#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
IRF4	3662	genome.wustl.edu	37	6	405067	405067	+	Silent	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr6:405067G>A	ENST00000380956.4	+	8	1275	c.1149G>A	c.(1147-1149)gtG>gtA	p.V383V		NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	383					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.V383V(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		GATTCCAGGTGACTCTATGCT	0.522			T	IGH@	MM																																		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	1	Substitution - coding silent(1)	ovary(1)	6											82.0	79.0	80.0					6																	405067		2203	4300	6503	350067	SO:0001819	synonymous_variant	3662			U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.1149G>A	6.37:g.405067G>A			350067	Q5VUI7|Q99660	Silent	SNP	ENST00000380956.4	37	CCDS4469.1	SNP	45	WashU																																																																																				0.522	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1			Silent
PCED1A	64773	genome.wustl.edu	37	20	2819116	2819116	+	Silent	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr20:2819116G>A	ENST00000360652.2	-	6	1105	c.603C>T	c.(601-603)ccC>ccT	p.P201P	VPS16_ENST00000380469.3_5'Flank|VPS16_ENST00000380445.3_5'Flank|PCED1A_ENST00000356872.3_Silent_p.P150P	NM_022760.4	NP_073597.2	Q9H1Q7	PED1A_HUMAN	PC-esterase domain containing 1A	201								p.P201P(1)									AGCCTGCCAGGGGCTGGAGCT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	20											48.0	53.0	52.0					20																	2819116		2203	4300	6503	2767116	SO:0001819	synonymous_variant	64773			AK026029	CCDS13035.1, CCDS59442.1	20p13	2012-06-11	2012-06-11	2012-06-11	ENSG00000132635	ENSG00000132635			16212	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 81"", ""family with sequence similarity 113, member A"""	C20orf81, FAM113A		20056006	Standard	NM_022760		Approved	bA12M19.1, FLJ22376	uc002wgz.2	Q9H1Q7	OTTHUMG00000031716	ENST00000360652.2:c.603C>T	20.37:g.2819116G>A			2767116	Q5JUA5|Q5JUA6|Q6PK19|Q86WF5|Q96CG7|Q9H1Q6|Q9H6D1	Silent	SNP	ENST00000360652.2	37	CCDS13035.1	SNP	43	WashU																																																																																				0.562	PCED1A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077676.2	NM_022760		Silent
TP53	7157	genome.wustl.edu	37	17	7578454	7578454	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr17:7578454G>A	ENST00000269305.4	-	5	665	c.476C>T	c.(475-477)gCc>gTc	p.A159V	TP53_ENST00000420246.2_Missense_Mutation_p.A159V|TP53_ENST00000445888.2_Missense_Mutation_p.A159V|TP53_ENST00000455263.2_Missense_Mutation_p.A159V|TP53_ENST00000359597.4_Missense_Mutation_p.A159V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.A159V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	159	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A159V(33)|p.0?(8)|p.A159D(7)|p.R158fs(6)|p.R65fs(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.R26fs(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.R158fs*11(1)|p.A66V(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.A27V(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.A159_Q167delAMAIYKQSQ(1)|p.V157fs*21(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGCCATGGCGCGGACGCG	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	81	Substitution - Missense(42)|Deletion - In frame(12)|Complex(10)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - frameshift(2)	central_nervous_system(15)|large_intestine(13)|lung(13)|stomach(6)|breast(6)|ovary(6)|oesophagus(4)|bone(4)|liver(4)|haematopoietic_and_lymphoid_tissue(3)|pancreas(2)|upper_aerodigestive_tract(1)|endometrium(1)|urinary_tract(1)|skin(1)|prostate(1)	17											50.0	51.0	51.0					17																	7578454		2203	4300	6503	7519179	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.476C>T	17.37:g.7578454G>A	ENSP00000269305:p.Ala159Val		7519179	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211949	0.58452	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99859	-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23	5.59	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.053992	0.64402	D	0.000001	D	0.99594	0.9853	L	0.49513	1.565	0.50171	D	0.999855	D;P;B;D;P;P;D	0.67145	0.984;0.881;0.358;0.989;0.832;0.769;0.996	P;P;B;P;P;P;P	0.59703	0.774;0.616;0.255;0.741;0.814;0.632;0.862	D	0.98152	1.0442	10	0.87932	D	0	-9.0177	10.7596	0.46258	0.0:0.2672:0.5942:0.1386	.	120;159;159;66;159;159;159	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	V	159;159;159;159;159;159;148;66;27;66;27;159	ENSP00000410739:A159V;ENSP00000352610:A159V;ENSP00000269305:A159V;ENSP00000398846:A159V;ENSP00000391127:A159V;ENSP00000391478:A159V;ENSP00000425104:A27V;ENSP00000423862:A66V;ENSP00000424104:A159V	ENSP00000269305:A159V	A	-	2	0	TP53	7519179	1.000000	0.71417	0.377000	0.26055	0.171000	0.22731	7.969000	0.87988	0.364000	0.24374	-0.176000	0.13171	GCC		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
SLC2A3	6515	genome.wustl.edu	37	12	8086490	8086490	+	Silent	SNP	T	T	C			TCGA-23-1021-01	TCGA-23-1021-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr12:8086490T>C	ENST00000075120.7	-	2	264	c.24A>G	c.(22-24)ccA>ccG	p.P8P		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	8					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)	p.P8P(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		ATATCAGAGCTGGGGTGACCT	0.453																																					Colon(96;424 1461 14416 20933 23688)											1	Substitution - coding silent(1)	ovary(1)	12											83.0	78.0	79.0					12																	8086490		2203	4300	6503	7977757	SO:0001819	synonymous_variant	6515			M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.24A>G	12.37:g.8086490T>C			7977757	B2R606|D3DUU6|Q6I9U2|Q9UG15	Silent	SNP	ENST00000075120.7	37	CCDS8586.1	SNP	55	WashU																																																																																				0.453	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257914.1	NM_006931		Silent
PKN1	5585	genome.wustl.edu	37	19	14580797	14580797	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr19:14580797G>A	ENST00000242783.6	+	18	2455	c.2290G>A	c.(2290-2292)Gag>Aag	p.E764K	PKN1_ENST00000342216.4_Missense_Mutation_p.E770K	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	764	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)	p.E764K(1)		breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						CCTCTGCAAGGAGGGTGAGGG	0.602																																					NSCLC(185;2539 2965 10733 52867)											1	Substitution - Missense(1)	ovary(1)	19											73.0	77.0	75.0					19																	14580797		2028	4181	6209	14441797	SO:0001583	missense	5585			S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.2290G>A	19.37:g.14580797G>A	ENSP00000242783:p.Glu764Lys		14441797	A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	ENST00000242783.6	37	CCDS42513.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765283	0.90020	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	T;T	0.63255	-0.03;-0.03	4.06	4.06	0.47325	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000002	T	0.64918	0.2642	N	0.17474	0.49	0.49687	D	0.99981	D;D	0.69078	0.996;0.997	D;D	0.79108	0.986;0.992	T	0.70978	-0.4725	10	0.87932	D	0	-24.0166	14.0886	0.64975	0.0:0.0:1.0:0.0	.	770;764	Q16512-2;Q16512	.;PKN1_HUMAN	K	764;770	ENSP00000242783:E764K;ENSP00000343325:E770K	ENSP00000242783:E764K	E	+	1	0	PKN1	14441797	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	7.655000	0.83696	2.255000	0.74692	0.491000	0.48974	GAG		0.602	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	NM_002741, NM_213560		Missense_Mutation
NMT2	9397	genome.wustl.edu	37	10	15161468	15161468	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr10:15161468G>C	ENST00000378165.4	-	9	1124	c.1044C>G	c.(1042-1044)atC>atG	p.I348M	NMT2_ENST00000540259.1_Missense_Mutation_p.I160M|RPP38_ENST00000451677.1_Intron|NMT2_ENST00000378150.1_Missense_Mutation_p.I335M|NMT2_ENST00000535341.1_Missense_Mutation_p.I335M	NM_004808.2	NP_004799.1	O60551	NMT2_HUMAN	N-myristoyltransferase 2	348					intracellular transport of virus (GO:0075733)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)	p.I348M(1)		breast(3)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(3)	21						GAACTGATTTGATATCTTTTG	0.448																																					Melanoma(117;1345 1645 4130 12688 30625)											1	Substitution - Missense(1)	ovary(1)	10											185.0	170.0	175.0					10																	15161468		2203	4300	6503	15201474	SO:0001583	missense	9397			AF043325	CCDS7109.1	10p13	2006-07-11			ENSG00000152465	ENSG00000152465			7858	protein-coding gene	gene with protein product		603801				9506952	Standard	NM_004808		Approved		uc001inz.1	O60551	OTTHUMG00000017723	ENST00000378165.4:c.1044C>G	10.37:g.15161468G>C	ENSP00000367407:p.Ile348Met		15201474	B0YJ49|Q53Y38|Q5VUC8|Q9BRB4	Missense_Mutation	SNP	ENST00000378165.4	37	CCDS7109.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	12.07	1.828134	0.32329	.	.	ENSG00000152465	ENST00000378165;ENST00000378150;ENST00000378143;ENST00000540259;ENST00000535341	T	0.51325	0.71	5.69	1.51	0.23008	Acyl-CoA N-acyltransferase (2);Myristoyl-CoA:protein N-myristoyltransferase, C-terminal (1);	0.408273	0.29424	N	0.012198	T	0.49012	0.1532	M	0.75777	2.31	0.37720	D	0.92487	B;B;B	0.19445	0.002;0.036;0.02	B;B;B	0.41666	0.096;0.363;0.257	T	0.46596	-0.9180	9	.	.	.	-5.754	0.9799	0.01433	0.293:0.2741:0.2924:0.1406	.	348;335;348	B2RCF3;Q5VUC6;O60551	.;.;NMT2_HUMAN	M	348;335;379;160;335	ENSP00000367407:I348M	.	I	-	3	3	NMT2	15201474	0.995000	0.38212	0.672000	0.29872	0.944000	0.59088	0.457000	0.21875	0.326000	0.23384	0.655000	0.94253	ATC		0.448	NMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046958.2	NM_004808		Missense_Mutation
MACROD2	140733	genome.wustl.edu	37	20	15843439	15843439	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1021-01	TCGA-23-1021-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr20:15843439A>C	ENST00000310348.4	+	9	695	c.695A>C	c.(694-696)tAc>tCc	p.Y232S	MACROD2_ENST00000402914.1_5'UTR|MACROD2_ENST00000217246.4_Missense_Mutation_p.Y232S|MACROD2_ENST00000378058.3_5'Flank			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	232	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.Y232S(1)		breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				TTCAAAATCTACAAAAAGAAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	20											93.0	93.0	93.0					20																	15843439		2203	4300	6503	15791439	SO:0001583	missense	140733			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.695A>C	20.37:g.15843439A>C	ENSP00000309809:p.Tyr232Ser		15791439	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	CCDS13120.2	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	17.11	3.306137	0.60305	.	.	ENSG00000172264	ENST00000217246;ENST00000310348	T;T	0.26373	1.74;1.74	5.6	4.46	0.54185	Appr-1-p processing (1);	0.000000	0.43260	D	0.000596	T	0.61211	0.2329	H	0.96970	3.915	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.76575	0.988;0.981	T	0.70710	-0.4797	10	0.56958	D	0.05	-6.409	9.632	0.39785	0.7809:0.0:0.0:0.2191	.	232;232	A1Z1Q3;A1Z1Q3-2	MACD2_HUMAN;.	S	232	ENSP00000217246:Y232S;ENSP00000309809:Y232S	ENSP00000217246:Y232S	Y	+	2	0	MACROD2	15791439	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.196000	0.42686	2.139000	0.66308	0.455000	0.32223	TAC		0.358	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676		Missense_Mutation
MYO9B	4650	genome.wustl.edu	37	19	17283721	17283721	+	Missense_Mutation	SNP	G	G	C	rs536977695		TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr19:17283721G>C	ENST00000594824.1	+	13	2236	c.2089G>C	c.(2089-2091)Gtg>Ctg	p.V697L	MYO9B_ENST00000397274.2_Missense_Mutation_p.V697L|MYO9B_ENST00000595618.1_Missense_Mutation_p.V697L			Q13459	MYO9B_HUMAN	myosin IXB	697	Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.V697L(1)		breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GGCCATGGCAGTGCTTCGGGA	0.701																																																1	Substitution - Missense(1)	ovary(1)	19											28.0	33.0	32.0					19																	17283721		2038	4172	6210	17144721	SO:0001583	missense	4650				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.2089G>C	19.37:g.17283721G>C	ENSP00000471367:p.Val697Leu		17144721	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37		SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	25.2	4.608594	0.87258	.	.	ENSG00000099331	ENST00000397274	D	0.84873	-1.91	4.51	4.51	0.55191	Myosin head, motor domain (2);	0.000000	0.49916	D	0.000139	D	0.89701	0.6791	L	0.54323	1.7	0.47183	D	0.999347	D;D;D	0.59357	0.973;0.973;0.985	D;D;D	0.64506	0.926;0.926;0.922	D	0.90571	0.4522	10	0.59425	D	0.04	.	16.166	0.81757	0.0:0.0:1.0:0.0	.	697;697;703	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	L	697	ENSP00000380444:V697L	ENSP00000380444:V697L	V	+	1	0	MYO9B	17144721	1.000000	0.71417	0.972000	0.41901	0.684000	0.39900	9.672000	0.98629	2.218000	0.71995	0.655000	0.94253	GTG		0.701	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1			Missense_Mutation
CLTCL1	8218	genome.wustl.edu	37	22	19175514	19175514	+	Silent	SNP	C	C	A			TCGA-23-1021-01	TCGA-23-1021-10	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr22:19175514C>A	ENST00000263200.10	-	28	4485	c.4413G>T	c.(4411-4413)ctG>ctT	p.L1471L	CLTCL1_ENST00000427926.1_Silent_p.L1471L|CLTCL1_ENST00000353891.5_Silent_p.L1471L|CLTCL1_ENST00000442042.2_Intron	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1471	Heavy chain arm.|Involved in binding clathrin light chain. {ECO:0000250}.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)	p.L1471L(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					CCTCCTCTGTCAGCAGGTGGT	0.587			T	?	ALCL																																		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	1	Substitution - coding silent(1)	ovary(1)	22											178.0	181.0	180.0					22																	19175514		2055	4183	6238	17555514	SO:0001819	synonymous_variant	8218				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.4413G>T	22.37:g.19175514C>A			17555514	B7Z7U5|Q14017|Q15808|Q15809	Nonstop_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	SNP	29	WashU																																																																																				0.587	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098		Nonstop_Mutation
MTUS1	57509	genome.wustl.edu	37	8	17612588	17612588	+	Silent	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr8:17612588G>A	ENST00000262102.6	-	2	953	c.729C>T	c.(727-729)taC>taT	p.Y243Y	MTUS1_ENST00000381862.3_Silent_p.Y243Y|MTUS1_ENST00000519263.1_Silent_p.Y243Y|MTUS1_ENST00000381869.3_Silent_p.Y243Y	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	243					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Y243Y(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		AAAATGCTGTGTAAGTCATGT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	8											188.0	166.0	173.0					8																	17612588		1917	4121	6038	17656868	SO:0001819	synonymous_variant	57509			AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.729C>T	8.37:g.17612588G>A			17656868	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Silent	SNP	ENST00000262102.6	37	CCDS43717.1	SNP	48	WashU																																																																																				0.413	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031		Silent
OR11H12	440153	genome.wustl.edu	37	14	19377700	19377700	+	Nonsense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr14:19377700G>A	ENST00000550708.1	+	1	179	c.107G>A	c.(106-108)tGg>tAg	p.W36*		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W36*(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ACTTGTGAGTGGACAATTCAG	0.433																																																1	Substitution - Nonsense(1)	ovary(1)	14											67.0	68.0	68.0					14																	19377700		2199	4296	6495	18447700	SO:0001587	stop_gained	440153				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.107G>A	14.37:g.19377700G>A	ENSP00000449002:p.Trp36*		18447700		Nonsense_Mutation	SNP	ENST00000550708.1	37	CCDS32017.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	g	12.34	1.907553	0.33721	.	.	ENSG00000257115	ENST00000550708	.	.	.	.	.	.	.	0.431515	0.17171	U	0.184292	.	.	.	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	6.4784	0.22049	2.0E-4:0.0:0.9998:0.0	.	.	.	.	X	36	.	ENSP00000449002:W36X	W	+	2	0	CR383656.1	18447700	0.000000	0.05858	0.593000	0.28771	0.151000	0.21798	-2.602000	0.00891	0.413000	0.25759	0.064000	0.15345	TGG		0.433	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408402.1	NM_001013354		Nonsense_Mutation
GMIP	51291	genome.wustl.edu	37	19	19745667	19745667	+	Silent	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr19:19745667C>T	ENST00000203556.4	-	17	1958	c.1821G>A	c.(1819-1821)gcG>gcA	p.A607A	GMIP_ENST00000587238.1_Silent_p.A581A|GMIP_ENST00000445806.2_Silent_p.A578A|GMIP_ENST00000586269.1_5'UTR	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	607	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)	p.A607A(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						GCTCCACCAACGCTCGGCCAT	0.622																																																1	Substitution - coding silent(1)	ovary(1)	19											46.0	47.0	47.0					19																	19745667		2203	4300	6503	19606667	SO:0001819	synonymous_variant	51291			AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.1821G>A	19.37:g.19745667C>T			19606667	A0AVN9|B7ZLZ0	Silent	SNP	ENST00000203556.4	37	CCDS12408.1	SNP	19	WashU																																																																																				0.622	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460551.1	NM_016573		Silent
LAMA3	3909	genome.wustl.edu	37	18	21487772	21487772	+	Missense_Mutation	SNP	C	C	A	rs141023743		TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr18:21487772C>A	ENST00000313654.9	+	54	7129	c.6888C>A	c.(6886-6888)aaC>aaA	p.N2296K	LAMA3_ENST00000269217.6_Missense_Mutation_p.N687K|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000587184.1_Missense_Mutation_p.N631K|LAMA3_ENST00000399516.3_Missense_Mutation_p.N2240K	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2296	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.N2296K(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GAAAGGCCAACGACATCACAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	18											139.0	132.0	134.0					18																	21487772		2203	4300	6503	19741770	SO:0001583	missense	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.6888C>A	18.37:g.21487772C>A	ENSP00000324532:p.Asn2296Lys		19741770	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	6.285	0.420750	0.11928	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.49720	0.77;0.77;0.77	5.27	-10.5	0.00291	Laminin II (1);	.	.	.	.	T	0.41236	0.1150	L	0.50333	1.59	0.22511	N	0.999038	B;B;B;B	0.34329	0.264;0.449;0.183;0.183	B;P;B;B	0.44696	0.258;0.458;0.153;0.108	T	0.48422	-0.9037	9	0.33141	T	0.24	.	7.7082	0.28663	0.0699:0.1999:0.1389:0.5912	.	631;687;2240;2296	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	K	2296;2240;687	ENSP00000324532:N2296K;ENSP00000382432:N2240K;ENSP00000269217:N687K	ENSP00000269217:N687K	N	+	3	2	LAMA3	19741770	0.000000	0.05858	0.018000	0.16275	0.170000	0.22686	-3.081000	0.00613	-2.570000	0.00468	-1.224000	0.01588	AAC		0.438	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		Missense_Mutation
IGLV3-12	28802	genome.wustl.edu	37	22	23114931	23114931	+	RNA	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr22:23114931G>A	ENST00000390313.2	+	0	212									immunoglobulin lambda variable 3-12																		GTCATCTATAGCGATAGCAAC	0.577																																																0			22											54.0	55.0	55.0					22																	23114931		1952	4129	6081	21444931						Z73658		22q11.2	2012-02-08			ENSG00000211667	ENSG00000211667		"""Immunoglobulins / IGL locus"""	5898	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151233		22.37:g.23114931G>A			21444931		Missense_Mutation	SNP	ENST00000390313.2	37		SNP	34	WashU																																																																																				0.577	IGLV3-12-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000321838.1	NG_000002		Missense_Mutation
MYO18A	399687	genome.wustl.edu	37	17	27448204	27448204	+	Missense_Mutation	SNP	C	C	T	rs372515961		TCGA-23-1021-01	TCGA-23-1021-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr17:27448204C>T	ENST00000527372.1	-	6	1577	c.1397G>A	c.(1396-1398)cGg>cAg	p.R466Q	MYO18A_ENST00000354329.4_Missense_Mutation_p.R466Q|MYO18A_ENST00000533112.1_Missense_Mutation_p.R466Q|MYO18A_ENST00000531253.1_Missense_Mutation_p.R466Q	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	466	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.R466Q(1)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GTCCTCCCGCCGACAACCCTT	0.577																																					Esophageal Squamous(182;472 2015 7001 15270 22562)											1	Substitution - Missense(1)	ovary(1)	17						C	GLN/ARG,GLN/ARG	2,4276		0,2,2137	30.0	32.0	31.0		1397,1397	5.9	1.0	17		31	0,8456		0,0,4228	no	missense,missense	MYO18A	NM_078471.3,NM_203318.1	43,43	0,2,6365	TT,TC,CC		0.0,0.0468,0.0157	possibly-damaging,possibly-damaging	466/2055,466/2040	27448204	2,12732	2139	4228	6367	24472330	SO:0001583	missense	399687			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.1397G>A	17.37:g.27448204C>T	ENSP00000437073:p.Arg466Gln		24472330	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	37	6.008283	0.97195	4.68E-4	0.0	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000458428;ENST00000531686	D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25	5.92	5.92	0.95590	Myosin head, motor domain (2);	0.055154	0.64402	D	0.000001	D	0.91858	0.7423	L	0.56340	1.77	0.49389	D	0.999787	P;D;D;D;D	0.76494	0.923;0.998;0.998;0.998;0.999	P;P;P;P;D	0.63488	0.473;0.845;0.845;0.845;0.915	D	0.91799	0.5450	10	0.72032	D	0.01	.	19.9311	0.97118	0.0:1.0:0.0:0.0	.	135;78;466;466;466	Q92614-2;F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;.;MY18A_HUMAN	Q	466;466;466;466;466;78;146	ENSP00000346291:R466Q;ENSP00000435932:R466Q;ENSP00000434228:R466Q;ENSP00000437073:R466Q	ENSP00000346291:R466Q	R	-	2	0	MYO18A	24472330	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.653000	0.67967	2.813000	0.96785	0.561000	0.74099	CGG		0.577	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471		Missense_Mutation
ARHGAP21	57584	genome.wustl.edu	37	10	24874562	24874562	+	Silent	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr10:24874562C>T	ENST00000396432.2	-	26	5142	c.4656G>A	c.(4654-4656)acG>acA	p.T1552T		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1551					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.T1551T(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						CCTGGGAAGACGTGCTGAGCA	0.532																																																1	Substitution - coding silent(1)	ovary(1)	10											73.0	76.0	75.0					10																	24874562		2203	4297	6500	24914568	SO:0001819	synonymous_variant	57584			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.4656G>A	10.37:g.24874562C>T			24914568	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Silent	SNP	ENST00000396432.2	37	CCDS7144.2	SNP	19	WashU																																																																																				0.532	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824		Silent
LRRC37B	114659	genome.wustl.edu	37	17	30376236	30376236	+	Silent	SNP	A	A	G			TCGA-23-1021-01	TCGA-23-1021-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr17:30376236A>G	ENST00000341671.7	+	10	2504	c.2499A>G	c.(2497-2499)acA>acG	p.T833T	LRRC37B_ENST00000394713.3_Silent_p.T782T|LRRC37B_ENST00000543378.2_Silent_p.T751T|LRRC37B_ENST00000327564.7_Silent_p.T860T|LRRC37B_ENST00000584368.1_Silent_p.T794T	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	833						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.T833T(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				GTTCAGAAACACATGTGCAAG	0.498																																																1	Substitution - coding silent(1)	ovary(1)	17											88.0	79.0	82.0					17																	30376236		2203	4300	6503	27400349	SO:0001819	synonymous_variant	114659			AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.2499A>G	17.37:g.30376236A>G			27400349	Q17RC9|Q5YKG6	Silent	SNP	ENST00000341671.7	37	CCDS32609.1	SNP	6	WashU																																																																																				0.498	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	NM_052888		Silent
HIST1H4L	8368	genome.wustl.edu	37	6	27841216	27841216	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr6:27841216C>T	ENST00000355981.2	-	1	73	c.73G>A	c.(73-75)Gac>Aac	p.D25N	HIST1H3I_ENST00000328488.2_5'Flank	NM_003546.2	NP_003537.1	P62805	H4_HUMAN	histone cluster 1, H4l	25					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.D25N(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	13						TGAATGTTGTCGCGCAGAACT	0.592																																																1	Substitution - Missense(1)	ovary(1)	6											71.0	62.0	65.0					6																	27841216		2203	4300	6503	27949195	SO:0001583	missense	8368			X83548	CCDS4637.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198558	ENSG00000275126		"""Histones / Replication-dependent"""	4791	protein-coding gene	gene with protein product		602831	"""H4 histone family, member K"", ""histone 1, H4l"""	H4FK		9031620, 9439656, 12408966	Standard	NM_003546		Approved	H4.k, H4/k	uc003njz.3	P62805	OTTHUMG00000016211	ENST00000355981.2:c.73G>A	6.37:g.27841216C>T	ENSP00000348258:p.Asp25Asn		27949195	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000355981.2	37	CCDS4637.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	18.27	3.586738	0.66105	.	.	ENSG00000198558	ENST00000355981	.	.	.	4.52	4.52	0.55395	.	0.000000	0.64402	D	0.000001	T	0.71256	0.3318	.	.	.	0.45762	D	0.998654	.	.	.	.	.	.	T	0.75975	-0.3128	6	0.87932	D	0	.	16.7018	0.85351	0.0:1.0:0.0:0.0	.	.	.	.	N	25	.	ENSP00000348258:D25N	D	-	1	0	HIST1H4L	27949195	1.000000	0.71417	0.981000	0.43875	0.018000	0.09664	7.386000	0.79775	2.439000	0.82584	0.655000	0.94253	GAC		0.592	HIST1H4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043513.1	NM_003546		Missense_Mutation
FOSL2	2355	genome.wustl.edu	37	2	28631719	28631719	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr2:28631719G>A	ENST00000264716.4	+	3	1311	c.448G>A	c.(448-450)Gag>Aag	p.E150K	FOSL2_ENST00000545753.1_Missense_Mutation_p.E111K|FOSL2_ENST00000379619.1_Missense_Mutation_p.E125K	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	150	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E150K(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					GGAGCTGACAGAGAAGCTGCA	0.647																																																1	Substitution - Missense(1)	ovary(1)	2											25.0	28.0	27.0					2																	28631719		2202	4300	6502	28485223	SO:0001583	missense	2355				CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.448G>A	2.37:g.28631719G>A	ENSP00000264716:p.Glu150Lys		28485223	B2RD58|B3KP27|B4DYV4|Q6FG46	Missense_Mutation	SNP	ENST00000264716.4	37	CCDS1766.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.877677	0.97055	.	.	ENSG00000075426	ENST00000379619;ENST00000264716;ENST00000436647;ENST00000545753	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.45	5.45	0.79879	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.047275	0.85682	D	0.000000	T	0.64627	0.2615	L	0.36672	1.1	0.80722	D	1	P	0.50819	0.939	P	0.51453	0.67	T	0.61257	-0.7099	9	.	.	.	-5.6283	19.2653	0.93983	0.0:0.0:1.0:0.0	.	150	P15408	FOSL2_HUMAN	K	125;150;111;111	ENSP00000368939:E125K;ENSP00000264716:E150K;ENSP00000396497:E111K;ENSP00000439303:E111K	.	E	+	1	0	FOSL2	28485223	1.000000	0.71417	0.970000	0.41538	0.997000	0.91878	9.790000	0.99075	2.554000	0.86153	0.655000	0.94253	GAG		0.647	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215116.2	NM_005253		Missense_Mutation
NOL4	8715	genome.wustl.edu	37	18	31803086	31803086	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1021-01	TCGA-23-1021-10	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr18:31803086C>A	ENST00000261592.5	-	1	429	c.132G>T	c.(130-132)gaG>gaT	p.E44D	RP11-379L18.1_ENST00000587528.1_RNA|NOL4_ENST00000538587.1_5'Flank|NOL4_ENST00000269185.4_5'UTR|NOL4_ENST00000589544.1_Missense_Mutation_p.E44D|NOL4_ENST00000535475.1_5'Flank|NOL4_ENST00000590846.1_5'Flank	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	44						nucleolus (GO:0005730)	RNA binding (GO:0003723)	p.E44D(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TGGAGCTCGACTCGGAGCCAT	0.602																																																1	Substitution - Missense(1)	ovary(1)	18											100.0	104.0	102.0					18																	31803086		2033	4175	6208	30057084	SO:0001583	missense	8715			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.132G>T	18.37:g.31803086C>A	ENSP00000261592:p.Glu44Asp		30057084	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	CCDS11907.2	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	16.98	3.272135	0.59649	.	.	ENSG00000101746	ENST00000261592	D	0.84442	-1.85	5.72	5.72	0.89469	.	.	.	.	.	T	0.79185	0.4403	L	0.34521	1.04	0.80722	D	1	B;B	0.23128	0.08;0.08	B;B	0.23716	0.048;0.048	T	0.73020	-0.4114	9	0.22109	T	0.4	-10.8333	16.5937	0.84789	0.0:1.0:0.0:0.0	.	44;44	O94818;O94818-2	NOL4_HUMAN;.	D	44	ENSP00000261592:E44D	ENSP00000261592:E44D	E	-	3	2	NOL4	30057084	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.441000	0.59981	2.701000	0.92244	0.561000	0.74099	GAG		0.602	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787		Missense_Mutation
LHX1	3975	genome.wustl.edu	37	17	35297671	35297671	+	Silent	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr17:35297671C>T	ENST00000254457.5	+	2	1666	c.255C>T	c.(253-255)caC>caT	p.H85H	RP11-445F12.2_ENST00000607336.1_RNA	NM_005568.3	NP_005559.2	P48742	LHX1_HUMAN	LIM homeobox 1	85	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell signaling (GO:0007267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|cerebellum development (GO:0021549)|cervix development (GO:0060067)|comma-shaped body morphogenesis (GO:0072049)|dorsal/ventral pattern formation (GO:0009953)|ectoderm formation (GO:0001705)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic viscerocranium morphogenesis (GO:0048703)|endoderm formation (GO:0001706)|epithelium development (GO:0060429)|forebrain regionalization (GO:0021871)|gastrulation with mouth forming second (GO:0001702)|head development (GO:0060322)|horizontal cell localization (GO:0035852)|kidney development (GO:0001822)|lateral motor column neuron migration (GO:0097477)|mesonephric duct development (GO:0072177)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerulus development (GO:0072224)|metanephric part of ureteric bud development (GO:0035502)|metanephric renal vesicle morphogenesis (GO:0072283)|metanephric S-shaped body morphogenesis (GO:0072284)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct elongation (GO:0035849)|nephric duct morphogenesis (GO:0072178)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|oviduct development (GO:0060066)|oviduct epithelium development (GO:0035846)|paramesonephric duct development (GO:0061205)|pattern specification process (GO:0007389)|positive regulation of anterior head development (GO:2000744)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primitive streak formation (GO:0090009)|pronephros development (GO:0048793)|regulation of gene expression (GO:0010468)|renal vesicle morphogenesis (GO:0072077)|retina layer formation (GO:0010842)|S-shaped body morphogenesis (GO:0072050)|somite rostral/caudal axis specification (GO:0032525)|spinal cord association neuron differentiation (GO:0021527)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)|uterine epithelium development (GO:0035847)|uterus development (GO:0060065)|vagina development (GO:0060068)|ventral spinal cord development (GO:0021517)	nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.H85H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Breast(25;0.00607)				AAGTGTTTCACCTGAACTGCT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	17											74.0	61.0	66.0					17																	35297671		2203	4299	6502	32371784	SO:0001819	synonymous_variant	3975			U14755	CCDS11316.1	17q12	2014-04-11			ENSG00000132130	ENSG00000273706		"""Homeoboxes / LIM class"""	6593	protein-coding gene	gene with protein product		601999				9212161	Standard	NM_005568		Approved	LIM-1, LIM1	uc002hnh.2	P48742	OTTHUMG00000188456	ENST00000254457.5:c.255C>T	17.37:g.35297671C>T			32371784	Q3MIW0	Silent	SNP	ENST00000254457.5	37	CCDS11316.1	SNP	18	WashU																																																																																				0.567	LHX1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256704.3	NM_005568		Silent
KCNE1	3753	genome.wustl.edu	37	21	35821549	35821549	+	Silent	SNP	G	G	T			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr21:35821549G>T	ENST00000337385.3	-	3	759	c.384C>A	c.(382-384)tcC>tcA	p.S128S	KCNE1_ENST00000399289.3_Silent_p.S128S|KCNE1_ENST00000432085.1_Silent_p.S128S|KCNE1_ENST00000416357.2_Silent_p.S128S|KCNE1_ENST00000399286.2_Silent_p.S128S|KCNE1_ENST00000399284.1_Silent_p.S128S	NM_001270402.1|NM_001270403.1	NP_001257331.1|NP_001257332.1	P15382	KCNE1_HUMAN	potassium voltage-gated channel, Isk-related family, member 1	128					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular response to cAMP (GO:0071320)|membrane repolarization (GO:0086009)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|protein N-linked glycosylation (GO:0006487)|protein O-linked glycosylation (GO:0006493)|regulation of delayed rectifier potassium channel activity (GO:1902259)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	potassium channel regulator activity (GO:0015459)|telethonin binding (GO:0031433)|voltage-gated potassium channel activity (GO:0005249)	p.S128S(1)		large_intestine(4)|lung(1)|ovary(2)	7					Indapamide(DB00808)	GGGTTCATGGGGAAGGCTTCG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	21											158.0	173.0	168.0					21																	35821549		2203	4299	6502	34743419	SO:0001819	synonymous_variant	3753			L28168	CCDS13636.1	21q22.1-q22.2	2014-09-17			ENSG00000180509	ENSG00000180509		"""Potassium channels"""	6240	protein-coding gene	gene with protein product		176261				8432548	Standard	NM_001127670		Approved	minK, ISK, JLNS2, LQT5	uc010gmp.4	P15382	OTTHUMG00000086236	ENST00000337385.3:c.384C>A	21.37:g.35821549G>T			34743419	A5H1P2|Q8N709|Q91Z94	Silent	SNP	ENST00000337385.3	37	CCDS13636.1	SNP	43	WashU																																																																																				0.502	KCNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194155.1			Silent
CYTH4	27128	genome.wustl.edu	37	22	37695333	37695333	+	Silent	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr22:37695333C>T	ENST00000248901.6	+	6	607	c.420C>T	c.(418-420)ctC>ctT	p.L140L	CYTH4_ENST00000402997.1_Silent_p.L140L|CYTH4_ENST00000439667.1_3'UTR|CYTH4_ENST00000405206.3_Silent_p.L140L	NM_013385.3	NP_037517.1	Q9UIA0	CYH4_HUMAN	cytohesin 4	140	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)	p.L140L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(2)|stomach(1)	15						ACCTCAACCTCGTCCAGGCCC	0.662																																																1	Substitution - coding silent(1)	ovary(1)	22											50.0	45.0	47.0					22																	37695333		2203	4300	6503	36025279	SO:0001819	synonymous_variant	27128			AF075458	CCDS13946.1	22q12.3-q13.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000100055	ENSG00000100055		"""Pleckstrin homology (PH) domain containing"""	9505	protein-coding gene	gene with protein product		606514	"""pleckstrin homology, Sec7 and coiled/coil domains 4"", ""pleckstrin homology, Sec7 and coiled-coil domains 4"""	PSCD4		10591208	Standard	NM_013385		Approved	CYT4, cytohesin-4	uc003arf.3	Q9UIA0	OTTHUMG00000150562	ENST00000248901.6:c.420C>T	22.37:g.37695333C>T			36025279	Q5R3F9|Q9UGT6	Silent	SNP	ENST00000248901.6	37	CCDS13946.1	SNP	31	WashU																																																																																				0.662	CYTH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318917.1			Silent
STK38	11329	genome.wustl.edu	37	6	36466221	36466221	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1021-01	TCGA-23-1021-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr6:36466221T>G	ENST00000229812.7	-	11	1280	c.995A>C	c.(994-996)aAg>aCg	p.K332T		NM_007271.2	NP_009202.1			serine/threonine kinase 38									p.K332T(1)		NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CATCACCTTCTTATATGTCTC	0.418																																					Colon(180;997 3561 16158)											1	Substitution - Missense(1)	ovary(1)	6											104.0	105.0	104.0					6																	36466221		2203	4300	6503	36574199	SO:0001583	missense	11329				CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.995A>C	6.37:g.36466221T>G	ENSP00000229812:p.Lys332Thr		36574199		Missense_Mutation	SNP	ENST00000229812.7	37	CCDS4822.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	20.7	4.039269	0.75617	.	.	ENSG00000112079	ENST00000229812	T	0.44083	0.93	5.91	5.91	0.95273	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.042888	0.85682	D	0.000000	T	0.29256	0.0728	L	0.33293	1	0.51233	D	0.999913	B	0.33940	0.433	B	0.40565	0.333	T	0.26467	-1.0102	10	0.87932	D	0	.	16.3469	0.83138	0.0:0.0:0.0:1.0	.	332	Q15208	STK38_HUMAN	T	332	ENSP00000229812:K332T	ENSP00000229812:K332T	K	-	2	0	STK38	36574199	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.663000	0.68038	2.263000	0.75096	0.528000	0.53228	AAG		0.418	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040346.1	NM_007271		Missense_Mutation
CLIP3	25999	genome.wustl.edu	37	19	36508804	36508804	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr19:36508804C>T	ENST00000360535.4	-	10	1500	c.1273G>A	c.(1273-1275)Gcg>Acg	p.A425T	AC002116.7_ENST00000586962.1_RNA|CLIP3_ENST00000593074.1_Missense_Mutation_p.A425T	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	425					chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)	p.A425T(1)		cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TTCTGGCCCGCGACAAGGACC	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											93.0	87.0	89.0					19																	36508804		2203	4300	6503	41200644	SO:0001583	missense	25999			AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.1273G>A	19.37:g.36508804C>T	ENSP00000353732:p.Ala425Thr		41200644	A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Missense_Mutation	SNP	ENST00000360535.4	37	CCDS12486.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	19.02	3.746692	0.69418	.	.	ENSG00000105270	ENST00000360535;ENST00000544037;ENST00000534959	D	0.91407	-2.84	4.44	4.44	0.53790	Cytoskeleton-associated protein, Gly-rich domain (3);	0.000000	0.85682	D	0.000000	D	0.88481	0.6448	N	0.25144	0.715	0.58432	D	0.999997	D	0.65815	0.995	P	0.54026	0.74	D	0.87748	0.2590	10	0.34782	T	0.22	-16.9113	14.5972	0.68415	0.0:1.0:0.0:0.0	.	425	Q96DZ5	CLIP3_HUMAN	T	425;307;401	ENSP00000353732:A425T	ENSP00000353732:A425T	A	-	1	0	CLIP3	41200644	1.000000	0.71417	0.062000	0.19696	0.731000	0.41821	5.234000	0.65343	2.305000	0.77605	0.561000	0.74099	GCG		0.622	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457426.1	NM_015526		Missense_Mutation
BMS1	9790	genome.wustl.edu	37	10	43289414	43289414	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr10:43289414G>T	ENST00000374518.5	+	9	1267	c.1204G>T	c.(1204-1206)Ggg>Tgg	p.G402W		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	402					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.G402W(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CAAGCCACTTGGGTCAGAGGA	0.408																																																1	Substitution - Missense(1)	ovary(1)	10											75.0	71.0	72.0					10																	43289414		2203	4300	6503	42609420	SO:0001583	missense	9790			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.1204G>T	10.37:g.43289414G>T	ENSP00000363642:p.Gly402Trp		42609420	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	g	21.9	4.217840	0.79352	.	.	ENSG00000165733	ENST00000374518	T	0.08896	3.04	5.66	5.66	0.87406	.	0.307408	0.39341	N	0.001396	T	0.28632	0.0709	M	0.67397	2.05	0.39361	D	0.965928	D	0.71674	0.998	D	0.66497	0.944	T	0.00507	-1.1699	10	0.56958	D	0.05	.	19.8188	0.96583	0.0:0.0:1.0:0.0	.	402	Q14692	BMS1_HUMAN	W	402	ENSP00000363642:G402W	ENSP00000363642:G402W	G	+	1	0	BMS1	42609420	1.000000	0.71417	0.974000	0.42286	0.889000	0.51656	5.541000	0.67212	2.678000	0.91216	0.644000	0.83932	GGG		0.408	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753		Missense_Mutation
HYI	81888	genome.wustl.edu	37	1	43917621	43917621	+	Missense_Mutation	SNP	C	C	T	rs373445250		TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr1:43917621C>T	ENST00000372425.4	-	4	685	c.490G>A	c.(490-492)Gac>Aac	p.D164N	HYI_ENST00000372426.1_Missense_Mutation_p.D116N|SZT2_ENST00000372442.1_3'UTR|SZT2_ENST00000562955.1_3'UTR|HYI_ENST00000372434.1_Missense_Mutation_p.D189N|HYI_ENST00000486909.1_Missense_Mutation_p.D164N|HYI_ENST00000372432.1_Missense_Mutation_p.D164N|HYI_ENST00000583037.1_Missense_Mutation_p.D91N|HYI-AS1_ENST00000444386.1_RNA			Q5T013	HYI_HUMAN	hydroxypyruvate isomerase (putative)	164							hydroxypyruvate isomerase activity (GO:0008903)	p.D91N(1)		large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	6	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGGGGCGTGTCCAGGAAGTAC	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											103.0	107.0	106.0					1																	43917621		2203	4300	6503	43690208	SO:0001583	missense	81888				CCDS488.1, CCDS488.2, CCDS53309.1, CCDS72771.1	1p34.2	2010-06-24	2010-06-24		ENSG00000178922	ENSG00000178922	5.3.1.22		26948	protein-coding gene	gene with protein product			"""hydroxypyruvate isomerase homolog (E. coli)"""			10561547	Standard	NM_031207		Approved	HT036	uc001cjo.3	Q5T013	OTTHUMG00000007502	ENST00000372425.4:c.490G>A	1.37:g.43917621C>T	ENSP00000361502:p.Asp164Asn		43690208	D3DPX4|D3DPX5|Q5Q9A2|Q7Z778|Q96S83|Q9BZR3|Q9BZR4	Missense_Mutation	SNP	ENST00000372425.4	37	CCDS53309.1	SNP	30	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.783|6.783	0.513396|0.513396	0.12944|0.12944	.|.	.|.	ENSG00000178922|ENSG00000178922	ENST00000372425;ENST00000372433;ENST00000372434;ENST00000372430;ENST00000372432;ENST00000372427;ENST00000372426;ENST00000486909|ENST00000470662;ENST00000487366	T;T;T;T|.	0.38722|.	1.12;1.12;1.12;1.12|.	5.38|5.38	5.38|5.38	0.77491|0.77491	Xylose isomerase-like, TIM barrel domain (2);Xylose isomerase, TIM barrel domain (1);|.	0.142024|.	0.64402|.	D|.	0.000007|.	T|.	0.24431|.	0.0592|.	N|N	0.03281|0.03281	-0.365|-0.365	0.43555|0.43555	D|D	0.995866|0.995866	B|.	0.12013|.	0.005|.	B|.	0.16289|.	0.015|.	T|.	0.14309|.	-1.0477|.	10|.	0.02654|.	T|.	1|.	.|.	7.3451|7.3451	0.26658|0.26658	0.0:0.7958:0.0:0.2042|0.0:0.7958:0.0:0.2042	.|.	164|.	Q5T013|.	HYI_HUMAN|.	N|X	164;82;116;91;164;97;116;164|82;87	ENSP00000361502:D164N;ENSP00000361509:D164N;ENSP00000361503:D116N;ENSP00000428399:D164N|.	ENSP00000361502:D164N|.	D|W	-|-	1|3	0|0	HYI|HYI	43690208|43690208	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	2.889000|2.889000	0.48601|0.48601	2.700000|2.700000	0.92200|0.92200	0.462000|0.462000	0.41574|0.41574	GAC|TGG		0.597	HYI-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_031207		Missense_Mutation
RYR1	6261	genome.wustl.edu	37	19	39075642	39075642	+	Silent	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr19:39075642C>T	ENST00000359596.3	+	102	14706	c.14706C>T	c.(14704-14706)atC>atT	p.I4902I	RYR1_ENST00000355481.4_Silent_p.I4897I|RYR1_ENST00000360985.3_Silent_p.I4897I			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4902					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.I4902I(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGGACGAGATCGAGGACCCCG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	19											233.0	184.0	201.0					19																	39075642		2203	4300	6503	43767482	SO:0001819	synonymous_variant	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14706C>T	19.37:g.39075642C>T			43767482	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1	SNP	31	WashU																																																																																				0.562	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			Silent
C21orf2	755	genome.wustl.edu	37	21	45751842	45751842	+	Silent	SNP	C	C	T	rs369370304		TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	T	C	T	Unknown	Valid	Germline	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr21:45751842C>T	ENST00000339818.4	-	5	636	c.429G>A	c.(427-429)gcG>gcA	p.A143A	C21orf2_ENST00000397956.3_Silent_p.A143A|C21orf2_ENST00000496321.1_5'UTR|AP001062.7_ENST00000448927.1_RNA|C21orf2_ENST00000325223.7_Silent_p.A143A|AP001062.8_ENST00000422357.1_RNA	NM_001271440.1|NM_004928.2	NP_001258369.1|NP_004919.1	O43822	CU002_HUMAN	chromosome 21 open reading frame 2	143					cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				endometrium(2)	2				Colorectal(79;0.0806)		TCTCTGGGGCCGCAGTGATCT	0.637													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19462	0.0		0.0	False		,,,				2504	0.0															0			21						C		1,4405	2.1+/-5.4	0,1,2202	82.0	64.0	70.0		429	-7.2	0.0	21		70	0,8600		0,0,4300	no	coding-synonymous	C21orf2	NM_004928.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		143/257	45751842	1,13005	2203	4300	6503	44576270	SO:0001819	synonymous_variant	755			Y11392	CCDS13709.1, CCDS59444.1, CCDS59445.1	21q22.3	2014-03-24			ENSG00000160226	ENSG00000160226			1260	protein-coding gene	gene with protein product	"""nuclear encoded mitochondrial protein"", ""leucine rich repeat containing 76"""	603191				9465297	Standard	NM_004928		Approved	YF5, A2, LRRC76	uc002zeq.2	O43822	OTTHUMG00000086909	ENST00000339818.4:c.429G>A	21.37:g.45751842C>T			44576270	A8MPS9|O14993|Q8N5X6|Q99837|Q99838	Silent	SNP	ENST00000339818.4	37	CCDS13709.1	SNP	23	WashU																																																																																				0.637	C21orf2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195799.1	NM_004928		Silent
HTR2A	3356	genome.wustl.edu	37	13	47409196	47409196	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1021-01	TCGA-23-1021-10	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr13:47409196G>C	ENST00000378688.4	-	3	1323	c.1192C>G	c.(1192-1194)Cag>Gag	p.Q398E	HTR2A_ENST00000542664.1_Missense_Mutation_p.Q398E|HTR2A_ENST00000543956.1_Missense_Mutation_p.Q314E			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	398					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.Q398E(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TCCTTGTACTGACACTGAATA	0.398																																																1	Substitution - Missense(1)	ovary(1)	13											138.0	132.0	134.0					13																	47409196		2203	4300	6503	46307197	SO:0001583	missense	3356			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.1192C>G	13.37:g.47409196G>C	ENSP00000367959:p.Gln398Glu		46307197	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	ENST00000378688.4	37	CCDS9405.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122593	0.37436	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.37235	1.21;1.21;1.21	5.61	5.61	0.85477	.	0.191349	0.46758	D	0.000278	T	0.39410	0.1077	M	0.61703	1.905	0.34826	D	0.739197	B;B	0.24963	0.115;0.0	B;B	0.25614	0.062;0.004	T	0.43572	-0.9383	10	0.21014	T	0.42	.	19.074	0.93151	0.0:0.0:1.0:0.0	.	314;398	F5GWE8;P28223	.;5HT2A_HUMAN	E	398;314;398	ENSP00000367959:Q398E;ENSP00000441861:Q314E;ENSP00000437737:Q398E	ENSP00000367959:Q398E	Q	-	1	0	HTR2A	46307197	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.540000	0.82074	2.823000	0.97156	0.644000	0.83932	CAG		0.398	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621		Missense_Mutation
SLC9A7	84679	genome.wustl.edu	37	X	46521558	46521558	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1021-01	TCGA-23-1021-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chrX:46521558T>G	ENST00000328306.4	-	7	959	c.934A>C	c.(934-936)Act>Cct	p.T312P		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	312					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)	p.T312P(1)		breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						AAGGCGTGAGTGTTCAGTCCC	0.413																																					Pancreas(118;454 1696 1930 13865 39976)											1	Substitution - Missense(1)	ovary(1)	X											60.0	49.0	53.0					X																	46521558		2203	4300	6503	46406502	SO:0001583	missense	84679			AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.934A>C	X.37:g.46521558T>G	ENSP00000330320:p.Thr312Pro		46406502	O75827|Q5JXP9	Missense_Mutation	SNP	ENST00000328306.4	37	CCDS14269.1	SNP	59	WashU	.	.	.	.	.	.	.	.	.	.	T	16.36	3.101983	0.56183	.	.	ENSG00000065923	ENST00000328306	T	0.57595	0.39	5.02	3.77	0.43336	Cation/H+ exchanger (1);	0.099738	0.64402	D	0.000002	T	0.39682	0.1087	N	0.03324	-0.35	0.58432	D	0.999998	P;B	0.40230	0.708;0.009	P;B	0.53313	0.723;0.008	T	0.28235	-1.0050	10	0.22706	T	0.39	.	10.148	0.42776	0.1513:0.0:0.0:0.8487	.	83;312	B3KPP8;Q96T83	.;SL9A7_HUMAN	P	312	ENSP00000330320:T312P	ENSP00000330320:T312P	T	-	1	0	SLC9A7	46406502	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.765000	0.68834	1.785000	0.52413	0.486000	0.48141	ACT		0.413	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591		Missense_Mutation
FAIM2	23017	genome.wustl.edu	37	12	50282968	50282968	+	Silent	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr12:50282968G>A	ENST00000320634.3	-	10	763	c.669C>T	c.(667-669)tgC>tgT	p.C223C	FAIM2_ENST00000550890.1_Silent_p.C177C	NM_012306.3	NP_036438.2	Q9BWQ8	LFG2_HUMAN	Fas apoptotic inhibitory molecule 2	223					apoptotic process (GO:0006915)|cerebellar granular layer development (GO:0021681)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum development (GO:0021549)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of neuron apoptotic process (GO:0043523)|response to ischemia (GO:0002931)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|postsynaptic membrane (GO:0045211)		p.C223C(1)		endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|skin(2)	14						GCACGCCCTGGCAGGAGGTGA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	12											82.0	70.0	74.0					12																	50282968		2203	4300	6503	48569235	SO:0001819	synonymous_variant	23017			AB023167	CCDS8791.1	12q13	2010-03-18				ENSG00000135472			17067	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 2"""	604306				10231032, 10535980	Standard	NM_012306		Approved	KIAA0950, LFG, NMP35, LIFEGUARD, TMBIM2, LFG2	uc001rvj.2	Q9BWQ8	OTTHUMG00000169808	ENST00000320634.3:c.669C>T	12.37:g.50282968G>A			48569235	A8K1W6|B3KR08|Q9UJY9|Q9Y2F7	Silent	SNP	ENST00000320634.3	37	CCDS8791.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	20.9	4.064934	0.76187	.	.	ENSG00000135472	ENST00000552863	.	.	.	4.61	3.7	0.42460	.	.	.	.	.	T	0.57975	0.2090	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53373	-0.8448	4	.	.	.	-14.7913	7.8711	0.29567	0.1186:0.0:0.8814:0.0	.	.	.	.	S	92	.	.	P	-	1	0	FAIM2	48569235	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	1.736000	0.38187	0.915000	0.36847	0.462000	0.41574	CCA		0.597	FAIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405984.1	NM_012306		Silent
SMARCD1	6602	genome.wustl.edu	37	12	50492572	50492572	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr12:50492572G>A	ENST00000394963.4	+	12	1866	c.1468G>A	c.(1468-1470)Gct>Act	p.A490T	SMARCD1_ENST00000381513.4_Missense_Mutation_p.A449T|SMARCD1_ENST00000548573.1_Missense_Mutation_p.A288T	NM_003076.4	NP_003067.3			SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1									p.A451T(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	18						GGCTCAGGAGGCTGTGTGCCG	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											82.0	76.0	78.0					12																	50492572		2203	4300	6503	48778839	SO:0001583	missense	6602			U66617	CCDS8797.2, CCDS8798.2	12q13-q14	2008-08-05			ENSG00000066117	ENSG00000066117			11106	protein-coding gene	gene with protein product		601735				8804307, 9693044, 12917342	Standard	NM_003076		Approved	BAF60A, Rsc6p, CRACD1	uc001rvx.4	Q96GM5	OTTHUMG00000150194	ENST00000394963.4:c.1468G>A	12.37:g.50492572G>A	ENSP00000378414:p.Ala490Thr		48778839		Missense_Mutation	SNP	ENST00000394963.4	37	CCDS8797.2	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	27.8	4.868535	0.91587	.	.	ENSG00000066117	ENST00000394963;ENST00000381513;ENST00000542914;ENST00000548573	T;T	0.60040	0.22;0.78	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.82857	0.5128	M	0.94021	3.485	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.998	D;D;D	0.87578	0.979;0.998;0.98	D	0.86749	0.1959	10	0.72032	D	0.01	-11.5665	19.1359	0.93428	0.0:0.0:1.0:0.0	.	288;449;490	F8VRQ4;Q96GM5-2;Q96GM5	.;.;SMRD1_HUMAN	T	490;449;266;288	ENSP00000378414:A490T;ENSP00000370924:A449T	ENSP00000370924:A449T	A	+	1	0	SMARCD1	48778839	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.657000	0.98554	2.837000	0.97791	0.591000	0.81541	GCT		0.562	SMARCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316759.2	NM_003076		Missense_Mutation
USP19	10869	genome.wustl.edu	37	3	49148453	49148453	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr3:49148453C>T	ENST00000398888.2	-	22	3484	c.3166G>A	c.(3166-3168)Ggc>Agc	p.G1056S	USP19_ENST00000453664.1_Missense_Mutation_p.G1147S|USP19_ENST00000434032.2_Missense_Mutation_p.G1157S|USP19_ENST00000398898.2_Missense_Mutation_p.G1096S|USP19_ENST00000398896.1_Missense_Mutation_p.G864S|USP19_ENST00000417901.1_Missense_Mutation_p.G1159S|USP19_ENST00000398892.3_Missense_Mutation_p.G1096S	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	1056	USP.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)	p.G1144S(1)		NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GTGAAGTGGCCGGCCCGGGCA	0.617																																																1	Substitution - Missense(1)	ovary(1)	3											53.0	63.0	60.0					3																	49148453		1983	4160	6143	49123457	SO:0001583	missense	10869			AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.3166G>A	3.37:g.49148453C>T	ENSP00000381863:p.Gly1056Ser		49123457	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	37	CCDS43090.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	26.7	4.763798	0.89932	.	.	ENSG00000172046	ENST00000398896;ENST00000398898;ENST00000417901;ENST00000453664;ENST00000398892;ENST00000398888;ENST00000434032	T;T;T;T;T;T;T	0.22336	1.98;1.97;2.06;2.06;1.96;2.1;2.07	5.76	5.76	0.90799	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.045788	0.85682	D	0.000000	T	0.41305	0.1153	L	0.42529	1.33	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;0.999	T	0.02037	-1.1225	10	0.33141	T	0.24	-16.9909	19.9857	0.97347	0.0:1.0:0.0:0.0	.	1157;1147;1056;1096;864	E9PEG8;E7EN22;O94966;B5MEG5;E7ESU0	.;.;UBP19_HUMAN;.;.	S	864;1096;1159;1147;1096;1056;1157	ENSP00000381870:G864S;ENSP00000381872:G1096S;ENSP00000395260:G1159S;ENSP00000400090:G1147S;ENSP00000381867:G1096S;ENSP00000381863:G1056S;ENSP00000401197:G1157S	ENSP00000381863:G1056S	G	-	1	0	USP19	49123457	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.388000	0.79795	2.706000	0.92434	0.655000	0.94253	GGC		0.617	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677		Missense_Mutation
CLCN5	1184	genome.wustl.edu	37	X	49850698	49850698	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1021-01	TCGA-23-1021-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chrX:49850698T>A	ENST00000307367.2	+	7	1076	c.785T>A	c.(784-786)gTa>gAa	p.V262E	CLCN5_ENST00000376088.3_Missense_Mutation_p.V332E|CLCN5_ENST00000376091.3_Missense_Mutation_p.V332E|CLCN5_ENST00000376108.3_Missense_Mutation_p.V262E			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	262					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.V262E(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					ATAGGTGGAGTATTATTCAGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	X											167.0	142.0	151.0					X																	49850698		2203	4300	6503	49737438	SO:0001583	missense	1184			X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.785T>A	X.37:g.49850698T>A	ENSP00000304257:p.Val262Glu		49737438	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	37	CCDS14328.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	21.8	4.199903	0.79015	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.94897	-3.55;-3.55;-3.55;-3.55	6.04	6.04	0.98038	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.98563	0.9520	H	0.99238	4.48	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	D	0.99429	1.0935	10	0.87932	D	0	-16.9653	14.4009	0.67044	0.0:0.0:0.0:1.0	.	262;332	P51795;P51795-2	CLCN5_HUMAN;.	E	332;164;332;262;262	ENSP00000365256:V332E;ENSP00000365259:V332E;ENSP00000365276:V262E;ENSP00000304257:V262E	ENSP00000304257:V262E	V	+	2	0	CLCN5	49737438	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	7.910000	0.87451	2.047000	0.60756	0.430000	0.28490	GTA		0.403	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1			Missense_Mutation
AGAP7P	653268	genome.wustl.edu	37	10	51464832	51464832	+	Missense_Mutation	SNP	G	G	A	rs201336718		TCGA-23-1021-01	TCGA-23-1021-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr10:51464832G>A	ENST00000374095.5	-	7	1749	c.1624C>T	c.(1624-1626)Cgg>Tgg	p.R542W		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		542	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.R542W(1)		kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						CGGATCCACCGTTCCTTCTCT	0.567																																																1	Substitution - Missense(1)	ovary(1)	10											102.0	122.0	115.0					10																	51464832		2197	4296	6493	51134838	SO:0001583	missense	0																														ENST00000374095.5:c.1624C>T	10.37:g.51464832G>A	ENSP00000363208:p.Arg542Trp		51134838	A6NGH4	Missense_Mutation	SNP	ENST00000374095.5	37	CCDS41524.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	.	4.642	0.119289	0.08881	.	.	ENSG00000204169	ENST00000374095	T	0.45276	0.9	.	.	.	.	0.299915	0.36854	N	0.002361	T	0.44456	0.1294	M	0.91300	3.195	0.51012	D	0.999903	B	0.17465	0.022	B	0.24269	0.052	T	0.11518	-1.0584	9	0.49607	T	0.09	.	4.7371	0.12993	0.3267:0.0:0.6733:0.0	.	542	Q5VUJ5	AGAP7_HUMAN	W	542	ENSP00000363208:R542W	ENSP00000363208:R542W	R	-	1	2	AGAP7	51134838	1.000000	0.71417	0.027000	0.17364	0.028000	0.11728	2.209000	0.42806	-1.187000	0.02709	-1.176000	0.01726	CGG		0.567	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048033.1			Missense_Mutation
DHX34	9704	genome.wustl.edu	37	19	47861378	47861378	+	Splice_Site	SNP	G	G	C			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr19:47861378G>C	ENST00000328771.4	+	4	1621		c.e4+1		DHX34_ENST00000471451.1_Splice_Site	NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34						negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.?(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CCAGGACAAGGTATCACAGGA	0.662																																																1	Unknown(1)	ovary(1)	19											21.0	22.0	22.0					19																	47861378		2203	4297	6500	52553216	SO:0001630	splice_region_variant	9704			D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.1272+1G>C	19.37:g.47861378G>C			52553216	B4DMY8	Splice_Site_SNP	SNP	ENST00000328771.4	37	CCDS12700.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	17.66	3.445266	0.63178	.	.	ENSG00000134815	ENST00000328771	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3613	0.87351	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DHX34	52553216	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	9.317000	0.96327	2.381000	0.81170	0.455000	0.32223	.		0.662	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	Intron	Splice_Site_SNP
TRPM4	54795	genome.wustl.edu	37	19	49692251	49692251	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1021-01	TCGA-23-1021-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr19:49692251T>C	ENST00000252826.5	+	14	2048	c.1922T>C	c.(1921-1923)cTc>cCc	p.L641P	TRPM4_ENST00000427978.2_Missense_Mutation_p.L641P|TRPM4_ENST00000355712.5_Missense_Mutation_p.L287P	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	641					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)	p.L641P(1)		breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		GCTGCCCGCCTCCTCCTCCGT	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											84.0	91.0	89.0					19																	49692251		2203	4300	6503	54384063	SO:0001583	missense	54795			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.1922T>C	19.37:g.49692251T>C	ENSP00000252826:p.Leu641Pro		54384063	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	ENST00000252826.5	37	CCDS33073.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	t	19.74	3.883042	0.72410	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	D;D;D	0.88586	-2.4;-2.4;-2.4	4.32	4.32	0.51571	.	0.184216	0.35013	N	0.003501	D	0.93943	0.8061	M	0.80847	2.515	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.999;0.987	D	0.94583	0.7781	10	0.87932	D	0	-4.7145	12.8427	0.57813	0.0:0.0:0.0:1.0	.	287;467;641;641	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	P	641;641;287	ENSP00000252826:L641P;ENSP00000407492:L641P;ENSP00000347944:L287P	ENSP00000252826:L641P	L	+	2	0	TRPM4	54384063	0.981000	0.34729	0.051000	0.19133	0.114000	0.19823	6.963000	0.76055	1.750000	0.51863	0.373000	0.22412	CTC		0.632	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	NM_017636		Missense_Mutation
DGKA	1606	genome.wustl.edu	37	12	56334146	56334146	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr12:56334146G>T	ENST00000331886.5	+	11	1301	c.847G>T	c.(847-849)Gac>Tac	p.D283Y	DGKA_ENST00000551156.1_Missense_Mutation_p.D283Y|DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000394147.1_Missense_Mutation_p.D283Y	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	283					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)	p.D283Y(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	CGGGCGCTGCGACCGCTGTCA	0.587											OREG0021913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	12											120.0	114.0	116.0					12																	56334146		2203	4300	6503	54620413	SO:0001583	missense	1606			AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.847G>T	12.37:g.56334146G>T	ENSP00000328405:p.Asp283Tyr	1014	54620413	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	ENST00000331886.5	37	CCDS8896.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	32	5.106779	0.94292	.	.	ENSG00000065357	ENST00000331886;ENST00000555218;ENST00000394147;ENST00000551156	D;D;D;D	0.93366	-3.21;-3.21;-3.21;-3.21	5.21	5.21	0.72293	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.154081	0.53938	D	0.000042	D	0.94683	0.8285	L	0.38175	1.15	0.80722	D	1	D;D;D	0.76494	0.983;0.999;0.994	P;D;D	0.68943	0.747;0.941;0.961	D	0.94878	0.8036	10	0.66056	D	0.02	.	18.063	0.89383	0.0:0.0:1.0:0.0	.	202;283;283	G3V4E1;B4E0C6;P23743	.;.;DGKA_HUMAN	Y	283;202;283;283	ENSP00000328405:D283Y;ENSP00000451743:D202Y;ENSP00000377703:D283Y;ENSP00000450359:D283Y	ENSP00000328405:D283Y	D	+	1	0	DGKA	54620413	1.000000	0.71417	0.979000	0.43373	0.971000	0.66376	4.952000	0.63618	2.871000	0.98454	0.655000	0.94253	GAC		0.587	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1			Missense_Mutation
OR8U1	219417	genome.wustl.edu	37	11	56143230	56143230	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr11:56143230G>A	ENST00000302270.1	+	1	131	c.131G>A	c.(130-132)gGt>gAt	p.G44D		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G44D(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					GGCAACTTGGGTTTGATCCTA	0.428																																																1	Substitution - Missense(1)	ovary(1)	11											310.0	275.0	286.0					11																	56143230		1941	4150	6091	55899806	SO:0001583	missense	219417			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.131G>A	11.37:g.56143230G>A	ENSP00000304188:p.Gly44Asp		55899806		Missense_Mutation	SNP	ENST00000302270.1	37	CCDS41647.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	11.47	1.647158	0.29246	.	.	ENSG00000172199	ENST00000302270	T	0.01084	5.36	5.78	5.78	0.91487	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000162	T	0.10337	0.0253	M	0.93854	3.465	0.09310	N	1	D	0.76494	0.999	D	0.79784	0.993	T	0.09443	-1.0674	10	0.87932	D	0	.	13.92	0.63926	0.0:0.0:0.8481:0.1519	.	44	Q8NH10	OR8U1_HUMAN	D	44	ENSP00000304188:G44D	ENSP00000304188:G44D	G	+	2	0	OR8U1	55899806	0.000000	0.05858	0.190000	0.23270	0.002000	0.02628	0.473000	0.22132	2.743000	0.94032	0.643000	0.83706	GGT		0.428	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391607.1	NM_001005204		Missense_Mutation
ZNF479	90827	genome.wustl.edu	37	7	57188088	57188088	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1021-01	TCGA-23-1021-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr7:57188088C>G	ENST00000331162.4	-	5	1304	c.1034G>C	c.(1033-1035)aGa>aCa	p.R345T		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R345I(1)|p.R345T(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			AGTATGAATTCTCTTATGTCT	0.443																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	7											22.0	23.0	23.0					7																	57188088		2072	4243	6315	57192030	SO:0001583	missense	90827			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1034G>C	7.37:g.57188088C>G	ENSP00000333776:p.Arg345Thr		57192030		Missense_Mutation	SNP	ENST00000331162.4	37	CCDS43590.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	c	8.464	0.856076	0.17106	.	.	ENSG00000185177	ENST00000331162	T	0.02421	4.3	0.946	-0.375	0.12509	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05090	0.0136	M	0.75615	2.305	0.23879	N	0.99658	D	0.55172	0.97	P	0.44477	0.451	T	0.20338	-1.0278	9	0.66056	D	0.02	.	5.3914	0.16245	0.551:0.449:0.0:0.0	.	345	Q96JC4	ZN479_HUMAN	T	345	ENSP00000333776:R345T	ENSP00000333776:R345T	R	-	2	0	ZNF479	57192030	0.000000	0.05858	0.014000	0.15608	0.014000	0.08584	-0.467000	0.06664	-1.303000	0.02332	-1.323000	0.01288	AGA		0.443	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		Missense_Mutation
CEP95	90799	genome.wustl.edu	37	17	62523310	62523310	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1021-01	TCGA-23-1021-10	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr17:62523310G>C	ENST00000556440.2	+	11	1744	c.1234G>C	c.(1234-1236)Gat>Cat	p.D412H	CEP95_ENST00000577476.1_3'UTR|CEP95_ENST00000553412.1_Missense_Mutation_p.D248H	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	412						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)		p.D412H(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						GGAGGTAGAGGATGGAACTGA	0.438																																																1	Substitution - Missense(1)	ovary(1)	17											96.0	92.0	93.0					17																	62523310		1974	4155	6129	59953772	SO:0001583	missense	90799			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.1234G>C	17.37:g.62523310G>C	ENSP00000450461:p.Asp412His		59953772	B4DMD2|Q96M81	Missense_Mutation	SNP	ENST00000556440.2	37	CCDS45763.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117579	0.37339	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	T;T	0.36520	1.25;1.26	3.69	-1.17	0.09648	.	1.141510	0.06187	N	0.680584	T	0.19927	0.0479	N	0.08118	0	0.09310	N	1	P	0.36249	0.545	B	0.41946	0.371	T	0.17806	-1.0357	10	0.72032	D	0.01	0.1691	0.3191	0.00300	0.3809:0.1957:0.2335:0.1898	.	412	Q96GE4	CEP95_HUMAN	H	347;412;248	ENSP00000450461:D412H;ENSP00000450906:D248H	ENSP00000438458:D347H	D	+	1	0	CEP95	59953772	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.102000	0.15272	-0.271000	0.09272	-1.078000	0.02229	GAT		0.438	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445100.2	NM_138363		Missense_Mutation
NLRP13	126204	genome.wustl.edu	37	19	56423125	56423125	+	Silent	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr19:56423125C>T	ENST00000342929.3	-	5	2057	c.2058G>A	c.(2056-2058)aaG>aaA	p.K686K	NLRP13_ENST00000588751.1_Silent_p.K686K	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	686							ATP binding (GO:0005524)	p.K686K(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		AAAGCCTTAGCTTATTTAACC	0.383																																																1	Substitution - coding silent(1)	ovary(1)	19											90.0	96.0	94.0					19																	56423125		2203	4300	6503	61114937	SO:0001819	synonymous_variant	126204			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.2058G>A	19.37:g.56423125C>T			61114937	Q7RTR5	Silent	SNP	ENST00000342929.3	37	CCDS33119.1	SNP	28	WashU																																																																																				0.383	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810		Silent
CDH7	1005	genome.wustl.edu	37	18	63547997	63547997	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr18:63547997C>T	ENST00000397968.2	+	12	2651	c.2225C>T	c.(2224-2226)gCt>gTt	p.A742V	CDH7_ENST00000323011.3_Missense_Mutation_p.A742V	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	742					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A742V(1)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GGCTCAGTTGCTGAATCACTC	0.443																																																1	Substitution - Missense(1)	ovary(1)	18											100.0	103.0	102.0					18																	63547997		2203	4300	6503	61698977	SO:0001583	missense	1005			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.2225C>T	18.37:g.63547997C>T	ENSP00000381058:p.Ala742Val		61698977	Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	CCDS11993.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	15.96	2.988058	0.53934	.	.	ENSG00000081138	ENST00000323011;ENST00000397966;ENST00000397968	D;D	0.81908	-1.55;-1.55	5.37	5.37	0.77165	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.91496	0.7315	M	0.76938	2.355	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92179	0.5750	10	0.72032	D	0.01	.	19.1123	0.93321	0.0:1.0:0.0:0.0	.	742	Q9ULB5	CADH7_HUMAN	V	742	ENSP00000319166:A742V;ENSP00000381058:A742V	ENSP00000319166:A742V	A	+	2	0	CDH7	61698977	1.000000	0.71417	0.218000	0.23776	0.046000	0.14306	7.818000	0.86416	2.515000	0.84797	0.655000	0.94253	GCT		0.443	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646		Missense_Mutation
SLC22A8	9376	genome.wustl.edu	37	11	62767255	62767255	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr11:62767255C>G	ENST00000336232.2	-	4	632	c.497G>C	c.(496-498)gGt>gCt	p.G166A	SLC22A8_ENST00000542795.1_5'UTR|SLC22A8_ENST00000311438.8_Missense_Mutation_p.G166A|SLC22A8_ENST00000430500.2_Missense_Mutation_p.G166A|SLC22A8_ENST00000545207.1_Missense_Mutation_p.G75A|SLC22A8_ENST00000535878.1_Missense_Mutation_p.G43A	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	166					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)	p.G166A(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GAAGGCTGCACCGGAGCCGCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	11											52.0	54.0	53.0					11																	62767255		2201	4298	6499	62523831	SO:0001583	missense	9376			AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.497G>C	11.37:g.62767255C>G	ENSP00000337335:p.Gly166Ala		62523831	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	ENST00000336232.2	37	CCDS8042.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	6.758	0.508688	0.12883	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000311438;ENST00000430500	T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81;-0.81	5.45	4.53	0.55603	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.323361	0.37393	N	0.002107	T	0.51822	0.1697	N	0.05330	-0.07	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.25614	0.037;0.062	T	0.30822	-0.9965	10	0.07030	T	0.85	.	11.4959	0.50408	0.1796:0.8204:0.0:0.0	.	166;166	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	A	166;152;75;43;166;166	ENSP00000337335:G166A;ENSP00000441658:G75A;ENSP00000443368:G43A;ENSP00000311463:G166A;ENSP00000398548:G166A	ENSP00000311463:G166A	G	-	2	0	SLC22A8	62523831	0.001000	0.12720	0.001000	0.08648	0.879000	0.50718	1.476000	0.35420	1.287000	0.44583	0.511000	0.50034	GGT		0.612	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254		Missense_Mutation
SIPA1L1	26037	genome.wustl.edu	37	14	72055680	72055680	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr14:72055680C>G	ENST00000555818.1	+	2	1439	c.1091C>G	c.(1090-1092)tCc>tGc	p.S364C	SIPA1L1_ENST00000381232.3_Missense_Mutation_p.S364C|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.S364C	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	364					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)	p.S364C(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ACTGGAGCTTCCGCAGCTGCC	0.473																																																1	Substitution - Missense(1)	ovary(1)	14											57.0	60.0	59.0					14																	72055680		2203	4300	6503	71125433	SO:0001583	missense	26037			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.1091C>G	14.37:g.72055680C>G	ENSP00000450832:p.Ser364Cys		71125433	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	37	CCDS9807.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	14.97	2.693670	0.48202	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550	D;D;D	0.90788	-2.73;-2.68;-2.73	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.95853	0.8650	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	0.995;1.0;0.99	D	0.95452	0.8535	10	0.87932	D	0	-9.8067	20.6593	0.99626	0.0:1.0:0.0:0.0	.	364;364;364	A6H8W6;O43166-2;O43166	.;.;SI1L1_HUMAN	C	364	ENSP00000370630:S364C;ENSP00000450832:S364C;ENSP00000351352:S364C	ENSP00000351352:S364C	S	+	2	0	SIPA1L1	71125433	1.000000	0.71417	0.741000	0.31004	0.026000	0.11368	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	TCC		0.473	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556		Missense_Mutation
DCK	1633	genome.wustl.edu	37	4	71888090	71888090	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1021-01	TCGA-23-1021-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr4:71888090A>G	ENST00000286648.5	+	3	611	c.214A>G	c.(214-216)Aca>Gca	p.T72A	MOB1B_ENST00000511449.1_3'UTR|DCK_ENST00000504730.1_Missense_Mutation_p.T72A|DCK_ENST00000504952.1_Missense_Mutation_p.T72A	NM_000788.2	NP_000779.1	P27707	DCK_HUMAN	deoxycytidine kinase	72					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxycytidine kinase activity (GO:0004137)|drug binding (GO:0008144)|nucleoside kinase activity (GO:0019206)|protein homodimerization activity (GO:0042803)	p.T72A(1)		endometrium(2)|large_intestine(3)|lung(3)|ovary(1)	9			Lung(101;0.235)		Cladribine(DB00242)|Clofarabine(DB00631)|Cytarabine(DB00987)|Decitabine(DB01262)|Emtricitabine(DB00879)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Lamivudine(DB00709)|Nelarabine(DB01280)|Pemetrexed(DB00642)|Zalcitabine(DB00943)	ATAGGAACTTACAATGTCTCA	0.313																																																1	Substitution - Missense(1)	ovary(1)	4											80.0	80.0	80.0					4																	71888090		2203	4300	6503	72106954	SO:0001583	missense	1633			M60527	CCDS3548.1	4q13.3-q21.1	2008-02-05			ENSG00000156136	ENSG00000156136	2.7.1.74		2704	protein-coding gene	gene with protein product		125450				8406512	Standard	NM_000788		Approved		uc003hfx.3	P27707	OTTHUMG00000129908	ENST00000286648.5:c.214A>G	4.37:g.71888090A>G	ENSP00000286648:p.Thr72Ala		72106954	B2R8V6|Q5TZY7|Q6FI11	Missense_Mutation	SNP	ENST00000286648.5	37	CCDS3548.1	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	14.13	2.442708	0.43326	.	.	ENSG00000156136	ENST00000286648;ENST00000504730;ENST00000504952	D;D;D	0.98876	-5.2;-4.71;-5.17	5.96	4.71	0.59529	.	0.044791	0.85682	D	0.000000	D	0.96204	0.8762	L	0.45422	1.42	0.58432	D	0.999999	B	0.19445	0.036	B	0.16722	0.016	D	0.93953	0.7233	10	0.23891	T	0.37	.	10.8517	0.46773	0.7649:0.0:0.0:0.2351	.	72	P27707	DCK_HUMAN	A	72	ENSP00000286648:T72A;ENSP00000425578:T72A;ENSP00000421508:T72A	ENSP00000286648:T72A	T	+	1	0	DCK	72106954	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	4.777000	0.62361	2.279000	0.76181	0.533000	0.62120	ACA		0.313	DCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252159.2			Missense_Mutation
Unknown	0	genome.wustl.edu	37	10	72554206	72554206	+	IGR	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr10:72554206C>T								TBATA (9049 upstream) : SGPL1 (21510 downstream)																							GCATCGGGCACAGTTCATGCA	0.507																																																0			10																																								72224212	SO:0001628	intergenic_variant	338611																															10.37:g.72554206C>T			72224212		Missense_Mutation	SNP		37		SNP	17	WashU																																																																																			0	0.507									Missense_Mutation
ZCCHC6	79670	genome.wustl.edu	37	9	88937965	88937965	+	Silent	SNP	G	G	T			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr9:88937965G>T	ENST00000375963.3	-	13	2872	c.2700C>A	c.(2698-2700)ggC>ggA	p.G900G	ZCCHC6_ENST00000469004.1_5'Flank|ZCCHC6_ENST00000375961.2_Silent_p.G900G|ZCCHC6_ENST00000277141.6_Silent_p.G189G|ZCCHC6_ENST00000375960.2_Silent_p.G777G	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	900	Glu-rich.			G -> V (in Ref. 1; CAI45944). {ECO:0000305}.	RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.G900G(2)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TAGCAGCTTCGCCTAACTCAT	0.423																																																2	Substitution - coding silent(2)	ovary(1)|endometrium(1)	9											173.0	147.0	156.0					9																	88937965		2203	4300	6503	88127785	SO:0001819	synonymous_variant	79670			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.2700C>A	9.37:g.88937965G>T			88127785	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Silent	SNP	ENST00000375963.3	37	CCDS35057.1	SNP	38	WashU																																																																																				0.423	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617		Silent
FAT3	120114	genome.wustl.edu	37	11	92568103	92568103	+	Silent	SNP	C	C	A			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr11:92568103C>A	ENST00000298047.6	+	14	9956	c.9939C>A	c.(9937-9939)gcC>gcA	p.A3313A	FAT3_ENST00000409404.2_Silent_p.A3313A|FAT3_ENST00000525166.1_Silent_p.A3163A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3313	Cadherin 30. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A3313A(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TAGTGGAAGCCAAAGATGGGG	0.463										TCGA Ovarian(4;0.039)																																						1	Substitution - coding silent(1)	ovary(1)	11											37.0	38.0	38.0					11																	92568103		1890	4122	6012	92207751	SO:0001819	synonymous_variant	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.9939C>A	11.37:g.92568103C>A			92207751	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37		SNP	21	WashU																																																																																				0.463	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		Silent
TMEM67	91147	genome.wustl.edu	37	8	94768048	94768048	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1021-01	TCGA-23-1021-10	A	A	G	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr8:94768048A>G	ENST00000453321.3	+	2	324	c.266A>G	c.(265-267)aAt>aGt	p.N89S	TMEM67_ENST00000409623.3_Intron	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	89					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)	p.N79S(1)		breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			ATGATCTCTAATAATGGAGGA	0.264																																																1	Substitution - Missense(1)	ovary(1)	8											34.0	34.0	34.0					8																	94768048		2202	4292	6494	94837224	SO:0001583	missense	91147			BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.266A>G	8.37:g.94768048A>G	ENSP00000389998:p.Asn89Ser		94837224	B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	ENST00000453321.3	37	CCDS6258.2	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	13.85	2.360885	0.41801	.	.	ENSG00000164953	ENST00000453321;ENST00000453906	T;T	0.67698	-0.28;-0.28	5.91	2.27	0.28462	Growth factor, receptor (1);	0.371931	0.32987	N	0.005416	T	0.55768	0.1941	L	0.50333	1.59	0.80722	D	1	B;P;P	0.45715	0.006;0.865;0.782	B;B;B	0.43478	0.005;0.421;0.419	T	0.50311	-0.8843	10	0.11182	T	0.66	-8.6769	8.1057	0.30885	0.7715:0.0:0.2285:0.0	.	89;89;89	Q5HYA8;F8WCQ6;E5RH38	MKS3_HUMAN;.;.	S	89	ENSP00000389998:N89S;ENSP00000403035:N89S	ENSP00000314488:N79S	N	+	2	0	TMEM67	94837224	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	2.062000	0.41413	0.160000	0.19432	-0.297000	0.09499	AAT		0.264	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704		Missense_Mutation
DZIP1	22873	genome.wustl.edu	37	13	96277050	96277050	+	Nonsense_Mutation	SNP	A	A	T			TCGA-23-1021-01	TCGA-23-1021-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr13:96277050A>T	ENST00000376829.2	-	8	1795	c.944T>A	c.(943-945)tTa>tAa	p.L315*	DZIP1_ENST00000361156.3_Nonsense_Mutation_p.L315*|DZIP1_ENST00000347108.3_Nonsense_Mutation_p.L315*|DZIP1_ENST00000361396.2_Nonsense_Mutation_p.L315*	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	315					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.L315*(1)		endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			CTTCGAAGTTAATTCTTTAAA	0.333																																																1	Substitution - Nonsense(1)	ovary(1)	13											101.0	94.0	97.0					13																	96277050		2195	4300	6495	95075051	SO:0001587	stop_gained	22873			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.944T>A	13.37:g.96277050A>T	ENSP00000366025:p.Leu315*		95075051	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Nonsense_Mutation	SNP	ENST00000376829.2	37	CCDS9478.1	SNP	13	WashU	.	.	.	.	.	.	.	.	.	.	A	46	12.138188	0.99639	.	.	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	.	.	.	5.4	5.4	0.78164	.	0.172533	0.38720	N	0.001593	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.3929	15.7186	0.77688	1.0:0.0:0.0:0.0	.	.	.	.	X	315	.	ENSP00000257312:L315X	L	-	2	0	DZIP1	95075051	1.000000	0.71417	0.994000	0.49952	0.947000	0.59692	6.667000	0.74451	2.174000	0.68829	0.533000	0.62120	TTA		0.333	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045496.3	NM_014934		Nonsense_Mutation
LINS	55180	genome.wustl.edu	37	15	101121005	101121005	+	Missense_Mutation	SNP	C	C	A	rs117825322		TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr15:101121005C>A	ENST00000314742.8	-	2	265	c.43G>T	c.(43-45)Gta>Tta	p.V15L	LINS_ENST00000561308.1_Missense_Mutation_p.V15L|LINS_ENST00000560133.1_Splice_Site|LINS_ENST00000559149.1_5'UTR	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	15								p.V15L(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						CCAAGAAGTACCTTCTTGTAT	0.358																																																1	Substitution - Missense(1)	ovary(1)	15											41.0	39.0	40.0					15																	101121005		2203	4300	6503	98938528	SO:0001583	missense	55180			AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.43G>T	15.37:g.101121005C>A	ENSP00000318423:p.Val15Leu		98938528	Q96FW2|Q9NVQ3	Missense_Mutation	SNP	ENST00000314742.8	37	CCDS10385.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	16.40	3.112130	0.56398	.	.	ENSG00000140471	ENST00000314742	T	0.37915	1.17	5.63	3.76	0.43208	.	0.106561	0.41396	D	0.000881	T	0.37183	0.0994	L	0.36672	1.1	0.80722	D	1	P;P	0.51351	0.944;0.869	P;P	0.50754	0.649;0.556	T	0.12319	-1.0552	10	0.62326	D	0.03	-13.9968	10.5516	0.45092	0.0:0.8519:0.0:0.1481	.	15;15	Q8NG48-2;Q8NG48	.;LINES_HUMAN	L	15	ENSP00000318423:V15L	ENSP00000318423:V15L	V	-	1	0	LINS	98938528	0.005000	0.15991	0.923000	0.36655	0.889000	0.51656	-0.002000	0.12924	0.732000	0.32470	0.650000	0.86243	GTA		0.358	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148		Missense_Mutation
TSTD2	158427	genome.wustl.edu	37	9	100368460	100368460	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1021-01	TCGA-23-1021-10	G	G	T	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr9:100368460G>T	ENST00000341170.4	-	7	1301	c.919C>A	c.(919-921)Ctt>Att	p.L307I	TSTD2_ENST00000354801.2_Missense_Mutation_p.L47I	NM_139246.4	NP_640339.4	Q5T7W7	TSTD2_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 2	307	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.							p.L307I(1)		large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	15						CAATCAAGAAGGATAGTATCA	0.353																																																1	Substitution - Missense(1)	ovary(1)	9											117.0	116.0	117.0					9																	100368460		2203	4300	6503	99408281	SO:0001583	missense	158427			AF258575	CCDS6727.2	9q22.33	2013-09-20	2009-08-12	2009-08-12	ENSG00000136925	ENSG00000136925			30087	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 97"""	C9orf97		12477932	Standard	NM_139246		Approved	PP4189	uc004axn.3	Q5T7W7	OTTHUMG00000020328	ENST00000341170.4:c.919C>A	9.37:g.100368460G>T	ENSP00000342499:p.Leu307Ile		99408281	A6NMJ4|A8K584|Q6ZQZ6|Q8IYM3|Q8WY73|Q96ML6|Q96MU1	Missense_Mutation	SNP	ENST00000341170.4	37	CCDS6727.2	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	14.49	2.552202	0.45487	.	.	ENSG00000136925	ENST00000375172;ENST00000341170;ENST00000375165;ENST00000354801	T;T;T	0.27104	1.69;1.69;1.69	5.18	3.31	0.37934	Rhodanese-like (5);	0.066943	0.64402	N	0.000014	T	0.17916	0.0430	L	0.41492	1.28	0.32895	D	0.512421	B;B	0.33477	0.013;0.413	B;B	0.35607	0.032;0.206	T	0.14172	-1.0482	10	0.20046	T	0.44	-5.0176	5.6795	0.17767	0.1448:0.0:0.666:0.1892	.	81;307	B3KVC7;Q5T7W7	.;TSTD2_HUMAN	I	81;307;47;47	ENSP00000342499:L307I;ENSP00000364308:L47I;ENSP00000346856:L47I	ENSP00000342499:L307I	L	-	1	0	TSTD2	99408281	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	1.989000	0.40707	1.490000	0.48466	0.655000	0.94253	CTT		0.353	TSTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053325.4	NM_139246		Missense_Mutation
SENP7	57337	genome.wustl.edu	37	3	101080585	101080585	+	Nonsense_Mutation	SNP	T	T	A			TCGA-23-1021-01	TCGA-23-1021-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr3:101080585T>A	ENST00000394095.2	-	11	1650	c.1597A>T	c.(1597-1599)Aaa>Taa	p.K533*	SENP7_ENST00000358203.3_Nonsense_Mutation_p.K369*|SENP7_ENST00000314261.7_Nonsense_Mutation_p.K467*|SENP7_ENST00000348610.3_Nonsense_Mutation_p.K500*|SENP7_ENST00000394091.1_Nonsense_Mutation_p.K369*|SENP7_ENST00000394094.2_Nonsense_Mutation_p.K468*	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	533						intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.K467*(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GAAGCTCCTTTTATTTTACCA	0.279																																																1	Substitution - Nonsense(1)	ovary(1)	3											31.0	33.0	32.0					3																	101080585		2192	4275	6467	102563275	SO:0001587	stop_gained	57337				CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.1597A>T	3.37:g.101080585T>A	ENSP00000377655:p.Lys533*		102563275	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Nonsense_Mutation	SNP	ENST00000394095.2	37	CCDS2941.2	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	37	5.999567	0.97189	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	.	.	.	5.71	5.71	0.89125	.	0.061993	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.5652	12.4094	0.55459	0.0:0.0:0.0:1.0	.	.	.	.	X	533;468;467;369;369;500	.	ENSP00000313624:K467X	K	-	1	0	SENP7	102563275	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	1.652000	0.37313	2.179000	0.69175	0.473000	0.43528	AAA		0.279	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654		Nonsense_Mutation
LAMB1	3912	genome.wustl.edu	37	7	107572701	107572701	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr7:107572701G>A	ENST00000222399.6	-	28	4540	c.4310C>T	c.(4309-4311)gCa>gTa	p.A1437V	LAMB1_ENST00000393561.1_Missense_Mutation_p.A1461V|LAMB1_ENST00000474380.1_5'UTR	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1437	Domain I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.A1437V(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GGCGTTGTGTGCAACAGTAAC	0.572																																																1	Substitution - Missense(1)	ovary(1)	7											174.0	159.0	164.0					7																	107572701		2203	4300	6503	107359937	SO:0001583	missense	3912			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4310C>T	7.37:g.107572701G>A	ENSP00000222399:p.Ala1437Val		107359937	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	34	5.306026	0.95629	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.37058	1.22;1.22	5.06	5.06	0.68205	.	.	.	.	.	T	0.46580	0.1400	M	0.78456	2.415	0.80722	D	1	P;P	0.45672	0.864;0.751	B;B	0.42214	0.38;0.287	T	0.57573	-0.7788	9	0.87932	D	0	.	18.6114	0.91286	0.0:0.0:1.0:0.0	.	1437;1461	P07942;G3XAI2	LAMB1_HUMAN;.	V	1461;1437	ENSP00000377191:A1461V;ENSP00000222399:A1437V	ENSP00000222399:A1437V	A	-	2	0	LAMB1	107359937	1.000000	0.71417	0.981000	0.43875	0.995000	0.86356	9.263000	0.95617	2.627000	0.88993	0.655000	0.94253	GCA		0.572	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		Missense_Mutation
IRS4	8471	genome.wustl.edu	37	X	107977213	107977213	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chrX:107977213C>T	ENST00000372129.2	-	1	2438	c.2362G>A	c.(2362-2364)Gca>Aca	p.A788T	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	788	CRK-binding.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.A788T(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TTTGGAATTGCACCGGCTCCA	0.483																																																1	Substitution - Missense(1)	ovary(1)	X											130.0	137.0	135.0					X																	107977213		2203	4300	6503	107863869	SO:0001583	missense	8471			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2362G>A	X.37:g.107977213C>T	ENSP00000361202:p.Ala788Thr		107863869		Missense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	14.87	2.664596	0.47572	.	.	ENSG00000133124	ENST00000372129	T	0.17213	2.29	5.33	4.45	0.53987	.	0.380105	0.27393	N	0.019580	T	0.26738	0.0654	M	0.63428	1.95	0.25970	N	0.982515	D	0.57257	0.979	P	0.54759	0.76	T	0.13415	-1.0510	10	0.62326	D	0.03	-13.6959	6.2438	0.20805	0.2421:0.6615:0.0:0.0964	.	788	O14654	IRS4_HUMAN	T	788	ENSP00000361202:A788T	ENSP00000361202:A788T	A	-	1	0	IRS4	107863869	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.994000	0.49433	2.447000	0.82792	0.600000	0.82982	GCA		0.483	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		Missense_Mutation
FAM184A	79632	genome.wustl.edu	37	6	119324733	119324733	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1021-01	TCGA-23-1021-10	C	C	G	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr6:119324733C>G	ENST00000338891.7	-	8	2313	c.1870G>C	c.(1870-1872)Gaa>Caa	p.E624Q	FAM184A_ENST00000368475.4_Missense_Mutation_p.E504Q|FAM184A_ENST00000521531.1_Missense_Mutation_p.E624Q|FAM184A_ENST00000352896.5_Missense_Mutation_p.E504Q|RP11-351A11.1_ENST00000518570.1_RNA	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	624						extracellular space (GO:0005615)		p.E624Q(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						TTCTCTTCTTCTTTCATGGCA	0.328																																																1	Substitution - Missense(1)	ovary(1)	6											103.0	94.0	97.0					6																	119324733		1830	4088	5918	119366432	SO:0001583	missense	79632			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.1870G>C	6.37:g.119324733C>G	ENSP00000342604:p.Glu624Gln		119366432	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	11.41	1.631512	0.29068	.	.	ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	6.07	5.19	0.71726	.	0.159662	0.53938	N	0.000053	T	0.28001	0.0690	L	0.41236	1.265	0.80722	D	1	P;B;P	0.42785	0.747;0.031;0.79	P;B;P	0.50378	0.56;0.028;0.639	T	0.04413	-1.0953	10	0.16896	T	0.51	-13.5885	17.4412	0.87565	0.0:0.8756:0.1244:0.0	.	624;504;624	Q8NB25-2;F8W8D6;Q8NB25	.;.;F184A_HUMAN	Q	624;504;504;624	ENSP00000342604:E624Q;ENSP00000326608:E504Q;ENSP00000357460:E504Q;ENSP00000430442:E624Q	ENSP00000342604:E624Q	E	-	1	0	FAM184A	119366432	1.000000	0.71417	0.950000	0.38849	0.381000	0.30169	2.738000	0.47401	1.563000	0.49615	-0.182000	0.12963	GAA		0.328	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581		Missense_Mutation
TMEM39A	55254	genome.wustl.edu	37	3	119180831	119180831	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1021-01	TCGA-23-1021-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr3:119180831T>A	ENST00000319172.5	-	2	511	c.91A>T	c.(91-93)Aat>Tat	p.N31Y	TMEM39A_ENST00000486159.1_5'UTR	NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	31						integral component of membrane (GO:0016021)		p.N31Y(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		CCTGTTCCATTGCCACAGCCT	0.438																																																1	Substitution - Missense(1)	ovary(1)	3											87.0	81.0	83.0					3																	119180831		2203	4300	6503	120663521	SO:0001583	missense	55254			BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.91A>T	3.37:g.119180831T>A	ENSP00000326063:p.Asn31Tyr		120663521	D3DN80|Q53FN4|Q53GI1|Q6PKB5	Missense_Mutation	SNP	ENST00000319172.5	37	CCDS2987.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	23.7	4.452808	0.84209	.	.	ENSG00000176142	ENST00000319172;ENST00000491685;ENST00000468676;ENST00000497993;ENST00000461654	T	0.47869	0.83	5.14	5.14	0.70334	.	0.084915	0.85682	D	0.000000	T	0.58807	0.2148	L	0.36672	1.1	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	T	0.61242	-0.7102	10	0.62326	D	0.03	-6.1304	14.5842	0.68312	0.0:0.0:0.0:1.0	.	31	Q9NV64	TM39A_HUMAN	Y	31	ENSP00000326063:N31Y	ENSP00000326063:N31Y	N	-	1	0	TMEM39A	120663521	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.409000	0.80053	2.285000	0.76669	0.533000	0.62120	AAT		0.438	TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354941.3	NM_018266		Missense_Mutation
SORL1	6653	genome.wustl.edu	37	11	121421296	121421296	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1021-01	TCGA-23-1021-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr11:121421296A>G	ENST00000260197.7	+	16	2312	c.2183A>G	c.(2182-2184)tAc>tGc	p.Y728C		NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	728					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.Y728C(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GGTGACAGCTACCGGAAGATT	0.552																																																1	Substitution - Missense(1)	ovary(1)	11											92.0	82.0	85.0					11																	121421296		2203	4299	6502	120926506	SO:0001583	missense	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.2183A>G	11.37:g.121421296A>G	ENSP00000260197:p.Tyr728Cys		120926506	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	23.6	4.434745	0.83885	.	.	ENSG00000137642	ENST00000260197	D	0.95342	-3.68	5.03	5.03	0.67393	VPS10 (1);	0.000000	0.85682	D	0.000000	D	0.97660	0.9233	M	0.90870	3.155	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98249	1.0492	10	0.54805	T	0.06	.	14.9166	0.70801	1.0:0.0:0.0:0.0	.	728	Q92673	SORL_HUMAN	C	728	ENSP00000260197:Y728C	ENSP00000260197:Y728C	Y	+	2	0	SORL1	120926506	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.568000	0.90741	2.111000	0.64477	0.533000	0.62120	TAC		0.552	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105		Missense_Mutation
SLC12A8	84561	genome.wustl.edu	37	3	124896804	124896804	+	Silent	SNP	G	G	T			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr3:124896804G>T	ENST00000393469.4	-	4	454	c.405C>A	c.(403-405)gcC>gcA	p.A135A	SLC12A8_ENST00000423114.2_Silent_p.A164A|SLC12A8_ENST00000469902.1_Silent_p.A135A|SLC12A8_ENST00000314584.7_5'UTR	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	135					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.A135A(1)		endometrium(2)|kidney(2)|lung(12)	16						TGATATACATGGCACCTGCAA	0.562																																																1	Substitution - coding silent(1)	ovary(1)	3											38.0	43.0	42.0					3																	124896804		2131	4232	6363	126379494	SO:0001819	synonymous_variant	84561				CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.405C>A	3.37:g.124896804G>T			126379494	C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Silent	SNP	ENST00000393469.4	37	CCDS43143.1	SNP	47	WashU																																																																																				0.562	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355711.4	NM_024628		Silent
HSPA4L	22824	genome.wustl.edu	37	4	128715245	128715245	+	Silent	SNP	T	T	C			TCGA-23-1021-01	TCGA-23-1021-10	T	T	C	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr4:128715245T>C	ENST00000296464.4	+	2	532	c.121T>C	c.(121-123)Ttg>Ctg	p.L41L	HSPA4L_ENST00000508776.1_Silent_p.L41L|HSPA4L_ENST00000439123.2_Silent_p.L72L|HSPA4L_ENST00000505726.1_Silent_p.L15L	NM_014278.2	NP_055093.2	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like	41					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.L41L(1)		central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						CTGTATATCATTGGGATCAAG	0.328																																																1	Substitution - coding silent(1)	ovary(1)	4											144.0	146.0	145.0					4																	128715245		2203	4300	6503	128934695	SO:0001819	synonymous_variant	22824			AB023421	CCDS3734.1	4q28	2011-09-07			ENSG00000164070	ENSG00000164070		"""Heat shock proteins / HSP70"""	17041	protein-coding gene	gene with protein product						10524232	Standard	NM_014278		Approved	APG-1, Osp94, HSPH3	uc003ifm.3	O95757	OTTHUMG00000133302	ENST00000296464.4:c.121T>C	4.37:g.128715245T>C			128934695	A2ICT2|Q4W5M5|Q8IWA2	Silent	SNP	ENST00000296464.4	37	CCDS3734.1	SNP	52	WashU																																																																																				0.328	HSPA4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257096.3	NM_014278		Silent
ZNF449	203523	genome.wustl.edu	37	X	134493888	134493888	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chrX:134493888C>A	ENST00000339249.4	+	4	771	c.631C>A	c.(631-633)Cag>Aag	p.Q211K		NM_152695.5	NP_689908.3	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	211					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q211K(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GAAGGAATTACAGGATTCTAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	X											102.0	98.0	100.0					X																	134493888		2203	4299	6502	134321554	SO:0001583	missense	203523			AY280801	CCDS14649.1	Xq26.3	2013-01-09			ENSG00000173275	ENSG00000173275		"""-"", ""Zinc fingers, C2H2-type"""	21039	protein-coding gene	gene with protein product		300627					Standard	NM_152695		Approved	ZSCAN19, FLJ23614	uc004eys.3	Q6P9G9	OTTHUMG00000022478	ENST00000339249.4:c.631C>A	X.37:g.134493888C>A	ENSP00000339585:p.Gln211Lys		134321554	Q5JRZ7|Q5JRZ8|Q6NZX2|Q8N3Q1|Q8TED7	Missense_Mutation	SNP	ENST00000339249.4	37	CCDS14649.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	8.992	0.977968	0.18812	.	.	ENSG00000173275	ENST00000339249	T	0.05447	3.44	4.85	1.95	0.26073	.	0.161421	0.29572	N	0.011763	T	0.03871	0.0109	N	0.24115	0.695	0.34113	D	0.663263	B	0.19583	0.037	B	0.22880	0.042	T	0.38090	-0.9677	10	0.12103	T	0.63	.	7.3958	0.26936	0.0:0.5836:0.3197:0.0967	.	211	Q6P9G9	ZN449_HUMAN	K	211	ENSP00000339585:Q211K	ENSP00000339585:Q211K	Q	+	1	0	ZNF449	134321554	0.021000	0.18746	0.955000	0.39395	0.979000	0.70002	0.985000	0.29578	0.529000	0.28599	0.523000	0.50628	CAG		0.333	ZNF449-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058411.1	NM_152695		Missense_Mutation
KEL	3792	genome.wustl.edu	37	7	142641429	142641429	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr7:142641429G>A	ENST00000355265.2	-	13	1946	c.1472C>T	c.(1471-1473)gCc>gTc	p.A491V	KEL_ENST00000479768.2_5'Flank	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	491					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.A491V(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					TTCTTGTCGGGCCAGCTCTGG	0.527																																																1	Substitution - Missense(1)	ovary(1)	7											100.0	96.0	98.0					7																	142641429		2203	4300	6503	142351551	SO:0001583	missense	3792			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1472C>T	7.37:g.142641429G>A	ENSP00000347409:p.Ala491Val		142351551	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	CCDS34766.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	3.368	-0.129103	0.06753	.	.	ENSG00000197993	ENST00000355265	T	0.81330	-1.48	4.85	3.04	0.35103	.	0.495107	0.18686	N	0.134019	T	0.73329	0.3573	M	0.61703	1.905	0.09310	N	0.999999	B	0.26483	0.15	B	0.15052	0.012	T	0.61865	-0.6975	10	0.38643	T	0.18	-7.4579	7.2994	0.26411	0.2:0.0:0.8:0.0	.	491	P23276	KELL_HUMAN	V	491	ENSP00000347409:A491V	ENSP00000347409:A491V	A	-	2	0	KEL	142351551	0.134000	0.22483	0.181000	0.23098	0.088000	0.18126	0.481000	0.22260	0.645000	0.30675	0.591000	0.81541	GCC		0.527	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		Missense_Mutation
RASA2	5922	genome.wustl.edu	37	3	141248601	141248601	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr3:141248601C>G	ENST00000452898.1	+	4	442	c.407C>G	c.(406-408)aCt>aGt	p.T136S	RASA2_ENST00000286364.3_Missense_Mutation_p.T136S	NM_006506.2	NP_006497.2	Q15283	RASA2_HUMAN	RAS p21 protein activator 2	136					intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.T136S(1)		NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	34						GGCAAAGAAACTTGGTTTTCA	0.328																																																1	Substitution - Missense(1)	ovary(1)	3											81.0	82.0	82.0					3																	141248601		2203	4299	6502	142731291	SO:0001583	missense	5922			AF115573	CCDS3117.1	3q22-q23	2013-01-10			ENSG00000155903	ENSG00000155903		"""Pleckstrin homology (PH) domain containing"""	9872	protein-coding gene	gene with protein product		601589				8699317	Standard	NM_006506		Approved	GAP1M	uc003etz.1	Q15283	OTTHUMG00000160221	ENST00000452898.1:c.407C>G	3.37:g.141248601C>G	ENSP00000391677:p.Thr136Ser		142731291	A8K7K1|G3V0F9|O00695|Q15284|Q92594|Q99577|Q9UEQ2	Missense_Mutation	SNP	ENST00000452898.1	37		SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	2.974	-0.211793	0.06140	.	.	ENSG00000155903	ENST00000286364;ENST00000452898	T;T	0.70986	-0.53;-0.53	5.84	4.96	0.65561	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.198015	0.43260	D	0.000584	T	0.62258	0.2413	L	0.48642	1.525	0.30959	N	0.723909	B;B;B	0.32188	0.245;0.359;0.245	B;B;B	0.36845	0.118;0.234;0.118	T	0.59198	-0.7499	10	0.09084	T	0.74	.	11.4892	0.50371	0.1408:0.7234:0.1358:0.0	.	136;136;136	A8K7K1;G3V0F9;Q15283	.;.;RASA2_HUMAN	S	136	ENSP00000286364:T136S;ENSP00000391677:T136S	ENSP00000286364:T136S	T	+	2	0	RASA2	142731291	0.904000	0.30761	1.000000	0.80357	0.989000	0.77384	0.689000	0.25437	1.456000	0.47831	0.655000	0.94253	ACT		0.328	RASA2-201	KNOWN	basic	protein_coding	protein_coding		NM_006506		Missense_Mutation
AOC1	26	genome.wustl.edu	37	7	150554202	150554202	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr7:150554202C>A	ENST00000493429.1	+	4	1228	c.644C>A	c.(643-645)aCt>aAt	p.T215N	AOC1_ENST00000360937.4_Missense_Mutation_p.T215N|AOC1_ENST00000467291.1_Missense_Mutation_p.T215N|AOC1_ENST00000416793.2_Missense_Mutation_p.T215N			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	215					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)	p.T215N(1)								Amiloride(DB00594)	CTGCACCCCACTGGGCTGGAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	7											74.0	79.0	78.0					7																	150554202		2043	4188	6231	150185135	SO:0001583	missense	26			AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.644C>A	7.37:g.150554202C>A	ENSP00000418614:p.Thr215Asn		150185135	C9J690|Q16683|Q16684|Q56II4|Q6GU42	Missense_Mutation	SNP	ENST00000493429.1	37	CCDS43679.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	14.46	2.543231	0.45280	.	.	ENSG00000002726	ENST00000493429;ENST00000467291;ENST00000460213;ENST00000360937;ENST00000416793;ENST00000437714;ENST00000483043	T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5	4.88	4.01	0.46588	Copper amine oxidase, N3-terminal (1);Copper amine oxidase, N2/N3-terminal (1);Copper amine oxidase, N-terminal (1);	0.392825	0.28420	N	0.015411	T	0.52500	0.1738	M	0.82056	2.57	0.37333	D	0.91004	D;D	0.89917	1.0;1.0	D;D	0.81914	0.987;0.995	T	0.60581	-0.7235	10	0.66056	D	0.02	-5.5083	7.3726	0.26810	0.0:0.8085:0.0:0.1915	.	215;215	C9J690;P19801	.;ABP1_HUMAN	N	215;215;215;215;215;91;215	ENSP00000418614:T215N;ENSP00000418328:T215N;ENSP00000418557:T215N;ENSP00000354193:T215N;ENSP00000411613:T215N;ENSP00000417392:T215N	ENSP00000354193:T215N	T	+	2	0	ABP1	150185135	0.783000	0.28701	0.888000	0.34837	0.567000	0.35839	2.386000	0.44380	1.291000	0.44653	-0.258000	0.10820	ACT		0.612	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350628.1	NM_001091		Missense_Mutation
RIF1	55183	genome.wustl.edu	37	2	152320193	152320193	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1021-01	TCGA-23-1021-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr2:152320193A>G	ENST00000243326.5	+	29	4642	c.4159A>G	c.(4159-4161)Aat>Gat	p.N1387D	RIF1_ENST00000430328.2_Missense_Mutation_p.N1387D|RIF1_ENST00000428287.2_Missense_Mutation_p.N1387D|RIF1_ENST00000453091.2_Missense_Mutation_p.N1387D|RIF1_ENST00000444746.2_Missense_Mutation_p.N1387D			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.N1387D(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		ATCCAAAGAGAATACACCCCC	0.368																																																1	Substitution - Missense(1)	ovary(1)	2											90.0	96.0	94.0					2																	152320193		2203	4300	6503	152028439	SO:0001583	missense	55183			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.4159A>G	2.37:g.152320193A>G	ENSP00000243326:p.Asn1387Asp		152028439	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	20.7	4.032546	0.75504	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19	5.45	5.45	0.79879	.	0.388373	0.30168	N	0.010251	T	0.52386	0.1731	M	0.66939	2.045	0.80722	D	1	D;D	0.56746	0.962;0.977	P;P	0.55871	0.637;0.786	T	0.53885	-0.8375	10	0.49607	T	0.09	-11.5968	15.1804	0.72952	1.0:0.0:0.0:0.0	.	1387;1387	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	D	1387	ENSP00000390181:N1387D;ENSP00000414615:N1387D;ENSP00000415691:N1387D;ENSP00000243326:N1387D;ENSP00000416123:N1387D	ENSP00000243326:N1387D	N	+	1	0	RIF1	152028439	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	6.854000	0.75440	2.076000	0.62316	0.455000	0.32223	AAT		0.368	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3			Missense_Mutation
SLC50A1	55974	genome.wustl.edu	37	1	155110534	155110534	+	Nonsense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr1:155110534G>A	ENST00000368404.4	+	5	586	c.524G>A	c.(523-525)tGg>tAg	p.W175*	SLC50A1_ENST00000303343.8_Nonsense_Mutation_p.W121*|SLC50A1_ENST00000484157.1_Nonsense_Mutation_p.W110*|SLC50A1_ENST00000368405.3_3'UTR|SLC50A1_ENST00000368401.5_Nonsense_Mutation_p.W120*	NM_018845.3	NP_061333.2	Q9BRV3	SWET1_HUMAN	solute carrier family 50 (sugar efflux transporter), member 1	175	Mediates interaction with TRPV2. {ECO:0000250}.|MtN3/slv 2.				carbohydrate transport (GO:0008643)|DNA recombination (GO:0006310)|glucoside transport (GO:0042946)|positive regulation of gene expression, epigenetic (GO:0045815)	endomembrane system (GO:0012505)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucoside transmembrane transporter activity (GO:0042947)	p.W175*(1)		endometrium(1)|lung(1)|ovary(1)|skin(1)	4						TCTGCCTCCTGGTGCCTCTAT	0.502																																																1	Substitution - Nonsense(1)	ovary(1)	1											167.0	146.0	153.0					1																	155110534		2203	4300	6503	153377158	SO:0001587	stop_gained	55974			AF126023, AF126024	CCDS1093.1, CCDS44238.1, CCDS44239.1, CCDS72929.1, CCDS72930.1	1q22	2013-07-17	2013-07-17	2010-11-30	ENSG00000169241	ENSG00000169241		"""Solute carriers"""	30657	protein-coding gene	gene with protein product	"""stromal cell protein"""	613683	"""recombination activating gene 1 activating protein 1"""	RAG1AP1		21107422	Standard	NM_018845		Approved	SCP, RP11-540D14.5, slv, RZPDo834D038D, HsSWEET1, SWEET1	uc001fhj.4	Q9BRV3	OTTHUMG00000035333	ENST00000368404.4:c.524G>A	1.37:g.155110534G>A	ENSP00000357389:p.Trp175*		153377158	Q5SR64|Q6IAK6|Q96DC5|Q9UHQ2|Q9UHQ3	Nonsense_Mutation	SNP	ENST00000368404.4	37	CCDS1093.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984212	0.74474	.	.	ENSG00000169241	ENST00000484157;ENST00000303343;ENST00000368404;ENST00000368401	.	.	.	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.3161	16.1085	0.81241	0.0:0.0:1.0:0.0	.	.	.	.	X	110;121;175;120	.	ENSP00000306146:W121X	W	+	2	0	SLC50A1	153377158	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	7.640000	0.83355	2.749000	0.94314	0.655000	0.94253	TGG		0.502	SLC50A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085505.1	NM_018845		Nonsense_Mutation
OR10J8P	343409	genome.wustl.edu	37	1	159336215	159336215	+	RNA	SNP	A	A	G			TCGA-23-1021-01	TCGA-23-1021-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr1:159336215A>G	ENST00000431862.1	-	0	227																		p.S89G(1)									CATAGGCCTGAGTCAGCCCAT	0.483																																																1	Substitution - Missense(1)	ovary(1)	1																																								157602839			26476																															1.37:g.159336215A>G			157602839		Missense_Mutation	SNP	ENST00000431862.1	37		SNP	11	WashU																																																																																				0.483	RP11-550P17.5-001	KNOWN	basic	antisense	antisense	OTTHUMT00000090626.1			Missense_Mutation
LCP2	3937	genome.wustl.edu	37	5	169680190	169680190	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1021-01	TCGA-23-1021-10	G	G	T	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr5:169680190G>T	ENST00000046794.5	-	18	1793	c.1178C>A	c.(1177-1179)gCc>gAc	p.A393D	LCP2_ENST00000521416.1_Missense_Mutation_p.A188D	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	393					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)		p.A393D(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		TCTGCCTTCGGCTCTGATAGG	0.438																																																1	Substitution - Missense(1)	ovary(1)	5											54.0	52.0	53.0					5																	169680190		1832	4083	5915	169612768	SO:0001583	missense	3937				CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.1178C>A	5.37:g.169680190G>T	ENSP00000046794:p.Ala393Asp		169612768	A8KA25|Q53XV4	Missense_Mutation	SNP	ENST00000046794.5	37	CCDS47339.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	10.82	1.459310	0.26248	.	.	ENSG00000043462	ENST00000046794;ENST00000521416	T;T	0.43688	0.95;0.94	5.73	-1.74	0.08056	.	1.314150	0.04678	N	0.411893	T	0.28764	0.0713	L	0.38175	1.15	0.09310	N	1	B;B	0.26935	0.059;0.164	B;B	0.26517	0.024;0.07	T	0.11446	-1.0587	9	.	.	.	4.8482	2.3098	0.04184	0.2177:0.3617:0.2969:0.1237	.	188;393	E7ESF6;Q13094	.;LCP2_HUMAN	D	393;188	ENSP00000046794:A393D;ENSP00000428871:A188D	.	A	-	2	0	LCP2	169612768	0.000000	0.05858	0.000000	0.03702	0.190000	0.23558	0.038000	0.13862	-0.591000	0.05859	0.557000	0.71058	GCC		0.438	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565		Missense_Mutation
ARL10	285598	genome.wustl.edu	37	5	175798811	175798811	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1021-01	TCGA-23-1021-10	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr5:175798811G>C	ENST00000310389.5	+	4	744	c.648G>C	c.(646-648)ttG>ttC	p.L216F		NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	216					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)	p.L216F(1)		endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TTTTCCTCTTGGCAGCCAGCA	0.602																																																1	Substitution - Missense(1)	ovary(1)	5											86.0	88.0	87.0					5																	175798811		2203	4300	6503	175731417	SO:0001583	missense	285598			BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.648G>C	5.37:g.175798811G>C	ENSP00000308496:p.Leu216Phe		175731417		Missense_Mutation	SNP	ENST00000310389.5	37	CCDS4400.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	10.81	1.455941	0.26161	.	.	ENSG00000175414	ENST00000310389	T	0.62498	0.02	5.39	2.6	0.31112	.	20.316300	0.00166	N	0.000000	T	0.64897	0.2640	N	0.12502	0.225	0.48830	D	0.999717	D	0.63880	0.993	D	0.68039	0.955	T	0.53194	-0.8473	10	0.87932	D	0	-13.5393	7.2607	0.26201	0.1507:0.138:0.7113:0.0	.	216	Q8N8L6	ARL10_HUMAN	F	216	ENSP00000308496:L216F	ENSP00000308496:L216F	L	+	3	2	ARL10	175731417	1.000000	0.71417	0.854000	0.33618	0.026000	0.11368	3.405000	0.52630	0.377000	0.24735	-0.140000	0.14226	TTG		0.602	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664		Missense_Mutation
ZFP2	80108	genome.wustl.edu	37	5	178358884	178358884	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr5:178358884G>C	ENST00000361362.2	+	5	1100	c.570G>C	c.(568-570)gaG>gaC	p.E190D	ZFP2_ENST00000520301.1_Missense_Mutation_p.E190D|ZFP2_ENST00000503510.2_Missense_Mutation_p.E190D|ZFP2_ENST00000523286.1_Missense_Mutation_p.E190D	NM_030613.2	NP_085116.2	Q6ZN57	ZFP2_HUMAN	ZFP2 zinc finger protein	190					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E190D(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	20	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)		AGTGTAAAGAGTGTGGCAAAG	0.388																																																1	Substitution - Missense(1)	ovary(1)	5											47.0	47.0	47.0					5																	178358884		2203	4300	6503	178291490	SO:0001583	missense	80108			AK025281	CCDS4440.1	5q35.3	2013-01-08	2012-11-27		ENSG00000198939	ENSG00000198939		"""Zinc fingers, C2H2-type"""	26138	protein-coding gene	gene with protein product			"""zinc finger protein 2 homolog (mouse)"""				Standard	NM_030613		Approved	FLJ21628, ZNF751	uc003mjn.1	Q6ZN57	OTTHUMG00000130885	ENST00000361362.2:c.570G>C	5.37:g.178358884G>C	ENSP00000354453:p.Glu190Asp		178291490	A5PLN5|B7ZM23|Q9H6Z6	Missense_Mutation	SNP	ENST00000361362.2	37	CCDS4440.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	g	13.63	2.294910	0.40594	.	.	ENSG00000198939	ENST00000361362;ENST00000520301;ENST00000523286;ENST00000503510	T;T;T;T	0.07444	3.19;3.19;3.19;3.19	4.7	-0.665	0.11403	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.569994	0.13204	N	0.405683	T	0.04363	0.0120	N	0.11313	0.125	0.27786	N	0.942983	B	0.09022	0.002	B	0.10450	0.005	T	0.36744	-0.9735	10	0.39692	T	0.17	-0.9813	8.9846	0.35986	0.5516:0.0:0.4484:0.0	.	190	Q6ZN57	ZFP2_HUMAN	D	190	ENSP00000354453:E190D;ENSP00000430980:E190D;ENSP00000430531:E190D;ENSP00000438114:E190D	ENSP00000354453:E190D	E	+	3	2	ZFP2	178291490	0.000000	0.05858	0.994000	0.49952	0.989000	0.77384	-0.949000	0.03893	-0.074000	0.12820	0.585000	0.79938	GAG		0.388	ZFP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253470.2	NM_030613		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179454988	179454988	+	Silent	SNP	C	C	A			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr2:179454988C>A	ENST00000591111.1	-	254	56765	c.56541G>T	c.(56539-56541)gtG>gtT	p.V18847V	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Silent_p.V11423V|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000359218.5_Silent_p.V11548V|TTN_ENST00000342992.6_Silent_p.V17920V|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Silent_p.V20488V|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.V11615V			Q8WZ42	TITIN_HUMAN	titin	18847	Ig-like 107.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V17918V(1)|p.V11423V(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCCTACTCTCACGGTAATAA	0.438																																																2	Substitution - coding silent(2)	ovary(2)	2											199.0	181.0	187.0					2																	179454988		1958	4146	6104	179163234	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.56541G>T	2.37:g.179454988C>A			179163234	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonstop_Mutation	SNP	ENST00000591111.1	37		SNP	29	WashU																																																																																				0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Nonstop_Mutation
STAT4	6775	genome.wustl.edu	37	2	191922749	191922749	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr2:191922749G>A	ENST00000392320.2	-	13	1515	c.1201C>T	c.(1201-1203)Cat>Tat	p.H401Y	STAT4_ENST00000358470.4_Missense_Mutation_p.H401Y	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	401					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.H401Y(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			CTTACCAAATGTCGAAATTCT	0.358																																																1	Substitution - Missense(1)	ovary(1)	2											74.0	74.0	74.0					2																	191922749		2203	4300	6503	191630994	SO:0001583	missense	6775				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.1201C>T	2.37:g.191922749G>A	ENSP00000376134:p.His401Tyr		191630994	Q96NZ6	Missense_Mutation	SNP	ENST00000392320.2	37	CCDS2310.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	22.0	4.236862	0.79800	.	.	ENSG00000138378	ENST00000358470;ENST00000392320	T;T	0.77750	-1.12;-1.12	5.38	5.38	0.77491	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.85044	0.5607	L	0.52126	1.63	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.67382	0.951;0.951;0.951	D	0.84001	0.0343	10	0.44086	T	0.13	-49.398	19.5078	0.95127	0.0:0.0:1.0:0.0	.	310;401;401	Q53S87;B4DV04;Q14765	.;.;STAT4_HUMAN	Y	401	ENSP00000351255:H401Y;ENSP00000376134:H401Y	ENSP00000351255:H401Y	H	-	1	0	STAT4	191630994	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	9.061000	0.93913	2.694000	0.91930	0.585000	0.79938	CAT		0.358	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335586.1	NM_003151		Missense_Mutation
LRRC15	131578	genome.wustl.edu	37	3	194081480	194081480	+	Missense_Mutation	SNP	C	C	T	rs200640377		TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr3:194081480C>T	ENST00000347624.3	-	2	378	c.293G>A	c.(292-294)cGa>cAa	p.R98Q	LRRC15_ENST00000428839.1_Missense_Mutation_p.R104Q|LRRC15_ENST00000439944.2_Missense_Mutation_p.R104Q	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	98					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)	p.R98Q(1)		biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		GCCCAGGTTTCGGAAGGCCCC	0.582																																																1	Substitution - Missense(1)	ovary(1)	3						C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	72.0	66.0	68.0		293,311	3.9	1.0	3		68	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	LRRC15	NM_130830.4,NM_001135057.2	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	98/582,104/588	194081480	1,13005	2203	4300	6503	195562775	SO:0001583	missense	131578			AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.293G>A	3.37:g.194081480C>T	ENSP00000306276:p.Arg98Gln		195562775	Q495Q6|Q7RTN7	Missense_Mutation	SNP	ENST00000347624.3	37	CCDS3306.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	6.943	0.543791	0.13312	0.0	1.16E-4	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.56103	0.48;0.48;0.48	4.8	3.93	0.45458	.	0.353495	0.27319	N	0.019918	T	0.29256	0.0728	N	0.25380	0.74	0.29603	N	0.847514	B;B	0.29716	0.106;0.255	B;B	0.19946	0.027;0.016	T	0.12192	-1.0557	10	0.13108	T	0.6	.	4.1354	0.10169	0.1714:0.575:0.0:0.2536	.	98;104	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	Q	98;104;104	ENSP00000306276:R98Q;ENSP00000389128:R104Q;ENSP00000413707:R104Q	ENSP00000306276:R98Q	R	-	2	0	LRRC15	195562775	0.026000	0.19158	0.977000	0.42913	0.722000	0.41435	0.189000	0.17037	1.341000	0.45600	0.462000	0.41574	CGA		0.582	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342858.2			Missense_Mutation
ZDBF2	57683	genome.wustl.edu	37	2	207171914	207171914	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr2:207171914G>A	ENST00000374423.3	+	5	3048	c.2662G>A	c.(2662-2664)Gaa>Aaa	p.E888K		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	888							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.E888K(1)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TAATTCTCCCGAAGTAGCTGT	0.363																																																1	Substitution - Missense(1)	ovary(1)	2											61.0	57.0	58.0					2																	207171914		1824	4092	5916	206880159	SO:0001583	missense	57683			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2662G>A	2.37:g.207171914G>A	ENSP00000363545:p.Glu888Lys		206880159	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004196	0.35320	.	.	ENSG00000204186	ENST00000374423	T	0.53857	0.6	4.41	0.266	0.15617	.	0.967282	0.08454	N	0.943444	T	0.38506	0.1043	L	0.45581	1.43	0.09310	N	1	B	0.25850	0.136	B	0.16289	0.015	T	0.22034	-1.0228	10	0.27785	T	0.31	.	3.5234	0.07751	0.4075:0.0:0.4195:0.173	.	888	Q9HCK1	ZDBF2_HUMAN	K	888	ENSP00000363545:E888K	ENSP00000363545:E888K	E	+	1	0	ZDBF2	206880159	0.053000	0.20554	0.000000	0.03702	0.221000	0.24807	-0.169000	0.09911	0.034000	0.15491	0.655000	0.94253	GAA		0.363	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		Missense_Mutation
PIKFYVE	200576	genome.wustl.edu	37	2	209190291	209190291	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1021-01	TCGA-23-1021-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr2:209190291C>A	ENST00000264380.4	+	20	2914	c.2756C>A	c.(2755-2757)cCt>cAt	p.P919H		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	919					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.P919H(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GACATCCCTCCTGAGTCTCTG	0.522																																																1	Substitution - Missense(1)	ovary(1)	2											74.0	67.0	69.0					2																	209190291		2203	4300	6503	208898536	SO:0001583	missense	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.2756C>A	2.37:g.209190291C>A	ENSP00000264380:p.Pro919His		208898536	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	0.356	-0.942223	0.02322	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	T;T	0.27557	1.66;1.82	6.07	2.33	0.28932	.	0.716341	0.13266	N	0.400875	T	0.24890	0.0604	L	0.36672	1.1	0.49687	D	0.99981	B;B	0.26876	0.102;0.162	B;B	0.30855	0.078;0.121	T	0.03898	-1.0994	10	0.49607	T	0.09	-0.6125	7.9759	0.30155	0.0:0.6943:0.116:0.1897	.	919;863	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	H	919;495;863	ENSP00000264380:P919H;ENSP00000405736:P863H	ENSP00000264380:P919H	P	+	2	0	PIKFYVE	208898536	0.003000	0.15002	0.001000	0.08648	0.134000	0.20937	1.585000	0.36600	0.162000	0.19483	0.650000	0.86243	CCT		0.522	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040		Missense_Mutation
USH2A	7399	genome.wustl.edu	37	1	216591942	216591942	+	Missense_Mutation	SNP	G	G	A	rs370653547		TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr1:216591942G>A	ENST00000307340.3	-	3	951	c.565C>T	c.(565-567)Cgc>Tgc	p.R189C	USH2A_ENST00000366943.2_Missense_Mutation_p.R189C|USH2A_ENST00000366942.3_Missense_Mutation_p.R189C	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	189					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.R189C(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTTACTGTGCGATAATAAAAC	0.368										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1						G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	130.0	124.0	126.0		565,565	5.6	1.0	1		126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	USH2A	NM_007123.5,NM_206933.2	180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	189/1547,189/5203	216591942	1,13005	2203	4300	6503	214658565	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.565C>T	1.37:g.216591942G>A	ENSP00000305941:p.Arg189Cys		214658565	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503905	0.85176	0.0	1.16E-4	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.74526	-0.85;-0.85;-0.85	5.62	5.62	0.85841	Concanavalin A-like lectin/glucanase (1);LamG-like jellyroll fold (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.43579	U	0.000557	D	0.85733	0.5765	M	0.65975	2.015	0.53005	D	0.999963	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.978	D	0.86518	0.1814	10	0.87932	D	0	.	19.6478	0.95789	0.0:0.0:1.0:0.0	.	189;189	O75445-2;O75445	.;USH2A_HUMAN	C	189	ENSP00000305941:R189C;ENSP00000355910:R189C;ENSP00000355909:R189C	ENSP00000305941:R189C	R	-	1	0	USH2A	214658565	1.000000	0.71417	0.989000	0.46669	0.993000	0.82548	4.047000	0.57383	2.638000	0.89438	0.655000	0.94253	CGC		0.368	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Missense_Mutation
TUBA4B	80086	genome.wustl.edu	37	2	220136260	220136260	+	RNA	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr2:220136260G>A	ENST00000490341.1	+	0	730					NR_003063.1		Q9H853	TBA4B_HUMAN	tubulin, alpha 4b (pseudogene)						microtubule-based process (GO:0007017)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|structural constituent of cytoskeleton (GO:0005200)										GGCCCTCAATGTGGACCTGAC	0.542																																																0			2																																								219844504			80086			AK024002		2q35	2014-03-20	2007-03-16	2007-02-12	ENSG00000243910	ENSG00000243910		"""Tubulins"""	18637	pseudogene	pseudogene			"""tubulin, alpha 4"", ""tubulin, alpha 4b"""	TUBA4		3785200	Standard	NR_003063		Approved	FLJ13940	uc002vkv.1	Q9H853	OTTHUMG00000154516		2.37:g.220136260G>A			219844504		Missense_Mutation	SNP	ENST00000490341.1	37		SNP	48	WashU																																																																																				0.542	TUBA4B-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000335637.1	NR_003063		Missense_Mutation
UGT1A9	54600	genome.wustl.edu	37	2	234581112	234581112	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr2:234581112G>A	ENST00000354728.4	+	1	614	c.532G>A	c.(532-534)Gaa>Aaa	p.E178K	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Missense_Mutation_p.E178K			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	178					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)	p.E178K(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	CCACTATCTTGAAGAAGGTGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	2											167.0	170.0	169.0					2																	234581112		2203	4300	6503	234245851	SO:0001583	missense	54600			AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.532G>A	2.37:g.234581112G>A	ENSP00000346768:p.Glu178Lys		234245851	B8K285|P36509|Q9HAX0	Missense_Mutation	SNP	ENST00000354728.4	37	CCDS2505.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	5.317	0.243819	0.10077	.	.	ENSG00000241119	ENST00000354728	T	0.60672	0.17	3.41	2.5	0.30297	.	.	.	.	.	T	0.43656	0.1257	N	0.15975	0.35	0.09310	N	1	B;B	0.26512	0.151;0.151	B;B	0.36766	0.232;0.232	T	0.46176	-0.9210	9	0.62326	D	0.03	.	7.8588	0.29497	0.0:0.1329:0.534:0.3331	.	178;178	Q5DSZ5;O60656	.;UD19_HUMAN	K	178	ENSP00000346768:E178K	ENSP00000346768:E178K	E	+	1	0	UGT1A9	234245851	0.000000	0.05858	0.235000	0.24058	0.633000	0.38033	0.520000	0.22878	0.739000	0.32628	0.440000	0.28878	GAA		0.473	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027		Missense_Mutation
REXO1L8P	392242	genome.wustl.edu	37	8	86556143	86556144	+	IGR	INS	-	-	TCAAAC	rs560225073	byFrequency	TCGA-23-1021-01	TCGA-23-1021-10	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr8:86556143_86556144insTCAAAC								RP11-317J10.4 (103403 upstream) : REXO1L1 (12550 downstream)																							AATGGGTTTCTTCAAACTCGGT	0.574														80	0.0159744	0.0197	0.0043	5008	,	,		49850	0.0208		0.0119	False		,,,				2504	0.0184															0			8																																								86743396	SO:0001628	intergenic_variant	392242																															8.37:g.86556144_86556149dupTCAAAC			86743395		In_Frame_Ins	INS		37		INS	56	WashU																																																																																			0	0.574									In_Frame_Ins
FAM129A	116496	genome.wustl.edu	37	1	184764715	184764716	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr1:184764715_184764716GG>CT	ENST00000367511.3	-	14	2375_2376	c.2182_2183CC>AG	c.(2182-2184)CCa>AGa	p.P728R	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	728	Glu-rich.				negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.P728T(1)|p.P728R(1)		autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						TTCCATCACTGGAGCAGAGTCC	0.554																																																2	Substitution - Missense(2)	ovary(2)	1																																								183031339	SO:0001583	missense	116496			AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.2182_2183delinsCT	1.37:g.184764715_184764716delinsCT	ENSP00000356481:p.Pro728Arg		183031338	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense	DNP	ENST00000367511.3	37	CCDS1364.1	DNP	47	WashU																																																																																				0.554	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1			Missense
GATA3	2625	genome.wustl.edu	37	10	8100551	8100551	+	Silent	SNP	G	G	A			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr10:8100551G>A	ENST00000346208.3	+	3	980	c.525G>A	c.(523-525)tcG>tcA	p.S175S	GATA3_ENST00000379328.3_Silent_p.S175S|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	175					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.S175S(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CGGCCGGCTCGGCCCGGCAGG	0.711			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																																Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Substitution - coding silent(1)	ovary(1)	10											48.0	48.0	48.0					10																	8100551		2203	4298	6501	8140557	SO:0001819	synonymous_variant	2625			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.525G>A	10.37:g.8100551G>A			8140557	Q5VWG7|Q5VWG8|Q96J16	Silent	SNP	ENST00000346208.3	37	CCDS7083.1	SNP	39	WashU																																																																																				0.711	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295		Silent
BRF1	2972	genome.wustl.edu	37	14	105684006	105684006	+	Silent	SNP	G	G	T	rs149163711		TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr14:105684006G>T	ENST00000546474.1	-	15	16606	c.1647C>A	c.(1645-1647)gcC>gcA	p.A549A	BRF1_ENST00000379932.4_Intron|BRF1_ENST00000551787.1_Intron|BRF1_ENST00000549044.1_5'UTR|BRF1_ENST00000327359.3_Silent_p.A434A|BRF1_ENST00000547530.1_Silent_p.A75A|BRF1_ENST00000446501.2_Silent_p.A311A|BRF1_ENST00000392557.4_Silent_p.A345A|BRF1_ENST00000379937.2_Silent_p.A522A|BRF1_ENST00000440513.3_Silent_p.A456A	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	549					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)	p.A549A(1)		NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		TGCCCCCGCCGGCGCTGCTGA	0.637																																																1	Substitution - coding silent(1)	ovary(1)	14											42.0	38.0	39.0					14																	105684006		2203	4300	6503	104755051	SO:0001819	synonymous_variant	2972			U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.1647C>A	14.37:g.105684006G>T			104755051	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Silent	SNP	ENST00000546474.1	37	CCDS10001.1	SNP	39	WashU																																																																																				0.637	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074548.4	NM_001519		Silent
PHLPP2	23035	genome.wustl.edu	37	16	71736603	71736604	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-23-1021-01	TCGA-23-1021-10	T	T	A	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr16:71736603_71736604TC>AA	ENST00000568954.1	-	3	693_694	c.315_316GA>TT	c.(313-318)caGAtc>caTTtc	p.105_106QI>HF	PHLPP2_ENST00000360429.3_Missense_Mutation_p.105_106QI>HF|PHLPP2_ENST00000356272.3_Missense_Mutation_p.105_106QI>HF|PHLPP2_ENST00000393524.2_Missense_Mutation_p.105_106QI>HF|PHLPP2_ENST00000567016.1_Missense_Mutation_p.140_141QI>HF			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	105					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						TCATAAACGATCTGAAGAGGTC	0.361																																																0			16																																								70294105	SO:0001583	missense	23035			BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.315_316delinsAA	16.37:g.71736603_71736604delinsAA	ENSP00000457991:p.Q105_I106delinsHF		70294104	A1L374|Q9NV17|Q9Y2E3	Missense	DNP	ENST00000568954.1	37	CCDS32479.1	DNP	50	WashU																																																																																				0.361	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1	NM_015020		Missense
CXXC1	30827	genome.wustl.edu	37	18	47811704	47811704	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1021-01	TCGA-23-1021-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr18:47811704G>C	ENST00000285106.6	-	6	1371	c.657C>G	c.(655-657)ttC>ttG	p.F219L	CXXC1_ENST00000587396.1_5'Flank|CXXC1_ENST00000589940.1_Missense_Mutation_p.F219L|CXXC1_ENST00000412036.2_Missense_Mutation_p.F219L	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	219					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.F219L(1)		autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						CCGAGGAAGGGAAGTACTTGT	0.677																																																1	Substitution - Missense(1)	ovary(1)	18											39.0	40.0	40.0					18																	47811704		2203	4300	6503	46065702	SO:0001583	missense	30827			BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.657C>G	18.37:g.47811704G>C	ENSP00000285106:p.Phe219Leu		46065702	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	ENST00000285106.6	37	CCDS11945.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	14.37	2.513824	0.44763	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.20881	2.04;2.04	3.85	3.85	0.44370	.	0.209888	0.32190	N	0.006459	T	0.18383	0.0441	L	0.36672	1.1	0.35839	D	0.825883	P;B;B;B	0.43392	0.805;0.219;0.14;0.14	P;B;B;B	0.45506	0.483;0.294;0.153;0.153	T	0.07481	-1.0770	10	0.10111	T	0.7	-12.4459	11.9623	0.53015	0.0:0.0:1.0:0.0	.	219;219;219;86	B2RC03;Q9P0U4-2;Q9P0U4;Q59EC8	.;.;CXXC1_HUMAN;.	L	219	ENSP00000285106:F219L;ENSP00000390475:F219L	ENSP00000285106:F219L	F	-	3	2	CXXC1	46065702	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.637000	0.37155	2.100000	0.63781	0.542000	0.68232	TTC		0.677	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255927.2	NM_014593		Missense_Mutation
RWDD1	51389	genome.wustl.edu	37	6	116914220	116914221	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-23-1021-01	TCGA-23-1021-10	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr6:116914220_116914221CC>AA	ENST00000466444.2	+	7	904_905	c.688_689CC>AA	c.(688-690)CCa>AAa	p.P230K	RWDD1_ENST00000392526.1_Missense_Mutation_p.P134K|RWDD1_ENST00000487832.2_Missense_Mutation_p.P134K	NM_015952.2	NP_057036.2	Q9H446	RWDD1_HUMAN	RWD domain containing 1	230								p.P230Q(1)|p.P230T(1)		NS(1)|breast(2)|central_nervous_system(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)	12		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.0312)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)|Epithelial(106;0.161)		TGAAGATGATCCAGACTATAAT	0.475																																																2	Substitution - Missense(2)	ovary(2)	6																																								117020914	SO:0001583	missense	51389			AF092134	CCDS34520.1, CCDS43496.1	6q13-q22.33	2012-12-07			ENSG00000111832	ENSG00000111832			20993	protein-coding gene	gene with protein product						10810093	Standard	NM_016104		Approved	PTD013	uc003pxd.3	Q9H446	OTTHUMG00000015441	Exception_encountered	6.37:g.116914220_116914221delinsAA	ENSP00000420357:p.Pro230Lys		117020913	A8K3W2|A8MT24|Q9Y313|Q9Y6B3	Missense	DNP	ENST00000466444.2	37	CCDS34520.1	DNP	30	WashU																																																																																				0.475	RWDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041952.2	NM_015952		Missense
Unknown	0	genome.wustl.edu	37	1	0	0	+	IGR	DEL	TCA	TCA	-			TCGA-23-1021-01	TCGA-23-1021-10	TCA	TCA	TCA	-	TCA	TCA	Unknown	Invalid:failed_liftOver	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr1:0delTCA								None (None upstream) : DDX11L1 (11868 downstream)																							NNNNNNNNNN	0.0																																																0			1																																								153614792	SO:0001628	intergenic_variant	55870																															1.37:g.0delTCA			153614790		In_Frame_Del	DEL		37		DEL	17	WashU																																																																																			0	0.000									In_Frame_Del
COL4A4	1286	genome.wustl.edu	37	2	227958954	227958962	+	In_Frame_Del	DEL	GGAAGCCCA	GGAAGCCCA	-			TCGA-23-1021-01	TCGA-23-1021-10	GGAAGCCCA	GGAAGCCCA	GGAAGCCCA	-	GGAAGCCCA	GGAAGCCCA	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1021-01	TCGA-23-1021-10	g.chr2:227958954_227958962delGGAAGCCCA	ENST00000396625.3	-	20	1455_1463	c.1248_1256delTGGGCTTCC	c.(1246-1257)cctgggcttcca>cca	p.416_419PGLP>P	COL4A4_ENST00000329662.7_In_Frame_Del_p.416_419PGLP>P	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	416	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		AGCTTCTCCTGGAAGCCCAGGAAGACCAG	0.522																																																0			2																																								227667206	SO:0001651	inframe_deletion	1286				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.1248_1256delTGGGCTTCC	2.37:g.227958954_227958962delGGAAGCCCA	ENSP00000379866:p.Pro416_Leu418del		227667198	A8MTZ1|Q53RW9|Q53S42|Q53WR1	In_Frame_Del	DEL	ENST00000396625.3	37	CCDS42828.1	DEL	47	WashU																																																																																				0.522	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092		In_Frame_Del
