#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
MYT1L	23040	genome.wustl.edu	37	2	1921010	1921010	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr2:1921010C>G	ENST00000399161.2	-	11	2332	c.1585G>C	c.(1585-1587)Gga>Cga	p.G529R	MYT1L_ENST00000428368.2_Missense_Mutation_p.G527R	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	529					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G529R(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TGCGGGCATCCGGACAGGCTG	0.567																																																1	Substitution - Missense(1)	ovary(1)	2											188.0	198.0	195.0					2																	1921010		2032	4191	6223	1900017	SO:0001583	missense	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1585G>C	2.37:g.1921010C>G	ENSP00000382114:p.Gly529Arg		1900017	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	34	5.329642	0.95733	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.64618	-0.05;-0.11	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.83594	0.5288	M	0.88842	2.985	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85949	0.1463	10	0.87932	D	0	-31.232	19.8984	0.96975	0.0:1.0:0.0:0.0	.	529;527	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	R	529;475;527	ENSP00000382114:G529R;ENSP00000396103:G527R	ENSP00000295067:G475R	G	-	1	0	MYT1L	1900017	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.755000	0.85180	2.713000	0.92767	0.655000	0.94253	GGA		0.567	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025		Missense_Mutation
ZNF500	26048	genome.wustl.edu	37	16	4812610	4812610	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1483-01	TCGA-13-1483-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr16:4812610T>A	ENST00000219478.6	-	3	861	c.562A>T	c.(562-564)Agg>Tgg	p.R188W	ZNF500_ENST00000545009.1_Missense_Mutation_p.R188W			O60304	ZN500_HUMAN	zinc finger protein 500	188					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R188W(1)		endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						CTCTGTGGCCTGTGGCTCAGC	0.612																																																1	Substitution - Missense(1)	ovary(1)	16											67.0	79.0	75.0					16																	4812610		2197	4300	6497	4752611	SO:0001583	missense	26048			AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.562A>T	16.37:g.4812610T>A	ENSP00000219478:p.Arg188Trp		4752611	A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Missense_Mutation	SNP	ENST00000219478.6	37	CCDS32383.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	13.55	2.271113	0.40194	.	.	ENSG00000103199	ENST00000545009;ENST00000219478	T;T	0.07114	3.3;3.22	3.22	0.862	0.19056	.	0.882541	0.09247	N	0.828458	T	0.09024	0.0223	N	0.19112	0.55	0.09310	N	1	D;D	0.58620	0.983;0.983	P;P	0.53062	0.632;0.717	T	0.36114	-0.9761	10	0.37606	T	0.19	.	5.8052	0.18436	0.0:0.376:0.0:0.624	.	188;188	B4DNN9;O60304	.;ZN500_HUMAN	W	188	ENSP00000445714:R188W;ENSP00000219478:R188W	ENSP00000219478:R188W	R	-	1	2	ZNF500	4752611	0.001000	0.12720	0.085000	0.20634	0.005000	0.04900	0.068000	0.14531	0.044000	0.15775	-0.290000	0.09829	AGG		0.612	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432461.1	XM_085507		Missense_Mutation
OR52E4	390081	genome.wustl.edu	37	11	5905526	5905526	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr11:5905526C>T	ENST00000316987.2	+	1	26	c.4C>T	c.(4-6)Cct>Tct	p.P2S		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P2S(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGGAGAATGCCTTCTATCAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	11											143.0	141.0	142.0					11																	5905526		2201	4296	6497	5862102	SO:0001583	missense	390081			AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.4C>T	11.37:g.5905526C>T	ENSP00000321426:p.Pro2Ser		5862102	Q6IFG0	Missense_Mutation	SNP	ENST00000316987.2	37	CCDS31401.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	2.105	-0.405242	0.04832	.	.	ENSG00000180974	ENST00000316987	T	0.38240	1.15	5.15	-5.08	0.02929	.	0.608360	0.14518	N	0.314625	T	0.07098	0.0180	N	0.00368	-1.59	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40608	-0.9554	10	0.18710	T	0.47	.	7.4129	0.27027	0.1371:0.2191:0.0:0.6439	.	2	Q8NGH9	O52E4_HUMAN	S	2	ENSP00000321426:P2S	ENSP00000321426:P2S	P	+	1	0	OR52E4	5862102	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.664000	0.01966	-0.871000	0.04042	-0.366000	0.07423	CCT		0.423	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401146.1	NM_001005165		Missense_Mutation
NLRP14	338323	genome.wustl.edu	37	11	7064352	7064352	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr11:7064352G>A	ENST00000299481.4	+	4	1441	c.1095G>A	c.(1093-1095)atG>atA	p.M365I		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	365	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.M365I(1)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TGTTTAGCATGTGCCAAGTCC	0.458																																																1	Substitution - Missense(1)	ovary(1)	11											131.0	130.0	130.0					11																	7064352		2201	4296	6497	7020928	SO:0001583	missense	338323			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.1095G>A	11.37:g.7064352G>A	ENSP00000299481:p.Met365Ile		7020928	Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	CCDS7776.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	9.073	0.997285	0.19043	.	.	ENSG00000158077	ENST00000299481	D	0.85258	-1.96	4.51	3.6	0.41247	NACHT nucleoside triphosphatase (1);	0.317503	0.27691	N	0.018254	T	0.77731	0.4174	L	0.50333	1.59	0.35865	D	0.827807	B	0.12630	0.006	B	0.13407	0.009	T	0.73338	-0.4014	10	0.27082	T	0.32	.	6.5217	0.22279	0.0985:0.1829:0.7186:0.0	.	365	Q86W24	NAL14_HUMAN	I	365	ENSP00000299481:M365I	ENSP00000299481:M365I	M	+	3	0	NLRP14	7020928	1.000000	0.71417	1.000000	0.80357	0.184000	0.23303	2.090000	0.41682	1.272000	0.44329	-0.140000	0.14226	ATG		0.458	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	G	A	rs121913344		TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr17:7577022G>A	ENST00000269305.4	-	8	1105	c.916C>T	c.(916-918)Cga>Tga	p.R306*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R306*|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.R306*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R306*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Nonsense_Mutation_p.R306*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	306	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R306*(133)|p.0?(8)|p.?(3)|p.R306fs*39(2)|p.K305fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTACCTCGCTTAGTGCTC	0.562	R306*(HCC1937_BREAST)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(MFE296_ENDOMETRIUM)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	147	Substitution - Nonsense(133)|Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	large_intestine(39)|breast(21)|upper_aerodigestive_tract(15)|ovary(11)|central_nervous_system(10)|oesophagus(10)|stomach(8)|lung(8)|endometrium(6)|bone(4)|pancreas(3)|haematopoietic_and_lymphoid_tissue(3)|biliary_tract(3)|kidney(2)|NS(2)|urinary_tract(1)|liver(1)	17	GRCh37	CM971506	TP53	M	rs121913344						120.0	106.0	110.0					17																	7577022		2203	4300	6503	7517747	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.916C>T	17.37:g.7577022G>A	ENSP00000269305:p.Arg306*		7517747	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782988	0.90282	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	3.21	0.36854	.	1.348720	0.05032	N	0.474808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4785	0.44678	0.0:0.0:0.6334:0.3666	.	.	.	.	X	306;306;306;306;306;295;174	.	ENSP00000269305:R306X	R	-	1	2	TP53	7517747	1.000000	0.71417	0.970000	0.41538	0.345000	0.29048	2.280000	0.43443	0.735000	0.32537	0.561000	0.74099	CGA		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
GRIN2A	2903	genome.wustl.edu	37	16	9857785	9857785	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr16:9857785G>A	ENST00000396573.2	-	14	3925	c.3616C>T	c.(3616-3618)Cga>Tga	p.R1206*	GRIN2A_ENST00000330684.3_Nonsense_Mutation_p.R1206*|GRIN2A_ENST00000562109.1_Nonsense_Mutation_p.R1206*|GRIN2A_ENST00000396575.2_Nonsense_Mutation_p.R1206*|GRIN2A_ENST00000535259.1_Nonsense_Mutation_p.R1049*|GRIN2A_ENST00000404927.2_Nonsense_Mutation_p.R1206*	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1206					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.R1206*(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGCCGGTATCGCTCGCTGGTC	0.537																																																1	Substitution - Nonsense(1)	ovary(1)	16											302.0	292.0	295.0					16																	9857785		2197	4300	6497	9765286	SO:0001587	stop_gained	2903				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3616C>T	16.37:g.9857785G>A	ENSP00000379818:p.Arg1206*		9765286	O00669|Q17RZ6	Nonsense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	38	6.803450	0.97849	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	.	.	.	5.09	4.04	0.47022	.	0.207437	0.46758	D	0.000272	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1281	0.53928	0.0:0.0:0.7252:0.2748	.	.	.	.	X	1206;1206;1049;1206;1206	.	.	R	-	1	2	GRIN2A	9765286	1.000000	0.71417	0.901000	0.35422	0.318000	0.28184	3.767000	0.55288	2.362000	0.80069	0.655000	0.94253	CGA		0.537	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			Nonsense_Mutation
GRIN2A	2903	genome.wustl.edu	37	16	9892135	9892135	+	Splice_Site	SNP	A	A	G			TCGA-13-1483-01	TCGA-13-1483-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr16:9892135A>G	ENST00000396573.2	-	12	2664	c.2355T>C	c.(2353-2355)gaT>gaC	p.D785D	GRIN2A_ENST00000330684.3_Splice_Site_p.D785D|GRIN2A_ENST00000562109.1_Splice_Site_p.D785D|GRIN2A_ENST00000396575.2_Splice_Site_p.D785D|GRIN2A_ENST00000535259.1_Splice_Site_p.D628D|GRIN2A_ENST00000404927.2_Splice_Site_p.D785D	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	785					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.D785D(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGGTCTTACCATCACCCACAA	0.532																																																1	Substitution - coding silent(1)	ovary(1)	16											74.0	57.0	63.0					16																	9892135		2197	4300	6497	9799636	SO:0001630	splice_region_variant	2903				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2356+1T>C	16.37:g.9892135A>G			9799636	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1	SNP	8	WashU																																																																																				0.532	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		Silent	Silent
KIF1B	23095	genome.wustl.edu	37	1	10425305	10425305	+	Splice_Site	SNP	T	T	C			TCGA-13-1483-01	TCGA-13-1483-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr1:10425305T>C	ENST00000377086.1	+	42	4714		c.e42+2		KIF1B_ENST00000263934.6_Splice_Site|KIF1B_ENST00000377081.1_Splice_Site			O60333	KIF1B_HUMAN	kinesin family member 1B						anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.?(1)		breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CTACATGAGGTATCCAGGGGC	0.552																																																1	Unknown(1)	ovary(1)	1											38.0	39.0	39.0					1																	10425305		2203	4300	6503	10347892	SO:0001630	splice_region_variant	23095			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4512+2T>C	1.37:g.10425305T>C			10347892	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Splice_Site_SNP	SNP	ENST00000377086.1	37		SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	19.14	3.769935	0.69992	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2691	0.73686	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIF1B	10347892	1.000000	0.71417	0.949000	0.38748	0.790000	0.44656	8.040000	0.89188	1.991000	0.58162	0.528000	0.53228	.		0.552	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		Intron	Splice_Site_SNP
ECSIT	51295	genome.wustl.edu	37	19	11618353	11618353	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1483-01	TCGA-13-1483-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr19:11618353A>G	ENST00000270517.7	-	7	1105	c.970T>C	c.(970-972)Tgg>Cgg	p.W324R	ECSIT_ENST00000591352.1_5'Flank|ECSIT_ENST00000252440.7_Missense_Mutation_p.V274A|ECSIT_ENST00000588998.1_Missense_Mutation_p.V60A|ECSIT_ENST00000417981.2_Missense_Mutation_p.W110R|ZNF653_ENST00000593191.1_5'Flank|ECSIT_ENST00000592312.1_Silent_p.S254S|ECSIT_ENST00000591104.1_Silent_p.S283S|ZNF653_ENST00000293771.5_5'Flank|CTC-398G3.6_ENST00000585656.1_5'Flank	NM_016581.4	NP_057665.2	Q9BQ95	ECSIT_HUMAN	ECSIT signalling integrator	324					BMP signaling pathway (GO:0030509)|innate immune response (GO:0045087)|mesoderm formation (GO:0001707)|oxidation-reduction process (GO:0055114)|regulation of oxidoreductase activity (GO:0051341)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	oxidoreductase activity, acting on NAD(P)H (GO:0016651)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.W324R(1)		kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	11						TAGAGGTTCCACTCCTCCGGC	0.587																																																1	Substitution - Missense(1)	ovary(1)	19											110.0	95.0	100.0					19																	11618353		2203	4300	6503	11479353	SO:0001583	missense	51295			BC005119	CCDS12262.1, CCDS45979.1, CCDS45980.1, CCDS59353.1	19p13.2	2013-05-24	2013-05-24			ENSG00000130159		"""Mitochondrial respiratory chain complex assembly factors"""	29548	protein-coding gene	gene with protein product	"""signaling intermediate in Toll pathway evolutionarily conserved ortholog (mouse)"""	608388	"""ECSIT homolog (Drosophila)"""			10465784, 22982022	Standard	NM_001142464		Approved	SITPEC	uc002msb.3	Q9BQ95		ENST00000270517.7:c.970T>C	19.37:g.11618353A>G	ENSP00000270517:p.Trp324Arg		11479353	E9PAN9|K7EMM0|Q96HQ7|Q9NYI1	Missense_Mutation	SNP	ENST00000270517.7	37	CCDS12262.1	SNP	6	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.61|11.61	1.691274|1.691274	0.30052|0.30052	.|.	.|.	ENSG00000130159|ENSG00000130159	ENST00000252440|ENST00000270517;ENST00000417981	.|T;T	.|0.39592	.|1.07;1.07	4.77|4.77	3.72|3.72	0.42706|0.42706	.|.	.|0.307616	.|0.28754	.|N	.|0.014246	T|T	0.19287|0.19287	0.0463|0.0463	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|B;B	0.17667|0.13145	0.023|0.007;0.0	B|B;B	0.15484|0.12156	0.013|0.007;0.0	T|T	0.07424|0.07424	-1.0773|-1.0773	7|9	0.05833|0.07482	T|T	0.94|0.82	-17.2071|-17.2071	7.1179|7.1179	0.25427|0.25427	0.5746:0.0:0.0:0.4254|0.5746:0.0:0.0:0.4254	.|.	274|110;324	Q9BQ95-2|E9PAN9;Q9BQ95	.|.;ECSIT_HUMAN	A|R	274|324;110	.|ENSP00000270517:W324R;ENSP00000412712:W110R	ENSP00000252440:V274A|ENSP00000270517:W324R	V|W	-|-	2|1	0|0	ECSIT|ECSIT	11479353|11479353	0.995000|0.995000	0.38212|0.38212	0.995000|0.995000	0.50966|0.50966	0.278000|0.278000	0.26855|0.26855	0.822000|0.822000	0.27352|0.27352	1.771000|1.771000	0.52183|0.52183	0.402000|0.402000	0.26972|0.26972	GTG|TGG		0.587	ECSIT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442603.2	NM_016581		Missense_Mutation
SPEN	23013	genome.wustl.edu	37	1	16256441	16256441	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr1:16256441G>C	ENST00000375759.3	+	11	3910	c.3706G>C	c.(3706-3708)Gat>Cat	p.D1236H		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1236					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.D1236H(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TGTCGATTTTGATATCTGCAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	1											99.0	93.0	95.0					1																	16256441		2203	4300	6503	16129028	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.3706G>C	1.37:g.16256441G>C	ENSP00000364912:p.Asp1236His		16129028	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	13.82	2.351255	0.41700	.	.	ENSG00000065526	ENST00000375759	T	0.09817	2.94	4.91	4.91	0.64330	.	.	.	.	.	T	0.19366	0.0465	N	0.24115	0.695	0.58432	D	0.999995	D	0.71674	0.998	P	0.60789	0.879	T	0.02251	-1.1188	9	0.72032	D	0.01	-6.1796	18.2949	0.90141	0.0:0.0:1.0:0.0	.	1236	Q96T58	MINT_HUMAN	H	1236	ENSP00000364912:D1236H	ENSP00000364912:D1236H	D	+	1	0	SPEN	16129028	1.000000	0.71417	0.997000	0.53966	0.890000	0.51754	7.331000	0.79192	2.555000	0.86185	0.557000	0.71058	GAT		0.473	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001		Missense_Mutation
DBX1	120237	genome.wustl.edu	37	11	20181507	20181507	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1483-01	TCGA-13-1483-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr11:20181507T>C	ENST00000524983.2	-	1	652	c.364A>G	c.(364-366)Aca>Gca	p.T122A	DBX1_ENST00000227256.3_Missense_Mutation_p.T122A			A6NMT0	DBX1_HUMAN	developing brain homeobox 1	122					regulation of transcription from RNA polymerase II promoter (GO:0006357)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.T122A(1)		endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)	21						CGCTTACCTGTTCTGGGCCCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	11											35.0	36.0	35.0					11																	20181507		2203	4300	6503	20138083	SO:0001583	missense	120237					11p15.1	2011-06-20				ENSG00000109851		"""Homeoboxes / ANTP class : NKL subclass"""	33185	protein-coding gene	gene with protein product						11239429	Standard	NM_001029865		Approved		uc021qey.1	A6NMT0		ENST00000524983.2:c.364A>G	11.37:g.20181507T>C	ENSP00000436881:p.Thr122Ala		20138083		Missense_Mutation	SNP	ENST00000524983.2	37		SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	9.288	1.049907	0.19827	.	.	ENSG00000109851	ENST00000524983;ENST00000227256	D;T	0.90676	-2.71;0.26	5.61	0.654	0.17833	.	0.471455	0.23023	N	0.052824	T	0.77691	0.4168	N	0.16478	0.41	0.22226	N	0.999278	B	0.06786	0.001	B	0.09377	0.004	T	0.58994	-0.7537	10	0.06099	T	0.92	.	9.8933	0.41302	0.0:0.3721:0.0:0.6279	.	122	F8W811	.	A	122	ENSP00000436881:T122A;ENSP00000227256:T122A	ENSP00000227256:T122A	T	-	1	0	DBX1	20138083	1.000000	0.71417	0.984000	0.44739	0.911000	0.54048	1.591000	0.36665	0.102000	0.17638	0.398000	0.26397	ACA		0.632	DBX1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387585.2	NM_001029865		Missense_Mutation
CYFIP1	23191	genome.wustl.edu	37	15	22929772	22929772	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr15:22929772G>A	ENST00000313077.7	+	6	571	c.446G>A	c.(445-447)aGg>aAg	p.R149K	CYFIP1_ENST00000560848.1_Missense_Mutation_p.R149K	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1									p.R149K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GCCGAGAGGAGGAAGGACTTC	0.542																																																1	Substitution - Missense(1)	ovary(1)	15											126.0	106.0	113.0					15																	22929772		2203	4300	6503	20481213	SO:0001583	missense	23191			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.446G>A	15.37:g.22929772G>A	ENSP00000324549:p.Arg149Lys		20481213		Missense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	16.90	3.251139	0.59212	.	.	ENSG00000068793	ENST00000313077;ENST00000412127	T	0.42513	0.97	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.50701	0.1631	L	0.37850	1.14	0.80722	D	1	P;B	0.50156	0.932;0.0	P;B	0.60012	0.867;0.001	T	0.30909	-0.9962	10	0.16420	T	0.52	-14.8972	18.4773	0.90798	0.0:0.0:1.0:0.0	.	177;149	E7EQ04;Q7L576	.;CYFP1_HUMAN	K	149;177	ENSP00000324549:R149K	ENSP00000324549:R149K	R	+	2	0	CYFIP1	20481213	1.000000	0.71417	0.998000	0.56505	0.914000	0.54420	9.658000	0.98594	2.439000	0.82584	0.561000	0.74099	AGG		0.542	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608		Missense_Mutation
METTL9	51108	genome.wustl.edu	37	16	21629218	21629218	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1483-01	TCGA-13-1483-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr16:21629218C>T	ENST00000358154.3	+	3	647	c.389C>T	c.(388-390)tCa>tTa	p.S130L	METTL9_ENST00000396014.4_Missense_Mutation_p.S130L	NM_001077180.1|NM_016025.3	NP_001070648.1|NP_057109.3	Q9H1A3	METL9_HUMAN	methyltransferase like 9	130								p.S130L(1)		endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	7				GBM - Glioblastoma multiforme(48;0.0759)		TTTGTGTTTTCACCAGATCAG	0.393																																																1	Substitution - Missense(1)	ovary(1)	16											160.0	153.0	155.0					16																	21629218		2199	4300	6499	21536719	SO:0001583	missense	51108			NM_016025, AF151839	CCDS10598.2, CCDS45440.1	16p12.2	2008-11-06			ENSG00000197006	ENSG00000197006			24586	protein-coding gene	gene with protein product	"""DORA reverse strand protein 1"""	609388				10810093, 11132146	Standard	NM_001077180		Approved	DREV1	uc002dje.3	Q9H1A3	OTTHUMG00000131584	ENST00000358154.3:c.389C>T	16.37:g.21629218C>T	ENSP00000350874:p.Ser130Leu		21536719	Q8NBT8|Q9BWJ7|Q9H1A2|Q9Y390	Missense_Mutation	SNP	ENST00000358154.3	37	CCDS10598.2	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.568837	0.96540	.	.	ENSG00000197006	ENST00000358154;ENST00000396014;ENST00000540294	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.83820	0.5337	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	0.989;1.0	D;D	0.79784	0.985;0.993	D	0.84829	0.0801	9	0.87932	D	0	-7.7649	18.3732	0.90420	0.0:1.0:0.0:0.0	.	130;130	Q9H1A3-2;Q9H1A3	.;METL9_HUMAN	L	130;130;94	.	ENSP00000350874:S130L	S	+	2	0	METTL9	21536719	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.531000	0.81973	2.941000	0.99782	0.655000	0.94253	TCA		0.393	METTL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254465.1	NM_016025		Missense_Mutation
CDH12	1010	genome.wustl.edu	37	5	21752321	21752321	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1483-01	TCGA-13-1483-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr5:21752321A>T	ENST00000382254.1	-	15	2996	c.1910T>A	c.(1909-1911)cTg>cAg	p.L637Q	CDH12_ENST00000504376.2_Missense_Mutation_p.L637Q|CDH12_ENST00000522262.1_Missense_Mutation_p.L597Q|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	637					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L637Q(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CTGCCTTCGCAGTGCTACATA	0.393										HNSCC(59;0.17)																																						1	Substitution - Missense(1)	ovary(1)	5											77.0	76.0	76.0					5																	21752321		2203	4300	6503	21788078	SO:0001583	missense	1010			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1910T>A	5.37:g.21752321A>T	ENSP00000371689:p.Leu637Gln		21788078	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	CCDS3890.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	16.17	3.048677	0.55110	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.60424	0.22;0.22;0.19	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.77068	0.4076	M	0.81614	2.55	0.58432	D	0.999991	P;D	0.71674	0.762;0.998	B;D	0.81914	0.411;0.995	T	0.80498	-0.1356	10	0.66056	D	0.02	.	15.4877	0.75578	1.0:0.0:0.0:0.0	.	597;637	B7Z2U6;P55289	.;CAD12_HUMAN	Q	637;637;597	ENSP00000423577:L637Q;ENSP00000371689:L637Q;ENSP00000428786:L597Q	ENSP00000371689:L637Q	L	-	2	0	CDH12	21788078	0.991000	0.36638	0.633000	0.29310	0.538000	0.34931	8.962000	0.93254	2.072000	0.62099	0.482000	0.46254	CTG		0.393	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		Missense_Mutation
ZNF729	100287226	genome.wustl.edu	37	19	22499326	22499326	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1483-01	TCGA-13-1483-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr19:22499326T>C	ENST00000601693.1	+	4	3225	c.3107T>C	c.(3106-3108)aTg>aCg	p.M1036T	ZNF729_ENST00000357491.6_Missense_Mutation_p.M1008T			A6NN14	ZN729_HUMAN	zinc finger protein 729	1036					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M1008T(1)		breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						TCAGCCCTTATGAAACATAAG	0.333																																																1	Substitution - Missense(1)	ovary(1)	19																																								22291166	SO:0001583	missense					CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.3107T>C	19.37:g.22499326T>C	ENSP00000469582:p.Met1036Thr		22291166	M0QY45	Missense_Mutation	SNP	ENST00000601693.1	37	CCDS59368.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.936574	0.00003	.	.	ENSG00000196350	ENST00000357491	T	0.35605	1.3	0.996	-1.99	0.07457	.	.	.	.	.	T	0.12518	0.0304	.	.	.	.	.	.	.	.	.	.	.	.	T	0.24225	-1.0166	5	0.10111	T	0.7	.	0.0959	0.00044	0.2327:0.2:0.2334:0.3338	.	.	.	.	T	1008	ENSP00000350085:M1008T	ENSP00000350085:M1008T	M	+	2	0	ZNF729	22291166	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	-0.260000	0.08708	-2.005000	0.00959	-2.060000	0.00399	ATG		0.333	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301		Missense_Mutation
TNRC6A	27327	genome.wustl.edu	37	16	24801413	24801413	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr16:24801413C>T	ENST00000395799.3	+	6	1579	c.1450C>T	c.(1450-1452)Cgt>Tgt	p.R484C	TNRC6A_ENST00000315183.7_Missense_Mutation_p.R484C	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	484	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1, AGO3 and AGO4.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R484C(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		AGGGGCCTGGCGTGTGAGCAC	0.468																																																1	Substitution - Missense(1)	ovary(1)	16											72.0	67.0	69.0					16																	24801413		2197	4300	6497	24708914	SO:0001583	missense	27327			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1450C>T	16.37:g.24801413C>T	ENSP00000379144:p.Arg484Cys		24708914	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	13.08	2.128876	0.37533	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.12361	2.69;2.7	5.79	5.79	0.91817	.	0.126285	0.56097	D	0.000036	T	0.18923	0.0454	L	0.36672	1.1	0.80722	D	1	D;D;D	0.76494	0.998;0.986;0.999	P;P;P	0.53649	0.731;0.648;0.676	T	0.00277	-1.1854	10	0.42905	T	0.14	-6.8485	11.3282	0.49460	0.1412:0.7227:0.1361:0.0	.	231;484;484	Q8NDV7-2;Q8NDV7-6;Q8NDV7	.;.;TNR6A_HUMAN	C	484	ENSP00000326900:R484C;ENSP00000379144:R484C	ENSP00000326900:R484C	R	+	1	0	TNRC6A	24708914	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.912000	0.56386	2.735000	0.93741	0.563000	0.77884	CGT		0.468	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847		Missense_Mutation
NF1	4763	genome.wustl.edu	37	17	29497010	29497010	+	Missense_Mutation	SNP	T	T	C	rs199474753		TCGA-13-1483-01	TCGA-13-1483-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr17:29497010T>C	ENST00000358273.4	+	5	964	c.581T>C	c.(580-582)cTg>cCg	p.L194P	NF1_ENST00000356175.3_Missense_Mutation_p.L194P|NF1_ENST00000431387.4_Missense_Mutation_p.L194P	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	194			L -> R (in NFNS; dbSNP:rs199474753). {ECO:0000269|PubMed:16380919}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.L194P(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAACGACTCCTGAAGGGTAAG	0.289			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(4)|Substitution - Missense(1)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)|ovary(1)	17	GRCh37	CM054014	NF1	M							63.0	63.0	63.0					17																	29497010		2203	4298	6501	26521136	SO:0001583	missense	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.581T>C	17.37:g.29497010T>C	ENSP00000351015:p.Leu194Pro		26521136	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	21.9	4.217150	0.79352	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175	D;D;D	0.81739	-1.53;-1.53;-1.53	5.59	5.59	0.84812	.	0.000000	0.64402	D	0.000001	D	0.89319	0.6681	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;0.999;0.997	D;D;D;D	0.91635	0.994;0.999;0.998;0.994	D	0.90579	0.4528	10	0.87932	D	0	.	15.7643	0.78114	0.0:0.0:0.0:1.0	.	194;194;194;194	P21359-2;P21359;Q14931;P21359-3	.;NF1_HUMAN;.;.	P	194	ENSP00000412921:L194P;ENSP00000351015:L194P;ENSP00000348498:L194P	ENSP00000348498:L194P	L	+	2	0	NF1	26521136	1.000000	0.71417	0.990000	0.47175	0.861000	0.49209	6.977000	0.76141	2.145000	0.66743	0.482000	0.46254	CTG		0.289	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		Missense_Mutation
ARMC4	55130	genome.wustl.edu	37	10	28228876	28228876	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1483-01	TCGA-13-1483-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr10:28228876T>A	ENST00000305242.5	-	14	2139	c.2047A>T	c.(2047-2049)Aat>Tat	p.N683Y	ARMC4_ENST00000537576.1_Missense_Mutation_p.N375Y|ARMC4_ENST00000545014.1_Missense_Mutation_p.N208Y	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	683					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.N683Y(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						TTCTCACTATTTAGGTTCTTG	0.443																																																1	Substitution - Missense(1)	ovary(1)	10											108.0	98.0	102.0					10																	28228876		2203	4300	6503	28268882	SO:0001583	missense	55130			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.2047A>T	10.37:g.28228876T>A	ENSP00000306410:p.Asn683Tyr		28268882	A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	ENST00000305242.5	37	CCDS7157.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	13.64	2.298683	0.40694	.	.	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000545014	D;D;D	0.93906	-3.31;-3.31;-3.31	5.62	5.62	0.85841	Armadillo-like helical (1);Armadillo-type fold (1);	0.331477	0.43260	D	0.000593	D	0.92616	0.7654	L	0.40543	1.245	0.80722	D	1	B;B	0.30482	0.232;0.281	B;B	0.42495	0.145;0.389	D	0.92141	0.5720	10	0.72032	D	0.01	-22.0273	14.94	0.70986	0.0:0.0:0.0:1.0	.	208;683	B7Z7I1;Q5T2S8	.;ARMC4_HUMAN	Y	375;683;208	ENSP00000443208:N375Y;ENSP00000306410:N683Y;ENSP00000441076:N208Y	ENSP00000306410:N683Y	N	-	1	0	ARMC4	28268882	0.857000	0.29778	0.007000	0.13788	0.009000	0.06853	6.444000	0.73452	2.266000	0.75297	0.533000	0.62120	AAT		0.443	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076		Missense_Mutation
FAM47C	442444	genome.wustl.edu	37	X	37027377	37027377	+	Silent	SNP	T	T	C			TCGA-13-1483-01	TCGA-13-1483-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chrX:37027377T>C	ENST00000358047.3	+	1	946	c.894T>C	c.(892-894)ccT>ccC	p.P298P		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	298								p.P298P(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						ATCGGGAGCCTCCTGAGACTG	0.597																																																1	Substitution - coding silent(1)	ovary(1)	X											79.0	69.0	72.0					X																	37027377		2202	4300	6502	36937298	SO:0001819	synonymous_variant	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.894T>C	X.37:g.37027377T>C			36937298	Q6ZU46	Silent	SNP	ENST00000358047.3	37	CCDS35227.1	SNP	54	WashU																																																																																				0.597	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		Silent
LGALS14	56891	genome.wustl.edu	37	19	40199901	40199901	+	Missense_Mutation	SNP	T	T	C	rs148265523	byFrequency	TCGA-13-1483-01	TCGA-13-1483-10	T	T	C	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr19:40199901T>C	ENST00000392052.3	+	4	591	c.368T>C	c.(367-369)aTg>aCg	p.M123T	LGALS14_ENST00000360675.3_Missense_Mutation_p.M152T	NM_020129.2	NP_064514.1	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14	123	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)	nucleus (GO:0005634)	carbohydrate binding (GO:0030246)	p.M152T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|stomach(2)	14	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)			TCTGTGAAGATGCTGCAAGTC	0.463													T|||	14	0.00279553	0.0106	0.0	5008	,	,		22626	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19						T	THR/MET,THR/MET	32,4374		0,32,2171	100.0	94.0	96.0		368,455	0.9	0.0	19	dbSNP_134	96	0,8600		0,0,4300	yes	missense,missense	LGALS14	NM_020129.2,NM_203471.1	81,81	0,32,6471	CC,CT,TT		0.0,0.7263,0.246	possibly-damaging,possibly-damaging	123/140,152/169	40199901	32,12974	2203	4300	6503	44891741	SO:0001583	missense	56891			AF267852	CCDS12542.1, CCDS46073.1	19q13.2	2014-03-19			ENSG00000006659	ENSG00000006659		"""Lectins, galactoside-binding"""	30054	protein-coding gene	gene with protein product		607260				11997112	Standard	NM_020129		Approved	PPL13, CLC2	uc002omg.3	Q8TCE9	OTTHUMG00000183143	ENST00000392052.3:c.368T>C	19.37:g.40199901T>C	ENSP00000375905:p.Met123Thr		44891741	A8MPV8|B2R530|C5HZ19|Q7Z4X8|Q96KD4|Q96KD5|Q96KD6|Q9NR03	Missense_Mutation	SNP	ENST00000392052.3	37	CCDS46073.1	SNP	51	WashU	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	.	0.415	-0.911218	0.02434	0.007263	0.0	ENSG00000006659	ENST00000392052;ENST00000360675	T;T	0.15603	2.41;2.41	0.902	0.902	0.19290	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.12347	0.0300	L	0.31926	0.97	0.09310	N	1	D;D	0.54397	0.966;0.966	P;P	0.56343	0.796;0.796	T	0.17167	-1.0378	9	0.15952	T	0.53	.	4.0373	0.09735	0.0:0.0:0.0:1.0	.	123;152	Q8TCE9;A8MPV8	PPL13_HUMAN;.	T	123;152	ENSP00000375905:M123T;ENSP00000353893:M152T	ENSP00000353893:M152T	M	+	2	0	LGALS14	44891741	0.023000	0.18921	0.003000	0.11579	0.017000	0.09413	0.248000	0.18198	0.653000	0.30826	0.260000	0.18958	ATG		0.463	LGALS14-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465222.1	NM_020129		Missense_Mutation
KANSL2	54934	genome.wustl.edu	37	12	49065713	49065713	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr12:49065713G>A	ENST00000420613.2	-	5	625	c.578C>T	c.(577-579)gCc>gTc	p.A193V	KANSL2_ENST00000357861.3_5'UTR|KANSL2_ENST00000553086.1_Missense_Mutation_p.A193V|KANSL2_ENST00000550347.1_Missense_Mutation_p.A376V	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	193					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)		p.A193V(1)									CATAATCAGGGCCACTTCTTC	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											95.0	91.0	92.0					12																	49065713		1885	4109	5994	47351980	SO:0001583	missense	54934			AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.578C>T	12.37:g.49065713G>A	ENSP00000415436:p.Ala193Val		47351980	Q8N3B5|Q96CV0|Q9NX51	Missense_Mutation	SNP	ENST00000420613.2	37	CCDS44869.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	13.98	2.399719	0.42512	.	.	ENSG00000139620	ENST00000550347;ENST00000420613;ENST00000553086;ENST00000550931	T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35	6.05	6.05	0.98169	.	0.049866	0.85682	D	0.000000	T	0.77212	0.4097	N	0.10760	0.04	0.80722	D	1	D;B	0.65815	0.995;0.217	P;B	0.56163	0.793;0.055	T	0.78109	-0.2332	10	0.34782	T	0.22	-23.3112	19.3727	0.94495	0.0:0.0:1.0:0.0	.	376;193	F8VX10;Q9H9L4	.;CL041_HUMAN	V	376;193;193;130	ENSP00000449747:A376V;ENSP00000415436:A193V;ENSP00000448833:A193V;ENSP00000448129:A130V	ENSP00000415436:A193V	A	-	2	0	C12orf41	47351980	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.682000	0.98655	2.878000	0.98634	0.650000	0.86243	GCC		0.383	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408841.1	NM_017822		Missense_Mutation
CIC	23152	genome.wustl.edu	37	19	42795131	42795131	+	Silent	SNP	C	C	A			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr19:42795131C>A	ENST00000575354.2	+	10	2251	c.2211C>A	c.(2209-2211)gcC>gcA	p.A737A	CIC_ENST00000160740.3_Silent_p.A737A|CIC_ENST00000572681.2_Silent_p.A1646A	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	737	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A737A(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CGGCAGCAGCCACCTCACCAG	0.647			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	1	Substitution - coding silent(1)	ovary(1)	19											29.0	31.0	30.0					19																	42795131		2202	4300	6502	47486971	SO:0001819	synonymous_variant	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.2211C>A	19.37:g.42795131C>A			47486971	Q7LGI1|Q9UEG5|Q9Y6T1	Silent	SNP	ENST00000575354.2	37	CCDS12601.1	SNP	21	WashU																																																																																				0.647	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			Silent
GPR115	221393	genome.wustl.edu	37	6	47682171	47682171	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1483-01	TCGA-13-1483-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr6:47682171C>T	ENST00000283303.2	+	6	1448	c.1190C>T	c.(1189-1191)aCc>aTc	p.T397I	GPR115_ENST00000327753.3_Missense_Mutation_p.T397I|RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000371220.1_Missense_Mutation_p.T454I	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	397					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T397I(1)		NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						AAATCGATGACCGACAAAGTT	0.478																																					GBM(22;431 510 9010 26644 32828)											1	Substitution - Missense(1)	ovary(1)	6											155.0	119.0	131.0					6																	47682171		2203	4300	6503	47790130	SO:0001583	missense	221393			AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.1190C>T	6.37:g.47682171C>T	ENSP00000283303:p.Thr397Ile		47790130	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	ENST00000283303.2	37	CCDS4922.2	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	2.065	-0.414522	0.04766	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.36878	1.23;1.23;1.23	5.26	-2.64	0.06114	.	2.053540	0.01487	N	0.016923	T	0.08133	0.0203	L	0.27053	0.805	0.09310	N	1	B	0.20459	0.045	B	0.18263	0.021	T	0.21930	-1.0231	10	0.46703	T	0.11	0.862	0.9009	0.01273	0.3701:0.1502:0.2886:0.1911	.	397	Q8IZF3	GP115_HUMAN	I	454;397;397	ENSP00000360264:T454I;ENSP00000328319:T397I;ENSP00000283303:T397I	ENSP00000283303:T397I	T	+	2	0	GPR115	47790130	0.001000	0.12720	0.000000	0.03702	0.045000	0.14185	0.802000	0.27069	-0.113000	0.11958	0.655000	0.94253	ACC		0.478	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838		Missense_Mutation
P4HTM	54681	genome.wustl.edu	37	3	49042491	49042491	+	Intron	SNP	C	C	A			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr3:49042491C>A	ENST00000383729.4	+	6	1444				WDR6_ENST00000608424.1_5'Flank|WDR6_ENST00000448293.1_5'Flank|WDR6_ENST00000395474.3_5'Flank|WDR6_ENST00000415265.2_5'Flank|P4HTM_ENST00000343546.4_Missense_Mutation_p.P362H	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	CAAGTATCTCCCAACTGGGGG	0.607																																																0			3											109.0	87.0	95.0					3																	49042491		2203	4300	6503	49017495	SO:0001627	intron_variant	54681				CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.1073+12C>A	3.37:g.49042491C>A			49017495	Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Missense_Mutation	SNP	ENST00000383729.4	37	CCDS43089.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	17.34	3.364190	0.61513	.	.	ENSG00000178467	ENST00000343546	.	.	.	5.0	0.835	0.18886	.	0.665977	0.12480	N	0.465259	T	0.29288	0.0729	.	.	.	0.09310	N	1	P	0.37276	0.589	B	0.43331	0.416	T	0.18209	-1.0344	7	.	.	.	.	4.9365	0.13943	0.0:0.4996:0.147:0.3534	.	362	Q9NXG6-3	.	H	362	.	.	P	+	2	0	P4HTM	49017495	0.000000	0.05858	0.162000	0.22713	0.380000	0.30137	-0.002000	0.12924	0.139000	0.18822	0.655000	0.94253	CCC		0.607	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157211.1	NM_177938		Missense_Mutation
SERPINE3	647174	genome.wustl.edu	37	13	51921247	51921247	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1483-01	TCGA-13-1483-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr13:51921247T>A	ENST00000521255.1	+	3	637	c.577T>A	c.(577-579)Tcc>Acc	p.S193T	SERPINE3_ENST00000524365.1_Missense_Mutation_p.S193T|SERPINE3_ENST00000400389.4_Missense_Mutation_p.S193T|MIR5693_ENST00000577722.1_RNA	NM_001101320.1	NP_001094790.1	A8MV23	SERP3_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 3	193					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S193T(1)		ovary(2)	2						GAGCACCATGTCCTTCCAAGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	13											116.0	113.0	114.0					13																	51921247		2083	4218	6301	50819248	SO:0001583	missense				AX772926	CCDS53870.1	13q14.3	2014-02-18			ENSG00000253309	ENSG00000253309		"""Serine (or cysteine) peptidase inhibitors"""	24774	protein-coding gene	gene with protein product						24172014	Standard	NM_001101320		Approved		uc001vfh.2	A8MV23	OTTHUMG00000016943	ENST00000521255.1:c.577T>A	13.37:g.51921247T>A	ENSP00000428316:p.Ser193Thr		50819248	B1V8P3	Missense_Mutation	SNP	ENST00000521255.1	37	CCDS53870.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	1.659	-0.511984	0.04200	.	.	ENSG00000253309	ENST00000524365;ENST00000521255;ENST00000400389	D;D;D	0.84223	-1.82;-1.82;-1.82	4.36	-1.84	0.07809	Serpin domain (3);	1.285740	0.05798	N	0.611746	T	0.75488	0.3856	N	0.20685	0.6	0.25535	N	0.987233	B;B	0.22080	0.051;0.064	B;B	0.19391	0.015;0.025	T	0.62627	-0.6814	10	0.72032	D	0.01	.	10.25	0.43364	0.6199:0.0:0.0:0.38	.	193;193	A8MV23-2;A8MV23	.;SERP3_HUMAN	T	193	ENSP00000430755:S193T;ENSP00000428316:S193T;ENSP00000441468:S193T	ENSP00000441468:S193T	S	+	1	0	SERPINE3	50819248	0.998000	0.40836	0.971000	0.41717	0.846000	0.48090	1.355000	0.34068	-0.462000	0.06984	-0.336000	0.08194	TCC		0.582	SERPINE3-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045021.2	NM_001101320		Missense_Mutation
ANKFN1	162282	genome.wustl.edu	37	17	54558087	54558087	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr17:54558087C>A	ENST00000318698.2	+	16	2043	c.2008C>A	c.(2008-2010)Cat>Aat	p.H670N	ANKFN1_ENST00000566473.2_Missense_Mutation_p.H670N	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	670								p.H670N(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						AAGTGTGGATCATACTTCTGA	0.408																																																1	Substitution - Missense(1)	ovary(1)	17											183.0	172.0	176.0					17																	54558087		2203	4300	6503	51913086	SO:0001583	missense	162282			AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.2008C>A	17.37:g.54558087C>A	ENSP00000321627:p.His670Asn		51913086		Missense_Mutation	SNP	ENST00000318698.2	37	CCDS32686.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	11.64	1.700243	0.30142	.	.	ENSG00000153930	ENST00000318698	T	0.21734	1.99	5.47	5.47	0.80525	.	0.337163	0.36591	N	0.002511	T	0.10937	0.0267	N	0.02916	-0.46	0.47476	D	0.999431	B	0.11235	0.004	B	0.04013	0.001	T	0.23797	-1.0178	10	0.17369	T	0.5	-12.2055	19.3291	0.94278	0.0:1.0:0.0:0.0	.	670	Q8N957	ANKF1_HUMAN	N	670	ENSP00000321627:H670N	ENSP00000321627:H670N	H	+	1	0	ANKFN1	51913086	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.414000	0.59802	2.553000	0.86117	0.655000	0.94253	CAT		0.408	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228		Missense_Mutation
KDR	3791	genome.wustl.edu	37	4	55971144	55971144	+	Silent	SNP	A	A	T			TCGA-13-1483-01	TCGA-13-1483-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr4:55971144A>T	ENST00000263923.4	-	13	1948	c.1653T>A	c.(1651-1653)ccT>ccA	p.P551P		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	551	Ig-like C2-type 6.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.P551P(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AAGTAATTTCAGGACCCCCTA	0.443			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																													Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	1	Substitution - coding silent(1)	ovary(1)	4											54.0	51.0	52.0					4																	55971144		2203	4300	6503	55665901	SO:0001819	synonymous_variant	3791			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1653T>A	4.37:g.55971144A>T			55665901	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	37	CCDS3497.1	SNP	7	WashU																																																																																				0.443	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1			Silent
CTNND1	1500	genome.wustl.edu	37	11	57573404	57573404	+	Silent	SNP	C	C	T			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr11:57573404C>T	ENST00000399050.4	+	10	2309	c.1773C>T	c.(1771-1773)caC>caT	p.H591H	CTNND1_ENST00000426142.2_Silent_p.H490H|CTNND1_ENST00000525902.1_Silent_p.H268H|CTNND1_ENST00000533667.1_Silent_p.H268H|CTNND1_ENST00000532245.1_Silent_p.H490H|CTNND1_ENST00000361796.4_Silent_p.H591H|CTNND1_ENST00000529873.1_Silent_p.H537H|CTNND1_ENST00000361391.6_Silent_p.H591H|CTNND1_ENST00000527467.1_Silent_p.H268H|CTNND1_ENST00000529526.1_Silent_p.H537H|CTNND1_ENST00000532844.1_Silent_p.H537H|CTNND1_ENST00000358694.6_Silent_p.H591H|CTNND1_ENST00000524630.1_Silent_p.H591H|CTNND1_ENST00000532463.1_Silent_p.H490H|CTNND1_ENST00000530094.1_Silent_p.H490H|CTNND1_ENST00000531014.1_Silent_p.H268H|CTNND1_ENST00000415361.2_Silent_p.H490H|CTNND1_ENST00000529986.1_Silent_p.H490H|CTNND1_ENST00000532787.1_Silent_p.H490H|CTNND1_ENST00000526938.1_Silent_p.H591H|CTNND1_ENST00000530748.1_Silent_p.H537H|CTNND1_ENST00000526772.1_Silent_p.H268H|CTNND1_ENST00000532649.1_Silent_p.H537H|CTNND1_ENST00000528621.1_Silent_p.H537H|CTNND1_ENST00000534579.1_Silent_p.H537H|CTNND1_ENST00000528232.1_Silent_p.H490H|CTNND1_ENST00000428599.2_Silent_p.H591H|CTNND1_ENST00000361332.4_Silent_p.H591H|CTNND1_ENST00000526357.1_Silent_p.H537H|CTNND1_ENST00000399039.4_Silent_p.H591H|CTNND1_ENST00000529919.1_Silent_p.H591H|CTNND1_ENST00000360682.6_Silent_p.H591H	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	591					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)	p.H591H(1)		breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				ATCAAGTTCACCGGGAGATCC	0.473																																																1	Substitution - coding silent(1)	ovary(1)	11											82.0	79.0	80.0					11																	57573404		1920	4127	6047	57329980	SO:0001819	synonymous_variant	1500			AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.1773C>T	11.37:g.57573404C>T			57329980	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Silent	SNP	ENST00000399050.4	37	CCDS44604.1	SNP	18	WashU																																																																																				0.473	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	NM_001331		Silent
ATG4C	84938	genome.wustl.edu	37	1	63329765	63329765	+	Missense_Mutation	SNP	C	C	A	rs35696652		TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr1:63329765C>A	ENST00000317868.4	+	11	1519	c.1312C>A	c.(1312-1314)Ctt>Att	p.L438I	ATG4C_ENST00000371120.3_Missense_Mutation_p.L438I	NM_032852.3	NP_116241.2	Q96DT6	ATG4C_HUMAN	autophagy related 4C, cysteine peptidase	438					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|protein targeting to membrane (GO:0006612)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)	p.L438I(1)	ATG4C/FBXO38(2)	NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(3)|ovary(1)|prostate(2)	19						TGAAGAAGACCTTTTTTCAGA	0.318																																																1	Substitution - Missense(1)	ovary(1)	1											62.0	66.0	65.0					1																	63329765		2202	4294	6496	63102353	SO:0001583	missense	84938			AK027773	CCDS623.1	1p31.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000125703	ENSG00000125703			16040	protein-coding gene	gene with protein product		611339	"""AUT (S. cerevisiae)-like 1, cysteine endopeptidase; AUT-like 1, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog C (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog C (S. cerevisiae)"""	AUTL1, APG4C		12446702	Standard	NM_032852		Approved	FLJ14867, AUTL3	uc001dau.3	Q96DT6	OTTHUMG00000009142	ENST00000317868.4:c.1312C>A	1.37:g.63329765C>A	ENSP00000322159:p.Leu438Ile		63102353	A6NLR8|D3DQ58|Q96K04	Missense_Mutation	SNP	ENST00000317868.4	37	CCDS623.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633359	0.47049	.	.	ENSG00000125703	ENST00000317868;ENST00000371120;ENST00000540025	T;T	0.70631	-0.5;-0.5	5.37	5.37	0.77165	.	0.058260	0.64402	D	0.000001	T	0.53738	0.1815	L	0.46157	1.445	0.43942	D	0.996608	P	0.39809	0.689	B	0.36378	0.223	T	0.56486	-0.7971	10	0.27082	T	0.32	-25.428	19.0979	0.93260	0.0:1.0:0.0:0.0	.	438	Q96DT6	ATG4C_HUMAN	I	438	ENSP00000322159:L438I;ENSP00000360161:L438I	ENSP00000322159:L438I	L	+	1	0	ATG4C	63102353	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.148000	0.31614	2.500000	0.84329	0.585000	0.79938	CTT		0.318	ATG4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025332.2	NM_032852		Missense_Mutation
LRIG1	26018	genome.wustl.edu	37	3	66436454	66436454	+	Silent	SNP	G	G	A			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr3:66436454G>A	ENST00000273261.3	-	13	2264	c.1740C>T	c.(1738-1740)acC>acT	p.T580T	LRIG1_ENST00000496559.2_5'UTR|SLC25A26_ENST00000536651.1_Intron|LRIG1_ENST00000383703.3_Silent_p.T604T	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	580	Ig-like C2-type 1.				innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)		p.T580T(1)		NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CAAAGTGGTTGGTGATGACAC	0.532																																																1	Substitution - coding silent(1)	ovary(1)	3											209.0	157.0	174.0					3																	66436454		2203	4300	6503	66519144	SO:0001819	synonymous_variant	26018			AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.1740C>T	3.37:g.66436454G>A			66519144	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Silent	SNP	ENST00000273261.3	37	CCDS33783.1	SNP	47	WashU																																																																																				0.532	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541		Silent
CTNNA3	29119	genome.wustl.edu	37	10	68940273	68940273	+	Silent	SNP	T	T	C			TCGA-13-1483-01	TCGA-13-1483-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr10:68940273T>C	ENST00000433211.2	-	7	1023	c.849A>G	c.(847-849)ttA>ttG	p.L283L	CTNNA3_ENST00000545309.1_Silent_p.L283L|CTNNA3_ENST00000373744.4_Silent_p.L283L	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.L283L(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TCAGGACAATTAAATTCTAAG	0.383																																																1	Substitution - coding silent(1)	ovary(1)	10											91.0	88.0	89.0					10																	68940273		2203	4300	6503	68610279	SO:0001819	synonymous_variant	29119			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.849A>G	10.37:g.68940273T>C			68610279		Silent	SNP	ENST00000433211.2	37	CCDS7269.1	SNP	61	WashU																																																																																				0.383	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266		Silent
ZNF638	27332	genome.wustl.edu	37	2	71577133	71577133	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1483-01	TCGA-13-1483-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr2:71577133G>A	ENST00000409544.1	+	2	1679	c.1049G>A	c.(1048-1050)cGg>cAg	p.R350Q	ZNF638_ENST00000377802.2_Missense_Mutation_p.R350Q|ZNF638_ENST00000264447.4_Missense_Mutation_p.R350Q|ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000355812.3_Missense_Mutation_p.R350Q	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	350					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R350Q(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						CAGCAAGAGCGGATCCCACAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											127.0	125.0	126.0					2																	71577133		2203	4300	6503	71430641	SO:0001583	missense	27332			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1049G>A	2.37:g.71577133G>A	ENSP00000386433:p.Arg350Gln		71430641	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	15.31	2.794284	0.50102	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.76316	-0.41;-1.01;0.14;-0.4;1.12;1.12	5.88	5.01	0.66863	.	0.171583	0.48767	N	0.000161	T	0.78457	0.4286	N	0.24115	0.695	0.28746	N	0.901724	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.77557	0.975;0.975;0.99;0.978;0.975	T	0.71899	-0.4453	10	0.34782	T	0.22	-2.9758	10.8697	0.46877	0.0862:0.0:0.9138:0.0	.	456;350;350;350;350	F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;ZN638_HUMAN;.	Q	350;456;350;350;350;350	ENSP00000386669:R350Q;ENSP00000438189:R456Q;ENSP00000348066:R350Q;ENSP00000367033:R350Q;ENSP00000264447:R350Q;ENSP00000386433:R350Q	ENSP00000264447:R350Q	R	+	2	0	ZNF638	71430641	0.661000	0.27430	0.643000	0.29450	0.683000	0.39861	1.989000	0.40707	1.490000	0.48466	0.655000	0.94253	CGG		0.418	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		Missense_Mutation
KIAA2022	340533	genome.wustl.edu	37	X	73963680	73963680	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1483-01	TCGA-13-1483-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chrX:73963680C>A	ENST00000055682.6	-	3	1323	c.712G>T	c.(712-714)Gca>Tca	p.A238S		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	238					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.A238S(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						AACAGTAATGCCTCATAATAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	X											163.0	150.0	155.0					X																	73963680		2203	4299	6502	73880405	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.712G>T	X.37:g.73963680C>A	ENSP00000055682:p.Ala238Ser		73880405	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	10.78	1.446016	0.25987	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.32515	1.45;1.45	5.97	4.21	0.49690	.	0.165665	0.53938	D	0.000054	T	0.18882	0.0453	N	0.14661	0.345	0.30893	N	0.730162	B	0.24823	0.112	B	0.23852	0.049	T	0.09037	-1.0693	10	0.35671	T	0.21	-1.9497	11.8929	0.52638	0.0:0.856:0.0:0.144	.	238	Q5QGS0	K2022_HUMAN	S	238	ENSP00000362567:A238S;ENSP00000055682:A238S	ENSP00000055682:A238S	A	-	1	0	KIAA2022	73880405	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.656000	0.61483	0.651000	0.30788	0.600000	0.82982	GCA		0.433	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		Missense_Mutation
MYCBP2	23077	genome.wustl.edu	37	13	77638760	77638760	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr13:77638760G>C	ENST00000544440.2	-	73	12565	c.12548C>G	c.(12547-12549)gCa>gGa	p.A4183G	MYCBP2_ENST00000407578.2_Missense_Mutation_p.A4221G|MYCBP2_ENST00000357337.6_Missense_Mutation_p.A4183G					MYC binding protein 2, E3 ubiquitin protein ligase									p.A4183G(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TCTAGTTGTTGCAATACATCT	0.338																																																1	Substitution - Missense(1)	ovary(1)	13											128.0	114.0	119.0					13																	77638760		2202	4300	6502	76536761	SO:0001583	missense	23077			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.12548C>G	13.37:g.77638760G>C	ENSP00000444596:p.Ala4183Gly		76536761		Missense_Mutation	SNP	ENST00000544440.2	37		SNP	46	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.089859|4.089859	0.76756|0.76756	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440|ENST00000429715	T;T;T|.	0.27890|.	1.64;1.64;1.64|.	5.93|5.93	5.93|5.93	0.95920|0.95920	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.48607|0.48607	0.1509|0.1509	N|N	0.08118|0.08118	0|0	0.58432|0.58432	D|D	0.999999|0.999999	P|.	0.46656|.	0.882|.	B|.	0.41236|.	0.351|.	T|T	0.42327|0.42327	-0.9458|-0.9458	10|5	0.49607|.	T|.	0.09|.	.|.	20.3539|20.3539	0.98825|0.98825	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	4183|.	O75592|.	MYCB2_HUMAN|.	G|W	4183;4221;4183|603	ENSP00000349892:A4183G;ENSP00000384288:A4221G;ENSP00000444596:A4183G|.	ENSP00000349892:A4183G|.	A|C	-|-	2|3	0|2	MYCBP2|MYCBP2	76536761|76536761	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.863000|7.863000	0.87023|0.87023	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	GCA|TGC		0.338	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		Missense_Mutation
PRUNE2	158471	genome.wustl.edu	37	9	79322617	79322617	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr9:79322617C>G	ENST00000376718.3	-	8	4696	c.4573G>C	c.(4573-4575)Gcc>Ccc	p.A1525P	PRUNE2_ENST00000428286.1_Missense_Mutation_p.A1166P	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1525					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.A1525P(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GACGAACCGGCTCCTGGAAGG	0.433																																																1	Substitution - Missense(1)	ovary(1)	9											54.0	50.0	51.0					9																	79322617		1568	3582	5150	78512437	SO:0001583	missense	158471			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.4573G>C	9.37:g.79322617C>G	ENSP00000365908:p.Ala1525Pro		78512437	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	SNP	28	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.15|15.15	2.747724|2.747724	0.49257|0.49257	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.48201|.	0.82;0.82|.	5.08|5.08	3.21|3.21	0.36854|0.36854	.|.	1.425270|.	0.04362|.	N|.	0.357615|.	T|T	0.39886|0.39886	0.1095|0.1095	L|L	0.51422|0.51422	1.61|1.61	0.09310|0.09310	N|N	0.999996|0.999996	P|.	0.37955|.	0.612|.	B|.	0.34722|.	0.188|.	T|T	0.25882|0.25882	-1.0119|-1.0119	10|5	0.44086|.	T|.	0.13|.	-1.076|-1.076	6.1684|6.1684	0.20404|0.20404	0.1513:0.6926:0.0:0.1561|0.1513:0.6926:0.0:0.1561	.|.	1525|.	Q8WUY3|.	PRUN2_HUMAN|.	P|T	1525;1166;1524|846	ENSP00000365908:A1525P;ENSP00000397425:A1166P|.	ENSP00000365908:A1525P|.	A|S	-|-	1|2	0|0	PRUNE2|PRUNE2	78512437|78512437	0.077000|0.077000	0.21312|0.21312	0.003000|0.003000	0.11579|0.11579	0.010000|0.010000	0.07245|0.07245	0.830000|0.830000	0.27462|0.27462	0.808000|0.808000	0.34231|0.34231	0.655000|0.655000	0.94253|0.94253	GCC|AGC		0.433	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818		Missense_Mutation
ELTD1	64123	genome.wustl.edu	37	1	79383653	79383653	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1483-01	TCGA-13-1483-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr1:79383653A>G	ENST00000370742.3	-	11	1607	c.1544T>C	c.(1543-1545)cTc>cCc	p.L515P		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	515					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.L515P(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		AATGAGATAGAGATGTATGCC	0.393																																																1	Substitution - Missense(1)	ovary(1)	1											144.0	135.0	138.0					1																	79383653		1878	4110	5988	79156241	SO:0001583	missense	64123			AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1544T>C	1.37:g.79383653A>G	ENSP00000359778:p.Leu515Pro		79156241	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	CCDS41352.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	22.7	4.329922	0.81690	.	.	ENSG00000162618	ENST00000370742	T	0.60171	0.21	6.08	6.08	0.98989	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.79173	0.4401	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84435	0.0579	9	.	.	.	.	16.6512	0.85203	1.0:0.0:0.0:0.0	.	515	Q9HBW9	ELTD1_HUMAN	P	515	ENSP00000359778:L515P	.	L	-	2	0	ELTD1	79156241	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.339000	0.96797	2.333000	0.79357	0.482000	0.46254	CTC		0.393	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159		Missense_Mutation
NTRK3	4916	genome.wustl.edu	37	15	88522597	88522597	+	Intron	SNP	G	G	A			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr15:88522597G>A	ENST00000360948.2	-	14	1747				NTRK3_ENST00000394480.2_Intron|NTRK3_ENST00000540489.2_Silent_p.S606S|NTRK3_ENST00000557856.1_Intron|NTRK3_ENST00000357724.2_Intron|NTRK3_ENST00000558306.1_5'UTR|NTRK3_ENST00000558676.1_Intron|NTRK3_ENST00000355254.2_Intron|NTRK3_ENST00000542733.2_Intron|NTRK3_ENST00000317501.3_Silent_p.S606S	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3						activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GACGTCCTTTGCTGAAATAAA	0.433			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0			15											125.0	122.0	123.0					15																	88522597		2201	4299	6500	86323601	SO:0001627	intron_variant	4916			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1586-38613C>T	15.37:g.88522597G>A			86323601	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	37	CCDS32322.1	SNP	46	WashU																																																																																				0.433	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				Silent
HSP90AB3P	3327	genome.wustl.edu	37	4	88814923	88814923	+	IGR	SNP	C	C	A			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr4:88814923C>A								MEPE (46954 upstream) : SPP1 (81895 downstream)																							AAGGCTGAGGCCGACAAGAAT	0.562																																																0			4																																								89033947	SO:0001628	intergenic_variant																																4.37:g.88814923C>A			89033947		Missense_Mutation	SNP		37		SNP	26	WashU																																																																																			0	0.562									Missense_Mutation
PRKRIP1	79706	genome.wustl.edu	37	7	102040048	102040048	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr7:102040048C>T	ENST00000496391.1	+	7	1569	c.259C>T	c.(259-261)Cgg>Tgg	p.R87W	PRKRIP1_ENST00000462601.1_Missense_Mutation_p.R30W|PRKRIP1_ENST00000354783.4_Missense_Mutation_p.R49W|PRKRIP1_ENST00000482465.1_3'UTR|PRKRIP1_ENST00000397912.3_Missense_Mutation_p.R87W			Q9H875	PKRI1_HUMAN	PRKR interacting protein 1 (IL11 inducible)	87	Required for RNA-binding. {ECO:0000250}.				negative regulation of phosphorylation (GO:0042326)|negative regulation of protein kinase activity (GO:0006469)|renal system process (GO:0003014)	extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.R87W(1)		endometrium(1)|lung(4)|ovary(1)	6						ACATCTGCGCCGGAGAGAATA	0.542																																																1	Substitution - Missense(1)	ovary(1)	7											113.0	107.0	109.0					7																	102040048		2203	4300	6503	101827053	SO:0001583	missense	79706			AK023964	CCDS34714.1	7q22.1	2013-01-09			ENSG00000128563	ENSG00000128563		"""Zinc fingers, C2H2-type"", ""-"""	21894	protein-coding gene	gene with protein product	"""likely ortholog of mouse C114 dsRNA-binding protein"", ""KRAB box domain containing 3"""					12679338	Standard	NM_024653		Approved	C114, FLJ13902, KRBOX3	uc003uzh.2	Q9H875	OTTHUMG00000157717	ENST00000496391.1:c.259C>T	7.37:g.102040048C>T	ENSP00000419270:p.Arg87Trp		101827053	B4DGM2|Q8NDM6|Q96CF8	Missense_Mutation	SNP	ENST00000496391.1	37	CCDS34714.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	c	22.6	4.307976	0.81247	.	.	ENSG00000128563	ENST00000496391;ENST00000462601;ENST00000397912;ENST00000354783	T;T;T;T	0.60424	0.19;0.19;0.19;0.19	6.13	3.31	0.37934	.	0.050417	0.85682	D	0.000000	T	0.75583	0.3869	M	0.86953	2.85	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.991;0.983;0.997	T	0.75277	-0.3374	10	0.72032	D	0.01	-18.6997	8.4346	0.32780	0.2766:0.6513:0.0:0.0721	.	49;30;87	B4DGM2;E9PC43;Q9H875	.;.;PKRI1_HUMAN	W	87;30;87;49	ENSP00000419270:R87W;ENSP00000420136:R30W;ENSP00000381010:R87W;ENSP00000346837:R49W	ENSP00000346837:R49W	R	+	1	2	PRKRIP1	101827053	0.997000	0.39634	0.892000	0.35008	0.996000	0.88848	3.795000	0.55499	0.448000	0.26722	-0.194000	0.12790	CGG		0.542	PRKRIP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349489.1	NM_024653		Missense_Mutation
ZNF462	58499	genome.wustl.edu	37	9	109689721	109689721	+	Silent	SNP	G	G	A			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr9:109689721G>A	ENST00000277225.5	+	3	3817	c.3528G>A	c.(3526-3528)ctG>ctA	p.L1176L	ZNF462_ENST00000457913.1_Silent_p.L1176L|ZNF462_ENST00000441147.2_Silent_p.L21L			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1176					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L1176L(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TACAACAGCTGAACCGAAGCA	0.572																																																1	Substitution - coding silent(1)	ovary(1)	9											121.0	129.0	127.0					9																	109689721		2203	4300	6503	108729542	SO:0001819	synonymous_variant	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3528G>A	9.37:g.109689721G>A			108729542	Q5T0T4|Q8N408	Silent	SNP	ENST00000277225.5	37	CCDS35096.1	SNP	45	WashU																																																																																				0.572	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224		Silent
IL36A	27179	genome.wustl.edu	37	2	113765446	113765446	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr2:113765446C>T	ENST00000259211.6	+	4	713	c.302C>T	c.(301-303)cCt>cTt	p.P101L		NM_014440.1	NP_055255.1	Q9UHA7	IL36A_HUMAN	interleukin 36, alpha	101					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)	p.P101L(1)		large_intestine(1)|lung(3)|ovary(2)|skin(1)|stomach(2)	9						CAACCCGAGCCTGTGAAGTCC	0.478																																																1	Substitution - Missense(1)	ovary(1)	2											128.0	123.0	124.0					2																	113765446		1925	4134	6059	113481917	SO:0001583	missense	27179			AF201831	CCDS42734.1	2q12-q14.1	2011-07-14	2011-06-06	2011-06-06	ENSG00000136694	ENSG00000136694		"""Interleukins and interleukin receptors"""	15562	protein-coding gene	gene with protein product		605509	"""interleukin 1 family, member 6 (epsilon)"""	IL1F6		10625660	Standard	XM_005263639		Approved	FIL1, FIL1E, IL-1F6, IL1(EPSILON), MGC129553, MGC129552	uc010yxr.2	Q9UHA7	OTTHUMG00000153320	ENST00000259211.6:c.302C>T	2.37:g.113765446C>T	ENSP00000259211:p.Pro101Leu		113481917	B2RAD9|Q53SR7|Q5BLR4|Q7RTZ8	Missense_Mutation	SNP	ENST00000259211.6	37	CCDS42734.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396788	0.62177	.	.	ENSG00000136694	ENST00000259211	T	0.16324	2.35	4.78	2.89	0.33648	.	0.426875	0.19699	N	0.108092	T	0.25082	0.0609	L	0.46741	1.465	0.09310	N	1	D	0.58970	0.984	P	0.58873	0.847	T	0.05209	-1.0899	10	0.32370	T	0.25	-28.5125	7.7434	0.28853	0.1849:0.6365:0.1786:0.0	.	101	Q9UHA7	IL36A_HUMAN	L	101	ENSP00000259211:P101L	ENSP00000259211:P101L	P	+	2	0	IL36A	113481917	0.003000	0.15002	0.001000	0.08648	0.421000	0.31385	1.125000	0.31332	0.530000	0.28619	0.591000	0.81541	CCT		0.478	IL36A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330711.1	NM_014440		Missense_Mutation
PVRL1	5818	genome.wustl.edu	37	11	119545333	119545333	+	Intron	SNP	C	C	T			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr11:119545333C>T	ENST00000264025.3	-	5	1534				PVRL1_ENST00000340882.2_Missense_Mutation_p.G343D|PVRL1_ENST00000524510.1_5'Flank|PVRL1_ENST00000341398.2_Intron	NM_002855.4	NP_002846.3	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)						adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		CCTCCCTTTGCCCGGATAGAT	0.527																																																0			11											295.0	272.0	280.0					11																	119545333		2199	4295	6494	119050543	SO:0001627	intron_variant	5818			X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000264025.3:c.1003+535G>A	11.37:g.119545333C>T			119050543	O75465|Q2M3D3|Q9HBE6|Q9HBW2	Missense_Mutation	SNP	ENST00000264025.3	37	CCDS8426.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	10.20	1.284089	0.23392	.	.	ENSG00000110400	ENST00000340882	T	0.74526	-0.85	3.76	2.85	0.33270	.	.	.	.	.	T	0.57446	0.2054	.	.	.	0.09310	N	1	P	0.38167	0.621	B	0.39904	0.313	T	0.43147	-0.9409	8	0.12430	T	0.62	.	7.1703	0.25715	0.0:0.8793:0.0:0.1207	.	343	Q15223-3	.	D	343	ENSP00000345289:G343D	ENSP00000345289:G343D	G	-	2	0	PVRL1	119050543	0.000000	0.05858	0.030000	0.17652	0.274000	0.26718	-0.362000	0.07602	1.184000	0.42957	0.655000	0.94253	GGC		0.527	PVRL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388231.1			Missense_Mutation
TPT1P9	389787	genome.wustl.edu	37	9	120845175	120845175	+	IGR	SNP	G	G	T			TCGA-13-1483-01	TCGA-13-1483-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr9:120845175G>T								RP11-281A20.1 (185641 upstream) : RP11-349E4.1 (604854 downstream)																							CATCCCTAAAGAAAATCATAT	0.373																																																0			9																																								119884996	SO:0001628	intergenic_variant	0																															9.37:g.120845175G>T			119884996		Missense_Mutation	SNP		37		SNP	33	WashU																																																																																			0	0.373									Missense_Mutation
PLA1A	51365	genome.wustl.edu	37	3	119343985	119343985	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr3:119343985G>T	ENST00000273371.4	+	9	1099	c.1027G>T	c.(1027-1029)Gtg>Ttg	p.V343L	PLA1A_ENST00000495992.1_Missense_Mutation_p.V327L|PLA1A_ENST00000488919.1_Missense_Mutation_p.V170L|PLA1A_ENST00000494440.1_Missense_Mutation_p.V327L	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	343					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)	p.V343L(1)		NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TCACAGCCTCGTGGAGTTTCA	0.493																																																1	Substitution - Missense(1)	ovary(1)	3											167.0	131.0	143.0					3																	119343985		2203	4300	6503	120826675	SO:0001583	missense	51365			AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.1027G>T	3.37:g.119343985G>T	ENSP00000273371:p.Val343Leu		120826675	B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	ENST00000273371.4	37	CCDS2991.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632844	0.47049	.	.	ENSG00000144837	ENST00000273371;ENST00000488919;ENST00000495992;ENST00000494440	D;D;D;D	0.94376	-2.81;-3.41;-2.79;-2.89	4.56	4.56	0.56223	.	0.189093	0.45361	D	0.000373	D	0.90017	0.6883	L	0.36672	1.1	0.40099	D	0.97634	P;B	0.36086	0.536;0.401	B;B	0.38842	0.283;0.147	D	0.89205	0.3560	10	0.32370	T	0.25	-12.6915	15.6546	0.77124	0.0:0.0:1.0:0.0	.	327;343	Q53H76-3;Q53H76	.;PLA1A_HUMAN	L	343;170;327;327	ENSP00000273371:V343L;ENSP00000420625:V170L;ENSP00000417326:V327L;ENSP00000418793:V327L	ENSP00000273371:V343L	V	+	1	0	PLA1A	120826675	0.999000	0.42202	0.996000	0.52242	0.970000	0.65996	3.256000	0.51492	2.545000	0.85829	0.655000	0.94253	GTG		0.493	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355252.2			Missense_Mutation
FBN2	2201	genome.wustl.edu	37	5	127854986	127854986	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr5:127854986G>T	ENST00000508053.1	-	11	1582	c.608C>A	c.(607-609)aCt>aAt	p.T203N	FBN2_ENST00000508989.1_Missense_Mutation_p.T170N|FBN2_ENST00000262464.4_Missense_Mutation_p.T203N			P35556	FBN2_HUMAN	fibrillin 2	203	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.T203N(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CTGTGGACCAGTGAACCCATA	0.378																																																1	Substitution - Missense(1)	ovary(1)	5											80.0	77.0	78.0					5																	127854986		2203	4300	6503	127882885	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.608C>A	5.37:g.127854986G>T	ENSP00000424571:p.Thr203Asn		127882885	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333888	0.81801	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989;ENST00000502468	D;D;D;T	0.92397	-3.03;-3.03;-3.03;-1.14	5.17	5.17	0.71159	Matrix fibril-associated (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000001	D	0.96470	0.8848	M	0.84433	2.695	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.998;0.998	D;D;D;D	0.85130	0.997;0.997;0.987;0.987	D	0.96149	0.9106	10	0.54805	T	0.06	.	18.8636	0.92282	0.0:0.0:1.0:0.0	.	170;203;170;203	P35556-2;E9PHW4;D6RJI3;P35556	.;.;.;FBN2_HUMAN	N	203;203;170;203	ENSP00000262464:T203N;ENSP00000424571:T203N;ENSP00000425596:T170N;ENSP00000424753:T203N	ENSP00000262464:T203N	T	-	2	0	FBN2	127882885	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.474000	0.97718	2.861000	0.98227	0.655000	0.94253	ACT		0.378	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		Missense_Mutation
DARS	1615	genome.wustl.edu	37	2	136741009	136741009	+	Silent	SNP	T	T	G			TCGA-13-1483-01	TCGA-13-1483-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr2:136741009T>G	ENST00000264161.4	-	2	297	c.82A>C	c.(82-84)Aga>Cga	p.R28R	AC093391.2_ENST00000438432.1_RNA|AC093391.2_ENST00000444406.1_RNA|AC093391.2_ENST00000419808.1_RNA|AC093391.2_ENST00000446492.1_RNA|DARS_ENST00000537273.1_Intron|DARS_ENST00000463008.1_5'Flank	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	28					aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.R28R(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	ATTCCATATCTCTCTTTAGCA	0.294																																																1	Substitution - coding silent(1)	ovary(1)	2											75.0	72.0	73.0					2																	136741009		2200	4292	6492	136457479	SO:0001819	synonymous_variant	1615			J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.82A>C	2.37:g.136741009T>G			136457479	A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Silent	SNP	ENST00000264161.4	37	CCDS2180.1	SNP	54	WashU																																																																																				0.294	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349		Silent
USP38	84640	genome.wustl.edu	37	4	144135702	144135702	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1483-01	TCGA-13-1483-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr4:144135702A>G	ENST00000307017.4	+	9	3079	c.2573A>G	c.(2572-2574)tAc>tGc	p.Y858C	USP38_ENST00000510377.1_Missense_Mutation_p.Y858C	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	858	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.Y858C(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					AGTGGGCATTACTATTCTTAT	0.438																																																1	Substitution - Missense(1)	ovary(1)	4											95.0	88.0	90.0					4																	144135702		2203	4300	6503	144355152	SO:0001583	missense	84640			AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.2573A>G	4.37:g.144135702A>G	ENSP00000303434:p.Tyr858Cys		144355152	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	ENST00000307017.4	37	CCDS3758.1	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	18.46	3.628820	0.67015	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	D;D	0.92446	-3.04;-3.04	5.48	5.48	0.80851	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.97688	0.9242	H	0.97874	4.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99293	1.0899	10	0.87932	D	0	-4.8064	15.8623	0.79035	1.0:0.0:0.0:0.0	.	858;858	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	C	858	ENSP00000427647:Y858C;ENSP00000303434:Y858C	ENSP00000303434:Y858C	Y	+	2	0	USP38	144355152	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.056000	0.93881	2.205000	0.71048	0.482000	0.46254	TAC		0.438	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557		Missense_Mutation
LATS1	9113	genome.wustl.edu	37	6	150004708	150004708	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr6:150004708G>C	ENST00000543571.1	-	4	2064	c.1517C>G	c.(1516-1518)cCa>cGa	p.P506R	LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_Missense_Mutation_p.P506R|LATS1_ENST00000392273.3_Missense_Mutation_p.P506R	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1									p.P506R(1)		central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		CTGTAGCTCTGGTTTTAATAC	0.453																																																1	Substitution - Missense(1)	ovary(1)	6											135.0	139.0	137.0					6																	150004708		2203	4300	6503	150046401	SO:0001583	missense	9113			AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.1517C>G	6.37:g.150004708G>C	ENSP00000437550:p.Pro506Arg		150046401		Missense_Mutation	SNP	ENST00000543571.1	37	CCDS34551.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	19.38	3.815854	0.70912	.	.	ENSG00000131023	ENST00000543571;ENST00000253339;ENST00000392273	T;T;T	0.58060	0.36;0.36;2.85	5.53	5.53	0.82687	.	0.000000	0.64402	D	0.000019	T	0.68256	0.2981	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.997	D;D;D	0.91635	0.98;0.999;0.98	T	0.65520	-0.6148	9	.	.	.	.	19.8134	0.96556	0.0:0.0:1.0:0.0	.	358;506;506	Q59FN4;O95835-2;O95835	.;.;LATS1_HUMAN	R	506	ENSP00000437550:P506R;ENSP00000253339:P506R;ENSP00000444678:P506R	.	P	-	2	0	LATS1	150046401	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.420000	0.97426	2.767000	0.95098	0.655000	0.94253	CCA		0.453	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690		Missense_Mutation
PCMT1	5110	genome.wustl.edu	37	6	150092350	150092350	+	Silent	SNP	C	C	T			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr6:150092350C>T	ENST00000367380.5	+	2	315	c.108C>T	c.(106-108)gaC>gaT	p.D36D	PCMT1_ENST00000464889.1_Silent_p.D94D|PCMT1_ENST00000367378.1_Silent_p.D94D|PCMT1_ENST00000544496.1_Intron|PCMT1_ENST00000367384.2_Silent_p.D94D	NM_001252049.1|NM_001252050.1|NM_001252051.1|NM_001252052.1|NM_005389.2	NP_001238978.1|NP_001238979.1|NP_001238980.1|NP_001238981.1|NP_005380.2	P22061	PIMT_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase	36					protein methylation (GO:0006479)|protein repair (GO:0030091)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.D36D(1)		kidney(1)|large_intestine(2)|lung(4)|ovary(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		TGGCTACAGACCGCTCCCACT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	6											100.0	95.0	96.0					6																	150092350		2203	4300	6503	150134043	SO:0001819	synonymous_variant	5110				CCDS5219.1, CCDS5219.2, CCDS59041.1, CCDS75533.1, CCDS75534.1	6q22.3-q24	2008-02-05			ENSG00000120265	ENSG00000120265	2.1.1.77		8728	protein-coding gene	gene with protein product		176851				1478665, 10343128	Standard	NM_005389		Approved		uc003qne.3	P22061	OTTHUMG00000015794	ENST00000367380.5:c.108C>T	6.37:g.150092350C>T			150134043	A8K109|J3KP72|Q14661|Q16556|Q5VYC1|Q5VYC2|Q93061|Q96II9|Q99625|Q9BQV7|Q9BQV8|Q9NP03	Silent	SNP	ENST00000367380.5	37		SNP	18	WashU																																																																																				0.348	PCMT1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				Silent
IYD	389434	genome.wustl.edu	37	6	150710532	150710532	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1483-01	TCGA-13-1483-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr6:150710532C>A	ENST00000344419.3	+	2	363	c.223C>A	c.(223-225)Ccc>Acc	p.P75T	IYD_ENST00000500320.3_Missense_Mutation_p.P75T|IYD_ENST00000392256.2_Missense_Mutation_p.P75T|IYD_ENST00000392255.3_Missense_Mutation_p.P75T|IYD_ENST00000229447.5_Missense_Mutation_p.P75T|IYD_ENST00000425615.3_Missense_Mutation_p.P20T	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	75					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)	p.P75T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		TGAACACATCCCCTTCTCTCA	0.373																																																1	Substitution - Missense(1)	ovary(1)	6											85.0	81.0	83.0					6																	150710532		2203	4300	6503	150752225	SO:0001583	missense	389434			AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.223C>A	6.37:g.150710532C>A	ENSP00000343763:p.Pro75Thr		150752225	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Missense_Mutation	SNP	ENST00000344419.3	37	CCDS5227.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	14.61	2.587909	0.46110	.	.	ENSG00000009765	ENST00000229447;ENST00000344419;ENST00000392256;ENST00000392255;ENST00000500320;ENST00000425615	D;T;D;D;D;D	0.90620	-2.62;-0.99;-2.57;-2.7;-2.61;-2.31	5.4	4.53	0.55603	.	0.112873	0.64402	D	0.000009	D	0.89701	0.6791	M	0.71581	2.175	0.58432	D	0.999997	P;B;P	0.44986	0.847;0.428;0.625	P;B;B	0.47118	0.538;0.126;0.259	D	0.90644	0.4577	10	0.59425	D	0.04	-3.6699	16.3215	0.82952	0.0:0.8677:0.1323:0.0	.	75;75;75	C9JFW2;Q6PHW0-3;Q6PHW0	.;.;IYD1_HUMAN	T	75;75;75;75;75;20	ENSP00000229447:P75T;ENSP00000343763:P75T;ENSP00000376085:P75T;ENSP00000376084:P75T;ENSP00000441276:P75T;ENSP00000390081:P20T	ENSP00000229447:P75T	P	+	1	0	IYD	150752225	0.998000	0.40836	0.176000	0.23000	0.026000	0.11368	4.061000	0.57485	1.504000	0.48704	0.555000	0.69702	CCC		0.373	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043754.3	NM_203395		Missense_Mutation
CCT8L1P	155100	genome.wustl.edu	37	7	152143516	152143516	+	IGR	SNP	T	T	A			TCGA-13-1483-01	TCGA-13-1483-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr7:152143516T>A								FABP5P3 (3244 upstream) : LINC01003 (17354 downstream)														p.S319T(1)									TCAGGCTAGGTCTCGGATGGA	0.592																																																1	Substitution - Missense(1)	ovary(1)	7											273.0	237.0	249.0					7																	152143516		2203	4300	6503	151774449	SO:0001628	intergenic_variant	155100																															7.37:g.152143516T>A			151774449		Missense_Mutation	SNP		37		SNP	58	WashU																																																																																			0	0.592									Missense_Mutation
ITLN2	142683	genome.wustl.edu	37	1	160920393	160920393	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1483-01	TCGA-13-1483-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr1:160920393T>C	ENST00000368029.3	-	5	607	c.550A>G	c.(550-552)Aac>Gac	p.N184D	ITLN2_ENST00000494442.1_5'UTR|RP11-544M22.1_ENST00000356006.3_RNA	NM_080878.2	NP_543154.1	Q8WWU7	ITLN2_HUMAN	intelectin 2	184	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.N184D(1)		endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	19	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			AAGCCAGTGTTGGTGCGGTAC	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											166.0	146.0	152.0					1																	160920393		2203	4300	6503	159187017	SO:0001583	missense	142683			AY065973	CCDS1212.1	1q22-q23.5	2013-02-06			ENSG00000158764	ENSG00000158764		"""Fibrinogen C domain containing"""	20599	protein-coding gene	gene with protein product		609874				11181563	Standard	NM_080878		Approved	HL-2	uc001fxd.3	Q8WWU7	OTTHUMG00000028605	ENST00000368029.3:c.550A>G	1.37:g.160920393T>C	ENSP00000357008:p.Asn184Asp		159187017	Q17RR2|Q5VYI0	Missense_Mutation	SNP	ENST00000368029.3	37	CCDS1212.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	C	6.320	0.427210	0.11987	.	.	ENSG00000158764	ENST00000368029	T	0.14391	2.51	4.47	-8.93	0.00771	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	1.119930	0.07029	N	0.828147	T	0.02193	0.0068	L	0.53729	1.69	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.40776	-0.9545	10	0.12766	T	0.61	-2.4732	3.0571	0.06188	0.3172:0.4121:0.1025:0.1682	.	183;184	A6NI51;Q8WWU7	.;ITLN2_HUMAN	D	184	ENSP00000357008:N184D	ENSP00000357008:N184D	N	-	1	0	ITLN2	159187017	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.263000	0.02850	-2.082000	0.00868	-1.322000	0.01289	AAC		0.567	ITLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071465.1	NM_080878		Missense_Mutation
PVRL4	81607	genome.wustl.edu	37	1	161042552	161042552	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1483-01	TCGA-13-1483-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr1:161042552T>C	ENST00000368012.3	-	9	1734	c.1432A>G	c.(1432-1434)Atc>Gtc	p.I478V	PVRL4_ENST00000453926.2_Missense_Mutation_p.I187V|ARHGAP30_ENST00000368015.1_5'Flank|PVRL4_ENST00000486694.1_5'UTR|ARHGAP30_ENST00000368013.3_5'Flank	NM_030916.2	NP_112178.2	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4	478					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I478V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|urinary_tract(1)	20	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GCCTGTTTGATGCCTTCATCC	0.567																																					NSCLC(76;1160 1387 14476 16172 29359)											1	Substitution - Missense(1)	ovary(1)	1											169.0	143.0	152.0					1																	161042552		2203	4300	6503	159309176	SO:0001583	missense	81607			AF426163	CCDS1216.1	1q22-q23.2	2013-01-14			ENSG00000143217	ENSG00000143217		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19688	protein-coding gene	gene with protein product		609607				11544254	Standard	NM_030916		Approved	nectin-4, PRR4, LNIR	uc001fxo.2	Q96NY8	OTTHUMG00000031475	ENST00000368012.3:c.1432A>G	1.37:g.161042552T>C	ENSP00000356991:p.Ile478Val		159309176	B4DQW3|Q96K15	Missense_Mutation	SNP	ENST00000368012.3	37	CCDS1216.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	18.21	3.572732	0.65765	.	.	ENSG00000143217	ENST00000368012;ENST00000453926	T;T	0.48522	0.81;1.18	4.85	4.85	0.62838	.	0.000000	0.48767	D	0.000180	T	0.36799	0.0980	N	0.19112	0.55	0.34776	D	0.734197	P;P;P	0.48640	0.518;0.699;0.913	P;P;P	0.61592	0.456;0.768;0.891	T	0.33343	-0.9872	10	0.33940	T	0.23	.	12.4413	0.55627	0.0:0.0:0.0:1.0	.	187;132;478	B4DQW3;B4DWD4;Q96NY8	.;.;PVRL4_HUMAN	V	478;187	ENSP00000356991:I478V;ENSP00000406015:I187V	ENSP00000356991:I478V	I	-	1	0	PVRL4	159309176	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.760000	0.62235	2.026000	0.59711	0.533000	0.62120	ATC		0.567	PVRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077074.1	NM_030916		Missense_Mutation
RANBP17	64901	genome.wustl.edu	37	5	170341194	170341194	+	Missense_Mutation	SNP	G	G	C	rs183823072		TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr5:170341194G>C	ENST00000523189.1	+	8	948	c.784G>C	c.(784-786)Gat>Cat	p.D262H		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	262					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.D262H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGAAACATTGGATCTTTTCTT	0.299			T	TRD@	ALL																																		Dom	yes		5	5q34	64901	RAN binding protein 17		L	1	Substitution - Missense(1)	ovary(1)	5											81.0	84.0	83.0					5																	170341194		2201	4293	6494	170273772	SO:0001583	missense	64901			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.784G>C	5.37:g.170341194G>C	ENSP00000427975:p.Asp262His		170273772	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	SNP	41	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	14.55|14.55	2.568453|2.568453	0.45798|0.45798	.|.	.|.	ENSG00000204764|ENSG00000204764	ENST00000523189;ENST00000545246|ENST00000522734	T|.	0.68479|.	-0.33|.	5.33|5.33	4.46|4.46	0.54185|0.54185	Armadillo-type fold (1);|.	0.198836|.	0.35870|.	N|.	0.002936|.	T|T	0.53769|0.53769	0.1817|0.1817	L|L	0.40543|0.40543	1.245|1.245	0.41484|0.41484	D|D	0.988188|0.988188	B|.	0.12630|.	0.006|.	B|.	0.12837|.	0.008|.	T|T	0.50775|0.50775	-0.8788|-0.8788	10|5	0.48119|.	T|.	0.1|.	-7.5372|-7.5372	9.5148|9.5148	0.39098|0.39098	0.0763:0.1428:0.7809:0.0|0.0763:0.1428:0.7809:0.0	.|.	262|.	Q9H2T7|.	RBP17_HUMAN|.	H|A	262;158|44	ENSP00000427975:D262H|.	ENSP00000373770:D262H|.	D|G	+|+	1|2	0|0	RANBP17|RANBP17	170273772|170273772	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	4.990000|4.990000	0.63876|0.63876	1.383000|1.383000	0.46405|0.46405	0.561000|0.561000	0.74099|0.74099	GAT|GGA		0.299	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897		Missense_Mutation
PPP1R12B	4660	genome.wustl.edu	37	1	202406959	202406959	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr1:202406959G>T	ENST00000608999.1	+	10	1418	c.1265G>T	c.(1264-1266)gGc>gTc	p.G422V	PPP1R12B_ENST00000356764.2_Missense_Mutation_p.W384C|RP11-175B9.2_ENST00000602961.1_RNA|PPP1R12B_ENST00000336894.4_Missense_Mutation_p.G422V|PPP1R12B_ENST00000480184.1_Missense_Mutation_p.G422V	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	422					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)	p.G422V(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			TTCTCTTCTGGCCTTTTTAAC	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											41.0	43.0	42.0					1																	202406959		2203	4300	6503	200673582	SO:0001583	missense	4660			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.1265G>T	1.37:g.202406959G>T	ENSP00000476755:p.Gly422Val		200673582	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Missense_Mutation	SNP	ENST00000608999.1	37	CCDS1426.1	SNP	42	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.44|11.44	1.639607|1.639607	0.29157|0.29157	.|.	.|.	ENSG00000077157|ENSG00000077157	ENST00000406302;ENST00000336894;ENST00000480184|ENST00000356764	T;T;T|T	0.69435|0.67523	1.06;1.08;-0.4|-0.27	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.294801|.	0.29868|.	N|.	0.010990|.	T|T	0.61375|0.61375	0.2342|0.2342	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B;B;B|B	0.31383|0.02656	0.002;0.034;0.321|0.0	B;B;B|B	0.28139|0.01281	0.0;0.02;0.086|0.0	T|T	0.57768|0.57768	-0.7754|-0.7754	9|8	0.38643|0.59425	T|D	0.18|0.04	.|.	16.1554|16.1554	0.81664|0.81664	0.0:0.1332:0.8668:0.0|0.0:0.1332:0.8668:0.0	.|.	422;422;422|384	O60237;F8W8M3;Q2TAI8|O60237-2	MYPT2_HUMAN;.;.|.	V|C	422|384	ENSP00000384496:G422V;ENSP00000337897:G422V;ENSP00000417159:G422V|ENSP00000349206:W384C	ENSP00000337897:G422V|ENSP00000349206:W384C	G|W	+|+	2|3	0|0	PPP1R12B|PPP1R12B	200673582|200673582	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.660000|0.660000	0.38997|0.38997	4.556000|4.556000	0.60775|0.60775	2.686000|2.686000	0.91538|0.91538	0.650000|0.650000	0.86243|0.86243	GGC|TGG		0.413	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099166.3	NM_032105		Missense_Mutation
IARS2	55699	genome.wustl.edu	37	1	220311385	220311385	+	Splice_Site	SNP	G	G	C			TCGA-13-1483-01	TCGA-13-1483-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr1:220311385G>C	ENST00000302637.5	+	17	2279	c.2175G>C	c.(2173-2175)aaG>aaC	p.K725N	snoU13_ENST00000459443.1_RNA|IARS2_ENST00000366922.1_Splice_Site_p.K653N	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	725					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)	p.K725N(1)		NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	ATATTAGCAAGGTTAGAACTA	0.388																																																1	Substitution - Missense(1)	ovary(1)	1											115.0	106.0	109.0					1																	220311385		2203	4300	6503	218378008	SO:0001630	splice_region_variant	55699			AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.2175+1G>C	1.37:g.220311385G>C			218378008	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Missense_Mutation	SNP	ENST00000302637.5	37	CCDS1523.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388512	0.82902	.	.	ENSG00000067704	ENST00000366922;ENST00000302637	T;T	0.18657	2.2;2.2	5.64	5.64	0.86602	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.044197	0.85682	D	0.000000	T	0.54224	0.1845	M	0.92880	3.355	0.80722	D	1	D	0.64830	0.994	P	0.59357	0.856	T	0.65010	-0.6272	10	0.87932	D	0	-16.819	18.2441	0.89979	0.0:0.0:1.0:0.0	.	725	Q9NSE4	SYIM_HUMAN	N	653;725	ENSP00000355889:K653N;ENSP00000303279:K725N	ENSP00000303279:K725N	K	+	3	2	IARS2	218378008	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	8.969000	0.93411	2.817000	0.96982	0.557000	0.71058	AAG		0.388	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	Missense_Mutation	Missense_Mutation
PTCH1	5727	genome.wustl.edu	37	9	98278988	98278988	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1483-01	TCGA-13-1483-10	C	C	G	C	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr9:98278988C>G	ENST00000375274.2	-	1	259	c.115G>C	c.(115-117)Gac>Cac	p.D39H	RP11-435O5.4_ENST00000604650.1_RNA|PTCH1_ENST00000468211.2_5'UTR|PTCH1_ENST00000437951.1_5'UTR|PTCH1_ENST00000430669.2_5'UTR			Q13635	PTC1_HUMAN	patched 1	0					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.D39H(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				cctcctccgtcttTACAAAAG	0.557																																																1	Substitution - Missense(1)	ovary(1)	9											117.0	117.0	117.0					9																	98278988		1816	4069	5885	97318809	SO:0001583	missense	5727			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000375274.2:c.115G>C	9.37:g.98278988C>G	ENSP00000364423:p.Asp39His		97318809	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000375274.2	37	CCDS47995.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	c	14.40	2.524678	0.44969	.	.	ENSG00000185920	ENST00000375274	D	0.90385	-2.66	3.11	3.11	0.35812	.	.	.	.	.	D	0.86100	0.5852	.	.	.	0.80722	D	1	B	0.25955	0.138	B	0.17979	0.02	D	0.85522	0.1204	8	0.62326	D	0.03	.	13.2852	0.60239	0.0:1.0:0.0:0.0	.	39	Q13635-2	.	H	39	ENSP00000364423:D39H	ENSP00000364423:D39H	D	-	1	0	PTCH1	97318809	0.379000	0.25123	0.997000	0.53966	0.981000	0.71138	0.458000	0.21892	1.749000	0.51849	0.479000	0.44913	GAC		0.557	PTCH1-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000406923.1	NM_000264		Missense_Mutation
SYT3	84258	genome.wustl.edu	37	19	51135640	51135640	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1483-01	TCGA-13-1483-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr19:51135640C>T	ENST00000338916.4	-	2	1210	c.577G>A	c.(577-579)Gga>Aga	p.G193R	SYT3_ENST00000593901.1_Missense_Mutation_p.G193R|SYT3_ENST00000544769.1_Missense_Mutation_p.G193R|SYT3_ENST00000600079.1_Missense_Mutation_p.G193R	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	193					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.G193R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GAGCCTGCTCCCCCCTCAGAG	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											39.0	42.0	41.0					19																	51135640		2203	4300	6503	55827452	SO:0001583	missense	84258			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.577G>A	19.37:g.51135640C>T	ENSP00000340914:p.Gly193Arg		55827452	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	CCDS12798.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	5.014	0.188313	0.09547	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.57595	0.39;0.39	5.24	3.07	0.35406	.	0.377447	0.20698	U	0.087331	T	0.25568	0.0622	N	0.03608	-0.345	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.12091	-1.0561	10	0.51188	T	0.08	.	6.1149	0.20122	0.0:0.6612:0.1594:0.1794	.	193	Q9BQG1	SYT3_HUMAN	R	193	ENSP00000340914:G193R;ENSP00000438883:G193R	ENSP00000340914:G193R	G	-	1	0	SYT3	55827452	0.031000	0.19500	0.012000	0.15200	0.524000	0.34500	0.930000	0.28858	1.331000	0.45412	0.655000	0.94253	GGA		0.642	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298		Missense_Mutation
PDGFRA	5156	genome.wustl.edu	37	4	55127387	55127387	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1483-01	TCGA-13-1483-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr4:55127387T>A	ENST00000257290.5	+	3	506	c.175T>A	c.(175-177)Tac>Aac	p.Y59N	FIP1L1_ENST00000507166.1_Intron|PDGFRA_ENST00000508170.1_Missense_Mutation_p.Y59N	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	59	Ig-like C2-type 1.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.Y59N(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	GAGCTGGCAGTACCCCATGTC	0.463			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	1	Substitution - Missense(1)	ovary(1)	4											104.0	114.0	110.0					4																	55127387		2203	4300	6503	54822144	SO:0001583	missense	5156	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.175T>A	4.37:g.55127387T>A	ENSP00000257290:p.Tyr59Asn		54822144	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	CCDS3495.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	12.08	1.829549	0.32329	.	.	ENSG00000134853	ENST00000257290;ENST00000508170;ENST00000512143;ENST00000503856;ENST00000504461;ENST00000512522	T;T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74;1.74	5.97	3.58	0.41010	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.295501	0.18361	U	0.143577	T	0.23410	0.0566	L	0.53249	1.67	0.35901	D	0.830427	B;B	0.16166	0.0;0.016	B;B	0.11329	0.002;0.006	T	0.10428	-1.0630	10	0.42905	T	0.14	.	8.1103	0.30911	0.0:0.2907:0.0:0.7093	.	59;59	P16234;P16234-2	PGFRA_HUMAN;.	N	59;59;84;59;59;59	ENSP00000257290:Y59N;ENSP00000425648:Y59N;ENSP00000425626:Y84N;ENSP00000425902:Y59N;ENSP00000426472:Y59N;ENSP00000425232:Y59N	ENSP00000257290:Y59N	Y	+	1	0	PDGFRA	54822144	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	1.389000	0.34453	0.531000	0.28639	0.482000	0.46254	TAC		0.463	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206		Missense_Mutation
ZBBX	79740	genome.wustl.edu	37	3	167016234	167016240	+	Frame_Shift_Del	DEL	TTTCTTG	TTTCTTG	-			TCGA-13-1483-01	TCGA-13-1483-10	TTTCTTG	TTTCTTG	TTTCTTG	-	TTTCTTG	TTTCTTG	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr3:167016234_167016240delTTTCTTG	ENST00000392766.2	-	18	2072_2078	c.1732_1738delCAAGAAA	c.(1732-1740)caagaaatafs	p.QEI578fs	ZBBX_ENST00000392767.2_Frame_Shift_Del_p.QEI578fs|ZBBX_ENST00000392764.1_Frame_Shift_Del_p.QEI549fs|ZBBX_ENST00000455345.2_Frame_Shift_Del_p.QEI578fs|ZBBX_ENST00000307529.5_Frame_Shift_Del_p.QEI578fs	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	578						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.Q578L(2)|p.Q578fs*1(2)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CTGCAGGCTATTTCTTGTAACAACTAA	0.295																																																4	Substitution - Missense(2)|Deletion - Frameshift(2)	ovary(2)|lung(2)	3																																								168498934	SO:0001589	frameshift_variant	79740			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1732_1738delCAAGAAA	3.37:g.167016234_167016240delTTTCTTG	ENSP00000376519:p.Gln578fs		168498928	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Frame_Shift_Del	DEL	ENST00000392766.2	37	CCDS3199.2	DEL	52	WashU																																																																																				0.295	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687		Frame_Shift_Del
WNT16	51384	genome.wustl.edu	37	7	120979118	120979118	+	Frame_Shift_Del	DEL	G	G	-			TCGA-13-1483-01	TCGA-13-1483-10	G	G	G	-	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-13-1483-01	TCGA-13-1483-10	g.chr7:120979118delG	ENST00000222462.2	+	4	1107	c.817delG	c.(817-819)gatfs	p.D273fs	WNT16_ENST00000361301.2_Frame_Shift_Del_p.D263fs	NM_057168.1	NP_476509.1	Q9UBV4	WNT16_HUMAN	wingless-type MMTV integration site family, member 16	273					bone remodeling (GO:0046849)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|optic cup formation involved in camera-type eye development (GO:0003408)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|replicative senescence (GO:0090399)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.D273fs*23(1)		breast(1)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)	18	all_neural(327;0.117)					GAGAGAAAAAGATCAGAGGAA	0.373																																																1	Deletion - Frameshift(1)	ovary(1)	7											96.0	95.0	95.0					7																	120979118		2203	4300	6503	120766354	SO:0001589	frameshift_variant	51384			AF152584	CCDS5780.1, CCDS5781.1	7q31	2008-07-18			ENSG00000002745	ENSG00000002745		"""Wingless-type MMTV integration sites"""	16267	protein-coding gene	gene with protein product		606267				10500199	Standard	NM_016087		Approved		uc003vjw.3	Q9UBV4	OTTHUMG00000156963	ENST00000222462.2:c.817delG	7.37:g.120979118delG	ENSP00000222462:p.Asp273fs		120766354	Q2M3G1|Q9Y5C0	Frame_Shift_Del	DEL	ENST00000222462.2	37	CCDS5781.1	DEL	33	WashU																																																																																				0.373	WNT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346843.1	NM_057168		Frame_Shift_Del
