#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
RBMXL1	494115	broad.mit.edu	37	1	89448995	89448995	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr1:89448995C>T	ENST00000321792.5	-	2	942	c.515G>A	c.(514-516)cGc>cAc	p.R172H	CCBL2_ENST00000370485.2_Intron|RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000370491.3_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.R172H|CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000446900.2_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	172					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R172H(1)									ACTGCTGCTGCGAACTAGTCC	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											156.0	160.0	159.0					1																	89448995		2203	4300	6503	89221583	SO:0001583	missense	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.515G>A	1.37:g.89448995C>T	ENSP00000318415:p.Arg172His		89221583		Missense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	21.3	4.133317	0.77662	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.77877	-1.13;-1.13	1.76	-3.52	0.04682	.	0.074218	0.53938	U	0.000044	T	0.56187	0.1968	L	0.51422	1.61	0.27223	N	0.959605	D	0.54964	0.969	P	0.51170	0.661	T	0.58228	-0.7673	10	0.49607	T	0.09	-6.7697	3.4498	0.07494	0.2218:0.5114:0.0:0.2669	.	172	Q96E39	RBMXL_HUMAN	H	172	ENSP00000318415:R172H;ENSP00000446099:R172H	ENSP00000318415:R172H	R	-	2	0	RBMXL1	89221583	1.000000	0.71417	0.889000	0.34880	0.854000	0.48673	2.066000	0.41452	-0.792000	0.04480	0.306000	0.20318	CGC		0.527	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610		Missense_Mutation
ARHGAP30	257106	broad.mit.edu	37	1	161022582	161022582	+	Missense_Mutation	SNP	C	C	T	rs202221316		TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr1:161022582C>T	ENST00000368013.3	-	7	990	c.670G>A	c.(670-672)Gag>Aag	p.E224K	ARHGAP30_ENST00000368015.1_Missense_Mutation_p.E47K|ARHGAP30_ENST00000368016.3_Missense_Mutation_p.E224K	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	224					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)	p.E224K(2)		breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CTCTCCACCTCACCACCTGGG	0.592													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17359	0.0		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(2)	1											37.0	40.0	39.0					1																	161022582		2203	4300	6503	159289206	SO:0001583	missense	257106			AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.670G>A	1.37:g.161022582C>T	ENSP00000356992:p.Glu224Lys		159289206	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	37	CCDS30918.1	SNP	29	Broad	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	12.56	1.974546	0.34848	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368017;ENST00000368015	T;T;T	0.32753	3.02;2.99;1.44	4.2	3.28	0.37604	.	0.687394	0.13762	N	0.364560	T	0.13841	0.0335	L	0.47016	1.485	0.30095	N	0.807953	B;B	0.25206	0.027;0.12	B;B	0.29176	0.04;0.099	T	0.15521	-1.0434	10	0.56958	D	0.05	.	9.9491	0.41628	0.0:0.7937:0.2063:0.0	.	224;224	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	K	224;224;76;47	ENSP00000356995:E224K;ENSP00000356992:E224K;ENSP00000356994:E47K	ENSP00000356992:E224K	E	-	1	0	ARHGAP30	159289206	0.990000	0.36364	0.066000	0.19879	0.454000	0.32378	4.780000	0.62382	0.973000	0.38340	-0.324000	0.08512	GAG		0.592	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720		Missense_Mutation
TNN	63923	broad.mit.edu	37	1	175063191	175063191	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr1:175063191G>A	ENST00000239462.4	+	7	1503	c.1390G>A	c.(1390-1392)Gac>Aac	p.D464N		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	464	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.D464N(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TGTCTCCTGGGACCCAGTGCA	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											97.0	81.0	86.0					1																	175063191		2203	4300	6503	173329814	SO:0001583	missense	63923			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1390G>A	1.37:g.175063191G>A	ENSP00000239462:p.Asp464Asn		173329814	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	8.710	0.911754	0.17907	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.57273	0.41	5.4	1.48	0.22813	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.275440	0.31335	N	0.007823	T	0.41719	0.1171	L	0.52823	1.66	0.37266	D	0.907183	B;B	0.10296	0.003;0.003	B;B	0.17979	0.01;0.02	T	0.27262	-1.0079	10	0.17369	T	0.5	.	8.2242	0.31560	0.4551:0.0:0.5449:0.0	.	464;464	B3KXB6;Q9UQP3	.;TENN_HUMAN	N	464	ENSP00000239462:D464N	ENSP00000239462:D464N	D	+	1	0	TNN	173329814	0.955000	0.32602	0.719000	0.30619	0.072000	0.16883	0.941000	0.29005	0.024000	0.15214	-0.217000	0.12591	GAC		0.463	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		Missense_Mutation
RYR2	6262	broad.mit.edu	37	1	237494210	237494210	+	Silent	SNP	T	T	C			TCGA-13-1477-01	TCGA-13-1477-10			T	C	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr1:237494210T>C	ENST00000366574.2	+	3	518	c.201T>C	c.(199-201)ttT>ttC	p.F67F	RYR2_ENST00000542537.1_Silent_p.F51F|RYR2_ENST00000360064.6_Missense_Mutation_p.L65S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	67					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.L65S(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCTGCACCTTTGTGCTGGAGC	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											88.0	92.0	91.0					1																	237494210		2065	4237	6302	235560833	SO:0001819	synonymous_variant	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.201T>C	1.37:g.237494210T>C			235560833	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	11.55	1.673070	0.29693	.	.	ENSG00000198626	ENST00000360064	D	0.96802	-4.13	5.26	-2.91	0.05631	.	0.887861	0.08909	U	0.876159	D	0.96466	0.8847	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.92757	0.6221	7	0.66056	D	0.02	.	11.541	0.50667	0.0:0.4818:0.0:0.5182	.	.	.	.	S	65	ENSP00000353174:L65S	ENSP00000353174:L65S	L	+	2	0	RYR2	235560833	1.000000	0.71417	0.982000	0.44146	0.651000	0.38670	0.928000	0.28831	-0.606000	0.05746	-1.167000	0.01749	TTG		0.522	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		Silent
FAM208B	54906	broad.mit.edu	37	10	5789063	5789063	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr10:5789063G>A	ENST00000328090.5	+	15	4304	c.3679G>A	c.(3679-3681)Gga>Aga	p.G1227R		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1227								p.G1227R(1)									CATTTCGTCAGGATGCCACAC	0.418																																																1	Substitution - Missense(1)	ovary(1)	10											83.0	83.0	83.0					10																	5789063		2005	4181	6186	5829069	SO:0001583	missense	54906			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.3679G>A	10.37:g.5789063G>A	ENSP00000328426:p.Gly1227Arg		5829069	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	CCDS41485.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.866964	0.00547	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.03801	3.8	5.55	-2.86	0.05717	.	3.167350	0.00496	N	0.000149	T	0.03390	0.0098	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40627	-0.9553	10	0.15952	T	0.53	.	5.2844	0.15692	0.3906:0.2818:0.3277:0.0	.	1227	Q5VWN6	F208B_HUMAN	R	1227;422	ENSP00000328426:G1227R	ENSP00000328426:G1227R	G	+	1	0	C10orf18	5829069	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.544000	0.06077	-0.837000	0.04223	-0.469000	0.05056	GGA		0.418	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782		Missense_Mutation
EDRF1	26098	broad.mit.edu	37	10	127429185	127429185	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr10:127429185C>T	ENST00000356792.4	+	16	2367	c.2135C>T	c.(2134-2136)gCa>gTa	p.A712V	C10orf137_ENST00000337623.3_Missense_Mutation_p.A678V	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		712					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.A678V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TACGGAAGAGCATTACGATAC	0.383																																																1	Substitution - Missense(1)	ovary(1)	10											125.0	115.0	118.0					10																	127429185		2203	4300	6503	127419175	SO:0001583	missense	26098																														ENST00000356792.4:c.2135C>T	10.37:g.127429185C>T	ENSP00000349244:p.Ala712Val		127419175	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Missense_Mutation	SNP	ENST00000356792.4	37	CCDS55733.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	34	5.352484	0.95830	.	.	ENSG00000107938	ENST00000356792;ENST00000392732;ENST00000337623;ENST00000368813	D	0.90620	-2.7	5.77	5.77	0.91146	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.93177	0.7827	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;0.996	D;D;D;D;D	0.85130	0.997;0.997;0.988;0.994;0.99	D	0.93594	0.6924	10	0.72032	D	0.01	.	19.9928	0.97374	0.0:1.0:0.0:0.0	.	712;712;59;678;712	F8W695;Q3B7T1;Q5VZQ1;Q3B7T1-5;Q3B7T1-3	.;EDRF1_HUMAN;.;.;.	V	712;712;678;132	ENSP00000357803:A132V	ENSP00000336727:A678V	A	+	2	0	C10orf137	127419175	1.000000	0.71417	0.818000	0.32626	0.957000	0.61999	7.417000	0.80156	2.745000	0.94114	0.650000	0.86243	GCA		0.383	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1			Missense_Mutation
FAM160A2	84067	broad.mit.edu	37	11	6239280	6239280	+	Silent	SNP	A	A	C			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr11:6239280A>C	ENST00000449352.2	-	9	1799	c.1536T>G	c.(1534-1536)ggT>ggG	p.G512G	FAM160A2_ENST00000265978.4_Silent_p.G526G|FAM160A2_ENST00000529360.1_5'Flank|FAM160A2_ENST00000524416.1_Silent_p.G512G			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	512					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)		p.G526G(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ACTCAGAGCCACCCAGGCTCT	0.662																																																1	Substitution - coding silent(1)	ovary(1)	11											19.0	22.0	21.0					11																	6239280		2201	4296	6497	6195856	SO:0001819	synonymous_variant	84067				CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.1536T>G	11.37:g.6239280A>C			6195856	Q9C0A4|Q9H0N3|Q9H624	Silent	SNP	ENST00000449352.2	37	CCDS44530.1	SNP	6	Broad																																																																																				0.662	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383759.1	NM_032127		Silent
ST5	6764	broad.mit.edu	37	11	8717998	8717998	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr11:8717998C>G	ENST00000534127.1	-	21	3653	c.3268G>C	c.(3268-3270)Gag>Cag	p.E1090Q	RP11-152H18.3_ENST00000529883.1_RNA|ST5_ENST00000313726.6_Missense_Mutation_p.E1090Q|ST5_ENST00000530438.1_Missense_Mutation_p.E670Q|ST5_ENST00000526757.1_Missense_Mutation_p.E670Q|ST5_ENST00000530991.1_Missense_Mutation_p.E562Q|ST5_ENST00000357665.1_Missense_Mutation_p.E1090Q|RPL27A_ENST00000531102.1_Intron|ST5_ENST00000526099.1_Missense_Mutation_p.E603Q|ST5_ENST00000534278.1_Missense_Mutation_p.E281Q	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	1090					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.E1090Q(1)		NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		TTTCTTAGCTCCCTGTCTTGG	0.493																																																1	Substitution - Missense(1)	ovary(1)	11											208.0	224.0	219.0					11																	8717998		2201	4296	6497	8674574	SO:0001583	missense	6764			U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.3268G>C	11.37:g.8717998C>G	ENSP00000433528:p.Glu1090Gln		8674574	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	ENST00000534127.1	37	CCDS7791.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.420372	0.96111	.	.	ENSG00000166444	ENST00000526757;ENST00000534127;ENST00000313726;ENST00000530991;ENST00000357665;ENST00000526099;ENST00000534278;ENST00000530438	T;T;T;T;T;T;T;T	0.15372	2.92;3.24;3.24;2.93;3.24;2.91;2.43;2.92	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.40956	0.1138	L	0.57536	1.79	0.80722	D	1	D;D;P	0.69078	0.997;0.974;0.947	D;P;P	0.66847	0.947;0.805;0.688	T	0.06862	-1.0803	10	0.87932	D	0	-19.4992	20.2087	0.98285	0.0:1.0:0.0:0.0	.	603;670;1090	B4DDL8;P78524-2;P78524	.;.;ST5_HUMAN	Q	670;1090;1090;562;1090;603;281;670	ENSP00000435097:E670Q;ENSP00000433528:E1090Q;ENSP00000319678:E1090Q;ENSP00000432887:E562Q;ENSP00000350294:E1090Q;ENSP00000436808:E603Q;ENSP00000433349:E281Q;ENSP00000436802:E670Q	ENSP00000319678:E1090Q	E	-	1	0	ST5	8674574	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.461000	0.80834	2.791000	0.96007	0.655000	0.94253	GAG		0.493	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386518.1	NM_005418		Missense_Mutation
C11orf16	56673	broad.mit.edu	37	11	8951051	8951051	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr11:8951051A>G	ENST00000326053.5	-	3	303	c.197T>C	c.(196-198)gTt>gCt	p.V66A	C11orf16_ENST00000528998.1_Intron|C11orf16_ENST00000525780.1_Missense_Mutation_p.V66A	NM_020643.2	NP_065694.2	Q9NQ32	CK016_HUMAN	chromosome 11 open reading frame 16	66								p.V66A(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	22				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		TGGGTCGGCAACGTGGAGACA	0.517																																																1	Substitution - Missense(1)	ovary(1)	11											66.0	65.0	65.0					11																	8951051		2201	4296	6497	8907627	SO:0001583	missense	56673			AJ400877	CCDS7794.1	11p15.3	2008-06-25			ENSG00000176029	ENSG00000176029			1169	protein-coding gene	gene with protein product						11528127	Standard	NM_020643		Approved		uc001mhb.4	Q9NQ32	OTTHUMG00000165654	ENST00000326053.5:c.197T>C	11.37:g.8951051A>G	ENSP00000318999:p.Val66Ala		8907627	Q53FB2|Q8N6Y9	Missense_Mutation	SNP	ENST00000326053.5	37	CCDS7794.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	1.033	-0.681306	0.03353	.	.	ENSG00000176029	ENST00000525780;ENST00000326053;ENST00000526227	T;T	0.31247	1.51;1.5	4.66	-1.38	0.09027	.	1.358230	0.04618	N	0.401534	T	0.19604	0.0471	N	0.22421	0.69	0.09310	N	1	B;B	0.11235	0.0;0.004	B;B	0.11329	0.004;0.006	T	0.23511	-1.0186	10	0.27082	T	0.32	-36.0624	6.1105	0.20097	0.4112:0.1592:0.4296:0.0	.	66;66	Q9NQ32-2;Q9NQ32	.;CK016_HUMAN	A	66	ENSP00000436818:V66A;ENSP00000318999:V66A	ENSP00000318999:V66A	V	-	2	0	C11orf16	8907627	0.000000	0.05858	0.083000	0.20561	0.026000	0.11368	0.154000	0.16343	-0.160000	0.11002	-0.331000	0.08364	GTT		0.517	C11orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385626.1	NM_020643		Missense_Mutation
PIK3C2A	5286	broad.mit.edu	37	11	17122912	17122912	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr11:17122912A>C	ENST00000265970.7	-	24	3920	c.3921T>G	c.(3919-3921)atT>atG	p.I1307M	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Missense_Mutation_p.I927M	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1307	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)	p.I1307M(1)		central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						ACTGAAAACGAATGGTGGGCT	0.393																																																1	Substitution - Missense(1)	ovary(1)	11											106.0	105.0	106.0					11																	17122912		2200	4293	6493	17079488	SO:0001583	missense	5286			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.3921T>G	11.37:g.17122912A>C	ENSP00000265970:p.Ile1307Met		17079488	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	16.20	3.054558	0.55218	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	T;T	0.75589	-0.95;-0.95	5.49	3.1	0.35709	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.085302	0.85682	D	0.000000	T	0.66386	0.2784	L	0.27053	0.805	0.38959	D	0.958517	P	0.43938	0.822	P	0.51487	0.671	T	0.64343	-0.6430	10	0.49607	T	0.09	-7.2729	3.6932	0.08354	0.6598:0.1376:0.0708:0.1318	.	1307	O00443	P3C2A_HUMAN	M	1307;927	ENSP00000265970:I1307M;ENSP00000438687:I927M	ENSP00000265970:I1307M	I	-	3	3	PIK3C2A	17079488	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.085000	0.30840	0.426000	0.26116	0.455000	0.32223	ATT		0.393	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645		Missense_Mutation
EHBP1L1	254102	broad.mit.edu	37	11	65349367	65349367	+	Silent	SNP	A	A	G			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr11:65349367A>G	ENST00000309295.4	+	9	1489	c.1224A>G	c.(1222-1224)tcA>tcG	p.S408S		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	408						membrane (GO:0016020)		p.S408S(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						CTAAGAGGTCAGGAGTCAGAG	0.557																																																1	Substitution - coding silent(1)	ovary(1)	11											90.0	106.0	100.0					11																	65349367		2158	4271	6429	65105943	SO:0001819	synonymous_variant	254102			AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.1224A>G	11.37:g.65349367A>G			65105943	Q8TB89|Q9H7M7	Silent	SNP	ENST00000309295.4	37	CCDS44649.1	SNP	7	Broad																																																																																				0.557	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658		Silent
IGHMBP2	3508	broad.mit.edu	37	11	68700913	68700914	+	Missense_Mutation	DNP	TC	TC	GT			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr11:68700913_68700914TC>GT	ENST00000255078.3	+	9	1493_1494	c.1382_1383TC>GT	c.(1381-1383)cTC>cGT	p.L461R		NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	461				L -> V (in Ref. 1; AAA53082). {ECO:0000305}.	ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)	p.L461R(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTTGGGCAGCTCACAGCCCACT	0.639																																																1	Substitution - Missense(1)	ovary(1)	11																																								68457490	SO:0001583	missense	3508			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	Exception_encountered	11.37:g.68700913_68700914delinsGT	ENSP00000255078:p.Leu461Arg		68457489	A0PJD2|Q00443|Q14177	Missense_Mutation	DNP	ENST00000255078.3	37	CCDS8187.1	DNP	54	Broad																																																																																				0.639	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396862.1	NM_002180		Missense_Mutation
DSCAML1	57453	broad.mit.edu	37	11	117352737	117352737	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1477-01	TCGA-13-1477-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr11:117352737C>T	ENST00000321322.6	-	12	2681	c.2680G>A	c.(2680-2682)Gtc>Atc	p.V894I	DSCAML1_ENST00000527706.1_Missense_Mutation_p.V624I	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	834	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.V894I(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TACCGCATGACGCGGTCAGGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	11											171.0	118.0	136.0					11																	117352737		2201	4296	6497	116857947	SO:0001583	missense	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2680G>A	11.37:g.117352737C>T	ENSP00000315465:p.Val894Ile		116857947	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	5.679	0.309873	0.10733	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.60040	0.24;0.22	3.89	2.98	0.34508	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.30572	0.0769	N	0.08118	0	0.31032	N	0.717317	P	0.35456	0.502	B	0.33568	0.166	T	0.23368	-1.0190	9	0.21540	T	0.41	.	5.005	0.14284	0.0:0.6024:0.0:0.3976	.	834	Q8TD84	DSCL1_HUMAN	I	624;894;601	ENSP00000434335:V624I;ENSP00000315465:V894I	ENSP00000315465:V894I	V	-	1	0	DSCAML1	116857947	1.000000	0.71417	0.839000	0.33178	0.097000	0.18754	4.880000	0.63107	0.845000	0.35118	-0.443000	0.05667	GTC		0.627	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		Missense_Mutation
TMPRSS12	283471	broad.mit.edu	37	12	51237644	51237644	+	Silent	SNP	T	T	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr12:51237644T>A	ENST00000398458.3	+	2	239	c.207T>A	c.(205-207)ctT>ctA	p.L69L	TMPRSS12_ENST00000551456.1_Silent_p.L69L|RN7SL519P_ENST00000497925.2_RNA	NM_182559.2	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane (C-terminal) protease, serine 12	69						integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.L69L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	18						CAGCACCGCTTAAGGATGTGT	0.438																																																1	Substitution - coding silent(1)	ovary(1)	12											39.0	38.0	38.0					12																	51237644		1937	4122	6059	49523911	SO:0001819	synonymous_variant	283471			BC048112	CCDS44881.1	12q13.12	2014-08-12	2010-04-21		ENSG00000186452	ENSG00000186452		"""Serine peptidases / Transmembrane"""	28779	protein-coding gene	gene with protein product			"""transmembrane protease, serine 12"""				Standard	NM_182559		Approved	MGC57341, CT151	uc001rwx.4	Q86WS5	OTTHUMG00000169483	ENST00000398458.3:c.207T>A	12.37:g.51237644T>A			49523911	B9ZVX2	Silent	SNP	ENST00000398458.3	37	CCDS44881.1	SNP	61	Broad																																																																																				0.438	TMPRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404289.1	NM_182559		Silent
RNASE3	6037	broad.mit.edu	37	14	21360144	21360144	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr14:21360144G>A	ENST00000304639.3	+	2	357	c.299G>A	c.(298-300)cGg>cAg	p.R100Q		NM_002935.2	NP_002926.2	P12724	ECP_HUMAN	ribonuclease, RNase A family, 3	100					antibacterial humoral response (GO:0019731)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)	p.R100Q(1)		endometrium(1)|large_intestine(1)|lung(6)|ovary(1)	9	all_cancers(95;0.00453)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	Pranlukast(DB01411)	AATTGTCATCGGAGTAGATTC	0.418																																																1	Substitution - Missense(1)	ovary(1)	14											103.0	106.0	105.0					14																	21360144		2191	4300	6491	20429984	SO:0001583	missense	6037			X55990	CCDS9560.1	14q11.2	2014-03-13	2010-05-07		ENSG00000169397	ENSG00000169397	3.1.27.-	"""Ribonucleases, RNase A"""	10046	protein-coding gene	gene with protein product	"""eosinophil cationic protein"""	131398		RNS3		1577491	Standard	NM_002935		Approved	ECP	uc001vyj.3	P12724	OTTHUMG00000029604	ENST00000304639.3:c.299G>A	14.37:g.21360144G>A	ENSP00000302324:p.Arg100Gln		20429984	Q4VBC1|Q8WTP7|Q8WZ62|Q9GZN9	Missense_Mutation	SNP	ENST00000304639.3	37	CCDS9560.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	g	0.061	-1.224813	0.01530	.	.	ENSG00000169397	ENST00000304639	T	0.72282	-0.64	2.38	0.00721	0.14070	Ribonuclease A, domain (4);	1.057750	0.07563	U	0.917382	T	0.37625	0.1010	N	0.02802	-0.49	0.09310	N	1	B	0.21688	0.059	B	0.04013	0.001	T	0.27020	-1.0086	10	0.02654	T	1	.	5.6946	0.17849	0.5288:0.0:0.4712:0.0	.	100	P12724	ECP_HUMAN	Q	100	ENSP00000302324:R100Q	ENSP00000302324:R100Q	R	+	2	0	RNASE3	20429984	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.391000	0.07323	-0.321000	0.08627	-0.419000	0.06015	CGG		0.418	RNASE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073795.2	NM_002935		Missense_Mutation
VRTN	55237	broad.mit.edu	37	14	74824922	74824922	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr14:74824922C>T	ENST00000256362.4	+	2	1677	c.1436C>T	c.(1435-1437)gCg>gTg	p.A479V		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	479					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)	p.A479V(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						AAGAGTGAGGCGGAAGAGGGG	0.652																																																1	Substitution - Missense(1)	ovary(1)	14											35.0	40.0	38.0					14																	74824922		2201	4295	6496	73894675	SO:0001583	missense	55237			AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.1436C>T	14.37:g.74824922C>T	ENSP00000256362:p.Ala479Val		73894675	Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	37	CCDS9830.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	4.814	0.151255	0.09185	.	.	ENSG00000133980	ENST00000256362	T	0.45276	0.9	4.29	-8.57	0.00900	.	0.837724	0.10269	N	0.695004	T	0.13500	0.0327	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12502	-1.0545	10	0.21014	T	0.42	1.6461	1.2291	0.01940	0.1883:0.3277:0.2065:0.2775	.	479	Q9H8Y1	VRTN_HUMAN	V	479	ENSP00000256362:A479V	ENSP00000256362:A479V	A	+	2	0	VRTN	73894675	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.578000	0.02125	-2.920000	0.00305	-1.509000	0.00949	GCG		0.652	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228		Missense_Mutation
TLN2	83660	broad.mit.edu	37	15	63054621	63054621	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr15:63054621G>A	ENST00000561311.1	+	38	5160	c.4930G>A	c.(4930-4932)Gac>Aac	p.D1644N	TLN2_ENST00000472902.1_Missense_Mutation_p.D37N|TLN2_ENST00000306829.6_Missense_Mutation_p.D1644N			Q9Y4G6	TLN2_HUMAN	talin 2	1644					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.D1644N(2)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TACAGTGTCCGACTCCATCAA	0.557																																																2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)	15											191.0	168.0	176.0					15																	63054621		2203	4300	6503	60841913	SO:0001583	missense	83660			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.4930G>A	15.37:g.63054621G>A	ENSP00000453508:p.Asp1644Asn		60841913	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	37	CCDS32261.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	29.7	5.031299	0.93575	.	.	ENSG00000171914	ENST00000306829	T	0.15834	2.39	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.46737	0.1408	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.41805	-0.9488	10	0.33141	T	0.24	-24.7648	18.7532	0.91823	0.0:0.0:1.0:0.0	.	688;1644	G1UI21;Q9Y4G6	.;TLN2_HUMAN	N	1644	ENSP00000303476:D1644N	ENSP00000303476:D1644N	D	+	1	0	TLN2	60841913	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	9.813000	0.99286	2.426000	0.82243	0.655000	0.94253	GAC		0.557	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2			Missense_Mutation
PALB2	79728	broad.mit.edu	37	16	23647080	23647080	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr16:23647080C>A	ENST00000261584.4	-	4	939	c.787G>T	c.(787-789)Gaa>Taa	p.E263*		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	263	DNA-binding (with the preference D loop > dsDNA > ssDNA).|Interaction with BRCA1.				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E263*(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		GGAATGTGTTCAAGGTGCTGA	0.398			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																														yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	1	Substitution - Nonsense(1)	ovary(1)	16											128.0	128.0	128.0					16																	23647080		2197	4300	6497	23554581	SO:0001587	stop_gained	79728				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.787G>T	16.37:g.23647080C>A	ENSP00000261584:p.Glu263*		23554581	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Nonsense_Mutation	SNP	ENST00000261584.4	37	CCDS32406.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	23.2	4.391323	0.83011	.	.	ENSG00000083093	ENST00000261584	.	.	.	5.96	3.99	0.46301	.	0.445587	0.23105	N	0.051867	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-0.6149	8.1644	0.31217	0.0:0.7382:0.1777:0.084	.	.	.	.	X	263	.	ENSP00000261584:E263X	E	-	1	0	PALB2	23554581	0.000000	0.05858	0.010000	0.14722	0.027000	0.11550	0.234000	0.17930	0.823000	0.34589	0.655000	0.94253	GAA		0.398	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675		Nonsense_Mutation
PLCG2	5336	broad.mit.edu	37	16	81972429	81972429	+	Silent	SNP	C	C	G			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr16:81972429C>G	ENST00000359376.3	+	29	3436	c.3222C>G	c.(3220-3222)ccC>ccG	p.P1074P		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	1074	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.P1074P(1)		NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						GCCATCTCCCCAAACTTGGAC	0.542																																																1	Substitution - coding silent(1)	ovary(1)	16											102.0	97.0	99.0					16																	81972429		1951	4144	6095	80529930	SO:0001819	synonymous_variant	5336				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.3222C>G	16.37:g.81972429C>G			80529930	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Silent	SNP	ENST00000359376.3	37	CCDS42204.1	SNP	21	Broad																																																																																				0.542	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1			Silent
EIF4A1	1973	broad.mit.edu	37	17	7479928	7479928	+	Silent	SNP	G	G	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr17:7479928G>A	ENST00000293831.8	+	5	448	c.432G>A	c.(430-432)gtG>gtA	p.V144V	SNORA48_ENST00000386847.1_RNA|CD68_ENST00000380498.6_5'Flank|SENP3-EIF4A1_ENST00000579777.1_RNA|CD68_ENST00000250092.6_5'Flank|SNORD10_ENST00000459579.1_RNA|EIF4A1_ENST00000582746.1_Silent_p.V144V|EIF4A1_ENST00000577269.1_Silent_p.V144V|SNORA67_ENST00000384423.1_RNA	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1	144	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.V144V(1)		NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						GTGCTGAGGTGCAGAAACTGC	0.552																																					Melanoma(120;278 1668 15796 27423 46368)											1	Substitution - coding silent(1)	ovary(1)	17											114.0	98.0	103.0					17																	7479928		2203	4300	6503	7420652	SO:0001819	synonymous_variant	1973			D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.432G>A	17.37:g.7479928G>A			7420652	B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	Silent	SNP	ENST00000293831.8	37	CCDS11113.1	SNP	46	Broad																																																																																				0.552	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226952.6	NM_001416		Silent
CNTD1	124817	broad.mit.edu	37	17	40951091	40951091	+	Silent	SNP	C	C	T			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr17:40951091C>T	ENST00000588408.1	+	1	282	c.6C>T	c.(4-6)gaC>gaT	p.D2D	CNTD1_ENST00000588527.1_Intron|COA3_ENST00000328434.7_5'Flank	NM_173478.2	NP_775749.2	Q8N815	CNTD1_HUMAN	cyclin N-terminal domain containing 1	2								p.D2D(1)		central_nervous_system(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		TGAATATGGACGGACCCATGA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	17											38.0	32.0	34.0					17																	40951091		2203	4300	6503	38204617	SO:0001819	synonymous_variant	124817			AK097456	CCDS11440.1	17q21.31	2014-07-03	2006-03-31	2006-03-31	ENSG00000176563	ENSG00000176563			26847	protein-coding gene	gene with protein product			"""cyclin N-terminal domain containing"""	CNTD		24891606	Standard	NM_173478		Approved	FLJ40137	uc002ibm.4	Q8N815		ENST00000588408.1:c.6C>T	17.37:g.40951091C>T			38204617	Q658Q6|Q8NEP1	Silent	SNP	ENST00000588408.1	37	CCDS11440.1	SNP	19	Broad																																																																																				0.582	CNTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452398.1	NM_173478		Silent
MYL4	4635	broad.mit.edu	37	17	45299108	45299108	+	Missense_Mutation	SNP	G	G	A	rs111293783		TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr17:45299108G>A	ENST00000354968.1	+	5	502	c.374G>A	c.(373-375)cGc>cAc	p.R125H	snoU13_ENST00000516279.1_RNA|MYL4_ENST00000572316.1_Missense_Mutation_p.R125H|MYL4_ENST00000393450.1_Missense_Mutation_p.R125H	NM_001002841.1	NP_001002841.1	P12829	MYL4_HUMAN	myosin, light chain 4, alkali; atrial, embryonic	125					cardiac muscle contraction (GO:0060048)|muscle filament sliding (GO:0030049)|positive regulation of ATPase activity (GO:0032781)|regulation of the force of heart contraction (GO:0002026)	A band (GO:0031672)|cytosol (GO:0005829)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin II heavy chain binding (GO:0032038)	p.R125H(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)	11						CACATTTCCCGCAACAAGGAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	17						G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	158.0	130.0	139.0		374,374	5.2	1.0	17	dbSNP_132	139	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MYL4	NM_001002841.1,NM_002476.2	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	125/198,125/198	45299108	1,13005	2203	4300	6503	42654107	SO:0001583	missense	4635				CCDS11510.1	17q21.32	2013-09-19	2006-09-29		ENSG00000198336	ENSG00000198336		"""Myosins / Light chain"", ""EF-hand domain containing"""	7585	protein-coding gene	gene with protein product	"""myosin, atrial/fetal muscle, light chain"""	160770	"""myosin, light polypeptide 4, alkali; atrial, embryonic"""			3417683	Standard	NM_002476		Approved	ALC1, AMLC, GT1, PRO1957	uc002ilg.3	P12829	OTTHUMG00000178232	ENST00000354968.1:c.374G>A	17.37:g.45299108G>A	ENSP00000347055:p.Arg125His		42654107	D3DXJ7|P11783	Missense_Mutation	SNP	ENST00000354968.1	37	CCDS11510.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582753	0.86748	0.0	1.16E-4	ENSG00000198336	ENST00000354968;ENST00000393450	D;D	0.84800	-1.9;-1.9	5.23	5.23	0.72850	EF-hand-like domain (1);	0.062472	0.56097	D	0.000023	D	0.90501	0.7024	M	0.79693	2.465	0.49798	D	0.999825	D	0.65815	0.995	P	0.61275	0.886	D	0.91128	0.4935	10	0.87932	D	0	-16.1352	10.1595	0.42842	0.0916:0.0:0.9084:0.0	.	125	P12829	MYL4_HUMAN	H	125	ENSP00000347055:R125H;ENSP00000377096:R125H	ENSP00000347055:R125H	R	+	2	0	MYL4	42654107	0.955000	0.32602	1.000000	0.80357	0.995000	0.86356	2.768000	0.47645	2.581000	0.87130	0.555000	0.69702	CGC		0.532	MYL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441059.1	NM_001002841		Missense_Mutation
ACOX1	51	broad.mit.edu	37	17	73956389	73956389	+	Intron	SNP	G	G	T			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr17:73956389G>T	ENST00000301608.4	-	4	491				ACOX1_ENST00000591857.1_5'UTR|ACOX1_ENST00000293217.5_Missense_Mutation_p.H113N|ACOX1_ENST00000537812.1_Missense_Mutation_p.H75N	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl						alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)	p.H113N(1)		large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	GTTGCCTGGTGAAGCAAGGTG	0.547																																																1	Substitution - Missense(1)	ovary(1)	17											65.0	58.0	60.0					17																	73956389		2203	4300	6503	71467984	SO:0001627	intron_variant	51			U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.431-2742C>A	17.37:g.73956389G>T			71467984	A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Missense_Mutation	SNP	ENST00000301608.4	37	CCDS11735.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	12.53	1.966259	0.34659	.	.	ENSG00000161533	ENST00000293217;ENST00000537812;ENST00000539791;ENST00000538781	T;T	0.38401	1.14;1.14	6.16	6.16	0.99307	.	0.340616	0.36740	N	0.002424	T	0.13927	0.0337	N	0.01267	-0.92	0.32657	N	0.518566	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.18808	-1.0325	10	0.13470	T	0.59	.	13.6708	0.62424	0.0:0.0:0.7491:0.2509	.	45;75;113	F5H0M0;F5GYQ8;Q15067-2	.;.;.	N	113;75;113;45	ENSP00000293217:H113N;ENSP00000441257:H75N	ENSP00000293217:H113N	H	-	1	0	ACOX1	71467984	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.621000	0.67743	2.937000	0.99478	0.650000	0.86243	CAC		0.547	ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439503.1			Missense_Mutation
RPTOR	57521	broad.mit.edu	37	17	78921059	78921059	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr17:78921059A>C	ENST00000306801.3	+	27	3535	c.3173A>C	c.(3172-3174)gAt>gCt	p.D1058A	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Missense_Mutation_p.D900A	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1058					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.D1058A(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GAGAAGCTGGATTATTTCCAC	0.507																																																1	Substitution - Missense(1)	ovary(1)	17											74.0	68.0	70.0					17																	78921059		2203	4300	6503	76535654	SO:0001583	missense	57521				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3173A>C	17.37:g.78921059A>C	ENSP00000307272:p.Asp1058Ala		76535654	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	17.69	3.452986	0.63290	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.27104	1.69;1.69	5.25	5.25	0.73442	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.24812	0.0602	N	0.02916	-0.46	0.80722	D	1	D;B	0.67145	0.996;0.2	D;B	0.78314	0.991;0.026	T	0.34976	-0.9807	10	0.15066	T	0.55	.	15.149	0.72681	1.0:0.0:0.0:0.0	.	900;1058	F5H7J5;Q8N122	.;RPTOR_HUMAN	A	1058;900	ENSP00000307272:D1058A;ENSP00000442479:D900A	ENSP00000307272:D1058A	D	+	2	0	RPTOR	76535654	1.000000	0.71417	0.992000	0.48379	0.622000	0.37654	8.820000	0.92003	1.978000	0.57642	0.533000	0.62120	GAT		0.507	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761		Missense_Mutation
CERS4	79603	broad.mit.edu	37	19	8315966	8315966	+	Silent	SNP	G	G	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr19:8315966G>A	ENST00000251363.5	+	3	306	c.6G>A	c.(4-6)ctG>ctA	p.L2L	CERS4_ENST00000595722.1_Intron|CERS4_ENST00000559450.1_Silent_p.L2L|CERS4_ENST00000558331.1_Intron|CERS4_ENST00000559336.1_Silent_p.L2L	NM_024552.2	NP_078828.2	Q9HA82	CERS4_HUMAN	ceramide synthase 4	2					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.L2L(1)									ACAGAATGCTGTCCAGTTTCA	0.572																																																1	Substitution - coding silent(1)	ovary(1)	19											234.0	235.0	235.0					19																	8315966		2203	4300	6503	8221966	SO:0001819	synonymous_variant	79603				CCDS12197.1	19p13.2	2014-09-11	2011-07-08	2011-07-08	ENSG00000090661	ENSG00000090661		"""Homeoboxes / CERS class"""	23747	protein-coding gene	gene with protein product		615334	"""LAG1 longevity assurance homolog 4 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 4"""	LASS4			Standard	NM_024552		Approved	FLJ12089, Trh1	uc002mjg.3	Q9HA82	OTTHUMG00000172570	ENST00000251363.5:c.6G>A	19.37:g.8315966G>A			8221966	D6W665	Silent	SNP	ENST00000251363.5	37	CCDS12197.1	SNP	48	Broad																																																																																				0.572	CERS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419200.1	NM_024552		Silent
MUC16	94025	broad.mit.edu	37	19	9057662	9057662	+	Silent	SNP	G	G	C			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr19:9057662G>C	ENST00000397910.4	-	3	29987	c.29784C>G	c.(29782-29784)tcC>tcG	p.S9928S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9930	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S5561S(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGACATCGTGGACTGATCAG	0.448																																																1	Substitution - coding silent(1)	ovary(1)	19											240.0	230.0	233.0					19																	9057662		2002	4173	6175	8918662	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29784C>G	19.37:g.9057662G>C			8918662	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	47	Broad																																																																																				0.448	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Silent
UNC13A	23025	broad.mit.edu	37	19	17750681	17750681	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr19:17750681T>A	ENST00000519716.2	-	23	2823	c.2824A>T	c.(2824-2826)Aac>Tac	p.N942Y	UNC13A_ENST00000552293.1_Missense_Mutation_p.N942Y|UNC13A_ENST00000550896.1_Missense_Mutation_p.N940Y|UNC13A_ENST00000252773.7_Missense_Mutation_p.N942Y|UNC13A_ENST00000428389.2_Missense_Mutation_p.N1030Y|UNC13A_ENST00000551649.1_Missense_Mutation_p.N942Y	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	942					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.N1030Y(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CGCAGGGAGTTATGCAGCTGG	0.577																																																1	Substitution - Missense(1)	ovary(1)	19											92.0	91.0	92.0					19																	17750681		2067	4214	6281	17611681	SO:0001583	missense	23025			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2824A>T	19.37:g.17750681T>A	ENSP00000429562:p.Asn942Tyr		17611681	E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	37	CCDS46013.2	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	17.40	3.380383	0.61845	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	D;D;D;T;T;D	0.82433	-1.6;-1.61;-1.6;-1.47;-1.48;-1.61	3.14	2.07	0.26955	.	0.181464	0.45361	U	0.000368	D	0.88829	0.6543	M	0.81497	2.545	0.46586	D	0.999111	D	0.89917	1.0	D	0.77557	0.99	D	0.86710	0.1935	10	0.87932	D	0	-9.8252	6.808	0.23788	0.2088:0.0:0.0:0.7911	.	942	Q9UPW8	UN13A_HUMAN	Y	942;1030;942;942;942;940	ENSP00000429562:N942Y;ENSP00000400409:N1030Y;ENSP00000252773:N942Y;ENSP00000447236:N942Y;ENSP00000447572:N942Y;ENSP00000446831:N940Y	ENSP00000252773:N942Y	N	-	1	0	UNC13A	17611681	1.000000	0.71417	0.996000	0.52242	0.936000	0.57629	7.506000	0.81665	0.397000	0.25310	0.254000	0.18369	AAC		0.577	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604		Missense_Mutation
ZNF234	10780	broad.mit.edu	37	19	44661740	44661740	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr19:44661740C>A	ENST00000426739.2	+	6	1829	c.1571C>A	c.(1570-1572)gCc>gAc	p.A524D	ZNF234_ENST00000592437.1_Missense_Mutation_p.A524D	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	524					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A524D(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				TTCAGTCAGGCCTCGCATCTT	0.458																																																1	Substitution - Missense(1)	ovary(1)	19											85.0	92.0	89.0					19																	44661740		2179	4287	6466	49353580	SO:0001583	missense	10780			X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1571C>A	19.37:g.44661740C>A	ENSP00000400878:p.Ala524Asp		49353580	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	ENST00000426739.2	37	CCDS46101.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	8.575	0.880870	0.17467	.	.	ENSG00000167380	ENST00000426739	T	0.08720	3.06	4.02	1.67	0.24075	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10078	0.0247	L	0.31845	0.965	0.09310	N	1	D	0.65815	0.995	P	0.56612	0.802	T	0.26538	-1.0100	9	0.39692	T	0.17	.	1.075	0.01630	0.1802:0.4337:0.175:0.2111	.	524	Q14588	ZN234_HUMAN	D	524	ENSP00000400878:A524D	ENSP00000400878:A524D	A	+	2	0	ZNF226	49353580	0.000000	0.05858	0.237000	0.24090	0.969000	0.65631	-4.596000	0.00210	1.021000	0.39600	0.585000	0.79938	GCC		0.458	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2			Missense_Mutation
NLRP4	147945	broad.mit.edu	37	19	56370018	56370018	+	Missense_Mutation	SNP	G	G	A	rs142191212		TCGA-13-1477-01	TCGA-13-1477-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr19:56370018G>A	ENST00000301295.6	+	3	1681	c.1259G>A	c.(1258-1260)cGg>cAg	p.R420Q	NLRP4_ENST00000587891.1_Missense_Mutation_p.R345Q|NLRP4_ENST00000346986.5_Missense_Mutation_p.R420Q	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	420	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.R420Q(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GACGACCTCCGGAGAAATGGG	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		18797	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19						G	GLN/ARG	3,4403	6.2+/-15.9	0,3,2200	109.0	107.0	108.0		1259	3.0	0.1	19	dbSNP_134	108	0,8600		0,0,4300	no	missense	NLRP4	NM_134444.4	43	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	probably-damaging	420/995	56370018	3,13003	2203	4300	6503	61061830	SO:0001583	missense	147945			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1259G>A	19.37:g.56370018G>A	ENSP00000301295:p.Arg420Gln		61061830	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	CCDS12936.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	16.91	3.251932	0.59212	6.81E-4	0.0	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.83914	-1.78;-1.78	4.09	3.05	0.35203	.	.	.	.	.	D	0.88489	0.6450	M	0.70108	2.13	0.09310	N	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;P	0.72075	0.976;0.935;0.851	T	0.77208	-0.2672	9	0.56958	D	0.05	.	8.1481	0.31124	0.1113:0.0:0.8887:0.0	.	420;345;420	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	Q	420	ENSP00000301295:R420Q;ENSP00000344787:R420Q	ENSP00000301295:R420Q	R	+	2	0	NLRP4	61061830	0.000000	0.05858	0.063000	0.19743	0.016000	0.09150	-0.156000	0.10100	1.078000	0.41014	-0.128000	0.14901	CGG		0.582	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444		Missense_Mutation
AGBL5	60509	broad.mit.edu	37	2	27291556	27291556	+	Missense_Mutation	SNP	G	G	T	rs368224692		TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr2:27291556G>T	ENST00000360131.4	+	13	2458	c.2299G>T	c.(2299-2301)Ggg>Tgg	p.G767W		NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	767					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.G767W(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATGGTAATCGGGAAAGGTCT	0.522																																																1	Substitution - Missense(1)	ovary(1)	2											90.0	93.0	92.0					2																	27291556		2203	4300	6503	27145060	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.2299G>T	2.37:g.27291556G>T	ENSP00000353249:p.Gly767Trp		27145060	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	ENST00000360131.4	37	CCDS1732.3	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630519	0.67015	.	.	ENSG00000084693	ENST00000360131	T	0.19250	2.16	5.57	5.57	0.84162	.	0.185389	0.45606	D	0.000354	T	0.36386	0.0965	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.07366	-1.0776	10	0.87932	D	0	-2.931	15.0944	0.72223	0.0:0.0:1.0:0.0	.	767	Q8NDL9	CBPC5_HUMAN	W	767	ENSP00000353249:G767W	ENSP00000353249:G767W	G	+	1	0	AGBL5	27145060	1.000000	0.71417	1.000000	0.80357	0.661000	0.39034	4.484000	0.60271	2.624000	0.88883	0.555000	0.69702	GGG		0.522	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831		Missense_Mutation
VPS54	51542	broad.mit.edu	37	2	64199339	64199339	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr2:64199339G>T	ENST00000272322.4	-	4	572	c.418C>A	c.(418-420)Cct>Act	p.P140T	VPS54_ENST00000409558.4_Missense_Mutation_p.P128T|VPS54_ENST00000354504.3_Missense_Mutation_p.P23T			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	140					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)		p.P140T(1)		endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						GTATCTTTAGGAGGACAAATA	0.289																																																1	Substitution - Missense(1)	ovary(1)	2											77.0	74.0	75.0					2																	64199339		2202	4292	6494	64052843	SO:0001583	missense	51542			AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.418C>A	2.37:g.64199339G>T	ENSP00000272322:p.Pro140Thr		64052843	Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Missense_Mutation	SNP	ENST00000272322.4	37	CCDS33208.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	12.97	2.098262	0.37048	.	.	ENSG00000143952	ENST00000354504;ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	T;T;T	0.30448	1.58;1.53;1.53	5.66	5.66	0.87406	.	0.372049	0.33419	N	0.004934	T	0.16896	0.0406	N	0.08118	0	0.30998	N	0.720688	B;B;B	0.23249	0.082;0.029;0.05	B;B;B	0.21917	0.036;0.016;0.037	T	0.09037	-1.0693	10	0.15499	T	0.54	.	14.9512	0.71077	0.0705:0.0:0.9295:0.0	.	23;140;128	Q9P1Q0-3;Q9P1Q0;Q9P1Q0-4	.;VPS54_HUMAN;.	T	23;140;128;128;140	ENSP00000346499:P23T;ENSP00000272322:P140T;ENSP00000386980:P128T	ENSP00000272322:P140T	P	-	1	0	VPS54	64052843	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.560000	0.53763	2.682000	0.91365	0.555000	0.69702	CCT		0.289	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327062.2	NM_016516		Missense_Mutation
LRP2	4036	broad.mit.edu	37	2	170103992	170103992	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr2:170103992G>A	ENST00000263816.3	-	20	3089	c.2804C>T	c.(2803-2805)gCc>gTc	p.A935V	LRP2_ENST00000443831.1_Missense_Mutation_p.A798V	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	935					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.A935V(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TCGAATAATGGCACCCAGTCT	0.373																																																1	Substitution - Missense(1)	ovary(1)	2											116.0	107.0	110.0					2																	170103992		2203	4300	6503	169812238	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.2804C>T	2.37:g.170103992G>A	ENSP00000263816:p.Ala935Val		169812238	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514853	0.44763	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.91351	-2.83;-2.83	5.74	1.72	0.24424	Six-bladed beta-propeller, TolB-like (1);	0.344469	0.32287	N	0.006311	D	0.89615	0.6766	L	0.38175	1.15	0.27924	N	0.938132	P;P	0.38020	0.615;0.561	P;B	0.48982	0.597;0.329	D	0.84887	0.0834	10	0.66056	D	0.02	.	13.7191	0.62717	0.0746:0.5554:0.37:0.0	.	798;935	E9PC35;P98164	.;LRP2_HUMAN	V	935;798	ENSP00000263816:A935V;ENSP00000409813:A798V	ENSP00000263816:A935V	A	-	2	0	LRP2	169812238	0.996000	0.38824	0.218000	0.23776	0.051000	0.14879	1.428000	0.34892	0.326000	0.23384	0.561000	0.74099	GCC		0.373	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		Missense_Mutation
USP37	57695	broad.mit.edu	37	2	219399421	219399421	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr2:219399421T>A	ENST00000258399.3	-	9	1101	c.689A>T	c.(688-690)aAg>aTg	p.K230M	USP37_ENST00000338465.5_Missense_Mutation_p.K230M|USP37_ENST00000415516.1_Missense_Mutation_p.K158M|USP37_ENST00000454775.1_Missense_Mutation_p.K230M|USP37_ENST00000418019.1_Missense_Mutation_p.K230M	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	230					G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)	p.K230M(1)		NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		TGTCATGGCCTTGTTGTTCCT	0.308																																																1	Substitution - Missense(1)	ovary(1)	2											146.0	141.0	143.0					2																	219399421		2203	4300	6503	219107665	SO:0001583	missense	57695			AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.689A>T	2.37:g.219399421T>A	ENSP00000258399:p.Lys230Met		219107665	A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	ENST00000258399.3	37	CCDS2418.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	20.5	4.007724	0.75046	.	.	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000415516;ENST00000418019;ENST00000338465	T;T;T;T;T	0.55052	0.73;0.73;0.71;0.73;0.54	6.03	4.88	0.63580	.	0.256080	0.42548	D	0.000698	T	0.49847	0.1581	L	0.61218	1.895	0.43729	D	0.996219	P;B;B	0.37207	0.587;0.4;0.278	B;B;B	0.38156	0.266;0.225;0.057	T	0.56780	-0.7922	10	0.87932	D	0	-19.4193	9.351	0.38138	0.0:0.0807:0.0:0.9193	.	230;158;230	Q86W68;Q86T82-2;Q86T82	.;.;UBP37_HUMAN	M	230;230;158;230;230	ENSP00000258399:K230M;ENSP00000393662:K230M;ENSP00000400902:K158M;ENSP00000396585:K230M;ENSP00000345043:K230M	ENSP00000258399:K230M	K	-	2	0	USP37	219107665	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	2.009000	0.40903	2.308000	0.77769	0.533000	0.62120	AAG		0.308	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256779.3	NM_020935		Missense_Mutation
GLB1L	79411	broad.mit.edu	37	2	220103061	220103061	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr2:220103061T>G	ENST00000295759.7	-	14	1565	c.1252A>C	c.(1252-1254)Acc>Ccc	p.T418P	GLB1L_ENST00000392089.2_Missense_Mutation_p.T418P|GLB1L_ENST00000409640.1_Missense_Mutation_p.T328P|GLB1L_ENST00000497855.1_5'UTR|GLB1L_ENST00000356283.3_Missense_Mutation_p.T328P			Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like	418					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)	p.T418P(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTCATATAGGTTCGGTACAAC	0.448																																																1	Substitution - Missense(1)	ovary(1)	2											156.0	144.0	148.0					2																	220103061		2203	4300	6503	219811305	SO:0001583	missense	79411				CCDS2437.1, CCDS74657.1	2q36.1	2008-02-05			ENSG00000163521	ENSG00000163521			28129	protein-coding gene	gene with protein product						12975309	Standard	XM_005246850		Approved	MGC10771	uc002vkm.3	Q6UWU2	OTTHUMG00000133133	ENST00000295759.7:c.1252A>C	2.37:g.220103061T>G	ENSP00000295759:p.Thr418Pro		219811305	Q96DR0	Missense_Mutation	SNP	ENST00000295759.7	37	CCDS2437.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	18.48	3.632621	0.67015	.	.	ENSG00000163521	ENST00000295759;ENST00000409640;ENST00000392089;ENST00000356283	D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.97467	0.9171	M	0.87456	2.885	0.80722	D	1	D;P	0.89917	1.0;0.882	D;P	0.91635	0.999;0.67	D	0.98276	1.0506	10	0.87932	D	0	-15.8936	15.612	0.76733	0.0:0.0:0.0:1.0	.	328;418	Q6UWU2-2;Q6UWU2	.;GLB1L_HUMAN	P	418;328;418;328	ENSP00000295759:T418P;ENSP00000386354:T328P;ENSP00000375939:T418P;ENSP00000348628:T328P	ENSP00000295759:T418P	T	-	1	0	GLB1L	219811305	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.126000	0.71635	2.281000	0.76405	0.533000	0.62120	ACC		0.448	GLB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256822.2	NM_024506		Missense_Mutation
ITM2C	81618	broad.mit.edu	37	2	231742247	231742247	+	Missense_Mutation	SNP	C	C	A	rs375987252		TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr2:231742247C>A	ENST00000326427.6	+	5	820	c.694C>A	c.(694-696)Cgc>Agc	p.R232S	ITM2C_ENST00000409704.2_Missense_Mutation_p.R170S|ITM2C_ENST00000326407.6_Missense_Mutation_p.R195S|ITM2C_ENST00000335005.6_Missense_Mutation_p.R185S	NM_030926.4	NP_112188.1	Q9NQX7	ITM2C_HUMAN	integral membrane protein 2C	232					negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)	p.R232S(1)		cervix(2)|lung(1)|ovary(1)|skin(1)	5		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;8.47e-12)|all cancers(144;3.44e-09)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		CCGGCTCCGGCGCCGGGCAAC	0.632																																																1	Substitution - Missense(1)	ovary(1)	2											80.0	80.0	80.0					2																	231742247		2203	4300	6503	231450491	SO:0001583	missense	81618			AF038953	CCDS2479.1, CCDS33395.1, CCDS33396.1, CCDS74665.1	2q37	2012-10-10			ENSG00000135916	ENSG00000135916		"""BRICHOS domain containing"""	6175	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2C"""	609554				9653160	Standard	NM_030926		Approved	BRI3, E25, hRPC.1050_D_4, ITM3, BRICD2C	uc002vqz.3	Q9NQX7	OTTHUMG00000133219	ENST00000326427.6:c.694C>A	2.37:g.231742247C>A	ENSP00000322730:p.Arg232Ser		231450491	B3KPG4|Q4G0A8|Q53H84|Q6IAE7|Q86VK5|Q8N288|Q8TAW0|Q9BUP8	Missense_Mutation	SNP	ENST00000326427.6	37	CCDS2479.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	32	5.166291	0.94768	.	.	ENSG00000135916	ENST00000326427;ENST00000335005;ENST00000326407;ENST00000409704	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.40909	0.1136	M	0.73962	2.25	0.80722	D	1	D;D;D	0.71674	0.998;0.99;0.99	D;P;P	0.67900	0.954;0.729;0.757	T	0.30416	-0.9979	10	0.87932	D	0	-11.6867	14.3008	0.66352	0.0:1.0:0.0:0.0	.	195;185;232	Q9NQX7-3;Q9NQX7-2;Q9NQX7	.;.;ITM2C_HUMAN	S	232;185;195;170	ENSP00000322730:R232S;ENSP00000335121:R185S;ENSP00000322100:R195S;ENSP00000387242:R170S	ENSP00000322100:R195S	R	+	1	0	ITM2C	231450491	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.479000	0.60236	2.437000	0.82529	0.655000	0.94253	CGC		0.632	ITM2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256954.2	NM_030926		Missense_Mutation
KCNQ2	3785	broad.mit.edu	37	20	62073883	62073883	+	Splice_Site	SNP	T	T	G			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr20:62073883T>G	ENST00000359125.2	-	5	866	c.692A>C	c.(691-693)gAg>gCg	p.E231A	KCNQ2_ENST00000370224.1_Splice_Site_p.E231A|KCNQ2_ENST00000344462.4_Splice_Site_p.E231A|KCNQ2_ENST00000360480.3_Splice_Site_p.E231A|KCNQ2_ENST00000354587.3_Splice_Site_p.E231A|KCNQ2_ENST00000344425.5_Splice_Site_p.E231A|KCNQ2_ENST00000357249.2_Splice_Site_p.E231A|KCNQ2_ENST00000359689.1_Splice_Site_p.E231A	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	231					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.E231A(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	AGTGACCAGCTCCTGAGAGGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	20											279.0	194.0	223.0					20																	62073883		2203	4300	6503	61544327	SO:0001630	splice_region_variant	3785			AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.691-1A>C	20.37:g.62073883T>G			61544327	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	CCDS13520.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	14.26	2.483150	0.44147	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222;ENST00000370221;ENST00000344425	D;D;D;D;D;D;D;D;D;D;D;D	0.98264	-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83	3.29	3.29	0.37713	Ion transport (1);	0.072266	0.53938	D	0.000052	D	0.97682	0.9240	M	0.65498	2.005	0.53688	D	0.999971	B;P;B;B;B;B	0.36712	0.014;0.566;0.011;0.023;0.04;0.028	B;P;B;B;B;B	0.46452	0.144;0.517;0.017;0.017;0.017;0.072	D	0.97985	1.0351	10	0.87932	D	0	-23.3559	11.9873	0.53155	0.0:0.0:0.0:1.0	.	231;231;231;231;231;231	B4DEP4;Q53Y30;O43526-3;O43526-2;O43526-4;O43526	.;.;.;.;.;KCNQ2_HUMAN	A	231	ENSP00000349789:E231A;ENSP00000352035:E231A;ENSP00000359246:E231A;ENSP00000346601:E231A;ENSP00000352718:E231A;ENSP00000399612:E231A;ENSP00000353668:E231A;ENSP00000339611:E231A;ENSP00000359244:E231A;ENSP00000359242:E231A;ENSP00000359241:E231A;ENSP00000345523:E231A	ENSP00000345523:E231A	E	-	2	0	KCNQ2	61544327	1.000000	0.71417	1.000000	0.80357	0.612000	0.37316	7.819000	0.86621	1.270000	0.44297	0.378000	0.23410	GAG		0.557	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	Missense_Mutation	Missense_Mutation
DOPEY2	9980	broad.mit.edu	37	21	37609660	37609660	+	Missense_Mutation	SNP	C	C	T	rs541281990		TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr21:37609660C>T	ENST00000399151.3	+	16	2808	c.2723C>T	c.(2722-2724)aCg>aTg	p.T908M		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	908					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.T908M(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CTGGCCCCTACGGCCAACATC	0.612													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17497	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	21											104.0	79.0	88.0					21																	37609660		2203	4300	6503	36531530	SO:0001583	missense	9980			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.2723C>T	21.37:g.37609660C>T	ENSP00000382104:p.Thr908Met		36531530	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	37	CCDS13643.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486356	0.84854	.	.	ENSG00000142197	ENST00000399151	T	0.66995	-0.24	5.42	5.42	0.78866	.	0.124012	0.56097	D	0.000027	T	0.67477	0.2897	L	0.44542	1.39	0.44104	D	0.996879	D	0.65815	0.995	P	0.47251	0.542	T	0.71955	-0.4436	10	0.72032	D	0.01	.	19.2437	0.93893	0.0:1.0:0.0:0.0	.	908	Q9Y3R5	DOP2_HUMAN	M	908	ENSP00000382104:T908M	ENSP00000382104:T908M	T	+	2	0	DOPEY2	36531530	0.998000	0.40836	0.046000	0.18839	0.931000	0.56810	7.321000	0.79088	2.545000	0.85829	0.591000	0.81541	ACG		0.612	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128		Missense_Mutation
CLTCL1	8218	broad.mit.edu	37	22	19241616	19241616	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr22:19241616G>A	ENST00000263200.10	-	3	457	c.385C>T	c.(385-387)Cac>Tac	p.H129Y	CLTCL1_ENST00000353891.5_Missense_Mutation_p.H129Y|CLTCL1_ENST00000427926.1_Missense_Mutation_p.H129Y	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	129	Globular terminal domain.|WD40-like repeat 3.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)	p.H129Y(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					ATGCTCCAGTGGTAGACCGCG	0.493			T	?	ALCL																																		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	1	Substitution - Missense(1)	ovary(1)	22											59.0	59.0	59.0					22																	19241616		1981	4165	6146	17621616	SO:0001583	missense	8218				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.385C>T	22.37:g.19241616G>A	ENSP00000445677:p.His129Tyr		17621616	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	19.29	3.798940	0.70567	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926;ENST00000449918	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	4.08	3.05	0.35203	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.000000	0.64402	D	0.000001	T	0.57577	0.2063	M	0.92784	3.345	0.58432	D	0.999995	D;D	0.76494	0.999;0.991	D;D	0.97110	1.0;0.996	T	0.66756	-0.5843	10	0.66056	D	0.02	-17.1353	11.9473	0.52936	0.0862:0.0:0.9138:0.0	.	129;129	P53675-2;P53675	.;CLH2_HUMAN	Y	129;129;129;150	ENSP00000439662:H129Y;ENSP00000445677:H129Y;ENSP00000441158:H129Y;ENSP00000443264:H150Y	ENSP00000445677:H129Y	H	-	1	0	CLTCL1	17621616	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	8.713000	0.91408	0.909000	0.36697	0.563000	0.77884	CAC		0.493	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098		Missense_Mutation
C3orf58	205428	broad.mit.edu	37	3	143691332	143691332	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr3:143691332A>G	ENST00000315691.3	+	1	693	c.158A>G	c.(157-159)aAt>aGt	p.N53S	C3orf58_ENST00000495414.1_5'Flank|C3orf58_ENST00000441925.2_5'Flank	NM_173552.3	NP_775823.1	Q8NDZ4	DIA1_HUMAN	chromosome 3 open reading frame 58	53					cardiac muscle cell proliferation (GO:0060038)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	COPI vesicle coat (GO:0030126)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)		p.N53S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CTGCAGCTCAATAAGTGCCCG	0.672																																																1	Substitution - Missense(1)	ovary(1)	3											18.0	20.0	20.0					3																	143691332		2186	4276	6462	145174022	SO:0001583	missense	205428			AK095161	CCDS3130.1, CCDS46929.1	3q24	2013-12-06			ENSG00000181744	ENSG00000181744			28490	protein-coding gene	gene with protein product	"""deleted in autism 1"", ""hypoxia and Akt induced stem cell factor"""	612200				21283809, 23784961, 24269490	Standard	NM_173552		Approved	MGC33365, DIA1, HASF	uc003evo.3	Q8NDZ4	OTTHUMG00000159380	ENST00000315691.3:c.158A>G	3.37:g.143691332A>G	ENSP00000320081:p.Asn53Ser		145174022	B2RCF2|B7Z1W3	Missense_Mutation	SNP	ENST00000315691.3	37	CCDS3130.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	16.55	3.153479	0.57259	.	.	ENSG00000181744	ENST00000315691	T	0.29917	1.55	3.81	3.81	0.43845	.	0.000000	0.85682	D	0.000000	T	0.24547	0.0595	L	0.38531	1.155	0.80722	D	1	P	0.35481	0.504	B	0.36335	0.222	T	0.04481	-1.0948	10	0.25751	T	0.34	.	12.747	0.57287	1.0:0.0:0.0:0.0	.	53	Q8NDZ4	CC058_HUMAN	S	53	ENSP00000320081:N53S	ENSP00000320081:N53S	N	+	2	0	C3orf58	145174022	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.985000	0.88162	1.613000	0.50231	0.459000	0.35465	AAT		0.672	C3orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355038.1	NM_173552		Missense_Mutation
FNDC3B	64778	broad.mit.edu	37	3	172080533	172080533	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr3:172080533C>A	ENST00000336824.4	+	23	3005	c.2906C>A	c.(2905-2907)gCt>gAt	p.A969D	FNDC3B_ENST00000415807.2_Missense_Mutation_p.A969D|FNDC3B_ENST00000416957.1_Missense_Mutation_p.A969D	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	969	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)	p.A969D(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TGTGCTGCTGCTGGTCCTCAG	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											119.0	108.0	112.0					3																	172080533		2203	4300	6503	173563227	SO:0001583	missense	64778			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.2906C>A	3.37:g.172080533C>A	ENSP00000338523:p.Ala969Asp		173563227	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	37	CCDS3217.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	19.33	3.807202	0.70797	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	T;T;T	0.57273	0.41;0.41;0.41	5.59	5.59	0.84812	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.099589	0.64402	D	0.000002	T	0.70894	0.3276	M	0.86740	2.835	0.80722	D	1	B	0.22683	0.073	B	0.41813	0.367	T	0.68704	-0.5338	10	0.36615	T	0.2	-14.5767	19.5828	0.95475	0.0:1.0:0.0:0.0	.	969	Q53EP0	FND3B_HUMAN	D	969	ENSP00000411242:A969D;ENSP00000338523:A969D;ENSP00000389094:A969D	ENSP00000338523:A969D	A	+	2	0	FNDC3B	173563227	1.000000	0.71417	0.141000	0.22245	0.904000	0.53231	7.456000	0.80751	2.621000	0.88768	0.563000	0.77884	GCT		0.473	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763		Missense_Mutation
LIFR	3977	broad.mit.edu	37	5	38510652	38510652	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1477-01	TCGA-13-1477-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr5:38510652C>T	ENST00000263409.4	-	7	1067	c.905G>A	c.(904-906)cGt>cAt	p.R302H	LIFR_ENST00000503088.1_5'UTR|LIFR_ENST00000453190.2_Missense_Mutation_p.R302H	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	302					cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.R302H(1)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					AGAAATATTACGAATCTTGAT	0.353			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	1	Substitution - Missense(1)	ovary(1)	5											97.0	89.0	92.0					5																	38510652		2203	4300	6503	38546409	SO:0001583	missense	3977			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.905G>A	5.37:g.38510652C>T	ENSP00000263409:p.Arg302His		38546409	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	5.113	0.206567	0.09704	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.62788	-0.0;-0.0	5.65	-1.01	0.10169	.	1.909190	0.01972	N	0.044143	T	0.36468	0.0968	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14559	-1.0468	10	0.30078	T	0.28	-0.0041	4.3258	0.11039	0.1613:0.3693:0.0:0.4694	.	302	P42702	LIFR_HUMAN	H	302	ENSP00000263409:R302H;ENSP00000398368:R302H	ENSP00000263409:R302H	R	-	2	0	LIFR	38546409	0.049000	0.20398	0.002000	0.10522	0.818000	0.46254	-0.022000	0.12480	-0.390000	0.07774	-0.238000	0.12139	CGT		0.353	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310		Missense_Mutation
PCDHB13	56123	broad.mit.edu	37	5	140595169	140595169	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr5:140595169C>G	ENST00000341948.4	+	1	1661	c.1474C>G	c.(1474-1476)Ccg>Gcg	p.P492A		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	492	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P492A(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCGCTGCTGCCGCCCCAGGA	0.657																																																1	Substitution - Missense(1)	ovary(1)	5											96.0	104.0	101.0					5																	140595169		2203	4300	6503	140575353	SO:0001583	missense	56123			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1474C>G	5.37:g.140595169C>G	ENSP00000345491:p.Pro492Ala		140575353	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	N	22.7	4.329919	0.81690	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.49432	0.78	3.58	2.67	0.31697	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.53158	0.1779	L	0.46157	1.445	0.09310	N	1	P	0.44090	0.826	P	0.57425	0.82	T	0.38672	-0.9650	9	0.66056	D	0.02	.	5.8646	0.18767	0.1909:0.7041:0.0:0.105	.	492	Q9Y5F0	PCDBD_HUMAN	A	492	ENSP00000345491:P492A	ENSP00000345491:P492A	P	+	1	0	PCDHB13	140575353	0.001000	0.12720	0.927000	0.36925	0.825000	0.46686	-0.229000	0.09098	1.716000	0.51395	0.298000	0.19748	CCG		0.657	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		Missense_Mutation
TENM2	57451	broad.mit.edu	37	5	167645417	167645417	+	Silent	SNP	C	C	T	rs149533207	byFrequency	TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr5:167645417C>T	ENST00000518659.1	+	23	4560	c.4521C>T	c.(4519-4521)aaC>aaT	p.N1507N	TENM2_ENST00000519204.1_Silent_p.N1386N|TENM2_ENST00000403607.2_Silent_p.N1331N|TENM2_ENST00000545108.1_Silent_p.N1506N|TENM2_ENST00000520394.1_Silent_p.N1268N	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1507					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.N1340N(2)|p.N1386N(1)|p.N1507N(1)									TAACAACCAACGGGGAGATCT	0.512													.|||	2	0.000399361	0.0	0.0	5008	,	,		23899	0.002		0.0	False		,,,				2504	0.0															4	Substitution - coding silent(4)	breast(3)|ovary(1)	5						C		0,4226		0,0,2113	144.0	146.0	146.0		4494	-9.5	0.4	5	dbSNP_134	146	1,8499		0,1,4249	no	coding-synonymous	ODZ2	NM_001122679.1		0,1,6362	TT,TC,CC		0.0118,0.0,0.0079		1498/2766	167645417	1,12725	2113	4250	6363	167577995	SO:0001819	synonymous_variant	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.4521C>T	5.37:g.167645417C>T			167577995	Q9ULU2	Silent	SNP	ENST00000518659.1	37		SNP	19	Broad																																																																																				0.512	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		Silent
STK10	6793	broad.mit.edu	37	5	171480005	171480005	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr5:171480005T>G	ENST00000176763.5	-	18	3037	c.2694A>C	c.(2692-2694)aaA>aaC	p.K898N		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	898					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.K898N(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGGCCTTCAGTTTCTGGGTTT	0.537																																																1	Substitution - Missense(1)	ovary(1)	5											109.0	95.0	100.0					5																	171480005		2203	4300	6503	171412610	SO:0001583	missense	6793			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.2694A>C	5.37:g.171480005T>G	ENSP00000176763:p.Lys898Asn		171412610	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	ENST00000176763.5	37	CCDS34290.1	SNP	60	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.66|18.66	3.672428|3.672428	0.67928|0.67928	.|.	.|.	ENSG00000072786|ENSG00000072786	ENST00000176763;ENST00000545839|ENST00000520476	T|.	0.76448|.	-1.02|.	4.24|4.24	3.36|3.36	0.38483|0.38483	.|.	0.190181|.	0.43747|.	D|.	0.000534|.	T|T	0.71187|0.71187	0.3310|0.3310	M|M	0.81942|0.81942	2.565|2.565	0.40869|0.40869	D|D	0.98389|0.98389	D|.	0.69078|.	0.997|.	D|.	0.74674|.	0.984|.	T|T	0.69756|0.69756	-0.5059|-0.5059	10|5	0.87932|.	D|.	0|.	.|.	8.1915|8.1915	0.31370|0.31370	0.0:0.7494:0.1589:0.0917|0.0:0.7494:0.1589:0.0917	.|.	898|.	O94804|.	STK10_HUMAN|.	N|T	898|171	ENSP00000176763:K898N|.	ENSP00000176763:K898N|.	K|N	-|-	3|2	2|0	STK10|STK10	171412610|171412610	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	0.892000|0.892000	0.28322|0.28322	0.517000|0.517000	0.28361|0.28361	-0.227000|-0.227000	0.12334|0.12334	AAA|AAC		0.537	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990		Missense_Mutation
C6orf136	221545	broad.mit.edu	37	6	30620609	30620609	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr6:30620609G>A	ENST00000376473.5	+	6	1024	c.865G>A	c.(865-867)Gtg>Atg	p.V289M	C6orf136_ENST00000528347.2_Missense_Mutation_p.V146M|C6orf136_ENST00000293604.6_Missense_Mutation_p.V470M|C6orf136_ENST00000376471.4_Missense_Mutation_p.V155M	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136	289						mitochondrion (GO:0005739)		p.V146M(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						TCCAACGCCTGTGAAGAAGCT	0.567																																																1	Substitution - Missense(1)	ovary(1)	6											113.0	120.0	118.0					6																	30620609		1511	2707	4218	30728588	SO:0001583	missense	221545			BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.865G>A	6.37:g.30620609G>A	ENSP00000365656:p.Val289Met		30728588	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Missense_Mutation	SNP	ENST00000376473.5	37	CCDS43443.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431922	0.62844	.	.	ENSG00000204564	ENST00000293604;ENST00000376473;ENST00000376471;ENST00000446773;ENST00000528347	.	.	.	5.53	5.53	0.82687	.	0.131808	0.51477	D	0.000088	T	0.46718	0.1407	N	0.19112	0.55	0.40612	D	0.981683	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.76575	0.915;0.988;0.915	T	0.52668	-0.8545	9	0.59425	D	0.04	-20.177	10.2388	0.43299	0.087:0.0:0.913:0.0	.	155;470;289	A9R9P9;F8VX15;Q5SQH8	.;.;CF136_HUMAN	M	470;289;155;407;146	.	ENSP00000293604:V470M	V	+	1	0	C6orf136	30728588	1.000000	0.71417	0.998000	0.56505	0.810000	0.45777	4.188000	0.58351	2.882000	0.98803	0.655000	0.94253	GTG		0.567	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076457.4	NM_145029		Missense_Mutation
PPP2R5D	5528	broad.mit.edu	37	6	42978450	42978450	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr6:42978450G>T	ENST00000485511.1	+	14	1709	c.1530G>T	c.(1528-1530)gaG>gaT	p.E510D	PPP2R5D_ENST00000472118.1_Missense_Mutation_p.E502D|PPP2R5D_ENST00000394110.3_Missense_Mutation_p.E478D|PPP2R5D_ENST00000461010.1_Missense_Mutation_p.E404D	NM_001270476.1|NM_006245.3	NP_001257405.1|NP_006236.1	Q14738	2A5D_HUMAN	protein phosphatase 2, regulatory subunit B', delta	510					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of catalytic activity (GO:0050790)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.E510D(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	25			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			AAAAAATCGAGGAGCTGGCCC	0.552																																					Melanoma(63;587 1613 29742 31770)											1	Substitution - Missense(1)	ovary(1)	6											61.0	67.0	65.0					6																	42978450		2203	4300	6503	43086428	SO:0001583	missense	5528			L76702	CCDS4878.1, CCDS43464.1, CCDS55002.1	6p21.1	2010-06-18	2010-04-14		ENSG00000112640	ENSG00000112640		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9312	protein-coding gene	gene with protein product		601646	"""protein phosphatase 2, regulatory subunit B (B56), delta isoform"", ""protein phosphatase 2, regulatory subunit B', delta isoform"""			7592815	Standard	NM_006245		Approved	B56D	uc003oth.4	Q14738	OTTHUMG00000014716	ENST00000485511.1:c.1530G>T	6.37:g.42978450G>T	ENSP00000417963:p.Glu510Asp		43086428	A8K3I9|B5BUA6|O00494|O00696|Q15171|Q5TC39	Missense_Mutation	SNP	ENST00000485511.1	37	CCDS4878.1	SNP	35	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.03|15.03	2.711715|2.711715	0.48517|0.48517	.|.	.|.	ENSG00000112640|ENSG00000112640	ENST00000485511;ENST00000394110;ENST00000472118;ENST00000541610;ENST00000461010|ENST00000470467;ENST00000486843	T;T;T;T|.	0.53857|.	0.6;0.6;0.6;0.62|.	5.58|5.58	3.8|3.8	0.43715|0.43715	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.52853|.	0.1760|.	M|M	0.76002|0.76002	2.32|2.32	0.52501|0.52501	D|D	0.999956|0.999956	B;B;B;B|.	0.13145|.	0.001;0.007;0.001;0.001|.	B;B;B;B|.	0.17433|.	0.006;0.01;0.018;0.005|.	T|.	0.54990|.	-0.8210|.	10|.	0.66056|.	D|.	0.02|.	-27.168|-27.168	7.9028|7.9028	0.29744|0.29744	0.1392:0.1326:0.7283:0.0|0.1392:0.1326:0.7283:0.0	.|.	404;492;510;478|.	Q14738-3;F5GYS1;Q14738;Q14738-2|.	.;.;2A5D_HUMAN;.|.	D|X	510;478;502;492;404|412;142	ENSP00000417963:E510D;ENSP00000377669:E478D;ENSP00000420550:E502D;ENSP00000420674:E404D|.	ENSP00000377669:E478D|.	E|G	+|+	3|1	2|0	PPP2R5D|PPP2R5D	43086428|43086428	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.937000|0.937000	0.57800|0.57800	3.338000|3.338000	0.52128|0.52128	0.724000|0.724000	0.32296|0.32296	-0.126000|-0.126000	0.14955|0.14955	GAG|GGA		0.552	PPP2R5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040573.3	NM_006245		Missense_Mutation
ENPP4	22875	broad.mit.edu	37	6	46108111	46108111	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1477-01	TCGA-13-1477-10			A	C	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr6:46108111A>C	ENST00000321037.4	+	2	1021	c.791A>C	c.(790-792)gAt>gCt	p.D264A		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	264					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)	p.D264A(1)		central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						ACTCTTATAGATTTGAGCCCA	0.413																																																1	Substitution - Missense(1)	ovary(1)	6											80.0	80.0	80.0					6																	46108111		2203	4300	6503	46216070	SO:0001583	missense	22875			AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.791A>C	6.37:g.46108111A>C	ENSP00000318066:p.Asp264Ala		46216070	A8K5G1|Q7L2N1	Missense_Mutation	SNP	ENST00000321037.4	37	CCDS34468.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	21.5	4.163302	0.78226	.	.	ENSG00000001561	ENST00000321037;ENST00000371401	T	0.73897	-0.79	5.67	5.67	0.87782	Alkaline-phosphatase-like, core domain (1);	0.043265	0.85682	D	0.000000	D	0.83806	0.5334	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.85310	0.1078	10	0.51188	T	0.08	-30.0074	15.9204	0.79562	1.0:0.0:0.0:0.0	.	264	Q9Y6X5	ENPP4_HUMAN	A	264	ENSP00000318066:D264A	ENSP00000318066:D264A	D	+	2	0	ENPP4	46216070	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.711000	0.91396	2.164000	0.68074	0.533000	0.62120	GAT		0.413	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040777.2			Missense_Mutation
USP42	84132	broad.mit.edu	37	7	6189639	6189639	+	Silent	SNP	G	G	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr7:6189639G>A	ENST00000306177.5	+	13	1970	c.1812G>A	c.(1810-1812)ctG>ctA	p.L604L		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	604					cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.L732L(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCAGCGTGCTGGTGCCCTATG	0.557																																																1	Substitution - coding silent(1)	ovary(1)	7											37.0	42.0	40.0					7																	6189639		1997	4173	6170	6156165	SO:0001819	synonymous_variant	84132			AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.1812G>A	7.37:g.6189639G>A			6156165	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	ENST00000306177.5	37	CCDS47535.1	SNP	47	Broad																																																																																				0.557	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526		Silent
CHRNB3	1142	broad.mit.edu	37	8	42587315	42587315	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr8:42587315T>A	ENST00000289957.2	+	5	993	c.865T>A	c.(865-867)Tct>Act	p.S289T		NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	289					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)	p.S289T(1)		endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	CATCCCATCGTCTTCCAAAGT	0.398																																																1	Substitution - Missense(1)	ovary(1)	8											253.0	233.0	239.0					8																	42587315		2203	4300	6503	42706472	SO:0001583	missense	1142			U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.865T>A	8.37:g.42587315T>A	ENSP00000289957:p.Ser289Thr		42706472	Q15827	Missense_Mutation	SNP	ENST00000289957.2	37	CCDS6134.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	t	11.41	1.631700	0.29068	.	.	ENSG00000147432	ENST00000289957	D	0.81821	-1.54	5.85	5.85	0.93711	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	T	0.73938	0.3651	N	0.05050	-0.12	0.58432	D	0.999999	D	0.76494	0.999	D	0.87578	0.998	T	0.71374	-0.4612	10	0.02654	T	1	.	11.1456	0.48428	0.1702:0.0:0.0:0.8298	.	289	Q05901	ACHB3_HUMAN	T	289	ENSP00000289957:S289T	ENSP00000289957:S289T	S	+	1	0	CHRNB3	42706472	0.997000	0.39634	0.910000	0.35882	0.957000	0.61999	2.852000	0.48310	2.242000	0.73789	0.529000	0.55759	TCT		0.398	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383055.1			Missense_Mutation
FGD3	89846	broad.mit.edu	37	9	95738854	95738854	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr9:95738854G>C	ENST00000375482.3	+	3	812	c.316G>C	c.(316-318)Ggg>Cgg	p.G106R	FGD3_ENST00000416701.2_Missense_Mutation_p.G106R|FGD3_ENST00000468206.1_3'UTR|FGD3_ENST00000337352.6_Missense_Mutation_p.G106R	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	106					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.G106R(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						CACTGTACTGGGGGCGCACGC	0.657																																																1	Substitution - Missense(1)	ovary(1)	9											20.0	27.0	25.0					9																	95738854		2029	4174	6203	94778675	SO:0001583	missense	89846			AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.316G>C	9.37:g.95738854G>C	ENSP00000364631:p.Gly106Arg		94778675	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	ENST00000375482.3	37	CCDS43849.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627287	0.28978	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352	T;T;T	0.71103	-0.54;-0.54;-0.54	4.07	2.2	0.27929	.	.	.	.	.	T	0.60534	0.2276	M	0.64997	1.995	0.20926	N	0.999826	B;P	0.47106	0.043;0.89	B;B	0.37888	0.018;0.26	T	0.48375	-0.9041	9	0.26408	T	0.33	.	6.6909	0.23171	0.2283:0.0:0.7717:0.0	.	106;106	F8W7P2;Q5JSP0	.;FGD3_HUMAN	R	106	ENSP00000364631:G106R;ENSP00000413833:G106R;ENSP00000336914:G106R	ENSP00000336914:G106R	G	+	1	0	FGD3	94778675	0.997000	0.39634	0.021000	0.16686	0.022000	0.10575	2.827000	0.48112	0.315000	0.23110	0.655000	0.94253	GGG		0.657	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055493.1	NM_033086		Missense_Mutation
FCN2	2220	broad.mit.edu	37	9	137779170	137779170	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chr9:137779170A>G	ENST00000291744.6	+	8	861	c.851A>G	c.(850-852)cAt>cGt	p.H284R	FCN2_ENST00000350339.2_Missense_Mutation_p.H246R	NM_004108.2	NP_004099.2	Q15485	FCN2_HUMAN	ficolin (collagen/fibrinogen domain containing lectin) 2	284	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|opsonization (GO:0008228)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|carbohydrate binding (GO:0030246)	p.H284R(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	20		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)		AGGGGGACTCATGGCAGCTTT	0.502																																																1	Substitution - Missense(1)	ovary(1)	9											90.0	87.0	88.0					9																	137779170		2203	4300	6503	136918991	SO:0001583	missense	2220			D49353	CCDS6983.1	9q34	2013-09-12	2013-09-12		ENSG00000160339	ENSG00000160339		"""Fibrinogen C domain containing"""	3624	protein-coding gene	gene with protein product	"""hucolin"", ""collagen/fibrinogen domain-containing protein 2"", ""ficolin B"", ""serum lectin p35"", ""L-ficolin"""	601624	"""ficolin (collagen/fibrinogen domain-containing lectin) 2 (hucolin)"""			8884275	Standard	XM_006717015		Approved	P35, FCNL, EBP-37, ficolin-2	uc004cfg.1	Q15485	OTTHUMG00000020892	ENST00000291744.6:c.851A>G	9.37:g.137779170A>G	ENSP00000291744:p.His284Arg		136918991	A6NFG7|A8K478|Q6IS69|Q7M4P4|Q9UC57	Missense_Mutation	SNP	ENST00000291744.6	37	CCDS6983.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	14.94	2.686207	0.47991	.	.	ENSG00000160339	ENST00000350339;ENST00000291744	T;T	0.20463	2.07;2.07	4.05	4.05	0.47172	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.157646	0.29100	N	0.013142	T	0.45657	0.1353	M	0.85299	2.745	0.20307	N	0.999912	D;D	0.63880	0.993;0.967	P;D	0.63033	0.83;0.91	T	0.40175	-0.9577	10	0.87932	D	0	.	10.9485	0.47315	1.0:0.0:0.0:0.0	.	246;284	Q15485-2;Q15485	.;FCN2_HUMAN	R	246;284	ENSP00000291741:H246R;ENSP00000291744:H284R	ENSP00000291744:H284R	H	+	2	0	FCN2	136918991	0.723000	0.28027	0.004000	0.12327	0.012000	0.07955	3.690000	0.54713	1.461000	0.47929	0.460000	0.39030	CAT		0.502	FCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054960.1	NM_004108		Missense_Mutation
GPM6B	2824	broad.mit.edu	37	X	13792741	13792741	+	Silent	SNP	C	C	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chrX:13792741C>A	ENST00000356942.5	-	7	1161	c.720G>T	c.(718-720)ctG>ctT	p.L240L	GPM6B_ENST00000454189.2_Silent_p.L221L|GPM6B_ENST00000398361.3_Silent_p.L154L|GPM6B_ENST00000316715.4_Intron|GPM6B_ENST00000355135.2_Silent_p.L280L|GPM6B_ENST00000493677.1_Intron	NM_005278.3	NP_005269.1	Q13491	GPM6B_HUMAN	glycoprotein M6B	240					cell differentiation (GO:0030154)|extracellular matrix assembly (GO:0085029)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of serotonin uptake (GO:0051612)|nervous system development (GO:0007399)|ossification (GO:0001503)|positive regulation of bone mineralization (GO:0030501)|protein transport (GO:0015031)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of focal adhesion assembly (GO:0051893)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)		p.L240L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)|pancreas(1)	6						TCATGTAGATCAGCTGGTGGA	0.443																																																1	Substitution - coding silent(1)	ovary(1)	X											90.0	79.0	83.0					X																	13792741		2203	4300	6503	13702662	SO:0001819	synonymous_variant	2824				CCDS14158.1, CCDS35206.1, CCDS35207.1, CCDS48084.1	Xp22.2	2010-08-03			ENSG00000046653	ENSG00000046653			4461	protein-coding gene	gene with protein product		300051				8661015	Standard	NM_001001995		Approved	M6B, MGC17150, MGC54284	uc004cvw.3	Q13491	OTTHUMG00000021162	ENST00000356942.5:c.720G>T	X.37:g.13792741C>A			13702662	O76077|Q86X43|Q8N956	Silent	SNP	ENST00000356942.5	37	CCDS14158.1	SNP	29	Broad																																																																																				0.443	GPM6B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055822.1	NM_001001995		Silent
MAGEB1	4112	broad.mit.edu	37	X	30269381	30269381	+	Silent	SNP	C	C	T			TCGA-13-1477-01	TCGA-13-1477-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chrX:30269381C>T	ENST00000378981.3	+	4	1092	c.771C>T	c.(769-771)taC>taT	p.Y257Y	MAGEB1_ENST00000397550.1_Silent_p.Y257Y|MAGEB1_ENST00000397548.2_Silent_p.Y257Y	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	257	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.Y257Y(1)		NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						ATCTGAAGTACGAGCAGGTGC	0.493																																																1	Substitution - coding silent(1)	ovary(1)	X											93.0	82.0	86.0					X																	30269381		2202	4300	6502	30179302	SO:0001819	synonymous_variant	4112				CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.771C>T	X.37:g.30269381C>T			30179302	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Silent	SNP	ENST00000378981.3	37	CCDS14222.1	SNP	19	Broad																																																																																				0.493	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056160.1	NM_002363		Silent
NLGN3	54413	broad.mit.edu	37	X	70389792	70389792	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chrX:70389792C>T	ENST00000358741.3	+	8	2695	c.2392C>T	c.(2392-2394)Cgc>Tgc	p.R798C	NLGN3_ENST00000536169.1_Missense_Mutation_p.R758C|NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000374051.3_Missense_Mutation_p.R778C	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	798					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.R778C(1)		biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					GACCCTGCGGCGCTCCCCGGA	0.612																																					Esophageal Squamous(103;760 1488 16849 22250 40351)											1	Substitution - Missense(1)	ovary(1)	X											102.0	70.0	81.0					X																	70389792		2202	4297	6499	70306517	SO:0001583	missense	54413			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.2392C>T	X.37:g.70389792C>T	ENSP00000351591:p.Arg798Cys		70306517	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	ENST00000358741.3	37	CCDS55441.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346340	0.61073	.	.	ENSG00000196338	ENST00000536169;ENST00000374051;ENST00000358741	T;T;T	0.73258	-0.7;-0.73;-0.73	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.82907	0.5139	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.76071	0.97;0.97;0.987	D	0.85078	0.0944	10	0.87932	D	0	.	12.5627	0.56291	0.1658:0.8342:0.0:0.0	.	758;798;778	D3DVV1;Q9NZ94;Q9NZ94-2	.;NLGN3_HUMAN;.	C	758;778;798	ENSP00000445298:R758C;ENSP00000363163:R778C;ENSP00000351591:R798C	ENSP00000351591:R798C	R	+	1	0	NLGN3	70306517	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.794000	0.55492	2.310000	0.77875	0.525000	0.51046	CGC		0.612	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977		Missense_Mutation
BCORL1	63035	broad.mit.edu	37	X	129147438	129147438	+	Silent	SNP	A	A	G			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chrX:129147438A>G	ENST00000218147.7	+	4	887	c.690A>G	c.(688-690)ccA>ccG	p.P230P	BCORL1_ENST00000540052.1_Silent_p.P230P|BCORL1_ENST00000359304.2_Silent_p.P230P|BCORL1_ENST00000303743.5_Silent_p.P230P			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	230	Pro-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P230P(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TCCCTGCCCCAGTCCCCCATT	0.642																																																1	Substitution - coding silent(1)	ovary(1)	X											144.0	130.0	135.0					X																	129147438		2203	4300	6503	128975119	SO:0001819	synonymous_variant	63035			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.690A>G	X.37:g.129147438A>G			128975119	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Silent	SNP	ENST00000218147.7	37	CCDS14616.1	SNP	7	Broad																																																																																				0.642	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		Silent
ZIC3	7547	broad.mit.edu	37	X	136648913	136648913	+	Silent	SNP	G	G	A			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-13-1477-01	TCGA-13-1477-10	g.chrX:136648913G>A	ENST00000287538.5	+	1	613	c.63G>A	c.(61-63)gcG>gcA	p.A21A	RP1-137H15.2_ENST00000456631.1_RNA|RP1-137H15.2_ENST00000442841.1_RNA|ZIC3_ENST00000370606.3_Silent_p.A21A	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	21					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A21A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					GCTTCGGCGCGCCGCGCCACC	0.726																																																1	Substitution - coding silent(1)	ovary(1)	X											11.0	10.0	10.0					X																	136648913		2177	4269	6446	136476579	SO:0001819	synonymous_variant	7547			AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.63G>A	X.37:g.136648913G>A			136476579	B2CNW4|Q14DE5|Q5JY75	Silent	SNP	ENST00000287538.5	37	CCDS14663.1	SNP	38	Broad																																																																																				0.726	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1			Silent
HJURP	55355	broad.mit.edu	37	2	234754370	234754397	+	Splice_Site	DEL	TTACCTCAAAATACTCTGCACCTTGTAG	TTACCTCAAAATACTCTGCACCTTGTAG	-			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-1477-01	TCGA-13-1477-10	g.chr2:234754370_234754397delTTACCTCAAAATACTCTGCACCTTGTAG	ENST00000411486.2	-	6	537_561	c.472_496delCTACAAGGTGCAGAGTATTTTGAGGTAA	c.(472-498)ctacaaggtgcagagtattttgaggta>ta	p.LQGAEYFEV158fs	HJURP_ENST00000432087.1_Splice_Site_p.LQGAEYFEV104fs|HJURP_ENST00000434039.1_5'UTR|HJURP_ENST00000441687.1_Intron	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	158					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)	p.?(1)		NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		GGGAAACAGATTACCTCAAAATACTCTGCACCTTGTAGCAGTATATCC	0.325																																																1	Unknown(1)	ovary(1)	2																																								234419136	SO:0001630	splice_region_variant	55355				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.495+1CTACAAGGTGCAGAGTATTTTGAGGTAA>-	2.37:g.234754370_234754397delTTACCTCAAAATACTCTGCACCTTGTAG			234419109	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Splice_Site_Del	DEL	ENST00000411486.2	37	CCDS33406.1	DEL	52	Broad																																																																																				0.325	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130996.6	NM_018410	Frame_Shift_Del	Splice_Site_Del
THBS4	7060	broad.mit.edu	37	5	79369090	79369102	+	Splice_Site	DEL	CTTTGCAGTCTGA	CTTTGCAGTCTGA	-			TCGA-13-1477-01	TCGA-13-1477-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-13-1477-01	TCGA-13-1477-10	g.chr5:79369090_79369102delCTTTGCAGTCTGA	ENST00000350881.2	+	15	2029_2034	c.1839_1844delCTTTGCAGTCTGA	c.(1837-1845)cactttgca>caa	p.HFA613fs	CTD-2201I18.1_ENST00000503007.1_RNA|THBS4_ENST00000511733.1_Splice_Site_p.HFA522fs|CTD-2201I18.1_ENST00000514042.1_RNA	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	613					behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.?(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		GTGCTGTTCTCTTTGCAGTCTGATGTGGATAAT	0.479																																																1	Unknown(1)	ovary(1)	5																																								79404858	SO:0001630	splice_region_variant	7060				CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.1840-1CTTTGCAGTCTGA>-	5.37:g.79369090_79369102delCTTTGCAGTCTGA			79404846	B2R909|Q86TG2	Splice_Site_Del	DEL	ENST00000350881.2	37	CCDS4049.1	DEL	32	Broad																																																																																				0.479	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226977.1		Frame_Shift_Del	Splice_Site_Del
