#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
AKR1C4	1109	hgsc.bcm.edu	37	10	5247796	5247796	+	Splice_Site	SNP	A	A	C			TCGA-23-1026-01	TCGA-23-1026-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr10:5247796A>C	ENST00000380448.1	+	6	699	c.446A>C	c.(445-447)gAg>gCg	p.E149A	AKR1C4_ENST00000263126.1_Splice_Site_p.E149A			P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4	149					androgen metabolic process (GO:0008209)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|bile acid transmembrane transporter activity (GO:0015125)|chlordecone reductase activity (GO:0047743)|electron carrier activity (GO:0009055)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|retinal dehydrogenase activity (GO:0001758)	p.E149A(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	18						GCCACATGGGAGGTGAGTGCT	0.448																																																1	Substitution - Missense(1)	ovary(1)	10											119.0	105.0	109.0					10																	5247796		2203	4300	6503	5237796	SO:0001630	splice_region_variant	1109			M33375	CCDS7064.1	10p15.1	2012-12-04	2012-12-04		ENSG00000198610	ENSG00000198610	1.1.1.225	"""Aldo-keto reductases"""	387	protein-coding gene	gene with protein product	"""chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4"""	600451	"""aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)"""	CHDR		7789999	Standard	NM_001818		Approved	DD4, HAKRA, C11, 3-alpha-HSD, CDR, MGC22581	uc001ihw.2	P17516	OTTHUMG00000017591	ENST00000380448.1:c.447+1A>C	10.37:g.5247796A>C			5237796	Q5T6A3|Q8WW84|Q9NS54	Missense_Mutation	SNP	ENST00000380448.1	37	CCDS7064.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.951	1.220177	0.22373	.	.	ENSG00000198610	ENST00000380448;ENST00000263126	T;T	0.52983	0.64;0.64	3.16	3.16	0.36331	NADP-dependent oxidoreductase domain (3);	0.270365	0.31031	N	0.008395	T	0.41673	0.1169	L	0.28740	0.885	0.45025	D	0.998044	B	0.25441	0.126	B	0.39904	0.313	T	0.38845	-0.9642	10	0.48119	T	0.1	.	9.6032	0.39617	1.0:0.0:0.0:0.0	.	149	P17516	AK1C4_HUMAN	A	149	ENSP00000369814:E149A;ENSP00000263126:E149A	ENSP00000263126:E149A	E	+	2	0	AKR1C4	5237796	1.000000	0.71417	0.995000	0.50966	0.028000	0.11728	7.251000	0.78297	1.195000	0.43115	0.260000	0.18958	GAG		0.448	AKR1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046543.2	NM_001818	Missense_Mutation	Missense_Mutation
ATP13A5	344905	hgsc.bcm.edu	37	3	193042719	193042719	+	Silent	SNP	C	C	T			TCGA-23-1026-01	TCGA-23-1026-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr3:193042719C>T	ENST00000342358.4	-	14	1725	c.1608G>A	c.(1606-1608)ctG>ctA	p.L536L		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	536						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.L536L(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TGAGAAGGATCAGAGAGTGGC	0.542																																																1	Substitution - coding silent(1)	ovary(1)	3											123.0	130.0	128.0					3																	193042719		2203	4300	6503	194525413	SO:0001819	synonymous_variant	344905			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1608G>A	3.37:g.193042719C>T			194525413	Q6UWS4|Q6ZWL0	Silent	SNP	ENST00000342358.4	37	CCDS33914.1	SNP	29	Baylor																																																																																				0.542	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505		Silent
BRCA1	672	hgsc.bcm.edu	37	17	41245110	41245110	+	Frame_Shift_Del	DEL	C	C	-			TCGA-23-1026-01	TCGA-23-1026-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr17:41245110delC	ENST00000357654.3	-	10	2556	c.2438delG	c.(2437-2439)ggafs	p.G813fs	BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_Frame_Shift_Del_p.G517fs|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000354071.3_Frame_Shift_Del_p.G813fs|BRCA1_ENST00000471181.2_Frame_Shift_Del_p.G813fs|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000493795.1_Frame_Shift_Del_p.G766fs|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000346315.3_Frame_Shift_Del_p.G813fs|BRCA1_ENST00000591534.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	813					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G813fs*2(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		ATGAATTAGTCCCTTGGGGTT	0.403			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	1	Deletion - Frameshift(1)	ovary(1)	17											223.0	222.0	222.0					17																	41245110		2203	4300	6503	38498636	SO:0001589	frameshift_variant	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.2438delG	17.37:g.41245110delC	ENSP00000350283:p.Gly813fs		38498636	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Frame_Shift_Del	DEL	ENST00000357654.3	37	CCDS11453.1	DEL	30	Baylor																																																																																				0.403	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294		Frame_Shift_Del
CDIP1	29965	hgsc.bcm.edu	37	16	4562577	4562577	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1026-01	TCGA-23-1026-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr16:4562577C>A	ENST00000399599.3	-	5	1171	c.623G>T	c.(622-624)tGc>tTc	p.C208F	CDIP1_ENST00000563332.2_Missense_Mutation_p.C208F|CDIP1_ENST00000567695.1_Missense_Mutation_p.C208F|CDIP1_ENST00000562334.1_Missense_Mutation_p.C129F|CDIP1_ENST00000563507.1_Missense_Mutation_p.C169F|CDIP1_ENST00000564828.1_3'UTR			Q9H305	CDIP1_HUMAN	cell death-inducing p53 target 1	208					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	nucleus (GO:0005634)		p.C208F(1)									GCTCCGTTAGCACAGGCGCTT	0.607																																																1	Substitution - Missense(1)	ovary(1)	16											59.0	63.0	62.0					16																	4562577		2108	4246	6354	4502578	SO:0001583	missense	29965			AF131218	CCDS42114.1, CCDS58419.1, CCDS58420.1	16p13.3	2012-11-14	2012-11-14	2012-11-14	ENSG00000089486	ENSG00000089486			13234	protein-coding gene	gene with protein product	"""cell death involved p53-target"", ""lipopolysaccharide-induced TNF factor-like"""	610503	"""chromosome 16 open reading frame 5"""	C16orf5		10570909, 17599062	Standard	NM_013399		Approved	CDIP, LITAFL	uc002cww.3	Q9H305	OTTHUMG00000177172	ENST00000399599.3:c.623G>T	16.37:g.4562577C>A	ENSP00000382508:p.Cys208Phe		4502578	A8K7M1|B4DFU1|B4DY75|D3DUD6|Q96ID8|Q9H0Q4|Q9P112	Missense_Mutation	SNP	ENST00000399599.3	37	CCDS42114.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.9	4.957722	0.92726	.	.	ENSG00000089486	ENST00000399599	D	0.93659	-3.26	5.85	5.85	0.93711	.	.	.	.	.	D	0.95551	0.8554	L	0.48877	1.53	0.80722	D	1	D;D;D	0.63046	0.98;0.992;0.98	D;D;D	0.74023	0.962;0.982;0.974	D	0.95680	0.8731	9	0.87932	D	0	-8.7833	18.7358	0.91753	0.0:1.0:0.0:0.0	.	129;169;208	B4DY75;B4DFU1;Q9H305	.;.;LITFL_HUMAN	F	208	ENSP00000382508:C208F	ENSP00000382508:C208F	C	-	2	0	C16orf5	4502578	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.629000	0.83207	2.767000	0.95098	0.655000	0.94253	TGC		0.607	CDIP1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435718.2	NM_013399		Missense_Mutation
C16orf70	80262	hgsc.bcm.edu	37	16	67180988	67180989	+	Frame_Shift_Ins	INS	-	-	C	rs539297455	byFrequency	TCGA-23-1026-01	TCGA-23-1026-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr16:67180988_67180989insC	ENST00000219139.3	+	16	1411_1412	c.1223_1224insC	c.(1222-1227)ggccccfs	p.GP408fs	C16orf70_ENST00000569600.1_Frame_Shift_Ins_p.GP408fs	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70	408								p.R411fs*4(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		ACCCTGTATGGCCCCCCCAGGC	0.594													CCCCCCT|CCCCCCC|CCCCCCCC|complex_insertion	5	0.000998403	0.0008	0.0029	5008	,	,		22846	0.0		0.0	False		,,,				2504	0.002															1	Insertion - Frameshift(1)	ovary(1)	16																																								65738490	SO:0001589	frameshift_variant	80262			AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510	ENST00000219139.3:c.1230dupC	16.37:g.67180995_67180995dupC	ENSP00000219139:p.Gly408fs		65738489	Q9HA86	Frame_Shift_Ins	INS	ENST00000219139.3	37	CCDS10828.1	INS	42	Baylor																																																																																				0.594	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268829.2	NM_025187		Frame_Shift_Ins
C5orf22	55322	hgsc.bcm.edu	37	5	31545772	31545772	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1026-01	TCGA-23-1026-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr5:31545772C>T	ENST00000325366.9	+	7	1139	c.1012C>T	c.(1012-1014)Ctt>Ttt	p.L338F	C5orf22_ENST00000355907.3_5'UTR	NM_018356.2	NP_060826.2	Q49AR2	CE022_HUMAN	chromosome 5 open reading frame 22	338								p.L338F(1)|p.L338I(1)		kidney(3)|large_intestine(2)|lung(10)|ovary(2)|skin(1)	18						ACTAGTTCCCCTTGTACAGAG	0.308																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	5											162.0	164.0	163.0					5																	31545772		2203	4299	6502	31581529	SO:0001583	missense	55322			AK002055	CCDS3895.1	5p13.3	2012-02-22			ENSG00000082213	ENSG00000082213			25639	protein-coding gene	gene with protein product							Standard	NM_018356		Approved	FLJ11193	uc003jhj.4	Q49AR2	OTTHUMG00000131067	ENST00000325366.9:c.1012C>T	5.37:g.31545772C>T	ENSP00000326879:p.Leu338Phe		31581529	Q8ND28|Q8WU61|Q9NUR1	Missense_Mutation	SNP	ENST00000325366.9	37	CCDS3895.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747221	0.89663	.	.	ENSG00000082213	ENST00000325366;ENST00000543911	T	0.38077	1.16	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.62134	0.2403	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62426	-0.6857	10	0.54805	T	0.06	-23.337	19.4899	0.95046	0.0:1.0:0.0:0.0	.	338	Q49AR2	CE022_HUMAN	F	338;73	ENSP00000326879:L338F	ENSP00000326879:L338F	L	+	1	0	C5orf22	31581529	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.954000	0.63631	2.603000	0.88011	0.555000	0.69702	CTT		0.308	C5orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253726.2	NM_018356		Missense_Mutation
CNGB3	54714	hgsc.bcm.edu	37	8	87679289	87679289	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1026-01	TCGA-23-1026-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr8:87679289C>T	ENST00000320005.5	-	6	763	c.716G>A	c.(715-717)cGc>cAc	p.R239H		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	239					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.R239H(1)		NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						GAAGACGAGGCGCAGTGGTAT	0.428																																																1	Substitution - Missense(1)	ovary(1)	8											112.0	103.0	106.0					8																	87679289		2203	4300	6503	87748405	SO:0001583	missense	54714			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.716G>A	8.37:g.87679289C>T	ENSP00000316605:p.Arg239His		87748405	C9JA51|Q9NRE9	Missense_Mutation	SNP	ENST00000320005.5	37	CCDS6244.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.7	4.943318	0.92593	.	.	ENSG00000170289	ENST00000320005	T	0.14266	2.52	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.47358	0.1441	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.55159	-0.8184	10	0.87932	D	0	.	19.4973	0.95079	0.0:1.0:0.0:0.0	.	239;239	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	H	239	ENSP00000316605:R239H	ENSP00000316605:R239H	R	-	2	0	CNGB3	87748405	1.000000	0.71417	0.949000	0.38748	0.654000	0.38779	6.033000	0.70925	2.608000	0.88229	0.655000	0.94253	CGC		0.428	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098		Missense_Mutation
DDIT3	1649	hgsc.bcm.edu	37	12	57910760	57910760	+	Silent	SNP	C	C	T			TCGA-23-1026-01	TCGA-23-1026-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr12:57910760C>T	ENST00000346473.3	-	4	521	c.342G>A	c.(340-342)cgG>cgA	p.R114R	DDIT3_ENST00000551116.1_Silent_p.R137R|DDIT3_ENST00000547303.1_Silent_p.R114R|MIR616_ENST00000385293.1_RNA|RN7SL312P_ENST00000582079.1_RNA|DDIT3_ENST00000552740.1_Silent_p.R137R	NM_001195057.1|NM_004083.5	NP_001181986.1|NP_004074.2	P35638	DDIT3_HUMAN	DNA-damage-inducible transcript 3	114	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|blood vessel maturation (GO:0001955)|cell cycle arrest (GO:0007050)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of determination of dorsal identity (GO:2000016)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|regulation of transcription, DNA-templated (GO:0006355)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to starvation (GO:0042594)|response to unfolded protein (GO:0006986)|Wnt signaling pathway (GO:0016055)	late endosome (GO:0005770)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.R114R(1)	EWSR1/DDIT3(45)|FUS/DDIT3(631)	central_nervous_system(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)	16						GCTTTCCAGCCCGGGCTGGGG	0.542			T	FUS	liposarcoma																																GBM(112;1383 1547 7626 23045 28770)		Dom	yes		12	12q13.1-q13.2	1649	DNA-damage-inducible transcript 3		M	1	Substitution - coding silent(1)	large_intestine(1)	12											138.0	147.0	144.0					12																	57910760		2203	4300	6503	56197027	SO:0001819	synonymous_variant	1649			BC003637	CCDS8943.1, CCDS55838.1	12q13.1-q13.2	2008-02-05				ENSG00000175197			2726	protein-coding gene	gene with protein product	"""C/EBP zeta"""	126337				1990262	Standard	NM_001195053		Approved	CHOP10, GADD153, CHOP	uc021qzk.1	P35638		ENST00000346473.3:c.342G>A	12.37:g.57910760C>T			56197027	F8VS99	Silent	SNP	ENST00000346473.3	37	CCDS8943.1	SNP	22	Baylor																																																																																				0.542	DDIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407137.1	NM_004083		Silent
DUSP19	142679	hgsc.bcm.edu	37	2	183943752	183943752	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1026-01	TCGA-23-1026-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr2:183943752A>G	ENST00000354221.4	+	1	266	c.91A>G	c.(91-93)Att>Gtt	p.I31V	DUSP19_ENST00000469344.1_3'UTR|DUSP19_ENST00000342619.6_Missense_Mutation_p.I31V	NM_080876.3	NP_543152.1	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19	31					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase activity (GO:0045860)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	JUN kinase phosphatase activity (GO:0008579)|MAP-kinase scaffold activity (GO:0005078)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase activator activity (GO:0030295)|protein kinase inhibitor activity (GO:0004860)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/threonine phosphatase activity (GO:0008330)	p.I31V(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(4)|pancreas(1)	17						TGGAAAGAAAATTATAGAAAC	0.453																																																1	Substitution - Missense(1)	ovary(1)	2											116.0	118.0	118.0					2																	183943752		2203	4300	6503	183651997	SO:0001583	missense	142679			AB038770	CCDS2289.1, CCDS46469.1	2q32.1	2011-06-09			ENSG00000162999	ENSG00000162999		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18894	protein-coding gene	gene with protein product		611437					Standard	NM_080876		Approved	SKRP1, DUSP17	uc002upd.3	Q8WTR2	OTTHUMG00000132622	ENST00000354221.4:c.91A>G	2.37:g.183943752A>G	ENSP00000346160:p.Ile31Val		183651997	B2RA79|Q547H4|Q8WYN4	Missense_Mutation	SNP	ENST00000354221.4	37	CCDS2289.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.99	2.701751	0.48307	.	.	ENSG00000162999	ENST00000342619;ENST00000354221	T;T	0.16196	2.36;3.77	6.17	2.21	0.28008	.	0.385018	0.29868	N	0.010989	T	0.12902	0.0313	L	0.34521	1.04	0.32762	N	0.504902	B;B	0.17667	0.023;0.016	B;B	0.12156	0.007;0.004	T	0.13150	-1.0520	10	0.19147	T	0.46	.	14.4546	0.67409	0.5978:0.4022:0.0:0.0	.	31;31	Q8WTR2-2;Q8WTR2	.;DUS19_HUMAN	V	31	ENSP00000343905:I31V;ENSP00000346160:I31V	ENSP00000343905:I31V	I	+	1	0	DUSP19	183651997	0.985000	0.35326	0.984000	0.44739	0.991000	0.79684	1.272000	0.33109	1.134000	0.42165	0.533000	0.62120	ATT		0.453	DUSP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255866.1			Missense_Mutation
ERCC6L	54821	hgsc.bcm.edu	37	X	71426275	71426275	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1026-01	TCGA-23-1026-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chrX:71426275G>A	ENST00000334463.3	-	2	2477	c.2342C>T	c.(2341-2343)cCc>cTc	p.P781L	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000373657.1_Missense_Mutation_p.P658L	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	781					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.P781L(1)		breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					ACCCTCTTTGGGCAGATCATC	0.413																																																1	Substitution - Missense(1)	ovary(1)	X											132.0	120.0	124.0					X																	71426275		2203	4300	6503	71343000	SO:0001583	missense	54821			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.2342C>T	X.37:g.71426275G>A	ENSP00000334675:p.Pro781Leu		71343000	Q8NCI1|Q96H93|Q9NXQ8	Missense_Mutation	SNP	ENST00000334463.3	37	CCDS35329.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.77	2.037925	0.35989	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	D;D	0.90504	-2.65;-2.68	5.04	4.11	0.48088	.	.	.	.	.	D	0.86418	0.5928	L	0.44542	1.39	0.09310	N	1	B	0.20052	0.041	B	0.16289	0.015	T	0.77915	-0.2409	9	0.49607	T	0.09	-1.4678	11.1586	0.48501	0.0:0.0:0.8157:0.1843	.	781	Q2NKX8	ERC6L_HUMAN	L	658;781	ENSP00000362761:P658L;ENSP00000334675:P781L	ENSP00000334675:P781L	P	-	2	0	ERCC6L	71343000	0.000000	0.05858	0.005000	0.12908	0.101000	0.19017	0.184000	0.16939	2.230000	0.72887	0.594000	0.82650	CCC		0.413	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669		Missense_Mutation
IL23R	149233	hgsc.bcm.edu	37	1	67648526	67648526	+	Silent	SNP	A	A	T			TCGA-23-1026-01	TCGA-23-1026-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr1:67648526A>T	ENST00000347310.5	+	4	546	c.375A>T	c.(373-375)ccA>ccT	p.P125P	C1orf141_ENST00000371007.2_Intron|IL23R_ENST00000371002.1_Silent_p.P125P	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor	125					defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)		p.P125P(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						CAGATCCGCCAGATATTCCTG	0.438																																																1	Substitution - coding silent(1)	ovary(1)	1											164.0	161.0	162.0					1																	67648526		2203	4300	6503	67421114	SO:0001819	synonymous_variant	149233			AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.375A>T	1.37:g.67648526A>T			67421114	C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	Silent	SNP	ENST00000347310.5	37	CCDS637.1	SNP	7	Baylor																																																																																				0.438	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025199.2	NM_144701		Silent
HHIPL2	79802	hgsc.bcm.edu	37	1	222717252	222717252	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1026-01	TCGA-23-1026-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr1:222717252G>A	ENST00000343410.6	-	2	659	c.601C>T	c.(601-603)Cct>Tct	p.P201S		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	201					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)	p.P201S(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CAGCCCTGAGGATCTTGGGCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											53.0	56.0	55.0					1																	222717252		2203	4300	6503	220783875	SO:0001583	missense	79802			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.601C>T	1.37:g.222717252G>A	ENSP00000342118:p.Pro201Ser		220783875	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	CCDS1530.2	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.859147	0.00552	.	.	ENSG00000143512	ENST00000343410	T	0.73789	-0.78	5.31	3.43	0.39272	Folate receptor-like (1);Six-bladed beta-propeller, TolB-like (1);	1.193380	0.06390	N	0.716982	T	0.68586	0.3017	L	0.55103	1.725	0.09310	N	1	B	0.13594	0.008	B	0.15052	0.012	T	0.51348	-0.8717	10	0.27082	T	0.32	1.4485	6.4166	0.21719	0.073:0.1313:0.6598:0.1359	.	201	Q6UWX4	HIPL2_HUMAN	S	201	ENSP00000342118:P201S	ENSP00000342118:P201S	P	-	1	0	HHIPL2	220783875	0.091000	0.21658	0.031000	0.17742	0.013000	0.08279	0.446000	0.21694	0.603000	0.29913	0.467000	0.42956	CCT		0.602	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746		Missense_Mutation
KIAA2026	158358	hgsc.bcm.edu	37	9	5923031	5923031	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1026-01	TCGA-23-1026-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr9:5923031C>A	ENST00000399933.3	-	8	2964	c.2965G>T	c.(2965-2967)Gcc>Tcc	p.A989S	KIAA2026_ENST00000381461.2_Missense_Mutation_p.A959S	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	989								p.A164S(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TCCAATGAGGCAAATGACTCT	0.403																																																1	Substitution - Missense(1)	ovary(1)	9											147.0	137.0	140.0					9																	5923031		1909	4134	6043	5913031	SO:0001583	missense	158358			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2965G>T	9.37:g.5923031C>A	ENSP00000382815:p.Ala989Ser		5913031	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	37		SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.979	1.227596	0.22542	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.4	3.46	0.39613	.	0.363764	0.23477	N	0.047759	T	0.24431	0.0592	N	0.17082	0.46	0.25971	N	0.982499	B	0.23377	0.084	B	0.18561	0.022	T	0.12837	-1.0532	9	0.27082	T	0.32	-1.7065	9.7186	0.40289	0.2921:0.5809:0.127:0.0	.	989	Q5HYC2	K2026_HUMAN	S	989;959	.	ENSP00000370870:A959S	A	-	1	0	KIAA2026	5913031	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	1.765000	0.38481	1.247000	0.43917	0.462000	0.41574	GCC		0.403	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969		Missense_Mutation
MTF2	22823	hgsc.bcm.edu	37	1	93602348	93602348	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1026-01	TCGA-23-1026-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr1:93602348G>T	ENST00000370298.4	+	15	1835	c.1546G>T	c.(1546-1548)Gta>Tta	p.V516L	MTF2_ENST00000540243.1_Missense_Mutation_p.V414L|MTF2_ENST00000545708.1_Missense_Mutation_p.V414L|MTF2_ENST00000370303.4_Missense_Mutation_p.V459L|MTF2_ENST00000471953.1_3'UTR	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	516					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.V516L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		CTCAGAAATTGTAAAAGATGA	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											92.0	89.0	90.0					1																	93602348		2203	4300	6503	93374936	SO:0001583	missense	22823			AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.1546G>T	1.37:g.93602348G>T	ENSP00000359321:p.Val516Leu		93374936	A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Missense_Mutation	SNP	ENST00000370298.4	37	CCDS742.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275947	0.40294	.	.	ENSG00000143033	ENST00000545708;ENST00000540243;ENST00000370298;ENST00000370303	T;T;T;T	0.29397	1.57;1.57;1.98;1.96	5.9	4.99	0.66335	.	0.327890	0.33040	N	0.005355	T	0.08044	0.0201	N	0.14661	0.345	0.37965	D	0.933083	B;B;B	0.22003	0.063;0.001;0.004	B;B;B	0.19666	0.026;0.001;0.004	T	0.11817	-1.0572	10	0.28530	T	0.3	-6.841	11.0071	0.47641	0.1414:0.0:0.8586:0.0	.	459;516;414	B1AKT6;Q9Y483;B4DZG1	.;MTF2_HUMAN;.	L	414;414;516;459	ENSP00000444962:V414L;ENSP00000443295:V414L;ENSP00000359321:V516L;ENSP00000359326:V459L	ENSP00000359321:V516L	V	+	1	0	MTF2	93374936	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.133000	0.64764	1.511000	0.48818	0.655000	0.94253	GTA		0.408	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028075.3	NM_007358		Missense_Mutation
NAT10	55226	hgsc.bcm.edu	37	11	34158196	34158196	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1026-01	TCGA-23-1026-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr11:34158196G>A	ENST00000257829.3	+	20	2242	c.2036G>A	c.(2035-2037)aGc>aAc	p.S679N	NAT10_ENST00000531159.2_Missense_Mutation_p.S607N|NAT10_ENST00000527971.1_Intron	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	679	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.					membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)	p.S679N(1)		endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				CAGGCTGTCAGCTTGTTGGAA	0.557																																																1	Substitution - Missense(1)	ovary(1)	11											97.0	86.0	90.0					11																	34158196		2202	4298	6500	34114772	SO:0001583	missense	55226			AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.2036G>A	11.37:g.34158196G>A	ENSP00000257829:p.Ser679Asn		34114772	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	ENST00000257829.3	37	CCDS7889.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652334	0.47362	.	.	ENSG00000135372	ENST00000257829;ENST00000531159	T;T	0.31769	1.48;1.48	5.4	5.4	0.78164	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (1);	0.035614	0.85682	D	0.000000	T	0.27798	0.0684	L	0.33710	1.025	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.03060	-1.1077	10	0.29301	T	0.29	-17.3389	19.1798	0.93619	0.0:0.0:1.0:0.0	.	679	Q9H0A0	NAT10_HUMAN	N	679;607	ENSP00000257829:S679N;ENSP00000433011:S607N	ENSP00000257829:S679N	S	+	2	0	NAT10	34114772	1.000000	0.71417	1.000000	0.80357	0.436000	0.31835	9.869000	0.99810	2.537000	0.85549	0.561000	0.74099	AGC		0.557	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662		Missense_Mutation
OTOF	9381	hgsc.bcm.edu	37	2	26696339	26696339	+	Frame_Shift_Del	DEL	A	A	-			TCGA-23-1026-01	TCGA-23-1026-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr2:26696339delA	ENST00000272371.2	-	28	3631	c.3505delT	c.(3505-3507)tcgfs	p.S1170fs	OTOF_ENST00000338581.6_Frame_Shift_Del_p.S423fs|OTOF_ENST00000402415.3_Frame_Shift_Del_p.S480fs|OTOF_ENST00000339598.3_Frame_Shift_Del_p.S423fs|OTOF_ENST00000403946.3_Frame_Shift_Del_p.S1170fs	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1170					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.S1169fs*3(1)|p.S422fs*3(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCAGGGACGACTGCACCCCC	0.602																																					GBM(102;732 1451 20652 24062 31372)											2	Deletion - Frameshift(2)	ovary(2)	2											79.0	75.0	76.0					2																	26696339		2203	4300	6503	26549843	SO:0001589	frameshift_variant	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3505delT	2.37:g.26696339delA	ENSP00000272371:p.Ser1170fs		26549843	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Frame_Shift_Del	DEL	ENST00000272371.2	37	CCDS1725.1	DEL	10	Baylor																																																																																				0.602	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			Frame_Shift_Del
PORCN	64840	hgsc.bcm.edu	37	X	48374143	48374143	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1026-01	TCGA-23-1026-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chrX:48374143G>A	ENST00000326194.6	+	10	1028	c.985G>A	c.(985-987)Gct>Act	p.A329T	PORCN_ENST00000537758.1_Missense_Mutation_p.A329T|PORCN_ENST00000367574.4_Missense_Mutation_p.A247T|PORCN_ENST00000361988.3_Missense_Mutation_p.A318T|PORCN_ENST00000355961.4_Missense_Mutation_p.A324T|PORCN_ENST00000355092.3_Missense_Mutation_p.A323T|PORCN_ENST00000359882.4_Missense_Mutation_p.A323T	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	329					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)	p.A329T(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GACCTTCTCGGCTGTGCTGGT	0.612																																																1	Substitution - Missense(1)	ovary(1)	X											53.0	50.0	51.0					X																	48374143		2203	4300	6503	48259087	SO:0001583	missense	64840			AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.985G>A	X.37:g.48374143G>A	ENSP00000322304:p.Ala329Thr		48259087	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Missense_Mutation	SNP	ENST00000326194.6	37	CCDS14299.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	27.6	4.845188	0.91197	.	.	ENSG00000102312	ENST00000359882;ENST00000537758;ENST00000367574;ENST00000355961;ENST00000361988;ENST00000326194;ENST00000355092	T;T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	D	0.89019	0.6596	M	0.86953	2.85	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.998;1.0;1.0	D	0.91072	0.4893	10	0.87932	D	0	-13.6158	14.4711	0.67517	0.0:0.0:1.0:0.0	.	323;329;247;318;324	Q9H237-3;Q9H237;B7ZAR3;Q9H237-4;Q9H237-2	.;PORCN_HUMAN;.;.;.	T	323;329;247;324;318;329;323	ENSP00000352946:A323T;ENSP00000446401:A329T;ENSP00000356546:A247T;ENSP00000348233:A324T;ENSP00000354978:A318T;ENSP00000322304:A329T;ENSP00000347207:A323T	ENSP00000322304:A329T	A	+	1	0	PORCN	48259087	1.000000	0.71417	0.994000	0.49952	0.942000	0.58702	8.900000	0.92551	2.084000	0.62774	0.529000	0.55759	GCT		0.612	PORCN-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356990.1	NM_022825		Missense_Mutation
PTK2	5747	hgsc.bcm.edu	37	8	141829027	141829027	+	Silent	SNP	C	C	A			TCGA-23-1026-01	TCGA-23-1026-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr8:141829027C>A	ENST00000522684.1	-	9	970	c.741G>T	c.(739-741)ctG>ctT	p.L247L	PTK2_ENST00000519419.1_Silent_p.L291L|PTK2_ENST00000340930.3_Silent_p.L247L|PTK2_ENST00000535192.1_Silent_p.L247L|PTK2_ENST00000521059.1_Silent_p.L247L|PTK2_ENST00000395218.2_Silent_p.L247L|PTK2_ENST00000517887.1_Silent_p.L291L	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	247	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)	p.L269L(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			AGACTGGAGACAGGATCTCAA	0.358																																																1	Substitution - coding silent(1)	ovary(1)	8											170.0	170.0	170.0					8																	141829027		2203	4299	6502	141898209	SO:0001819	synonymous_variant	5747			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.741G>T	8.37:g.141829027C>A			141898209	B4E2N6|F5H4S4|Q14291|Q9UD85	Silent	SNP	ENST00000522684.1	37	CCDS6381.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.421	1.082979	0.20309	.	.	ENSG00000169398	ENST00000519654	.	.	.	5.6	-3.82	0.04281	.	.	.	.	.	T	0.49389	0.1554	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43294	-0.9400	4	.	.	.	.	6.3336	0.21285	0.0902:0.3938:0.4205:0.0955	.	.	.	.	F	258	.	.	V	-	1	0	PTK2	141898209	0.833000	0.29383	0.872000	0.34217	0.996000	0.88848	-0.144000	0.10280	-1.071000	0.03145	-0.165000	0.13383	GTC		0.358	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607		Silent
SETDB2	83852	hgsc.bcm.edu	37	13	50055232	50055232	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1026-01	TCGA-23-1026-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr13:50055232C>A	ENST00000317257.8	+	9	1997	c.1172C>A	c.(1171-1173)aCa>aAa	p.T391K	SETDB2_ENST00000354234.4_Missense_Mutation_p.T379K|SETDB2_ENST00000258672.5_Missense_Mutation_p.T379K	NM_031915.2	NP_114121.2	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2	391	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromosome segregation (GO:0007059)|heart looping (GO:0001947)|histone H3-K9 methylation (GO:0051567)|left/right axis specification (GO:0070986)|mitotic nuclear division (GO:0007067)|negative regulation of transcription, DNA-templated (GO:0045892)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|zinc ion binding (GO:0008270)	p.T391K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	15		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		GACAGAGGGACATTTGTTTGC	0.398																																																1	Substitution - Missense(1)	ovary(1)	13											143.0	128.0	133.0					13																	50055232		2203	4300	6503	48953233	SO:0001583	missense	83852			AF334407	CCDS9417.1, CCDS53868.1	13q14	2011-07-01	2003-05-06	2003-05-09	ENSG00000136169	ENSG00000136169		"""Chromatin-modifying enzymes / K-methyltransferases"""	20263	protein-coding gene	gene with protein product		607865	"""chromosome 13 open reading frame 4"""	C13orf4		11306461	Standard	NM_031915		Approved	CLLD8, CLLL8, KMT1F	uc001vda.3	Q96T68	OTTHUMG00000016918	ENST00000317257.8:c.1172C>A	13.37:g.50055232C>A	ENSP00000326477:p.Thr391Lys		48953233	Q5TC65|Q5TC66|Q5W0A7|Q659A7|Q86UD6|Q96AI6	Missense_Mutation	SNP	ENST00000317257.8	37	CCDS9417.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.5	4.162959	0.78226	.	.	ENSG00000136169	ENST00000354234;ENST00000317257;ENST00000258672	D;D;D	0.82984	-1.67;-1.67;-1.67	5.72	4.88	0.63580	SET domain (3);	0.049083	0.85682	D	0.000000	D	0.89805	0.6821	M	0.66939	2.045	0.45139	D	0.998154	D;D;D;D	0.89917	1.0;1.0;1.0;0.993	D;D;D;D	0.97110	0.996;0.999;1.0;0.911	D	0.90856	0.4735	10	0.87932	D	0	.	14.6798	0.69009	0.0:0.9305:0.0:0.0695	.	391;379;391;109	Q96T68-3;Q96T68-2;Q96T68;Q59FW0	.;.;SETB2_HUMAN;.	K	379;391;379	ENSP00000346175:T379K;ENSP00000326477:T391K;ENSP00000258672:T379K	ENSP00000258672:T379K	T	+	2	0	SETDB2	48953233	0.999000	0.42202	0.819000	0.32651	0.952000	0.60782	6.008000	0.70739	1.436000	0.47453	0.655000	0.94253	ACA		0.398	SETDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044925.1	NM_031915		Missense_Mutation
SCAF11	9169	hgsc.bcm.edu	37	12	46320485	46320489	+	Frame_Shift_Del	DEL	TTTTC	TTTTC	-			TCGA-23-1026-01	TCGA-23-1026-10	TTTTC	TTTTC	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr12:46320485_46320489delTTTTC	ENST00000369367.3	-	11	3228_3232	c.2995_2999delGAAAA	c.(2995-3000)gaaaaafs	p.EK999fs	SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000419565.2_Frame_Shift_Del_p.EK999fs|SCAF11_ENST00000465950.1_Frame_Shift_Del_p.EK684fs|SCAF11_ENST00000549162.1_Frame_Shift_Del_p.EK807fs	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	999					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E999fs*2(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GATGTCATTTTTTTCTTTTCTTGTA	0.39																																																1	Deletion - Frameshift(1)	ovary(1)	12																																								44606756	SO:0001589	frameshift_variant	9169			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2995_2999delGAAAA	12.37:g.46320490_46320494delTTTTC	ENSP00000358374:p.Glu999fs		44606752	A6NEU9|A6NLW5|Q8IW59	Frame_Shift_Del	DEL	ENST00000369367.3	37	CCDS8748.2	DEL	64	Baylor																																																																																				0.390	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719		Frame_Shift_Del
SLITRK1	114798	hgsc.bcm.edu	37	13	84455109	84455109	+	Silent	SNP	G	G	T			TCGA-23-1026-01	TCGA-23-1026-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr13:84455109G>T	ENST00000377084.2	-	1	1419	c.534C>A	c.(532-534)ccC>ccA	p.P178P		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	178					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.P178P(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GGTGGGTGATGGGCACATACT	0.537																																																1	Substitution - coding silent(1)	ovary(1)	13											95.0	94.0	94.0					13																	84455109		2203	4300	6503	83353110	SO:0001819	synonymous_variant	114798			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.534C>A	13.37:g.84455109G>T			83353110	Q5U5I6|Q96SF9	Silent	SNP	ENST00000377084.2	37	CCDS9464.1	SNP	47	Baylor																																																																																				0.537	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		Silent
TAF3	83860	hgsc.bcm.edu	37	10	8006885	8006885	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1026-01	TCGA-23-1026-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr10:8006885A>G	ENST00000344293.5	+	3	1618	c.1412A>G	c.(1411-1413)gAt>gGt	p.D471G		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	471					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						GCCTCCATTGATGAGGTTGTA	0.483																																																0			10											100.0	99.0	99.0					10																	8006885		1947	4146	6093	8046891	SO:0001583	missense	83860			AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.1412A>G	10.37:g.8006885A>G	ENSP00000340271:p.Asp471Gly		8046891	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	37	CCDS41487.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.71	2.616688	0.46736	.	.	ENSG00000165632	ENST00000344293	T	0.21734	1.99	5.62	5.62	0.85841	.	0.077363	0.53938	D	0.000059	T	0.30103	0.0754	M	0.79475	2.455	0.58432	D	0.999997	P	0.52316	0.952	B	0.41860	0.368	T	0.19614	-1.0300	10	0.49607	T	0.09	-35.5012	15.8234	0.78676	1.0:0.0:0.0:0.0	.	471	Q5VWG9	TAF3_HUMAN	G	471	ENSP00000340271:D471G	ENSP00000340271:D471G	D	+	2	0	TAF3	8046891	1.000000	0.71417	0.740000	0.30986	0.203000	0.24098	8.668000	0.91158	2.148000	0.66965	0.528000	0.53228	GAT		0.483	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923		Missense_Mutation
TMEM180	79847	hgsc.bcm.edu	37	10	104229753	104229753	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1026-01	TCGA-23-1026-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr10:104229753G>C	ENST00000238936.4	+	4	409	c.172G>C	c.(172-174)Gtg>Ctg	p.V58L	TMEM180_ENST00000366277.2_5'UTR|TMEM180_ENST00000450947.2_3'UTR|TMEM180_ENST00000369931.3_Missense_Mutation_p.V58L	NM_024789.3	NP_079065.2	Q14CX5	TM180_HUMAN	transmembrane protein 180	58						integral component of membrane (GO:0016021)		p.V58L(1)		breast(3)|endometrium(2)|large_intestine(3)|lung(1)|ovary(3)|skin(1)	13		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CCTGCAGACAGTGTTTCTCCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	10											136.0	94.0	108.0					10																	104229753		2203	4300	6503	104219743	SO:0001583	missense	79847			AK026182	CCDS7535.1	10q24.32	2011-02-09	2006-10-12	2006-10-12	ENSG00000138111	ENSG00000138111			26196	protein-coding gene	gene with protein product				C10orf77		12477932	Standard	XM_006717971		Approved	FLJ22529, bA18I14.8	uc001kvt.3	Q14CX5	OTTHUMG00000018961	ENST00000238936.4:c.172G>C	10.37:g.104229753G>C	ENSP00000238936:p.Val58Leu		104219743	Q6NWM8|Q6NWM9|Q6PEZ7|Q9H679	Missense_Mutation	SNP	ENST00000238936.4	37	CCDS7535.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.90	2.969430	0.53614	.	.	ENSG00000138111	ENST00000447593;ENST00000238936;ENST00000369931	D	0.88586	-2.4	5.08	5.08	0.68730	Major facilitator superfamily domain, general substrate transporter (1);	0.192894	0.45606	D	0.000357	D	0.86104	0.5853	L	0.56769	1.78	0.80722	D	1	B;P;P	0.43578	0.451;0.793;0.811	B;B;B	0.40534	0.07;0.329;0.332	D	0.85204	0.1017	10	0.35671	T	0.21	.	11.8955	0.52654	0.0804:0.0:0.9196:0.0	.	58;58;58	B4DWN6;Q14CX5;Q6UWF4	.;TM180_HUMAN;.	L	58	ENSP00000238936:V58L	ENSP00000238936:V58L	V	+	1	0	TMEM180	104219743	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.867000	0.69597	2.365000	0.80145	0.491000	0.48974	GTG		0.612	TMEM180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050075.2	NM_024789		Missense_Mutation
TMPO	7112	hgsc.bcm.edu	37	12	98921763	98921763	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1026-01	TCGA-23-1026-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr12:98921763T>C	ENST00000556029.1	+	2	735	c.379T>C	c.(379-381)Tac>Cac	p.Y127H	TMPO_ENST00000261210.5_Missense_Mutation_p.Y127H|TMPO_ENST00000266732.4_Missense_Mutation_p.Y127H|TMPO_ENST00000393053.2_Missense_Mutation_p.Y127H|TMPO_ENST00000343315.5_Missense_Mutation_p.Y127H	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin	127	LEM. {ECO:0000255|PROSITE- ProRule:PRU00313}.|Nucleoplasmic. {ECO:0000255}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)	p.Y127H(2)		breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GCTTGTGAAATACGGAGTGAA	0.353																																																2	Substitution - Missense(2)	ovary(2)	12											158.0	163.0	161.0					12																	98921763		2203	4300	6503	97445894	SO:0001583	missense	7112				CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.379T>C	12.37:g.98921763T>C	ENSP00000450627:p.Tyr127His		97445894	A2T926|Q14861	Missense_Mutation	SNP	ENST00000556029.1	37	CCDS31879.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	11.81	1.748818	0.30955	.	.	ENSG00000120802	ENST00000556029;ENST00000343315;ENST00000266732;ENST00000393053;ENST00000261210;ENST00000556678	T;T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46;0.46	4.89	3.74	0.42951	LEM-like domain (4);Lamino-associated polypeptide 2/emerin (6);	0.055722	0.85682	D	0.000000	T	0.52821	0.1758	L	0.43701	1.375	0.53005	D	0.999968	B;B;B;P	0.36086	0.285;0.013;0.121;0.536	B;B;B;P	0.48552	0.377;0.022;0.111;0.581	T	0.47560	-0.9108	10	0.38643	T	0.18	.	8.3687	0.32402	0.0:0.1644:0.0:0.8356	.	160;127;127;127	Q59G12;P42167;A2T926;P42166	.;LAP2B_HUMAN;.;LAP2A_HUMAN	H	127;127;127;127;127;34	ENSP00000450627:Y127H;ENSP00000340251:Y127H;ENSP00000266732:Y127H;ENSP00000376773:Y127H;ENSP00000261210:Y127H;ENSP00000451552:Y34H	ENSP00000261210:Y127H	Y	+	1	0	TMPO	97445894	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	3.283000	0.51701	0.715000	0.32103	0.482000	0.46254	TAC		0.353	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407973.2	NM_003276		Missense_Mutation
VILL	50853	hgsc.bcm.edu	37	3	38043303	38043304	+	Frame_Shift_Ins	INS	-	-	C	rs374442833		TCGA-23-1026-01	TCGA-23-1026-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr3:38043303_38043304insC	ENST00000283713.6	+	13	1697_1698	c.1431_1432insC	c.(1432-1434)cccfs	p.P478fs	VILL_ENST00000465644.1_Frame_Shift_Ins_p.P196fs|VILL_ENST00000383759.2_Frame_Shift_Ins_p.P478fs			O15195	VILL_HUMAN	villin-like	478					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)	p.H480fs*38(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		TGGGCAGCGAGCCCCCCCACTT	0.594																																																1	Insertion - Frameshift(1)	ovary(1)	3								6,4260		0,6,2127						5.0	1.0			127	3,8251		0,3,4124	no	frameshift	VILL	NM_015873.3		0,9,6251	A1A1,A1R,RR		0.0363,0.1406,0.0719				9,12511				38018308	SO:0001589	frameshift_variant	50853				CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.1438dupC	3.37:g.38043310_38043310dupC	ENSP00000283713:p.Pro478fs		38018307	A8MZP1|Q9BT80|Q9BWH7	Frame_Shift_Ins	INS	ENST00000283713.6	37	CCDS2670.2	INS	34	Baylor																																																																																				0.594	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253360.3	NM_015873		Frame_Shift_Ins
MAP3K19	80122	hgsc.bcm.edu	37	2	135744151	135744151	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1026-01	TCGA-23-1026-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr2:135744151T>A	ENST00000375845.3	-	7	2321	c.2291A>T	c.(2290-2292)gAa>gTa	p.E764V	MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000358371.4_Missense_Mutation_p.E651V|MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000392915.1_Missense_Mutation_p.E781V|MAP3K19_ENST00000315513.3_5'UTR	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	764							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E116V(1)|p.E764V(1)									CCAGTCTGGTTCTGAAATACC	0.388																																																2	Substitution - Missense(2)	ovary(2)	2											73.0	73.0	73.0					2																	135744151		2203	4300	6503	135460621	SO:0001583	missense	80122			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.2291A>T	2.37:g.135744151T>A	ENSP00000365005:p.Glu764Val		135460621	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	37	CCDS2176.2	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141336	0.37825	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000392915;ENST00000437365	T;T;T;T	0.76709	-1.04;-0.98;1.32;-1.03	4.75	3.56	0.40772	.	0.428095	0.19756	N	0.106764	T	0.61173	0.2326	L	0.32530	0.975	0.30279	N	0.791468	B;P;B	0.37207	0.091;0.587;0.221	B;B;B	0.32465	0.07;0.146;0.07	T	0.63225	-0.6685	10	0.72032	D	0.01	.	3.551	0.07845	0.1673:0.205:0.0:0.6277	.	651;781;764	Q56UN5-3;A8MWG7;Q56UN5	.;.;YSK4_HUMAN	V	764;651;781;154	ENSP00000365005:E764V;ENSP00000351140:E651V;ENSP00000376647:E781V;ENSP00000392827:E154V	ENSP00000351140:E651V	E	-	2	0	YSK4	135460621	0.821000	0.29204	0.554000	0.28268	0.799000	0.45148	0.563000	0.23547	0.794000	0.33899	0.334000	0.21626	GAA		0.388	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052		Missense_Mutation
ZEB1	6935	hgsc.bcm.edu	37	10	31791301	31791301	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1026-01	TCGA-23-1026-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr10:31791301T>A	ENST00000320985.10	+	4	455	c.345T>A	c.(343-345)gaT>gaA	p.D115E	ZEB1_ENST00000542815.3_Missense_Mutation_p.D48E|ZEB1_ENST00000361642.5_Missense_Mutation_p.D116E|ZEB1_ENST00000560721.2_Missense_Mutation_p.D95E|ZEB1_ENST00000446923.2_Missense_Mutation_p.D99E|ZEB1_ENST00000559858.1_3'UTR			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	115					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.D115E(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				GCGAGTCAGATGCAGAAAATG	0.358																																					Ovarian(40;423 959 14296 36701 49589)											1	Substitution - Missense(1)	ovary(1)	10											110.0	101.0	104.0					10																	31791301		2203	4300	6503	31831307	SO:0001583	missense	6935			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.345T>A	10.37:g.31791301T>A	ENSP00000319248:p.Asp115Glu		31831307	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	CCDS7169.1	SNP	51	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.34|19.34	3.808129|3.808129	0.70797|0.70797	.|.	.|.	ENSG00000148516|ENSG00000148516	ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000424869;ENST00000446923|ENST00000543514	T;T;T;T;T|.	0.81415|.	-1.49;-1.49;-1.49;-1.49;-1.49|.	5.92|5.92	2.35|2.35	0.29111|0.29111	.|.	0.099877|.	0.44285|.	D|.	0.000462|.	T|T	0.57388|0.57388	0.2050|0.2050	L|L	0.46157|0.46157	1.445|1.445	0.50171|0.50171	D|D	0.99985|0.99985	P;P;P;P;P;P|.	0.45044|.	0.702;0.849;0.849;0.589;0.849;0.849|.	B;B;P;B;P;P|.	0.47102|.	0.421;0.386;0.514;0.145;0.537;0.514|.	T|T	0.55431|0.55431	-0.8142|-0.8142	10|6	0.22706|0.87932	T|D	0.39|0	-26.901|-26.901	8.5821|8.5821	0.33634|0.33634	0.0:0.2766:0.0:0.7234|0.0:0.2766:0.0:0.7234	.|.	48;99;115;95;116;115|.	F5H4I8;E9PCM7;B2RBI8;Q5VZ84;Q2KJ05;P37275|.	.;.;.;.;.;ZEB1_HUMAN|.	E|K	115;116;115;48;115;95;116;99|7	ENSP00000354487:D116E;ENSP00000444891:D48E;ENSP00000319248:D115E;ENSP00000415961:D116E;ENSP00000391612:D99E|.	ENSP00000319248:D115E|ENSP00000443742:M7K	D|M	+|+	3|2	2|0	ZEB1|ZEB1	31831307|31831307	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.412000|0.412000	0.21131|0.21131	0.158000|0.158000	0.19367|0.19367	-0.263000|-0.263000	0.10527|0.10527	GAT|ATG		0.358	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751		Missense_Mutation
ZNF554	115196	hgsc.bcm.edu	37	19	2832405	2832405	+	Frame_Shift_Del	DEL	C	C	-			TCGA-23-1026-01	TCGA-23-1026-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-23-1026-01	TCGA-23-1026-10	g.chr19:2832405delC	ENST00000317243.5	+	4	556	c.358delC	c.(358-360)cttfs	p.L120fs	ZNF554_ENST00000591265.1_Frame_Shift_Del_p.L120fs	NM_001102651.1	NP_001096121.1	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	120	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L120fs*18(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGTATTTACTTTTTCAACC	0.478																																																1	Deletion - Frameshift(1)	ovary(1)	19											149.0	148.0	148.0					19																	2832405		1877	4105	5982	2783405	SO:0001589	frameshift_variant	115196			AK027860	CCDS42462.1	19p13.3	2013-09-20			ENSG00000172006	ENSG00000172006		"""Zinc fingers, C2H2-type"", ""-"""	26629	protein-coding gene	gene with protein product						12477932	Standard	NM_001102651		Approved	FLJ34817	uc002lwm.2	Q86TJ5	OTTHUMG00000180493	ENST00000317243.5:c.358delC	19.37:g.2832405delC	ENSP00000321132:p.Leu120fs		2783405	Q8NAT3|Q9BWN3	Frame_Shift_Del	DEL	ENST00000317243.5	37	CCDS42462.1	DEL	20	Baylor																																																																																				0.478	ZNF554-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451598.3	NM_152303		Frame_Shift_Del
