#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
NXN	64359	genome.wustl.edu	37	17	725672	725672	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr17:725672C>T	ENST00000336868.3	-	4	729	c.638G>A	c.(637-639)cGg>cAg	p.R213Q	NXN_ENST00000575801.1_Missense_Mutation_p.R105Q|NXN_ENST00000538650.1_5'UTR|NXN_ENST00000577098.1_5'Flank|NXN_ENST00000537628.2_5'UTR	NM_022463.4	NP_071908.2	Q6DKJ4	NXN_HUMAN	nucleoredoxin	213	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cardiovascular system development (GO:0072358)|cell differentiation (GO:0030154)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein-disulfide reductase activity (GO:0047134)|thioredoxin-disulfide reductase activity (GO:0004791)	p.R213Q(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		CACCAGGACCCGGGTGAGGCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	17											92.0	70.0	78.0					17																	725672		2203	4300	6503	672422	SO:0001583	missense	64359				CCDS10998.1, CCDS56013.1	17p13	2007-08-10			ENSG00000167693	ENSG00000167693			18008	protein-coding gene	gene with protein product		612895					Standard	NM_022463		Approved	FLJ12614, NRX	uc002fsa.3	Q6DKJ4	OTTHUMG00000090307	ENST00000336868.3:c.638G>A	17.37:g.725672C>T	ENSP00000337443:p.Arg213Gln		672422	B4DXQ0|D3DTH2|Q3SWW6|Q6P3U6|Q7L4C6|Q9H9Q1	Missense_Mutation	SNP	ENST00000336868.3	37	CCDS10998.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997162	0.74818	.	.	ENSG00000167693	ENST00000336868;ENST00000537628	T	0.80123	-1.34	5.94	5.94	0.96194	Alkyl hydroperoxide reductase subunit C/ Thiol specific antioxidant (1);Thioredoxin-like fold (3);	0.108375	0.64402	D	0.000004	D	0.82472	0.5044	N	0.12887	0.27	0.80722	D	1	B;D;D	0.76494	0.282;0.999;0.999	B;D;D	0.77557	0.035;0.99;0.986	D	0.85269	0.1055	10	0.66056	D	0.02	-15.4728	19.3475	0.94370	0.0:1.0:0.0:0.0	.	105;100;213	B4DXQ0;Q6DKJ4-2;Q6DKJ4	.;.;NXN_HUMAN	Q	213;105	ENSP00000337443:R213Q	ENSP00000337443:R213Q	R	-	2	0	NXN	672422	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.881000	0.69706	2.816000	0.96949	0.563000	0.77884	CGG		0.607	NXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206669.1			Missense_Mutation
OR51E2	81285	genome.wustl.edu	37	11	4703040	4703040	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:4703040C>A	ENST00000396950.3	-	2	1141	c.902G>T	c.(901-903)cGg>cTg	p.R301L		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	301					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)	p.R301L(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		AGCCAGCACCCGTGTTCTGAT	0.488																																																1	Substitution - Missense(1)	ovary(1)	11											153.0	127.0	136.0					11																	4703040		2201	4298	6499	4659616	SO:0001583	missense	81285			AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.902G>T	11.37:g.4703040C>A	ENSP00000380153:p.Arg301Leu		4659616	B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	37	CCDS7751.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	19.29	3.799287	0.70567	.	.	ENSG00000167332	ENST00000396950	T	0.37584	1.19	5.35	5.35	0.76521	.	0.000000	0.41712	D	0.000840	T	0.50222	0.1603	L	0.39514	1.22	0.35947	D	0.833637	D	0.76494	0.999	D	0.70935	0.971	T	0.53795	-0.8388	10	0.40728	T	0.16	.	15.9013	0.79380	0.0:1.0:0.0:0.0	.	301	Q9H255	O51E2_HUMAN	L	301	ENSP00000380153:R301L	ENSP00000380153:R301L	R	-	2	0	OR51E2	4659616	0.499000	0.26083	0.975000	0.42487	0.669000	0.39330	0.878000	0.28126	2.781000	0.95711	0.655000	0.94253	CGG		0.488	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774		Missense_Mutation
RANBP6	26953	genome.wustl.edu	37	9	6015291	6015291	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr9:6015291T>C	ENST00000259569.5	-	1	327	c.317A>G	c.(316-318)aAg>aGg	p.K106R	RANBP6_ENST00000485372.1_Intron	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	106					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.K106R(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		TGTTTCTAACTTAACAGCCAG	0.443																																																1	Substitution - Missense(1)	ovary(1)	9											77.0	79.0	78.0					9																	6015291		2203	4300	6503	6005291	SO:0001583	missense	26953			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.317A>G	9.37:g.6015291T>C	ENSP00000259569:p.Lys106Arg		6005291	Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	37	CCDS6467.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	12.42	1.931252	0.34096	.	.	ENSG00000137040	ENST00000259569	T	0.09723	2.95	4.51	4.51	0.55191	Armadillo-like helical (1);Armadillo-type fold (1);	0.112660	0.64402	D	0.000009	T	0.06280	0.0162	N	0.14661	0.345	0.32630	N	0.522188	B	0.02656	0.0	B	0.04013	0.001	T	0.15549	-1.0433	10	0.11794	T	0.64	-10.6746	12.4374	0.55606	0.0:0.0:0.0:1.0	.	106	O60518	RNBP6_HUMAN	R	106	ENSP00000259569:K106R	ENSP00000259569:K106R	K	-	2	0	RANBP6	6005291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.678000	0.68153	2.254000	0.74563	0.459000	0.35465	AAG		0.443	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416		Missense_Mutation
SLC16A11	162515	genome.wustl.edu	37	17	6945155	6945155	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr17:6945155C>A	ENST00000308009.1	-	4	1596	c.1259G>T	c.(1258-1260)aGc>aTc	p.S420I	SLC16A11_ENST00000447225.1_Missense_Mutation_p.S388I	NM_153357.1	NP_699188.1	Q8NCK7	MOT11_HUMAN	solute carrier family 16, member 11	420					lipid metabolic process (GO:0006629)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.S420I(1)		endometrium(2)|kidney(2)|lung(2)|ovary(1)|skin(2)	9						GTAGATGAAGCTGCCGGAGAG	0.607																																																1	Substitution - Missense(1)	ovary(1)	17											38.0	49.0	46.0					17																	6945155		2199	4296	6495	6885879	SO:0001583	missense	162515			AK074674	CCDS11086.1	17p13.2	2013-07-18	2013-07-18		ENSG00000174326	ENSG00000174326		"""Solute carriers"""	23093	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 11"""	615765	"""solute carrier family 16 (monocarboxylic acid transporters), member 11"""				Standard	NM_153357		Approved	FLJ90193, MCT11	uc002gei.1	Q8NCK7	OTTHUMG00000102087	ENST00000308009.1:c.1259G>T	17.37:g.6945155C>A	ENSP00000310490:p.Ser420Ile		6885879		Missense_Mutation	SNP	ENST00000308009.1	37	CCDS11086.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828791	0.50845	.	.	ENSG00000174326	ENST00000308009;ENST00000447225	T;T	0.57273	0.41;0.41	5.12	5.12	0.69794	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.340460	0.32488	N	0.006037	T	0.60495	0.2273	L	0.58101	1.795	0.35949	D	0.833792	D	0.59357	0.985	P	0.55055	0.767	T	0.64326	-0.6434	10	0.27082	T	0.32	.	13.9443	0.64075	0.0:1.0:0.0:0.0	.	420	Q8NCK7	MOT11_HUMAN	I	420;388	ENSP00000310490:S420I;ENSP00000394449:S388I	ENSP00000310490:S420I	S	-	2	0	SLC16A11	6885879	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	1.845000	0.39279	2.644000	0.89710	0.650000	0.86243	AGC		0.607	SLC16A11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219921.1	NM_153357		Missense_Mutation
ACSM4	341392	genome.wustl.edu	37	12	7456964	7456964	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:7456964A>T	ENST00000399422.4	+	1	85	c.37A>T	c.(37-39)Atc>Ttc	p.I13F		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	13					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						ATTTAGATTCATCTGGCTCAC	0.478																																																0			12											160.0	153.0	155.0					12																	7456964		1886	4117	6003	7348231	SO:0001583	missense	341392				CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.37A>T	12.37:g.7456964A>T	ENSP00000382349:p.Ile13Phe		7348231	A8MTI6	Missense_Mutation	SNP	ENST00000399422.4	37	CCDS44825.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	13.87	2.366926	0.41902	.	.	ENSG00000215009	ENST00000399422	T	0.46063	0.88	4.42	-1.0	0.10196	.	.	.	.	.	T	0.19287	0.0463	N	0.08118	0	0.20307	N	0.999911	B	0.02656	0.0	B	0.04013	0.001	T	0.17715	-1.0360	9	0.52906	T	0.07	-13.2738	4.2111	0.10512	0.3851:0.3981:0.2168:0.0	.	13	P0C7M7	ACSM4_HUMAN	F	13	ENSP00000382349:I13F	ENSP00000382349:I13F	I	+	1	0	ACSM4	7348231	0.000000	0.05858	0.257000	0.24404	0.484000	0.33280	-0.697000	0.05098	0.019000	0.15079	0.533000	0.62120	ATC		0.478	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337866.2	NM_001080454		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7578440	7578440	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1022-01	TCGA-23-1022-10	T	T	C	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr17:7578440T>C	ENST00000269305.4	-	5	679	c.490A>G	c.(490-492)Aag>Gag	p.K164E	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.K164E|TP53_ENST00000455263.2_Missense_Mutation_p.K164E|TP53_ENST00000445888.2_Missense_Mutation_p.K164E|TP53_ENST00000413465.2_Missense_Mutation_p.K164E|TP53_ENST00000420246.2_Missense_Mutation_p.K164E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	164	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in sporadic cancers; somatic mutation).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K164E(15)|p.K164*(11)|p.0?(8)|p.K164Q(2)|p.K164fs*6(2)|p.K164fs*3(2)|p.V157_C176del20(1)|p.Y163fs*1(1)|p.Y163_Q165delYKQ(1)|p.P151_V173del23(1)|p.K164fs*5(1)|p.K71E(1)|p.K164fs*17(1)|p.Y163fs*14(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.K32E(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGTGACTGCTTGTAGATGGCC	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Substitution - Missense(19)|Substitution - Nonsense(11)|Deletion - Frameshift(8)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(1)	lung(12)|central_nervous_system(6)|bone(5)|urinary_tract(4)|breast(4)|oesophagus(4)|upper_aerodigestive_tract(3)|large_intestine(3)|ovary(3)|liver(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	17											54.0	54.0	54.0					17																	7578440		2203	4300	6503	7519165	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.490A>G	17.37:g.7578440T>C	ENSP00000269305:p.Lys164Glu		7519165	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	16.70	3.195088	0.58017	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99784	-6.74;-6.74;-6.74;-6.74;-6.74;-6.74;-6.74;-6.74;-6.74	5.59	4.5	0.54988	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99585	0.9850	M	0.62088	1.915	0.58432	D	0.999992	D;D;D;D;D;P;D	0.89917	0.986;0.996;0.965;0.998;0.997;0.95;1.0	D;D;P;D;D;P;D	0.85130	0.934;0.952;0.76;0.98;0.972;0.9;0.997	D	0.98302	1.0519	10	0.87932	D	0	-15.5455	10.4804	0.44689	0.1456:0.0:0.0:0.8544	.	125;164;164;71;164;164;164	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	E	164;164;164;164;164;164;153;71;32;71;32;164	ENSP00000410739:K164E;ENSP00000352610:K164E;ENSP00000269305:K164E;ENSP00000398846:K164E;ENSP00000391127:K164E;ENSP00000391478:K164E;ENSP00000425104:K32E;ENSP00000423862:K71E;ENSP00000424104:K164E	ENSP00000269305:K164E	K	-	1	0	TP53	7519165	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	7.996000	0.88334	1.039000	0.40074	-0.336000	0.08194	AAG		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
MTCL1	23255	genome.wustl.edu	37	18	8784735	8784735	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr18:8784735C>A	ENST00000306329.11	+	5	2705	c.2705C>A	c.(2704-2706)cCc>cAc	p.P902H	SOGA2_ENST00000400050.3_Missense_Mutation_p.P542H|SOGA2_ENST00000517570.1_Missense_Mutation_p.P542H|SOGA2_ENST00000359865.3_Missense_Mutation_p.P542H|SOGA2_ENST00000306285.7_5'UTR														p.P542H(1)									GGCCTATCCCCCTTGCCCCAC	0.617																																																1	Substitution - Missense(1)	ovary(1)	18											89.0	89.0	89.0					18																	8784735		2203	4300	6503	8774735	SO:0001583	missense	23255																														ENST00000306329.11:c.2705C>A	18.37:g.8784735C>A	ENSP00000305027:p.Pro902His		8774735		Missense_Mutation	SNP	ENST00000306329.11	37		SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	11.11	1.543429	0.27563	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050	T;T;T	0.51574	0.7;0.7;0.7	5.35	5.35	0.76521	.	0.150419	0.31612	N	0.007342	T	0.66781	0.2824	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73708	0.957;0.981	T	0.68580	-0.5371	10	0.66056	D	0.02	-21.1224	19.0641	0.93103	0.0:1.0:0.0:0.0	.	563;542	A8MQ54;Q9Y4B5-3	.;.	H	563;542;542;542	ENSP00000429556:P542H;ENSP00000352927:P542H;ENSP00000382924:P542H	ENSP00000305027:P563H	P	+	2	0	CCDC165	8774735	1.000000	0.71417	0.938000	0.37757	0.705000	0.40729	7.487000	0.81328	2.497000	0.84241	0.655000	0.94253	CCC		0.617	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1			Missense_Mutation
OR7D2	162998	genome.wustl.edu	37	19	9296785	9296785	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:9296785C>G	ENST00000344248.2	+	1	507	c.328C>G	c.(328-330)Ctg>Gtg	p.L110V		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	110					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L110V(1)		breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						TTTTCCTATTCTGGACACGCT	0.517																																																1	Substitution - Missense(1)	ovary(1)	19											182.0	167.0	172.0					19																	9296785		2203	4300	6503	9157785	SO:0001583	missense	162998			AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.328C>G	19.37:g.9296785C>G	ENSP00000345563:p.Leu110Val		9157785	Q6IFJ7|Q8N133	Missense_Mutation	SNP	ENST00000344248.2	37	CCDS32900.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	0.830	-0.745599	0.03065	.	.	ENSG00000188000	ENST00000344248	T	0.00653	5.96	2.21	-1.95	0.07548	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31268	U	0.007960	T	0.00496	0.0016	L	0.28649	0.875	0.09310	N	1	B	0.23058	0.079	B	0.19946	0.027	T	0.49466	-0.8937	10	0.62326	D	0.03	.	1.8614	0.03189	0.4995:0.2153:0.1648:0.1204	.	110	Q96RA2	OR7D2_HUMAN	V	110	ENSP00000345563:L110V	ENSP00000345563:L110V	L	+	1	2	OR7D2	9157785	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	-0.338000	0.07842	-0.321000	0.08627	0.511000	0.50034	CTG		0.517	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449002.1			Missense_Mutation
FRMPD4	9758	genome.wustl.edu	37	X	12738746	12738746	+	3'UTR	SNP	T	T	C			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chrX:12738746T>C	ENST00000380682.1	+	0	4569					NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4						positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.I1346T(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CCATCAAACATTCACTCGGAA	0.512																																																1	Substitution - Missense(1)	ovary(1)	X											71.0	52.0	57.0					X																	12738746		692	1591	2283	12648667	SO:0001624	3_prime_UTR_variant	9758			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.*94T>C	X.37:g.12738746T>C			12648667	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	SNP	52	WashU																																																																																				0.512	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		Missense_Mutation
XKR3	150165	genome.wustl.edu	37	22	17265233	17265233	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr22:17265233A>G	ENST00000331428.5	-	4	758	c.656T>C	c.(655-657)aTc>aCc	p.I219T		NM_175878.3	NP_787074.2	Q5GH77	XKR3_HUMAN	XK, Kell blood group complex subunit-related family, member 3	219						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I219T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GCTGATCTGGATGGCCAGTAT	0.403																																																1	Substitution - Missense(1)	ovary(1)	22											16.0	16.0	16.0					22																	17265233		1466	3479	4945	15645233	SO:0001583	missense	150165			AY989815	CCDS42975.1	22q11.1	2007-01-16	2006-01-12		ENSG00000172967	ENSG00000172967			28778	protein-coding gene	gene with protein product		611674	"""X Kell blood group precursor-related family, member 3"""			16431037	Standard	NM_175878		Approved	MGC57211, XTES	uc002zlv.3	Q5GH77	OTTHUMG00000143726	ENST00000331428.5:c.656T>C	22.37:g.17265233A>G	ENSP00000331704:p.Ile219Thr		15645233	B2RPN1|Q52PG8|Q8N7E1	Missense_Mutation	SNP	ENST00000331428.5	37	CCDS42975.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	.	16.01	3.001119	0.54254	.	.	ENSG00000172967	ENST00000331428	T	0.64991	-0.13	0.771	0.771	0.18504	.	0.132226	0.47455	U	0.000232	T	0.53367	0.1792	L	0.46157	1.445	0.39338	D	0.965532	D	0.59767	0.986	P	0.49301	0.606	T	0.50432	-0.8829	10	0.22706	T	0.39	.	5.862	0.18754	1.0:0.0:0.0:0.0	.	219	Q5GH77	XKR3_HUMAN	T	219	ENSP00000331704:I219T	ENSP00000331704:I219T	I	-	2	0	XKR3	15645233	1.000000	0.71417	0.818000	0.32626	0.116000	0.19942	5.834000	0.69361	0.630000	0.30394	0.246000	0.17985	ATC		0.403	XKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289789.1	NM_175878		Missense_Mutation
CYP4F12	66002	genome.wustl.edu	37	19	15793204	15793204	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:15793204G>T	ENST00000550308.1	+	6	911	c.531G>T	c.(529-531)aaG>aaT	p.K177N	CYP4F12_ENST00000324632.10_Missense_Mutation_p.K177N	NM_023944.3	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 12	177					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|leukotriene B4 catabolic process (GO:0036101)|long-chain fatty acid metabolic process (GO:0001676)|negative regulation of blood coagulation (GO:0030195)|oxidation-reduction process (GO:0055114)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|very long-chain fatty acid metabolic process (GO:0000038)|vitamin E metabolic process (GO:0042360)|vitamin K biosynthetic process (GO:0042371)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)	p.K177N(1)		NS(1)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	41	Acute lymphoblastic leukemia(2;0.0367)				Fingolimod(DB08868)	GCCAGGACAAGTGGCAGCACC	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											61.0	57.0	59.0					19																	15793204		2203	4300	6503	15654204	SO:0001583	missense	66002			AB035130	CCDS42517.1	19p13.1	2008-02-05	2003-01-14		ENSG00000186204	ENSG00000186204		"""Cytochrome P450s"""	18857	protein-coding gene	gene with protein product		611485	"""cytochrome P450, subfamily IVF, polypeptide 12"""			11162607	Standard	NM_023944		Approved		uc002nbl.3	Q9HCS2	OTTHUMG00000164477	ENST00000550308.1:c.531G>T	19.37:g.15793204G>T	ENSP00000448998:p.Lys177Asn		15654204	E7ET51|O60389|Q5JPJ7|Q9HCS1	Missense_Mutation	SNP	ENST00000550308.1	37	CCDS42517.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	.	13.13	2.144196	0.37825	.	.	ENSG00000186204	ENST00000550308;ENST00000324632	T;T	0.69806	-0.43;-0.43	2.36	1.26	0.21427	.	0.072728	0.52532	U	0.000068	T	0.66723	0.2818	L	0.55743	1.74	0.37933	D	0.932079	P	0.45011	0.848	P	0.51742	0.678	T	0.67565	-0.5638	10	0.51188	T	0.08	.	8.1436	0.31097	0.0:0.0:0.7582:0.2418	.	177	Q9HCS2	CP4FC_HUMAN	N	177	ENSP00000448998:K177N;ENSP00000321821:K177N	ENSP00000321821:K177N	K	+	3	2	CYP4F12	15654204	1.000000	0.71417	0.998000	0.56505	0.363000	0.29612	1.013000	0.29937	0.516000	0.28340	0.491000	0.48974	AAG		0.567	CYP4F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378938.9			Missense_Mutation
ADORA2B	136	genome.wustl.edu	37	17	15878585	15878585	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr17:15878585C>T	ENST00000304222.2	+	2	1260	c.928C>T	c.(928-930)Ctc>Ttc	p.L310F	ZSWIM7_ENST00000399280.2_5'Flank	NM_000676.2	NP_000667.1	P29275	AA2BR_HUMAN	adenosine A2b receptor	310					activation of adenylate cyclase activity (GO:0007190)|activation of MAPK activity (GO:0000187)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular defense response (GO:0006968)|cellular response to extracellular stimulus (GO:0031668)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)|JNK cascade (GO:0007254)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to non-antigenic stimulus (GO:0002882)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation vascular endothelial growth factor production (GO:0010575)|relaxation of vascular smooth muscle (GO:0060087)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)	p.L310F(1)		breast(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	9				UCEC - Uterine corpus endometrioid carcinoma (92;0.0855)	Adenosine(DB00640)|Defibrotide(DB04932)|Enprofylline(DB00824)|Theophylline(DB00277)	CAGGTATCTTCTCTGCCAAGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	17											103.0	109.0	107.0					17																	15878585		2203	4300	6503	15819310	SO:0001583	missense	136			M97759	CCDS11173.1	17p12	2012-08-08			ENSG00000170425	ENSG00000170425		"""GPCR / Class A : Adenosine receptors"""	264	protein-coding gene	gene with protein product		600446				7558011	Standard	NM_000676		Approved		uc002gpd.1	P29275	OTTHUMG00000059140	ENST00000304222.2:c.928C>T	17.37:g.15878585C>T	ENSP00000304501:p.Leu310Phe		15819310		Missense_Mutation	SNP	ENST00000304222.2	37	CCDS11173.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	11.48	1.650058	0.29336	.	.	ENSG00000170425	ENST00000304222	T	0.37411	1.2	5.79	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.20981	0.0505	N	0.17082	0.46	0.47374	D	0.999408	B	0.15719	0.014	B	0.14023	0.01	T	0.07139	-1.0788	10	0.19147	T	0.46	-13.9349	9.6001	0.39598	0.0:0.7842:0.1416:0.0742	.	310	P29275	AA2BR_HUMAN	F	310	ENSP00000304501:L310F	ENSP00000304501:L310F	L	+	1	0	ADORA2B	15819310	1.000000	0.71417	0.920000	0.36463	0.512000	0.34134	4.280000	0.58959	1.464000	0.47987	-0.253000	0.11424	CTC		0.498	ADORA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131032.1			Missense_Mutation
PIK3C2A	5286	genome.wustl.edu	37	11	17172172	17172172	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:17172172G>C	ENST00000265970.7	-	3	1199	c.1200C>G	c.(1198-1200)caC>caG	p.H400Q	PIK3C2A_ENST00000531428.1_5'UTR|PIK3C2A_ENST00000540361.1_Missense_Mutation_p.H20Q	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	400					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)	p.H400Q(1)		central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						GGTTTGTGCGGTGATTGGTAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	11											167.0	150.0	156.0					11																	17172172		2200	4293	6493	17128748	SO:0001583	missense	5286			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.1200C>G	11.37:g.17172172G>C	ENSP00000265970:p.His400Gln		17128748	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	3.738	-0.054187	0.07362	.	.	ENSG00000011405	ENST00000265970;ENST00000540361;ENST00000544896	T;T	0.40476	1.03;1.03	5.94	1.47	0.22746	.	0.393472	0.28398	N	0.015486	T	0.18718	0.0449	N	0.12182	0.205	0.09310	N	1	B;B	0.14805	0.011;0.001	B;B	0.12837	0.008;0.001	T	0.09357	-1.0678	10	0.28530	T	0.3	-2.7413	2.9173	0.05757	0.2142:0.2862:0.3943:0.1053	.	400;400	F5H5W9;O00443	.;P3C2A_HUMAN	Q	400;20;400	ENSP00000265970:H400Q;ENSP00000438687:H20Q	ENSP00000265970:H400Q	H	-	3	2	PIK3C2A	17128748	0.001000	0.12720	0.390000	0.26220	0.186000	0.23388	-0.055000	0.11807	0.392000	0.25172	0.591000	0.81541	CAC		0.368	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645		Missense_Mutation
ST8SIA6	338596	genome.wustl.edu	37	10	17363274	17363274	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr10:17363274A>C	ENST00000377602.4	-	8	874	c.800T>G	c.(799-801)cTt>cGt	p.L267R		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	267					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)	p.L267R(1)		endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						TGCTGGCAGAAGAAAAAATGC	0.368																																																1	Substitution - Missense(1)	ovary(1)	10											73.0	81.0	78.0					10																	17363274		2203	4300	6503	17403280	SO:0001583	missense	338596				CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.800T>G	10.37:g.17363274A>C	ENSP00000366827:p.Leu267Arg		17403280	B0YJ97|B9EH72|Q5VZH4	Missense_Mutation	SNP	ENST00000377602.4	37	CCDS31158.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	23.2	4.387435	0.82902	.	.	ENSG00000148488	ENST00000377610;ENST00000377602	T	0.33654	1.4	5.18	5.18	0.71444	.	0.061476	0.64402	D	0.000005	T	0.63070	0.2480	M	0.82630	2.6	0.53005	D	0.999963	D	0.89917	1.0	D	0.76071	0.987	T	0.67268	-0.5713	10	0.52906	T	0.07	-5.111	15.4962	0.75653	1.0:0.0:0.0:0.0	.	267	P61647	SIA8F_HUMAN	R	97;267	ENSP00000366827:L267R	ENSP00000366827:L267R	L	-	2	0	ST8SIA6	17403280	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	6.974000	0.76122	2.307000	0.77673	0.528000	0.53228	CTT		0.368	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	NM_001004470		Missense_Mutation
PAX7	5081	genome.wustl.edu	37	1	18960889	18960889	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:18960889G>C	ENST00000375375.3	+	2	776	c.178G>C	c.(178-180)Gtg>Ctg	p.V60L	PAX7_ENST00000400661.3_Missense_Mutation_p.V60L|PAX7_ENST00000420770.2_Missense_Mutation_p.V60L	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	60	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.|Sufficient to mediate interaction with PAXBP1. {ECO:0000250}.				anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V60L(1)	PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		CCACAAGATAGTGGAGATGGC	0.612			T	FOXO1A	alveolar rhabdomyosarcoma																																		Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	1	Substitution - Missense(1)	ovary(1)	1											52.0	48.0	50.0					1																	18960889		2203	4300	6503	18833476	SO:0001583	missense	5081			X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.178G>C	1.37:g.18960889G>C	ENSP00000364524:p.Val60Leu		18833476	E9PFV9|Q0VA99|Q2PJS5	Missense_Mutation	SNP	ENST00000375375.3	37	CCDS186.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	32	5.139650	0.94560	.	.	ENSG00000009709	ENST00000375375;ENST00000420770;ENST00000400661	D;D;D	0.99537	-6.11;-6.11;-6.11	5.34	5.34	0.76211	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.068847	0.64402	D	0.000017	D	0.99606	0.9857	M	0.83384	2.64	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.992	D;D;D	0.81914	0.995;0.991;0.971	D	0.98072	1.0399	10	0.87932	D	0	.	17.6184	0.88074	0.0:0.0:1.0:0.0	.	60;60;60	E9PFV9;P23759-2;P23759	.;.;PAX7_HUMAN	L	60	ENSP00000364524:V60L;ENSP00000403389:V60L;ENSP00000383502:V60L	ENSP00000364524:V60L	V	+	1	0	PAX7	18833476	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.799000	0.99117	2.499000	0.84300	0.462000	0.41574	GTG		0.612	PAX7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006928.1	NM_002584		Missense_Mutation
RNF112	7732	genome.wustl.edu	37	17	19317435	19317435	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr17:19317435G>A	ENST00000461366.1	+	7	1068	c.853G>A	c.(853-855)Gat>Aat	p.D285N	CTB-187M2.2_ENST00000579897.1_RNA	NM_007148.4	NP_009079.2	Q9ULX5	RN112_HUMAN	ring finger protein 112	285	GB1/RHD3-type G.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)	p.D285N(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|urinary_tract(1)	12						GGAGCTGAAGGATACAGACCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	17											62.0	63.0	63.0					17																	19317435		1890	4113	6003	19258027	SO:0001583	missense	7732			AF054587	CCDS58529.1	17p11.2	2013-01-16	2008-06-13	2008-06-13	ENSG00000128482	ENSG00000128482		"""RING-type (C3HC4) zinc fingers"""	12968	protein-coding gene	gene with protein product		601237	"""zinc finger protein 179"""	ZNF179		8660987, 9806830	Standard	NM_007148		Approved	BFP	uc010vyw.2	Q9ULX5	OTTHUMG00000059601	ENST00000461366.1:c.853G>A	17.37:g.19317435G>A	ENSP00000454919:p.Asp285Asn		19258027	O60633|Q7Z5V9	Missense_Mutation	SNP	ENST00000461366.1	37	CCDS58529.1	SNP	41	WashU																																																																																				0.562	RNF112-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132549.4	NM_007148		Missense_Mutation
OR4N2	390429	genome.wustl.edu	37	14	20296515	20296515	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr14:20296515A>T	ENST00000315947.1	+	1	908	c.908A>T	c.(907-909)aAt>aTt	p.N303I	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N303I(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AAGGTGTTTAATAAGCACATA	0.343																																																1	Substitution - Missense(1)	ovary(1)	14											26.0	28.0	27.0					14																	20296515		2190	4245	6435	19366355	SO:0001583	missense	390429				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.908A>T	14.37:g.20296515A>T	ENSP00000319601:p.Asn303Ile		19366355	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	37	CCDS32022.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	.	8.484	0.860556	0.17178	.	.	ENSG00000176294	ENST00000315947	T	0.36699	1.24	4.57	-6.42	0.01932	.	0.808003	0.10618	N	0.653687	T	0.14700	0.0355	N	0.20685	0.6	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17992	-1.0351	10	0.33141	T	0.24	.	0.583	0.00715	0.2986:0.1131:0.2385:0.3497	.	303	Q8NGD1	OR4N2_HUMAN	I	303	ENSP00000319601:N303I	ENSP00000319601:N303I	N	+	2	0	OR4N2	19366355	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.069000	0.14552	-1.060000	0.03189	0.482000	0.46254	AAT		0.343	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2			Missense_Mutation
ZNF90	7643	genome.wustl.edu	37	19	20216091	20216091	+	Silent	SNP	T	T	A			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:20216091T>A	ENST00000418063.2	+	3	304	c.192T>A	c.(190-192)acT>acA	p.T64T	ZNF90_ENST00000474284.1_3'UTR	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	64	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T64T(2)		breast(1)|lung(2)|ovary(1)|skin(1)	5						AACCCTTCACTGTGAAGAGAC	0.398																																																2	Substitution - coding silent(2)	ovary(2)	19											110.0	111.0	111.0					19																	20216091		692	1591	2283	20077091	SO:0001819	synonymous_variant	7643			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.192T>A	19.37:g.20216091T>A			20077091	B9EH87	Silent	SNP	ENST00000418063.2	37	CCDS46028.1	SNP	55	WashU																																																																																				0.398	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350101.1	NM_007138		Silent
UMOD	7369	genome.wustl.edu	37	16	20348686	20348686	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr16:20348686G>C	ENST00000570689.1	-	8	1813	c.1667C>G	c.(1666-1668)gCt>gGt	p.A556G	UMOD_ENST00000302509.4_Missense_Mutation_p.A556G|UMOD_ENST00000396138.4_Missense_Mutation_p.A605G|UMOD_ENST00000424589.1_Missense_Mutation_p.A589G|UMOD_ENST00000396134.2_Missense_Mutation_p.A589G|UMOD_ENST00000570331.1_5'UTR|UMOD_ENST00000396142.2_Missense_Mutation_p.A556G			P07911	UROM_HUMAN	uromodulin	556	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)	p.A556G(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						ATAGTTTCCAGCAAACCGGAA	0.527																																																1	Substitution - Missense(1)	ovary(1)	16											108.0	105.0	106.0					16																	20348686		2203	4300	6503	20256187	SO:0001583	missense	7369			M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1667C>G	16.37:g.20348686G>C	ENSP00000460548:p.Ala556Gly		20256187	B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Missense_Mutation	SNP	ENST00000570689.1	37	CCDS10583.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075324	0.76415	.	.	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7	5.62	5.62	0.85841	Zona pellucida sperm-binding protein (3);	0.126915	0.36101	N	0.002787	D	0.90731	0.7091	M	0.89214	3.015	0.36588	D	0.873919	P;P	0.49862	0.896;0.929	P;P	0.61477	0.649;0.889	D	0.93629	0.6954	10	0.87932	D	0	-7.6534	10.568	0.45184	0.0869:0.0:0.9131:0.0	.	589;556	E9PEA4;P07911	.;UROM_HUMAN	G	556;589;589;556;534;556	ENSP00000379438:A589G;ENSP00000416346:A589G;ENSP00000306279:A556G;ENSP00000379446:A556G	ENSP00000306279:A556G	A	-	2	0	UMOD	20256187	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	2.959000	0.49153	2.614000	0.88457	0.655000	0.94253	GCT		0.527	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1			Missense_Mutation
FOCAD	54914	genome.wustl.edu	37	9	20881926	20881926	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr9:20881926G>T	ENST00000380249.1	+	22	2738	c.2374G>T	c.(2374-2376)Ggg>Tgg	p.G792W	FOCAD_ENST00000605086.1_Missense_Mutation_p.G228W|FOCAD_ENST00000338382.6_Missense_Mutation_p.G792W	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	792						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.G792W(1)									TATGCCTCGTGGGATATATCA	0.368																																																1	Substitution - Missense(1)	ovary(1)	9											87.0	97.0	94.0					9																	20881926		2203	4300	6503	20871926	SO:0001583	missense	54914			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.2374G>T	9.37:g.20881926G>T	ENSP00000369599:p.Gly792Trp		20871926	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	26.4	4.730071	0.89390	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.10099	2.91;2.91	5.82	5.82	0.92795	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.34193	0.0889	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00953	-1.1502	10	0.87932	D	0	-27.0064	20.1022	0.97879	0.0:0.0:1.0:0.0	.	792	Q5VW36	K1797_HUMAN	W	792	ENSP00000369599:G792W;ENSP00000344307:G792W	ENSP00000344307:G792W	G	+	1	0	KIAA1797	20871926	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.682000	0.98655	2.759000	0.94783	0.555000	0.69702	GGG		0.368	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794		Missense_Mutation
HSPG2	3339	genome.wustl.edu	37	1	22205548	22205548	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:22205548T>C	ENST00000374695.3	-	18	2489	c.2410A>G	c.(2410-2412)Atg>Gtg	p.M804V		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	804	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.M804V(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GTGGCCTTCATGGCGTCCCCA	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											67.0	67.0	67.0					1																	22205548		2203	4300	6503	22078135	SO:0001583	missense	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.2410A>G	1.37:g.22205548T>C	ENSP00000363827:p.Met804Val		22078135	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	15.84	2.951062	0.53186	.	.	ENSG00000142798	ENST00000374695	T	0.60920	0.15	5.33	5.33	0.75918	EGF-like, laminin (4);	0.184216	0.26231	N	0.025578	T	0.27900	0.0687	N	0.00637	-1.305	0.23036	N	0.998394	B	0.02656	0.0	B	0.01281	0.0	T	0.30909	-0.9962	10	0.66056	D	0.02	.	13.2647	0.60127	0.0:0.0:0.0:1.0	.	804	P98160	PGBM_HUMAN	V	804	ENSP00000363827:M804V	ENSP00000363827:M804V	M	-	1	0	HSPG2	22078135	1.000000	0.71417	0.876000	0.34364	0.971000	0.66376	2.581000	0.46077	2.008000	0.58898	0.454000	0.30748	ATG		0.622	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529		Missense_Mutation
RGL4	266747	genome.wustl.edu	37	22	24038801	24038801	+	Splice_Site	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr22:24038801G>T	ENST00000290691.5	+	7	2257	c.1087G>T	c.(1087-1089)Gcg>Tcg	p.A363S	KB-1572G7.2_ENST00000421064.1_RNA|RGL4_ENST00000401461.1_Splice_Site_p.A227S	NM_153615.1	NP_705843.1	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation stimulator-like 4	363	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.A363S(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(3)	15						CACCTGGCAGGCGGGGAGCTT	0.652																																																1	Substitution - Missense(1)	ovary(1)	22											38.0	39.0	39.0					22																	24038801		2202	4299	6501	22368801	SO:0001630	splice_region_variant	266747				CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496			31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214				9178890, 10851075	Standard	NM_153615		Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000290691.5:c.1087-1G>T	22.37:g.24038801G>T			22368801	Q495L8	Missense_Mutation	SNP	ENST00000290691.5	37	CCDS13811.1	SNP	42	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	12.69|12.69	2.014901|2.014901	0.35511|0.35511	.|.	.|.	ENSG00000159496|ENSG00000159496	ENST00000401461;ENST00000290691;ENST00000382833;ENST00000423392|ENST00000452208	T;T;T|.	0.33865|.	1.39;1.71;1.57|.	1.94|1.94	-1.87|-1.87	0.07737|0.07737	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);|.	0.858235|.	0.09731|.	U|.	0.763093|.	T|T	0.18841|0.18841	0.0452|0.0452	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	P;P;P;P|.	0.39424|.	0.536;0.536;0.536;0.673|.	B;B;B;B|.	0.39027|.	0.229;0.288;0.288;0.245|.	T|T	0.26608|0.26608	-1.0098|-1.0098	10|5	0.34782|.	T|.	0.22|.	.|.	3.6957|3.6957	0.08364|0.08364	0.2994:0.2091:0.4914:0.0|0.2994:0.2091:0.4914:0.0	.|.	227;227;363;363|.	E7EW79;Q495L8;E9PH87;Q8IZJ4|.	.;.;.;RGDSR_HUMAN|.	S|V	227;363;363;363|44	ENSP00000383951:A227S;ENSP00000290691:A363S;ENSP00000402142:A363S|.	ENSP00000290691:A363S|.	A|G	+|+	1|2	0|0	RGL4|RGL4	22368801|22368801	0.994000|0.994000	0.37717|0.37717	0.002000|0.002000	0.10522|0.10522	0.001000|0.001000	0.01503|0.01503	2.228000|2.228000	0.42981|0.42981	-0.411000|-0.411000	0.07530|0.07530	-0.385000|-0.385000	0.06624|0.06624	GCG|GGC		0.652	RGL4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319711.1	NM_153615	Missense_Mutation	Missense_Mutation
C2CD5	9847	genome.wustl.edu	37	12	22622721	22622721	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:22622721C>G	ENST00000333957.4	-	22	2710	c.2455G>C	c.(2455-2457)Gat>Cat	p.D819H	C2CD5_ENST00000536386.1_Missense_Mutation_p.D821H|C2CD5_ENST00000446597.1_Missense_Mutation_p.D819H|C2CD5_ENST00000545552.1_Missense_Mutation_p.D832H|C2CD5_ENST00000542676.1_Missense_Mutation_p.D819H|C2CD5_ENST00000396028.2_Missense_Mutation_p.D810H|C2CD5_ENST00000544930.1_Missense_Mutation_p.D634H	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	819					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.D819H(1)									TCTTCATTATCTGTTGAGGCT	0.313																																																1	Substitution - Missense(1)	ovary(1)	12											84.0	86.0	85.0					12																	22622721		2203	4300	6503	22513988	SO:0001583	missense	9847			AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.2455G>C	12.37:g.22622721C>G	ENSP00000334229:p.Asp819His		22513988	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	ENST00000333957.4	37	CCDS31758.1	SNP	32	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.78|17.78	3.473837|3.473837	0.63737|0.63737	.|.	.|.	ENSG00000111731|ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930|ENST00000539615	T;T;T;T;T;T|.	0.66099|.	-0.15;-0.18;-0.19;-0.18;-0.18;-0.12|.	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	0.060005|.	0.64402|.	D|.	0.000003|.	T|T	0.59810|0.59810	0.2221|0.2221	L|L	0.38175|0.38175	1.15|1.15	0.44619|0.44619	D|D	0.997597|0.997597	D;P;D;D;P|.	0.63880|.	0.973;0.802;0.987;0.993;0.761|.	P;P;D;P;B|.	0.64144|.	0.896;0.467;0.922;0.889;0.275|.	T|T	0.55114|0.55114	-0.8191|-0.8191	10|5	0.59425|.	D|.	0.04|.	-24.2712|-24.2712	17.1161|17.1161	0.86689|0.86689	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	821;819;634;810;819|.	F5H2A1;B4DRN7;F5H3N1;Q86YS7-2;Q86YS7|.	.;.;.;.;K0528_HUMAN|.	H|H	819;819;821;810;819;832;634|102	ENSP00000334229:D819H;ENSP00000388756:D819H;ENSP00000439392:D821H;ENSP00000379345:D810H;ENSP00000441951:D819H;ENSP00000443204:D832H|.	ENSP00000334229:D819H|.	D|Q	-|-	1|3	0|2	KIAA0528|KIAA0528	22513988|22513988	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.529000|3.529000	0.53532|0.53532	2.538000|2.538000	0.85594|0.85594	0.650000|0.650000	0.86243|0.86243	GAT|CAG		0.313	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802		Missense_Mutation
CHST9	83539	genome.wustl.edu	37	18	24496362	24496362	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr18:24496362C>T	ENST00000284224.8	-	6	1470	c.1193G>A	c.(1192-1194)aGg>aAg	p.R398K	AQP4-AS1_ENST00000568797.1_RNA|AQP4-AS1_ENST00000578701.1_RNA|AQP4-AS1_ENST00000582605.1_RNA|AQP4-AS1_ENST00000579964.1_RNA|CHST9_ENST00000581714.1_Missense_Mutation_p.R398K|CHST9_ENST00000580774.1_3'UTR	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	398					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)	p.R398K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					GGAAGAGTGCCTATCCTTAAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	18											154.0	142.0	146.0					18																	24496362		1839	4092	5931	22750360	SO:0001583	missense	83539			AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.1193G>A	18.37:g.24496362C>T	ENSP00000284224:p.Arg398Lys		22750360	Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Missense_Mutation	SNP	ENST00000284224.8	37	CCDS42422.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749683	0.69533	.	.	ENSG00000154080	ENST00000284224	T	0.73047	-0.71	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.81903	0.4921	L	0.49640	1.575	0.80722	D	1	D	0.67145	0.996	D	0.69824	0.966	T	0.81106	-0.1083	10	0.62326	D	0.03	-25.1503	20.6593	0.99626	0.0:1.0:0.0:0.0	.	398	Q7L1S5	CHST9_HUMAN	K	398	ENSP00000284224:R398K	ENSP00000284224:R398K	R	-	2	0	CHST9	22750360	1.000000	0.71417	0.988000	0.46212	0.979000	0.70002	5.733000	0.68571	2.885000	0.99019	0.655000	0.94253	AGG		0.373	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446549.1	NM_031422		Missense_Mutation
SACS	26278	genome.wustl.edu	37	13	23913870	23913870	+	Missense_Mutation	SNP	T	T	C	rs550057119		TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr13:23913870T>C	ENST00000382292.3	-	9	4418	c.4145A>G	c.(4144-4146)cAt>cGt	p.H1382R	SACS_ENST00000402364.1_Missense_Mutation_p.H632R|SACS_ENST00000382298.3_Missense_Mutation_p.H1382R			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1382					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.H1235R(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TTTGCTATGATGTATAGGAAC	0.348													T|||	1	0.000199681	0.0	0.0	5008	,	,		22108	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	13											180.0	174.0	176.0					13																	23913870		2203	4300	6503	22811870	SO:0001583	missense	26278			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.4145A>G	13.37:g.23913870T>C	ENSP00000371729:p.His1382Arg		22811870	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	10.34	1.323769	0.24080	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.93307	-3.2;-3.2;-3.2	6.06	6.06	0.98353	.	0.291907	0.39407	N	0.001366	D	0.87229	0.6125	N	0.14661	0.345	0.26146	N	0.980205	B	0.13145	0.007	B	0.15052	0.012	T	0.73933	-0.3826	10	0.25106	T	0.35	.	16.6127	0.84892	0.0:0.0:0.0:1.0	.	1382	Q9NZJ4	SACS_HUMAN	R	1382;632;1382	ENSP00000371729:H1382R;ENSP00000385844:H632R;ENSP00000371735:H1382R	ENSP00000371729:H1382R	H	-	2	0	SACS	22811870	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.134000	0.71689	2.322000	0.78497	0.528000	0.53228	CAT		0.348	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		Missense_Mutation
ZNF724P	440519	genome.wustl.edu	37	19	23405878	23405878	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:23405878C>G	ENST00000418100.1	-	4	1286	c.1169G>C	c.(1168-1170)gGa>gCa	p.G390A				A8MTY0	ZN724_HUMAN	zinc finger protein 724, pseudogene	390					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G390A(1)		endometrium(3)|kidney(1)|lung(2)|ovary(2)	8						TGGTTTTTCTCCAGTATGAAT	0.388																																																1	Substitution - Missense(1)	ovary(1)	19																																								23197718	SO:0001583	missense	440519					19p12	2014-02-14	2010-08-03		ENSG00000196081	ENSG00000196081			32460	pseudogene	pseudogene			"""zinc finger protein 724 pseudogene"", ""zinc finger protein 724 (pseudogene)"""				Standard	NR_045525		Approved		uc021uru.1	A8MTY0	OTTHUMG00000183231	ENST00000418100.1:c.1169G>C	19.37:g.23405878C>G	ENSP00000413411:p.Gly390Ala		23197718		Missense_Mutation	SNP	ENST00000418100.1	37		SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	6.146	0.395093	0.11638	.	.	ENSG00000196081	ENST00000418100	T	0.01505	4.82	1.09	1.09	0.20402	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01454	0.0047	.	.	.	0.41433	D	0.987876	D	0.54601	0.967	B	0.32090	0.14	T	0.65738	-0.6095	8	0.87932	D	0	.	8.9884	0.36008	0.0:1.0:0.0:0.0	.	390	A8MTY0	ZN724_HUMAN	A	390	ENSP00000413411:G390A	ENSP00000413411:G390A	G	-	2	0	ZNF724P	23197718	0.490000	0.26012	0.284000	0.24805	0.247000	0.25773	2.031000	0.41117	0.488000	0.27723	0.491000	0.48974	GGA		0.388	ZNF724P-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000465743.1			Missense_Mutation
ZNF91	7644	genome.wustl.edu	37	19	23542956	23542956	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:23542956T>G	ENST00000300619.7	-	4	3030	c.2825A>C	c.(2824-2826)gAa>gCa	p.E942A	ZNF91_ENST00000397082.2_Missense_Mutation_p.E910A|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	942					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E942A(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTTGCCACATTCTTCACATTT	0.403																																																1	Substitution - Missense(1)	ovary(1)	19											64.0	67.0	66.0					19																	23542956		2172	4283	6455	23334796	SO:0001583	missense	7644			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2825A>C	19.37:g.23542956T>G	ENSP00000300619:p.Glu942Ala		23334796	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	10.41	1.341662	0.24339	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.06933	3.24;3.24	1.34	1.34	0.21922	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16128	0.0388	L	0.42487	1.325	0.09310	N	1	D;D	0.71674	0.998;0.987	P;D	0.63793	0.854;0.918	T	0.10382	-1.0632	9	0.56958	D	0.05	.	7.53	0.27677	0.0:0.0:0.0:1.0	.	910;942	Q05481-2;Q05481	.;ZNF91_HUMAN	A	942;910	ENSP00000300619:E942A;ENSP00000380272:E910A	ENSP00000300619:E942A	E	-	2	0	ZNF91	23334796	0.000000	0.05858	0.512000	0.27736	0.122000	0.20287	-0.101000	0.10973	0.569000	0.29329	0.172000	0.16884	GAA		0.403	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430		Missense_Mutation
ACOT9	23597	genome.wustl.edu	37	X	23731273	23731273	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chrX:23731273G>C	ENST00000336430.7	-	8	745	c.614C>G	c.(613-615)gCt>gGt	p.A205G	ACOT9_ENST00000492081.1_Intron|ACOT9_ENST00000379295.1_Missense_Mutation_p.A145G|ACOT9_ENST00000379303.5_Missense_Mutation_p.A214G	NM_001033583.2	NP_001028755.2	Q9Y305	ACOT9_HUMAN	acyl-CoA thioesterase 9	205					acyl-CoA metabolic process (GO:0006637)	mitochondrion (GO:0005739)	acetyl-CoA hydrolase activity (GO:0003986)|carboxylic ester hydrolase activity (GO:0052689)	p.A205G(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(4)|pancreas(1)|skin(1)	15						AGAATCACGAGCCACCATTAC	0.299																																																1	Substitution - Missense(1)	ovary(1)	X											81.0	68.0	73.0					X																	23731273		2203	4300	6503	23641194	SO:0001583	missense	23597			AF132950	CCDS35216.1, CCDS43924.1	Xp22.11	2008-02-05			ENSG00000123130	ENSG00000123130		"""Acyl CoA thioesterases"""	17152	protein-coding gene	gene with protein product		300862				10383425, 10810093, 16103133, 16940157	Standard	XM_005274471		Approved	CGI-16, MT-ACT48, ACATE2	uc004dao.3	Q9Y305	OTTHUMG00000021257	ENST00000336430.7:c.614C>G	X.37:g.23731273G>C	ENSP00000336580:p.Ala205Gly		23641194	B3KNC9|B7ZM94	Missense_Mutation	SNP	ENST00000336430.7	37	CCDS35216.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	27.7	4.854545	0.91355	.	.	ENSG00000123130	ENST00000379303;ENST00000336430;ENST00000379295;ENST00000473710	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	4.82	4.82	0.62117	.	0.093606	0.64402	D	0.000001	T	0.61739	0.2371	M	0.88512	2.96	0.80722	D	1	P;P;P	0.42296	0.699;0.659;0.775	P;P;P	0.53035	0.533;0.524;0.716	T	0.69942	-0.5008	10	0.62326	D	0.03	-7.0552	17.4533	0.87599	0.0:0.0:1.0:0.0	.	172;205;214	Q9Y305-2;Q9Y305;Q9Y305-4	.;ACOT9_HUMAN;.	G	214;205;145;131	ENSP00000368605:A214G;ENSP00000336580:A205G;ENSP00000368597:A145G;ENSP00000420490:A131G	ENSP00000336580:A205G	A	-	2	0	ACOT9	23641194	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.055000	0.93873	2.134000	0.65973	0.525000	0.51046	GCT		0.299	ACOT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056065.1	NM_012332		Missense_Mutation
ADCY3	109	genome.wustl.edu	37	2	25051013	25051013	+	Nonsense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:25051013G>T	ENST00000260600.5	-	13	3041	c.2190C>A	c.(2188-2190)taC>taA	p.Y730*	ADCY3_ENST00000450524.1_5'UTR|ADCY3_ENST00000405392.1_Intron|RP11-443B20.1_ENST00000606114.1_RNA	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	730					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.Y730*(1)		NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GTCCCGTGTAGTACTGGAGAC	0.597											OREG0014498	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Nonsense(1)	ovary(1)	2											61.0	53.0	56.0					2																	25051013		2203	4300	6503	24904517	SO:0001587	stop_gained	109			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.2190C>A	2.37:g.25051013G>T	ENSP00000260600:p.Tyr730*	776	24904517	B3KT86|Q53T54|Q9UDB1	Nonsense_Mutation	SNP	ENST00000260600.5	37	CCDS1715.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	46	12.500396	0.99673	.	.	ENSG00000138031	ENST00000260600;ENST00000415879;ENST00000455323;ENST00000450524	.	.	.	5.0	5.0	0.66597	.	0.650946	0.16370	N	0.217344	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.1003	0.89504	0.0:0.0:1.0:0.0	.	.	.	.	X	730;705;69;73	.	ENSP00000260600:Y730X	Y	-	3	2	ADCY3	24904517	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	4.158000	0.58150	2.608000	0.88229	0.561000	0.74099	TAC		0.597	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2			Nonsense_Mutation
LMNTD1	160492	genome.wustl.edu	37	12	25679139	25679139	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:25679139G>A	ENST00000282881.6	-	5	778	c.629C>T	c.(628-630)gCa>gTa	p.A210V	IFLTD1_ENST00000445693.1_Missense_Mutation_p.A147V|IFLTD1_ENST00000413632.2_Intron|IFLTD1_ENST00000539744.1_Missense_Mutation_p.A113V|IFLTD1_ENST00000458174.2_Missense_Mutation_p.A231V	NM_152590.3	NP_689803.2	Q8N9Z9	LMTD1_HUMAN		210	LTD.				cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)	structural molecule activity (GO:0005198)	p.A210V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22	all_lung(3;2.75e-22)|Lung NSC(3;1.77e-21)|all_hematologic(7;0.00656)|Colorectal(261;0.0847)					TGCTTCAGATGCTGCTGCCCA	0.388																																																1	Substitution - Missense(1)	ovary(1)	12											119.0	108.0	112.0					12																	25679139		2203	4300	6503	25570406	SO:0001583	missense	160492																														ENST00000282881.6:c.629C>T	12.37:g.25679139G>A	ENSP00000282881:p.Ala210Val		25570406	B4DL27|B4DY70|Q8IY38	Missense_Mutation	SNP	ENST00000282881.6	37	CCDS8704.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	18.43	3.622438	0.66787	.	.	ENSG00000152936	ENST00000282881;ENST00000539744;ENST00000458174;ENST00000445693;ENST00000545543	D;D;D;D;D	0.98512	-4.97;-4.97;-4.97;-4.97;-4.86	5.29	4.38	0.52667	Intermediate filament, C-terminal (1);	.	.	.	.	D	0.98024	0.9349	L	0.51422	1.61	0.80722	D	1	D;D;D	0.76494	0.975;0.988;0.999	P;P;D	0.70935	0.741;0.796;0.971	D	0.97533	1.0081	8	.	.	.	-19.3654	11.0225	0.47726	0.0:0.0:0.8143:0.1857	.	147;231;210	Q8N9Z9-3;Q8N9Z9-5;Q8N9Z9	.;.;ILFT1_HUMAN	V	210;113;231;147;40	ENSP00000282881:A210V;ENSP00000443132:A113V;ENSP00000407353:A231V;ENSP00000407043:A147V;ENSP00000443596:A40V	.	A	-	2	0	IFLTD1	25570406	0.944000	0.32072	0.933000	0.37362	0.972000	0.66771	1.912000	0.39946	1.422000	0.47177	0.655000	0.94253	GCA		0.388	IFLTD1-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402279.1			Missense_Mutation
RP11-848P1.9	0	genome.wustl.edu	37	17	29349031	29349031	+	RNA	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr17:29349031G>T	ENST00000579692.1	+	0	411																		p.?(1)									TCTTTTTCCAGTGCCATCAAC	0.368																																																1	Unknown(1)	central_nervous_system(1)	17																																								26373157			646021																															17.37:g.29349031G>T			26373157		Missense_Mutation	SNP	ENST00000579692.1	37		SNP	36	WashU																																																																																				0.368	RP11-848P1.9-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000445165.1			Missense_Mutation
WDTC1	23038	genome.wustl.edu	37	1	27632830	27632830	+	Missense_Mutation	SNP	G	G	A	rs138646253		TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:27632830G>A	ENST00000319394.3	+	16	2525	c.1990G>A	c.(1990-1992)Gat>Aat	p.D664N	WDTC1_ENST00000361771.3_Missense_Mutation_p.D663N	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	664					cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)	p.D663N(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		GGCCTCTGATGATGAGGACAG	0.667																																																1	Substitution - Missense(1)	ovary(1)	1						G	ASN/ASP	0,4406		0,0,2203	41.0	45.0	43.0		1987	4.4	0.6	1	dbSNP_134	43	1,8599	1.2+/-3.3	0,1,4299	no	missense	WDTC1	NM_015023.3	23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	663/677	27632830	1,13005	2203	4300	6503	27505417	SO:0001583	missense	23038			AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.1990G>A	1.37:g.27632830G>A	ENSP00000317971:p.Asp664Asn		27505417	D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	Missense_Mutation	SNP	ENST00000319394.3	37		SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	16.58	3.163624	0.57476	0.0	1.16E-4	ENSG00000142784	ENST00000319394;ENST00000361771	T;T	0.63913	-0.07;-0.07	5.33	4.39	0.52855	.	0.094576	0.64402	D	0.000001	T	0.44435	0.1293	N	0.08118	0	0.53005	D	0.999963	B;B	0.25609	0.079;0.13	B;B	0.29440	0.047;0.102	T	0.39603	-0.9606	10	0.41790	T	0.15	.	14.5891	0.68351	0.0:0.0:0.8529:0.1471	.	664;663	Q8N5D0;Q8N5D0-4	WDTC1_HUMAN;.	N	664;663	ENSP00000317971:D664N;ENSP00000355317:D663N	ENSP00000317971:D664N	D	+	1	0	WDTC1	27505417	1.000000	0.71417	0.617000	0.29091	0.905000	0.53344	9.414000	0.97362	1.339000	0.45563	0.655000	0.94253	GAT		0.667	WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015023		Missense_Mutation
XPO6	23214	genome.wustl.edu	37	16	28192352	28192352	+	Splice_Site	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr16:28192352C>G	ENST00000304658.5	-	2	504	c.4G>C	c.(4-6)Gca>Cca	p.A2P	XPO6_ENST00000565698.1_5'UTR|Y_RNA_ENST00000363268.1_RNA|SNORA25_ENST00000363782.1_RNA	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	2					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						TCTTCAGATGCCTAACAAAGG	0.388																																																0			16											64.0	55.0	58.0					16																	28192352		1819	4083	5902	28099853	SO:0001630	splice_region_variant	23214			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.4-1G>C	16.37:g.28192352C>G			28099853	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	37	CCDS42135.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041894	0.93685	.	.	ENSG00000169180	ENST00000304658	T	0.58358	0.34	6.04	6.04	0.98038	Armadillo-type fold (1);	0.052497	0.85682	D	0.000000	T	0.57051	0.2027	L	0.29908	0.895	0.58432	D	0.999996	D;P	0.58620	0.983;0.952	P;P	0.56474	0.799;0.601	T	0.49762	-0.8905	10	0.32370	T	0.25	-9.3211	18.073	0.89417	0.0:1.0:0.0:0.0	.	2;2	B7ZM10;Q96QU8	.;XPO6_HUMAN	P	2	ENSP00000302790:A2P	ENSP00000302790:A2P	A	-	1	0	XPO6	28099853	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.429000	0.59901	2.873000	0.98535	0.561000	0.74099	GCA		0.388	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	Missense_Mutation	Missense_Mutation
DOC2A	8448	genome.wustl.edu	37	16	30021350	30021350	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr16:30021350G>A	ENST00000350119.4	-	2	384	c.194C>T	c.(193-195)gCa>gTa	p.A65V	DOC2A_ENST00000564979.1_Missense_Mutation_p.A65V|DOC2A_ENST00000567824.1_5'Flank|DOC2A_ENST00000564944.1_Missense_Mutation_p.A65V	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	65	Interaction with UNC13D and DYNLT1.				nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)	p.A65V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						AAGGAGGGCTGCAGGGGGGGC	0.701																																																1	Substitution - Missense(1)	ovary(1)	16											19.0	20.0	20.0					16																	30021350		2180	4250	6430	29928851	SO:0001583	missense	8448			D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.194C>T	16.37:g.30021350G>A	ENSP00000340017:p.Ala65Val		29928851	B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Missense_Mutation	SNP	ENST00000350119.4	37	CCDS10666.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	12.38	1.919371	0.33908	.	.	ENSG00000149927	ENST00000350119	T	0.61980	0.06	3.98	-0.219	0.13135	.	0.205957	0.23983	N	0.042660	T	0.44540	0.1298	L	0.36672	1.1	0.09310	N	1	B	0.19706	0.038	B	0.16722	0.016	T	0.22312	-1.0220	10	0.27785	T	0.31	.	7.1527	0.25620	0.5307:0.0:0.4693:0.0	.	65	Q14183	DOC2A_HUMAN	V	65	ENSP00000340017:A65V	ENSP00000340017:A65V	A	-	2	0	DOC2A	29928851	0.005000	0.15991	0.066000	0.19879	0.944000	0.59088	0.498000	0.22530	-0.188000	0.10499	-0.258000	0.10820	GCA		0.701	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255148.2	NM_003586		Missense_Mutation
HEATR5A	25938	genome.wustl.edu	37	14	31856365	31856365	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr14:31856365C>G	ENST00000389961.3	-	7	1131	c.1132G>C	c.(1132-1134)Gat>Cat	p.D378H	HEATR5A_ENST00000543095.2_Missense_Mutation_p.D384H|HEATR5A_ENST00000439727.1_Missense_Mutation_p.D91H|HEATR5A_ENST00000404677.3_Missense_Mutation_p.D384H|HEATR5A_ENST00000439348.1_Missense_Mutation_p.D378H			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	378								p.D378H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TGGCAAATATCCTTTACAGCA	0.428																																																1	Substitution - Missense(1)	ovary(1)	14											133.0	125.0	128.0					14																	31856365		1872	4113	5985	30926116	SO:0001583	missense	25938			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.1132G>C	14.37:g.31856365C>G	ENSP00000374611:p.Asp378His		30926116	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	ENST00000389961.3	37		SNP	30	WashU	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	15.78|15.78|15.78	2.935888|2.935888|2.935888	0.52972|0.52972|0.52972	.|.|.	.|.|.	ENSG00000129493|ENSG00000129493|ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095;ENST00000404677|ENST00000550366|ENST00000538864	T;T;T;T;T|.|.	0.08102|.|.	3.13;3.13;3.13;3.13;3.13|.|.	5.35|5.35|5.35	5.35|5.35|5.35	0.76521|0.76521|0.76521	.|.|.	0.354964|.|.	0.31358|.|.	N|.|.	0.007792|.|.	T|T|T	0.66839|0.66839|0.66839	0.2830|0.2830|0.2830	L|L|L	0.40543|0.40543|0.40543	1.245|1.245|1.245	0.49299|0.49299|0.49299	D|D|D	0.999775|0.999775|0.999775	P|.|.	0.37708|.|.	0.606|.|.	P|.|.	0.47528|.|.	0.549|.|.	T|T|T	0.62378|0.62378|0.62378	-0.6867|-0.6867|-0.6867	10|5|5	0.87932|.|.	D|.|.	0|.|.	.|.|.	19.0578|19.0578|19.0578	0.93072|0.93072|0.93072	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	384|.|.	B5MC49|.|.	.|.|.	H|A|S	378;378;91;384;384|42|11	ENSP00000374611:D378H;ENSP00000405407:D378H;ENSP00000408681:D91H;ENSP00000437968:D384H;ENSP00000384646:D384H|.|.	ENSP00000374611:D378H|.|.	D|G|R	-|-|-	1|2|3	0|0|2	HEATR5A|HEATR5A|HEATR5A	30926116|30926116|30926116	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.869000|0.869000|0.869000	0.49853|0.49853|0.49853	4.805000|4.805000|4.805000	0.62561|0.62561|0.62561	2.496000|2.496000|2.496000	0.84212|0.84212|0.84212	0.491000|0.491000|0.491000	0.48974|0.48974|0.48974	GAT|GGA|AGG		0.428	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473		Missense_Mutation
SVILP1	645954	genome.wustl.edu	37	10	30978431	30978431	+	IGR	SNP	A	A	C			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr10:30978431A>C								RP11-14C22.3 (31967 upstream) : SVILP1 (4159 downstream)																							AATAACAAAAACATACCTACC	0.418																																																0			10																																								31018437	SO:0001628	intergenic_variant																																10.37:g.30978431A>C			31018437		Splice_Site_SNP	SNP		37		SNP	2	WashU																																																																																			0	0.418									Splice_Site_SNP
TIAM1	7074	genome.wustl.edu	37	21	32638780	32638780	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr21:32638780G>A	ENST00000286827.3	-	5	980	c.509C>T	c.(508-510)tCc>tTc	p.S170F	TIAM1_ENST00000541036.1_Missense_Mutation_p.S170F|TIAM1_ENST00000469412.1_Intron	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	170					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S170F(1)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						TGCAGATTTGGAGCGTTTCTT	0.502																																																1	Substitution - Missense(1)	ovary(1)	21											101.0	99.0	100.0					21																	32638780		2203	4300	6503	31560651	SO:0001583	missense	7074				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.509C>T	21.37:g.32638780G>A	ENSP00000286827:p.Ser170Phe		31560651	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	24.8	4.574479	0.86542	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036;ENST00000455508	T;T	0.60040	0.35;0.22	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.74045	0.3665	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.996;0.996	T	0.75476	-0.3304	10	0.87932	D	0	.	19.5961	0.95538	0.0:0.0:1.0:0.0	.	170;170;170	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	F	170;11;170;170	ENSP00000286827:S170F;ENSP00000441570:S170F	ENSP00000286827:S170F	S	-	2	0	TIAM1	31560651	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.870000	0.92336	2.621000	0.88768	0.591000	0.81541	TCC		0.502	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253		Missense_Mutation
TNF	7124	genome.wustl.edu	37	6	31545063	31545063	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:31545063C>T	ENST00000449264.2	+	4	626	c.451C>T	c.(451-453)Ctc>Ttc	p.L151F		NM_000594.3	NP_000585.2	P01375	TNFA_HUMAN	tumor necrosis factor	151					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nicotine (GO:0071316)|cellular response to organic cyclic compound (GO:0071407)|chronic inflammatory response to antigenic stimulus (GO:0002439)|defense response to Gram-positive bacterium (GO:0050830)|embryonic digestive tract development (GO:0048566)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glucose metabolic process (GO:0006006)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JNK cascade (GO:0007254)|leukocyte tethering or rolling (GO:0050901)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|necroptotic signaling pathway (GO:0097527)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of branching involved in lung morphogenesis (GO:0061048)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of glucose import (GO:0046325)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of L-glutamate transport (GO:0002037)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid storage (GO:0010888)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|organ morphogenesis (GO:0009887)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle development (GO:0051798)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of mononuclear cell migration (GO:0071677)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of podosome assembly (GO:0071803)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein transport (GO:0051222)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translational initiation by iron (GO:0045994)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|receptor biosynthetic process (GO:0032800)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of immunoglobulin secretion (GO:0051023)|regulation of insulin secretion (GO:0050796)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to salt stress (GO:0009651)|response to virus (GO:0009615)|sequestering of triglyceride (GO:0030730)|skeletal muscle contraction (GO:0003009)|transformed cell apoptotic process (GO:0006927)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	cytokine activity (GO:0005125)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|transcription regulatory region DNA binding (GO:0044212)|tumor necrosis factor receptor binding (GO:0005164)	p.L151F(1)		large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(3)	8		Ovarian(999;0.00556)			Adalimumab(DB00051)|Amrinone(DB01427)|Certolizumab pegol(DB08904)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Epinephrine(DB00668)|Etanercept(DB00005)|Glucosamine(DB01296)|golimumab(DB06674)|Infliximab(DB00065)|Pomalidomide(DB08910)|Pranlukast(DB01411)|Pseudoephedrine(DB00852)|Thalidomide(DB01041)	CACCCATGTGCTCCTCACCCA	0.617									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																																							1	Substitution - Missense(1)	ovary(1)	6											144.0	100.0	116.0					6																	31545063		1511	2709	4220	31653042	SO:0001583	missense	7124	Familial Cancer Database	incl.: Familial Head and Neck Cancer	X02910	CCDS4702.1	6p21.3	2013-05-22	2010-05-04		ENSG00000232810	ENSG00000232810		"""Tumor necrosis factor (ligand) superfamily"""	11892	protein-coding gene	gene with protein product	"""TNF superfamily, member 2"""	191160	"""tumor necrosis factor (TNF superfamily, member 2)"""	TNFA		2413547, 6392892	Standard	NM_000594		Approved	TNFSF2, DIF, TNF-alpha	uc003nui.4	P01375	OTTHUMG00000031194	ENST00000449264.2:c.451C>T	6.37:g.31545063C>T	ENSP00000398698:p.Leu151Phe		31653042	O43647|Q9P1Q2|Q9UIV3	Missense_Mutation	SNP	ENST00000449264.2	37	CCDS4702.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	7.669	0.686489	0.14973	.	.	ENSG00000232810	ENST00000449264	D	0.94537	-3.45	5.4	-0.0979	0.13631	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.428589	0.26411	N	0.024521	T	0.74786	0.3762	L	0.31420	0.93	0.31269	N	0.691996	B	0.13145	0.007	B	0.17098	0.017	T	0.57406	-0.7817	10	0.17832	T	0.49	.	1.6819	0.02833	0.2791:0.4168:0.1363:0.1677	.	151	P01375	TNFA_HUMAN	F	151	ENSP00000398698:L151F	ENSP00000398698:L151F	L	+	1	0	TNF	31653042	0.014000	0.17966	0.381000	0.26106	0.598000	0.36846	0.247000	0.18179	-0.030000	0.13804	0.561000	0.74099	CTC		0.617	TNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076390.2			Missense_Mutation
PPP1R17	10842	genome.wustl.edu	37	7	31746836	31746836	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:31746836A>G	ENST00000342032.3	+	5	1035	c.407A>G	c.(406-408)gAc>gGc	p.D136G	PPP1R17_ENST00000409146.3_Missense_Mutation_p.D85G|PPP1R17_ENST00000498609.1_3'UTR	NM_006658.4	NP_006649.2	O96001	PPR17_HUMAN	protein phosphatase 1, regulatory subunit 17	136					central nervous system development (GO:0007417)|intracellular signal transduction (GO:0035556)|regulation of phosphatase activity (GO:0010921)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)	p.D136G(1)									TTGCTCAGGGACGAGAGACCC	0.418																																																1	Substitution - Missense(1)	ovary(1)	7											132.0	115.0	121.0					7																	31746836		2203	4300	6503	31713361	SO:0001583	missense	10842			AF071789	CCDS5436.1, CCDS47570.1	7p15	2012-04-17	2011-10-11	2011-10-11	ENSG00000106341	ENSG00000106341		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16973	protein-coding gene	gene with protein product	"""G-substrate"""	604088	"""chromosome 7 open reading frame 16"""	C7orf16		10051666, 9920894	Standard	NM_006658		Approved	GSBS	uc003tcl.3	O96001	OTTHUMG00000128629	ENST00000342032.3:c.407A>G	7.37:g.31746836A>G	ENSP00000340125:p.Asp136Gly		31713361	B4DE58|Q9UDQ0	Missense_Mutation	SNP	ENST00000342032.3	37	CCDS5436.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	12.46	1.944535	0.34283	.	.	ENSG00000106341	ENST00000342032;ENST00000409146	T;T	0.33865	1.4;1.39	5.86	3.52	0.40303	.	0.278005	0.35407	N	0.003235	T	0.25938	0.0632	L	0.41236	1.265	0.29332	N	0.866636	B;B	0.06786	0.001;0.001	B;B	0.12156	0.007;0.003	T	0.12268	-1.0554	10	0.31617	T	0.26	-3.3014	6.8767	0.24151	0.8243:0.0:0.1757:0.0	.	85;136	B4DE58;O96001	.;PPR17_HUMAN	G	136;85	ENSP00000340125:D136G;ENSP00000386459:D85G	ENSP00000340125:D136G	D	+	2	0	C7orf16	31713361	0.989000	0.36119	0.799000	0.32177	0.926000	0.56050	2.904000	0.48719	1.157000	0.42530	0.528000	0.53228	GAC		0.418	PPP1R17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250498.1	NM_006658		Missense_Mutation
COL16A1	1307	genome.wustl.edu	37	1	32151712	32151712	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:32151712C>T	ENST00000373672.3	-	28	2380	c.1864G>A	c.(1864-1866)Gca>Aca	p.A622T	COL16A1_ENST00000271069.6_Missense_Mutation_p.A621T|COL16A1_ENST00000373668.3_Missense_Mutation_p.A622T	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	622	Collagen-like 2.|Triple-helical region 7 (COL7) with 1 imperfection.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.A622T(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TTGATGCCTGCTGGCCCCACT	0.597																																					Colon(143;498 1786 21362 25193 36625)											1	Substitution - Missense(1)	ovary(1)	1											95.0	107.0	103.0					1																	32151712		2120	4224	6344	31924299	SO:0001583	missense	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.1864G>A	1.37:g.32151712C>T	ENSP00000362776:p.Ala622Thr		31924299	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	7.855	0.724804	0.15439	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668	D;D;D	0.93604	-3.25;-2.58;-3.25	5.53	1.13	0.20643	.	0.844778	0.10606	N	0.655043	D	0.85191	0.5640	N	0.22421	0.69	0.21652	N	0.9996	B;B;B	0.09022	0.0;0.002;0.002	B;B;B	0.12837	0.003;0.008;0.005	T	0.69669	-0.5083	10	0.14656	T	0.56	.	6.7909	0.23699	0.1464:0.7493:0.0:0.1043	.	622;622;622	A6NCT7;Q07092;Q07092-2	.;COGA1_HUMAN;.	T	622;621;622	ENSP00000362776:A622T;ENSP00000271069:A621T;ENSP00000362772:A622T	ENSP00000271069:A621T	A	-	1	0	COL16A1	31924299	0.859000	0.29813	0.556000	0.28293	0.122000	0.20287	0.386000	0.20702	0.326000	0.23384	0.563000	0.77884	GCA		0.597	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856		Missense_Mutation
AKAP6	9472	genome.wustl.edu	37	14	33293555	33293555	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr14:33293555C>G	ENST00000280979.4	+	13	6706	c.6536C>G	c.(6535-6537)tCt>tGt	p.S2179C	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	2179					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.S2179C(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CCAAATGAATCTGCAGTTCCC	0.453																																					Melanoma(49;821 1200 7288 13647 42351)											1	Substitution - Missense(1)	ovary(1)	14											92.0	80.0	84.0					14																	33293555		2203	4300	6503	32363306	SO:0001583	missense	9472			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.6536C>G	14.37:g.33293555C>G	ENSP00000280979:p.Ser2179Cys		32363306	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	CCDS9644.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	18.71	3.683267	0.68157	.	.	ENSG00000151320	ENST00000280979	T	0.05513	3.43	5.93	5.93	0.95920	.	0.615681	0.16383	N	0.216839	T	0.07458	0.0188	L	0.29908	0.895	0.53688	D	0.999975	P	0.38642	0.641	B	0.36959	0.237	T	0.25572	-1.0128	10	0.66056	D	0.02	-1.7001	15.8897	0.79286	0.1359:0.8641:0.0:0.0	.	2179	Q13023	AKAP6_HUMAN	C	2179	ENSP00000280979:S2179C	ENSP00000280979:S2179C	S	+	2	0	AKAP6	32363306	0.000000	0.05858	0.149000	0.22428	0.736000	0.42039	0.653000	0.24902	2.805000	0.96524	0.655000	0.94253	TCT		0.453	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		Missense_Mutation
EVA1C	59271	genome.wustl.edu	37	21	33887206	33887206	+	Silent	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr21:33887206A>G	ENST00000300255.2	+	8	1505	c.1032A>G	c.(1030-1032)agA>agG	p.R344R	EVA1C_ENST00000382699.3_Silent_p.R341R|EVA1C_ENST00000401402.3_Silent_p.R296R|EVA1C_ENST00000485488.1_3'UTR	NM_058187.3	NP_478067.2	P58658	EVA1C_HUMAN	eva-1 homolog C (C. elegans)	344						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.R344R(1)									TGGTCATCAGAGAGTCCTGTG	0.622																																																1	Substitution - coding silent(1)	ovary(1)	21											59.0	57.0	58.0					21																	33887206		2203	4300	6503	32809077	SO:0001819	synonymous_variant	59271			AF358258	CCDS13614.1, CCDS68186.1	21q22.11	2012-11-05	2012-11-05	2012-11-05	ENSG00000166979	ENSG00000166979			13239	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 64"", ""chromosome 21 open reading frame 63"", ""family with sequence similarity 176, member C"""	C21orf64, C21orf63, FAM176C		11707072, 19470522	Standard	NM_058187		Approved	B18, PRED34, B19	uc002ypr.1	P58658	OTTHUMG00000064922	ENST00000300255.2:c.1032A>G	21.37:g.33887206A>G			32809077	A6ND58|Q8IXZ0	Silent	SNP	ENST00000300255.2	37	CCDS13614.1	SNP	11	WashU																																																																																				0.622	EVA1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139403.1	NM_058187		Silent
COL11A2	1302	genome.wustl.edu	37	6	33154447	33154447	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:33154447G>T	ENST00000374708.4	-	5	1013	c.755C>A	c.(754-756)cCa>cAa	p.P252Q	COL11A2_ENST00000374713.1_Missense_Mutation_p.P252Q|COL11A2_ENST00000374712.1_Missense_Mutation_p.P252Q|COL11A2_ENST00000341947.2_Missense_Mutation_p.P252Q|COL11A2_ENST00000374714.1_Missense_Mutation_p.P252Q|COL11A2_ENST00000361917.1_Missense_Mutation_p.P252Q|COL11A2_ENST00000395194.1_Missense_Mutation_p.P252Q|COL11A2_ENST00000357486.1_Missense_Mutation_p.P252Q|COL11A2_ENST00000395197.1_Missense_Mutation_p.P252Q	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	252	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.P252Q(1)		biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						AAGTCTTGATGGTTGCTGCTG	0.572																																					Melanoma(1;90 116 3946 5341 17093)											1	Substitution - Missense(1)	ovary(1)	6											238.0	224.0	228.0					6																	33154447		2203	4300	6503	33262425	SO:0001583	missense	1302			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.755C>A	6.37:g.33154447G>T	ENSP00000363840:p.Pro252Gln		33262425	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	ENST00000374708.4	37	CCDS43452.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142308	0.37825	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000457788;ENST00000395194	D;D;D;D;D;D;D;D;D;T	0.90069	-2.36;-2.26;-2.31;-2.32;-2.31;-2.33;-2.44;-2.32;-2.61;1.8	4.21	3.33	0.38152	.	0.326711	0.18020	N	0.154275	T	0.79930	0.4531	N	0.14661	0.345	0.09310	N	0.999996	D;B;D;D	0.89917	1.0;0.054;0.986;0.995	D;B;P;D	0.85130	0.997;0.056;0.649;0.941	T	0.69007	-0.5259	10	0.16420	T	0.52	.	7.2786	0.26297	0.1197:0.0:0.8803:0.0	.	252;252;252;252	Q7Z6C3;P13942-8;P13942-6;P13942	.;.;.;COBA2_HUMAN	Q	252	ENSP00000363840:P252Q;ENSP00000339915:P252Q;ENSP00000350079:P252Q;ENSP00000363846:P252Q;ENSP00000363845:P252Q;ENSP00000378623:P252Q;ENSP00000363844:P252Q;ENSP00000355123:P252Q;ENSP00000405520:P252Q;ENSP00000378620:P252Q	ENSP00000339915:P252Q	P	-	2	0	COL11A2	33262425	0.828000	0.29307	0.715000	0.30552	0.564000	0.35744	2.075000	0.41538	2.342000	0.79632	0.442000	0.29010	CCA		0.572	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2			Missense_Mutation
LTBP1	4052	genome.wustl.edu	37	2	33540336	33540336	+	Splice_Site	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:33540336G>A	ENST00000404816.2	+	24	4083	c.3730G>A	c.(3730-3732)Gat>Aat	p.D1244N	LTBP1_ENST00000390003.4_Splice_Site_p.D919N|LTBP1_ENST00000418533.2_Splice_Site_p.D918N|LTBP1_ENST00000354476.3_Splice_Site_p.D1245N|LTBP1_ENST00000404525.1_Splice_Site_p.D865N|LTBP1_ENST00000402934.1_Splice_Site_p.D865N|LTBP1_ENST00000407925.1_Splice_Site_p.D918N|LTBP1_ENST00000272273.5_Splice_Site_p.D184N			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1244	EGF-like 13; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.D1245N(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TACGTGTGAAGGTAAGATAAA	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											104.0	92.0	96.0					2																	33540336		2203	4300	6503	33393840	SO:0001630	splice_region_variant	4052				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.3730+1G>A	2.37:g.33540336G>A			33393840	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	CCDS33177.2	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590875	0.86851	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000272273;ENST00000422669	D;D;D;D;D;D;D;D;D	0.99051	-5.37;-5.37;-5.37;-5.37;-5.37;-5.37;-5.37;-5.37;-5.37	4.98	4.98	0.66077	EGF-like calcium-binding, conserved site (1);	.	.	.	.	D	0.99363	0.9776	M	0.86864	2.845	0.80722	D	1	B;B;B;D;D;D;D	0.89917	0.024;0.066;0.084;1.0;1.0;1.0;1.0	B;B;B;D;D;D;D	0.91635	0.016;0.043;0.015;0.992;0.999;0.999;0.999	D	0.98956	1.0796	9	0.72032	D	0.01	.	18.2782	0.90089	0.0:0.0:1.0:0.0	.	184;1286;918;865;918;919;1245	E7EUU6;Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	.;LTBP1_HUMAN;.;.;.;.;.	N	1244;1245;919;918;865;865;918;184;122	ENSP00000386043:D1244N;ENSP00000346467:D1245N;ENSP00000374653:D919N;ENSP00000393057:D918N;ENSP00000384373:D865N;ENSP00000385359:D865N;ENSP00000384091:D918N;ENSP00000272273:D184N;ENSP00000395211:D122N	ENSP00000272273:D184N	D	+	1	0	LTBP1	33393840	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	7.159000	0.77483	2.295000	0.77249	0.655000	0.94253	GAT		0.443	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	Missense_Mutation	Missense_Mutation
ZSCAN20	7579	genome.wustl.edu	37	1	33959131	33959131	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:33959131A>G	ENST00000361328.3	+	7	1942	c.1789A>G	c.(1789-1791)Act>Gct	p.T597A		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	597					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T597A(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TAGTGCTGAGACTGATGCCCA	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											130.0	135.0	133.0					1																	33959131		2102	4231	6333	33731718	SO:0001583	missense	7579			X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1789A>G	1.37:g.33959131A>G	ENSP00000355053:p.Thr597Ala		33731718	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	ENST00000361328.3	37	CCDS41300.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.461166	0.00171	.	.	ENSG00000121903	ENST00000326544;ENST00000361328;ENST00000401072	.	.	.	4.34	0.213	0.15244	.	0.925114	0.09139	N	0.843286	T	0.07369	0.0186	N	0.00642	-1.3	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35549	-0.9784	9	0.02654	T	1	0.4354	6.8621	0.24072	0.4373:0.0:0.5627:0.0	.	596;597	P17040-3;P17040	.;ZSC20_HUMAN	A	597;531;531	.	ENSP00000324450:T597A	T	+	1	0	ZSCAN20	33731718	0.000000	0.05858	0.010000	0.14722	0.007000	0.05969	-0.185000	0.09684	-0.059000	0.13154	-0.242000	0.12053	ACT		0.582	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238		Missense_Mutation
BMPER	168667	genome.wustl.edu	37	7	33976958	33976958	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:33976958C>G	ENST00000297161.2	+	4	651	c.277C>G	c.(277-279)Ctg>Gtg	p.L93V	BMPER_ENST00000426693.1_Missense_Mutation_p.L93V	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	93	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.L93V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						AGACTGTGCCCTGGCCATCAA	0.478																																																1	Substitution - Missense(1)	ovary(1)	7											123.0	113.0	116.0					7																	33976958		2203	4300	6503	33943483	SO:0001583	missense	168667				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.277C>G	7.37:g.33976958C>G	ENSP00000297161:p.Leu93Val		33943483	A8K1P8|Q8TF36	Missense_Mutation	SNP	ENST00000297161.2	37	CCDS5442.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	11.50	1.658253	0.29425	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	T;T	0.64991	-0.13;-0.13	5.18	3.39	0.38822	von Willebrand factor, type C (2);	0.000000	0.64402	D	0.000004	T	0.43942	0.1270	L	0.35723	1.085	0.50467	D	0.999872	P	0.43750	0.816	B	0.32762	0.152	T	0.29058	-1.0024	10	0.40728	T	0.16	.	8.9439	0.35747	0.0:0.7714:0.0:0.2286	.	93	Q8N8U9	BMPER_HUMAN	V	93	ENSP00000297161:L93V;ENSP00000393950:L93V	ENSP00000297161:L93V	L	+	1	2	BMPER	33943483	1.000000	0.71417	0.998000	0.56505	0.105000	0.19272	2.278000	0.43426	0.572000	0.29383	-0.251000	0.11542	CTG		0.478	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468		Missense_Mutation
KIF24	347240	genome.wustl.edu	37	9	34255784	34255784	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr9:34255784C>T	ENST00000402558.2	-	10	3845	c.3821G>A	c.(3820-3822)tGc>tAc	p.C1274Y	KIF24_ENST00000379166.2_Missense_Mutation_p.C1274Y|KIF24_ENST00000379174.3_Missense_Mutation_p.C1140Y|KIF24_ENST00000345050.2_Missense_Mutation_p.C1140Y			Q5T7B8	KIF24_HUMAN	kinesin family member 24	1274					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.C756Y(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			CTTGGGAGAGCAGCTGGGAAC	0.562											OREG0019148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	9											72.0	59.0	64.0					9																	34255784		2203	4300	6503	34245784	SO:0001583	missense	347240			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.3821G>A	9.37:g.34255784C>T	ENSP00000384433:p.Cys1274Tyr	846	34245784	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	37	CCDS6551.2	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	9.912	1.209856	0.22289	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050	T;T;T;T	0.71222	-0.33;-0.55;-0.33;-0.55	4.73	3.76	0.43208	.	0.149300	0.31884	N	0.006905	T	0.65637	0.2710	M	0.62723	1.935	0.34193	D	0.67224	B	0.06786	0.001	B	0.06405	0.002	T	0.71307	-0.4632	10	0.44086	T	0.13	.	11.8133	0.52195	0.1749:0.8251:0.0:0.0	.	1274	Q5T7B8	KIF24_HUMAN	Y	1274;1140;1274;1140	ENSP00000384433:C1274Y;ENSP00000368472:C1140Y;ENSP00000368464:C1274Y;ENSP00000340179:C1140Y	ENSP00000340179:C1140Y	C	-	2	0	KIF24	34245784	0.066000	0.20996	0.996000	0.52242	0.330000	0.28571	0.375000	0.20518	2.604000	0.88044	0.650000	0.86243	TGC		0.562	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5			Missense_Mutation
PSMD3	5709	genome.wustl.edu	37	17	38151480	38151480	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr17:38151480G>T	ENST00000264639.4	+	8	1322	c.1148G>T	c.(1147-1149)gGg>gTg	p.G383V	PSMD3_ENST00000541736.1_Missense_Mutation_p.G245V	NM_002809.3	NP_002800.2	O43242	PSMD3_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 3	383	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)	p.G383V(3)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Colorectal(19;0.000442)					GATCAGTTTGGGGAGAAGTTT	0.517																																					Ovarian(186;531 2051 6385 19668 48409)											3	Substitution - Missense(3)	prostate(2)|ovary(1)	17											191.0	190.0	190.0					17																	38151480		2203	4300	6503	35405006	SO:0001583	missense	5709			D67025	CCDS11356.1	17q21.2	2010-07-23			ENSG00000108344	ENSG00000108344		"""Proteasome (prosome, macropain) subunits"""	9560	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 2"""	TSTA2		9017604	Standard	NM_002809		Approved	S3, P58, Rpn3	uc002htn.2	O43242	OTTHUMG00000133251	ENST00000264639.4:c.1148G>T	17.37:g.38151480G>T	ENSP00000264639:p.Gly383Val		35405006	B3KMW9|B4DT72|Q96EI2|Q9BQA4	Missense_Mutation	SNP	ENST00000264639.4	37	CCDS11356.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	20.8	4.052366	0.75960	.	.	ENSG00000108344	ENST00000264639;ENST00000415039;ENST00000541736	T;T	0.28895	1.59;1.59	5.17	5.17	0.71159	Tetratricopeptide-like helical (1);PCI/PINT associated module (1);Proteasome component (PCI) domain (1);	0.101932	0.64402	D	0.000002	T	0.47469	0.1447	M	0.82323	2.585	0.80722	D	1	B	0.29671	0.254	B	0.38755	0.281	T	0.52931	-0.8509	10	0.72032	D	0.01	-32.1036	17.6102	0.88050	0.0:0.0:1.0:0.0	.	383	O43242	PSMD3_HUMAN	V	383;370;245	ENSP00000264639:G383V;ENSP00000442508:G245V	ENSP00000264639:G383V	G	+	2	0	PSMD3	35405006	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.257000	0.72480	2.687000	0.91594	0.655000	0.94253	GGG		0.517	PSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257018.1	NM_002809		Missense_Mutation
PLA2G6	8398	genome.wustl.edu	37	22	38509582	38509582	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr22:38509582C>T	ENST00000332509.3	-	15	2297	c.2114G>A	c.(2113-2115)tGt>tAt	p.C705Y	PLA2G6_ENST00000402064.1_Missense_Mutation_p.C651Y|BAIAP2L2_ENST00000381669.3_5'Flank|PLA2G6_ENST00000335539.3_Missense_Mutation_p.C651Y|BAIAP2L2_ENST00000332536.5_5'Flank	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	705					cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)	p.C705Y(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	GACATCCACACAGGTCACAGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	22											131.0	111.0	118.0					22																	38509582		2203	4300	6503	36839528	SO:0001583	missense	8398			AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.2114G>A	22.37:g.38509582C>T	ENSP00000333142:p.Cys705Tyr		36839528	A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Missense_Mutation	SNP	ENST00000332509.3	37	CCDS13967.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419281	0.62622	.	.	ENSG00000184381	ENST00000332509;ENST00000419848;ENST00000335539;ENST00000402064	T;T;T	0.75589	-0.95;-0.95;-0.95	4.36	4.36	0.52297	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.110594	0.64402	D	0.000007	T	0.73969	0.3655	L	0.29908	0.895	0.80722	D	1	D;P	0.65815	0.995;0.894	P;P	0.58172	0.834;0.535	T	0.75382	-0.3337	10	0.49607	T	0.09	-7.4005	12.0905	0.53724	0.0:0.6623:0.3377:0.0	.	651;705	O60733-2;O60733	.;PA2G6_HUMAN	Y	705;566;651;651	ENSP00000333142:C705Y;ENSP00000335149:C651Y;ENSP00000386100:C651Y	ENSP00000333142:C705Y	C	-	2	0	PLA2G6	36839528	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.557000	0.73937	1.965000	0.57142	0.561000	0.74099	TGT		0.592	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321860.1	NM_001004426		Missense_Mutation
FSIP1	161835	genome.wustl.edu	37	15	40056114	40056114	+	Splice_Site	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr15:40056114G>T	ENST00000350221.3	-	5	676	c.467C>A	c.(466-468)tCt>tAt	p.S156Y		NM_152597.4	NP_689810.3	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	156								p.S156Y(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	23		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		ATATTTTGCAGACTAATGAAA	0.323																																																1	Substitution - Missense(1)	ovary(1)	15											43.0	48.0	47.0					15																	40056114		2192	4290	6482	37843406	SO:0001630	splice_region_variant	161835			BC045191	CCDS10050.1	15q14	2012-11-19			ENSG00000150667	ENSG00000150667			21674	protein-coding gene	gene with protein product		615795				14702039	Standard	NM_152597		Approved	FLJ35989	uc001zki.3	Q8NA03	OTTHUMG00000172456	ENST00000350221.3:c.466-1C>A	15.37:g.40056114G>T			37843406	Q6X2C8|Q86Y89	Missense_Mutation	SNP	ENST00000350221.3	37	CCDS10050.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	11.37	1.620080	0.28801	.	.	ENSG00000150667	ENST00000350221	T	0.25579	1.79	5.87	2.93	0.34026	.	0.439784	0.21582	N	0.072229	T	0.31199	0.0789	M	0.63428	1.95	0.30869	N	0.732699	P	0.49358	0.923	P	0.51055	0.657	T	0.28106	-1.0054	9	.	.	.	-1.4837	4.5517	0.12116	0.2675:0.16:0.5725:0.0	.	156	Q8NA03	FSIP1_HUMAN	Y	156	ENSP00000280236:S156Y	.	S	-	2	0	FSIP1	37843406	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	0.581000	0.23819	0.779000	0.33543	0.650000	0.86243	TCT		0.323	FSIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252118.2	NM_152597	Missense_Mutation	Missense_Mutation
FREM2	341640	genome.wustl.edu	37	13	39358814	39358814	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr13:39358814T>C	ENST00000280481.7	+	6	6104	c.5888T>C	c.(5887-5889)aTa>aCa	p.I1963T		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1963	Calx-beta 2.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I1963T(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTGTGTCGGATAGTCATAATT	0.502																																																1	Substitution - Missense(1)	ovary(1)	13											147.0	131.0	136.0					13																	39358814		2203	4300	6503	38256814	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5888T>C	13.37:g.39358814T>C	ENSP00000280481:p.Ile1963Thr		38256814	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	14.63	2.592274	0.46214	.	.	ENSG00000150893	ENST00000280481	T	0.36878	1.23	5.96	5.96	0.96718	Na-Ca exchanger/integrin-beta4 (2);	0.382193	0.26258	N	0.025419	T	0.60183	0.2249	M	0.89715	3.055	0.30691	N	0.751359	B;P	0.38148	0.374;0.62	B;P	0.47705	0.22;0.555	T	0.69658	-0.5086	10	0.87932	D	0	.	16.4293	0.83835	0.0:0.0:0.0:1.0	.	1963;1963	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	T	1963	ENSP00000280481:I1963T	ENSP00000280481:I1963T	I	+	2	0	FREM2	38256814	0.982000	0.34865	0.007000	0.13788	0.034000	0.12701	7.950000	0.87804	2.271000	0.75665	0.528000	0.53228	ATA		0.502	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		Missense_Mutation
BCOR	54880	genome.wustl.edu	37	X	39922071	39922071	+	Silent	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chrX:39922071G>A	ENST00000378444.4	-	9	4329	c.4101C>T	c.(4099-4101)caC>caT	p.H1367H	BCOR_ENST00000378463.1_Silent_p.H210H|BCOR_ENST00000342274.4_Silent_p.H1333H|BCOR_ENST00000397354.3_Silent_p.H1333H|BCOR_ENST00000378455.4_Silent_p.H1315H	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1367					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.H1333H(1)		breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						GAGGGATCAAGTGTTTGGTTT	0.567			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		1	Substitution - coding silent(1)	ovary(1)	X											133.0	99.0	110.0					X																	39922071		2202	4300	6502	39807015	SO:0001819	synonymous_variant	54880			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4101C>T	X.37:g.39922071G>A			39807015	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	ENST00000378444.4	37	CCDS48093.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	2.505	-0.314227	0.05422	.	.	ENSG00000183337	ENST00000427012	.	.	.	5.88	-0.292	0.12839	.	.	.	.	.	T	0.60143	0.2246	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53528	-0.8426	4	.	.	.	-28.0923	11.9777	0.53103	0.4003:0.0:0.5997:0.0	.	.	.	.	I	62	.	.	T	-	2	0	BCOR	39807015	1.000000	0.71417	0.432000	0.26747	0.572000	0.35998	2.983000	0.49345	-0.593000	0.05844	-0.912000	0.02778	ACT		0.567	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745		Silent
FAM187B	148109	genome.wustl.edu	37	19	35719310	35719310	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:35719310G>A	ENST00000324675.3	-	1	322	c.274C>T	c.(274-276)Ctc>Ttc	p.L92F		NM_152481.1	NP_689694.1	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	92						integral component of membrane (GO:0016021)		p.L92F(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	9						CAGTGGTAGAGGCCCGTCTGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	19											78.0	71.0	73.0					19																	35719310		2203	4300	6503	40411150	SO:0001583	missense	148109			AK098526	CCDS12448.1	19q13.12	2008-10-16	2008-10-16	2008-10-16	ENSG00000177558	ENSG00000177558			26366	protein-coding gene	gene with protein product			"""transmembrane protein 162"""	TMEM162			Standard	NM_152481		Approved	FLJ25660	uc002nyk.1	Q17R55	OTTHUMG00000164450	ENST00000324675.3:c.274C>T	19.37:g.35719310G>A	ENSP00000323355:p.Leu92Phe		40411150	Q8N7G6	Missense_Mutation	SNP	ENST00000324675.3	37	CCDS12448.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	2.400	-0.337877	0.05278	.	.	ENSG00000177558	ENST00000324675	T	0.23147	1.92	5.33	-10.7	0.00240	Immunoglobulin-like fold (1);	1.444210	0.04160	N	0.322854	T	0.08268	0.0206	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27331	-1.0077	10	0.33141	T	0.24	-12.6343	0.3105	0.00287	0.2637:0.1932:0.2743:0.2689	.	92	Q17R55	F187B_HUMAN	F	92	ENSP00000323355:L92F	ENSP00000323355:L92F	L	-	1	0	FAM187B	40411150	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.936000	0.00685	-4.132000	0.00071	-4.230000	0.00009	CTC		0.507	FAM187B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378854.1	NM_152481		Missense_Mutation
WBP2NL	164684	genome.wustl.edu	37	22	42415741	42415741	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr22:42415741C>G	ENST00000328823.9	+	3	278	c.247C>G	c.(247-249)Ctc>Gtc	p.L83V	WBP2NL_ENST00000543212.1_Missense_Mutation_p.L9V	NM_152613.2	NP_689826.2	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like	83	GRAM.				egg activation (GO:0007343)|male pronucleus assembly (GO:0035039)|meiotic nuclear division (GO:0007126)	perinuclear theca (GO:0033011)	WW domain binding (GO:0050699)	p.L83V(1)		breast(2)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)	14						GATGACGAACCTCACTGTTGA	0.393																																																1	Substitution - Missense(1)	ovary(1)	22											239.0	218.0	225.0					22																	42415741		2203	4300	6503	40745687	SO:0001583	missense	164684			BC022546	CCDS14029.1	22q13.2	2007-07-18			ENSG00000183066	ENSG00000183066			28389	protein-coding gene	gene with protein product	"""postacrosomal sheath WW domain-binding protein"""	610981				17289678	Standard	NM_152613		Approved	FLJ26145, MGC26816, PAWP	uc003bbt.3	Q6ICG8	OTTHUMG00000151270	ENST00000328823.9:c.247C>G	22.37:g.42415741C>G	ENSP00000332983:p.Leu83Val		40745687	A3KFF7|A8MSG5|B3KXX4|Q8TBF0|Q8TBF3	Missense_Mutation	SNP	ENST00000328823.9	37	CCDS14029.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	5.310	0.242606	0.10077	.	.	ENSG00000183066	ENST00000328823;ENST00000543212	D;T	0.83335	-1.71;1.45	4.86	3.83	0.44106	GRAM (1);	0.581392	0.15696	N	0.249197	T	0.58963	0.2159	N	0.02751	-0.505	0.21627	N	0.99962	B	0.26775	0.159	B	0.27262	0.078	T	0.49244	-0.8960	10	0.06891	T	0.86	-4.2251	8.9917	0.36028	0.0:0.0913:0.0:0.9087	.	83	Q6ICG8	WBP2L_HUMAN	V	83;9	ENSP00000332983:L83V;ENSP00000442447:L9V	ENSP00000332983:L83V	L	+	1	0	WBP2NL	40745687	1.000000	0.71417	0.247000	0.24249	0.023000	0.10783	4.351000	0.59398	0.899000	0.36444	-0.302000	0.09304	CTC		0.393	WBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322037.1	NM_152613		Missense_Mutation
MTA3	57504	genome.wustl.edu	37	2	42936244	42936244	+	Intron	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:42936244G>T	ENST00000405094.1	+	14	1525				MTA3_ENST00000406911.1_Missense_Mutation_p.M510I|MTA3_ENST00000472767.1_3'UTR|MTA3_ENST00000405592.1_Intron|MTA3_ENST00000406652.1_Intron|MTA3_ENST00000407270.3_Missense_Mutation_p.M511I			Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.?(1)		endometrium(1)|large_intestine(2)|lung(9)|ovary(2)|stomach(1)	15						AATGTAAGATGCTTTTAAATT	0.393																																																1	Unknown(1)	ovary(1)	2											64.0	61.0	62.0					2																	42936244		1823	4077	5900	42789748	SO:0001627	intron_variant	57504			AB033092	CCDS46267.1, CCDS62900.1	2p22.1	2013-01-25	2004-12-15		ENSG00000057935	ENSG00000057935		"""GATA zinc finger domain containing"""	23784	protein-coding gene	gene with protein product		609050	"""metastasis associated gene family, member 3"""			12705869, 14613024	Standard	NM_001282755		Approved	KIAA1266	uc002rsq.3	Q9BTC8	OTTHUMG00000150452	ENST00000405094.1:c.1525+8G>T	2.37:g.42936244G>T			42789748	Q9NSP2|Q9ULF4	Missense_Mutation	SNP	ENST00000405094.1	37		SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	9.520	1.108032	0.20714	.	.	ENSG00000057935	ENST00000407270;ENST00000406911	T;T	0.39406	1.08;1.08	5.71	4.82	0.62117	.	.	.	.	.	T	0.12817	0.0311	N	0.00621	-1.32	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.24368	-1.0162	8	.	.	.	.	9.087	0.36587	0.0731:0.0:0.7796:0.1472	.	510;511	E7EQY4;Q9BTC8-2	.;.	I	511;510	ENSP00000385045:M511I;ENSP00000385241:M510I	.	M	+	3	0	MTA3	42789748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.013000	0.57138	2.687000	0.91594	0.655000	0.94253	ATG		0.393	MTA3-017	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000318159.1	NM_020744		Missense_Mutation
ABCC10	89845	genome.wustl.edu	37	6	43400778	43400778	+	Nonsense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:43400778C>T	ENST00000372530.4	+	3	1275	c.1060C>T	c.(1060-1062)Cag>Tag	p.Q354*	ABCC10_ENST00000443426.2_Intron|ABCC10_ENST00000244533.3_Nonsense_Mutation_p.Q311*	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	354	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.Q311K(1)|p.Q311*(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	GGTAACACTTCAGGCACGGGG	0.592																																																2	Substitution - Nonsense(1)|Substitution - Missense(1)	ovary(1)|lung(1)	6											58.0	57.0	57.0					6																	43400778		2203	4300	6503	43508756	SO:0001587	stop_gained	89845			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.1060C>T	6.37:g.43400778C>T	ENSP00000361608:p.Gln354*		43508756	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Nonsense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	18.80	3.701534	0.68501	.	.	ENSG00000124574	ENST00000372530;ENST00000244533	.	.	.	5.2	5.2	0.72013	.	0.710044	0.14003	N	0.347967	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-17.3198	9.1942	0.37217	0.1551:0.5925:0.2524:0.0	.	.	.	.	X	354;311	.	ENSP00000244533:Q311X	Q	+	1	0	ABCC10	43508756	0.989000	0.36119	1.000000	0.80357	0.135000	0.20990	1.709000	0.37909	2.445000	0.82738	0.561000	0.74099	CAG		0.592	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450		Nonsense_Mutation
RYR1	6261	genome.wustl.edu	37	19	38998378	38998378	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:38998378C>G	ENST00000359596.3	+	58	8843	c.8843C>G	c.(8842-8844)tCg>tGg	p.S2948W	RYR1_ENST00000355481.4_Missense_Mutation_p.S2948W|RYR1_ENST00000360985.3_Missense_Mutation_p.S2948W			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2948	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.S2948W(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GAACTGGACTCGTCTTCCATT	0.557																																																1	Substitution - Missense(1)	ovary(1)	19											160.0	140.0	147.0					19																	38998378		2203	4300	6503	43690218	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.8843C>G	19.37:g.38998378C>G	ENSP00000352608:p.Ser2948Trp		43690218	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	12.20	1.865557	0.32977	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96967	-4.19;-4.19;-4.18	4.15	4.15	0.48705	.	0.181373	0.31199	U	0.008067	D	0.95001	0.8382	L	0.40543	1.245	0.44852	D	0.997868	P;P	0.42827	0.791;0.687	P;B	0.47346	0.544;0.342	D	0.94821	0.7987	10	0.42905	T	0.14	.	16.2015	0.82084	0.0:1.0:0.0:0.0	.	2948;2948	P21817-2;P21817	.;RYR1_HUMAN	W	2948	ENSP00000352608:S2948W;ENSP00000347667:S2948W;ENSP00000354254:S2948W	ENSP00000347667:S2948W	S	+	2	0	RYR1	43690218	0.992000	0.36948	0.973000	0.42090	0.943000	0.58893	4.385000	0.59613	2.155000	0.67459	0.305000	0.20034	TCG		0.557	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			Missense_Mutation
ACAA2	10449	genome.wustl.edu	37	18	47310299	47310299	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr18:47310299C>G	ENST00000285093.10	-	10	1587	c.1112G>C	c.(1111-1113)cGt>cCt	p.R371P	ACAA2_ENST00000587994.1_Missense_Mutation_p.R368P|ACAA2_ENST00000589432.1_Missense_Mutation_p.R316P	NM_006111.2	NP_006102.2	P42765	THIM_HUMAN	acetyl-CoA acyltransferase 2	371					cellular response to hypoxia (GO:0071456)|cholesterol biosynthetic process (GO:0006695)|fatty acid metabolic process (GO:0006631)|negative regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902109)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	acetyl-CoA C-acyltransferase activity (GO:0003988)|poly(A) RNA binding (GO:0044822)	p.R371P(1)		large_intestine(2)|lung(7)|ovary(1)	10						TCCACCTCGACGCCTGAAAAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	18											72.0	57.0	62.0					18																	47310299		2203	4300	6503	45564297	SO:0001583	missense	10449			D16294	CCDS11939.1	18q21	2010-04-30	2010-04-30		ENSG00000167315	ENSG00000167315	2.3.1.16		83	protein-coding gene	gene with protein product	"""mitochondrial 3-oxoacyl-Coenzyme A thiolase"""	604770	"""acetyl-Coenzyme A acyltransferase 2"""			8241273	Standard	NM_006111		Approved	DSAEC	uc002ldw.4	P42765	OTTHUMG00000132667	ENST00000285093.10:c.1112G>C	18.37:g.47310299C>G	ENSP00000285093:p.Arg371Pro		45564297	Q9BUT6	Missense_Mutation	SNP	ENST00000285093.10	37	CCDS11939.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372572	0.61624	.	.	ENSG00000167315	ENST00000285093	D	0.93133	-3.17	5.88	5.01	0.66863	Thiolase-like, subgroup (1);Thiolase-like (1);Thiolase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97198	0.9084	M	0.91196	3.185	0.80722	D	1	D;D	0.67145	0.991;0.996	D;D	0.72982	0.931;0.979	D	0.97969	1.0342	10	0.87932	D	0	-19.5067	14.7838	0.69787	0.0:0.9312:0.0:0.0688	.	371;371	B2RB23;P42765	.;THIM_HUMAN	P	371	ENSP00000285093:R371P	ENSP00000285093:R371P	R	-	2	0	ACAA2	45564297	1.000000	0.71417	0.985000	0.45067	0.147000	0.21601	7.094000	0.76944	1.487000	0.48415	0.655000	0.94253	CGT		0.408	ACAA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255921.2	NM_006111		Missense_Mutation
NUMBL	9253	genome.wustl.edu	37	19	41188843	41188843	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:41188843G>A	ENST00000252891.4	-	4	447	c.280C>T	c.(280-282)Cgg>Tgg	p.R94W	NUMBL_ENST00000598779.1_Missense_Mutation_p.R53W|NUMBL_ENST00000540131.1_Missense_Mutation_p.R53W|NUMBL_ENST00000599594.1_5'Flank	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	94	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)		p.R94W(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			TGCATTCCCCGGGACTCCTCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											141.0	120.0	127.0					19																	41188843		2203	4300	6503	45880683	SO:0001583	missense	9253			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.280C>T	19.37:g.41188843G>A	ENSP00000252891:p.Arg94Trp		45880683	Q7Z4J9	Missense_Mutation	SNP	ENST00000252891.4	37	CCDS12561.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923144	0.52653	.	.	ENSG00000105245	ENST00000252891;ENST00000540131	T;T	0.19532	2.14;2.14	4.16	0.501	0.16925	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.50514	0.1620	M	0.91972	3.26	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.59231	-0.7493	10	0.87932	D	0	-21.8703	11.9091	0.52729	0.0:0.0:0.3957:0.6042	.	94;94	A8K033;Q9Y6R0	.;NUMBL_HUMAN	W	94;53	ENSP00000252891:R94W;ENSP00000442759:R53W	ENSP00000252891:R94W	R	-	1	2	NUMBL	45880683	0.939000	0.31865	0.994000	0.49952	0.460000	0.32559	0.696000	0.25541	0.091000	0.17302	0.460000	0.39030	CGG		0.592	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756		Missense_Mutation
B9D2	80776	genome.wustl.edu	37	19	41863906	41863906	+	Nonsense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:41863906G>T	ENST00000243578.3	-	3	329	c.110C>A	c.(109-111)tCa>tAa	p.S37*	TMEM91_ENST00000604123.1_Intron|TMEM91_ENST00000539627.1_Intron|CTC-435M10.3_ENST00000604424.1_Intron	NM_030578.3	NP_085055.2	Q9BPU9	B9D2_HUMAN	B9 protein domain 2	37	B9. {ECO:0000255|PROSITE- ProRule:PRU00713}.				cilium assembly (GO:0042384)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)	gamma-tubulin binding (GO:0043015)	p.S37*(1)		large_intestine(1)|ovary(1)	2						CCGCACGCCTGACAGGAGCTT	0.627																																																1	Substitution - Nonsense(1)	ovary(1)	19											76.0	61.0	66.0					19																	41863906		2203	4300	6503	46555746	SO:0001587	stop_gained	80776			BC004157	CCDS12579.1	19q13.2	2014-01-28				ENSG00000123810			28636	protein-coding gene	gene with protein product		611951				21763481	Standard	NM_030578		Approved	MGC4093, MKS10	uc002oqj.2	Q9BPU9		ENST00000243578.3:c.110C>A	19.37:g.41863906G>T	ENSP00000243578:p.Ser37*		46555746		Nonsense_Mutation	SNP	ENST00000243578.3	37	CCDS12579.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	31	5.098232	0.94197	.	.	ENSG00000123810	ENST00000243578	.	.	.	4.48	4.48	0.54585	.	0.074638	0.56097	U	0.000037	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.0826	0.81014	0.0:0.0:1.0:0.0	.	.	.	.	X	37	.	ENSP00000243578:S37X	S	-	2	0	B9D2	46555746	1.000000	0.71417	0.966000	0.40874	0.360000	0.29518	8.426000	0.90273	2.332000	0.79248	0.313000	0.20887	TCA		0.627	B9D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463489.1	NM_030578		Nonsense_Mutation
CELF1	10658	genome.wustl.edu	37	11	47508323	47508323	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:47508323C>G	ENST00000358597.3	-	3	288	c.289G>C	c.(289-291)Gct>Cct	p.A97P	CELF1_ENST00000395290.2_Missense_Mutation_p.A97P|CELF1_ENST00000361904.3_Missense_Mutation_p.A97P|CELF1_ENST00000532048.1_Missense_Mutation_p.A124P|CELF1_ENST00000310513.5_Missense_Mutation_p.A97P|CELF1_ENST00000531165.1_Missense_Mutation_p.A124P|CELF1_ENST00000395292.2_Missense_Mutation_p.A97P|AC090559.1_ENST00000578625.1_RNA			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	97	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)	p.A97P(1)		central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						TCACTGTCAGCAGGTTTCATC	0.383																																					Pancreas(163;1949 1966 9906 43218 43785)											1	Substitution - Missense(1)	ovary(1)	11											172.0	167.0	169.0					11																	47508323		2201	4298	6499	47464899	SO:0001583	missense	10658			U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.289G>C	11.37:g.47508323C>G	ENSP00000351409:p.Ala97Pro		47464899	B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Missense_Mutation	SNP	ENST00000358597.3	37	CCDS31482.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	36	5.743231	0.96873	.	.	ENSG00000149187	ENST00000395290;ENST00000358597;ENST00000395292;ENST00000310513;ENST00000361904;ENST00000531165;ENST00000532048	T;T;T;T;T;T;T	0.80393	-1.37;0.83;0.83;0.83;0.83;0.83;0.83	5.9	5.9	0.94986	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	D	0.92701	0.7680	M	0.92077	3.27	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;0.996;0.996;1.0;0.99	D	0.93526	0.6865	10	0.87932	D	0	-9.1305	20.2723	0.98479	0.0:1.0:0.0:0.0	.	97;124;124;97;97;97	F8W940;G5EA30;Q92879-4;Q92879-2;Q92879-3;Q92879	.;.;.;.;.;CELF1_HUMAN	P	97;97;97;97;97;124;124	ENSP00000378705:A97P;ENSP00000351409:A97P;ENSP00000378706:A97P;ENSP00000308386:A97P;ENSP00000354639:A97P;ENSP00000436864:A124P;ENSP00000435926:A124P	ENSP00000308386:A97P	A	-	1	0	CELF1	47464899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.793000	0.96121	0.563000	0.77884	GCT		0.383	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398352.1	NM_006560		Missense_Mutation
PTGIS	5740	genome.wustl.edu	37	20	48130869	48130869	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr20:48130869C>A	ENST00000244043.4	-	7	948	c.919G>T	c.(919-921)Gct>Tct	p.A307S	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	307					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)	p.A307S(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	CGGACAGCAGCCAGGGCTTCA	0.577																																																1	Substitution - Missense(1)	ovary(1)	20											52.0	49.0	50.0					20																	48130869		2203	4300	6503	47564276	SO:0001583	missense	5740				CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.919G>T	20.37:g.48130869C>A	ENSP00000244043:p.Ala307Ser		47564276	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Missense_Mutation	SNP	ENST00000244043.4	37	CCDS13419.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	7.421	0.636689	0.14386	.	.	ENSG00000124212	ENST00000244043	T	0.01379	4.96	4.1	3.12	0.35913	.	0.327620	0.27640	N	0.018461	T	0.02533	0.0077	L	0.60957	1.885	0.40171	D	0.977179	B	0.33583	0.418	B	0.39339	0.297	T	0.53933	-0.8368	10	0.48119	T	0.1	-17.051	9.0233	0.36213	0.0:0.8814:0.0:0.1186	.	307	Q16647	PTGIS_HUMAN	S	307	ENSP00000244043:A307S	ENSP00000244043:A307S	A	-	1	0	PTGIS	47564276	0.259000	0.24043	0.851000	0.33527	0.773000	0.43773	0.459000	0.21908	0.780000	0.33566	0.561000	0.74099	GCT		0.577	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080496.2			Missense_Mutation
GLDN	342035	genome.wustl.edu	37	15	51687159	51687159	+	Silent	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr15:51687159C>T	ENST00000335449.6	+	5	725	c.669C>T	c.(667-669)tcC>tcT	p.S223S	GLDN_ENST00000396399.2_Silent_p.S99S	NM_181789.2	NP_861454.2	Q6ZMI3	GLDN_HUMAN	gliomedin	223					clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|microvillus organization (GO:0032528)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S223S(1)		central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		GAGATGTGTCCAACGACGTGC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	15											117.0	101.0	106.0					15																	51687159		2196	4293	6489	49474451	SO:0001819	synonymous_variant	342035			AY358144	CCDS10140.2	15q15.3	2008-02-05	2005-10-06	2005-10-06	ENSG00000186417	ENSG00000186417			29514	protein-coding gene	gene with protein product		608603	"""collomin"""	COLM		16039564, 12642876	Standard	XM_005254338		Approved	CRG-L2, CLOM, colmedin, UNC-112	uc002aba.3	Q6ZMI3	OTTHUMG00000131746	ENST00000335449.6:c.669C>T	15.37:g.51687159C>T			49474451	Q6UXZ7|Q7Z359	Silent	SNP	ENST00000335449.6	37	CCDS10140.2	SNP	21	WashU																																																																																				0.592	GLDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254667.2	NM_181789		Silent
DEFB114	245928	genome.wustl.edu	37	6	49928151	49928151	+	Missense_Mutation	SNP	T	T	A	rs562939075		TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:49928151T>A	ENST00000322066.3	-	2	63	c.64A>T	c.(64-66)Acc>Tcc	p.T22S		NM_001037499.1	NP_001032588.1	Q30KQ6	DB114_HUMAN	defensin, beta 114	22					defense response to bacterium (GO:0042742)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)	extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)	p.T22S(1)		kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Lung NSC(77;0.042)					TTCACCAAGGTACATGTGGCT	0.348																																																1	Substitution - Missense(1)	ovary(1)	6											88.0	79.0	82.0					6																	49928151		2203	4299	6502	50036110	SO:0001583	missense	245928			DQ012018	CCDS34474.1	6p12.3	2010-03-30			ENSG00000177684	ENSG00000177684		"""Defensins, beta"""	18095	protein-coding gene	gene with protein product		615243				11854508, 16033865	Standard	NM_001037499		Approved	DEFB-14	uc011dwp.2	Q30KQ6	OTTHUMG00000160209	ENST00000322066.3:c.64A>T	6.37:g.49928151T>A	ENSP00000312702:p.Thr22Ser		50036110	Q8NES9	Missense_Mutation	SNP	ENST00000322066.3	37	CCDS34474.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	1.845	-0.466437	0.04476	.	.	ENSG00000177684	ENST00000322066	.	.	.	3.4	-0.777	0.10981	.	0.942717	0.08681	N	0.909428	T	0.05960	0.0155	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.39187	-0.9626	7	.	.	.	-1.4887	3.9034	0.09172	0.5446:0.0:0.1571:0.2983	.	22	Q30KQ6	DB114_HUMAN	S	22	.	.	T	-	1	0	DEFB114	50036110	0.000000	0.05858	0.001000	0.08648	0.043000	0.13939	-1.309000	0.02728	-0.136000	0.11475	0.528000	0.53228	ACC		0.348	DEFB114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359665.1	NM_001037499		Missense_Mutation
SCN8A	6334	genome.wustl.edu	37	12	52115511	52115511	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:52115511G>A	ENST00000354534.6	+	12	1995	c.1817G>A	c.(1816-1818)cGg>cAg	p.R606Q	SCN8A_ENST00000545061.1_Missense_Mutation_p.R606Q|SCN8A_ENST00000550891.1_Missense_Mutation_p.R606Q	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	606					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.R606Q(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	ATCCCCATCCGGGCCCGCGAG	0.706																																																1	Substitution - Missense(1)	ovary(1)	12											7.0	12.0	11.0					12																	52115511		1968	4103	6071	50401778	SO:0001583	missense	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.1817G>A	12.37:g.52115511G>A	ENSP00000346534:p.Arg606Gln		50401778	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341898	0.81911	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961;ENST00000551216	D;D;D;D;D	0.91686	-2.89;-2.89;-2.89;-2.89;-2.89	3.83	3.83	0.44106	Domain of unknown function DUF3451 (1);	0.000000	0.85682	D	0.000000	D	0.95847	0.8648	M	0.83118	2.625	0.58432	D	0.999996	P;D;D;P	0.71674	0.937;0.998;0.996;0.949	B;D;P;P	0.72982	0.329;0.979;0.644;0.459	D	0.95744	0.8786	10	0.45353	T	0.12	.	16.3045	0.82842	0.0:0.0:1.0:0.0	.	606;606;606;606	F8VWM7;Q9UQD0-3;F8VRN5;Q9UQD0	.;.;.;SCN8A_HUMAN	Q	606;606;606;606;519;404	ENSP00000448415:R606Q;ENSP00000346534:R606Q;ENSP00000440360:R606Q;ENSP00000347255:R606Q;ENSP00000447567:R404Q	ENSP00000346534:R606Q	R	+	2	0	SCN8A	50401778	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	3.747000	0.55134	2.136000	0.66102	0.467000	0.42956	CGG		0.706	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191		Missense_Mutation
MYH14	79784	genome.wustl.edu	37	19	50804965	50804965	+	Silent	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:50804965C>G	ENST00000596571.1	+	37	5394	c.5394C>G	c.(5392-5394)gcC>gcG	p.A1798A	MYH14_ENST00000425460.1_Silent_p.A1806A|MYH14_ENST00000440075.2_Silent_p.A1839A|MYH14_ENST00000262269.8_Silent_p.A1839A|MYH14_ENST00000376970.2_Silent_p.A1831A|MYH14_ENST00000601313.1_Silent_p.A1839A|MYH14_ENST00000598205.1_Silent_p.A1806A			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1798					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GTTTCTCAGCCAAGGCAGAGA	0.622																																																0			19											39.0	46.0	44.0					19																	50804965		2055	4223	6278	55496777	SO:0001819	synonymous_variant	79784			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.5394C>G	19.37:g.50804965C>G			55496777	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Silent	SNP	ENST00000596571.1	37	CCDS59411.1	SNP	21	WashU																																																																																				0.622	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729		Silent
OR5AS1	219447	genome.wustl.edu	37	11	55798731	55798731	+	Silent	SNP	T	T	G			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:55798731T>G	ENST00000313555.1	+	1	837	c.837T>G	c.(835-837)acT>acG	p.T279T		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T279T(1)		endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					TGTTTTATACTGTTGTATTTC	0.363																																																1	Substitution - coding silent(1)	ovary(1)	11											70.0	65.0	66.0					11																	55798731		2201	4296	6497	55555307	SO:0001819	synonymous_variant	219447			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.837T>G	11.37:g.55798731T>G			55555307	Q6IFB8	Silent	SNP	ENST00000313555.1	37	CCDS31516.1	SNP	55	WashU																																																																																				0.363	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921		Silent
KLK3	354	genome.wustl.edu	37	19	51361312	51361312	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:51361312C>A	ENST00000326003.2	+	3	275	c.234C>A	c.(232-234)caC>caA	p.H78Q	KLK3_ENST00000595952.1_Intron|KLK3_ENST00000360617.3_Missense_Mutation_p.H78Q|KLK3_ENST00000597483.1_Intron|KLK3_ENST00000593997.1_Missense_Mutation_p.H78Q	NM_001030047.1|NM_001030048.1|NM_001648.2	NP_001025218.1|NP_001025219.1|NP_001639.1	P07288	KLK3_HUMAN	kallikrein-related peptidase 3	78	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular protein metabolic process (GO:0044267)|negative regulation of angiogenesis (GO:0016525)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.H78Q(1)		breast(1)|cervix(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		TGGGTCGGCACAGCCTGTTTC	0.537																																					Colon(185;1767 2023 13025 30120 37630)											1	Substitution - Missense(1)	ovary(1)	19											65.0	56.0	59.0					19																	51361312		2203	4300	6503	56053124	SO:0001583	missense	354			X14810	CCDS12807.1, CCDS33083.1, CCDS46155.1	19q13.41	2012-10-02	2006-10-27			ENSG00000142515		"""Kallikreins"""	6364	protein-coding gene	gene with protein product		176820	"""kallikrein 3, (prostate specific antigen)"""	APS		2456523, 2436946, 16800724, 16800723	Standard	NM_001648		Approved	PSA	uc021uyi.1	P07288		ENST00000326003.2:c.234C>A	19.37:g.51361312C>A	ENSP00000314151:p.His78Gln		56053124	C9JXH3|G3V0H4|G3XAE3|Q15096|Q16272|Q86TG8|Q8IXI4	Missense_Mutation	SNP	ENST00000326003.2	37	CCDS12807.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	15.79	2.936722	0.52972	.	.	ENSG00000142515	ENST00000326003;ENST00000360617;ENST00000326052	D;D	0.89746	-2.56;-2.56	2.31	1.26	0.21427	.	0.591479	0.14082	N	0.342610	D	0.92381	0.7582	M	0.74647	2.275	0.80722	D	1	D;D	0.76494	0.992;0.999	D;D	0.74023	0.962;0.982	D	0.89987	0.4105	10	0.87932	D	0	.	7.202	0.25887	0.0:0.8512:0.0:0.1488	.	78;78	Q8NCW4;G3XAE3	.;.	Q	78	ENSP00000314151:H78Q;ENSP00000353829:H78Q	ENSP00000314151:H78Q	H	+	3	2	KLK3	56053124	0.000000	0.05858	0.003000	0.11579	0.153000	0.21895	-0.143000	0.10296	0.520000	0.28426	0.505000	0.49811	CAC		0.537	KLK3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464067.1	NM_145864		Missense_Mutation
SIGLEC8	27181	genome.wustl.edu	37	19	51957963	51957963	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:51957963G>T	ENST00000321424.3	-	5	1189	c.1123C>A	c.(1123-1125)Ctg>Atg	p.L375M	SIGLEC8_ENST00000430817.1_Missense_Mutation_p.L266M|SIGLEC8_ENST00000340550.5_Missense_Mutation_p.L282M|SIGLEC8_ENST00000597352.1_5'Flank	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	375					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.L375M(1)		NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CAGAAGGACAGGAAGGCCAGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	19											137.0	125.0	129.0					19																	51957963		2203	4300	6503	56649775	SO:0001583	missense	27181			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.1123C>A	19.37:g.51957963G>T	ENSP00000321077:p.Leu375Met		56649775	Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	CCDS33086.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	.	12.59	1.983117	0.34942	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.69806	0.94;-0.43;0.65	2.31	0.102	0.14522	.	1.150660	0.07064	U	0.834174	T	0.80884	0.4709	M	0.87547	2.89	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;1.0;0.994	T	0.62105	-0.6924	10	0.87932	D	0	.	3.9509	0.09369	0.3995:0.0:0.6005:0.0	.	266;282;375	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	M	266;375;282	ENSP00000389142:L266M;ENSP00000321077:L375M;ENSP00000339448:L282M	ENSP00000321077:L375M	L	-	1	2	SIGLEC8	56649775	0.000000	0.05858	0.002000	0.10522	0.240000	0.25518	-0.370000	0.07523	0.311000	0.23014	0.393000	0.25936	CTG		0.582	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442		Missense_Mutation
ZNF613	79898	genome.wustl.edu	37	19	52448889	52448889	+	Silent	SNP	T	T	C			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:52448889T>C	ENST00000293471.6	+	6	2432	c.1753T>C	c.(1753-1755)Tta>Cta	p.L585L	ZNF613_ENST00000601794.1_Intron|ZNF613_ENST00000391794.4_Silent_p.L549L	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	585					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L585L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		TCAGACCTCATTAACTAACAG	0.448																																																1	Substitution - coding silent(1)	ovary(1)	19											86.0	72.0	77.0					19																	52448889		2203	4300	6503	57140701	SO:0001819	synonymous_variant	79898			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1753T>C	19.37:g.52448889T>C			57140701	Q96SS9	Silent	SNP	ENST00000293471.6	37	CCDS33089.1	SNP	52	WashU																																																																																				0.448	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461104.2	NM_024840		Silent
RNF111	54778	genome.wustl.edu	37	15	59384740	59384740	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr15:59384740A>T	ENST00000557998.1	+	13	3055	c.2768A>T	c.(2767-2769)aAa>aTa	p.K923I	RNF111_ENST00000348370.4_Missense_Mutation_p.K915I|RNF111_ENST00000559209.1_Missense_Mutation_p.K924I|RNF111_ENST00000561186.1_Missense_Mutation_p.K932I|RNF111_ENST00000434298.1_Missense_Mutation_p.K932I	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	923					gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K915I(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		TCACAGAGGAAACTGCACTGC	0.368																																					NSCLC(72;983 1365 10746 34387 47081)											1	Substitution - Missense(1)	ovary(1)	15											96.0	92.0	94.0					15																	59384740		2192	4291	6483	57172032	SO:0001583	missense	54778			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.2768A>T	15.37:g.59384740A>T	ENSP00000452732:p.Lys923Ile		57172032	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	ENST00000557998.1	37	CCDS58366.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	24.0	4.479006	0.84747	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.17370	2.29;2.28	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.32071	0.0817	L	0.34521	1.04	0.80722	D	1	D;D;P	0.89917	1.0;0.999;0.672	D;D;P	0.91635	0.999;0.997;0.651	T	0.03969	-1.0988	10	0.59425	D	0.04	-20.4849	15.5098	0.75772	1.0:0.0:0.0:0.0	.	932;923;915	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	I	915;932	ENSP00000288199:K915I;ENSP00000393641:K932I	ENSP00000288199:K915I	K	+	2	0	RNF111	57172032	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.730000	0.91510	2.075000	0.62263	0.254000	0.18369	AAA		0.368	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	NM_017610		Missense_Mutation
OR4D6	219983	genome.wustl.edu	37	11	59225293	59225293	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:59225293A>C	ENST00000300127.2	+	1	883	c.860A>C	c.(859-861)tAt>tCt	p.Y287S		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y287S(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						CCCATCATCTATTCCCTGAGA	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											112.0	114.0	113.0					11																	59225293		2201	4295	6496	58981869	SO:0001583	missense	219983			AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.860A>C	11.37:g.59225293A>C	ENSP00000300127:p.Tyr287Ser		58981869	B2RNP7|Q6IFF5|Q96R74	Missense_Mutation	SNP	ENST00000300127.2	37	CCDS31562.1	SNP	16	WashU	.	.	.	.	.	.	.	.	.	.	A	15.25	2.779153	0.49891	.	.	ENSG00000166884	ENST00000300127	T	0.61742	0.08	6.01	6.01	0.97437	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000182	T	0.81192	0.4771	M	0.91920	3.255	0.50467	D	0.999875	D	0.89917	1.0	D	0.97110	1.0	D	0.85425	0.1145	10	0.87932	D	0	-17.2115	15.3555	0.74423	1.0:0.0:0.0:0.0	.	287	Q8NGJ1	OR4D6_HUMAN	S	287	ENSP00000300127:Y287S	ENSP00000300127:Y287S	Y	+	2	0	OR4D6	58981869	1.000000	0.71417	0.997000	0.53966	0.002000	0.02628	8.922000	0.92789	2.299000	0.77371	0.533000	0.62120	TAT		0.507	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708		Missense_Mutation
NLRP12	91662	genome.wustl.edu	37	19	54314534	54314534	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:54314534C>T	ENST00000324134.6	-	3	547	c.379G>A	c.(379-381)Gaa>Aaa	p.E127K	NLRP12_ENST00000391773.1_Missense_Mutation_p.E127K|NLRP12_ENST00000391775.3_Missense_Mutation_p.E127K|NLRP12_ENST00000345770.5_Missense_Mutation_p.E127K|NLRP12_ENST00000391772.1_Missense_Mutation_p.E127K|NLRP12_ENST00000351894.4_Missense_Mutation_p.E127K|NLRP12_ENST00000535162.1_Missense_Mutation_p.E127K|NLRP12_ENST00000354278.3_Missense_Mutation_p.E127K	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	127					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.E127K(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CTGTAGGTTTCCTGGGGATCT	0.542																																																1	Substitution - Missense(1)	ovary(1)	19											73.0	71.0	72.0					19																	54314534		2202	4295	6497	59006346	SO:0001583	missense	91662			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.379G>A	19.37:g.54314534C>T	ENSP00000319377:p.Glu127Lys		59006346	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	CCDS12864.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	8.754	0.922051	0.17982	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.73681	-0.7;-0.73;-0.76;-0.77;-0.75;-0.69;-0.75	4.47	2.3	0.28687	.	0.703660	0.12215	N	0.488905	T	0.49677	0.1571	L	0.28014	0.82	0.18873	N	0.999981	P;P;P;P	0.40144	0.454;0.651;0.651;0.704	B;B;B;B	0.33521	0.15;0.115;0.165;0.152	T	0.41288	-0.9517	10	0.06625	T	0.88	.	3.8827	0.09085	0.1885:0.5987:0.0:0.2128	.	127;127;127;127	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	K	127	ENSP00000319377:E127K;ENSP00000438030:E127K;ENSP00000340473:E127K;ENSP00000346231:E127K;ENSP00000375655:E127K;ENSP00000375653:E127K;ENSP00000375652:E127K	ENSP00000319377:E127K	E	-	1	0	NLRP12	59006346	0.001000	0.12720	0.002000	0.10522	0.243000	0.25628	0.402000	0.20965	0.431000	0.26258	0.306000	0.20318	GAA		0.542	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		Missense_Mutation
BRSK1	84446	genome.wustl.edu	37	19	55805588	55805588	+	Silent	SNP	C	C	A			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:55805588C>A	ENST00000309383.1	+	6	859	c.582C>A	c.(580-582)ccC>ccA	p.P194P	BRSK1_ENST00000590333.1_Silent_p.P210P|BRSK1_ENST00000585418.1_Silent_p.P194P	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	194	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.P194P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		TCAGGTCCCCCCATTATGCGT	0.617																																																1	Substitution - coding silent(1)	ovary(1)	19											82.0	85.0	84.0					19																	55805588		2203	4300	6503	60497400	SO:0001819	synonymous_variant	84446			AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.582C>A	19.37:g.55805588C>A			60497400	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	ENST00000309383.1	37	CCDS12921.1	SNP	22	WashU																																																																																				0.617	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430		Silent
NLRP13	126204	genome.wustl.edu	37	19	56423971	56423971	+	Missense_Mutation	SNP	T	T	A	rs149489544		TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:56423971T>A	ENST00000342929.3	-	5	1211	c.1212A>T	c.(1210-1212)gaA>gaT	p.E404D	NLRP13_ENST00000588751.1_Missense_Mutation_p.E404D	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	404	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)	p.E404D(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TTTTCTCAACTTCACTTGAGT	0.448																																																1	Substitution - Missense(1)	ovary(1)	19											86.0	90.0	89.0					19																	56423971		2203	4300	6503	61115783	SO:0001583	missense	126204			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1212A>T	19.37:g.56423971T>A	ENSP00000343891:p.Glu404Asp		61115783	Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	37	CCDS33119.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	7.970	0.748967	0.15710	.	.	ENSG00000173572	ENST00000342929	T	0.73047	-0.71	2.7	-3.58	0.04597	.	.	.	.	.	T	0.42653	0.1212	N	0.14661	0.345	0.09310	N	1	B	0.28512	0.214	B	0.21917	0.037	T	0.17745	-1.0359	9	0.40728	T	0.16	.	0.8016	0.01076	0.1622:0.2545:0.1636:0.4197	.	404	Q86W25	NAL13_HUMAN	D	404	ENSP00000343891:E404D	ENSP00000343891:E404D	E	-	3	2	NLRP13	61115783	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.703000	0.05063	-1.109000	0.02996	-1.431000	0.01090	GAA		0.448	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810		Missense_Mutation
ZNF583	147949	genome.wustl.edu	37	19	56925716	56925716	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:56925716G>T	ENST00000333201.9	+	4	349	c.139G>T	c.(139-141)Gtt>Ttt	p.V47F	ZNF583_ENST00000291598.7_Missense_Mutation_p.V47F	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	47	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V47F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		GTAAGCAGGAGTTTCTGTTTC	0.453																																																1	Substitution - Missense(1)	ovary(1)	19											94.0	103.0	100.0					19																	56925716		2203	4300	6503	61617528	SO:0001583	missense	147949			AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.139G>T	19.37:g.56925716G>T	ENSP00000388502:p.Val47Phe		61617528	O14850|Q2NKK3	Missense_Mutation	SNP	ENST00000333201.9	37	CCDS12943.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	15.83	2.949729	0.53186	.	.	ENSG00000198440	ENST00000537943;ENST00000291598;ENST00000333201;ENST00000391778;ENST00000436972	T;T;T;T	0.00801	5.68;5.68;5.68;5.68	4.72	-7.55	0.01327	Krueppel-associated box (3);	0.213057	0.23736	N	0.045064	T	0.00300	0.0009	N	0.00321	-1.65	0.09310	N	1	B	0.29805	0.257	B	0.29942	0.109	T	0.52381	-0.8583	10	0.41790	T	0.15	.	7.1416	0.25558	0.0971:0.6142:0.1646:0.1241	.	47	Q96ND8	ZN583_HUMAN	F	47	ENSP00000444291:V47F;ENSP00000291598:V47F;ENSP00000388502:V47F;ENSP00000375657:V47F	ENSP00000291598:V47F	V	+	1	0	ZNF583	61617528	0.000000	0.05858	0.001000	0.08648	0.956000	0.61745	-4.190000	0.00277	-0.682000	0.05197	0.467000	0.42956	GTT		0.453	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1	NM_152478		Missense_Mutation
SCGB2A2	4250	genome.wustl.edu	37	11	62037717	62037717	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:62037717C>T	ENST00000227918.2	+	1	91	c.29C>T	c.(28-30)gCg>gTg	p.A10V	SCGB2A2_ENST00000525380.1_Missense_Mutation_p.A10V	NM_002411.2	NP_002402.1	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2	10								p.A10V(1)		large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7						CTCATGCTGGCGGCCCTCTCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	11											131.0	124.0	126.0					11																	62037717		2202	4299	6501	61794293	SO:0001583	missense	4250			AF015224	CCDS8018.1	11q13	2011-12-14	2002-03-22	2002-03-22	ENSG00000110484	ENSG00000110484		"""Secretoglobins"""	7050	protein-coding gene	gene with protein product	"""mammaglobin A"""	605562	"""mammaglobin 1"""	MGB1		9488047, 8631025, 22155607	Standard	XM_005274005		Approved	UGB2, MGC71974	uc001ntc.3	Q13296	OTTHUMG00000167509	ENST00000227918.2:c.29C>T	11.37:g.62037717C>T	ENSP00000227918:p.Ala10Val		61794293	A1A522|Q86WH8	Missense_Mutation	SNP	ENST00000227918.2	37	CCDS8018.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463708	0.26335	.	.	ENSG00000110484	ENST00000227918;ENST00000525380	.	.	.	2.99	-2.06	0.07298	.	.	.	.	.	T	0.13500	0.0327	.	.	.	0.09310	N	1	B;B	0.27951	0.195;0.123	B;B	0.12837	0.008;0.004	T	0.26395	-1.0104	7	0.12766	T	0.61	.	3.674	0.08284	0.0:0.3786:0.2019:0.4195	.	10;10	Q13296-2;Q13296	.;SG2A2_HUMAN	V	10	.	ENSP00000227918:A10V	A	+	2	0	SCGB2A2	61794293	0.000000	0.05858	0.013000	0.15412	0.026000	0.11368	-0.815000	0.04481	-0.421000	0.07416	0.467000	0.42956	GCG		0.612	SCGB2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394860.1	NM_002411		Missense_Mutation
LPHN3	23284	genome.wustl.edu	37	4	62598858	62598858	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr4:62598858T>A	ENST00000514591.1	+	7	1110	c.781T>A	c.(781-783)Tct>Act	p.S261T	LPHN3_ENST00000506700.1_Missense_Mutation_p.S261T|LPHN3_ENST00000514996.1_Missense_Mutation_p.S261T|LPHN3_ENST00000507164.1_Missense_Mutation_p.S329T|LPHN3_ENST00000509896.1_Missense_Mutation_p.S329T|LPHN3_ENST00000506746.1_Missense_Mutation_p.S329T|LPHN3_ENST00000508946.1_Missense_Mutation_p.S261T|LPHN3_ENST00000506720.1_Missense_Mutation_p.S329T|LPHN3_ENST00000511324.1_Missense_Mutation_p.S329T|LPHN3_ENST00000507625.1_Missense_Mutation_p.S329T|LPHN3_ENST00000545650.1_Missense_Mutation_p.S261T|LPHN3_ENST00000504896.1_Missense_Mutation_p.S261T|LPHN3_ENST00000514157.1_Missense_Mutation_p.S261T|LPHN3_ENST00000508693.1_Missense_Mutation_p.S329T|LPHN3_ENST00000512091.2_Missense_Mutation_p.S261T			Q9HAR2	LPHN3_HUMAN	latrophilin 3	261	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.S261T(1)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GGGAGGCAAATCTGACATAGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	4											75.0	68.0	70.0					4																	62598858		1925	4129	6054	62281453	SO:0001583	missense	23284			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.781T>A	4.37:g.62598858T>A	ENSP00000422533:p.Ser261Thr		62281453	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	2.590	-0.295448	0.05532	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.83376	0.5241	N	0.04148	-0.265	0.49051	D	0.99974	D;D;P	0.63046	0.992;0.992;0.954	D;D;D	0.76071	0.987;0.987;0.943	T	0.79892	-0.1611	10	0.02654	T	1	.	9.7144	0.40265	0.1545:0.0:0.0:0.8455	.	261;329;261	E9PE04;E7EN28;Q9HAR2-2	.;.;.	T	261;261;329;329;261;261;261;261;261;329;329;329;261;261;261;329;329;261	ENSP00000423388:S261T;ENSP00000422533:S261T;ENSP00000423787:S329T;ENSP00000425033:S329T;ENSP00000424120:S261T;ENSP00000439831:S261T;ENSP00000421476:S329T;ENSP00000424030:S329T;ENSP00000421372:S329T;ENSP00000425201:S261T;ENSP00000423434:S261T;ENSP00000421627:S261T;ENSP00000420931:S329T;ENSP00000425884:S329T;ENSP00000424258:S261T	ENSP00000280009:S261T	S	+	1	0	LPHN3	62281453	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.940000	0.56599	1.989000	0.58080	0.455000	0.32223	TCT		0.413	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			Missense_Mutation
TRIP4	9325	genome.wustl.edu	37	15	64690018	64690018	+	Splice_Site	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr15:64690018G>T	ENST00000261884.3	+	4	678		c.e4+1		TRIP4_ENST00000559565.1_Splice_Site|RN7SL595P_ENST00000582065.1_RNA	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4						positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.?(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						TGGCACTCTGGTAAATTATTT	0.398																																																1	Unknown(1)	ovary(1)	15											74.0	72.0	73.0					15																	64690018		2203	4300	6503	62477071	SO:0001630	splice_region_variant	9325			L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.618+1G>T	15.37:g.64690018G>T			62477071	B2RAS0|Q96ED7|Q9UKH0	Splice_Site_SNP	SNP	ENST00000261884.3	37	CCDS10194.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187231	0.78789	.	.	ENSG00000103671	ENST00000261884	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4354	0.90643	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRIP4	62477071	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.386000	0.97228	2.415000	0.81967	0.563000	0.77884	.		0.398	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256635.2	NM_016213	Intron	Splice_Site_SNP
EXOC5P1	644548	genome.wustl.edu	37	4	63684285	63684285	+	IGR	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr4:63684285G>A								AC110810.1 (223105 upstream) : RP11-257A22.1 (309743 downstream)																							GGCAGTTTGCGATGTAGCTGA	0.383																																																0			4																																								63366880	SO:0001628	intergenic_variant	644556																															4.37:g.63684285G>A			63366880		Missense_Mutation	SNP		37		SNP	37	WashU																																																																																			0	0.383									Missense_Mutation
ZNF324B	388569	genome.wustl.edu	37	19	58967205	58967205	+	Silent	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr19:58967205G>C	ENST00000336614.4	+	4	1001	c.894G>C	c.(892-894)tcG>tcC	p.S298S	ZNF324B_ENST00000545523.1_Silent_p.S298S|ZNF324B_ENST00000391696.1_Silent_p.S288S	NM_207395.2	NP_997278.2	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	298					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S298S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GCCAGACGTCGCACTTGACGC	0.677																																																1	Substitution - coding silent(1)	ovary(1)	19											43.0	38.0	39.0					19																	58967205		2201	4298	6499	63659017	SO:0001819	synonymous_variant	388569			AK127750	CCDS33138.1	19q13.43	2013-01-08				ENSG00000249471		"""Zinc fingers, C2H2-type"", ""-"""	33107	protein-coding gene	gene with protein product							Standard	NM_207395		Approved	FLJ45850	uc002qsv.1	Q6AW86		ENST00000336614.4:c.894G>C	19.37:g.58967205G>C			63659017	B2RTZ6|Q6ZMX8|Q6ZS42	Silent	SNP	ENST00000336614.4	37	CCDS33138.1	SNP	38	WashU																																																																																				0.677	ZNF324B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467038.1	NM_207395		Silent
Unknown	0	genome.wustl.edu	37	2	65433048	65433048	+	IGR	SNP	T	T	A			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:65433048T>A								SNORA74 (47054 upstream) : ACTR2 (21838 downstream)																							AAGCTTACACTCTCTGCTCTG	0.498																																																0			2																																								65286552	SO:0001628	intergenic_variant	729317																															2.37:g.65433048T>A			65286552		Missense_Mutation	SNP		37		SNP	54	WashU																																																																																			0	0.498									Missense_Mutation
PIAS1	8554	genome.wustl.edu	37	15	68434291	68434291	+	Silent	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr15:68434291C>T	ENST00000249636.6	+	3	625	c.477C>T	c.(475-477)gaC>gaT	p.D159D	PIAS1_ENST00000545237.1_Silent_p.D161D	NM_016166.1	NP_057250.1	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	159	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				androgen receptor signaling pathway (GO:0030521)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|protein-DNA complex assembly (GO:0065004)|regulation of cell proliferation (GO:0042127)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.D159D(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)	24						TAGCATCAGACAACAGTCAGC	0.353																																																1	Substitution - coding silent(1)	ovary(1)	15											61.0	57.0	58.0					15																	68434291		1867	4116	5983	66221345	SO:0001819	synonymous_variant	8554			AF077951	CCDS45290.1	15q	2011-10-11	2002-04-19	2002-04-19		ENSG00000033800		"""Zinc fingers, MIZ-type"""	2752	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 3"""	603566	"""DEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1"""	DDXBP1		9724754, 9177271	Standard	XM_005254735		Approved	GBP, GU/RH-II, ZMIZ3	uc002aqz.3	O75925		ENST00000249636.6:c.477C>T	15.37:g.68434291C>T			66221345	B2RB67|B3KSY9|C5J4B4|Q147X4|Q99751|Q9UN02	Silent	SNP	ENST00000249636.6	37	CCDS45290.1	SNP	17	WashU																																																																																				0.353	PIAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419642.2			Silent
HYDIN	54768	genome.wustl.edu	37	16	70977797	70977797	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr16:70977797G>C	ENST00000393567.2	-	42	6737	c.6587C>G	c.(6586-6588)cCc>cGc	p.P2196R		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2196					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.P2147R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TCCGACACTGGGACTAACACT	0.602																																																1	Substitution - Missense(1)	ovary(1)	16											34.0	36.0	35.0					16																	70977797		2020	4181	6201	69535298	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6587C>G	16.37:g.70977797G>C	ENSP00000377197:p.Pro2196Arg		69535298	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	5.159	0.214865	0.09810	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00824	5.65	5.14	2.04	0.26737	.	0.584174	0.12357	U	0.476014	T	0.00845	0.0028	N	0.25647	0.755	0.34811	D	0.737708	B	0.22346	0.068	B	0.23716	0.048	T	0.46596	-0.9180	10	0.36615	T	0.2	.	4.2963	0.10902	0.1456:0.1254:0.5998:0.1292	.	2195	F8WD23	.	R	2196;2195	ENSP00000377197:P2196R	ENSP00000313052:P2195R	P	-	2	0	HYDIN	69535298	0.970000	0.33590	0.460000	0.27093	0.046000	0.14306	1.611000	0.36879	0.655000	0.30866	0.609000	0.83330	CCC		0.602	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			Missense_Mutation
HEXA	3073	genome.wustl.edu	37	15	72638893	72638893	+	Silent	SNP	G	G	A	rs587779406		TCGA-23-1022-01	TCGA-23-1022-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr15:72638893G>A	ENST00000268097.5	-	11	1808	c.1305C>T	c.(1303-1305)taC>taT	p.Y435Y	RP11-106M3.3_ENST00000570175.1_RNA|HEXA_ENST00000429918.2_Silent_p.Y262Y|HEXA_ENST00000457859.2_Intron|HEXA_ENST00000566304.1_Silent_p.Y446Y|HEXA_ENST00000567159.1_Silent_p.Y435Y|RP11-106M3.2_ENST00000379915.4_RNA	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	435					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)	p.Y435Y(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						GTTCCACTATGTAGAAATCCT	0.572																																																1	Substitution - coding silent(1)	ovary(1)	15											101.0	109.0	107.0					15																	72638893		2199	4297	6496	70425947	SO:0001819	synonymous_variant	3073			M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.1305C>T	15.37:g.72638893G>A			70425947	B4DKE7|E7ENH7|Q53HS8|Q6AI32	Silent	SNP	ENST00000268097.5	37	CCDS10243.1	SNP	48	WashU																																																																																				0.572	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257317.2	NM_000520		Silent
COL9A1	1297	genome.wustl.edu	37	6	71011764	71011764	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:71011764A>T	ENST00000357250.6	-	2	186	c.28T>A	c.(28-30)Ttc>Atc	p.F10I	COL9A1_ENST00000370496.3_Missense_Mutation_p.F10I	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	10					axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.F10I(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						ACAAAGAAGAAAACTGGAATT	0.423																																																1	Substitution - Missense(1)	ovary(1)	6											36.0	37.0	37.0					6																	71011764		2203	4300	6503	71068485	SO:0001583	missense	1297				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.28T>A	6.37:g.71011764A>T	ENSP00000349790:p.Phe10Ile		71068485	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	16.01	3.002053	0.54254	.	.	ENSG00000112280	ENST00000357250;ENST00000370496	D;D	0.91068	-2.41;-2.78	5.85	4.69	0.59074	.	0.078571	0.56097	D	0.000035	T	0.76863	0.4047	L	0.32530	0.975	0.80722	D	1	B	0.20368	0.044	B	0.13407	0.009	T	0.74740	-0.3563	10	0.52906	T	0.07	.	9.9087	0.41392	0.9212:0.0:0.0788:0.0	.	10	P20849	CO9A1_HUMAN	I	10	ENSP00000349790:F10I;ENSP00000359527:F10I	ENSP00000349790:F10I	F	-	1	0	COL9A1	71068485	1.000000	0.71417	0.993000	0.49108	0.891000	0.51852	2.396000	0.44468	1.038000	0.40049	0.533000	0.62120	TTC		0.423	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			Missense_Mutation
HCN4	10021	genome.wustl.edu	37	15	73635973	73635973	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr15:73635973T>A	ENST00000261917.3	-	2	1955	c.962A>T	c.(961-963)gAg>gTg	p.E321V	RP11-272D12.1_ENST00000558742.1_RNA|RP11-272D12.1_ENST00000557981.1_RNA	NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	321					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.E321V(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TGTGTTGTCCTCCACCACGAT	0.493																																																1	Substitution - Missense(1)	ovary(1)	15											98.0	80.0	87.0					15																	73635973		2198	4297	6495	71423026	SO:0001583	missense	10021			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.962A>T	15.37:g.73635973T>A	ENSP00000261917:p.Glu321Val		71423026	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	37	CCDS10248.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	20.2	3.949961	0.73787	.	.	ENSG00000138622	ENST00000261917	D	0.94793	-3.52	5.34	5.34	0.76211	Ion transport (1);	.	.	.	.	D	0.96741	0.8936	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96747	0.9551	9	0.49607	T	0.09	.	15.6106	0.76713	0.0:0.0:0.0:1.0	.	321	Q9Y3Q4	HCN4_HUMAN	V	321	ENSP00000261917:E321V	ENSP00000261917:E321V	E	-	2	0	HCN4	71423026	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.889000	0.87307	2.147000	0.66899	0.533000	0.62120	GAG		0.493	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477		Missense_Mutation
C2CD3	26005	genome.wustl.edu	37	11	73843994	73843994	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:73843994C>G	ENST00000334126.7	-	7	1338	c.1112G>C	c.(1111-1113)cGg>cCg	p.R371P	C2CD3_ENST00000539061.1_Missense_Mutation_p.R371P|C2CD3_ENST00000313663.7_Missense_Mutation_p.R371P			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	371					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)		p.R371P(1)|p.R371Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GTCTTTAAACCGATTCCTAGA	0.388																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	11											171.0	155.0	160.0					11																	73843994		2200	4293	6493	73521642	SO:0001583	missense	26005			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1112G>C	11.37:g.73843994C>G	ENSP00000334379:p.Arg371Pro		73521642	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37		SNP	23	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.17|12.17	1.858920|1.858920	0.32884|0.32884	.|.	.|.	ENSG00000168014|ENSG00000168014	ENST00000289350|ENST00000334126;ENST00000313663;ENST00000313681;ENST00000539061	.|T;T	.|0.10099	.|2.91;2.91	5.2|5.2	-0.211|-0.211	0.13172|0.13172	.|.	.|1.109980	.|0.06889	.|N	.|0.803948	T|T	0.04048|0.04048	0.0113|0.0113	N|N	0.02011|0.02011	-0.69|-0.69	0.09310|0.09310	N|N	1|1	.|B;B	.|0.06786	.|0.0;0.001	.|B;B	.|0.04013	.|0.001;0.001	T|T	0.42865|0.42865	-0.9426|-0.9426	6|10	0.25751|0.34782	T|T	0.34|0.22	6.7573|6.7573	5.9902|5.9902	0.19456|0.19456	0.0:0.3639:0.2564:0.3797|0.0:0.3639:0.2564:0.3797	.|.	.|371;371	.|Q4AC94;Q4AC94-1	.|C2CD3_HUMAN;.	R|P	371|371	.|ENSP00000334379:R371P;ENSP00000323339:R371P	ENSP00000289350:G371R|ENSP00000323339:R371P	G|R	-|-	1|2	0|0	C2CD3|C2CD3	73521642|73521642	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.144000|0.144000	0.21451|0.21451	0.034000|0.034000	0.13776|0.13776	-0.270000|-0.270000	0.09285|0.09285	-0.254000|-0.254000	0.11334|0.11334	GGT|CGG		0.388	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531		Missense_Mutation
CAPS2	84698	genome.wustl.edu	37	12	75676116	75676116	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:75676116T>G	ENST00000409445.3	-	17	1780	c.1584A>C	c.(1582-1584)aaA>aaC	p.K528N	RP11-560G2.1_ENST00000549953.1_RNA|CAPS2_ENST00000393284.3_Missense_Mutation_p.K296N|CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000409799.1_Missense_Mutation_p.K446N|CAPS2_ENST00000442339.2_Missense_Mutation_p.K118N	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	528	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)	p.K296N(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						TGAAATCCAGTTTCATAAAGG	0.358																																																1	Substitution - Missense(1)	ovary(1)	12											88.0	93.0	91.0					12																	75676116		2203	4300	6503	73962383	SO:0001583	missense	84698			AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.1584A>C	12.37:g.75676116T>G	ENSP00000386959:p.Lys528Asn		73962383	Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	ENST00000409445.3	37	CCDS9008.2	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	18.37	3.609789	0.66558	.	.	ENSG00000180881	ENST00000409799;ENST00000409445;ENST00000378703;ENST00000393284;ENST00000442339	T;T;T;T	0.29917	1.67;1.55;1.63;1.72	5.95	4.78	0.61160	EF-hand-like domain (1);	0.202382	0.40640	N	0.001043	T	0.57666	0.2069	M	0.90705	3.14	0.50171	D	0.999856	B;P;D;D;P	0.76494	0.399;0.837;0.999;0.968;0.923	B;B;D;P;P	0.68039	0.206;0.373;0.955;0.823;0.786	T	0.62877	-0.6761	10	0.87932	D	0	-9.302	8.2909	0.31956	0.0:0.0682:0.1347:0.7971	.	118;296;264;528;446	A2RRN2;Q9BXY5-2;Q9BXY5-3;Q9BXY5;B9A061	.;.;.;CAYP2_HUMAN;.	N	446;528;264;296;118	ENSP00000386977:K446N;ENSP00000386959:K528N;ENSP00000376963:K296N;ENSP00000389633:K118N	ENSP00000367975:K264N	K	-	3	2	CAPS2	73962383	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	1.604000	0.36804	1.041000	0.40125	0.519000	0.50382	AAA		0.358	CAPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327880.2			Missense_Mutation
C1QTNF1	114897	genome.wustl.edu	37	17	77043752	77043752	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr17:77043752G>A	ENST00000339142.2	+	5	983	c.428G>A	c.(427-429)aGc>aAc	p.S143N	C1QTNF1_ENST00000581774.1_Missense_Mutation_p.S143N|C1QTNF1_ENST00000583904.1_Missense_Mutation_p.S143N|C1QTNF1_ENST00000578229.1_Missense_Mutation_p.S61N|C1QTNF1_ENST00000582625.1_3'UTR|C1QTNF1_ENST00000311661.4_Missense_Mutation_p.S61N|C1QTNF1_ENST00000579760.1_Missense_Mutation_p.S143N|C1QTNF1_ENST00000354124.3_Missense_Mutation_p.S153N|C1QTNF1_ENST00000580454.1_Missense_Mutation_p.S143N|C1QTNF1_ENST00000580474.1_Missense_Mutation_p.S143N|C1QTNF1_ENST00000392445.2_Missense_Mutation_p.S143N	NM_198593.3	NP_940995.1	Q9BXJ1	C1QT1_HUMAN	C1q and tumor necrosis factor related protein 1	143	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase B signaling (GO:0051897)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|regulation of glucose metabolic process (GO:0010906)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)	p.S61N(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(2)	14			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)			CGGTGCAAGAGCCACTACGCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	17											61.0	61.0	61.0					17																	77043752		2203	4300	6503	74555347	SO:0001583	missense	114897			AF329840	CCDS11761.1, CCDS11762.1	17q25	2012-07-02			ENSG00000173918	ENSG00000173918			14324	protein-coding gene	gene with protein product	"""G protein coupled receptor interacting protein"""	610365				12409230	Standard	NM_198593		Approved	CTRP1, ZSIG37, GIP, FLJ90694	uc002jwp.4	Q9BXJ1	OTTHUMG00000177533	ENST00000339142.2:c.428G>A	17.37:g.77043752G>A	ENSP00000340864:p.Ser143Asn		74555347	Q6ZMH6|Q96NF2|Q9GZR4	Missense_Mutation	SNP	ENST00000339142.2	37	CCDS11761.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	6.713	0.500316	0.12762	.	.	ENSG00000173918	ENST00000339142;ENST00000311661;ENST00000354124;ENST00000392444;ENST00000392445	T;D;T	0.81659	-1.0;-1.52;-1.02	5.33	1.82	0.25136	Tumour necrosis factor-like (1);Complement C1q protein (2);	0.459560	0.23724	N	0.045183	T	0.64583	0.2611	L	0.34521	1.04	0.33892	D	0.637441	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.12837	0.008;0.008;0.008	T	0.54344	-0.8308	10	0.17369	T	0.5	.	4.8665	0.13611	0.4576:0.283:0.2593:0.0	.	153;153;143	A8K7L9;Q6ZMH6;Q9BXJ1	.;.;C1QT1_HUMAN	N	143;61;153;143;153	ENSP00000340864:S143N;ENSP00000311265:S61N;ENSP00000343230:S153N	ENSP00000311265:S61N	S	+	2	0	C1QTNF1	74555347	0.074000	0.21230	0.998000	0.56505	0.761000	0.43186	-0.455000	0.06762	0.032000	0.15435	-0.367000	0.07326	AGC		0.612	C1QTNF1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437388.2	NM_030968		Missense_Mutation
HK2	3099	genome.wustl.edu	37	2	75081576	75081576	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:75081576G>T	ENST00000290573.2	+	2	820	c.220G>T	c.(220-222)Ggg>Tgg	p.G74W	HK2_ENST00000409174.1_Missense_Mutation_p.G46W	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	74	Hexokinase type-1 1.|Regulatory.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)	p.G74W(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						CACTCCAGATGGGACAGGTAC	0.542																																																1	Substitution - Missense(1)	ovary(1)	2											89.0	84.0	85.0					2																	75081576		2203	4300	6503	74935084	SO:0001583	missense	3099				CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.220G>T	2.37:g.75081576G>T	ENSP00000290573:p.Gly74Trp		74935084	D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	ENST00000290573.2	37	CCDS1956.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358367	0.82243	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.99722	-6.53;-6.53	5.24	5.24	0.73138	Hexokinase, N-terminal (1);	0.056612	0.64402	D	0.000001	D	0.99862	0.9935	H	0.98918	4.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96559	0.9414	10	0.87932	D	0	-35.2519	16.3815	0.83462	0.0:0.0:1.0:0.0	.	74	P52789	HXK2_HUMAN	W	74;74;46	ENSP00000290573:G74W;ENSP00000387140:G46W	ENSP00000290573:G74W	G	+	1	0	HK2	74935084	1.000000	0.71417	0.992000	0.48379	0.906000	0.53458	9.263000	0.95617	2.724000	0.93272	0.561000	0.74099	GGG		0.542	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252238.2	NM_000189		Missense_Mutation
PPBP	5473	genome.wustl.edu	37	4	74853678	74853678	+	Missense_Mutation	SNP	C	C	A	rs373114326		TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr4:74853678C>A	ENST00000296028.3	-	1	236	c.143G>T	c.(142-144)gGc>gTc	p.G48V		NM_002704.3	NP_002695.1	P02775	CXCL7_HUMAN	pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)	48					blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|defense response to bacterium (GO:0042742)|glucose transport (GO:0015758)|immune response (GO:0006955)|leukocyte migration involved in inflammatory response (GO:0002523)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell division (GO:0051781)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)	glucose transmembrane transporter activity (GO:0005355)	p.G48V(1)		breast(1)|central_nervous_system(1)|lung(1)|ovary(2)|skin(2)|stomach(1)|urinary_tract(2)	10	Breast(15;0.00136)		all cancers(17;0.00273)|Lung(101;0.196)			TCTACCTTTGCCTTTCGCCAA	0.537																																																1	Substitution - Missense(1)	ovary(1)	4											138.0	129.0	132.0					4																	74853678		2203	4300	6503	75072542	SO:0001583	missense	5473			M54995	CCDS3563.1	4q12-q13	2013-02-25	2002-08-22		ENSG00000163736	ENSG00000163736		"""Endogenous ligands"""	9240	protein-coding gene	gene with protein product	"""platelet basic protein"", ""beta-thromboglobulin"", ""connective tissue-activating peptide III"", ""neutrophil-activating peptide-2"""	121010		THBGB1		1826003	Standard	NM_002704		Approved	SCYB7, TGB, NAP-2-L1, LA-PF4, MDGF, LDGF, Beta-TG, CTAP3, CXCL7, PBP, b-TG1, TGB1, CTAPIII, NAP-2	uc003hhj.3	P02775	OTTHUMG00000130008	ENST00000296028.3:c.143G>T	4.37:g.74853678C>A	ENSP00000296028:p.Gly48Val		75072542	B2R5F3|Q6IBJ8	Missense_Mutation	SNP	ENST00000296028.3	37	CCDS3563.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	4.844	0.156914	0.09236	.	.	ENSG00000163736	ENST00000296028	T	0.50001	0.76	2.23	-4.34	0.03666	Chemokine interleukin-8-like domain (1);	.	.	.	.	T	0.21718	0.0523	N	0.14661	0.345	0.09310	N	0.999998	B	0.19817	0.039	B	0.15052	0.012	T	0.12016	-1.0564	9	0.37606	T	0.19	.	1.078	0.01637	0.1549:0.3541:0.2366:0.2544	.	48	P02775	CXCL7_HUMAN	V	48	ENSP00000296028:G48V	ENSP00000296028:G48V	G	-	2	0	PPBP	75072542	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.801000	0.04550	-1.088000	0.03077	-0.494000	0.04653	GGC		0.537	PPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252281.2	NM_002704		Missense_Mutation
CSRP2	1466	genome.wustl.edu	37	12	77252746	77252746	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:77252746C>A	ENST00000311083.5	-	6	691	c.568G>T	c.(568-570)Gtt>Ttt	p.V190F	CSRP2_ENST00000546966.1_Missense_Mutation_p.V190F|CSRP2_ENST00000552330.1_Missense_Mutation_p.V240F	NM_001321.1	NP_001312.1	Q16527	CSRP2_HUMAN	cysteine and glycine-rich protein 2	190					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.V190F(1)		kidney(1)|large_intestine(4)|ovary(1)|prostate(1)|skin(1)	8						TGGGCATGAACAAGAGCCCCT	0.433																																																1	Substitution - Missense(1)	ovary(1)	12											96.0	95.0	95.0					12																	77252746		2203	4300	6503	75776877	SO:0001583	missense	1466			BC000992	CCDS9015.1	12q21.1	2005-10-30				ENSG00000175183			2470	protein-coding gene	gene with protein product		601871				7499425, 9286703	Standard	XM_006719258		Approved	SmLIM, CRP2, LMO5	uc001syl.1	Q16527		ENST00000311083.5:c.568G>T	12.37:g.77252746C>A	ENSP00000310901:p.Val190Phe		75776877	Q93030	Missense_Mutation	SNP	ENST00000311083.5	37	CCDS9015.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	23.8	4.456681	0.84317	.	.	ENSG00000175183	ENST00000311083;ENST00000552330;ENST00000546966	D;D;D	0.92397	-3.03;-3.03;-3.03	6.03	6.03	0.97812	.	0.451193	0.23591	N	0.046542	D	0.89983	0.6873	L	0.38175	1.15	0.80722	D	1	P	0.45011	0.848	B	0.41723	0.365	D	0.90220	0.4271	10	0.59425	D	0.04	-21.8977	20.5666	0.99351	0.0:1.0:0.0:0.0	.	190	Q16527	CSRP2_HUMAN	F	190;240;190	ENSP00000310901:V190F;ENSP00000449824:V240F;ENSP00000450056:V190F	ENSP00000310901:V190F	V	-	1	0	CSRP2	75776877	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	4.554000	0.60760	2.854000	0.98071	0.655000	0.94253	GTT		0.433	CSRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406572.1	NM_001321		Missense_Mutation
RORB	6096	genome.wustl.edu	37	9	77257495	77257495	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr9:77257495A>G	ENST00000396204.2	+	4	434	c.434A>G	c.(433-435)aAc>aGc	p.N145S	RORB_ENST00000376896.3_Missense_Mutation_p.N134S			Q92753	RORB_HUMAN	RAR-related orphan receptor B	145	Hinge. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.N134S(1)		breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	AGCAACCTGAACAACGAGACC	0.597																																																1	Substitution - Missense(1)	ovary(1)	9											122.0	99.0	106.0					9																	77257495		2203	4300	6503	76447315	SO:0001583	missense	6096			Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.434A>G	9.37:g.77257495A>G	ENSP00000379507:p.Asn145Ser		76447315	Q8WX73	Missense_Mutation	SNP	ENST00000396204.2	37		SNP	2	WashU	.	.	.	.	.	.	.	.	.	.	A	5.240	0.229713	0.09916	.	.	ENSG00000198963	ENST00000376896;ENST00000396204	D;D	0.93488	-3.22;-3.23	5.63	-2.82	0.05787	.	0.589252	0.20979	N	0.082256	D	0.84311	0.5444	N	0.25647	0.755	0.44188	D	0.997007	B;B	0.19331	0.035;0.033	B;B	0.17098	0.017;0.013	T	0.66712	-0.5854	10	0.09590	T	0.72	.	11.6213	0.51119	0.649:0.0:0.351:0.0	.	145;134	Q92753;Q58EY0	RORB_HUMAN;.	S	134;145	ENSP00000366093:N134S;ENSP00000379507:N145S	ENSP00000366093:N134S	N	+	2	0	RORB	76447315	0.995000	0.38212	0.041000	0.18516	0.947000	0.59692	1.383000	0.34385	-0.819000	0.04323	0.533000	0.62120	AAC		0.597	RORB-201	KNOWN	basic	protein_coding	protein_coding				Missense_Mutation
LPAR4	2846	genome.wustl.edu	37	X	78010950	78010950	+	Missense_Mutation	SNP	G	G	A	rs372050796		TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chrX:78010950G>A	ENST00000435339.3	+	2	970	c.584G>A	c.(583-585)cGt>cAt	p.R195H		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	195					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)	p.R195H(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						TTCTCCAAACGTGTCTGGAAG	0.418																																																1	Substitution - Missense(1)	ovary(1)	X											87.0	78.0	81.0					X																	78010950		2202	4299	6501	77897606	SO:0001583	missense	2846			U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.584G>A	X.37:g.78010950G>A	ENSP00000408205:p.Arg195His		77897606	B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	ENST00000435339.3	37	CCDS14441.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	14.42	2.529279	0.44969	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.37411	1.2;1.2	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.261041	0.37348	N	0.002130	T	0.32941	0.0846	N	0.16862	0.45	0.36077	D	0.842523	D	0.54772	0.968	P	0.51701	0.677	T	0.40270	-0.9572	10	0.36615	T	0.2	.	14.3788	0.66897	0.0:0.0:1.0:0.0	.	195	Q99677	LPAR4_HUMAN	H	195	ENSP00000408205:R195H;ENSP00000362398:R195H	ENSP00000362398:R195H	R	+	2	0	LPAR4	77897606	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.973000	0.49264	1.938000	0.56188	0.415000	0.27848	CGT		0.418	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296		Missense_Mutation
TENM4	26011	genome.wustl.edu	37	11	78387369	78387369	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:78387369C>T	ENST00000278550.7	-	30	5786	c.5324G>A	c.(5323-5325)gGc>gAc	p.G1775D		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1775					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.G1775D(1)									CACCTCCATGCCGTTGGCCAG	0.627																																																1	Substitution - Missense(1)	ovary(1)	11											28.0	35.0	33.0					11																	78387369		2149	4243	6392	78065017	SO:0001583	missense	26011			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5324G>A	11.37:g.78387369C>T	ENSP00000278550:p.Gly1775Asp		78065017	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	28.6	4.935833	0.92458	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.91521	-2.86;0.35	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.95541	0.8551	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95414	0.8501	9	.	.	.	.	18.2069	0.89858	0.0:1.0:0.0:0.0	.	1775	Q6N022	TEN4_HUMAN	D	1775;239	ENSP00000278550:G1775D;ENSP00000431711:G239D	.	G	-	2	0	ODZ4	78065017	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.593000	0.82686	2.584000	0.87258	0.650000	0.86243	GGC		0.627	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			Missense_Mutation
GAN	8139	genome.wustl.edu	37	16	81391420	81391420	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr16:81391420G>A	ENST00000568107.2	+	5	1019	c.857G>A	c.(856-858)cGg>cAg	p.R286Q		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	286					cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R286Q(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				CTTAGTTCACGGAAACCCACA	0.403																																					GBM(106;1239 1507 7582 9741 33976)											1	Substitution - Missense(1)	ovary(1)	16											176.0	157.0	164.0					16																	81391420		2202	4300	6502	79948921	SO:0001583	missense	8139			AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.857G>A	16.37:g.81391420G>A	ENSP00000476795:p.Arg286Gln		79948921		Missense_Mutation	SNP	ENST00000568107.2	37	CCDS10935.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	25.9	4.684729	0.88639	.	.	ENSG00000127688	ENST00000248272	T	0.66815	-0.23	5.83	5.83	0.93111	Galactose oxidase, beta-propeller (1);	0.000000	0.37219	U	0.002182	T	0.56001	0.1956	N	0.19112	0.55	0.80722	D	1	D	0.57571	0.98	P	0.44422	0.449	T	0.52373	-0.8584	10	0.13853	T	0.58	.	20.1197	0.97955	0.0:0.0:1.0:0.0	.	286	Q9H2C0	GAN_HUMAN	Q	286	ENSP00000248272:R286Q	ENSP00000248272:R286Q	R	+	2	0	GAN	79948921	1.000000	0.71417	1.000000	0.80357	0.353000	0.29299	9.610000	0.98337	2.755000	0.94549	0.557000	0.71058	CGG		0.403	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3			Missense_Mutation
BMP3	651	genome.wustl.edu	37	4	81967025	81967025	+	Silent	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr4:81967025A>G	ENST00000282701.2	+	2	770	c.450A>G	c.(448-450)ggA>ggG	p.G150G		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	150					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)	p.G150G(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						CAGTGTCTGGAGGATGCTCCC	0.448																																																1	Substitution - coding silent(1)	ovary(1)	4											124.0	108.0	113.0					4																	81967025		2203	4300	6503	82186049	SO:0001819	synonymous_variant	651			M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.450A>G	4.37:g.81967025A>G			82186049	Q4VAS5	Silent	SNP	ENST00000282701.2	37	CCDS3588.1	SNP	11	WashU																																																																																				0.448	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252634.1			Silent
ALPK3	57538	genome.wustl.edu	37	15	85400841	85400841	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr15:85400841G>C	ENST00000258888.5	+	6	3645	c.3478G>C	c.(3478-3480)Gat>Cat	p.D1160H		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1160					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.D1160H(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TGGCCTCATAGATTCCCTGAA	0.637																																																1	Substitution - Missense(1)	ovary(1)	15											44.0	50.0	48.0					15																	85400841		2203	4299	6502	83201845	SO:0001583	missense	57538			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.3478G>C	15.37:g.85400841G>C	ENSP00000258888:p.Asp1160His		83201845	Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	CCDS10333.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832089	0.71258	.	.	ENSG00000136383	ENST00000258888	T	0.66460	-0.21	5.17	5.17	0.71159	.	0.692719	0.13759	N	0.364684	T	0.74558	0.3732	L	0.32530	0.975	0.38348	D	0.944241	D	0.89917	1.0	D	0.85130	0.997	T	0.76812	-0.2821	10	0.87932	D	0	-18.2419	14.1715	0.65512	0.0:0.0:1.0:0.0	.	1160	Q96L96	ALPK3_HUMAN	H	1160	ENSP00000258888:D1160H	ENSP00000258888:D1160H	D	+	1	0	ALPK3	83201845	0.998000	0.40836	0.970000	0.41538	0.973000	0.67179	3.502000	0.53332	2.417000	0.82017	0.563000	0.77884	GAT		0.637	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778		Missense_Mutation
HELQ	113510	genome.wustl.edu	37	4	84337944	84337944	+	Silent	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr4:84337944G>C	ENST00000295488.3	-	17	3300	c.3138C>G	c.(3136-3138)ctC>ctG	p.L1046L	HELQ_ENST00000510985.1_Silent_p.L979L	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	1046					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.L1046L(1)		breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						TTGTCCTTACGAGCACTTCAG	0.368								Other identified genes with known or suspected DNA repair function																																								1	Substitution - coding silent(1)	ovary(1)	4											191.0	182.0	185.0					4																	84337944		2203	4300	6503	84556968	SO:0001819	synonymous_variant	113510			AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.3138C>G	4.37:g.84337944G>C			84556968	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Silent	SNP	ENST00000295488.3	37	CCDS3603.1	SNP	37	WashU																																																																																				0.368	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636		Silent
CEP290	80184	genome.wustl.edu	37	12	88465166	88465166	+	Silent	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:88465166A>G	ENST00000552810.1	-	43	6259	c.5916T>C	c.(5914-5916)gaT>gaC	p.D1972D	CEP290_ENST00000309041.7_Silent_p.D1974D|CEP290_ENST00000397838.3_Silent_p.D1032D|CEP290_ENST00000547691.2_Silent_p.D1032D	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1972					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.D1974D(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						CCAAAACCTGATCAACAGTCA	0.323																																																1	Substitution - coding silent(1)	ovary(1)	12											141.0	126.0	131.0					12																	88465166		1812	4075	5887	86989297	SO:0001819	synonymous_variant	80184			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.5916T>C	12.37:g.88465166A>G			86989297	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Silent	SNP	ENST00000552810.1	37	CCDS55858.1	SNP	12	WashU																																																																																				0.323	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114		Silent
C7orf62	219557	genome.wustl.edu	37	7	88423915	88423915	+	Silent	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:88423915A>G	ENST00000297203.2	-	2	527	c.342T>C	c.(340-342)taT>taC	p.Y114Y	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	114								p.Y114Y(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						CATGGCCAATATAATCTAAAA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	7											54.0	55.0	55.0					7																	88423915		2203	4300	6503	88261851	SO:0001819	synonymous_variant	219557			BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.342T>C	7.37:g.88423915A>G			88261851		Silent	SNP	ENST00000297203.2	37	CCDS34678.1	SNP	16	WashU																																																																																				0.373	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332714.1	NM_152706		Silent
RRAGD	58528	genome.wustl.edu	37	6	90089026	90089026	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:90089026T>C	ENST00000369415.4	-	4	952	c.676A>G	c.(676-678)Ata>Gta	p.I226V	RRAGD_ENST00000492783.1_5'UTR|RRAGD_ENST00000359203.3_Missense_Mutation_p.I75V	NM_021244.4	NP_067067.1			Ras-related GTP binding D									p.I226V(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(2)	15		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		BRCA - Breast invasive adenocarcinoma(108;0.0144)		GCTTCAAATATTGAATGATCA	0.353																																																1	Substitution - Missense(1)	ovary(1)	6											79.0	81.0	80.0					6																	90089026		2203	4300	6503	90145745	SO:0001583	missense	58528			AF272036	CCDS5022.1	6q15-q16	2008-02-05			ENSG00000025039	ENSG00000025039			19903	protein-coding gene	gene with protein product		608268				11073942	Standard	NM_021244		Approved	DKFZP761H171, bA11D8.2.1	uc003pnd.4	Q9NQL2	OTTHUMG00000015200	ENST00000369415.4:c.676A>G	6.37:g.90089026T>C	ENSP00000358423:p.Ile226Val		90145745		Missense_Mutation	SNP	ENST00000369415.4	37	CCDS5022.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	19.88	3.908968	0.72868	.	.	ENSG00000025039	ENST00000369415;ENST00000359203	D;D	0.82255	-1.59;-1.59	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.81118	0.4756	L	0.52266	1.64	0.80722	D	1	P	0.48764	0.915	P	0.53518	0.728	T	0.79092	-0.1945	10	0.25751	T	0.34	-19.8113	16.4075	0.83691	0.0:0.0:0.0:1.0	.	226	Q9NQL2	RRAGD_HUMAN	V	226;75	ENSP00000358423:I226V;ENSP00000352131:I75V	ENSP00000352131:I75V	I	-	1	0	RRAGD	90145745	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.275000	0.75901	0.528000	0.53228	ATA		0.353	RRAGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041484.1	NM_021244		Missense_Mutation
S1PR3	1903	genome.wustl.edu	37	9	91617047	91617047	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr9:91617047G>T	ENST00000375846.3	+	1	5627	c.932G>T	c.(931-933)cGt>cTt	p.R311L	S1PR3_ENST00000358157.2_Missense_Mutation_p.R311L			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	311					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.R311L(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						GCCTTCTTCCGTCTGGTCTGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	9											47.0	43.0	44.0					9																	91617047		2203	4300	6503	90806867	SO:0001583	missense	1903			AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.932G>T	9.37:g.91617047G>T	ENSP00000365006:p.Arg311Leu		90806867	Q5SQD8|Q7Z5I2	Missense_Mutation	SNP	ENST00000375846.3	37	CCDS6680.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611720	0.66558	.	.	ENSG00000213694	ENST00000358157;ENST00000375846	T;T	0.40225	1.04;1.04	5.15	4.23	0.50019	.	0.316092	0.32002	N	0.006727	T	0.49898	0.1584	M	0.64567	1.98	0.46260	D	0.998957	D	0.54207	0.965	P	0.50049	0.629	T	0.55560	-0.8122	10	0.72032	D	0.01	.	14.2324	0.65903	0.0734:0.0:0.9266:0.0	.	311	Q99500	S1PR3_HUMAN	L	311	ENSP00000350878:R311L;ENSP00000365006:R311L	ENSP00000350878:R311L	R	+	2	0	S1PR3	90806867	1.000000	0.71417	0.960000	0.40013	0.487000	0.33371	3.815000	0.55651	2.683000	0.91414	0.313000	0.20887	CGT		0.607	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2	NM_005226		Missense_Mutation
CCDC88C	440193	genome.wustl.edu	37	14	91772241	91772241	+	Silent	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	G	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr14:91772241C>G	ENST00000389857.6	-	19	3311	c.3225G>C	c.(3223-3225)ctG>ctC	p.L1075L		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1075					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)	p.L1075L(1)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GTTCCTTTAGCAGCTGCTTCT	0.537																																																1	Substitution - coding silent(1)	ovary(1)	14											78.0	77.0	77.0					14																	91772241		2052	4191	6243	90841994	SO:0001819	synonymous_variant	440193				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.3225G>C	14.37:g.91772241C>G			90841994	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	37	CCDS45151.1	SNP	25	WashU																																																																																				0.537	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		Silent
FAT3	120114	genome.wustl.edu	37	11	92085950	92085950	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:92085950G>T	ENST00000298047.6	+	1	689	c.672G>T	c.(670-672)aaG>aaT	p.K224N	FAT3_ENST00000525166.1_Missense_Mutation_p.K74N|FAT3_ENST00000409404.2_Missense_Mutation_p.K224N|FAT3_ENST00000541502.1_Missense_Mutation_p.K224N			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	224	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K224N(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATGATGAAAAGAATAGGTATG	0.388										TCGA Ovarian(4;0.039)																																						2	Substitution - Missense(2)	large_intestine(2)	11											119.0	113.0	115.0					11																	92085950		1855	4102	5957	91725598	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.672G>T	11.37:g.92085950G>T	ENSP00000298047:p.Lys224Asn		91725598	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109088	0.37242	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.15	4.23	0.50019	.	.	.	.	.	T	0.37598	0.1009	N	0.25890	0.77	0.27808	N	0.942236	P	0.44627	0.839	P	0.46543	0.52	T	0.15492	-1.0435	9	0.37606	T	0.19	.	5.4549	0.16584	0.1846:0.1671:0.6484:0.0	.	224	Q8TDW7-3	.	N	224;224;224;74	ENSP00000298047:K224N;ENSP00000387040:K224N;ENSP00000443786:K224N;ENSP00000432586:K74N	ENSP00000298047:K224N	K	+	3	2	FAT3	91725598	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	1.459000	0.35234	1.281000	0.44480	0.655000	0.94253	AAG		0.388	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		Missense_Mutation
PLXNC1	10154	genome.wustl.edu	37	12	94575306	94575306	+	Missense_Mutation	SNP	G	G	A	rs533262461		TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:94575306G>A	ENST00000258526.4	+	3	1537	c.1288G>A	c.(1288-1290)Gtt>Att	p.V430I	RP11-74K11.2_ENST00000550759.1_RNA	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	430	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)	p.V430I(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CTACAAACTCGTTCCTGATCC	0.313																																																1	Substitution - Missense(1)	ovary(1)	12											97.0	108.0	105.0					12																	94575306		2203	4300	6503	93099437	SO:0001583	missense	10154			AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.1288G>A	12.37:g.94575306G>A	ENSP00000258526:p.Val430Ile		93099437	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	CCDS9049.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	9.273	1.046206	0.19748	.	.	ENSG00000136040	ENST00000258526;ENST00000551850	T;T	0.04502	3.61;3.61	6.08	4.28	0.50868	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.698869	0.15271	N	0.271252	T	0.04543	0.0124	L	0.34521	1.04	0.80722	D	1	B	0.17268	0.021	B	0.04013	0.001	T	0.39121	-0.9629	10	0.19147	T	0.46	.	10.4697	0.44629	0.1516:0.0:0.8484:0.0	.	430	O60486	PLXC1_HUMAN	I	430;46	ENSP00000258526:V430I;ENSP00000447843:V46I	ENSP00000258526:V430I	V	+	1	0	PLXNC1	93099437	0.975000	0.34042	0.787000	0.31911	0.359000	0.29487	1.615000	0.36922	0.922000	0.37019	0.591000	0.81541	GTT		0.313	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2			Missense_Mutation
MANEA	79694	genome.wustl.edu	37	6	96034488	96034488	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:96034488A>T	ENST00000358812.4	+	2	307	c.173A>T	c.(172-174)aAt>aTt	p.N58I	MANEA_ENST00000369293.1_Missense_Mutation_p.N58I	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	58					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)	p.N58I(1)		breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		TTGGGGAAAAATTTTGATTTC	0.353																																																1	Substitution - Missense(1)	ovary(1)	6											79.0	81.0	80.0					6																	96034488		2203	4300	6503	96141209	SO:0001583	missense	79694			AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.173A>T	6.37:g.96034488A>T	ENSP00000351669:p.Asn58Ile		96141209	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Missense_Mutation	SNP	ENST00000358812.4	37	CCDS5032.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	2.606	-0.291779	0.05568	.	.	ENSG00000172469	ENST00000358812;ENST00000369293;ENST00000542500	.	.	.	5.58	-11.2	0.00127	.	1.615210	0.02944	N	0.140904	T	0.01940	0.0061	N	0.02011	-0.69	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.08055	0.001;0.003	T	0.21621	-1.0240	9	0.36615	T	0.2	-0.022	0.2847	0.00249	0.3541:0.1536:0.1919:0.3004	.	58;58	Q5SRI9;Q8WWX4	MANEA_HUMAN;.	I	58	.	ENSP00000351669:N58I	N	+	2	0	MANEA	96141209	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	-0.253000	0.08794	-2.763000	0.00369	-1.219000	0.01604	AAT		0.353	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043644.1	NM_024641		Missense_Mutation
ASNS	440	genome.wustl.edu	37	7	97482384	97482384	+	Nonsense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:97482384G>C	ENST00000394309.3	-	12	1935	c.1464C>G	c.(1462-1464)taC>taG	p.Y488*	ASNS_ENST00000394308.3_Nonsense_Mutation_p.Y488*|ASNS_ENST00000422745.1_Nonsense_Mutation_p.Y467*|ASNS_ENST00000437628.1_Nonsense_Mutation_p.Y405*|ASNS_ENST00000455086.1_Nonsense_Mutation_p.Y405*|ASNS_ENST00000175506.4_Nonsense_Mutation_p.Y488*|ASNS_ENST00000444334.1_Nonsense_Mutation_p.Y467*	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	488	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)	p.Y488*(2)		ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	GATGTTCAACGTATTCCTGTA	0.353																																					Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)											2	Substitution - Nonsense(2)	ovary(2)	7											39.0	37.0	38.0					7																	97482384		2203	4299	6502	97320320	SO:0001587	stop_gained	440			M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1464C>G	7.37:g.97482384G>C	ENSP00000377846:p.Tyr488*		97320320	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Nonsense_Mutation	SNP	ENST00000394309.3	37	CCDS5652.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	39	7.372672	0.98241	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000437628;ENST00000394308;ENST00000422745;ENST00000455086;ENST00000444334	.	.	.	3.63	-3.07	0.05363	.	0.318671	0.34156	N	0.004209	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.6364	10.0663	0.42306	0.5217:0.0:0.4783:0.0	.	.	.	.	X	488;488;405;488;467;405;467	.	ENSP00000175506:Y488X	Y	-	3	2	ASNS	97320320	0.182000	0.23173	0.008000	0.14137	0.839000	0.47603	0.229000	0.17833	-0.636000	0.05524	-1.191000	0.01696	TAC		0.353	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356		Nonsense_Mutation
LMTK2	22853	genome.wustl.edu	37	7	97833389	97833389	+	Silent	SNP	G	G	A	rs542059077	byFrequency	TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:97833389G>A	ENST00000297293.5	+	13	4667	c.4374G>A	c.(4372-4374)acG>acA	p.T1458T		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1458				Missing (in Ref. 2; BAA83031). {ECO:0000305}.	early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					CCCGGAGCACGGAGCAGAGCT	0.572													G|||	3	0.000599042	0.0008	0.0	5008	,	,		14903	0.002		0.0	False		,,,				2504	0.0															0			7											81.0	90.0	87.0					7																	97833389		2203	4300	6503	97671325	SO:0001819	synonymous_variant	22853			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.4374G>A	7.37:g.97833389G>A			97671325	A4D272|Q75MG7|Q9UPS3	Silent	SNP	ENST00000297293.5	37	CCDS5654.1	SNP	39	WashU																																																																																				0.572	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916		Silent
SCYL2	55681	genome.wustl.edu	37	12	100708360	100708360	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:100708360G>A	ENST00000360820.2	+	8	1500	c.1063G>A	c.(1063-1065)Gga>Aga	p.G355R		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	355					endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)	p.G355R(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						GTTTTTCAAAGGACTGCCAAA	0.313																																																1	Substitution - Missense(1)	ovary(1)	12											66.0	66.0	66.0					12																	100708360		2203	4297	6500	99232491	SO:0001583	missense	55681			AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.1063G>A	12.37:g.100708360G>A	ENSP00000354061:p.Gly355Arg		99232491	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	ENST00000360820.2	37	CCDS9076.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349223	0.61183	.	.	ENSG00000136021	ENST00000549687;ENST00000258506;ENST00000360820	T;T	0.32753	1.44;1.44	5.43	5.43	0.79202	Armadillo-like helical (1);Protein kinase-like domain (1);Armadillo-type fold (1);	0.097529	0.64402	D	0.000001	T	0.35770	0.0943	M	0.66939	2.045	0.80722	D	1	B	0.33477	0.413	B	0.29077	0.098	T	0.17684	-1.0361	10	0.45353	T	0.12	.	19.6166	0.95636	0.0:0.0:1.0:0.0	.	355	Q6P3W7	SCYL2_HUMAN	R	355;182;355	ENSP00000448366:G355R;ENSP00000354061:G355R	ENSP00000258506:G182R	G	+	1	0	SCYL2	99232491	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.701000	0.84566	2.721000	0.93114	0.655000	0.94253	GGA		0.313	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2	NM_017988		Missense_Mutation
OR5H7P	79291	genome.wustl.edu	37	3	97957389	97957389	+	lincRNA	SNP	G	G	C	rs528613842		TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr3:97957389G>C	ENST00000508616.1	+	0	26																		p.S26T(1)									TTCCGTGGGAGTTTGGCCTTT	0.413																																																1	Substitution - Missense(1)	ovary(1)	3																																								99440079																																		3.37:g.97957389G>C			99440079		Missense_Mutation	SNP	ENST00000508616.1	37		SNP	36	WashU																																																																																				0.413	RP11-325B23.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000359282.1			Missense_Mutation
TAF6	6878	genome.wustl.edu	37	7	99709850	99709850	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:99709850G>T	ENST00000344095.4	-	7	1126	c.601C>A	c.(601-603)Ctg>Atg	p.L201M	TAF6_ENST00000472509.1_Missense_Mutation_p.L258M|TAF6_ENST00000453269.2_Missense_Mutation_p.L201M|TAF6_ENST00000497233.1_5'Flank|TAF6_ENST00000452041.1_Missense_Mutation_p.L201M|RP11-506M12.1_ENST00000494221.1_RNA|TAF6_ENST00000418432.2_Missense_Mutation_p.L125M|TAF6_ENST00000437822.2_Missense_Mutation_p.L238M	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	201					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L201M(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCCCCCTCCAGCAAGGGCGGC	0.567																																																1	Substitution - Missense(1)	ovary(1)	7											28.0	36.0	34.0					7																	99709850		2202	4300	6502	99547786	SO:0001583	missense	6878				CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.601C>A	7.37:g.99709850G>T	ENSP00000344537:p.Leu201Met		99547786	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Missense_Mutation	SNP	ENST00000344095.4	37	CCDS5686.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423324	0.62733	.	.	ENSG00000106290	ENST00000453269;ENST00000472509;ENST00000452041;ENST00000344095;ENST00000418432;ENST00000437822;ENST00000493322;ENST00000440225	T;T;T;T;T;T;T	0.45668	0.9;0.89;0.9;0.9;0.9;0.96;0.94	4.99	4.11	0.48088	.	0.469100	0.19100	N	0.122740	T	0.44561	0.1299	L	0.34521	1.04	0.31409	N	0.675751	D;D;D;D;D;D	0.63880	0.987;0.993;0.987;0.978;0.993;0.987	P;P;P;P;P;P	0.59221	0.719;0.854;0.719;0.706;0.719;0.7	T	0.48969	-0.8987	10	0.46703	T	0.11	-13.6225	7.7042	0.28640	0.1865:0.0:0.8134:0.0	.	238;201;191;201;201;125	B4DT11;P49848-2;A4D299;P49848;C9JTY6;B3KUR4	.;.;.;TAF6_HUMAN;.;.	M	201;258;201;201;125;238;201;182	ENSP00000389575:L201M;ENSP00000419760:L258M;ENSP00000416396:L201M;ENSP00000344537:L201M;ENSP00000399982:L238M;ENSP00000419555:L201M;ENSP00000410012:L182M	ENSP00000344537:L201M	L	-	1	2	TAF6	99547786	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	4.860000	0.62961	1.319000	0.45190	0.563000	0.77884	CTG		0.567	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641		Missense_Mutation
LRCH4	4034	genome.wustl.edu	37	7	100173896	100173896	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:100173896G>T	ENST00000310300.6	-	15	1655	c.1603C>A	c.(1603-1605)Cca>Aca	p.P535T	SAP25_ENST00000538735.1_5'Flank|LRCH4_ENST00000497245.1_Missense_Mutation_p.P83T	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4	535	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				nervous system development (GO:0007399)	PML body (GO:0016605)		p.P535T(1)		NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTCTCATCTGGAACCTGGGGG	0.632																																																1	Substitution - Missense(1)	ovary(1)	7											34.0	36.0	35.0					7																	100173896		2203	4300	6503	100011832	SO:0001583	missense	4034			AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.1603C>A	7.37:g.100173896G>T	ENSP00000309689:p.Pro535Thr		100011832	A4D2D5|Q8WV85|Q96ID0	Missense_Mutation	SNP	ENST00000310300.6	37	CCDS34706.1	SNP	41	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.470|1.470	-0.560200|-0.560200	0.03939|0.03939	.|.	.|.	ENSG00000077454|ENSG00000077454	ENST00000485554|ENST00000310300;ENST00000497245	.|T;T	.|0.45276	.|1.5;0.9	4.14|4.14	1.08|1.08	0.20341|0.20341	.|Calponin homology domain (1);	.|0.891443	.|0.09738	.|N	.|0.762221	T|T	0.20618|0.20618	0.0496|0.0496	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B	.|0.28713	.|0.017;0.22	.|B;B	.|0.28139	.|0.01;0.086	T|T	0.20974|0.20974	-1.0259|-1.0259	5|10	.|0.54805	.|T	.|0.06	0.5773|0.5773	3.732|3.732	0.08496|0.08496	0.2312:0.2073:0.5615:0.0|0.2312:0.2073:0.5615:0.0	.|.	.|83;535	.|C9JYK0;O75427	.|.;LRCH4_HUMAN	L|T	59|535;83	.|ENSP00000309689:P535T;ENSP00000419870:P83T	.|ENSP00000309689:P535T	F|P	-|-	3|1	2|0	LRCH4|LRCH4	100011832|100011832	0.000000|0.000000	0.05858|0.05858	0.020000|0.020000	0.16555|0.16555	0.101000|0.101000	0.19017|0.19017	0.193000|0.193000	0.17116|0.17116	0.518000|0.518000	0.28383|0.28383	0.555000|0.555000	0.69702|0.69702	TTC|CCA		0.632	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356110.1	NM_002319		Missense_Mutation
FBXO24	26261	genome.wustl.edu	37	7	100187937	100187937	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:100187937G>C	ENST00000241071.6	+	3	601	c.279G>C	c.(277-279)caG>caC	p.Q93H	FBXO24_ENST00000427939.2_Missense_Mutation_p.Q131H|FBXO24_ENST00000360609.2_Splice_Site_p.Q93H|PCOLCE-AS1_ENST00000442166.2_RNA|PCOLCE-AS1_ENST00000544873.1_RNA|FBXO24_ENST00000468962.1_Missense_Mutation_p.Q81H|FBXO24_ENST00000498195.1_3'UTR|FBXO24_ENST00000465843.1_Splice_Site_p.Q93H	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24	93					protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.Q93H(1)		NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					TCCAAGATCAGGGTTCTGGAG	0.607																																																1	Substitution - Missense(1)	ovary(1)	7											59.0	51.0	54.0					7																	100187937		2203	4300	6503	100025873	SO:0001583	missense	26261			AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.279G>C	7.37:g.100187937G>C	ENSP00000241071:p.Gln93His		100025873	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	ENST00000241071.6	37	CCDS5698.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628640	0.46944	.	.	ENSG00000106336	ENST00000461079;ENST00000241071;ENST00000360609;ENST00000465843;ENST00000466053;ENST00000468962;ENST00000427939	T;T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58;0.58	4.66	4.66	0.58398	F-box domain, Skp2-like (1);	0.265146	0.27759	N	0.017962	T	0.34687	0.0906	N	0.08118	0	0.41271	D	0.986846	B;B;B;B	0.09022	0.001;0.001;0.001;0.002	B;B;B;B	0.09377	0.001;0.001;0.001;0.004	T	0.25293	-1.0136	10	0.66056	D	0.02	-17.3398	15.1425	0.72620	0.0:0.0:1.0:0.0	.	81;131;93;93	B4DY42;B4DX91;O75426;O75426-2	.;.;FBX24_HUMAN;.	H	116;93;93;93;98;81;131	ENSP00000419587:Q116H;ENSP00000241071:Q93H;ENSP00000353821:Q93H;ENSP00000419602:Q93H;ENSP00000417179:Q98H;ENSP00000420239:Q81H;ENSP00000416558:Q131H	ENSP00000241071:Q93H	Q	+	3	2	FBXO24	100025873	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	0.811000	0.27198	2.427000	0.82271	0.456000	0.33151	CAG		0.607	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1			Missense_Mutation
LRRC39	127495	genome.wustl.edu	37	1	100618068	100618068	+	Silent	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:100618068G>A	ENST00000370137.1	-	9	1023	c.825C>T	c.(823-825)ttC>ttT	p.F275F	LRRC39_ENST00000342895.3_Silent_p.F275F|LRRC39_ENST00000370138.1_Silent_p.F275F	NM_001256386.1|NM_144620.3	NP_001243315.1|NP_653221.1	Q96DD0	LRC39_HUMAN	leucine rich repeat containing 39	275								p.F275F(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	13		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0826)|all cancers(265;0.135)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		GGTTGTCTCTGAAGTTGACAA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	1											107.0	102.0	104.0					1																	100618068		2203	4300	6503	100390656	SO:0001819	synonymous_variant	127495			AK096892	CCDS766.1, CCDS58014.1	1p21.3	2008-02-05			ENSG00000122477	ENSG00000122477			28228	protein-coding gene	gene with protein product						12975309	Standard	NM_001256385		Approved	MGC14816	uc001dsx.2	Q96DD0	OTTHUMG00000010839	ENST00000370137.1:c.825C>T	1.37:g.100618068G>A			100390656	B3KUD2|D3DT56|Q5VVK7	Silent	SNP	ENST00000370137.1	37	CCDS766.1	SNP	45	WashU																																																																																				0.373	LRRC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029917.2	NM_144620		Silent
MUC17	140453	genome.wustl.edu	37	7	100683992	100683992	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:100683992A>T	ENST00000306151.4	+	3	9359	c.9295A>T	c.(9295-9297)Act>Tct	p.T3099S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3099	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T3099S(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCCAATCTCAACTTATAGTGA	0.488																																																1	Substitution - Missense(1)	ovary(1)	7											262.0	266.0	265.0					7																	100683992		2203	4300	6503	100470712	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9295A>T	7.37:g.100683992A>T	ENSP00000302716:p.Thr3099Ser		100470712	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	2	WashU	.	.	.	.	.	.	.	.	.	.	a	9.280	1.047996	0.19827	.	.	ENSG00000169876	ENST00000306151	T	0.03441	3.93	1.15	-0.369	0.12534	.	.	.	.	.	T	0.05090	0.0136	N	0.24115	0.695	0.09310	N	1	P	0.46578	0.88	P	0.62184	0.899	T	0.39078	-0.9631	9	0.16420	T	0.52	.	2.1865	0.03888	0.4497:0.3258:0.2246:0.0	.	3099	Q685J3	MUC17_HUMAN	S	3099	ENSP00000302716:T3099S	ENSP00000302716:T3099S	T	+	1	0	MUC17	100470712	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-3.322000	0.00513	-0.071000	0.12886	0.102000	0.15555	ACT		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Missense_Mutation
NPAS2	4862	genome.wustl.edu	37	2	101564740	101564740	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:101564740A>G	ENST00000335681.5	+	6	692	c.407A>G	c.(406-408)cAa>cGa	p.Q136R	NPAS2_ENST00000542504.1_Missense_Mutation_p.Q201R|NPAS2_ENST00000486017.1_3'UTR	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	136	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.Q136R(2)		cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTCCCAGAACAAGAACATTCA	0.358																																																2	Substitution - Missense(2)	ovary(2)	2											113.0	110.0	111.0					2																	101564740		2203	4300	6503	100931172	SO:0001583	missense	4862			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.407A>G	2.37:g.101564740A>G	ENSP00000338283:p.Gln136Arg		100931172	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	ENST00000335681.5	37	CCDS2048.1	SNP	5	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.26|13.26	2.184786|2.184786	0.38609|0.38609	.|.	.|.	ENSG00000170485|ENSG00000170485	ENST00000427413|ENST00000335681;ENST00000542504	.|T;T	.|0.16324	.|2.35;2.35	4.97|4.97	4.97|4.97	0.65823|0.65823	.|PAS (3);PAS fold (1);	.|0.060448	.|0.64402	.|D	.|0.000002	T|T	0.08179|0.08179	0.0204|0.0204	N|N	0.03238|0.03238	-0.38|-0.38	0.45490|0.45490	D|D	0.99845|0.99845	.|B;B	.|0.23442	.|0.069;0.085	.|B;B	.|0.24155	.|0.051;0.03	T|T	0.29427|0.29427	-1.0012|-1.0012	5|10	.|0.13108	.|T	.|0.6	.|.	14.8137|14.8137	0.70013|0.70013	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|201;136	.|F5H027;Q99743	.|.;NPAS2_HUMAN	E|R	202|136;201	.|ENSP00000338283:Q136R;ENSP00000438428:Q201R	.|ENSP00000338283:Q136R	K|Q	+|+	1|2	0|0	NPAS2|NPAS2	100931172|100931172	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.293000|6.293000	0.72731|0.72731	2.077000|2.077000	0.62373|0.62373	0.528000|0.528000	0.53228|0.53228	AAG|CAA		0.358	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3			Missense_Mutation
GPR128	84873	genome.wustl.edu	37	3	100413790	100413790	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr3:100413790C>T	ENST00000273352.3	+	16	2607	c.2339C>T	c.(2338-2340)cCg>cTg	p.P780L	GPR128_ENST00000481506.1_3'UTR|GPR128_ENST00000475887.1_Missense_Mutation_p.P485L	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	780					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P780L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						GAAACCTCTCCGAGTACTGAG	0.443																																					Pancreas(87;185 1975 7223 18722)											1	Substitution - Missense(1)	ovary(1)	3											124.0	119.0	120.0					3																	100413790		2203	4300	6503	101896480	SO:0001583	missense	84873			AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.2339C>T	3.37:g.100413790C>T	ENSP00000273352:p.Pro780Leu		101896480	Q14D94|Q86SQ2	Missense_Mutation	SNP	ENST00000273352.3	37	CCDS2938.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	c	2.432	-0.330558	0.05314	.	.	ENSG00000144820	ENST00000273352;ENST00000475887	T;T	0.38240	1.15;1.51	5.2	-10.4	0.00318	.	16.475400	0.00166	N	0.000000	T	0.11196	0.0273	N	0.04959	-0.14	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25813	-1.0121	10	0.07325	T	0.83	.	1.1229	0.01728	0.3686:0.2922:0.1868:0.1524	.	485;780	E9PHI0;Q96K78	.;GP128_HUMAN	L	780;485	ENSP00000273352:P780L;ENSP00000419788:P485L	ENSP00000273352:P780L	P	+	2	0	GPR128	101896480	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.539000	0.00219	-2.785000	0.00359	-4.252000	0.00008	CCG		0.443	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353236.1			Missense_Mutation
STAB2	55576	genome.wustl.edu	37	12	104054121	104054121	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:104054121C>T	ENST00000388887.2	+	16	1951	c.1747C>T	c.(1747-1749)Ctt>Ttt	p.L583F	RP11-341G23.2_ENST00000551905.1_RNA	NM_017564.9	NP_060034.9			stabilin 2									p.L583F(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						ATCTCGGAAGCTTCTGGAACT	0.438																																																1	Substitution - Missense(1)	ovary(1)	12											237.0	238.0	238.0					12																	104054121		2203	4300	6503	102578251	SO:0001583	missense	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.1747C>T	12.37:g.104054121C>T	ENSP00000373539:p.Leu583Phe		102578251		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626284	0.87560	.	.	ENSG00000136011	ENST00000388887	D	0.93712	-3.27	5.99	5.99	0.97316	FAS1 domain (5);	0.000000	0.85682	D	0.000000	D	0.97467	0.9171	M	0.90759	3.145	0.49389	D	0.999787	D	0.89917	1.0	D	0.97110	1.0	D	0.97636	1.0145	10	0.72032	D	0.01	.	19.2492	0.93917	0.0:1.0:0.0:0.0	.	583	Q8WWQ8	STAB2_HUMAN	F	583	ENSP00000373539:L583F	ENSP00000373539:L583F	L	+	1	0	STAB2	102578251	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.386000	0.59620	2.840000	0.97914	0.655000	0.94253	CTT		0.438	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			Missense_Mutation
TDG	6996	genome.wustl.edu	37	12	104376702	104376702	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:104376702G>T	ENST00000392872.3	+	5	838	c.604G>T	c.(604-606)Gat>Tat	p.D202Y	AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000542036.1_Missense_Mutation_p.K25N|TDG_ENST00000544861.1_Missense_Mutation_p.D59Y|TDG_ENST00000266775.9_Missense_Mutation_p.D198Y	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase	202					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)	p.D202Y(1)		large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		CGGCAGCAAAGATCTCTCCAG	0.453								Base excision repair (BER), DNA glycosylases																																								1	Substitution - Missense(1)	ovary(1)	12											80.0	77.0	78.0					12																	104376702		2203	4300	6503	102900832	SO:0001583	missense	6996			U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.604G>T	12.37:g.104376702G>T	ENSP00000376611:p.Asp202Tyr		102900832	Q8IUZ6|Q8IZM3	Missense_Mutation	SNP	ENST00000392872.3	37	CCDS9095.1	SNP	33	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.64|18.64	3.667285|3.667285	0.67814|0.67814	.|.	.|.	ENSG00000139372|ENSG00000139372	ENST00000392872;ENST00000266775;ENST00000544861;ENST00000537100|ENST00000542036	T;T;T;T|T	0.49139|0.22539	0.79;0.79;0.79;0.79|1.95	5.4|5.4	5.4|5.4	0.78164|0.78164	Uracil-DNA glycosylase-like (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.36991|0.36991	0.0987|0.0987	M|M	0.89095|0.89095	3.005|3.005	0.38388|0.38388	D|D	0.945323|0.945323	D;D|B	0.89917|0.18741	1.0;1.0|0.03	D;D|B	0.91635|0.12837	0.999;0.994|0.008	T|T	0.44620|0.44620	-0.9316|-0.9316	10|9	0.87932|0.87932	D|D	0|0	-33.6241|-33.6241	19.1762|19.1762	0.93603|0.93603	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	202;202|25	B2R848;Q13569|B4DI29	.;TDG_HUMAN|.	Y|N	202;198;59;195|25	ENSP00000376611:D202Y;ENSP00000266775:D198Y;ENSP00000445899:D59Y;ENSP00000439825:D195Y|ENSP00000439054:K25N	ENSP00000266775:D198Y|ENSP00000439054:K25N	D|K	+|+	1|3	0|2	TDG|TDG	102900832|102900832	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.724000|0.724000	0.41520|0.41520	9.796000|9.796000	0.99103|0.99103	2.518000|2.518000	0.84900|0.84900	0.563000|0.563000	0.77884|0.77884	GAT|AAG		0.453	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2			Missense_Mutation
ZCCHC18	644353	genome.wustl.edu	37	X	103359003	103359003	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chrX:103359003A>T	ENST00000537356.3	+	2	1615	c.201A>T	c.(199-201)caA>caT	p.Q67H	ZCCHC18_ENST00000422784.1_Intron|SLC25A53_ENST00000357421.4_Intron			P0CG32	ZCC18_HUMAN	zinc finger, CCHC domain containing 18	67							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)										GGCTGATCCAAGTCAATGAGG	0.498																																																0			X											69.0	57.0	61.0					X																	103359003		692	1591	2283	103245659	SO:0001583	missense	644353			AF086548	CCDS65304.1	Xq22.2	2013-01-31	2009-02-03		ENSG00000166707	ENSG00000166707		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	32459	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7B"""		"""zinc finger, CCHC domain containing 12 pseudogene 1"""				Standard	NM_001143978		Approved	SIZN2, PNMA7B	uc011msh.2	P0CG32	OTTHUMG00000022123	ENST00000537356.3:c.201A>T	X.37:g.103359003A>T	ENSP00000473824:p.Gln67His		103245659		Missense_Mutation	SNP	ENST00000537356.3	37		SNP	3	WashU																																																																																				0.498	ZCCHC18-006	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471686.1	NM_001143978		Missense_Mutation
INA	9118	genome.wustl.edu	37	10	105048223	105048223	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr10:105048223A>C	ENST00000369849.4	+	3	1346	c.1297A>C	c.(1297-1299)Agt>Cgt	p.S433R		NM_032727.3	NP_116116.1	Q16352	AINX_HUMAN	internexin neuronal intermediate filament protein, alpha	433	Tail.				cell differentiation (GO:0030154)|neurofilament cytoskeleton organization (GO:0060052)|substantia nigra development (GO:0021762)	cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular space (GO:0005615)|neurofilament (GO:0005883)	structural constituent of cytoskeleton (GO:0005200)	p.S433R(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)	13				Epithelial(162;3.45e-09)|all cancers(201;9.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		TAGAATCCTCAGTGCTACAAC	0.507																																																1	Substitution - Missense(1)	ovary(1)	10											123.0	118.0	120.0					10																	105048223		2203	4300	6503	105038213	SO:0001583	missense	9118			S78296	CCDS7545.1	10q24	2013-01-16			ENSG00000148798	ENSG00000148798		"""Intermediate filaments type IV"""	6057	protein-coding gene	gene with protein product		605338		NEF5		7769995	Standard	NM_032727		Approved	NF-66	uc001kws.3	Q16352	OTTHUMG00000018986	ENST00000369849.4:c.1297A>C	10.37:g.105048223A>C	ENSP00000358865:p.Ser433Arg		105038213	B1AQK0|Q9BRC5	Missense_Mutation	SNP	ENST00000369849.4	37	CCDS7545.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	17.98	3.521039	0.64747	.	.	ENSG00000148798	ENST00000369849	D	0.83506	-1.73	5.17	5.17	0.71159	.	0.104186	0.64402	D	0.000007	T	0.73598	0.3607	N	0.24115	0.695	0.46376	D	0.999016	B	0.02656	0.0	B	0.01281	0.0	T	0.70117	-0.4960	10	0.51188	T	0.08	.	14.1255	0.65217	1.0:0.0:0.0:0.0	.	433	Q16352	AINX_HUMAN	R	433	ENSP00000358865:S433R	ENSP00000358865:S433R	S	+	1	0	INA	105038213	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.564000	0.53791	2.173000	0.68751	0.454000	0.30748	AGT		0.507	INA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050145.1	NM_032727		Missense_Mutation
CBLL1	79872	genome.wustl.edu	37	7	107389401	107389401	+	Silent	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:107389401C>T	ENST00000440859.3	+	2	557	c.90C>T	c.(88-90)ctC>ctT	p.L30L	CBLL1_ENST00000415884.2_Silent_p.L30L|CBLL1_ENST00000222597.2_Silent_p.L30L	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	30					negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L30L(1)		endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						CTATAAAGCTCATCTCCAAAC	0.423																																																1	Substitution - coding silent(1)	ovary(1)	7											141.0	142.0	142.0					7																	107389401		2203	4300	6503	107176637	SO:0001819	synonymous_variant				AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.90C>T	7.37:g.107389401C>T			107176637	B7ZM03|Q8TAJ4|Q9H5S6	Missense_Mutation	SNP	ENST00000440859.3	37	CCDS5747.1	SNP	29	WashU																																																																																				0.423	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814		Missense_Mutation
CUL5	8065	genome.wustl.edu	37	11	107925383	107925383	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:107925383G>T	ENST00000393094.2	+	6	1179	c.563G>T	c.(562-564)tGt>tTt	p.C188F		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	188					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)	p.C188F(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		GTTAACCTTTGTTCTAATCCT	0.289																																																1	Substitution - Missense(1)	ovary(1)	11											33.0	37.0	35.0					11																	107925383		2189	4285	6474	107430593	SO:0001583	missense	8065			X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.563G>T	11.37:g.107925383G>T	ENSP00000376808:p.Cys188Phe		107430593	A8K960|O14766|Q9BZC6	Missense_Mutation	SNP	ENST00000393094.2	37	CCDS31668.1	SNP	48	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.42|19.42	3.823913|3.823913	0.71143|0.71143	.|.	.|.	ENSG00000166266|ENSG00000166266	ENST00000393094|ENST00000532782	T|T	0.29917|0.43294	1.55|0.95	5.88|5.88	4.96|4.96	0.65561|0.65561	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);|.	0.312664|.	0.42682|.	D|.	0.000668|.	T|T	0.60196|0.60196	0.2250|0.2250	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	D|.	0.67145|.	0.996|.	D|.	0.63488|.	0.915|.	T|T	0.61836|0.61836	-0.6981|-0.6981	10|6	0.72032|.	D|.	0.01|.	-10.797|-10.797	16.3587|16.3587	0.83245|0.83245	0.0:0.0:0.8669:0.1331|0.0:0.0:0.8669:0.1331	.|.	188|.	Q93034|.	CUL5_HUMAN|.	F|F	188|84	ENSP00000376808:C188F|ENSP00000431221:L84F	ENSP00000376808:C188F|.	C|L	+|+	2|3	0|2	CUL5|CUL5	107430593|107430593	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.827000|9.827000	0.99397|0.99397	1.462000|1.462000	0.47948|0.47948	0.655000|0.655000	0.94253|0.94253	TGT|TTG		0.289	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389429.1			Missense_Mutation
ABRA	137735	genome.wustl.edu	37	8	107782232	107782232	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr8:107782232G>T	ENST00000311955.3	-	1	241	c.187C>A	c.(187-189)Cct>Act	p.P63T		NM_139166.4	NP_631905.1			actin-binding Rho activating protein									p.P63T(1)		breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			ATTGGTTTAGGAGCTTGAGGT	0.607																																																1	Substitution - Missense(1)	ovary(1)	8											89.0	90.0	90.0					8																	107782232		2203	4300	6503	107851408	SO:0001583	missense	137735			AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.187C>A	8.37:g.107782232G>T	ENSP00000311436:p.Pro63Thr		107851408		Missense_Mutation	SNP	ENST00000311955.3	37	CCDS6305.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	2.325	-0.354630	0.05138	.	.	ENSG00000174429	ENST00000311955	D	0.91740	-2.9	5.66	0.368	0.16146	.	0.804396	0.11835	N	0.524850	D	0.85305	0.5666	L	0.50333	1.59	0.09310	N	1	B	0.18610	0.029	B	0.15052	0.012	T	0.70385	-0.4886	10	0.31617	T	0.26	0.172	0.8137	0.01098	0.3794:0.1161:0.2683:0.2362	.	63	Q8N0Z2	ABRA_HUMAN	T	63	ENSP00000311436:P63T	ENSP00000311436:P63T	P	-	1	0	ABRA	107851408	0.000000	0.05858	0.008000	0.14137	0.330000	0.28571	0.103000	0.15292	0.030000	0.15379	-0.150000	0.13652	CCT		0.607	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166		Missense_Mutation
APC	324	genome.wustl.edu	37	5	112174650	112174650	+	Missense_Mutation	SNP	G	G	A	rs28933379		TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:112174650G>A	ENST00000457016.1	+	16	3739	c.3359G>A	c.(3358-3360)gGa>gAa	p.G1120E	APC_ENST00000508376.2_Missense_Mutation_p.G1120E|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.G1120E			P25054	APC_HUMAN	adenomatous polyposis coli	1120	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.		G -> E (in gastric cancer; dbSNP:rs28933379).		anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.G1120E(2)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCTAATCATGGAATTAATCAA	0.403		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	3	Substitution - Missense(2)|Unknown(1)	ovary(1)|stomach(1)|skin(1)	5	GRCh37	CI972534	APC	I	rs28933379						85.0	77.0	80.0					5																	112174650		2202	4300	6502	112202549	SO:0001583	missense	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3359G>A	5.37:g.112174650G>A	ENSP00000413133:p.Gly1120Glu		112202549	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	11.38	1.620341	0.28801	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.93763	-2.49;-3.28;-2.49;-2.49;-2.67	5.56	3.71	0.42584	.	0.488596	0.20777	N	0.085862	D	0.87621	0.6223	N	0.24115	0.695	0.30362	N	0.783718	P;P	0.34780	0.468;0.468	B;B	0.30855	0.121;0.121	T	0.83023	-0.0166	10	0.49607	T	0.09	-9.3002	15.3711	0.74564	0.0:0.4124:0.5876:0.0	rs28933379	1122;1120	Q4LE70;P25054	.;APC_HUMAN	E	1120;1102;1120;1120;1120	ENSP00000413133:G1120E;ENSP00000423224:G1102E;ENSP00000257430:G1120E;ENSP00000427089:G1120E;ENSP00000423828:G1120E	ENSP00000257430:G1120E	G	+	2	0	APC	112202549	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.085000	0.57657	0.657000	0.30906	0.655000	0.94253	GGA		0.403	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		Missense_Mutation
APC	324	genome.wustl.edu	37	5	112177305	112177305	+	Nonsense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:112177305C>G	ENST00000457016.1	+	16	6394	c.6014C>G	c.(6013-6015)tCa>tGa	p.S2005*	APC_ENST00000508376.2_Nonsense_Mutation_p.S2005*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.S2005*			P25054	APC_HUMAN	adenomatous polyposis coli	2005	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S2005*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CCTCAAGCatcaggctatgct	0.408		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	2	Substitution - Nonsense(1)|Unknown(1)	ovary(1)|skin(1)	5											81.0	80.0	80.0					5																	112177305		2200	4299	6499	112205204	SO:0001587	stop_gained	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.6014C>G	5.37:g.112177305C>G	ENSP00000413133:p.Ser2005*		112205204	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	44	10.687366	0.99450	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	5.86	5.86	0.93980	.	0.293920	0.37577	N	0.002030	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.0943	20.1986	0.98248	0.0:1.0:0.0:0.0	.	.	.	.	X	2005	.	.	S	+	2	0	APC	112205204	1.000000	0.71417	0.994000	0.49952	0.922000	0.55478	3.601000	0.54059	2.781000	0.95711	0.650000	0.86243	TCA		0.408	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		Nonsense_Mutation
PSD4	23550	genome.wustl.edu	37	2	113943815	113943815	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:113943815C>G	ENST00000245796.6	+	5	1806	c.1611C>G	c.(1609-1611)caC>caG	p.H537Q	PSD4_ENST00000441564.3_Missense_Mutation_p.H509Q	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	537					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.H537Q(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTGACATTCACCTGACTTCTG	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											42.0	46.0	44.0					2																	113943815		2200	4300	6500	113660286	SO:0001583	missense	23550			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.1611C>G	2.37:g.113943815C>G	ENSP00000245796:p.His537Gln		113660286	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	37	CCDS33276.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	10.07	1.249073	0.22880	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.10668	2.86;2.85	4.88	3.08	0.35506	.	2.408010	0.01155	N	0.006519	T	0.07052	0.0179	N	0.19112	0.55	0.09310	N	0.999997	B;B;P	0.34462	0.054;0.018;0.454	B;B;B	0.24006	0.024;0.014;0.05	T	0.34378	-0.9831	10	0.12103	T	0.63	.	7.5425	0.27746	0.0:0.8059:0.0:0.1941	.	195;509;537	Q59HG0;Q8NDX1-2;Q8NDX1	.;.;PSD4_HUMAN	Q	537;509	ENSP00000245796:H537Q;ENSP00000413997:H509Q	ENSP00000245796:H537Q	H	+	3	2	PSD4	113660286	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.256000	0.18351	0.764000	0.33197	0.655000	0.94253	CAC		0.488	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455		Missense_Mutation
NNMT	4837	genome.wustl.edu	37	11	114167364	114167364	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:114167364C>G	ENST00000535401.1	+	3	350	c.86C>G	c.(85-87)tCt>tGt	p.S29C	NNMT_ENST00000545255.1_5'Flank|RP11-64D24.2_ENST00000544925.1_RNA|NNMT_ENST00000299964.3_Missense_Mutation_p.S29C|NNMT_ENST00000542647.1_5'Flank|NNMT_ENST00000541754.1_5'Flank			P40261	NNMT_HUMAN	nicotinamide N-methyltransferase	29					methylation (GO:0032259)|organ regeneration (GO:0031100)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	nicotinamide N-methyltransferase activity (GO:0008112)	p.S29C(1)		kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;4.83e-16)|all_epithelial(67;7.28e-09)|all_hematologic(158;0.000135)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.79e-06)|Epithelial(105;1.32e-05)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.128)	Niacin(DB00627)	AAGTTTGGTTCTAGGCACTCT	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											90.0	86.0	87.0					11																	114167364		2201	4296	6497	113672574	SO:0001583	missense	4837			U08021	CCDS8368.1	11q23.1	2007-08-15					2.1.1.1		7861	protein-coding gene	gene with protein product		600008				8575745	Standard	NM_006169		Approved		uc001pos.1	P40261		ENST00000535401.1:c.86C>G	11.37:g.114167364C>G	ENSP00000441434:p.Ser29Cys		113672574		Missense_Mutation	SNP	ENST00000535401.1	37	CCDS8368.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	11.04	1.522294	0.27211	.	.	ENSG00000166741	ENST00000535401;ENST00000299964	T;T	0.04317	3.65;3.65	5.36	4.45	0.53987	.	0.493601	0.19741	N	0.107124	T	0.07999	0.0200	M	0.67397	2.05	0.80722	D	1	B	0.20550	0.046	B	0.11329	0.006	T	0.04593	-1.0940	10	0.54805	T	0.06	-1.1869	11.7574	0.51882	0.0:0.9135:0.0:0.0865	.	29	P40261	NNMT_HUMAN	C	29	ENSP00000441434:S29C;ENSP00000299964:S29C	ENSP00000299964:S29C	S	+	2	0	NNMT	113672574	0.034000	0.19679	0.882000	0.34594	0.239000	0.25481	1.838000	0.39211	1.267000	0.44247	0.591000	0.81541	TCT		0.413	NNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398951.1	NM_006169		Missense_Mutation
ZFP37	7539	genome.wustl.edu	37	9	115818910	115818910	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr9:115818910C>T	ENST00000374227.3	-	1	86	c.59G>A	c.(58-60)aGa>aAa	p.R20K	ZFP37_ENST00000553380.1_Missense_Mutation_p.R20K|ZFP37_ENST00000555206.1_Missense_Mutation_p.R20K	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	20					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R20K(1)		NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TTCCGCACTTCTCCTCCGGTC	0.667																																																1	Substitution - Missense(1)	ovary(1)	9											123.0	122.0	122.0					9																	115818910		2203	4300	6503	114858731	SO:0001583	missense	7539			AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.59G>A	9.37:g.115818910C>T	ENSP00000363344:p.Arg20Lys		114858731	A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Missense_Mutation	SNP	ENST00000374227.3	37	CCDS6787.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	c	13.02	2.111607	0.37242	.	.	ENSG00000136866	ENST00000374227;ENST00000555206;ENST00000553380	T;T;T	0.05139	3.51;3.49;3.58	3.29	0.45	0.16624	.	.	.	.	.	T	0.02455	0.0075	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.003;0.003;0.001	T	0.46952	-0.9154	9	0.05721	T	0.95	.	5.4579	0.16600	0.0:0.6311:0.0:0.3689	.	20;20;20	G3V3L7;Q9Y6Q3-2;Q9Y6Q3	.;.;ZFP37_HUMAN	K	20	ENSP00000363344:R20K;ENSP00000451310:R20K;ENSP00000452552:R20K	ENSP00000363344:R20K	R	-	2	0	ZFP37	114858731	0.001000	0.12720	0.000000	0.03702	0.096000	0.18686	-0.188000	0.09642	0.084000	0.17077	0.558000	0.71614	AGA		0.667	ZFP37-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055439.1	NM_003408		Missense_Mutation
NRAP	4892	genome.wustl.edu	37	10	115368216	115368216	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr10:115368216G>T	ENST00000359988.3	-	32	3903	c.3659C>A	c.(3658-3660)cCc>cAc	p.P1220H	NRAP_ENST00000369360.3_Missense_Mutation_p.P1193H|NRAP_ENST00000369358.4_Missense_Mutation_p.P1228H|NRAP_ENST00000360478.3_Missense_Mutation_p.P1185H	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.P1220H(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		AAGGAGGTTGGGAGTGTCTGT	0.428																																																1	Substitution - Missense(1)	ovary(1)	10											261.0	252.0	255.0					10																	115368216		2203	4300	6503	115358206	SO:0001583	missense	4892				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.3659C>A	10.37:g.115368216G>T	ENSP00000353078:p.Pro1220His		115358206		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073999	0.76415	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	6.17	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.82976	0.5154	M	0.85630	2.765	0.44736	D	0.997738	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.996;0.997	D	0.83637	0.0148	10	0.51188	T	0.08	.	15.4094	0.74905	0.0:0.0:0.8616:0.1384	.	1220;1185;1220	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	H	1228;1193;1220;1185	ENSP00000358365:P1228H;ENSP00000358367:P1193H;ENSP00000353078:P1220H;ENSP00000353666:P1185H	ENSP00000353078:P1220H	P	-	2	0	NRAP	115358206	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.477000	0.66799	2.941000	0.99782	0.655000	0.94253	CCC		0.428	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175		Missense_Mutation
ZBTB20	26137	genome.wustl.edu	37	3	114057992	114057992	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr3:114057992G>T	ENST00000474710.1	-	5	2264	c.2086C>A	c.(2086-2088)Ccc>Acc	p.P696T	ZBTB20_ENST00000357258.3_Missense_Mutation_p.P623T|ZBTB20_ENST00000462705.1_Missense_Mutation_p.P623T|ZBTB20_ENST00000464560.1_Missense_Mutation_p.P623T|ZBTB20_ENST00000481632.1_Missense_Mutation_p.P623T|ZBTB20_ENST00000471418.1_Missense_Mutation_p.P623T|ZBTB20_ENST00000393785.2_Missense_Mutation_p.P623T	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	696						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.P623T(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GCACCTGGGGGTGTGCCTGCA	0.632																																					NSCLC(69;748 1344 9802 11203 30933)											1	Substitution - Missense(1)	ovary(1)	3											49.0	49.0	49.0					3																	114057992		2203	4300	6503	115540682	SO:0001583	missense	26137			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.2086C>A	3.37:g.114057992G>T	ENSP00000419153:p.Pro696Thr		115540682	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	7.946	0.743913	0.15642	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.76;2.75;2.75	5.65	0.219	0.15274	.	0.871567	0.10103	N	0.715680	T	0.08802	0.0218	N	0.14661	0.345	0.31893	N	0.616969	B	0.06786	0.001	B	0.06405	0.002	T	0.20505	-1.0273	10	0.27785	T	0.31	.	20.4617	0.99160	0.0:0.6352:0.3648:0.0	.	696	Q9HC78	ZBT20_HUMAN	T	623;623;623;623;696;623;623	ENSP00000420324:P623T;ENSP00000377375:P623T;ENSP00000418092:P623T;ENSP00000419902:P623T;ENSP00000419153:P696T;ENSP00000349803:P623T;ENSP00000417307:P623T	ENSP00000349803:P623T	P	-	1	0	ZBTB20	115540682	0.194000	0.23325	0.993000	0.49108	0.990000	0.78478	0.573000	0.23699	0.121000	0.18284	0.655000	0.94253	CCC		0.632	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642		Missense_Mutation
WNT2	7472	genome.wustl.edu	37	7	116937751	116937751	+	Silent	SNP	A	A	T	rs373540369		TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:116937751A>T	ENST00000265441.3	-	4	1067	c.768T>A	c.(766-768)gcT>gcA	p.A256A		NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	256					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.A256A(1)		breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		ACCTCTCGTTAGCCACAGTGA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	7											109.0	99.0	102.0					7																	116937751		2203	4300	6503	116724987	SO:0001819	synonymous_variant	7472			X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.768T>A	7.37:g.116937751A>T			116724987	A4D0V1|Q75N05|Q9UDP9	Silent	SNP	ENST00000265441.3	37	CCDS5771.1	SNP	15	WashU																																																																																				0.488	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391		Silent
PAX4	5078	genome.wustl.edu	37	7	127253098	127253098	+	Silent	SNP	G	G	C	rs115621771	byFrequency	TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:127253098G>C	ENST00000341640.2	-	6	874	c.669C>G	c.(667-669)ctC>ctG	p.L223L	PAX4_ENST00000378740.2_Silent_p.L223L|PAX4_ENST00000463946.1_Silent_p.L221L|PAX4_ENST00000338516.3_Silent_p.L231L	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	231					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.L223L(1)		cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						TTTCCCACTTGAGCTTCTCTT	0.527																																					Ovarian(113;737 1605 7858 27720 34092)											1	Substitution - coding silent(1)	ovary(1)	7											264.0	195.0	218.0					7																	127253098		2203	4300	6503	127040334	SO:0001819	synonymous_variant	5078				CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.669C>G	7.37:g.127253098G>C			127040334	O95161|Q6B0H0	Silent	SNP	ENST00000341640.2	37	CCDS5797.1	SNP	45	WashU																																																																																				0.527	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349165.1			Silent
ZXDC	79364	genome.wustl.edu	37	3	126191065	126191065	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr3:126191065A>G	ENST00000389709.3	-	2	1044	c.991T>C	c.(991-993)Tcc>Ccc	p.S331P	ZXDC_ENST00000336332.5_Missense_Mutation_p.S331P	NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	331					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S331P(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		CCAGGAAAGGAGCAGGAAAAG	0.493																																																1	Substitution - Missense(1)	ovary(1)	3											77.0	82.0	80.0					3																	126191065		2194	4296	6490	127673755	SO:0001583	missense	79364			AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.991T>C	3.37:g.126191065A>G	ENSP00000374359:p.Ser331Pro		127673755	C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Missense_Mutation	SNP	ENST00000389709.3	37	CCDS43145.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	14.90	2.673902	0.47781	.	.	ENSG00000070476	ENST00000389709;ENST00000336332	T;T	0.11712	2.75;2.78	4.39	4.39	0.52855	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.137618	0.49916	D	0.000124	T	0.17408	0.0418	N	0.19112	0.55	0.50039	D	0.999848	D;D	0.76494	0.999;0.999	D;D	0.69142	0.962;0.916	T	0.03034	-1.1080	10	0.72032	D	0.01	-23.1139	11.8496	0.52403	1.0:0.0:0.0:0.0	.	331;331	Q2QGD7-2;Q2QGD7	.;ZXDC_HUMAN	P	331	ENSP00000374359:S331P;ENSP00000337694:S331P	ENSP00000337694:S331P	S	-	1	0	ZXDC	127673755	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	4.441000	0.59981	1.756000	0.51951	0.402000	0.26972	TCC		0.493	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370327.2	NM_025112		Missense_Mutation
UGGT1	56886	genome.wustl.edu	37	2	128886622	128886622	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:128886622A>G	ENST00000259253.6	+	13	1293	c.1246A>G	c.(1246-1248)Aat>Gat	p.N416D	UGGT1_ENST00000375990.3_Missense_Mutation_p.N392D	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	416					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)	p.N416D(1)		NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TGTGTTGAGGAATGAAGCTCG	0.383																																																1	Substitution - Missense(1)	ovary(1)	2											122.0	125.0	124.0					2																	128886622		2203	4300	6503	128603092	SO:0001583	missense	56886			AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.1246A>G	2.37:g.128886622A>G	ENSP00000259253:p.Asn416Asp		128603092	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	CCDS2154.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	12.84	2.057271	0.36277	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.36520	1.25;1.25	5.7	5.7	0.88788	.	0.045125	0.85682	D	0.000000	T	0.37571	0.1008	L	0.59436	1.845	0.58432	D	0.999993	B;B	0.32101	0.356;0.048	B;B	0.34536	0.185;0.034	T	0.13415	-1.0510	10	0.20519	T	0.43	.	15.9666	0.79979	1.0:0.0:0.0:0.0	.	392;416	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	D	392;416	ENSP00000365158:N392D;ENSP00000259253:N416D	ENSP00000259253:N416D	N	+	1	0	UGGT1	128603092	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.827000	0.92041	2.174000	0.68829	0.482000	0.46254	AAT		0.383	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120		Missense_Mutation
ADAMTS19	171019	genome.wustl.edu	37	5	129037270	129037270	+	Silent	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:129037270G>A	ENST00000274487.4	+	20	3271	c.3126G>A	c.(3124-3126)gcG>gcA	p.A1042A	ADAMTS19_ENST00000509467.1_3'UTR|CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1042	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A1042A(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TGTGGGAGGCGGGAGTGTGGT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	5											68.0	63.0	65.0					5																	129037270		2203	4300	6503	129065169	SO:0001819	synonymous_variant	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3126G>A	5.37:g.129037270G>A			129065169		Silent	SNP	ENST00000274487.4	37	CCDS4146.1	SNP	39	WashU																																																																																				0.567	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638		Silent
GPR133	283383	genome.wustl.edu	37	12	131451011	131451011	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:131451011T>A	ENST00000261654.5	+	3	666	c.107T>A	c.(106-108)tTt>tAt	p.F36Y	GPR133_ENST00000535015.1_Missense_Mutation_p.F36Y	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	36					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.F36Y(1)		NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CCCCAAGGATTTCAGGTGTTG	0.453																																																1	Substitution - Missense(1)	ovary(1)	12											69.0	72.0	71.0					12																	131451011		2203	4300	6503	130016964	SO:0001583	missense	283383			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.107T>A	12.37:g.131451011T>A	ENSP00000261654:p.Phe36Tyr		130016964	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	CCDS9272.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	16.57	3.158910	0.57368	.	.	ENSG00000111452	ENST00000261654;ENST00000543826;ENST00000542091;ENST00000535015	T;T	0.53423	0.82;0.62	5.03	5.03	0.67393	.	0.149224	0.46442	D	0.000292	T	0.54983	0.1892	M	0.68952	2.095	0.80722	D	1	D;D	0.59767	0.986;0.986	P;P	0.49922	0.626;0.626	T	0.61505	-0.7049	10	0.72032	D	0.01	.	12.7929	0.57545	0.0:0.0:0.0:1.0	.	36;36	B7ZLF7;Q6QNK2	.;GP133_HUMAN	Y	36	ENSP00000261654:F36Y;ENSP00000444425:F36Y	ENSP00000261654:F36Y	F	+	2	0	GPR133	130016964	1.000000	0.71417	0.812000	0.32479	0.005000	0.04900	6.329000	0.72920	2.001000	0.58596	0.533000	0.62120	TTT		0.453	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827		Missense_Mutation
ODF2	4957	genome.wustl.edu	37	9	131256968	131256968	+	Intron	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr9:131256968G>T	ENST00000434106.3	+	17	2274				ODF2_ENST00000393527.3_Intron|ODF2_ENST00000372814.3_Silent_p.G688G|ODF2_ENST00000444119.2_Intron|ODF2_ENST00000546203.1_Silent_p.G625G|ODF2_ENST00000372791.3_Silent_p.G625G|ODF2_ENST00000372807.5_Intron|ODF2_ENST00000604420.1_Intron|ODF2_ENST00000351030.3_Intron|ODF2_ENST00000393533.2_Silent_p.G644G|ODF2_ENST00000448249.3_Silent_p.G563G	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						GGCAGAAAGGGTCCCACGAAC	0.567																																																0			9											49.0	49.0	49.0					9																	131256968		2203	4300	6503	130296789	SO:0001627	intron_variant	4957			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.1911+21G>T	9.37:g.131256968G>T			130296789	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Silent	SNP	ENST00000434106.3	37	CCDS56588.1	SNP	44	WashU																																																																																				0.567	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3			Silent
EFCAB12	90288	genome.wustl.edu	37	3	129140624	129140624	+	Silent	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr3:129140624G>A	ENST00000505956.1	-	2	234	c.72C>T	c.(70-72)ccC>ccT	p.P24P	EFCAB12_ENST00000326085.3_Silent_p.P24P	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	24							calcium ion binding (GO:0005509)	p.P24P(1)									TTTCATTGATGGGAGTCTTAG	0.517																																																1	Substitution - coding silent(1)	ovary(1)	3											31.0	30.0	31.0					3																	129140624		1887	4112	5999	130623314	SO:0001819	synonymous_variant	90288			AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.72C>T	3.37:g.129140624G>A			130623314	Q69YX4	Silent	SNP	ENST00000505956.1	37	CCDS54638.1	SNP	47	WashU																																																																																				0.517	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355530.1	NM_207307		Silent
ENPP1	5167	genome.wustl.edu	37	6	132171147	132171147	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:132171147C>T	ENST00000360971.2	+	3	351	c.331C>T	c.(331-333)Cgc>Tgc	p.R111C		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	111	SMB 1. {ECO:0000255|PROSITE- ProRule:PRU00350}.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)	p.R59C(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	TTGCAAAGGTCGCTGTTTCGA	0.383																																					Colon(104;336 1535 5856 11019 33782)											1	Substitution - Missense(1)	ovary(1)	6											128.0	122.0	124.0					6																	132171147		2203	4300	6503	132212840	SO:0001583	missense	5167			M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.331C>T	6.37:g.132171147C>T	ENSP00000354238:p.Arg111Cys		132212840	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	ENST00000360971.2	37	CCDS5150.2	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333520	0.81801	.	.	ENSG00000197594	ENST00000360971	T	0.63255	-0.03	5.16	5.16	0.70880	Somatomedin B domain (3);Somatomedin B, chordata (1);	0.000000	0.64402	D	0.000002	T	0.81635	0.4864	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85706	0.1316	10	0.87932	D	0	-16.9205	17.7963	0.88572	0.0:1.0:0.0:0.0	.	111	P22413	ENPP1_HUMAN	C	111	ENSP00000354238:R111C	ENSP00000354238:R111C	R	+	1	0	ENPP1	132212840	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.031000	0.64134	2.563000	0.86464	0.650000	0.86243	CGC		0.383	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042238.2			Missense_Mutation
CHRM2	1129	genome.wustl.edu	37	7	136699896	136699896	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:136699896T>G	ENST00000445907.2	+	3	812	c.284T>G	c.(283-285)gTg>gGg	p.V95G	CHRM2_ENST00000401861.1_Missense_Mutation_p.V95G|CHRM2_ENST00000397608.3_Missense_Mutation_p.V95G|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|CHRM2_ENST00000320658.5_Missense_Mutation_p.V95G|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000402486.3_Missense_Mutation_p.V95G|CHRM2_ENST00000453373.1_Missense_Mutation_p.V95G	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	95					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)	p.V95G(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	GGACCTGTGGTGTGTGACCTT	0.468																																																1	Substitution - Missense(1)	ovary(1)	7											195.0	184.0	188.0					7																	136699896		2203	4300	6503	136350436	SO:0001583	missense	1129				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.284T>G	7.37:g.136699896T>G	ENSP00000399745:p.Val95Gly		136350436	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	ENST00000445907.2	37	CCDS5843.1	SNP	59	WashU	.	.	.	.	.	.	.	.	.	.	T	18.10	3.549583	0.65311	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34	5.61	5.61	0.85477	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.55816	0.1944	M	0.69463	2.115	0.80722	D	1	D	0.63046	0.992	D	0.63597	0.916	T	0.52983	-0.8502	10	0.33141	T	0.24	-6.1645	15.8611	0.79021	0.0:0.0:0.0:1.0	.	95	P08172	ACM2_HUMAN	G	95	ENSP00000399745:V95G;ENSP00000415386:V95G;ENSP00000319984:V95G;ENSP00000380733:V95G;ENSP00000384937:V95G;ENSP00000384401:V95G	ENSP00000319984:V95G	V	+	2	0	CHRM2	136350436	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.243000	0.72384	2.145000	0.66743	0.529000	0.55759	GTG		0.468	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1			Missense_Mutation
FAM135B	51059	genome.wustl.edu	37	8	139144882	139144882	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr8:139144882A>G	ENST00000395297.1	-	20	4345	c.4175T>C	c.(4174-4176)tTc>tCc	p.F1392S		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1392								p.F1392S(4)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CTTCTCCAGGAAGAGTTCTGA	0.522										HNSCC(54;0.14)																																						4	Substitution - Missense(4)	ovary(2)|lung(2)	8											179.0	187.0	184.0					8																	139144882		1954	4149	6103	139214064	SO:0001583	missense	51059			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.4175T>C	8.37:g.139144882A>G	ENSP00000378710:p.Phe1392Ser		139214064	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	23.6	4.434611	0.83885	.	.	ENSG00000147724	ENST00000395297	T	0.26957	1.7	5.74	5.74	0.90152	.	0.059495	0.64402	D	0.000002	T	0.54983	0.1892	M	0.82517	2.595	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.61456	-0.7059	10	0.87932	D	0	-24.7186	15.226	0.73352	1.0:0.0:0.0:0.0	.	1392	Q49AJ0	F135B_HUMAN	S	1392	ENSP00000378710:F1392S	ENSP00000378710:F1392S	F	-	2	0	FAM135B	139214064	1.000000	0.71417	1.000000	0.80357	0.590000	0.36582	9.339000	0.96797	2.206000	0.71126	0.482000	0.46254	TTC		0.522	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		Missense_Mutation
DENND2A	27147	genome.wustl.edu	37	7	140301270	140301270	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:140301270A>C	ENST00000275884.6	-	2	1345	c.928T>G	c.(928-930)Tct>Gct	p.S310A	DENND2A_ENST00000492720.1_Missense_Mutation_p.S310A|DENND2A_ENST00000537639.1_Missense_Mutation_p.S310A|DENND2A_ENST00000496613.1_Missense_Mutation_p.S310A			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	310					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.S310A(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					ggtgggggagaggagggcaga	0.597																																																1	Substitution - Missense(1)	ovary(1)	7											44.0	49.0	48.0					7																	140301270		1974	4151	6125	139947739	SO:0001583	missense	27147			AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.928T>G	7.37:g.140301270A>C	ENSP00000275884:p.Ser310Ala		139947739	C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	ENST00000275884.6	37	CCDS43659.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	16.39	3.109456	0.56398	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720	T;T;T;T	0.10005	3.63;3.63;3.63;2.92	4.85	4.85	0.62838	.	0.209266	0.43260	D	0.000581	T	0.12817	0.0311	L	0.55834	1.745	0.38068	D	0.936296	B;B	0.29862	0.259;0.104	B;B	0.25291	0.041;0.059	T	0.05241	-1.0897	10	0.51188	T	0.08	-9.5576	14.5958	0.68407	1.0:0.0:0.0:0.0	.	310;310	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	A	310	ENSP00000275884:S310A;ENSP00000442245:S310A;ENSP00000419654:S310A;ENSP00000419464:S310A	ENSP00000275884:S310A	S	-	1	0	DENND2A	139947739	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	7.161000	0.77505	2.038000	0.60285	0.379000	0.24179	TCT		0.597	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689		Missense_Mutation
PCDHB7	56129	genome.wustl.edu	37	5	140554153	140554153	+	Silent	SNP	G	G	A	rs567529552		TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:140554153G>A	ENST00000231137.3	+	1	1911	c.1737G>A	c.(1735-1737)gcG>gcA	p.A579A		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	579	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A579A(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCCCCGGGCGGCCGAGCCGG	0.706													G|||	1	0.000199681	0.0	0.0	5008	,	,		16255	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	5											28.0	38.0	35.0					5																	140554153		2116	4170	6286	140534337	SO:0001819	synonymous_variant	56129			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1737G>A	5.37:g.140554153G>A			140534337	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	5.924	0.354469	0.11239	.	.	ENSG00000113212	ENST00000543636	.	.	.	4.3	-0.293	0.12835	.	.	.	.	.	T	0.56688	0.2002	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56214	-0.8016	5	0.87932	D	0	.	4.0236	0.09677	0.0763:0.2456:0.4274:0.2508	.	.	.	.	Q	362	.	ENSP00000440828:R362Q	R	+	2	0	PCDHB7	140534337	0.000000	0.05858	0.998000	0.56505	0.662000	0.39071	-0.573000	0.05874	0.016000	0.14998	0.449000	0.29647	CGG		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		Silent
COPB2	9276	genome.wustl.edu	37	3	139077104	139077104	+	Missense_Mutation	SNP	C	C	T	rs560518160		TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr3:139077104C>T	ENST00000333188.5	-	21	2744	c.2563G>A	c.(2563-2565)Ggg>Agg	p.G855R	COPB2_ENST00000507777.1_Missense_Mutation_p.G826R	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	855					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)	p.G855R(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						GCAGGTTTCCCATCAAGTTCC	0.433													C|||	1	0.000199681	0.0	0.0	5008	,	,		18641	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	3											110.0	96.0	100.0					3																	139077104		2203	4300	6503	140559794	SO:0001583	missense	9276			BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.2563G>A	3.37:g.139077104C>T	ENSP00000329419:p.Gly855Arg		140559794	B4DZI8	Missense_Mutation	SNP	ENST00000333188.5	37	CCDS3108.1	SNP	21	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.84|12.84	2.058654|2.058654	0.36277|0.36277	.|.	.|.	ENSG00000184432|ENSG00000184432	ENST00000333188;ENST00000507777|ENST00000503326	T;T|.	0.61980|.	0.06;0.17|.	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	0.717399|.	0.13055|.	N|.	0.417385|.	T|.	0.41190|.	0.1148|.	N|N	0.24115|0.24115	0.695|0.695	0.30766|0.30766	N|N	0.743519|0.743519	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|.	0.39121|.	-0.9629|.	10|.	0.20519|.	T|.	0.43|.	-21.3713|-21.3713	13.8059|13.8059	0.63230|0.63230	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	855|.	P35606|.	COPB2_HUMAN|.	R|X	855;826|68	ENSP00000329419:G855R;ENSP00000422295:G826R|.	ENSP00000329419:G855R|.	G|W	-|-	1|2	0|0	COPB2|COPB2	140559794|140559794	0.797000|0.797000	0.28877|0.28877	0.936000|0.936000	0.37596|0.37596	0.765000|0.765000	0.43378|0.43378	3.232000|3.232000	0.51302|0.51302	2.634000|2.634000	0.89283|0.89283	0.650000|0.650000	0.86243|0.86243	GGG|TGG		0.433	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2	NM_004766		Missense_Mutation
PCDHB15	56121	genome.wustl.edu	37	5	140626712	140626712	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:140626712G>C	ENST00000231173.3	+	1	1566	c.1566G>C	c.(1564-1566)gaG>gaC	p.E522D		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	522	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E522D(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGACTACGAGGCCCTGCAGG	0.697																																																1	Substitution - Missense(1)	ovary(1)	5											73.0	84.0	80.0					5																	140626712		2203	4300	6503	140606896	SO:0001583	missense	56121			AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.1566G>C	5.37:g.140626712G>C	ENSP00000231173:p.Glu522Asp		140606896	Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	37	CCDS4257.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	14.52	2.560544	0.45590	.	.	ENSG00000113248	ENST00000231173	T	0.72394	-0.65	4.62	2.38	0.29361	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.87321	0.6148	H	0.95982	3.75	0.21325	N	0.999725	D	0.89917	1.0	D	0.97110	1.0	T	0.75706	-0.3224	9	0.87932	D	0	.	8.8014	0.34912	0.2931:0.0:0.7069:0.0	.	522	Q9Y5E8	PCDBF_HUMAN	D	522	ENSP00000231173:E522D	ENSP00000231173:E522D	E	+	3	2	PCDHB15	140606896	0.298000	0.24417	1.000000	0.80357	0.724000	0.41520	0.818000	0.27295	1.099000	0.41499	0.485000	0.47835	GAG		0.697	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935		Missense_Mutation
PCDH1	5097	genome.wustl.edu	37	5	141243376	141243376	+	Silent	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:141243376C>G	ENST00000394536.3	-	3	2659	c.2520G>C	c.(2518-2520)ggG>ggC	p.G840G	PCDH1_ENST00000287008.3_Silent_p.G840G|PCDH1_ENST00000536585.1_Silent_p.G818G|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000456271.1_Silent_p.G828G	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	840	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G840G(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		ATTCTGGATCCCCAGCAATGT	0.587																																					Ovarian(132;1609 1739 4190 14731 45037)											1	Substitution - coding silent(1)	ovary(1)	5											108.0	117.0	114.0					5																	141243376		2203	4300	6503	141223560	SO:0001819	synonymous_variant	5097			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.2520G>C	5.37:g.141243376C>G			141223560	Q8IUP2	Silent	SNP	ENST00000394536.3	37	CCDS43375.1	SNP	22	WashU																																																																																				0.587	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420		Silent
Unknown	0	genome.wustl.edu	37	7	0	0	+	IGR	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Invalid:failed_liftOver	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:0A>G								None (None upstream) : AC093627.7 (70971 downstream)																							NNNNNNNNNN	0.0																																																0			7																																								141952571	SO:0001628	intergenic_variant																																7.37:g.0A>G			141952571		Missense_Mutation	SNP		37		SNP	7	WashU																																																																																			0	0.000									Missense_Mutation
GJA8	2703	genome.wustl.edu	37	1	147381251	147381251	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:147381251A>G	ENST00000369235.1	+	1	1169	c.1169A>G	c.(1168-1170)aAg>aGg	p.K390R	GJA8_ENST00000240986.4_Missense_Mutation_p.K390R			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	390					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)	p.K390R(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					CAGTCGGAGAAGGTGTCAAAG	0.577																																					Melanoma(76;1255 1795 8195 52096)											1	Substitution - Missense(1)	ovary(1)	1											54.0	58.0	56.0					1																	147381251		2203	4300	6503	145847875	SO:0001583	missense	2703			U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.1169A>G	1.37:g.147381251A>G	ENSP00000358238:p.Lys390Arg		145847875	A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	ENST00000369235.1	37	CCDS30834.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	N	0.911	-0.719159	0.03182	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.97710	-4.5;-4.5	5.31	-0.0276	0.13926	.	3.328010	0.01636	U	0.023780	D	0.83394	0.5245	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	D	0.83794	0.0232	10	0.19147	T	0.46	.	2.2679	0.04083	0.4047:0.1267:0.0727:0.396	.	390	P48165	CXA8_HUMAN	R	390	ENSP00000240986:K390R;ENSP00000358238:K390R	ENSP00000240986:K390R	K	+	2	0	GJA8	145847875	0.992000	0.36948	0.003000	0.11579	0.235000	0.25334	0.511000	0.22739	-0.168000	0.10853	-0.327000	0.08410	AAG		0.577	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267		Missense_Mutation
SH3TC2	79628	genome.wustl.edu	37	5	148392217	148392217	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:148392217T>A	ENST00000515425.1	-	13	3235	c.3134A>T	c.(3133-3135)gAg>gTg	p.E1045V	SH3TC2_ENST00000512049.1_Missense_Mutation_p.E1038V|SH3TC2_ENST00000538184.1_Missense_Mutation_p.E592V	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	1045					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)		p.E1045V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGCCAGGCCTCAGCAGCCTT	0.597																																																1	Substitution - Missense(1)	ovary(1)	5											49.0	49.0	49.0					5																	148392217		2203	4300	6503	148372410	SO:0001583	missense	79628			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.3134A>T	5.37:g.148392217T>A	ENSP00000423660:p.Glu1045Val		148372410	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	37	CCDS4293.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	18.35	3.603850	0.66445	.	.	ENSG00000169247	ENST00000538184;ENST00000515425;ENST00000512049	T;T;T	0.77489	-1.04;-1.1;-1.04	5.67	3.28	0.37604	Tetratricopeptide-like helical (1);	0.066004	0.64402	D	0.000018	T	0.75191	0.3816	L	0.56769	1.78	0.80722	D	1	P;P;P	0.48640	0.913;0.913;0.913	B;P;B	0.47470	0.424;0.548;0.424	T	0.74134	-0.3763	10	0.54805	T	0.06	-4.4403	7.2814	0.26314	0.1303:0.0701:0.0:0.7996	.	1038;1045;1045	Q14CC0;E9PDF1;Q8TF17	.;.;S3TC2_HUMAN	V	592;1045;1038	ENSP00000441427:E592V;ENSP00000423660:E1045V;ENSP00000421860:E1038V	ENSP00000425627:E1045V	E	-	2	0	SH3TC2	148372410	1.000000	0.71417	0.966000	0.40874	0.793000	0.44817	3.947000	0.56652	0.956000	0.37904	-0.333000	0.08304	GAG		0.597	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577		Missense_Mutation
UST	10090	genome.wustl.edu	37	6	149342611	149342611	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:149342611G>C	ENST00000367463.4	+	7	1034	c.931G>C	c.(931-933)Gac>Cac	p.D311H		NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	311					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.D311H(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		TATCTACAAAGACCCAGGTAA	0.453																																																1	Substitution - Missense(1)	ovary(1)	6											102.0	96.0	98.0					6																	149342611		2203	4300	6503	149384304	SO:0001583	missense	10090			AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.931G>C	6.37:g.149342611G>C	ENSP00000356433:p.Asp311His		149384304	B2RCX6	Missense_Mutation	SNP	ENST00000367463.4	37	CCDS5213.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	15.37	2.812105	0.50527	.	.	ENSG00000111962	ENST00000367463	T	0.73681	-0.77	5.64	4.69	0.59074	.	0.208451	0.49916	D	0.000133	T	0.37571	0.1008	N	0.12182	0.205	0.40860	D	0.983829	B	0.16166	0.016	B	0.29440	0.102	T	0.41998	-0.9477	10	0.46703	T	0.11	-19.0774	3.2538	0.06824	0.5423:0.0:0.4577:0.0	.	311	Q9Y2C2	UST_HUMAN	H	311	ENSP00000356433:D311H	ENSP00000356433:D311H	D	+	1	0	UST	149384304	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.435000	0.73412	1.425000	0.47237	0.650000	0.86243	GAC		0.453	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043363.1	NM_005715		Missense_Mutation
GIMAP5	55340	genome.wustl.edu	37	7	150439380	150439380	+	Silent	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:150439380C>G	ENST00000358647.3	+	3	520	c.153C>G	c.(151-153)ccC>ccG	p.P51P	GIMAP5_ENST00000479556.1_3'UTR	NM_018384.4	NP_060854.2	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5	51	AIG1-type G.				myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of T cell activation (GO:0050868)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0032831)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of membrane potential (GO:0045838)|positive regulation of natural killer cell cytokine production (GO:0002729)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of mitochondrial membrane permeability (GO:0046902)|T cell differentiation (GO:0030217)|T cell homeostasis (GO:0043029)|temperature homeostasis (GO:0001659)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)	p.P51P(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|urinary_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTGGCCAGCCCGTGTTTGAGT	0.552																																																1	Substitution - coding silent(1)	ovary(1)	7											88.0	74.0	79.0					7																	150439380		2203	4300	6503	150070313	SO:0001819	synonymous_variant	55340			AK002158	CCDS5907.1	7q36.1	2014-04-04	2004-10-29	2004-10-30	ENSG00000196329	ENSG00000196329		"""GTPases, IMAP"""	18005	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 5"""	608086	"""immune associated nucleotide 4 like 1 (mouse)"""	IAN4L1			Standard	NM_018384		Approved	HIMAP3, IAN5		Q96F15	OTTHUMG00000157542	ENST00000358647.3:c.153C>G	7.37:g.150439380C>G			150070313	D3DWZ5|Q6IA75|Q96NE4|Q9NUK9	Silent	SNP	ENST00000358647.3	37	CCDS5907.1	SNP	23	WashU																																																																																				0.552	GIMAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349108.2	NM_018384		Silent
AOC1	26	genome.wustl.edu	37	7	150557711	150557711	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:150557711T>C	ENST00000493429.1	+	6	2563	c.1979T>C	c.(1978-1980)aTt>aCt	p.I660T	AOC1_ENST00000360937.4_Missense_Mutation_p.I660T|AOC1_ENST00000416793.2_Missense_Mutation_p.I679T|AOC1_ENST00000480582.1_3'UTR|AOC1_ENST00000467291.1_Missense_Mutation_p.I660T			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	660					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)	p.I660T(1)								Amiloride(DB00594)	AACGAGAACATTGAAAATGAG	0.602																																																1	Substitution - Missense(1)	ovary(1)	7											130.0	142.0	138.0					7																	150557711		2080	4221	6301	150188644	SO:0001583	missense	26			AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.1979T>C	7.37:g.150557711T>C	ENSP00000418614:p.Ile660Thr		150188644	C9J690|Q16683|Q16684|Q56II4|Q6GU42	Missense_Mutation	SNP	ENST00000493429.1	37	CCDS43679.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	18.21	3.572749	0.65765	.	.	ENSG00000002726	ENST00000493429;ENST00000467291;ENST00000360937;ENST00000416793;ENST00000437714	T;T;T;T	0.07800	3.16;3.16;3.16;3.16	5.05	5.05	0.67936	Copper amine oxidase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.36963	0.0986	M	0.92555	3.32	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.91635	0.999;0.977	T	0.47195	-0.9136	10	0.87932	D	0	-39.4316	12.7556	0.57333	0.0:0.0:0.0:1.0	.	679;660	C9J690;P19801	.;ABP1_HUMAN	T	660;660;660;679;536	ENSP00000418614:I660T;ENSP00000418328:I660T;ENSP00000354193:I660T;ENSP00000411613:I679T	ENSP00000354193:I660T	I	+	2	0	ABP1	150188644	1.000000	0.71417	0.996000	0.52242	0.557000	0.35523	3.868000	0.56055	1.907000	0.55213	0.402000	0.26972	ATT		0.602	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350628.1	NM_001091		Missense_Mutation
LMNA	4000	genome.wustl.edu	37	1	156104723	156104723	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:156104723T>G	ENST00000368300.4	+	4	979	c.767T>G	c.(766-768)gTg>gGg	p.V256G	LMNA_ENST00000361308.4_Missense_Mutation_p.V256G|LMNA_ENST00000368299.3_Missense_Mutation_p.V256G|LMNA_ENST00000392353.3_Missense_Mutation_p.V175G|LMNA_ENST00000347559.2_Missense_Mutation_p.V256G|LMNA_ENST00000473598.2_Missense_Mutation_p.V157G|LMNA_ENST00000368301.2_Missense_Mutation_p.V256G|LMNA_ENST00000368297.1_Missense_Mutation_p.V175G|LMNA_ENST00000448611.2_Missense_Mutation_p.V144G|LMNA_ENST00000496738.1_3'UTR	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	256	Coil 2.|Rod.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)	p.V256G(1)		NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					GAGGACCAGGTGGAGCAGTAT	0.582									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																																							1	Substitution - Missense(1)	ovary(1)	1											109.0	90.0	96.0					1																	156104723		2203	4300	6503	154371347	SO:0001583	missense	4000	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.767T>G	1.37:g.156104723T>G	ENSP00000357283:p.Val256Gly		154371347	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Missense_Mutation	SNP	ENST00000368300.4	37	CCDS1129.1	SNP	59	WashU	.	.	.	.	.	.	.	.	.	.	T	29.4	5.001873	0.93227	.	.	ENSG00000160789	ENST00000368301;ENST00000347559;ENST00000361308;ENST00000368300;ENST00000368299;ENST00000292302;ENST00000392355;ENST00000448611;ENST00000368297;ENST00000504687;ENST00000473598;ENST00000392353	D;D;D;D;D;D;D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59;-2.59;-2.59;-2.59;-2.59;-2.59;-2.59	5.58	5.58	0.84498	Filament (1);	0.000000	0.49916	D	0.000131	D	0.89952	0.6864	L	0.58669	1.825	0.80722	D	1	P;B;P;B;B;B;B	0.48764	0.775;0.009;0.915;0.082;0.022;0.033;0.017	P;B;P;B;B;B;B	0.57468	0.735;0.038;0.821;0.098;0.038;0.085;0.012	D	0.91509	0.5225	10	0.87932	D	0	.	13.6959	0.62580	0.0:0.0:0.0:1.0	.	144;256;157;175;256;256;256	E7EUI9;Q6UYC3;D6RAQ3;Q5TCI8;P02545;P02545-3;P02545-2	.;.;.;.;LMNA_HUMAN;.;.	G	256;256;256;256;256;256;256;144;175;173;157;175	ENSP00000357284:V256G;ENSP00000292304:V256G;ENSP00000355292:V256G;ENSP00000357283:V256G;ENSP00000357282:V256G;ENSP00000395597:V144G;ENSP00000357280:V175G;ENSP00000426535:V173G;ENSP00000421821:V157G;ENSP00000376164:V175G	ENSP00000292302:V256G	V	+	2	0	LMNA	154371347	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.957000	0.87870	2.111000	0.64477	0.460000	0.39030	GTG		0.582	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707		Missense_Mutation
SPTA1	6708	genome.wustl.edu	37	1	158583525	158583525	+	Silent	SNP	A	A	C			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:158583525A>C	ENST00000368147.4	-	50	7155	c.6975T>G	c.(6973-6975)gcT>gcG	p.A2325A	SPTA1_ENST00000485680.1_5'Flank	NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2325	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.A2325A(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTGGATCCACAGCATCCAGGA	0.507																																																1	Substitution - coding silent(1)	ovary(1)	1											72.0	71.0	71.0					1																	158583525		1947	4138	6085	156850149	SO:0001819	synonymous_variant	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6975T>G	1.37:g.158583525A>C			156850149	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	CCDS41423.1	SNP	7	WashU																																																																																				0.507	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		Silent
MNDA	4332	genome.wustl.edu	37	1	158819015	158819015	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:158819015G>A	ENST00000368141.4	+	7	1473	c.1212G>A	c.(1210-1212)atG>atA	p.M404I		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	404					B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.M404I(1)		NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					AAGGACCAATGAATGTTAATT	0.308																																																1	Substitution - Missense(1)	ovary(1)	1											92.0	85.0	87.0					1																	158819015		2203	4300	6503	157085639	SO:0001583	missense	4332			BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.1212G>A	1.37:g.158819015G>A	ENSP00000357123:p.Met404Ile		157085639		Missense_Mutation	SNP	ENST00000368141.4	37	CCDS1177.1	SNP	45	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.497|4.497	0.092164|0.092164	0.08632|0.08632	.|.	.|.	ENSG00000163563|ENSG00000163563	ENST00000438394|ENST00000368141	.|T	.|0.04317	.|3.65	2.84|2.84	-2.48|-2.48	0.06423|0.06423	.|.	.|7.046570	.|0.00424	.|N	.|0.000061	T|T	0.01189|0.01189	0.0039|0.0039	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.47837|0.47837	-0.9086|-0.9086	5|10	.|0.37606	.|T	.|0.19	.|.	8.122|8.122	0.30976|0.30976	0.1482:0.2393:0.6125:0.0|0.1482:0.2393:0.6125:0.0	.|.	.|404	.|P41218	.|MNDA_HUMAN	K|I	101|404	.|ENSP00000357123:M404I	.|ENSP00000357123:M404I	E|M	+|+	1|3	0|0	MNDA|MNDA	157085639|157085639	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.120000|0.120000	0.20174|0.20174	-2.912000|-2.912000	0.00698|0.00698	-0.515000|-0.515000	0.06479|0.06479	0.462000|0.462000	0.41574|0.41574	GAA|ATG		0.308	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432		Missense_Mutation
PYHIN1	149628	genome.wustl.edu	37	1	158913767	158913767	+	Splice_Site	SNP	A	A	T			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:158913767A>T	ENST00000368140.1	+	6	1435	c.1190A>T	c.(1189-1191)cAg>cTg	p.Q397L	PYHIN1_ENST00000485134.1_3'UTR|PYHIN1_ENST00000392252.3_Splice_Site_p.Q388L|PYHIN1_ENST00000392254.2_Splice_Site_p.Q397L|PYHIN1_ENST00000368138.3_Splice_Site_p.Q388L	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	397	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				cell cycle (GO:0007049)	nucleus (GO:0005634)		p.Q397L(1)		breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					AGTTTCATCCAGGTGAGAAAT	0.333																																																1	Substitution - Missense(1)	ovary(1)	1											51.0	52.0	52.0					1																	158913767		2203	4299	6502	157180391	SO:0001630	splice_region_variant	149628			AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.1191+1A>T	1.37:g.158913767A>T			157180391	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	CCDS1178.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	14.76	2.630317	0.46944	.	.	ENSG00000163564	ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	3.04	3.04	0.35103	HIN-200/IF120x (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.23249	0.0562	L	0.61218	1.895	0.34847	D	0.741289	P;P;P;P	0.52061	0.95;0.913;0.95;0.917	P;P;P;B	0.53062	0.717;0.544;0.544;0.342	T	0.08452	-1.0721	9	0.87932	D	0	.	7.7222	0.28740	1.0:0.0:0.0:0.0	.	388;397;388;397	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9	.;.;.;IFIX_HUMAN	L	397;388;397;388	ENSP00000357122:Q397L;ENSP00000357120:Q388L;ENSP00000376083:Q397L;ENSP00000376082:Q388L	ENSP00000357120:Q388L	Q	+	2	0	PYHIN1	157180391	0.723000	0.28027	0.079000	0.20413	0.104000	0.19210	2.044000	0.41241	1.368000	0.46115	0.482000	0.46254	CAG		0.333	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501	Missense_Mutation	Missense_Mutation
ARHGAP30	257106	genome.wustl.edu	37	1	161018482	161018482	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:161018482G>C	ENST00000368013.3	-	12	2649	c.2329C>G	c.(2329-2331)Caa>Gaa	p.Q777E	USF1_ENST00000435396.1_5'Flank|ARHGAP30_ENST00000368016.3_Intron|USF1_ENST00000368021.3_5'Flank|ARHGAP30_ENST00000368015.1_Missense_Mutation_p.Q600E	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	777	Glu-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)	p.Q777E(1)		breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			TCAGCAACTTGATCTTCCTGG	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											209.0	208.0	208.0					1																	161018482		2203	4300	6503	159285106	SO:0001583	missense	257106			AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.2329C>G	1.37:g.161018482G>C	ENSP00000356992:p.Gln777Glu		159285106	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	37	CCDS30918.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.321760	0.01320	.	.	ENSG00000186517	ENST00000368013;ENST00000368015	T;T	0.30714	3.05;1.52	4.63	2.72	0.32119	.	0.924044	0.08880	N	0.880174	T	0.12860	0.0312	L	0.60455	1.87	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35001	-0.9806	10	0.51188	T	0.08	.	6.7894	0.23692	0.096:0.3442:0.5598:0.0	.	777	Q7Z6I6	RHG30_HUMAN	E	777;600	ENSP00000356992:Q777E;ENSP00000356994:Q600E	ENSP00000356992:Q777E	Q	-	1	0	ARHGAP30	159285106	0.001000	0.12720	0.000000	0.03702	0.717000	0.41224	0.485000	0.22324	0.388000	0.25054	-0.519000	0.04390	CAA		0.493	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720		Missense_Mutation
GABRG2	2566	genome.wustl.edu	37	5	161524811	161524811	+	Silent	SNP	C	C	A			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:161524811C>A	ENST00000361925.4	+	4	715	c.495C>A	c.(493-495)acC>acA	p.T165T	GABRG2_ENST00000414552.2_Silent_p.T165T|GABRG2_ENST00000393933.4_Silent_p.T70T|GABRG2_ENST00000356592.3_Silent_p.T165T			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	165					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.T165T(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGATCACCACCCCCAACAGGA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	5											98.0	98.0	98.0					5																	161524811		2203	4300	6503	161457389	SO:0001819	synonymous_variant	2566				CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.495C>A	5.37:g.161524811C>A			161457389	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Silent	SNP	ENST00000361925.4	37	CCDS4358.1	SNP	22	WashU																																																																																				0.418	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1			Silent
SLC9C2	284525	genome.wustl.edu	37	1	173505055	173505055	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:173505055C>G	ENST00000367714.3	-	15	2111	c.1689G>C	c.(1687-1689)atG>atC	p.M563I	SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_Intron	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	563					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.M563I(1)									TTCTAGTTCTCATATAAGTTG	0.254																																																1	Substitution - Missense(1)	ovary(1)	1											22.0	26.0	24.0					1																	173505055		2137	4230	6367	171771678	SO:0001583	missense	284525			AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.1689G>C	1.37:g.173505055C>G	ENSP00000356687:p.Met563Ile		171771678	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	CCDS1308.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	0.247	-1.009188	0.02112	.	.	ENSG00000162753	ENST00000367714	T	0.21361	2.01	5.81	-4.24	0.03777	.	0.546793	0.16489	N	0.212219	T	0.02119	0.0066	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44097	-0.9350	10	0.21540	T	0.41	-9.9766	6.4471	0.21882	0.0:0.3339:0.4045:0.2615	.	563	Q5TAH2	S9A11_HUMAN	I	563	ENSP00000356687:M563I	ENSP00000356687:M563I	M	-	3	0	SLC9A11	171771678	0.023000	0.18921	0.004000	0.12327	0.002000	0.02628	-0.187000	0.09656	-0.383000	0.07858	-0.331000	0.08364	ATG		0.254	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179465864	179465864	+	Silent	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:179465864G>T	ENST00000591111.1	-	238	51068	c.50844C>A	c.(50842-50844)ggC>ggA	p.G16948G	TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342992.6_Silent_p.G16021G|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Silent_p.G18589G|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Silent_p.G9716G|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Silent_p.G9649G|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Silent_p.G9524G			Q8WZ42	TITIN_HUMAN	titin	16948	Fibronectin type-III 23. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G16021G(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGTGATGAGGCCAATCTTGA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	2											49.0	49.0	49.0					2																	179465864		1858	4106	5964	179174109	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.50844C>A	2.37:g.179465864G>T			179174109	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37		SNP	42	WashU																																																																																				0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Silent
RASGEF1C	255426	genome.wustl.edu	37	5	179546376	179546376	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:179546376C>T	ENST00000393371.2	-	7	1173	c.877G>A	c.(877-879)Ggc>Agc	p.G293S	RASGEF1C_ENST00000522500.1_Missense_Mutation_p.G142S|RASGEF1C_ENST00000361132.4_Missense_Mutation_p.G293S|RASGEF1C_ENST00000519883.1_5'UTR			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	293	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.G293S(1)		breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTGAAGTTGCCGATGTTGAAG	0.642																																																1	Substitution - Missense(1)	ovary(1)	5											149.0	120.0	130.0					5																	179546376		2203	4300	6503	179478982	SO:0001583	missense	255426			AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.877G>A	5.37:g.179546376C>T	ENSP00000377037:p.Gly293Ser		179478982	D3DWQ7|Q7Z4T0|Q8NA49	Missense_Mutation	SNP	ENST00000393371.2	37	CCDS4452.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	21.0	4.080744	0.76528	.	.	ENSG00000146090	ENST00000361132;ENST00000393371;ENST00000522500	T;T;T	0.33865	1.39;1.39;1.39	4.38	4.38	0.52667	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.55194	0.1905	L	0.55743	1.74	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57266	-0.7841	10	0.52906	T	0.07	.	15.9161	0.79521	0.0:1.0:0.0:0.0	.	293	Q8N431	RGF1C_HUMAN	S	293;293;142	ENSP00000354963:G293S;ENSP00000377037:G293S;ENSP00000429114:G142S	ENSP00000354963:G293S	G	-	1	0	RASGEF1C	179478982	1.000000	0.71417	0.983000	0.44433	0.210000	0.24377	5.361000	0.66092	2.173000	0.68751	0.561000	0.74099	GGC		0.642	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253506.2	NM_175062		Missense_Mutation
KLHL6	89857	genome.wustl.edu	37	3	183210290	183210290	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr3:183210290T>C	ENST00000341319.3	-	6	1591	c.1556A>G	c.(1555-1557)tAt>tGt	p.Y519C		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	519					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)			p.Y519C(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			ACCAACGACATAGATGCGGTC	0.532																																																1	Substitution - Missense(1)	ovary(1)	3											134.0	111.0	119.0					3																	183210290		2203	4300	6503	184692984	SO:0001583	missense	89857			AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1556A>G	3.37:g.183210290T>C	ENSP00000341342:p.Tyr519Cys		184692984	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	19.14	3.770515	0.69992	.	.	ENSG00000172578	ENST00000341319	T	0.73897	-0.79	5.12	5.12	0.69794	Kelch-type beta propeller (1);	0.055265	0.85682	D	0.000000	D	0.89350	0.6690	M	0.93550	3.43	0.50632	D	0.999888	D	0.89917	1.0	D	0.81914	0.995	D	0.92215	0.5779	10	0.87932	D	0	.	15.21	0.73214	0.0:0.0:0.0:1.0	.	519	Q8WZ60	KLHL6_HUMAN	C	519	ENSP00000341342:Y519C	ENSP00000341342:Y519C	Y	-	2	0	KLHL6	184692984	1.000000	0.71417	0.966000	0.40874	0.863000	0.49368	6.129000	0.71657	2.051000	0.60960	0.482000	0.46254	TAT		0.532	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446		Missense_Mutation
EIF4G1	1981	genome.wustl.edu	37	3	184042725	184042725	+	Silent	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr3:184042725G>T	ENST00000346169.2	+	18	2950	c.2679G>T	c.(2677-2679)cgG>cgT	p.R893R	EIF4G1_ENST00000342981.4_Silent_p.R894R|EIF4G1_ENST00000352767.3_Silent_p.R900R|EIF4G1_ENST00000382330.3_Silent_p.R900R|EIF4G1_ENST00000411531.1_Silent_p.R854R|EIF4G1_ENST00000424196.1_Silent_p.R900R|SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000427845.1_Silent_p.R807R|EIF4G1_ENST00000319274.6_Silent_p.R893R|EIF4G1_ENST00000434061.2_Silent_p.R698R|EIF4G1_ENST00000441154.1_Silent_p.R730R|EIF4G1_ENST00000350481.5_Silent_p.R729R|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000435046.2_Silent_p.R697R|EIF4G1_ENST00000392537.2_Silent_p.R806R|EIF4G1_ENST00000414031.1_Silent_p.R853R	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	893	eIF3/EIF4A-binding.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.R893R(1)		central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TAGCCCGGCGGCGCTCTTTAG	0.478																																																1	Substitution - coding silent(1)	ovary(1)	3											67.0	77.0	73.0					3																	184042725		2203	4300	6503	185525419	SO:0001819	synonymous_variant	1981			D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.2679G>T	3.37:g.184042725G>T			185525419	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Silent	SNP	ENST00000346169.2	37	CCDS3259.1	SNP	42	WashU																																																																																				0.478	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917		Silent
FAT1	2195	genome.wustl.edu	37	4	187540678	187540678	+	Silent	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr4:187540678C>T	ENST00000441802.2	-	10	7271	c.7062G>A	c.(7060-7062)cgG>cgA	p.R2354R		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2354	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R2354R(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TCGTGTGCTGCCGGGACTGCT	0.498										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)											1	Substitution - coding silent(1)	ovary(1)	4											128.0	132.0	131.0					4																	187540678		2130	4241	6371	187777672	SO:0001819	synonymous_variant	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.7062G>A	4.37:g.187540678C>T			187777672		Silent	SNP	ENST00000441802.2	37	CCDS47177.1	SNP	26	WashU																																																																																				0.498	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		Silent
HECW2	57520	genome.wustl.edu	37	2	197297969	197297969	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:197297969C>T	ENST00000260983.3	-	2	361	c.179G>A	c.(178-180)aGc>aAc	p.S60N		NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	60					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S60N(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GGCAGTTAAGCTGGAGCGGCT	0.572																																																1	Substitution - Missense(1)	ovary(1)	2											82.0	74.0	77.0					2																	197297969		2203	4300	6503	197006214	SO:0001583	missense	57520			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.179G>A	2.37:g.197297969C>T	ENSP00000260983:p.Ser60Asn		197006214	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	16.94	3.260156	0.59321	.	.	ENSG00000138411	ENST00000260983;ENST00000452031;ENST00000427457	T;T;T	0.35605	1.3;1.3;1.3	5.27	5.27	0.74061	.	0.116141	0.64402	D	0.000011	T	0.39306	0.1073	M	0.67953	2.075	0.44702	D	0.997693	P	0.40638	0.725	B	0.38428	0.273	T	0.40905	-0.9538	10	0.66056	D	0.02	.	14.6536	0.68817	0.0:0.855:0.145:0.0	.	60	Q9P2P5	HECW2_HUMAN	N	60	ENSP00000260983:S60N;ENSP00000409918:S60N;ENSP00000395770:S60N	ENSP00000260983:S60N	S	-	2	0	HECW2	197006214	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	4.776000	0.62354	2.736000	0.93811	0.561000	0.74099	AGC		0.572	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760		Missense_Mutation
PPFIA4	8497	genome.wustl.edu	37	1	203037592	203037592	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:203037592T>A	ENST00000447715.2	+	32	3535	c.3094T>A	c.(3094-3096)Tgg>Agg	p.W1032R	PPFIA4_ENST00000272198.6_Missense_Mutation_p.W548R|PPFIA4_ENST00000599966.1_Missense_Mutation_p.W539R|PPFIA4_ENST00000414050.2_Missense_Mutation_p.W761R|PPFIA4_ENST00000367240.2_Missense_Mutation_p.W1033R|PPFIA4_ENST00000295706.4_Missense_Mutation_p.W539R			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	1032	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)		p.W1178R(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						TGTGTTAGTCTGGACCAACGA	0.552																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	73.0	73.0					1																	203037592		1969	4145	6114	201304215	SO:0001583	missense	8497			AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.3094T>A	1.37:g.203037592T>A	ENSP00000402576:p.Trp1032Arg		201304215	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Missense_Mutation	SNP	ENST00000447715.2	37		SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	t	20.5	3.998346	0.74818	.	.	ENSG00000143847	ENST00000367240;ENST00000447715;ENST00000295706;ENST00000414050;ENST00000272198	D;D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55;-2.55	3.62	3.62	0.41486	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.38663	U	0.001616	D	0.95878	0.8658	H	0.96175	3.78	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.96721	0.9532	10	0.87932	D	0	-14.2893	12.6981	0.57016	0.0:0.0:0.0:1.0	.	761;1032;234;539;548	B4DIS5;B1N949;B3KN22;O75335-2;O75335	.;.;.;.;LIPA4_HUMAN	R	1033;1032;539;761;548	ENSP00000356209:W1033R;ENSP00000402576:W1032R;ENSP00000295706:W539R;ENSP00000400379:W761R;ENSP00000272198:W548R	ENSP00000272198:W548R	W	+	1	0	PPFIA4	201304215	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	7.760000	0.85248	1.644000	0.50603	0.449000	0.29647	TGG		0.552	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1	NM_015053		Missense_Mutation
KCNH1	3756	genome.wustl.edu	37	1	210857394	210857394	+	Silent	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:210857394C>T	ENST00000271751.4	-	11	2226	c.2199G>A	c.(2197-2199)ccG>ccA	p.P733P	KCNH1_ENST00000367007.4_Silent_p.P706P			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	733	Calmodulin-binding.				myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.P733P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		CAGGGTGGTCCGGGGGCAAGA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	1											47.0	50.0	49.0					1																	210857394		2203	4300	6503	208924017	SO:0001819	synonymous_variant	3756			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2199G>A	1.37:g.210857394C>T			208924017	B1AQ26|O76035|Q14CL3	Silent	SNP	ENST00000271751.4	37	CCDS1496.1	SNP	23	WashU																																																																																				0.582	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238		Silent
USH2A	7399	genome.wustl.edu	37	1	216246484	216246484	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:216246484C>T	ENST00000307340.3	-	28	6117	c.5731G>A	c.(5731-5733)Gga>Aga	p.G1911R	RP11-22M7.2_ENST00000446411.1_RNA|RP11-22M7.2_ENST00000430890.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.G1911R|RP11-22M7.2_ENST00000445619.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1911	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.G1911R(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGCTCTTTTCCCTGGTAAACC	0.463										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1											86.0	76.0	79.0					1																	216246484		2203	4300	6503	214313107	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5731G>A	1.37:g.216246484C>T	ENSP00000305941:p.Gly1911Arg		214313107	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	33	5.249447	0.95305	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.44881	0.91;0.91	6.03	6.03	0.97812	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.44097	D	0.000492	T	0.67031	0.2850	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65344	-0.6191	10	0.56958	D	0.05	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	1911	O75445	USH2A_HUMAN	R	1911	ENSP00000305941:G1911R;ENSP00000355910:G1911R	ENSP00000305941:G1911R	G	-	1	0	USH2A	214313107	1.000000	0.71417	0.907000	0.35723	0.999000	0.98932	7.294000	0.78760	2.854000	0.98071	0.655000	0.94253	GGA		0.463	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Missense_Mutation
PTPRN	5798	genome.wustl.edu	37	2	220162763	220162763	+	Silent	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:220162763C>G	ENST00000295718.2	-	13	1971	c.1731G>C	c.(1729-1731)gtG>gtC	p.V577V	PTPRN_ENST00000409251.3_Silent_p.V548V|PTPRN_ENST00000497977.1_5'Flank|AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000423636.2_Silent_p.V487V	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	577					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.V577V(1)		breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GAGTGAGCAGCACTGAGCGCA	0.637																																																1	Substitution - coding silent(1)	ovary(1)	2											68.0	65.0	66.0					2																	220162763		2203	4300	6503	219871007	SO:0001819	synonymous_variant	5798				CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.1731G>C	2.37:g.220162763C>G			219871007	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Silent	SNP	ENST00000295718.2	37	CCDS2440.1	SNP	25	WashU																																																																																				0.637	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2			Silent
GPR55	9290	genome.wustl.edu	37	2	231774990	231774990	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:231774990C>G	ENST00000392040.1	-	2	880	c.688G>C	c.(688-690)Gcc>Ccc	p.A230P	GPR55_ENST00000392039.2_Missense_Mutation_p.A230P|AC012507.4_ENST00000454890.1_RNA	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	230					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)	p.A230P(1)		endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		GCCAGGCTGGCTGCGATGCTG	0.592																																																1	Substitution - Missense(1)	ovary(1)	2											92.0	93.0	93.0					2																	231774990		2203	4300	6503	231483234	SO:0001583	missense	9290			AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.688G>C	2.37:g.231774990C>G	ENSP00000375894:p.Ala230Pro		231483234	Q8N580	Missense_Mutation	SNP	ENST00000392040.1	37	CCDS2480.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	9.423	1.083497	0.20309	.	.	ENSG00000135898	ENST00000392040;ENST00000392039;ENST00000438398	T;T;T	0.40225	1.04;1.04;1.04	5.53	0.44	0.16572	GPCR, rhodopsin-like superfamily (1);	0.588445	0.18744	N	0.132363	T	0.43166	0.1235	M	0.78916	2.43	0.09310	N	1	B	0.32071	0.355	B	0.38296	0.27	T	0.44651	-0.9314	10	0.72032	D	0.01	-17.9653	5.3476	0.16018	0.5568:0.2809:0.0:0.1623	.	230	Q9Y2T6	GPR55_HUMAN	P	230	ENSP00000375894:A230P;ENSP00000375893:A230P;ENSP00000412768:A230P	ENSP00000375893:A230P	A	-	1	0	GPR55	231483234	0.302000	0.24454	0.000000	0.03702	0.097000	0.18754	0.875000	0.28079	-0.005000	0.14395	0.561000	0.74099	GCC		0.592	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332618.1	NM_005683		Missense_Mutation
RYR2	6262	genome.wustl.edu	37	1	237838123	237838123	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:237838123C>G	ENST00000366574.2	+	60	9124	c.8807C>G	c.(8806-8808)gCc>gGc	p.A2936G	RYR2_ENST00000360064.6_Missense_Mutation_p.A2934G|RYR2_ENST00000542537.1_Missense_Mutation_p.A2920G|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2936					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.A2934G(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTGGATGAAGCCCATCAGTAT	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											112.0	106.0	108.0					1																	237838123		1886	4113	5999	235904746	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8807C>G	1.37:g.237838123C>G	ENSP00000355533:p.Ala2936Gly		235904746	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756600	0.89843	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97924	-4.61;-4.58;-4.6	4.88	4.88	0.63580	.	0.185793	0.32190	U	0.006443	D	0.98077	0.9366	M	0.79123	2.44	0.80722	D	1	D	0.59357	0.985	P	0.53360	0.724	D	0.99153	1.0859	10	0.87932	D	0	.	18.3939	0.90492	0.0:1.0:0.0:0.0	.	2936	Q92736	RYR2_HUMAN	G	2936;2934;2920	ENSP00000355533:A2936G;ENSP00000353174:A2934G;ENSP00000443798:A2920G	ENSP00000353174:A2934G	A	+	2	0	RYR2	235904746	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.182000	0.77689	2.406000	0.81754	0.557000	0.71058	GCC		0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		Missense_Mutation
SCLY	51540	genome.wustl.edu	37	2	238991893	238991893	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:238991893A>T	ENST00000555827.1	+	7	846	c.782A>T	c.(781-783)tAt>tTt	p.Y261F	SCLY_ENST00000254663.6_Missense_Mutation_p.Y269F|SCLY_ENST00000373332.3_Missense_Mutation_p.Y179F|SCLY_ENST00000422984.2_Missense_Mutation_p.Y167F|SCLY_ENST00000409736.2_Missense_Mutation_p.Y261F|SCLY_ENST00000429612.2_Intron			Q96I15	SCLY_HUMAN	selenocysteine lyase	261					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)	pyridoxal phosphate binding (GO:0030170)|selenocysteine lyase activity (GO:0009000)|transferase activity (GO:0016740)	p.Y261F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	22		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		TTCCAGTTTTATGGTCCCAGG	0.443																																					Melanoma(24;424 891 11947 32582 36034)|Ovarian(46;648 1065 26199 32764 45893)											1	Substitution - Missense(1)	ovary(1)	2											149.0	136.0	140.0					2																	238991893		2203	4300	6503	238656632	SO:0001583	missense	51540			AF175767	CCDS2524.1, CCDS2524.2	2q37.3	2008-02-05			ENSG00000132330	ENSG00000132330			18161	protein-coding gene	gene with protein product	"""putative selenocysteine lyase"""	611056				10692412	Standard	NM_016510		Approved	SCL	uc010fyv.4	Q96I15	OTTHUMG00000133336	ENST00000555827.1:c.782A>T	2.37:g.238991893A>T	ENSP00000450613:p.Tyr261Phe		238656632	B9A068|J3KN06|Q53SN1|Q53SN8|Q7L670|Q9NVT7|Q9NZR7	Missense_Mutation	SNP	ENST00000555827.1	37		SNP	16	WashU	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	17.45|17.45|17.45	3.392835|3.392835|3.392835	0.62066|0.62066|0.62066	.|.|.	.|.|.	ENSG00000132330|ENSG00000132330|ENSG00000132330	ENST00000437134|ENST00000433750|ENST00000254663;ENST00000555827;ENST00000373332;ENST00000409736;ENST00000422984;ENST00000450965	.|.|T;T;D;D;T;D	.|.|0.87966	.|.|2.01;2.01;-2.32;-2.32;2.01;-2.32	5.79|5.79|5.79	4.64|4.64|4.64	0.57946|0.57946|0.57946	.|.|Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	D|D|D	0.93900|0.93900|0.93900	0.8048|0.8048|0.8048	M|M|M	0.90595|0.90595|0.90595	3.13|3.13|3.13	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D	.|.|0.89917	.|.|1.0;0.998;0.978	.|.|D;D;P	.|.|0.85130	.|.|0.997;0.97;0.84	D|D|D	0.93911|0.93911|0.93911	0.7197|0.7197|0.7197	5|5|10	.|.|0.72032	.|.|D	.|.|0.01	-24.5411|-24.5411|-24.5411	10.9022|10.9022|10.9022	0.47058|0.47058|0.47058	0.9255:0.0:0.0745:0.0|0.9255:0.0:0.0745:0.0|0.9255:0.0:0.0745:0.0	.|.|.	.|.|167;261;261	.|.|E7ESG3;Q96I15;Q96I15-2	.|.|.;SCLY_HUMAN;.	F|L|F	104|3|269;261;179;261;167;91	.|.|ENSP00000254663:Y269F;ENSP00000450613:Y261F;ENSP00000362429:Y179F;ENSP00000387162:Y261F;ENSP00000416865:Y167F;ENSP00000414053:Y91F	.|.|ENSP00000254663:Y261F	L|M|Y	+|+|+	3|1|2	2|0|0	SCLY|SCLY|SCLY	238656632|238656632|238656632	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.968000|0.968000|0.968000	0.41197|0.41197|0.41197	0.258000|0.258000|0.258000	0.26162|0.26162|0.26162	8.427000|8.427000|8.427000	0.90275|0.90275|0.90275	1.022000|1.022000|1.022000	0.39626|0.39626|0.39626	-0.256000|-0.256000|-0.256000	0.11100|0.11100|0.11100	TTA|ATG|TAT		0.443	SCLY-204	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_016510		Missense_Mutation
PKHD1L1	93035	genome.wustl.edu	37	8	110530403	110530403	+	Frame_Shift_Del	DEL	C	C	-			TCGA-23-1022-01	TCGA-23-1022-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr8:110530403delC	ENST00000378402.5	+	73	11801	c.11697delC	c.(11695-11697)ttcfs	p.F3899fs		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3899					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.L3904fs*38(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TAGACCAATTCCTTCCTAACC	0.343										HNSCC(38;0.096)																																						1	Deletion - Frameshift(1)	ovary(1)	8											75.0	66.0	68.0					8																	110530403		1859	4094	5953	110599579	SO:0001589	frameshift_variant	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.11697delC	8.37:g.110530403delC	ENSP00000367655:p.Phe3899fs		110599579	Q567P2|Q9UF27	Frame_Shift_Del	DEL	ENST00000378402.5	37	CCDS47911.1	DEL	30	WashU																																																																																				0.343	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		Frame_Shift_Del
ADRB2	154	genome.wustl.edu	37	5	148207445	148207445	+	Frame_Shift_Del	DEL	G	G	-			TCGA-23-1022-01	TCGA-23-1022-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:148207445delG	ENST00000305988.4	+	1	1290	c.1051delG	c.(1051-1053)gggfs	p.G351fs		NM_000024.5	NP_000015	P07550	ADRB2_HUMAN	adrenoceptor beta 2, surface	351					activation of adenylate cyclase activity (GO:0007190)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|bone resorption (GO:0045453)|brown fat cell differentiation (GO:0050873)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|diet induced thermogenesis (GO:0002024)|endosome to lysosome transport (GO:0008333)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of smooth muscle contraction (GO:0045986)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor-mediated endocytosis (GO:0006898)|regulation of sodium ion transport (GO:0002028)|regulation of vasodilation (GO:0042312)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta2-adrenergic receptor activity (GO:0004941)|norepinephrine binding (GO:0051380)|potassium channel regulator activity (GO:0015459)|protein homodimerization activity (GO:0042803)	p.N352fs>62(1)		endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(3)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Acebutolol(DB01193)|Alprenolol(DB00866)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Arformoterol(DB01274)|Asenapine(DB06216)|Atenolol(DB00335)|Bambuterol(DB01408)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dipivefrin(DB00449)|Dobutamine(DB00841)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Indacaterol(DB05039)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenoxybenzamine(DB00925)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Sotalol(DB00489)|Terbutaline(DB00871)|Timolol(DB00373)|Trimipramine(DB00726)	GAAGGCCTATGGGAATGGCTA	0.517																																																1	Deletion - Frameshift(1)	ovary(1)	5											55.0	57.0	56.0					5																	148207445		2203	4300	6503	148187638	SO:0001589	frameshift_variant	154			AF022953	CCDS4292.1	5q31-q32	2012-08-08	2012-05-09		ENSG00000169252	ENSG00000169252		"""GPCR / Class A : Adrenoceptors : beta"""	286	protein-coding gene	gene with protein product		109690	"""adrenergic, beta-2-, receptor, surface"""	ADRB2R			Standard	NM_000024		Approved	ADRBR, BAR, B2AR	uc003lpr.2	P07550	OTTHUMG00000129933	ENST00000305988.4:c.1051delG	5.37:g.148207445delG	ENSP00000305372:p.Gly351fs		148187638	B0LPE4|B2R7X2|O14823|O14824|O14825|O14826|Q4JG18|Q53GA6|Q6GMT4|Q6P4D8|Q8NEQ9|Q96EC3|Q9UCZ0|Q9UCZ1|Q9UCZ2|Q9UCZ3|Q9UH95|Q9UHA1|Q9UMZ5	Frame_Shift_Del	DEL	ENST00000305988.4	37	CCDS4292.1	DEL	47	WashU																																																																																				0.517	ADRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252189.1	NM_000024		Frame_Shift_Del
FAM120B	84498	genome.wustl.edu	37	6	170713658	170713659	+	Frame_Shift_Ins	INS	-	-	T			TCGA-23-1022-01	TCGA-23-1022-10	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:170713658_170713659insT	ENST00000476287.1	+	10	2821_2822	c.2713_2714insT	c.(2713-2715)gacfs	p.D905fs	FAM120B_ENST00000252510.9_Frame_Shift_Ins_p.D237fs|FAM120B_ENST00000540480.1_Frame_Shift_Ins_p.D917fs|FAM120B_ENST00000537664.1_Frame_Shift_Ins_p.D928fs|FAM120B_ENST00000496635.1_3'UTR	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	905					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		(1)		endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		GTATGAGCATGACCAGTGGAGA	0.386																																																1	Unknown(1)	ovary(1)	6																																								170555584	SO:0001589	frameshift_variant	84498			AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	Exception_encountered	6.37:g.170713658_170713659insT	ENSP00000417970:p.Asp905fs		170555583	B4DL34|Q86V68|Q96JI9	Frame_Shift_Ins	INS	ENST00000476287.1	37	CCDS5314.1	INS	45	WashU																																																																																				0.386	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448		Frame_Shift_Ins
BOLA1	51027	genome.wustl.edu	37	1	149871669	149871669	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	C	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:149871669G>C	ENST00000369153.2	+	3	721	c.57G>C	c.(55-57)ttG>ttC	p.L19F	BOLA1_ENST00000476344.1_Intron|BOLA1_ENST00000369152.5_Missense_Mutation_p.L19F|BOLA1_ENST00000369150.1_Missense_Mutation_p.L19F			Q9Y3E2	BOLA1_HUMAN	bolA family member 1	19						extracellular region (GO:0005576)|mitochondrion (GO:0005739)		p.L19F(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	10	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GCGTTTGTTTGTGCCAGGGCA	0.682																																																1	Substitution - Missense(1)	ovary(1)	1											38.0	44.0	42.0					1																	149871669		2203	4300	6503	148138293	SO:0001583	missense	51027			AF151901	CCDS939.1	1q21	2013-09-02	2013-09-02		ENSG00000178096	ENSG00000178096			24263	protein-coding gene	gene with protein product		613181	"""bolA-like 1 (E. coli)"", ""bolA homolog 1 (E. coli)"""			14718656	Standard	NM_016074		Approved	CGI-143	uc001etf.3	Q9Y3E2	OTTHUMG00000012087	ENST00000369153.2:c.57G>C	1.37:g.149871669G>C	ENSP00000358149:p.Leu19Phe		148138293	B2R7K2|D3DUZ4|Q5QNY0	Missense_Mutation	SNP	ENST00000369153.2	37	CCDS939.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334011	0.24253	.	.	ENSG00000178096	ENST00000369153;ENST00000369152;ENST00000369150	T;T;T	0.46451	0.87;0.87;0.87	4.55	3.62	0.41486	.	0.709712	0.12486	N	0.464665	T	0.11324	0.0276	N	0.14661	0.345	0.25773	N	0.984814	B	0.32968	0.392	B	0.33042	0.157	T	0.11767	-1.0574	10	0.51188	T	0.08	-3.5487	7.5122	0.27579	0.1964:0.0:0.8036:0.0	.	19	Q9Y3E2	BOLA1_HUMAN	F	19	ENSP00000358149:L19F;ENSP00000358148:L19F;ENSP00000358146:L19F	ENSP00000358146:L19F	L	+	3	2	BOLA1	148138293	0.039000	0.19947	0.978000	0.43139	0.076000	0.17211	0.529000	0.23019	1.233000	0.43693	0.455000	0.32223	TTG		0.682	BOLA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033443.2	NM_016074		Missense_Mutation
SLC2A5	6518	genome.wustl.edu	37	1	9098913	9098913	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:9098913C>T	ENST00000377424.4	-	9	1251	c.1072G>A	c.(1072-1074)Gtg>Atg	p.V358M	SLC2A5_ENST00000535586.1_Missense_Mutation_p.V243M|SLC2A5_ENST00000536305.1_Missense_Mutation_p.V299M	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	358					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)	p.V358M(1)		endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GCAGTGAGCACGCAGCAGGCT	0.667																																																1	Substitution - Missense(1)	ovary(1)	1											17.0	19.0	18.0					1																	9098913		2197	4297	6494	9021500	SO:0001583	missense	6518			BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1072G>A	1.37:g.9098913C>T	ENSP00000366641:p.Val358Met		9021500	Q14770|Q5T977|Q8IVB3	Missense_Mutation	SNP	ENST00000377424.4	37	CCDS99.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	14.04	2.418149	0.42918	.	.	ENSG00000142583	ENST00000377424;ENST00000456780;ENST00000536305;ENST00000535586	T;T;T	0.76316	-1.01;-1.01;-1.01	5.42	5.42	0.78866	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.131786	0.52532	D	0.000073	D	0.87521	0.6198	M	0.83384	2.64	0.47621	D	0.999479	D;D;D	0.69078	0.986;0.997;0.986	P;D;P	0.65684	0.803;0.937;0.861	D	0.88036	0.2778	10	0.49607	T	0.09	.	14.3269	0.66526	0.0:0.8507:0.1493:0.0	.	314;299;358	B4DG19;B4DU31;P22732	.;.;GTR5_HUMAN	M	358;341;299;243	ENSP00000366641:V358M;ENSP00000440688:V299M;ENSP00000442744:V243M	ENSP00000366641:V358M	V	-	1	0	SLC2A5	9021500	0.209000	0.23505	0.962000	0.40283	0.185000	0.23345	0.610000	0.24253	2.553000	0.86117	0.655000	0.94253	GTG		0.667	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039		Missense_Mutation
SHC1	6464	genome.wustl.edu	37	1	154942743	154942743	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr1:154942743G>A	ENST00000368445.5	-	1	474	c.260C>T	c.(259-261)gCa>gTa	p.A87V	SHC1_ENST00000448116.2_Missense_Mutation_p.A87V|SHC1_ENST00000368449.4_Intron|SHC1_ENST00000368450.1_Intron|SHC1_ENST00000368453.4_Intron|SHC1_ENST00000606391.1_Intron	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	87					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.A87V(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ATCATCAGCTGCCCTTCCTGG	0.672																																					NSCLC(4;32 234 1864 2492 3259 13747 17376)											1	Substitution - Missense(1)	ovary(1)	1											26.0	31.0	30.0					1																	154942743		2203	4298	6501	153209367	SO:0001583	missense	6464			U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.260C>T	1.37:g.154942743G>A	ENSP00000357430:p.Ala87Val		153209367	B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Missense_Mutation	SNP	ENST00000368445.5	37	CCDS30881.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	13.64	2.296564	0.40594	.	.	ENSG00000160691	ENST00000368445;ENST00000448116;ENST00000368443	T;T	0.55052	0.54;0.54	4.27	1.13	0.20643	.	0.533336	0.18979	N	0.125936	T	0.22475	0.0542	L	0.43152	1.355	0.58432	D	0.999999	B;B	0.33583	0.152;0.418	B;B	0.34180	0.05;0.177	T	0.03566	-1.1024	10	0.25751	T	0.34	.	7.2195	0.25979	0.1722:0.1413:0.6865:0.0	.	87;87	P29353-6;P29353	.;SHC1_HUMAN	V	87;87;23	ENSP00000357430:A87V;ENSP00000401303:A87V	ENSP00000357428:A23V	A	-	2	0	SHC1	153209367	0.817000	0.29147	0.713000	0.30519	0.955000	0.61496	2.071000	0.41500	0.552000	0.29026	0.555000	0.69702	GCA		0.672	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090781.2	NM_183001		Missense_Mutation
OR8U1	219417	genome.wustl.edu	37	11	56143423	56143423	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:56143423G>T	ENST00000302270.1	+	1	324	c.324G>T	c.(322-324)atG>atT	p.M108I		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M108I(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					TCACCTTCATGATATCAGAAT	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											176.0	168.0	171.0					11																	56143423		2078	4244	6322	55899999	SO:0001583	missense	219417			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.324G>T	11.37:g.56143423G>T	ENSP00000304188:p.Met108Ile		55899999		Missense_Mutation	SNP	ENST00000302270.1	37	CCDS41647.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.174182	0.00312	.	.	ENSG00000172199	ENST00000302270	T	0.00392	7.58	5.78	3.82	0.43975	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000016	T	0.00109	0.0003	N	0.01505	-0.83	0.09310	N	1	B	0.19706	0.038	B	0.15484	0.013	T	0.47341	-0.9125	10	0.06757	T	0.87	.	3.6393	0.08161	0.14:0.1393:0.577:0.1438	.	108	Q8NH10	OR8U1_HUMAN	I	108	ENSP00000304188:M108I	ENSP00000304188:M108I	M	+	3	0	OR8U1	55899999	0.000000	0.05858	0.730000	0.30809	0.006000	0.05464	-0.290000	0.08354	2.743000	0.94032	0.643000	0.83706	ATG		0.413	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391607.1	NM_001005204		Missense_Mutation
JAM3	83700	genome.wustl.edu	37	11	133939045	133939045	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	A	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr11:133939045C>A	ENST00000299106.4	+	1	226	c.67C>A	c.(67-69)Ctt>Att	p.L23I	JAM3_ENST00000441717.3_Missense_Mutation_p.L23I|JAM3_ENST00000529443.2_Missense_Mutation_p.L68I			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3	23					adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)	p.L68I(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		CCTGCTGCTGCTTTTCAGGGG	0.692																																																1	Substitution - Missense(1)	ovary(1)	11											20.0	19.0	19.0					11																	133939045		2170	4239	6409	133444255	SO:0001583	missense	83700			AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.67C>A	11.37:g.133939045C>A	ENSP00000299106:p.Leu23Ile		133444255	B3KWG9|Q8WWL8|Q96FL1	Missense_Mutation	SNP	ENST00000299106.4	37	CCDS8494.2	SNP	28	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.13|12.13	1.845600|1.845600	0.32606|0.32606	.|.	.|.	ENSG00000166086|ENSG00000166086	ENST00000534549;ENST00000531698;ENST00000529443|ENST00000299106;ENST00000441717	T|T	0.73789|0.79247	-0.78|-1.25	5.2|5.2	4.18|4.18	0.49190|0.49190	.|Immunoglobulin-like (1);	.|3.389020	.|0.00649	.|N	.|0.000551	T|T	0.63885|0.63885	0.2549|0.2549	N|N	0.14661|0.14661	0.345|0.345	0.28465|0.28465	N|N	0.915692|0.915692	.|P;B	.|0.39424	.|0.673;0.427	.|B;B	.|0.35813	.|0.211;0.142	T|T	0.60500|0.60500	-0.7251|-0.7251	6|10	.|0.46703	.|T	.|0.11	.|.	5.7822|5.7822	0.18312|0.18312	0.0:0.8311:0.0:0.1689|0.0:0.8311:0.0:0.1689	.|.	.|23;23	.|B3KWG9;Q9BX67	.|.;JAM3_HUMAN	D|I	27|68;23	ENSP00000431883:A27D|ENSP00000395742:L23I	.|ENSP00000299106:L68I	A|L	+|+	2|1	0|0	JAM3|JAM3	133444255|133444255	0.751000|0.751000	0.28327|0.28327	0.860000|0.860000	0.33809|0.33809	0.470000|0.470000	0.32858|0.32858	0.393000|0.393000	0.20817|0.20817	2.403000|2.403000	0.81681|0.81681	0.508000|0.508000	0.49915|0.49915	GCT|CTT		0.692	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393303.4	NM_032801		Missense_Mutation
HECTD4	283450	genome.wustl.edu	37	12	112610483	112610483	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr12:112610483C>T	ENST00000430131.2	-	66	11656	c.10511G>A	c.(10510-10512)tGt>tAt	p.C3504Y	HECTD4_ENST00000550722.1_Missense_Mutation_p.C3780Y|HECTD4_ENST00000377560.5_Missense_Mutation_p.C3754Y			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3504					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.C3504Y(1)									ACTCAGGAGACAGGCCACTCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	12											53.0	63.0	60.0					12																	112610483		2134	4244	6378	111094866	SO:0001583	missense	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.10511G>A	12.37:g.112610483C>T	ENSP00000404379:p.Cys3504Tyr		111094866	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	32	5.182680	0.94885	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.46451	0.87;0.87;0.87	5.75	5.75	0.90469	.	.	.	.	.	T	0.38692	0.1050	N	0.24115	0.695	0.58432	D	0.999999	P	0.50943	0.94	P	0.44732	0.459	T	0.32851	-0.9891	9	0.72032	D	0.01	.	19.9421	0.97168	0.0:1.0:0.0:0.0	.	3504	Q9Y4D8	K0614_HUMAN	Y	3754;3504;3780	ENSP00000366783:C3754Y;ENSP00000404379:C3504Y;ENSP00000449784:C3780Y	ENSP00000366783:C3754Y	C	-	2	0	C12orf51	111094866	1.000000	0.71417	0.992000	0.48379	0.924000	0.55760	7.456000	0.80751	2.714000	0.92807	0.561000	0.74099	TGT		0.612	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		Missense_Mutation
LIMS1	3987	genome.wustl.edu	37	2	109276124	109276125	+	Nonsense_Mutation	DNP	TG	TG	CT			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:109276124_109276125TG>CT	ENST00000393310.1	+	2	227_228	c.60_61TG>CT	c.(58-63)gcTGag>gcCTag	p.E21*	LIMS1_ENST00000542845.1_Nonsense_Mutation_p.E83*|LIMS1_ENST00000462817.1_3'UTR|LIMS1_ENST00000393314.2_Nonsense_Mutation_p.E83*|LIMS1_ENST00000544547.1_Nonsense_Mutation_p.E33*|LIMS1_ENST00000410093.1_Nonsense_Mutation_p.E25*|LIMS1_ENST00000332345.6_Nonsense_Mutation_p.E21*|LIMS1_ENST00000409441.1_Nonsense_Mutation_p.E58*|LIMS1_ENST00000338045.3_Nonsense_Mutation_p.E21*	NM_001193488.1	NP_001180417.1	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1	21	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell aging (GO:0007569)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chordate embryonic development (GO:0043009)|establishment or maintenance of cell polarity (GO:0007163)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|protein heterooligomerization (GO:0051291)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	10						TTGCGCCCGCTGAGAAGATCGT	0.574																																																0			2																																								108642557	SO:0001587	stop_gained	3987				CCDS2078.1, CCDS54382.1, CCDS54383.1, CCDS54384.1, CCDS54385.1	2q12.3	2008-05-23			ENSG00000169756	ENSG00000169756			6616	protein-coding gene	gene with protein product		602567				7517666, 10022929	Standard	NM_001193482		Approved	PINCH, PINCH1	uc002tek.4	P48059	OTTHUMG00000130983	Exception_encountered	2.37:g.109276124_109276125delinsCT	ENSP00000376987:p.Glu21*		108642556	B2RAJ4|B7Z483|B7Z7R3|B7Z907|Q53TE0|Q9BS44	Missense	DNP	ENST00000393310.1	37	CCDS2078.1	DNP	55	WashU																																																																																				0.574	LIMS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253596.1	NM_004987		Missense
ASNSD1	54529	genome.wustl.edu	37	2	190531586	190531586	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	A	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr2:190531586C>A	ENST00000260952.4	+	4	1141	c.728C>A	c.(727-729)cCt>cAt	p.P243H	ASNSD1_ENST00000607062.1_Intron	NM_019048.2	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	243					asparagine biosynthetic process (GO:0006529)|glutamine metabolic process (GO:0006541)		asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)	p.P243H(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(3)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			CCTGTTGTTCCTTTAAATATG	0.373																																																1	Substitution - Missense(1)	ovary(1)	2																																								190239831	SO:0001583	missense	54529			AY116969	CCDS2300.1	2q32.2	2012-09-20			ENSG00000138381	ENSG00000138381			24910	protein-coding gene	gene with protein product							Standard	NM_019048		Approved	NS3TP1, FLJ20752, NBLA00058	uc002uqt.3	Q9NWL6	OTTHUMG00000132665	ENST00000260952.4:c.728C>A	2.37:g.190531586C>A	ENSP00000260952:p.Pro243His		190239831	D3DPH6|Q3LIC3|Q4ZG45	Missense_Mutation	SNP	ENST00000260952.4	37	CCDS2300.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	21.4	4.138954	0.77775	.	.	ENSG00000138381	ENST00000260952;ENST00000420250	T;T	0.31769	1.48;1.49	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.51856	0.1699	M	0.76002	2.32	0.80722	D	1	D	0.61697	0.99	P	0.53401	0.725	T	0.51371	-0.8714	10	0.72032	D	0.01	2.4643	20.8794	0.99867	0.0:1.0:0.0:0.0	.	243	Q9NWL6	ASND1_HUMAN	H	243	ENSP00000260952:P243H;ENSP00000406790:P243H	ENSP00000260952:P243H	P	+	2	0	ASNSD1	190239831	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.421000	0.80204	2.941000	0.99782	0.655000	0.94253	CCT		0.373	ASNSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255919.3	NM_019048		Missense_Mutation
RIMS4	140730	genome.wustl.edu	37	20	43384918	43384919	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr20:43384918_43384919GC>AG	ENST00000372851.3	-	6	732_733	c.666_667GC>CT	c.(664-669)gaGCtg>gaCTtg	p.E222D	RIMS4_ENST00000541604.2_Missense_Mutation_p.E223D	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	222					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)		p.L223L(1)|p.E222D(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				GTCAAGTCCAGCTCCTCCAGCA	0.644																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(2)	20																																								42818333	SO:0001583	missense	140730				CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546	ENST00000372851.3:c.666_667delinsAG	20.37:g.43384918_43384919delinsAG	ENSP00000361942:p.Glu222Asp		42818332	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense	DNP	ENST00000372851.3	37	CCDS13338.1	DNP	34	WashU																																																																																				0.644	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	NM_182970		Missense
CELSR3	1951	genome.wustl.edu	37	3	48689423	48689423	+	Missense_Mutation	SNP	C	C	G	rs369174347		TCGA-23-1022-01	TCGA-23-1022-10	C	C	G	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr3:48689423C>G	ENST00000164024.4	-	12	6090	c.5810G>C	c.(5809-5811)cGa>cCa	p.R1937P	CELSR3_ENST00000544264.1_Missense_Mutation_p.R1937P	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1937	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.R1937P(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CGCATTCACTCGGTGGCTGGG	0.657																																																1	Substitution - Missense(1)	ovary(1)	3											29.0	32.0	31.0					3																	48689423		2203	4300	6503	48664427	SO:0001583	missense	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.5810G>C	3.37:g.48689423C>G	ENSP00000164024:p.Arg1937Pro		48664427	O75092	Missense_Mutation	SNP	ENST00000164024.4	37	CCDS2775.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	10.27	1.305045	0.23736	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.79653	-1.29;-1.29	5.72	2.57	0.30868	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	T	0.69540	0.3122	L	0.34521	1.04	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.59059	-0.7525	9	0.46703	T	0.11	.	8.1423	0.31091	0.0:0.5774:0.249:0.1736	.	1937;2007	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	P	1937	ENSP00000164024:R1937P;ENSP00000445694:R1937P	ENSP00000164024:R1937P	R	-	2	0	CELSR3	48664427	0.400000	0.25295	0.997000	0.53966	0.776000	0.43924	0.758000	0.26447	0.790000	0.33803	-0.797000	0.03246	CGA		0.657	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		Missense_Mutation
PTPN13	5783	genome.wustl.edu	37	4	87655895	87655895	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	T	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr4:87655895C>T	ENST00000411767.2	+	14	2081	c.2018C>T	c.(2017-2019)aCt>aTt	p.T673I	PTPN13_ENST00000316707.6_Missense_Mutation_p.T673I|PTPN13_ENST00000511467.1_Missense_Mutation_p.T673I|PTPN13_ENST00000427191.2_Missense_Mutation_p.T673I|PTPN13_ENST00000436978.1_Missense_Mutation_p.T673I			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	673	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)	p.T673I(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TTCAGACATACTCTGACGTGT	0.388																																																1	Substitution - Missense(1)	ovary(1)	4											99.0	93.0	95.0					4																	87655895		1888	4121	6009	87874919	SO:0001583	missense	5783				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.2018C>T	4.37:g.87655895C>T	ENSP00000407249:p.Thr673Ile		87874919	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	10.32	1.318284	0.23994	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	5.85	3.84	0.44239	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.378221	0.22298	N	0.061916	T	0.29620	0.0739	N	0.24115	0.695	0.09310	N	0.999998	P;B;P;P	0.52316	0.952;0.338;0.724;0.677	P;B;P;P	0.51582	0.674;0.377;0.511;0.48	T	0.07443	-1.0772	10	0.66056	D	0.02	.	10.419	0.44340	0.205:0.5504:0.2446:0.0	.	673;673;673;673	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	I	673;673;673;673;673;641	ENSP00000408368:T673I;ENSP00000394794:T673I;ENSP00000322675:T673I;ENSP00000407249:T673I;ENSP00000426626:T673I	ENSP00000322675:T673I	T	+	2	0	PTPN13	87874919	0.000000	0.05858	0.038000	0.18304	0.198000	0.23893	0.971000	0.29396	0.548000	0.28955	0.655000	0.94253	ACT		0.388	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1			Missense_Mutation
ENC1	8507	genome.wustl.edu	37	5	73931272	73931272	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:73931272C>G	ENST00000302351.4	-	2	2169	c.1039G>C	c.(1039-1041)Ggg>Cgg	p.G347R	ENC1_ENST00000510316.1_Missense_Mutation_p.G274R|ENC1_ENST00000537006.1_Missense_Mutation_p.G347R	NM_003633.3	NP_003624.1	O14682	ENC1_HUMAN	ectodermal-neural cortex 1 (with BTB domain)	347					multicellular organismal development (GO:0007275)|negative regulation of translation (GO:0017148)|nervous system development (GO:0007399)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.G347R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	20		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)		GACCCCCGCCCCCCAGTAATG	0.527																																																1	Substitution - Missense(1)	ovary(1)	5											91.0	100.0	97.0					5																	73931272		2203	4300	6503	73967028	SO:0001583	missense	8507			AF059611	CCDS4021.1, CCDS58958.1	5q13	2013-01-30	2013-01-30		ENSG00000171617	ENSG00000171617		"""Kelch-like"", ""BTB/POZ domain containing"""	3345	protein-coding gene	gene with protein product	"""kelch-like family member 37"""	605173	"""ectodermal-neural cortex 1 (with BTB-like domain)"""	NRPB		9305847, 9566959	Standard	NM_003633		Approved	PIG10, ENC-1, TP53I10, KLHL37	uc003kdc.5	O14682	OTTHUMG00000102059	ENST00000302351.4:c.1039G>C	5.37:g.73931272C>G	ENSP00000306356:p.Gly347Arg		73967028	B4DHJ1|E9PFU0|O75464|Q9UPG9	Missense_Mutation	SNP	ENST00000302351.4	37	CCDS4021.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061727	0.76187	.	.	ENSG00000171617	ENST00000302351;ENST00000510316;ENST00000537006	D;D;D	0.99494	-6.01;-6.01;-6.01	5.89	5.89	0.94794	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.99729	0.9894	H	0.96269	3.795	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	D	0.97575	1.0107	10	0.87932	D	0	.	20.2566	0.98424	0.0:1.0:0.0:0.0	.	347	O14682	ENC1_HUMAN	R	347;274;347	ENSP00000306356:G347R;ENSP00000423804:G274R;ENSP00000446289:G347R	ENSP00000306356:G347R	G	-	1	0	ENC1	73967028	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.818000	0.86416	2.793000	0.96121	0.561000	0.74099	GGG		0.527	ENC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219862.2	NM_003633		Missense_Mutation
ITK	3702	genome.wustl.edu	37	5	156649982	156649982	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	C	A	A	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr5:156649982A>C	ENST00000422843.3	+	6	757	c.605A>C	c.(604-606)gAc>gCc	p.D202A	CTB-4E7.1_ENST00000519375.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	202	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.D202A(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	TGCCTGCTGGACAGTTCTGAG	0.498			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	1	Substitution - Missense(1)	ovary(1)	5											139.0	130.0	133.0					5																	156649982		2203	4300	6503	156582560	SO:0001583	missense	3702			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.605A>C	5.37:g.156649982A>C	ENSP00000398655:p.Asp202Ala		156582560	B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	CCDS4336.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	22.0	4.234596	0.79800	.	.	ENSG00000113263	ENST00000422843	T	0.19669	2.13	5.81	5.81	0.92471	Src homology-3 domain (4);	0.097116	0.64402	D	0.000001	T	0.33089	0.0851	M	0.69823	2.125	0.52099	D	0.999947	P	0.38745	0.645	P	0.44477	0.451	T	0.08827	-1.0703	10	0.66056	D	0.02	.	13.7005	0.62606	1.0:0.0:0.0:0.0	.	202	Q08881	ITK_HUMAN	A	202	ENSP00000398655:D202A	ENSP00000398655:D202A	D	+	2	0	ITK	156582560	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.215000	0.72206	2.217000	0.71921	0.482000	0.46254	GAC		0.498	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2			Missense_Mutation
PDSS2	57107	genome.wustl.edu	37	6	107566787	107566787	+	Missense_Mutation	SNP	C	C	G	rs35555197	byFrequency	TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:107566787C>G	ENST00000369037.4	-	4	944	c.667G>C	c.(667-669)Gta>Cta	p.V223L	PDSS2_ENST00000453874.2_Missense_Mutation_p.V223L	NM_020381.3	NP_065114.3	Q86YH6	DLP1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 2	223					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|regulation of body fluid levels (GO:0050878)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)	p.V223L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)	19	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		ACTCCTTGTACCAAGTCCATA	0.294																																																1	Substitution - Missense(1)	ovary(1)	6											44.0	42.0	42.0					6																	107566787		2202	4295	6497	107673480	SO:0001583	missense	57107			AF254956	CCDS5059.1	6q21	2006-02-14	2006-02-14	2006-02-14	ENSG00000164494	ENSG00000164494			23041	protein-coding gene	gene with protein product		610564	"""chromosome 6 open reading frame 210"""	C6orf210		16262699	Standard	NM_020381		Approved	bA59I9.3	uc003prt.2	Q86YH6	OTTHUMG00000059359	ENST00000369037.4:c.667G>C	6.37:g.107566787C>G	ENSP00000358033:p.Val223Leu		107673480	Q33DR4|Q4G158|Q5VU38|Q5VU39|Q9NR58	Missense_Mutation	SNP	ENST00000369037.4	37	CCDS5059.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	17.36	3.370499	0.61624	.	.	ENSG00000164494	ENST00000369037;ENST00000453874	T;T	0.64438	-0.1;-0.1	5.6	5.6	0.85130	Terpenoid synthase (2);	0.056183	0.64402	D	0.000001	T	0.74928	0.3781	M	0.89785	3.06	0.58432	D	0.999998	P;P;P	0.49862	0.86;0.929;0.929	P;P;P	0.52309	0.695;0.627;0.627	T	0.79165	-0.1916	10	0.52906	T	0.07	.	19.6142	0.95626	0.0:1.0:0.0:0.0	.	223;223;223	B4DKU5;B2RE48;Q86YH6	.;.;DLP1_HUMAN	L	223	ENSP00000358033:V223L;ENSP00000399691:V223L	ENSP00000358033:V223L	V	-	1	0	PDSS2	107673480	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.940000	0.70187	2.631000	0.89168	0.585000	0.79938	GTA		0.294	PDSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131954.1	NM_020381		Missense_Mutation
RXRB	6257	genome.wustl.edu	37	6	33163374	33163374	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:33163374G>A	ENST00000374680.3	-	7	1440	c.1229C>T	c.(1228-1230)tCa>tTa	p.S410L	RXRB_ENST00000544186.1_Missense_Mutation_p.S220L|RXRB_ENST00000374685.4_Missense_Mutation_p.S410L	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	410	Ligand-binding. {ECO:0000250}.				cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.S410L(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	TACTCCTGCTGAATGGGCTGA	0.562																																																1	Substitution - Missense(1)	ovary(1)	6											94.0	89.0	91.0					6																	33163374		1510	2709	4219	33271352	SO:0001583	missense	6257			M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.1229C>T	6.37:g.33163374G>A	ENSP00000363812:p.Ser410Leu		33271352	P28703|Q59G65|Q5JP92|Q5STQ1	Missense_Mutation	SNP	ENST00000374680.3	37	CCDS4768.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	13.81	2.346933	0.41599	.	.	ENSG00000204231	ENST00000374685;ENST00000374680;ENST00000544186	D;D;D	0.96716	-4.1;-4.1;-4.1	5.35	3.52	0.40303	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.305250	0.33753	N	0.004596	D	0.95316	0.8480	L	0.41632	1.29	0.80722	D	1	B;D;D;D	0.76494	0.001;0.999;0.999;0.999	B;D;D;D	0.70935	0.008;0.971;0.96;0.971	D	0.94153	0.7407	10	0.37606	T	0.19	.	13.3383	0.60530	0.0:0.4688:0.5312:0.0	.	220;410;450;410	E9PK95;Q5STP9;Q59G65;P28702	.;.;.;RXRB_HUMAN	L	410;410;220	ENSP00000363817:S410L;ENSP00000363812:S410L;ENSP00000439222:S220L	ENSP00000363812:S410L	S	-	2	0	RXRB	33271352	1.000000	0.71417	0.448000	0.26945	0.538000	0.34931	6.671000	0.74472	0.788000	0.33755	0.549000	0.68633	TCA		0.562	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	NM_021976		Missense_Mutation
PEX3	8504	genome.wustl.edu	37	6	143792700	143792700	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1022-01	TCGA-23-1022-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr6:143792700C>G	ENST00000367591.4	+	7	593	c.530C>G	c.(529-531)aCa>aGa	p.T177R		NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	177					peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)	p.T177R(1)		endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		ATAGGCCTGACAGAATTGATC	0.294																																																1	Substitution - Missense(1)	ovary(1)	6											85.0	81.0	82.0					6																	143792700		2203	4298	6501	143834393	SO:0001583	missense	8504			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.530C>G	6.37:g.143792700C>G	ENSP00000356563:p.Thr177Arg		143834393	Q6FGP5	Missense_Mutation	SNP	ENST00000367591.4	37	CCDS5199.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	10.49	1.365789	0.24684	.	.	ENSG00000034693	ENST00000344281;ENST00000367592;ENST00000367591	T;T	0.40225	1.04;1.04	5.68	5.68	0.88126	.	0.189579	0.56097	D	0.000035	T	0.17789	0.0427	L	0.27053	0.805	0.44956	D	0.997975	B;B	0.31503	0.123;0.326	B;B	0.34536	0.026;0.185	T	0.04579	-1.0941	10	0.15499	T	0.54	-10.0695	14.3477	0.66678	0.0:0.929:0.0:0.071	.	177;177	B4DV31;P56589	.;PEX3_HUMAN	R	133;133;177	ENSP00000356564:T133R;ENSP00000356563:T177R	ENSP00000344195:T133R	T	+	2	0	PEX3	143834393	0.963000	0.33076	1.000000	0.80357	0.995000	0.86356	1.850000	0.39328	2.838000	0.97847	0.591000	0.81541	ACA		0.294	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042525.1			Missense_Mutation
COL1A2	1278	genome.wustl.edu	37	7	94054949	94054949	+	Missense_Mutation	SNP	G	G	A	rs72659309		TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr7:94054949G>A	ENST00000297268.6	+	43	3280	c.2809G>A	c.(2809-2811)Ggt>Agt	p.G937S		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	937					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.G937S(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGGTCCCCCAGGTCGCGATGG	0.478										HNSCC(75;0.22)																																						1	Substitution - Missense(1)	ovary(1)	7	GRCh37	CM070783	COL1A2	M	rs72659309						105.0	95.0	98.0					7																	94054949		2203	4300	6503	93892885	SO:0001583	missense	1278			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2809G>A	7.37:g.94054949G>A	ENSP00000297268:p.Gly937Ser		93892885	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	28.5	4.927895	0.92389	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.99167	-5.51	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.99507	0.9824	M	0.93594	3.435	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98459	1.0595	10	0.87932	D	0	.	19.5787	0.95455	0.0:0.0:1.0:0.0	.	937	P08123	CO1A2_HUMAN	S	937;938	ENSP00000297268:G937S	ENSP00000297268:G937S	G	+	1	0	COL1A2	93892885	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.657000	0.98554	2.941000	0.99782	0.655000	0.94253	GGT		0.478	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089		Missense_Mutation
MATN2	4147	genome.wustl.edu	37	8	98954029	98954029	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr8:98954029A>T	ENST00000520016.1	+	3	861	c.737A>T	c.(736-738)gAg>gTg	p.E246V	MATN2_ENST00000521689.1_Missense_Mutation_p.E246V|MATN2_ENST00000522025.2_Splice_Site|MATN2_ENST00000254898.5_Missense_Mutation_p.E246V|MATN2_ENST00000524308.1_Missense_Mutation_p.E246V			O00339	MATN2_HUMAN	matrilin 2	246	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.E246V(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			AGCACCCTGGAGCATAACTGT	0.502																																																1	Substitution - Missense(1)	ovary(1)	8											100.0	103.0	102.0					8																	98954029		2139	4252	6391	99023205	SO:0001583	missense	4147			U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.737A>T	8.37:g.98954029A>T	ENSP00000430487:p.Glu246Val		99023205	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	ENST00000520016.1	37	CCDS55264.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	16.50	3.139744	0.56936	.	.	ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000520016	D;D;D;D	0.96491	-4.03;-4.03;-4.03;-4.03	5.24	4.08	0.47627	Epidermal growth factor-like (1);EGF-like calcium-binding (1);	0.672540	0.13775	N	0.363633	D	0.92424	0.7595	L	0.33137	0.985	0.37674	D	0.923244	B;B;B;B	0.14438	0.01;0.004;0.005;0.007	B;B;B;B	0.16289	0.015;0.009;0.015;0.015	D	0.88398	0.3013	10	0.38643	T	0.18	-6.9535	9.3587	0.38182	0.9175:0.0:0.0825:0.0	.	246;246;246;246	E9PF03;O00339-2;O00339;Q8N2G3	.;.;MATN2_HUMAN;.	V	246	ENSP00000429977:E246V;ENSP00000254898:E246V;ENSP00000430221:E246V;ENSP00000430487:E246V	ENSP00000254898:E246V	E	+	2	0	MATN2	99023205	1.000000	0.71417	0.989000	0.46669	0.894000	0.52154	2.476000	0.45171	0.839000	0.34971	-0.379000	0.06801	GAG		0.502	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1			Missense_Mutation
SHARPIN	81858	genome.wustl.edu	37	8	145153859	145153859	+	Silent	SNP	G	G	A			TCGA-23-1022-01	TCGA-23-1022-10	G	G	G	A	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr8:145153859G>A	ENST00000398712.2	-	8	1522	c.1086C>T	c.(1084-1086)gcC>gcT	p.A362A	SHARPIN_ENST00000533948.1_5'Flank	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	362					apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)	p.A362A(1)		breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGCGGTCTGGGGCATTGATGA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	8											54.0	58.0	57.0					8																	145153859		2048	4217	6265	145225847	SO:0001819	synonymous_variant	81858			AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.1086C>T	8.37:g.145153859G>A			145225847	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Missense_Mutation	SNP	ENST00000398712.2	37	CCDS43777.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	g	15.59	2.879274	0.51801	.	.	ENSG00000179526	ENST00000359551	T	0.31510	1.49	4.62	0.638	0.17742	.	1.121610	0.06917	N	0.808765	T	0.27731	0.0682	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37686	-0.9695	7	0.39692	T	0.17	.	7.2447	0.26115	0.3912:0.0:0.6088:0.0	.	.	.	.	S	321	ENSP00000352551:P321S	ENSP00000352551:P321S	P	-	1	0	SHARPIN	145225847	0.958000	0.32768	0.540000	0.28089	0.760000	0.43138	0.542000	0.23222	0.188000	0.20168	0.550000	0.68814	CCC		0.612	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382901.1	NM_030974		Missense_Mutation
HPGDS	27306	genome.wustl.edu	37	4	95239089	95239089	+	Frame_Shift_Del	DEL	A	A	-			TCGA-23-1022-01	TCGA-23-1022-10	A	A	A	-	A	A	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chr4:95239089delA	ENST00000295256.5	-	3	251	c.161delT	c.(160-162)ttgfs	p.L54fs	HPGDS_ENST00000514774.1_5'UTR	NM_014485.2	NP_055300.1	O60760	HPGDS_HUMAN	hematopoietic prostaglandin D synthase	54	GST N-terminal.				arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|glutathione derivative biosynthetic process (GO:1901687)|locomotory behavior (GO:0007626)|prostaglandin metabolic process (GO:0006693)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	calcium ion binding (GO:0005509)|glutathione transferase activity (GO:0004364)|magnesium ion binding (GO:0000287)|prostaglandin-D synthase activity (GO:0004667)|protein homodimerization activity (GO:0042803)	p.L54fs*12(1)		breast(1)|cervix(1)|lung(3)|ovary(1)|urinary_tract(1)	7					Glutathione(DB00143)	ATCAACTTCCAAAATGGGGAT	0.323																																					Colon(86;1802 1843 17863 46794)											1	Deletion - Frameshift(1)	ovary(1)	4											84.0	85.0	85.0					4																	95239089		2203	4299	6502	95458112	SO:0001589	frameshift_variant	27306			D82073	CCDS3640.1	4q22.2	2012-06-21			ENSG00000163106	ENSG00000163106		"""Glutathione S-transferases / Soluble"""	17890	protein-coding gene	gene with protein product	"""glutathione S-transferase sigma"""	602598				9323136, 9353279, 11672424	Standard	XM_005262932		Approved	GSTS, PGDS, H-PGDS, PGD2, GSTS1-1	uc003hte.1	O60760	OTTHUMG00000130974	ENST00000295256.5:c.161delT	4.37:g.95239089delA	ENSP00000295256:p.Leu54fs		95458112	Q6FHT9	Frame_Shift_Del	DEL	ENST00000295256.5	37	CCDS3640.1	DEL	5	WashU																																																																																				0.323	HPGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253587.1	NM_014485		Frame_Shift_Del
KLHL34	257240	genome.wustl.edu	37	X	21674169	21674169	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1022-01	TCGA-23-1022-10	T	T	T	G	T	T	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1022-01	TCGA-23-1022-10	g.chrX:21674169T>G	ENST00000379499.2	-	1	2279	c.1738A>C	c.(1738-1740)Aag>Cag	p.K580Q		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	580						extracellular space (GO:0005615)		p.K580Q(1)		cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						TCCCGCCACTTGAGGCCGCCC	0.697																																																1	Substitution - Missense(1)	ovary(1)	X											21.0	19.0	19.0					X																	21674169		2198	4293	6491	21584090	SO:0001583	missense	257240			AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.1738A>C	X.37:g.21674169T>G	ENSP00000368813:p.Lys580Gln		21584090		Missense_Mutation	SNP	ENST00000379499.2	37	CCDS14199.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	18.84	3.709785	0.68730	.	.	ENSG00000185915	ENST00000379499	T	0.72835	-0.69	5.35	5.35	0.76521	Kelch-type beta propeller (1);	0.063652	0.64402	D	0.000008	T	0.76392	0.3981	L	0.44542	1.39	0.33634	D	0.606424	D	0.69078	0.997	P	0.60789	0.879	D	0.83479	0.0063	10	0.54805	T	0.06	.	14.3873	0.66953	0.0:0.0:0.0:1.0	.	580	Q8N239	KLH34_HUMAN	Q	580	ENSP00000368813:K580Q	ENSP00000368813:K580Q	K	-	1	0	KLHL34	21584090	1.000000	0.71417	0.987000	0.45799	0.963000	0.63663	5.959000	0.70339	1.973000	0.57446	0.486000	0.48141	AAG		0.697	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056022.1	NM_153270		Missense_Mutation
