_Intron|MRRF_ENST00000373729.1_Intron|MRRF_ENST00000394315.3_Silent_p.R16R|MRRF_ENST00000373730.3_Silent_p.R16R|MRRF_ENST00000297908.3_Silent_p.R16R|MRRF_ENST00000373723.5_Silent_p.R16R	NM_138777.3	NP_620132.1	Q96E11	RRFM_HUMAN	mitochondrial ribosome recycling factor	16					ribosome disassembly (GO:0032790)|translation (GO:0006412)	mitochondrion (GO:0005739)		p.R16R(1)		breast(3)|endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	12						CTACCTTTCGCAATTATCTTG	0.443																																																1	Substitution - coding silent(1)	ovary(1)	9											208.0	209.0	209.0					9																	125033218		2203	4300	6503	124073039	SO:0001819	synonymous_variant	92399			AA115320	CCDS6840.1, CCDS48013.1, CCDS55336.1	9q32-q34.1	2008-02-05			ENSG00000148187	ENSG00000148187			7234	protein-coding gene	gene with protein product		604602				9838146, 10773675	Standard	NM_001173512		Approved	RRF	uc010mwa.3	Q96E11	OTTHUMG00000020600	ENST00000344641.3:c.48C>T	9.37:g.125033218C>T			124073039	A8K6D8|A8K6Z4|B7Z4X5|B7Z6P7|Q5RKT1|Q5T7T0|Q5T7T1|Q5T7T2|Q5T7T3|Q5T7T4|Q5T7T5	Silent	SNP	ENST00000344641.3	37	CCDS6840.1	SNP	25	WashU																																																																																				0.443	MRRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053914.1	NM_138777		Silent
DDX25	29118	genome.wustl.edu	37	11	125787021	125787021	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1412-01	TCGA-13-1412-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr11:125787021G>C	ENST00000263576.6	+	9	1068	c.913G>C	c.(913-915)Gag>Cag	p.E305Q	RP11-680F20.9_ENST00000533033.2_RNA|DDX25_ENST00000525943.1_3'UTR	NM_013264.4	NP_037396.3	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 25	305					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.E191Q(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)	10	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		GTTACGCAAAGAGGAGCTCAC	0.463																																																1	Substitution - Missense(1)	ovary(1)	11											80.0	79.0	79.0					11																	125787021		2108	4245	6353	125292231	SO:0001583	missense	29118			AF155140	CCDS44766.1	11q24	2012-02-23	2012-02-23		ENSG00000109832	ENSG00000109832		"""DEAD-boxes"""	18698	protein-coding gene	gene with protein product	"""gonadotropin-regulated testicular RNA helicase"""	607663	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 25"""			10608860, 15096601	Standard	NM_013264		Approved	GRTH	uc001qcz.5	Q9UHL0	OTTHUMG00000165859	ENST00000263576.6:c.913G>C	11.37:g.125787021G>C	ENSP00000263576:p.Glu305Gln		125292231	B2R6Z0|Q5XVN2|Q86W81|Q8IYP1	Missense_Mutation	SNP	ENST00000263576.6	37	CCDS44766.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879235	0.51801	.	.	ENSG00000109832	ENST00000525943;ENST00000263576;ENST00000526875	T	0.03580	3.88	5.79	5.79	0.91817	DEAD-like helicase (1);	0.000000	0.85682	D	0.000000	T	0.22044	0.0531	M	0.84326	2.69	0.80722	D	1	D;D	0.71674	0.992;0.998	D;D	0.71870	0.946;0.975	T	0.00132	-1.2012	10	0.72032	D	0.01	-6.9125	19.6367	0.95736	0.0:0.0:1.0:0.0	.	305;305	B4DHI6;Q9UHL0	.;DDX25_HUMAN	Q	191;305;171	ENSP00000263576:E305Q	ENSP00000263576:E305Q	E	+	1	0	DDX25	125292231	1.000000	0.71417	0.999000	0.59377	0.841000	0.47740	9.378000	0.97191	2.735000	0.93741	0.655000	0.94253	GAG		0.463	DDX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386736.3	NM_013264		Missense_Mutation
IGSF1	3547	genome.wustl.edu	37	X	130408594	130408594	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1412-01	TCGA-13-1412-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chrX:130408594G>C	ENST00000361420.3	-	18	3809	c.3730C>G	c.(3730-3732)Ctg>Gtg	p.L1244V	IGSF1_ENST00000370910.1_Missense_Mutation_p.L1235V|IGSF1_ENST00000370904.1_Missense_Mutation_p.L1235V|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370903.3_Missense_Mutation_p.L1249V			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1244					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.L1244V(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						ACCAGCTCCAGGGGATCACTA	0.537																																																1	Substitution - Missense(1)	ovary(1)	X											133.0	124.0	127.0					X																	130408594		2203	4300	6503	130236275	SO:0001583	missense	3547			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3730C>G	X.37:g.130408594G>C	ENSP00000355010:p.Leu1244Val		130236275	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	CCDS14629.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	13.03	2.115667	0.37339	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.10960	2.82;2.82;2.82;2.82	5.42	2.72	0.32119	Immunoglobulin-like fold (1);	0.368253	0.19947	N	0.102505	T	0.25938	0.0632	M	0.66297	2.02	0.28186	N	0.927947	D;P;D	0.63046	0.983;0.756;0.992	D;P;D	0.76071	0.969;0.678;0.987	T	0.04165	-1.0972	10	0.51188	T	0.08	.	7.3046	0.26440	0.2846:0.0:0.7154:0.0	.	1235;688;1244	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	V	1235;1244;1235;1249	ENSP00000359947:L1235V;ENSP00000355010:L1244V;ENSP00000359941:L1235V;ENSP00000359940:L1249V	ENSP00000355010:L1244V	L	-	1	2	IGSF1	130236275	0.866000	0.29940	0.810000	0.32431	0.836000	0.47400	0.828000	0.27435	0.218000	0.20820	-0.199000	0.12753	CTG		0.537	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			Missense_Mutation
PLEKHB2	55041	genome.wustl.edu	37	2	131904258	131904258	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1412-01	TCGA-13-1412-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr2:131904258A>T	ENST00000403716.1	+	8	1141	c.581A>T	c.(580-582)tAt>tTt	p.Y194F	PLEKHB2_ENST00000409279.1_Missense_Mutation_p.Y194F|PLEKHB2_ENST00000234115.6_Missense_Mutation_p.Y193F|PLEKHB2_ENST00000439822.2_Missense_Mutation_p.I150F|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000438882.2_Missense_Mutation_p.I158F|PLEKHB2_ENST00000409612.1_Missense_Mutation_p.Y194F|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000409158.1_Missense_Mutation_p.Y202F|PLEKHB2_ENST00000538982.1_Missense_Mutation_p.Y146F	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	194						endosome (GO:0005768)|membrane (GO:0016020)		p.Y193F(1)		large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		CGAGAGCGCTATCGAGACAAC	0.512																																																1	Substitution - Missense(1)	ovary(1)	2											178.0	184.0	182.0					2																	131904258		2203	4300	6503	131620728	SO:0001583	missense	55041				CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.581A>T	2.37:g.131904258A>T	ENSP00000385892:p.Tyr194Phe		131620728	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Missense_Mutation	SNP	ENST00000403716.1	37	CCDS46413.1	SNP	16	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.47|16.47	3.132829|3.132829	0.56828|0.56828	.|.	.|.	ENSG00000115762|ENSG00000115762	ENST00000439822;ENST00000438882|ENST00000409158;ENST00000403716;ENST00000234115;ENST00000538982;ENST00000409612;ENST00000409279	.|.	.|.	.|.	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	.|.	.|.	.|.	.|.	T|T	0.60183|0.60183	0.2249|0.2249	M|M	0.63428|0.63428	1.95|1.95	0.39631|0.39631	D|D	0.970177|0.970177	P;B|P;P;P;P	0.43169|0.39665	0.8;0.165|0.457;0.592;0.457;0.682	B;B|B;B;B;B	0.38562|0.42771	0.276;0.059|0.223;0.397;0.223;0.223	T|T	0.65364|0.65364	-0.6186|-0.6186	7|8	.|0.52906	.|T	.|0.07	.|.	13.7769|13.7769	0.63059|0.63059	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	150;158|193;193;194;202	B4DZ66;B4DF08|Q53FF1;Q96CS7-3;Q96CS7;B8ZZN1	.;.|.;.;PKHB2_HUMAN;.	F|F	150;158|202;194;193;146;194;194	.|.	.|ENSP00000234115:Y193F	I|Y	+|+	1|2	0|0	PLEKHB2|PLEKHB2	131620728|131620728	1.000000|1.000000	0.71417|0.71417	0.907000|0.907000	0.35723|0.35723	0.780000|0.780000	0.44128|0.44128	7.282000|7.282000	0.78630|0.78630	2.144000|2.144000	0.66660|0.66660	0.524000|0.524000	0.50904|0.50904	ATC|TAT		0.512	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331304.2	NM_017958		Missense_Mutation
NUP214	8021	genome.wustl.edu	37	9	134050999	134050999	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr9:134050999C>G	ENST00000359428.5	+	23	3454	c.3310C>G	c.(3310-3312)Cag>Gag	p.Q1104E	NUP214_ENST00000411637.2_Missense_Mutation_p.Q1094E|NUP214_ENST00000451030.1_Missense_Mutation_p.Q1105E			P35658	NU214_HUMAN	nucleoporin 214kDa	1104	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)	p.Q1104E(1)		NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		GATGGCCAGTCAGGCACCAGG	0.592			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	1	Substitution - Missense(1)	ovary(1)	9											27.0	26.0	26.0					9																	134050999		2203	4300	6503	133040820	SO:0001583	missense	8021			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.3310C>G	9.37:g.134050999C>G	ENSP00000352400:p.Gln1104Glu		133040820	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	CCDS6940.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	27.2	4.806536	0.90623	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605	T;T;T	0.38077	1.17;1.16;1.17	5.79	5.79	0.91817	.	0.000000	0.40144	N	0.001164	T	0.42832	0.1220	N	0.08118	0	0.58432	D	0.999999	P;D;D;D	0.71674	0.898;0.998;0.996;0.996	P;D;D;D	0.80764	0.57;0.994;0.987;0.987	T	0.52170	-0.8611	10	0.52906	T	0.07	-6.2768	19.0281	0.92941	0.0:1.0:0.0:0.0	.	1093;698;1094;1104	P35658-2;Q5JUP9;P35658-4;P35658	.;.;.;NU214_HUMAN	E	1104;1094;1105;1093;698;533	ENSP00000352400:Q1104E;ENSP00000396576:Q1094E;ENSP00000405014:Q1105E	ENSP00000352400:Q1104E	Q	+	1	0	NUP214	133040820	1.000000	0.71417	0.934000	0.37439	0.870000	0.49936	4.857000	0.62939	2.733000	0.93635	0.655000	0.94253	CAG		0.592	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085		Missense_Mutation
C9orf171	389799	genome.wustl.edu	37	9	135374905	135374905	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr9:135374905C>T	ENST00000343036.2	+	4	598	c.550C>T	c.(550-552)Cgc>Tgc	p.R184C	C9orf171_ENST00000393216.2_Missense_Mutation_p.R148C|C9orf171_ENST00000393215.3_Missense_Mutation_p.R148C	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	184			R -> H (in dbSNP:rs11243798).					p.R184C(1)		large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						CAATGACATCCGCATCAGTGA	0.602																																																1	Substitution - Missense(1)	ovary(1)	9											87.0	88.0	87.0					9																	135374905		2203	4300	6503	134364726	SO:0001583	missense				AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.550C>T	9.37:g.135374905C>T	ENSP00000343290:p.Arg184Cys		134364726	Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	CCDS6949.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088807	0.76756	.	.	ENSG00000188523	ENST00000393215;ENST00000343036;ENST00000393216	T;T;T	0.27557	1.66;1.66;1.66	5.15	5.15	0.70609	.	0.067918	0.64402	D	0.000020	T	0.52693	0.1750	L	0.60455	1.87	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.87578	0.992;0.998	T	0.54132	-0.8339	10	0.87932	D	0	.	16.1436	0.81548	0.0:1.0:0.0:0.0	.	148;184	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	C	148;184;148	ENSP00000376908:R148C;ENSP00000343290:R184C;ENSP00000376909:R148C	ENSP00000343290:R184C	R	+	1	0	C9orf171	134364726	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	2.005000	0.40864	2.560000	0.86352	0.561000	0.74099	CGC		0.602	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417		Missense_Mutation
SV2A	9900	genome.wustl.edu	37	1	149884907	149884907	+	Silent	SNP	G	G	A			TCGA-13-1412-01	TCGA-13-1412-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr1:149884907G>A	ENST00000369146.3	-	2	976	c.486C>T	c.(484-486)ggC>ggT	p.G162G	SV2A_ENST00000369145.1_Silent_p.G162G	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	162					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.G162G(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	ACTGGAAGCGGCCGTGGCCAC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	1											102.0	101.0	101.0					1																	149884907		2203	4300	6503	148151531	SO:0001819	synonymous_variant	9900			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.486C>T	1.37:g.149884907G>A			148151531	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	ENST00000369146.3	37	CCDS940.1	SNP	42	WashU																																																																																				0.617	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1			Silent
PDE6A	5145	genome.wustl.edu	37	5	149324230	149324230	+	Nonsense_Mutation	SNP	C	C	A	rs35515899|rs577050700	byFrequency	TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr5:149324230C>A	ENST00000255266.5	-	1	126	c.7G>T	c.(7-9)Gag>Tag	p.E3*		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	3					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.E3*(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	GCTGTCACCTCGCCCATGGCT	0.547																																																1	Substitution - Nonsense(1)	ovary(1)	5																																								149304423	SO:0001587	stop_gained	5145				CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.7G>T	5.37:g.149324230C>A	ENSP00000255266:p.Glu3*		149304423	Q0P638	Nonsense_Mutation	SNP	ENST00000255266.5	37	CCDS4299.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	36	5.687157	0.96784	.	.	ENSG00000132915	ENST00000255266	.	.	.	5.79	5.79	0.91817	.	0.200405	0.43747	D	0.000527	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	15.5247	0.75894	0.0:1.0:0.0:0.0	.	.	.	.	X	3	.	ENSP00000255266:E3X	E	-	1	0	PDE6A	149304423	0.946000	0.32159	0.956000	0.39512	0.393000	0.30537	4.673000	0.61604	2.750000	0.94351	0.561000	0.74099	GAG		0.547	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2			Nonsense_Mutation
CSAG1	158511	genome.wustl.edu	37	X	151909159	151909159	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1412-01	TCGA-13-1412-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chrX:151909159G>T	ENST00000370287.3	+	5	516	c.188G>T	c.(187-189)aGg>aTg	p.R63M	CSAG1_ENST00000452779.2_Missense_Mutation_p.R63M|CSAG1_ENST00000370291.2_3'UTR	NM_153478.1	NP_705611.1	Q6PB30	CSAG1_HUMAN	chondrosarcoma associated gene 1	63								p.R63M(1)		central_nervous_system(1)|kidney(1)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					CAACCCAAAAGGGAAAAGGGA	0.522																																																1	Substitution - Missense(1)	ovary(1)	X											96.0	98.0	97.0					X																	151909159		2203	4300	6503	151659815	SO:0001583	missense	158511			AF268419	CCDS76047.1	Xq28	2009-08-07			ENSG00000198930	ENSG00000198930			24294	protein-coding gene	gene with protein product	"""cancer/testis antigen family 24, member 1"""					12039054	Standard	XM_006724810		Approved	CSAGE, CT24.1	uc004fgf.3	Q6PB30	OTTHUMG00000022648	ENST00000370287.3:c.188G>T	X.37:g.151909159G>T	ENSP00000359310:p.Arg63Met		151659815	A6NE22	Missense_Mutation	SNP	ENST00000370287.3	37	CCDS14711.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	6.926	0.540614	0.13250	.	.	ENSG00000198930	ENST00000370287;ENST00000452779	T;T	0.45276	0.9;0.9	0.837	0.837	0.18896	.	.	.	.	.	T	0.54334	0.1852	.	.	.	0.09310	N	1	D	0.71674	0.998	P	0.61132	0.884	T	0.41179	-0.9523	7	0.87932	D	0	.	.	.	.	.	63	Q6PB30	CSAG1_HUMAN	M	63	ENSP00000359310:R63M;ENSP00000396520:R63M	ENSP00000359310:R63M	R	+	2	0	CSAG1	151659815	0.014000	0.17966	0.004000	0.12327	0.019000	0.09904	0.186000	0.16978	0.689000	0.31550	0.179000	0.17066	AGG		0.522	CSAG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058760.2	NM_153479		Missense_Mutation
CLIC2	1193	genome.wustl.edu	37	X	154528097	154528097	+	Splice_Site	SNP	C	C	T			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chrX:154528097C>T	ENST00000369449.2	-	3	512		c.e3+1		CLIC2_ENST00000465553.1_Splice_Site	NM_001289.4	NP_001280.3	O15247	CLIC2_HUMAN	chloride intracellular channel 2						chloride transmembrane transport (GO:1902476)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|oxidation-reduction process (GO:0055114)|positive regulation of binding (GO:0051099)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|signal transduction (GO:0007165)|transport (GO:0006810)	chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)|glutathione peroxidase activity (GO:0004602)|voltage-gated chloride channel activity (GO:0005247)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)	18	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AAATGCTGTACCTTGGAGGAG	0.358																																					Melanoma(108;581 1592 2289 21669 28822)											1	Unknown(1)	ovary(1)	X											86.0	84.0	85.0					X																	154528097		2203	4300	6503	154181291	SO:0001630	splice_region_variant	1193			AJ000217	CCDS14767.1	Xq28	2012-09-26			ENSG00000155962	ENSG00000155962		"""Ion channels / Chloride channels : Intracellular"""	2063	protein-coding gene	gene with protein product		300138				9339381	Standard	NM_001289		Approved	XAP121	uc004fnf.3	O15247	OTTHUMG00000022660	ENST00000369449.2:c.293+1G>A	X.37:g.154528097C>T			154181291	A8K9S0|O15174|Q5JT80|Q8TCE3	Splice_Site_SNP	SNP	ENST00000369449.2	37	CCDS14767.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	16.04	3.010059	0.54361	.	.	ENSG00000155962	ENST00000369449	.	.	.	4.0	4.0	0.46444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6006	0.45365	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CLIC2	154181291	1.000000	0.71417	0.999000	0.59377	0.728000	0.41692	7.114000	0.77103	2.262000	0.75019	0.415000	0.27848	.		0.358	CLIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058793.1	NM_001289	Intron	Splice_Site_SNP
SCN9A	6335	genome.wustl.edu	37	2	167128930	167128930	+	Silent	SNP	C	C	T			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr2:167128930C>T	ENST00000409435.1	-	16	3329	c.3330G>A	c.(3328-3330)tcG>tcA	p.S1110S	SCN9A_ENST00000375387.4_Silent_p.S1111S|SCN9A_ENST00000409672.1_Silent_p.S1099S|SCN9A_ENST00000303354.6_Silent_p.S1111S|AC010127.3_ENST00000447809.2_RNA			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1110					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.S1099S(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATTCACTATCCGAATCACTGC	0.348																																																1	Substitution - coding silent(1)	ovary(1)	2											65.0	57.0	60.0					2																	167128930		1849	4098	5947	166837176	SO:0001819	synonymous_variant	6335			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.3330G>A	2.37:g.167128930C>T			166837176	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Silent	SNP	ENST00000409435.1	37	CCDS46441.1	SNP	23	WashU																																																																																				0.348	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977		Silent
TTN	7273	genome.wustl.edu	37	2	179430843	179430843	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr2:179430843C>G	ENST00000591111.1	-	276	75317	c.75093G>C	c.(75091-75093)aaG>aaC	p.K25031N	TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K17799N|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K24104N|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K26672N|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K17732N|TTN_ENST00000460472.2_Missense_Mutation_p.K17607N|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25031	Ig-like 123.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K17607N(1)|p.K24102N(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAAAGCAGACTTTGATCCAC	0.393																																																2	Substitution - Missense(2)	ovary(2)	2											176.0	169.0	171.0					2																	179430843		1867	4101	5968	179139089	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.75093G>C	2.37:g.179430843C>G	ENSP00000465570:p.Lys25031Asn		179139089	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	8.253	0.809506	0.16537	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.81	2.39	0.29439	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78585	0.4306	M	0.77820	2.39	0.38320	D	0.943503	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.78061	-0.2351	9	0.87932	D	0	.	7.9321	0.29907	0.0:0.4204:0.0:0.5796	.	17607;17732;17799;25031	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	24104;17607;17799;17732;17605	ENSP00000343764:K24104N;ENSP00000434586:K17607N;ENSP00000340554:K17799N;ENSP00000352154:K17732N	ENSP00000340554:K17799N	K	-	3	2	TTN	179139089	0.992000	0.36948	0.991000	0.47740	0.979000	0.70002	0.283000	0.18846	0.191000	0.20236	-0.300000	0.09419	AAG		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
CACNA1E	777	genome.wustl.edu	37	1	181708291	181708291	+	Silent	SNP	C	C	T			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr1:181708291C>T	ENST00000367573.2	+	25	3621	c.3621C>T	c.(3619-3621)gaC>gaT	p.D1207D	CACNA1E_ENST00000360108.3_Silent_p.D1188D|CACNA1E_ENST00000367570.1_Silent_p.D1207D|CACNA1E_ENST00000526775.1_Silent_p.D1188D|CACNA1E_ENST00000358338.5_Silent_p.D1139D|CACNA1E_ENST00000357570.5_Silent_p.D1158D|CACNA1E_ENST00000367567.4_Silent_p.D814D	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1207					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.D1207D(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AGATGATAGACCAAGGCTTGA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	1											243.0	247.0	246.0					1																	181708291		2105	4224	6329	179974914	SO:0001819	synonymous_variant	777			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.3621C>T	1.37:g.181708291C>T			179974914	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	CCDS55664.1	SNP	18	WashU																																																																																				0.542	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		Silent
EIF2B5	8893	genome.wustl.edu	37	3	183860567	183860567	+	Splice_Site	SNP	G	G	A			TCGA-13-1412-01	TCGA-13-1412-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr3:183860567G>A	ENST00000273783.3	+	11	1669	c.1547G>A	c.(1546-1548)gGa>gAa	p.G516E	EIF2B5_ENST00000444495.1_Splice_Site_p.G516E	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	516					astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)	p.G516E(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GGCTTCTCAGGACTCAAGATC	0.458																																																1	Substitution - Missense(1)	ovary(1)	3											23.0	27.0	25.0					3																	183860567		2201	4299	6500	185343261	SO:0001630	splice_region_variant	8893			U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.1547-1G>A	3.37:g.183860567G>A			185343261	Q541Z1|Q96D04	Missense_Mutation	SNP	ENST00000273783.3	37	CCDS3252.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	g	17.27	3.347011	0.61183	.	.	ENSG00000145191	ENST00000273783;ENST00000444495;ENST00000544027	D;D	0.97888	-4.59;-4.59	5.79	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.98096	0.9372	L	0.56769	1.78	0.80722	D	1	P;D	0.89917	0.675;1.0	B;D	0.77004	0.241;0.989	D	0.98126	1.0428	9	.	.	.	.	14.7653	0.69634	0.0701:0.0:0.9299:0.0	.	516;516	E9PC74;Q13144	.;EI2BE_HUMAN	E	516;516;272	ENSP00000273783:G516E;ENSP00000409142:G516E	.	G	+	2	0	EIF2B5	185343261	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	6.116000	0.71571	1.464000	0.47987	-0.254000	0.11334	GGA		0.458	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1		Missense_Mutation	Missense_Mutation
KCNT2	343450	genome.wustl.edu	37	1	196398705	196398705	+	Splice_Site	SNP	A	A	T			TCGA-13-1412-01	TCGA-13-1412-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr1:196398705A>T	ENST00000294725.9	-	9	1735		c.e9+1		KCNT2_ENST00000609185.1_Splice_Site|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000498426.1_Splice_Site|KCNT2_ENST00000367433.5_Splice_Site|KCNT2_ENST00000367431.4_Splice_Site			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2						potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.?(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						GGTTTTGTTTACCTGTATGGG	0.378																																																1	Unknown(1)	ovary(1)	1											80.0	73.0	76.0					1																	196398705		2203	4300	6503	194665328	SO:0001630	splice_region_variant	343450			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.819+1T>A	1.37:g.196398705A>T			194665328	Q3SY59|Q5VTN1|Q6ZMT3	Splice_Site_SNP	SNP	ENST00000294725.9	37	CCDS1384.1	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	22.3	4.267401	0.80469	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000294725	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7343	0.77831	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KCNT2	194665328	1.000000	0.71417	0.999000	0.59377	0.857000	0.48899	9.333000	0.96459	2.115000	0.64714	0.533000	0.62120	.		0.378	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	Intron	Splice_Site_SNP
ACAP2	23527	genome.wustl.edu	37	3	195013022	195013022	+	Missense_Mutation	SNP	G	G	A	rs546719175	byFrequency	TCGA-13-1412-01	TCGA-13-1412-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr3:195013022G>A	ENST00000326793.6	-	19	2155	c.1925C>T	c.(1924-1926)gCg>gTg	p.A642V		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	642					cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.A642V(1)		cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						AAGTGGTGTCGCTTTGTTTTC	0.383													G|||	3	0.000599042	0.0	0.0	5008	,	,		18643	0.0		0.0	False		,,,				2504	0.0031															1	Substitution - Missense(1)	ovary(1)	3											166.0	164.0	165.0					3																	195013022		2203	4300	6503	196494311	SO:0001583	missense	23527				CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.1925C>T	3.37:g.195013022G>A	ENSP00000324287:p.Ala642Val		196494311	A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	ENST00000326793.6	37	CCDS33924.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	21.0	4.088266	0.76756	.	.	ENSG00000114331	ENST00000326793	T	0.65549	-0.16	5.43	5.43	0.79202	Ankyrin repeat-containing domain (3);	0.108834	0.64402	D	0.000005	T	0.48132	0.1483	N	0.20685	0.6	0.42331	D	0.992293	P	0.43973	0.823	B	0.37731	0.257	T	0.49224	-0.8962	10	0.30854	T	0.27	.	18.2382	0.89957	0.0:0.0:1.0:0.0	.	642	Q15057	ACAP2_HUMAN	V	642	ENSP00000324287:A642V	ENSP00000324287:A642V	A	-	2	0	ACAP2	196494311	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.569000	0.45973	2.560000	0.86352	0.655000	0.94253	GCG		0.383	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	NM_012287		Missense_Mutation
NUMA1	4926	genome.wustl.edu	37	11	71726361	71726375	+	In_Frame_Del	DEL	CCAGGGCATCTGCAG	CCAGGGCATCTGCAG	-	rs370348490		TCGA-13-1412-01	TCGA-13-1412-10	CCAGGGCATCTGCAG	CCAGGGCATCTGCAG	CCAGGGCATCTGCAG	-	CCAGGGCATCTGCAG	CCAGGGCATCTGCAG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr11:71726361_71726375delCCAGGGCATCTGCAG	ENST00000393695.3	-	15	2505_2519	c.2174_2188delCTGCAGATGCCCTGG	c.(2173-2190)gctgcagatgccctggaa>gaa	p.AADAL725del	NUMA1_ENST00000358965.6_In_Frame_Del_p.AADAL725del|NUMA1_ENST00000351960.6_Intron|RP11-849H4.4_ENST00000502284.1_RNA	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1									p.A725_L729del(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						TGCTGCTCTTCCAGGGCATCTGCAGCCCTGCGCTT	0.6			T	RARA	APL																																		Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	1	Deletion - In frame(1)	ovary(1)	11																																								71404023	SO:0001651	inframe_deletion	4926			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.2174_2188delCTGCAGATGCCCTGG	11.37:g.71726361_71726375delCCAGGGCATCTGCAG	ENSP00000377298:p.Ala725_Leu729del		71404009		In_Frame_Del	DEL	ENST00000393695.3	37	CCDS31633.1	DEL	30	WashU																																																																																				0.600	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1			In_Frame_Del
FLG	2312	genome.wustl.edu	37	1	152278109	152278109	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	G	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr1:152278109C>G	ENST00000368799.1	-	3	9288	c.9253G>C	c.(9253-9255)Gga>Cga	p.G3085R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3085	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G3085R(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTTGTCTTCCTCTAGTGCTG	0.572									Ichthyosis																																							1	Substitution - Missense(1)	ovary(1)	1											47.0	64.0	59.0					1																	152278109		1948	4168	6116	150544733	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9253G>C	1.37:g.152278109C>G	ENSP00000357789:p.Gly3085Arg		150544733	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	7.088	0.571555	0.13623	.	.	ENSG00000143631	ENST00000368799	T	0.02974	4.09	3.59	-0.246	0.13022	.	.	.	.	.	T	0.00468	0.0015	N	0.25380	0.74	0.09310	N	1	P	0.47841	0.901	B	0.33846	0.171	T	0.41179	-0.9523	9	0.15952	T	0.53	.	2.8322	0.05503	0.0:0.4084:0.2417:0.3499	.	3085	P20930	FILA_HUMAN	R	3085	ENSP00000357789:G3085R	ENSP00000357789:G3085R	G	-	1	0	FLG	150544733	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	-3.142000	0.00585	0.142000	0.18901	0.449000	0.29647	GGA		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		Missense_Mutation
KIAA1755	85449	genome.wustl.edu	37	20	36841547	36841547	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1412-01	TCGA-13-1412-10	C	C	C	G	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chr20:36841547C>G	ENST00000279024.4	-	14	3771	c.3500G>C	c.(3499-3501)aGc>aCc	p.S1167T		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	1167								p.S1167T(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				AGGGACCTGGCTCTGCCTGGG	0.642																																																1	Substitution - Missense(1)	ovary(1)	20											38.0	41.0	40.0					20																	36841547		2203	4300	6503	36274961	SO:0001583	missense	85449			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.3500G>C	20.37:g.36841547C>G	ENSP00000279024:p.Ser1167Thr		36274961	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	CCDS33467.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	11.04	1.521250	0.27211	.	.	ENSG00000149633	ENST00000279024	T	0.08370	3.1	5.14	2.16	0.27623	.	1.152160	0.06324	N	0.705042	T	0.08133	0.0203	L	0.38838	1.175	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.39099	-0.9630	10	0.72032	D	0.01	.	5.0113	0.14313	0.0:0.6412:0.1732:0.1857	.	1167	Q5JYT7	K1755_HUMAN	T	1167	ENSP00000279024:S1167T	ENSP00000279024:S1167T	S	-	2	0	KIAA1755	36274961	0.050000	0.20438	0.000000	0.03702	0.194000	0.23727	1.039000	0.30266	0.335000	0.23614	0.561000	0.74099	AGC		0.642	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864		Missense_Mutation
IRAK1	3654	genome.wustl.edu	37	X	153284906	153284906	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1412-01	TCGA-13-1412-10	G	G	G	A	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1412-01	TCGA-13-1412-10	g.chrX:153284906G>A	ENST00000369980.3	-	2	447	c.280C>T	c.(280-282)Cgt>Tgt	p.R94C	IRAK1_ENST00000477274.1_5'Flank|IRAK1_ENST00000393687.2_Missense_Mutation_p.R94C|IRAK1_ENST00000393682.1_Missense_Mutation_p.R120C|IRAK1_ENST00000369974.2_Missense_Mutation_p.R94C|MIR718_ENST00000390190.2_RNA|IRAK1_ENST00000429936.2_Missense_Mutation_p.R120C	NM_001025242.1|NM_001569.3	NP_001020413.1|NP_001560.2	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	94	Death.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|interleukin-1 receptor complex (GO:0045323)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|NF-kappaB-inducing kinase activity (GO:0004704)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)	p.R94C(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(15)|ovary(2)	25	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCCGCGCACGGAGCAGCTGC	0.741																																																1	Substitution - Missense(1)	ovary(1)	X											20.0	20.0	20.0					X																	153284906		2197	4292	6489	152938100	SO:0001583	missense	3654			L76191	CCDS14740.1, CCDS35443.1, CCDS35444.1	Xq28	2011-07-08			ENSG00000184216	ENSG00000184216			6112	protein-coding gene	gene with protein product		300283				9374458, 8599092	Standard	XM_005274668		Approved	IRAK, pelle	uc004fjs.1	P51617	OTTHUMG00000024228	ENST00000369980.3:c.280C>T	X.37:g.153284906G>A	ENSP00000358997:p.Arg94Cys		152938100	D3DWW3|D3DWW4|Q7Z5V4|Q96C06|Q96RL2	Missense_Mutation	SNP	ENST00000369980.3	37	CCDS14740.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	.	26.1	4.700632	0.88924	.	.	ENSG00000184216	ENST00000369980;ENST00000369974;ENST00000393682;ENST00000444230;ENST00000393687;ENST00000429936	D;D;D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06;-2.06;-2.06	4.47	4.47	0.54385	Death (1);DEATH-like (2);	0.301498	0.23656	N	0.045864	D	0.89938	0.6860	L	0.49778	1.585	0.58432	D	0.999991	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.999;0.999	D	0.91102	0.4915	10	0.87932	D	0	-14.1656	15.0964	0.72238	0.0:0.0:1.0:0.0	.	120;94;94;94	D3YTB5;P51617-4;P51617;P51617-2	.;.;IRAK1_HUMAN;.	C	94;94;120;90;94;120	ENSP00000358997:R94C;ENSP00000358991:R94C;ENSP00000377287:R120C;ENSP00000399974:R90C;ENSP00000377291:R94C;ENSP00000392662:R120C	ENSP00000358990:R120C	R	-	1	0	IRAK1	152938100	0.999000	0.42202	0.924000	0.36721	0.953000	0.61014	3.747000	0.55134	1.795000	0.52594	0.377000	0.23210	CGT		0.741	IRAK1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061143.3			Missense_Mutation
