#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PADI6	353238	broad.mit.edu	37	1	17721513	17721513	+	RNA	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr1:17721513G>A	ENST00000434762.2	+	0	1455							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.P467P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TCCAAGCGCCGGTGGAGCTCT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	1											64.0	69.0	67.0					1																	17721513		2144	4293	6437	17594100			353238			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17721513G>A			17594100	Q330K5|Q70SX3	Silent	SNP	ENST00000434762.2	37		SNP	39	Broad																																																																																				0.542	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4	NM_207421		Silent
MRTO4	51154	broad.mit.edu	37	1	19585030	19585030	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr1:19585030G>A	ENST00000330263.4	+	7	850	c.553G>A	c.(553-555)Gag>Aag	p.E185K		NM_016183.3	NP_057267.2	Q9UKD2	MRT4_HUMAN	mRNA turnover 4 homolog (S. cerevisiae)	185					ribosome biogenesis (GO:0042254)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.E185K(1)		breast(1)|endometrium(1)|large_intestine(1)|liver(2)|ovary(1)|pancreas(1)|stomach(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.87e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00301)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GCTGACCCCAGAGCAGGCTCG	0.622																																					GBM(192;2418 3032 7540 48714)											1	Substitution - Missense(1)	ovary(1)	1											122.0	120.0	120.0					1																	19585030		2203	4300	6503	19457617	SO:0001583	missense	51154			AK027569	CCDS191.1	1p36.13	2008-02-05	2006-12-21	2007-01-05	ENSG00000053372	ENSG00000053372			18477	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 33"", ""MRT4, mRNA turnover 4, homolog (S. cerevisiae)"""	C1orf33			Standard	NM_016183		Approved	dJ657E11.4, MRT4	uc001bbs.3	Q9UKD2	OTTHUMG00000002496	ENST00000330263.4:c.553G>A	1.37:g.19585030G>A	ENSP00000364320:p.Glu185Lys		19457617	B3KNB3|Q5TG55|Q96SS6|Q9BPV9	Missense_Mutation	SNP	ENST00000330263.4	37	CCDS191.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.484451	0.96323	.	.	ENSG00000053372	ENST00000330263	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.55737	0.1939	L	0.52573	1.65	0.80722	D	1	P	0.50819	0.939	B	0.42214	0.38	T	0.61008	-0.7149	9	0.52906	T	0.07	-39.069	17.9039	0.88913	0.0:0.0:1.0:0.0	.	185	Q9UKD2	MRT4_HUMAN	K	185	.	ENSP00000364320:E185K	E	+	1	0	MRTO4	19457617	1.000000	0.71417	0.986000	0.45419	0.960000	0.62799	9.026000	0.93700	2.633000	0.89246	0.591000	0.81541	GAG		0.622	MRTO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007075.2	NM_016183		Missense_Mutation
CNKSR1	10256	broad.mit.edu	37	1	26514727	26514727	+	Nonsense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr1:26514727G>A	ENST00000374253.5	+	17	1517	c.1478G>A	c.(1477-1479)tGg>tAg	p.W493*	CNKSR1_ENST00000361530.6_Nonsense_Mutation_p.W486*|CNKSR1_ENST00000531191.1_Nonsense_Mutation_p.W228*|CATSPER4_ENST00000456354.2_5'Flank	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	493	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)	p.W486*(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		CTCCATAGGTGGGTGCGTCAT	0.572																																					NSCLC(180;1396 2109 28270 30756 34275)											1	Substitution - Nonsense(1)	ovary(1)	1											93.0	89.0	91.0					1																	26514727		2203	4300	6503	26387314	SO:0001587	stop_gained	10256			AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.1478G>A	1.37:g.26514727G>A	ENSP00000363371:p.Trp493*		26387314	B1AMW9|O95381	Nonsense_Mutation	SNP	ENST00000374253.5	37		SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	45	11.989463	0.99625	.	.	ENSG00000142675	ENST00000361530;ENST00000374253;ENST00000531191	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.6359	18.2859	0.90114	0.0:0.0:1.0:0.0	.	.	.	.	X	486;493;228	.	ENSP00000354609:W486X	W	+	2	0	CNKSR1	26387314	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.704000	0.68347	2.757000	0.94681	0.655000	0.94253	TGG		0.572	CNKSR1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000089943.2	NM_006314		Nonsense_Mutation
FABP3	2170	broad.mit.edu	37	1	31845817	31845817	+	Silent	SNP	C	C	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr1:31845817C>T	ENST00000373713.2	-	1	106	c.45G>A	c.(43-45)aaG>aaA	p.K15K		NM_004102.3	NP_004093.1	P05413	FABPH_HUMAN	fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)	15					cholesterol homeostasis (GO:0042632)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid import (GO:0044539)|negative regulation of cell proliferation (GO:0008285)|phospholipid homeostasis (GO:0055091)|positive regulation of phospholipid biosynthetic process (GO:0071073)|regulation of fatty acid oxidation (GO:0046320)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to insulin (GO:0032868)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasm (GO:0016528)	cytoskeletal protein binding (GO:0008092)|icosatetraenoic acid binding (GO:0050543)|long-chain fatty acid binding (GO:0036041)|long-chain fatty acid transporter activity (GO:0005324)|oleic acid binding (GO:0070538)			large_intestine(1)|lung(2)|ovary(2)	5		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0185)|READ - Rectum adenocarcinoma(331;0.149)		CATCGAAATTCTTGCTGTCCA	0.592																																																0			1											102.0	88.0	93.0					1																	31845817		2203	4300	6503	31618404	SO:0001819	synonymous_variant	2170			U57623	CCDS342.1	1p33-p32	2013-03-01	2003-09-10		ENSG00000121769	ENSG00000121769		"""Fatty acid binding protein family"""	3557	protein-coding gene	gene with protein product		134651	"""fatty acid binding protein 11"""	MDGI, FABP11		8661024	Standard	NM_004102		Approved	H-FABP, O-FABP	uc001bss.1	P05413	OTTHUMG00000003797	ENST00000373713.2:c.45G>A	1.37:g.31845817C>T			31618404	B2RAB6|Q5VV93|Q99957	Silent	SNP	ENST00000373713.2	37	CCDS342.1	SNP	32	Broad																																																																																				0.592	FABP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010683.1	NM_004102		Silent
KIAA0754	643314	broad.mit.edu	37	1	39877339	39877339	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr1:39877339C>T	ENST00000530275.1	+	1	1189	c.994C>T	c.(994-996)Ctt>Ttt	p.L332F	MACF1_ENST00000289893.4_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000361689.2_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	332										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCAGATGTTTCTTGAACTTGA	0.453											OREG0013393	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			1											130.0	125.0	127.0					1																	39877339		1921	4141	6062	39649926	SO:0001583	missense	643314					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.994C>T	1.37:g.39877339C>T	ENSP00000431179:p.Leu332Phe	889	39649926	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	ENST00000530275.1	37		SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	23.6	4.438499	0.83885	.	.	ENSG00000255103	ENST00000530275	D	0.86627	-2.15	5.14	5.14	0.70334	.	.	.	.	.	D	0.90068	0.6898	L	0.27053	0.805	0.31231	N	0.696294	D	0.89917	1.0	D	0.91635	0.999	D	0.89514	0.3773	9	0.87932	D	0	.	18.626	0.91338	0.0:1.0:0.0:0.0	.	332	O94854	K0754_HUMAN	F	332	ENSP00000431179:L332F	ENSP00000431179:L332F	L	+	1	0	RP4-562N20.1	39649926	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.348000	0.59379	2.398000	0.81561	0.655000	0.94253	CTT		0.453	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038		Missense_Mutation
PAPPA2	60676	broad.mit.edu	37	1	176664927	176664927	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr1:176664927A>G	ENST00000367662.3	+	7	3842	c.2678A>G	c.(2677-2679)tAt>tGt	p.Y893C		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	893					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Y893C(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TTTCGTCAGTATGTGCACACA	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											83.0	86.0	85.0					1																	176664927		2086	4234	6320	174931550	SO:0001583	missense	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2678A>G	1.37:g.176664927A>G	ENSP00000356634:p.Tyr893Cys		174931550	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	21.5	4.165435	0.78339	.	.	ENSG00000116183	ENST00000367662	T	0.04706	3.57	5.51	5.51	0.81932	Fibronectin, type III (2);	0.000000	0.85682	D	0.000000	T	0.24470	0.0593	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01218	-1.1415	10	0.87932	D	0	-22.1286	15.2975	0.73922	1.0:0.0:0.0:0.0	.	893	Q9BXP8	PAPP2_HUMAN	C	893	ENSP00000356634:Y893C	ENSP00000356634:Y893C	Y	+	2	0	PAPPA2	174931550	1.000000	0.71417	0.986000	0.45419	0.958000	0.62258	7.137000	0.77295	2.098000	0.63641	0.460000	0.39030	TAT		0.537	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			Missense_Mutation
LAMC1	3915	broad.mit.edu	37	1	183111876	183111876	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1116-01	TCGA-23-1116-10			A	C	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr1:183111876A>C	ENST00000258341.4	+	28	5038	c.4781A>C	c.(4780-4782)aAg>aCg	p.K1594T	RP11-181K3.4_ENST00000457852.3_RNA	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	1594	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.K1594T(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GACATCAGGAAGACCTTACCA	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											126.0	110.0	115.0					1																	183111876		2203	4300	6503	181378499	SO:0001583	missense	3915			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.4781A>C	1.37:g.183111876A>C	ENSP00000258341:p.Lys1594Thr		181378499	Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	37	CCDS1351.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	13.04	2.119317	0.37436	.	.	ENSG00000135862	ENST00000258341	T	0.31247	1.5	5.57	3.28	0.37604	.	0.159267	0.53938	D	0.000041	T	0.25975	0.0633	L	0.56769	1.78	0.43317	D	0.995334	B	0.29716	0.255	B	0.24394	0.053	T	0.03566	-1.1024	10	0.25106	T	0.35	.	9.517	0.39111	0.8577:0.0:0.1423:0.0	.	1594	P11047	LAMC1_HUMAN	T	1594	ENSP00000258341:K1594T	ENSP00000258341:K1594T	K	+	2	0	LAMC1	181378499	1.000000	0.71417	0.973000	0.42090	0.997000	0.91878	5.465000	0.66725	0.415000	0.25817	0.533000	0.62120	AAG		0.522	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293		Missense_Mutation
OR2M5	127059	broad.mit.edu	37	1	248308539	248308539	+	Silent	SNP	G	G	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr1:248308539G>T	ENST00000366476.1	+	1	90	c.90G>T	c.(88-90)ctG>ctT	p.L30L		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L30L(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			TCTTCTTTCTGGTCCTGGCCA	0.507																																																1	Substitution - coding silent(1)	ovary(1)	1											220.0	222.0	222.0					1																	248308539		2203	4297	6500	246375162	SO:0001819	synonymous_variant	127059				CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.90G>T	1.37:g.248308539G>T			246375162		Silent	SNP	ENST00000366476.1	37	CCDS31105.1	SNP	47	Broad																																																																																				0.507	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		Silent
ZNF488	118738	broad.mit.edu	37	10	48371533	48371533	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr10:48371533G>A	ENST00000395702.2	+	2	1228	c.1001G>A	c.(1000-1002)cGg>cAg	p.R334Q	ZNF488_ENST00000586537.1_Missense_Mutation_p.R227Q|ZNF488_ENST00000494156.1_3'UTR			Q96MN9	ZN488_HUMAN	zinc finger protein 488	334					negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R334Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						CACCTCTCCCGGCACATGACT	0.652																																																1	Substitution - Missense(1)	ovary(1)	10											57.0	60.0	59.0					10																	48371533		2203	4300	6503	47991539	SO:0001583	missense	118738			AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	ENST00000395702.2:c.1001G>A	10.37:g.48371533G>A	ENSP00000379054:p.Arg334Gln		47991539	Q05CE0	Missense_Mutation	SNP	ENST00000395702.2	37	CCDS7217.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.322832	0.95708	.	.	ENSG00000165388	ENST00000395702	T	0.29655	1.56	5.39	3.52	0.40303	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	U	0.000000	T	0.44808	0.1311	L	0.42529	1.33	0.30876	N	0.731986	D	0.89917	1.0	D	0.97110	1.0	T	0.49341	-0.8950	10	0.87932	D	0	.	10.5891	0.45300	0.0724:0.133:0.7945:0.0	.	334	Q96MN9	ZN488_HUMAN	Q	334	ENSP00000379054:R334Q	ENSP00000379054:R334Q	R	+	2	0	ZNF488	47991539	1.000000	0.71417	0.982000	0.44146	0.997000	0.91878	9.384000	0.97219	0.752000	0.32923	0.655000	0.94253	CGG		0.652	ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314632.1	NM_153034		Missense_Mutation
ARID5B	84159	broad.mit.edu	37	10	63852465	63852465	+	Silent	SNP	G	G	C			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr10:63852465G>C	ENST00000279873.7	+	10	3653	c.3243G>C	c.(3241-3243)ctG>ctC	p.L1081L	ARID5B_ENST00000309334.5_Silent_p.L838L	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	1081					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					TCCCAGGTCTGTATTCCGGGA	0.577																																																0			10											62.0	63.0	63.0					10																	63852465		2203	4300	6503	63522471	SO:0001819	synonymous_variant	84159			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.3243G>C	10.37:g.63852465G>C			63522471	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Silent	SNP	ENST00000279873.7	37	CCDS31208.1	SNP	48	Broad																																																																																				0.577	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482		Silent
ZNF365	22891	broad.mit.edu	37	10	64136532	64136532	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr10:64136532C>A	ENST00000395254.3	+	2	860	c.580C>A	c.(580-582)Ctg>Atg	p.L194M	ZNF365_ENST00000395255.3_Missense_Mutation_p.L194M|ZNF365_ENST00000466727.1_Intron|ZNF365_ENST00000410046.3_Missense_Mutation_p.L194M	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0								p.L194M(2)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					AACTGCGGAACTGTTGGAAGT	0.483																																																2	Substitution - Missense(2)	ovary(2)	10											119.0	125.0	123.0					10																	64136532		2203	4300	6503	63806538	SO:0001583	missense	22891			AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.580C>A	10.37:g.64136532C>A	ENSP00000378674:p.Leu194Met		63806538		Missense_Mutation	SNP	ENST00000395254.3	37	CCDS31209.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752740	0.69648	.	.	ENSG00000138311	ENST00000395254;ENST00000395255;ENST00000410046	T;T;T	0.34667	1.35;1.35;1.35	5.73	5.73	0.89815	.	0.000000	0.56097	D	0.000021	T	0.63355	0.2504	M	0.75264	2.295	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79108	0.989;0.992;0.992;0.992	T	0.64525	-0.6387	10	0.66056	D	0.02	.	19.8989	0.96978	0.0:1.0:0.0:0.0	.	194;194;194;209	Q70YC5-3;Q70YC5-2;Q70YC5;Q70YC5-4	.;.;ZN365_HUMAN;.	M	194	ENSP00000378674:L194M;ENSP00000378675:L194M;ENSP00000387091:L194M	ENSP00000378674:L194M	L	+	1	2	ZNF365	63806538	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	3.715000	0.54897	2.706000	0.92434	0.555000	0.69702	CTG		0.483	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048238.2	NM_014951		Missense_Mutation
ZSWIM8	23053	broad.mit.edu	37	10	75553932	75553932	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr10:75553932G>A	ENST00000605216.1	+	13	2870	c.2653G>A	c.(2653-2655)Gtg>Atg	p.V885M	ZSWIM8_ENST00000604729.1_Missense_Mutation_p.V885M|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.V885M|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.V852M|ZSWIM8_ENST00000431225.1_3'UTR|ZSWIM8-AS1_ENST00000456638.2_RNA|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.V885M	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	885							zinc ion binding (GO:0008270)	p.V885M(1)									GGAGTCTGAGGTGGCTGCCCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	10											116.0	124.0	121.0					10																	75553932		2067	4206	6273	75223938	SO:0001583	missense	23053			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.2653G>A	10.37:g.75553932G>A	ENSP00000474748:p.Val885Met		75223938	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	ENST00000605216.1	37		SNP	44	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.53|19.53	3.844505|3.844505	0.71488|0.71488	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000433366|ENST00000398706	.|T	.|0.47177	.|0.85	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	.|0.221244	.|0.29355	.|U	.|0.012400	T|T	0.41259|0.41259	0.1151|0.1151	L|L	0.43152|0.43152	1.355|1.355	0.40153|0.40153	D|D	0.976972|0.976972	.|P;P;P;P	.|0.48016	.|0.835;0.904;0.739;0.835	.|P;P;P;P	.|0.45232	.|0.474;0.474;0.474;0.474	T|T	0.43410|0.43410	-0.9393|-0.9393	5|10	.|0.72032	.|D	.|0.01	-7.2226|-7.2226	6.3216|6.3216	0.21221|0.21221	0.2108:0.0:0.7892:0.0|0.2108:0.0:0.7892:0.0	.|.	.|885;885;885;885	.|A7E2V4;A7E2V4-3;A7E2V4-5;A7E2V4-4	.|K0913_HUMAN;.;.;.	D|M	600|885	.|ENSP00000381693:V885M	.|ENSP00000381693:V885M	G|V	+|+	2|1	0|0	KIAA0913|KIAA0913	75223938|75223938	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.971000|4.971000	0.63749|0.63749	2.751000|2.751000	0.94390|0.94390	0.650000|0.650000	0.86243|0.86243	GGT|GTG		0.562	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487		Missense_Mutation
EMX2	2018	broad.mit.edu	37	10	119302954	119302954	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr10:119302954C>T	ENST00000553456.3	+	1	1000	c.176C>T	c.(175-177)gCc>gTc	p.A59V	EMX2OS_ENST00000440007.1_RNA|EMX2OS_ENST00000450314.2_RNA|EMX2OS_ENST00000551288.1_RNA|EMX2_ENST00000442245.4_Missense_Mutation_p.A59V	NM_004098.3	NP_004089.1	Q04743	EMX2_HUMAN	empty spiracles homeobox 2	59	Poly-Ala.				anterior/posterior pattern specification (GO:0009952)|cell proliferation in forebrain (GO:0021846)|cerebral cortex regionalization (GO:0021796)|dentate gyrus development (GO:0021542)|forebrain cell migration (GO:0021885)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|response to drug (GO:0042493)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A59V(1)		endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(2)	12		Colorectal(252;0.109)|Lung NSC(174;0.179)|all_lung(145;0.22)		all cancers(201;0.0133)		gccgccgccgccggTAGGGGC	0.716																																																1	Substitution - Missense(1)	ovary(1)	10											4.0	6.0	6.0					10																	119302954		1895	3800	5695	119292944	SO:0001583	missense	2018			AF301598	CCDS7601.1, CCDS53583.1	10q26.11	2011-06-20	2007-02-15		ENSG00000170370	ENSG00000170370		"""Homeoboxes / ANTP class : NKL subclass"""	3341	protein-coding gene	gene with protein product		600035	"""empty spiracles homolog 2 (Drosophila)"""			7959790	Standard	NM_004098		Approved		uc001ldh.4	Q04743	OTTHUMG00000019123	ENST00000553456.3:c.176C>T	10.37:g.119302954C>T	ENSP00000450962:p.Ala59Val		119292944	G3V305|Q96NN8|Q9BQF4	Missense_Mutation	SNP	ENST00000553456.3	37	CCDS7601.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	12.79	2.044886	0.36085	.	.	ENSG00000170370;ENSG00000258614	ENST00000369201;ENST00000553456	D	0.92446	-3.04	5.81	5.81	0.92471	.	0.158948	0.56097	D	0.000025	D	0.88235	0.6382	L	0.43923	1.385	0.34317	D	0.686135	B;B	0.32829	0.386;0.124	B;B	0.31191	0.125;0.054	D	0.88369	0.2993	10	0.17832	T	0.49	-8.0501	16.9871	0.86342	0.0:1.0:0.0:0.0	.	59;59	G3V305;Q04743	.;EMX2_HUMAN	V	59	ENSP00000450962:A59V	ENSP00000358202:A59V	A	+	2	0	AC005871.1;EMX2	119292944	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	4.816000	0.62642	2.732000	0.93576	0.643000	0.83706	GCC		0.716	EMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050569.4	NM_004098		Missense_Mutation
OR5L2	26338	broad.mit.edu	37	11	55595502	55595502	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr11:55595502G>A	ENST00000378397.1	+	1	808	c.808G>A	c.(808-810)Gtt>Att	p.V270I		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				CAGTGGAGATGTTGACAAAGT	0.488										HNSCC(27;0.073)																																						0			11											95.0	86.0	89.0					11																	55595502		2200	4296	6496	55352078	SO:0001583	missense	26338			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.808G>A	11.37:g.55595502G>A	ENSP00000367650:p.Val270Ile		55352078	Q6IF66|Q96RB2	Missense_Mutation	SNP	ENST00000378397.1	37	CCDS31511.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	.	6.436	0.448575	0.12223	.	.	ENSG00000205030	ENST00000378397	T	0.00058	8.79	5.1	-4.0	0.04057	GPCR, rhodopsin-like superfamily (1);	0.846344	0.10294	N	0.691921	T	0.00073	0.0002	N	0.02275	-0.615	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.01238	-1.1409	10	0.29301	T	0.29	-1.6528	7.2902	0.26362	0.4146:0.0:0.4685:0.1169	.	270	Q8NGL0	OR5L2_HUMAN	I	270	ENSP00000367650:V270I	ENSP00000367650:V270I	V	+	1	0	OR5L2	55352078	0.280000	0.24249	0.003000	0.11579	0.290000	0.27261	0.923000	0.28757	-0.281000	0.09141	0.536000	0.68110	GTT		0.488	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739		Missense_Mutation
MMP8	4317	broad.mit.edu	37	11	102585343	102585343	+	Silent	SNP	G	G	A	rs201019213		TCGA-23-1116-01	TCGA-23-1116-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr11:102585343G>A	ENST00000236826.3	-	8	1232	c.1134C>T	c.(1132-1134)gaC>gaT	p.D378D		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	378					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.D378D(1)		autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	AAACAGCTGCGTCAATTGCTT	0.393																																																1	Substitution - coding silent(1)	ovary(1)	11											75.0	73.0	74.0					11																	102585343		2203	4299	6502	102090553	SO:0001819	synonymous_variant	4317			J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.1134C>T	11.37:g.102585343G>A			102090553	Q45F99	Silent	SNP	ENST00000236826.3	37	CCDS8320.1	SNP	40	Broad																																																																																				0.393	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395223.1	NM_002424		Silent
PRMT8	56341	broad.mit.edu	37	12	3659196	3659196	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr12:3659196G>C	ENST00000382622.3	+	3	746	c.356G>C	c.(355-357)gGg>gCg	p.G119A	PRMT8_ENST00000261252.4_3'UTR|PRMT8_ENST00000452611.2_Missense_Mutation_p.G110A	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	119	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			CTGGATGTGGGGAGTGGTACT	0.552																																																0			12											224.0	186.0	199.0					12																	3659196		2203	4300	6503	3529457	SO:0001583	missense	56341			AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.356G>C	12.37:g.3659196G>C	ENSP00000372067:p.Gly119Ala		3529457	B2RDP0|Q8TBJ8	Missense_Mutation	SNP	ENST00000382622.3	37	CCDS8521.2	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835066	0.50951	.	.	ENSG00000111218	ENST00000452611;ENST00000382622	T;T	0.67171	-0.25;-0.25	5.69	4.8	0.61643	.	0.000000	0.85682	D	0.000000	D	0.88190	0.6370	H	0.98333	4.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.91640	0.5326	10	0.87932	D	0	.	12.4292	0.55565	0.0814:0.0:0.9186:0.0	.	110;119	Q9NR22-2;Q9NR22	.;ANM8_HUMAN	A	110;119	ENSP00000414507:G110A;ENSP00000372067:G119A	ENSP00000372067:G119A	G	+	2	0	PRMT8	3529457	1.000000	0.71417	0.849000	0.33467	0.016000	0.09150	9.813000	0.99286	1.411000	0.46957	-0.136000	0.14681	GGG		0.552	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	NM_019854		Missense_Mutation
LTBR	4055	broad.mit.edu	37	12	6499840	6499840	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr12:6499840C>T	ENST00000228918.4	+	10	1371	c.1045C>T	c.(1045-1047)Cat>Tat	p.H349Y	LTBR_ENST00000541102.1_Missense_Mutation_p.H206Y|LTBR_ENST00000539925.1_Missense_Mutation_p.H330Y	NM_002342.2	NP_002333.1	P36941	TNR3_HUMAN	lymphotoxin beta receptor (TNFR superfamily, member 3)	349					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)	p.H349Y(1)		breast(1)|cervix(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15						CAATGGCATTCATGTCACCGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											132.0	136.0	135.0					12																	6499840		2203	4300	6503	6370101	SO:0001583	missense	4055			L04270	CCDS8544.1, CCDS59233.1	12p13	2013-05-22				ENSG00000111321		"""Tumor necrosis factor receptor superfamily"""	6718	protein-coding gene	gene with protein product		600979		D12S370		8171323, 8486360	Standard	NM_002342		Approved	TNFCR, TNFR-RP, TNFR2-RP, TNF-R-III, TNFRSF3	uc001qny.2	P36941		ENST00000228918.4:c.1045C>T	12.37:g.6499840C>T	ENSP00000228918:p.His349Tyr		6370101	B7Z1D2|D3DUR2|F5GXE7	Missense_Mutation	SNP	ENST00000228918.4	37	CCDS8544.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	13.51	2.260123	0.39995	.	.	ENSG00000111321	ENST00000539925;ENST00000228918;ENST00000540343;ENST00000541102	D;D;T	0.87412	-2.25;-2.25;-0.34	4.33	3.42	0.39159	.	0.435416	0.16934	N	0.193548	D	0.84705	0.5531	L	0.32530	0.975	0.27257	N	0.958736	D;P;P	0.52996	0.957;0.928;0.818	P;P;B	0.51701	0.677;0.477;0.342	T	0.76580	-0.2907	10	0.49607	T	0.09	-2.4119	9.9931	0.41883	0.0:0.7939:0.206:0.0	.	330;330;349	F5GXE7;B7Z1D2;P36941	.;.;TNR3_HUMAN	Y	330;349;242;206	ENSP00000440875:H330Y;ENSP00000228918:H349Y;ENSP00000438605:H206Y	ENSP00000228918:H349Y	H	+	1	0	LTBR	6370101	0.955000	0.32602	0.983000	0.44433	0.374000	0.29953	1.974000	0.40559	1.013000	0.39391	0.555000	0.69702	CAT		0.562	LTBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399422.1			Missense_Mutation
SLC22A17	51310	broad.mit.edu	37	14	23816823	23816823	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr14:23816823G>C	ENST00000206544.8	-	7	1398	c.1062C>G	c.(1060-1062)ttC>ttG	p.F354L	SLC22A17_ENST00000397260.3_Missense_Mutation_p.F243L|SLC22A17_ENST00000397267.1_Missense_Mutation_p.F354L|SLC22A17_ENST00000354772.3_Missense_Mutation_p.F354L|SLC22A17_ENST00000474057.1_5'UTR	NM_020372.2	NP_065105.2	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17	354					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|vacuole (GO:0005773)	transmembrane signaling receptor activity (GO:0004888)|transmembrane transporter activity (GO:0022857)	p.F354L(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TGACCCCCAGGAAGACACAGG	0.642																																																1	Substitution - Missense(1)	ovary(1)	14											49.0	56.0	54.0					14																	23816823		2203	4300	6503	22886663	SO:0001583	missense	51310			AJ243653	CCDS9593.1, CCDS9594.2	14q11.2	2013-05-22	2008-01-11		ENSG00000092096	ENSG00000092096		"""Solute carriers"""	23095	protein-coding gene	gene with protein product	"""neutrophil gelatinase-associated lipocalin receptor"""	611461				16377569	Standard	NM_016609		Approved	BOCT, BOIT, NGALR	uc001wjl.3	Q8WUG5	OTTHUMG00000028740	ENST00000206544.8:c.1062C>G	14.37:g.23816823G>C	ENSP00000206544:p.Phe354Leu		22886663	A4UA13|A8MUT0|Q2TAB0|Q5BKY8|Q86U04|Q9H1D3|Q9NQD5	Missense_Mutation	SNP	ENST00000206544.8	37	CCDS9593.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	9.366	1.069200	0.20147	.	.	ENSG00000092096	ENST00000354772;ENST00000397260;ENST00000206544;ENST00000397267	T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76	5.04	5.04	0.67666	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.071226	0.64402	D	0.000018	T	0.58595	0.2133	N	0.20445	0.575	0.41573	D	0.988697	B;B	0.20887	0.043;0.049	B;B	0.26614	0.021;0.071	T	0.54050	-0.8351	10	0.06099	T	0.92	-24.0486	15.4089	0.74902	0.0:0.0:1.0:0.0	.	354;354	Q8WUG5-2;Q8WUG5	.;S22AH_HUMAN	L	354;243;354;354	ENSP00000346824:F354L;ENSP00000380430:F243L;ENSP00000206544:F354L;ENSP00000380437:F354L	ENSP00000206544:F354L	F	-	3	2	SLC22A17	22886663	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.572000	0.36461	2.629000	0.89072	0.655000	0.94253	TTC		0.642	SLC22A17-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157223.3	NM_020372		Missense_Mutation
TTC7B	145567	broad.mit.edu	37	14	91196448	91196448	+	Silent	SNP	C	C	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr14:91196448C>T	ENST00000328459.6	-	5	790	c.669G>A	c.(667-669)caG>caA	p.Q223Q	TTC7B_ENST00000357056.2_Silent_p.Q223Q	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	223										NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				CATGGGCTCTCTGAAGTCCTG	0.408																																																0			14											90.0	100.0	96.0					14																	91196448		2203	4300	6503	90266201	SO:0001819	synonymous_variant	145567			BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.669G>A	14.37:g.91196448C>T			90266201	Q86U24|Q86VT3	Silent	SNP	ENST00000328459.6	37	CCDS32140.1	SNP	32	Broad																																																																																				0.408	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411364.2			Silent
GJD2	57369	broad.mit.edu	37	15	35045515	35045515	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr15:35045515T>C	ENST00000290374.4	-	2	606	c.130A>G	c.(130-132)Acg>Gcg	p.T44A	RP11-814P5.1_ENST00000558707.1_RNA|RP11-814P5.1_ENST00000503496.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	44					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)	p.T44A(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		TCGTACACCGTCTCCCCCACA	0.582																																																1	Substitution - Missense(1)	ovary(1)	15											87.0	79.0	82.0					15																	35045515		2201	4298	6499	32832807	SO:0001583	missense	57369			AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.130A>G	15.37:g.35045515T>C	ENSP00000290374:p.Thr44Ala		32832807	Q2M241|Q9P2R0	Missense_Mutation	SNP	ENST00000290374.4	37	CCDS10040.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	13.82	2.352453	0.41700	.	.	ENSG00000159248	ENST00000290374	D	0.99032	-5.35	5.1	5.1	0.69264	Connexin, N-terminal (2);	0.148612	0.42548	D	0.000698	D	0.95878	0.8658	N	0.05259	-0.085	0.80722	D	1	B	0.17852	0.024	B	0.26310	0.068	D	0.93465	0.6814	10	0.48119	T	0.1	.	15.0355	0.71744	0.0:0.0:0.0:1.0	.	44	Q9UKL4	CXD2_HUMAN	A	44	ENSP00000290374:T44A	ENSP00000290374:T44A	T	-	1	0	GJD2	32832807	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.868000	0.87116	2.142000	0.66516	0.459000	0.35465	ACG		0.582	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251875.2			Missense_Mutation
GNG13	51764	broad.mit.edu	37	16	849054	849054	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr16:849054C>G	ENST00000248150.4	-	2	125	c.24G>C	c.(22-24)caG>caC	p.Q8H		NM_016541.2	NP_057625.1	Q9P2W3	GBG13_HUMAN	guanine nucleotide binding protein (G protein), gamma 13	8					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|sensory perception of taste (GO:0050909)|small molecule metabolic process (GO:0044281)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|signal transducer activity (GO:0004871)	p.Q8H(1)		ovary(1)	1		Hepatocellular(780;0.00335)				CTTTCTTCATCTGTGGCACGT	0.642																																																1	Substitution - Missense(1)	ovary(1)	16											121.0	96.0	104.0					16																	849054		2198	4299	6497	789055	SO:0001583	missense	51764			AB030207	CCDS10427.1	16p13.3	2008-08-01			ENSG00000127588	ENSG00000127588			14131	protein-coding gene	gene with protein product	"""G gamma subunit, clone:h2-35"""	607298				10570481	Standard	NM_016541		Approved	h2-35, G(gamma)13	uc002ckh.4	Q9P2W3	OTTHUMG00000047839	ENST00000248150.4:c.24G>C	16.37:g.849054C>G	ENSP00000248150:p.Gln8His		789055	B2R5C8|Q52LX0|Q9UJJ3	Missense_Mutation	SNP	ENST00000248150.4	37	CCDS10427.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728178	0.69074	.	.	ENSG00000127588	ENST00000248150	T	0.23552	1.9	5.72	3.72	0.42706	G-protein gamma domain (5);	0.053018	0.85682	D	0.000000	T	0.30479	0.0766	.	.	.	0.58432	D	0.999999	P	0.42123	0.771	P	0.46144	0.505	T	0.02288	-1.1182	9	0.48119	T	0.1	-23.8441	10.3833	0.44125	0.0:0.7907:0.1351:0.0743	.	8	Q9P2W3	GBG13_HUMAN	H	8	ENSP00000248150:Q8H	ENSP00000248150:Q8H	Q	-	3	2	GNG13	789055	1.000000	0.71417	0.997000	0.53966	0.710000	0.40934	3.668000	0.54554	0.723000	0.32274	0.561000	0.74099	CAG		0.642	GNG13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109062.3	NM_016541		Missense_Mutation
SLC12A4	6560	broad.mit.edu	37	16	67984375	67984375	+	Silent	SNP	C	C	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr16:67984375C>T	ENST00000316341.3	-	12	1616	c.1476G>A	c.(1474-1476)agG>agA	p.R492R	SLC12A4_ENST00000422611.2_Silent_p.R494R|SLC12A4_ENST00000338335.3_Silent_p.R492R|SLC12A4_ENST00000572010.1_5'Flank|SLC12A4_ENST00000541864.2_Silent_p.R461R|SLC12A4_ENST00000537830.2_Silent_p.R486R|SLC12A4_ENST00000576616.1_Silent_p.R492R|SLC12A4_ENST00000572037.1_Silent_p.R444R	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	492					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.R492R(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCACCAAGTTCCTGCTGACAC	0.622																																																1	Substitution - coding silent(1)	ovary(1)	16											76.0	71.0	72.0					16																	67984375		2198	4300	6498	66541876	SO:0001819	synonymous_variant	6560				CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.1476G>A	16.37:g.67984375C>T			66541876	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Silent	SNP	ENST00000316341.3	37	CCDS10855.1	SNP	30	Broad																																																																																				0.622	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072		Silent
TBX2	6909	broad.mit.edu	37	17	59485672	59485672	+	Silent	SNP	C	C	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr17:59485672C>T	ENST00000240328.3	+	7	2225	c.1944C>T	c.(1942-1944)gcC>gcT	p.A648A	RP11-332H18.4_ENST00000592009.1_RNA	NM_005994.3	NP_005985.3	Q13207	TBX2_HUMAN	T-box 2	648					aorta morphogenesis (GO:0035909)|atrioventricular canal development (GO:0036302)|cardiac muscle tissue development (GO:0048738)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|developmental growth involved in morphogenesis (GO:0060560)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|endocardial cushion morphogenesis (GO:0003203)|mammary placode formation (GO:0060596)|muscle cell fate determination (GO:0007521)|negative regulation of cardiac chamber formation (GO:1901211)|negative regulation of heart looping (GO:1901208)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|palate development (GO:0060021)|pharynx development (GO:0060465)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A638A(1)		endometrium(1)|lung(7)|ovary(1)	9						GCTCCAAGGCCGCTGGTGGAA	0.701																																					GBM(3;187 253 11467 14965 23079)											1	Substitution - coding silent(1)	ovary(1)	17											17.0	15.0	16.0					17																	59485672		2195	4287	6482	56840454	SO:0001819	synonymous_variant	6909			AB209378	CCDS11627.2	17q23.2	2012-01-23			ENSG00000121068	ENSG00000121068		"""T-boxes"""	11597	protein-coding gene	gene with protein product		600747				8530034	Standard	NM_005994		Approved		uc010wox.2	Q13207	OTTHUMG00000156986	ENST00000240328.3:c.1944C>T	17.37:g.59485672C>T			56840454	Q16424|Q7Z647	Silent	SNP	ENST00000240328.3	37	CCDS11627.2	SNP	23	Broad																																																																																				0.701	TBX2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346977.2	NM_005994		Silent
PRTN3	5657	broad.mit.edu	37	19	843898	843898	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr19:843898A>G	ENST00000234347.5	+	3	279	c.233A>G	c.(232-234)cAg>cGg	p.Q78R	PRTN3_ENST00000544537.2_Missense_Mutation_p.Q37R	NM_002777.3	NP_002768.3	P24158	PRTN3_HUMAN	proteinase 3	78	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				collagen catabolic process (GO:0030574)|mature dendritic cell differentiation (GO:0097029)|negative regulation of phagocytosis (GO:0050765)|positive regulation of cell proliferation (GO:0008284)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.Q78R(1)		lung(1)|ovary(2)|urinary_tract(1)	4		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCAGACCCCAGCGCCTGGTG	0.701																																																1	Substitution - Missense(1)	ovary(1)	19											22.0	23.0	23.0					19																	843898		2189	4288	6477	794898	SO:0001583	missense	5657				CCDS32860.1	19p13.3	2008-07-31	2008-07-31			ENSG00000196415			9495	protein-coding gene	gene with protein product	"""myeloblastin"", ""serine proteinase, neutrophil"", ""Wegener granulomatosis autoantigen"""	177020				2258701	Standard	NM_002777		Approved	PR-3, ACPA, C-ANCA, AGP7, MBT, P29	uc002lqa.1	P24158		ENST00000234347.5:c.233A>G	19.37:g.843898A>G	ENSP00000234347:p.Gln78Arg		794898	P15637|P18078|Q4VB08|Q4VB09|Q6LBM7|Q6LBN2|Q9UD25|Q9UQD8	Missense_Mutation	SNP	ENST00000234347.5	37	CCDS32860.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	a	7.090	0.572043	0.13623	.	.	ENSG00000196415	ENST00000234347;ENST00000544537	D	0.88509	-2.39	2.73	-5.09	0.02920	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.65637	0.2710	N	0.03029	-0.43	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.55425	-0.8143	9	0.25106	T	0.35	.	0.7434	0.00977	0.2018:0.3785:0.1684:0.2513	.	78	P24158	PRTN3_HUMAN	R	78;37	ENSP00000234347:Q78R	ENSP00000234347:Q78R	Q	+	2	0	PRTN3	794898	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.379000	0.00243	-1.202000	0.02655	0.398000	0.26397	CAG		0.701	PRTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457888.2	NM_002777		Missense_Mutation
CPAMD8	27151	broad.mit.edu	37	19	17039019	17039019	+	Missense_Mutation	SNP	T	T	C	rs375296622		TCGA-23-1116-01	TCGA-23-1116-10			T	C	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr19:17039019T>C	ENST00000443236.1	-	25	3342	c.3311A>G	c.(3310-3312)aAt>aGt	p.N1104S		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1057						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.N1104S(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GACAGACTCATTGGATGGCTC	0.587																																																1	Substitution - Missense(1)	ovary(1)	19						T	SER/ASN	0,3938		0,0,1969	35.0	39.0	38.0		3311	3.1	0.8	19		38	1,8309		0,1,4154	no	missense	CPAMD8	NM_015692.2	46	0,1,6123	CC,CT,TT		0.012,0.0,0.0082	possibly-damaging	1104/1933	17039019	1,12247	1969	4155	6124	16900019	SO:0001583	missense	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3311A>G	19.37:g.17039019T>C	ENSP00000402505:p.Asn1104Ser		16900019	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	SNP	52	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.558|4.558	0.103578|0.103578	0.08731|0.08731	0.0|0.0	1.2E-4|1.2E-4	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	3.13|3.13	3.13|3.13	0.36017|0.36017	.|Farnesoic acid O-methyl transferase (1);	.|0.462648	.|0.17924	.|U	.|0.157387	T|T	0.35970|0.35970	0.0950|0.0950	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|P	.|0.38420	.|0.63	.|B	.|0.34873	.|0.191	T|T	0.09185|0.09185	-1.0686|-1.0686	5|9	.|0.27082	.|T	.|0.32	.|.	11.38|11.38	0.49752|0.49752	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1057	.|Q8IZJ3	.|CPMD8_HUMAN	V|S	1115|1104	.|.	.|ENSP00000291440:N1104S	M|N	-|-	1|2	0|0	CPAMD8|CPAMD8	16900019|16900019	1.000000|1.000000	0.71417|0.71417	0.819000|0.819000	0.32651|0.32651	0.075000|0.075000	0.17131|0.17131	2.111000|2.111000	0.41883|0.41883	1.072000|1.072000	0.40860|0.40860	0.533000|0.533000	0.62120|0.62120	ATG|AAT		0.587	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692		Missense_Mutation
ITPKC	80271	broad.mit.edu	37	19	41235196	41235196	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1116-01	TCGA-23-1116-10			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr19:41235196C>G	ENST00000263370.2	+	3	1378	c.1345C>G	c.(1345-1347)Ctg>Gtg	p.L449V		NM_025194.2	NP_079470.1	Q96DU7	IP3KC_HUMAN	inositol-trisphosphate 3-kinase C	449					inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.L449V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	14			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GAAAGACCCGCTGCGACCTTT	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											66.0	58.0	61.0					19																	41235196		2203	4300	6503	45927036	SO:0001583	missense	80271			Y11999	CCDS12563.1	19q13.1	2011-04-28	2011-04-28		ENSG00000086544	ENSG00000086544	2.7.1.127		14897	protein-coding gene	gene with protein product		606476	"""inositol 1,4,5-trisphosphate 3-kinase C"""			11085927	Standard	NM_025194		Approved	IP3KC, IP3-3KC	uc002oot.3	Q96DU7		ENST00000263370.2:c.1345C>G	19.37:g.41235196C>G	ENSP00000263370:p.Leu449Val		45927036	Q9UE25|Q9Y475	Missense_Mutation	SNP	ENST00000263370.2	37	CCDS12563.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	13.27	2.188365	0.38609	.	.	ENSG00000086544	ENST00000263370	T	0.18657	2.2	5.49	2.09	0.27110	.	0.000000	0.85682	D	0.000000	T	0.41396	0.1157	M	0.82323	2.585	0.58432	D	0.999995	D	0.61697	0.99	P	0.62435	0.902	T	0.34775	-0.9815	10	0.72032	D	0.01	-17.3894	8.2765	0.31874	0.0:0.6627:0.0:0.3373	.	449	Q96DU7	IP3KC_HUMAN	V	449	ENSP00000263370:L449V	ENSP00000263370:L449V	L	+	1	2	ITPKC	45927036	0.984000	0.35163	0.997000	0.53966	0.693000	0.40251	2.669000	0.46825	0.732000	0.32470	-0.367000	0.07326	CTG		0.567	ITPKC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463104.1	NM_025194		Missense_Mutation
LMTK3	114783	broad.mit.edu	37	19	49000792	49000794	+	Missense_Mutation	TNP	GGG	GGG	TTT			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr19:49000792_49000794GGG>TTT	ENST00000600059.1	-	11	3759_3761	c.3532_3534CCC>AAA	c.(3532-3534)CCC>AAA	p.P1178K	LMTK3_ENST00000270238.3_Missense_Mutation_p.P1207K			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	1178	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P1207T(1)		breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		CTGGGGCCCCGGGCTCTCCCTCG	0.754																																																1	Substitution - Missense(1)	ovary(1)	19																																								53692606	SO:0001583	missense	114783			AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.3532_3534CCC>AAA	19.37:g.49000792GGG>TTT	ENSP00000472020:p.Pro1178Lys		53692604	Q4G0U1	Missense_Mutation	TNP	ENST00000600059.1	37		TNP	39	Broad																																																																																				0.754	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1	NM_052895		Missense_Mutation
GYS1	2997	broad.mit.edu	37	19	49489140	49489140	+	Silent	SNP	G	G	A	rs371721154		TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr19:49489140G>A	ENST00000323798.3	-	4	841	c.645C>T	c.(643-645)gcC>gcT	p.A215A	GYS1_ENST00000457974.1_5'Flank|GYS1_ENST00000544287.1_Intron|GYS1_ENST00000540532.1_Silent_p.A135A|GYS1_ENST00000263276.6_Silent_p.A151A|GYS1_ENST00000541188.1_Silent_p.A135A	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	215					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)	p.A215A(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		CCACGGCACCGGCACACAGGT	0.632																																																1	Substitution - coding silent(1)	ovary(1)	19						G	,	0,4406		0,0,2203	68.0	61.0	64.0		453,645	-7.9	0.0	19		64	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GYS1	NM_001161587.1,NM_002103.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	151/674,215/738	49489140	1,13005	2203	4300	6503	54180952	SO:0001819	synonymous_variant	2997				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.645C>T	19.37:g.49489140G>A			54180952	Q9BTT9	Silent	SNP	ENST00000323798.3	37	CCDS12747.1	SNP	39	Broad																																																																																				0.632	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103		Silent
NOSIP	51070	broad.mit.edu	37	19	50059680	50059680	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr19:50059680C>T	ENST00000596358.1	-	8	786	c.728G>A	c.(727-729)gGg>gAg	p.G243E	NOSIP_ENST00000339093.3_Missense_Mutation_p.G246E|NOSIP_ENST00000391853.3_Missense_Mutation_p.G243E	NM_001270960.1	NP_001257889.1	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein	243					negative regulation of catalytic activity (GO:0043086)|negative regulation of nitric-oxide synthase activity (GO:0051001)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G243E(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|skin(2)|urinary_tract(1)	11		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		GACCACAGCCCCACTACGGTG	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											84.0	67.0	73.0					19																	50059680		2203	4300	6503	54751492	SO:0001583	missense	51070			AF132959	CCDS12772.1	19q13.3	2008-02-05				ENSG00000142546			17946	protein-coding gene	gene with protein product						11149895, 10810093	Standard	NM_015953		Approved	CGI-25	uc002pol.4	Q9Y314		ENST00000596358.1:c.728G>A	19.37:g.50059680C>T	ENSP00000470034:p.Gly243Glu		54751492	Q96FD2	Missense_Mutation	SNP	ENST00000596358.1	37	CCDS12772.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628466	0.67015	.	.	ENSG00000142546	ENST00000339093;ENST00000391853	D	0.89617	-2.54	5.15	4.1	0.47936	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.95265	0.8464	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95907	0.8920	10	0.87932	D	0	-49.251	13.8414	0.63441	0.1545:0.8455:0.0:0.0	.	243	Q9Y314	NOSIP_HUMAN	E	243	ENSP00000375726:G243E	ENSP00000343497:G243E	G	-	2	0	NOSIP	54751492	1.000000	0.71417	0.957000	0.39632	0.143000	0.21401	6.834000	0.75339	1.155000	0.42497	0.462000	0.41574	GGG		0.632	NOSIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465423.1			Missense_Mutation
ADM5	199800	broad.mit.edu	37	19	50189896	50189896	+	5'Flank	SNP	G	G	A	rs181508065		TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr19:50189896G>A	ENST00000420022.3	+	0	0				CTB-33G10.6_ENST00000596472.1_RNA|PRMT1_ENST00000532489.1_Silent_p.T269T|PRMT1_ENST00000454376.2_Silent_p.T315T|PRMT1_ENST00000391851.4_Silent_p.T297T	NM_001101340.1	NP_001094810.1	C9JUS6	ADM5_HUMAN	adrenomedullin 5 (putative)							extracellular region (GO:0005576)		p.T291T(1)									GGAAGCAGACGGTGTTCTACA	0.687																																																1	Substitution - coding silent(1)	ovary(1)	19											47.0	41.0	43.0					19																	50189896		2203	4300	6503	54881708	SO:0001631	upstream_gene_variant	3276			BC032764	CCDS46146.1	19q13.33	2012-12-07	2012-12-07	2012-10-29	ENSG00000224420	ENSG00000224420			27293	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 76"", ""adrenomedullin 5 homolog (pig)"""	C19orf76		18434369	Standard	NM_001101340		Approved	AM5	uc002pph.2	C9JUS6			19.37:g.50189896G>A	Exception_encountered		54881708		Silent	SNP	ENST00000420022.3	37	CCDS46146.1	SNP	39	Broad																																																																																				0.687	ADM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465777.1	NM_001101340		Silent
NLRP5	126206	broad.mit.edu	37	19	56538818	56538818	+	Missense_Mutation	SNP	G	G	A	rs200987887		TCGA-23-1116-01	TCGA-23-1116-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr19:56538818G>A	ENST00000390649.3	+	7	1219	c.1219G>A	c.(1219-1221)Gtc>Atc	p.V407I		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	407	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.V407I(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CTTCCTGATCGTCACCGTCAG	0.542													g|||	1	0.000199681	0.0	0.0	5008	,	,		20585	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	19						A	ILE/VAL	1,4179		0,1,2089	44.0	46.0	45.0		1219	-6.7	0.0	19		45	0,8434		0,0,4217	yes	missense	NLRP5	NM_153447.4	29	0,1,6306	AA,AG,GG		0.0,0.0239,0.0079	benign	407/1201	56538818	1,12613	2090	4217	6307	61230630	SO:0001583	missense	126206			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1219G>A	19.37:g.56538818G>A	ENSP00000375063:p.Val407Ile		61230630	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	g	0.055	-1.237820	0.01493	2.39E-4	0.0	ENSG00000171487	ENST00000390649	T	0.78481	-1.18	3.35	-6.7	0.01766	NACHT nucleoside triphosphatase (1);	0.458519	0.16270	N	0.221828	T	0.32133	0.0819	N	0.00670	-1.27	0.09310	N	1	P	0.36199	0.543	B	0.32583	0.148	T	0.51663	-0.8677	10	0.02654	T	1	.	7.572	0.27913	0.5545:0.3269:0.1186:0.0	.	407	P59047	NALP5_HUMAN	I	407	ENSP00000375063:V407I	ENSP00000375063:V407I	V	+	1	0	NLRP5	61230630	0.011000	0.17503	0.000000	0.03702	0.000000	0.00434	-0.036000	0.12185	-2.712000	0.00393	-2.063000	0.00397	GTC		0.542	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		Missense_Mutation
GREB1	9687	broad.mit.edu	37	2	11777935	11777935	+	Silent	SNP	C	C	T	rs200104733|rs34955282	byFrequency	TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr2:11777935C>T	ENST00000381486.2	+	31	5740	c.5440C>T	c.(5440-5442)Ctg>Ttg	p.L1814L	GREB1_ENST00000234142.5_Silent_p.L1814L|GREB1_ENST00000396123.1_Silent_p.L812L	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1814			L -> V (in dbSNP:rs34955282).			integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CCAGCTCCTGCTGGAGAAGTT	0.622																																					Ovarian(39;850 945 2785 23371 33093)											0			2											69.0	77.0	75.0					2																	11777935		2143	4250	6393	11695386	SO:0001819	synonymous_variant	9687				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.5440C>T	2.37:g.11777935C>T			11695386	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Silent	SNP	ENST00000381486.2	37	CCDS42655.1	SNP	28	Broad																																																																																				0.622	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		Silent
DDX1	1653	broad.mit.edu	37	2	15760383	15760383	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr2:15760383G>A	ENST00000381341.2	+	18	1647	c.1258G>A	c.(1258-1260)Gag>Aag	p.E420K	DDX1_ENST00000233084.3_Missense_Mutation_p.E420K			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	420	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)	p.E420K(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		GAAACTGTCCGAGAAGATAAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	2											130.0	126.0	128.0					2																	15760383		2203	4300	6503	15677834	SO:0001583	missense	1653			X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.1258G>A	2.37:g.15760383G>A	ENSP00000370745:p.Glu420Lys		15677834	B4DME8|B4DPN6	Missense_Mutation	SNP	ENST00000381341.2	37	CCDS1686.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.141873	0.94560	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	T;T	0.04454	3.62;3.62	6.07	6.07	0.98685	DEAD-like helicase (2);	0.000000	0.85682	D	0.000000	T	0.06735	0.0172	N	0.17872	0.535	0.80722	D	1	D	0.61697	0.99	P	0.46659	0.523	T	0.46992	-0.9151	10	0.33141	T	0.24	-29.4035	20.6525	0.99598	0.0:0.0:1.0:0.0	.	420	Q92499	DDX1_HUMAN	K	420;420;404	ENSP00000370745:E420K;ENSP00000233084:E420K	ENSP00000233084:E420K	E	+	1	0	DDX1	15677834	1.000000	0.71417	0.995000	0.50966	0.436000	0.31835	9.869000	0.99810	2.890000	0.99128	0.585000	0.79938	GAG		0.368	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207141.2	NM_004939		Missense_Mutation
KIF3C	3797	broad.mit.edu	37	2	26204478	26204478	+	Silent	SNP	C	C	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr2:26204478C>T	ENST00000264712.3	-	1	888	c.309G>A	c.(307-309)aaG>aaA	p.K103K	KIF3C_ENST00000405914.1_Silent_p.K103K	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	103	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.K103K(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGTATAGGTCTTGCCAGTGC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	2											76.0	70.0	72.0					2																	26204478		2203	4300	6503	26057982	SO:0001819	synonymous_variant	3797				CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.309G>A	2.37:g.26204478C>T			26057982	O43544|Q4ZG18|Q53SX5|Q562F7	Silent	SNP	ENST00000264712.3	37	CCDS1719.1	SNP	32	Broad																																																																																				0.607	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1			Silent
ATP6V1E2	90423	broad.mit.edu	37	2	46739447	46739447	+	Missense_Mutation	SNP	C	C	T	rs142304043		TCGA-23-1116-01	TCGA-23-1116-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr2:46739447C>T	ENST00000306448.4	-	2	1517	c.404G>A	c.(403-405)cGc>cAc	p.R135H	ATP6V1E2_ENST00000522587.1_Missense_Mutation_p.R135H	NM_080653.3	NP_542384.1	Q96A05	VATE2_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2	135					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|proton-transporting two-sector ATPase complex, catalytic domain (GO:0033178)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.R135H(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.151)			TGGCCGGCAGCGTACAATCAT	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		19067	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2						C	HIS/ARG	0,4406		0,0,2203	91.0	88.0	89.0		404	4.4	1.0	2	dbSNP_134	89	3,8597	3.0+/-9.4	0,3,4297	yes	missense	ATP6V1E2	NM_080653.3	29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	possibly-damaging	135/227	46739447	3,13003	2203	4300	6503	46592951	SO:0001583	missense	90423			BC008981	CCDS1826.1	2p21	2011-02-10	2006-01-13	2002-06-21	ENSG00000250565	ENSG00000250565		"""ATPases / V-type"""	18125	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 31kD-like 2"", ""ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 2"""	ATP6EL2, ATP6V1EL2		12036578	Standard	NM_080653		Approved	MGC9341, VMA4, ATP6E1	uc002ruy.3	Q96A05	OTTHUMG00000128819	ENST00000306448.4:c.404G>A	2.37:g.46739447C>T	ENSP00000304891:p.Arg135His		46592951		Missense_Mutation	SNP	ENST00000306448.4	37	CCDS1826.1	SNP	27	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.48	3.633009	0.67015	0.0	3.49E-4	ENSG00000250565	ENST00000306448;ENST00000522587	.	.	.	4.37	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.68348	0.2991	M	0.80183	2.485	0.80722	D	1	B	0.24533	0.105	B	0.26969	0.075	T	0.71361	-0.4616	9	0.72032	D	0.01	-9.083	12.7449	0.57276	0.0:1.0:0.0:0.0	.	135	Q96A05	VATE2_HUMAN	H	135	.	ENSP00000304891:R135H	R	-	2	0	ATP6V1E2	46592951	1.000000	0.71417	0.994000	0.49952	0.975000	0.68041	3.920000	0.56446	2.713000	0.92767	0.655000	0.94253	CGC		0.552	ATP6V1E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250753.1	NM_080653		Missense_Mutation
MARS2	92935	broad.mit.edu	37	2	198571199	198571199	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr2:198571199A>C	ENST00000282276.6	+	1	1113	c.1070A>C	c.(1069-1071)gAt>gCt	p.D357A	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	357					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)	p.D357A(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	AACGTGGTGGATCCTAGGACT	0.562																																																1	Substitution - Missense(1)	ovary(1)	2											374.0	328.0	343.0					2																	198571199		2203	4300	6503	198279444	SO:0001583	missense	92935			BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.1070A>C	2.37:g.198571199A>C	ENSP00000282276:p.Asp357Ala		198279444	A0AVC3|Q76E79|Q8IW62|Q8N7N4	Missense_Mutation	SNP	ENST00000282276.6	37	CCDS33358.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	21.4	4.147969	0.78001	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	T	0.51817	0.69	5.45	5.45	0.79879	Aminoacyl-tRNA synthetase, class I (M) (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.051258	0.85682	D	0.000000	T	0.67059	0.2853	M	0.75615	2.305	0.58432	D	0.999999	D	0.67145	0.996	D	0.70227	0.968	T	0.70407	-0.4880	10	0.59425	D	0.04	-13.1448	13.474	0.61297	1.0:0.0:0.0:0.0	.	357	Q96GW9	SYMM_HUMAN	A	357;284	ENSP00000282276:D357A	ENSP00000282276:D357A	D	+	2	0	MARS2	198279444	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.224000	0.95209	2.082000	0.62665	0.533000	0.62120	GAT		0.562	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395		Missense_Mutation
ALS2CR12	130540	broad.mit.edu	37	2	202208956	202208956	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr2:202208956T>G	ENST00000286190.5	-	5	445	c.399A>C	c.(397-399)caA>caC	p.Q133H	ALS2CR12_ENST00000405148.2_Missense_Mutation_p.Q133H|ALS2CR12_ENST00000392257.3_Missense_Mutation_p.Q133H|ALS2CR12_ENST00000448967.1_5'UTR|ALS2CR12_ENST00000439709.1_Missense_Mutation_p.Q133H			Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12	133					regulation of GTPase activity (GO:0043087)	outer dense fiber (GO:0001520)|sperm fibrous sheath (GO:0035686)|sperm flagellum (GO:0036126)		p.Q133H(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)	21						GCTCTGAGATTTGCTCTTCTA	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											271.0	255.0	261.0					2																	202208956		2203	4300	6503	201917201	SO:0001583	missense	130540			AB053314	CCDS2346.1, CCDS46488.1	2q33.1	2009-10-06			ENSG00000155749	ENSG00000155749			14439	protein-coding gene	gene with protein product							Standard	XM_006712272		Approved		uc002uya.4	Q96Q35	OTTHUMG00000132824	ENST00000286190.5:c.399A>C	2.37:g.202208956T>G	ENSP00000286190:p.Gln133His		201917201	G5E9S3|Q53TT6|Q8N1B6	Missense_Mutation	SNP	ENST00000286190.5	37	CCDS2346.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	14.26	2.481966	0.44147	.	.	ENSG00000155749	ENST00000286190;ENST00000405148;ENST00000392257;ENST00000439709	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.17	2.3	0.28687	.	0.136402	0.33959	N	0.004394	T	0.36744	0.0978	M	0.66939	2.045	0.28104	N	0.931296	B;B	0.32800	0.385;0.385	B;B	0.33295	0.161;0.099	T	0.38351	-0.9665	10	0.87932	D	0	-7.1569	4.8772	0.13662	0.1674:0.6461:0.0:0.1865	.	133;133	Q96Q35;G5E9S3	AL2SB_HUMAN;.	H	133	ENSP00000286190:Q133H;ENSP00000385098:Q133H;ENSP00000376086:Q133H;ENSP00000412073:Q133H	ENSP00000286190:Q133H	Q	-	3	2	ALS2CR12	201917201	1.000000	0.71417	1.000000	0.80357	0.325000	0.28411	0.620000	0.24403	0.240000	0.21263	-0.375000	0.07067	CAA		0.433	ALS2CR12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256286.1	NM_139163		Missense_Mutation
IRS1	3667	broad.mit.edu	37	2	227663087	227663088	+	Missense_Mutation	DNP	CC	CC	TT	rs200009513		TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr2:227663087_227663088CC>TT	ENST00000305123.5	-	1	1387_1388	c.367_368GG>AA	c.(367-369)GGa>AAa	p.G123K	RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	123	Mediates interaction with PHIP. {ECO:0000250}.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.G123K(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GGCCGCAGCTCCGTCGTGGTGG	0.688											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	2																																								227371332	SO:0001583	missense	3667				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.367_368delinsTT	2.37:g.227663087_227663088delinsTT	ENSP00000304895:p.Gly123Lys	2321	227371331		Missense_Mutation	DNP	ENST00000305123.5	37	CCDS2463.1	DNP	30	Broad																																																																																				0.688	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544		Missense_Mutation
KIF1A	547	broad.mit.edu	37	2	241685237	241685237	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr2:241685237C>A	ENST00000320389.7	-	29	3147	c.2989G>T	c.(2989-2991)Ggc>Tgc	p.G997C	KIF1A_ENST00000498729.2_Missense_Mutation_p.G1098C	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	997					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.G997C(1)		NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		AAGGTGTTGCCCAGGCGGAGG	0.622																																																1	Substitution - Missense(1)	ovary(1)	2											35.0	39.0	38.0					2																	241685237		2013	4197	6210	241333910	SO:0001583	missense	547			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2989G>T	2.37:g.241685237C>A	ENSP00000322791:p.Gly997Cys		241333910	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	SNP	22	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.86|18.86	3.712464|3.712464	0.68730|0.68730	.|.	.|.	ENSG00000130294|ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283|ENST00000415042	D;D;D|.	0.84516|.	-1.86;-1.86;-1.86|.	4.17|4.17	4.17|4.17	0.49024|0.49024	.|.	0.000000|.	0.85682|.	U|.	0.000000|.	T|T	0.77805|0.77805	0.4185|0.4185	M|M	0.83483|0.83483	2.645|2.645	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	T|T	0.81111|0.81111	-0.1081|-0.1081	10|5	0.72032|.	D|.	0.01|.	.|.	16.4761|16.4761	0.84132|0.84132	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1098;1098;997|.	F5H045;Q12756-2;Q12756|.	.;.;KIF1A_HUMAN|.	C|C	997;1098;1098;1098|123	ENSP00000322791:G997C;ENSP00000438388:G1098C;ENSP00000384231:G1098C|.	ENSP00000322791:G997C|.	G|W	-|-	1|3	0|0	KIF1A|KIF1A	241333910|241333910	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.404000|0.404000	0.30871|0.30871	7.626000|7.626000	0.83164|0.83164	1.870000|1.870000	0.54199|0.54199	0.313000|0.313000	0.20887|0.20887	GGC|TGG		0.622	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483		Missense_Mutation
MC3R	4159	broad.mit.edu	37	20	54824044	54824044	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr20:54824044G>C	ENST00000243911.2	+	1	257	c.145G>C	c.(145-147)Ggc>Cgc	p.G49R		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	49					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.G86R(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			CCTGTCTCTGGGCATCGTCAG	0.567																																																1	Substitution - Missense(1)	ovary(1)	20											105.0	90.0	95.0					20																	54824044		2203	4300	6503	54257451	SO:0001583	missense	4159				CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.145G>C	20.37:g.54824044G>C	ENSP00000243911:p.Gly49Arg		54257451	Q4KN27|Q9H517	Missense_Mutation	SNP	ENST00000243911.2	37	CCDS13449.2	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889499	0.72524	.	.	ENSG00000124089	ENST00000243911	T	0.02974	4.09	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000003	T	0.06600	0.0169	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56763	-0.7925	10	0.87932	D	0	.	17.9343	0.89008	0.0:0.0:1.0:0.0	.	86	P41968	MC3R_HUMAN	R	49	ENSP00000243911:G49R	ENSP00000243911:G49R	G	+	1	0	MC3R	54257451	1.000000	0.71417	0.999000	0.59377	0.518000	0.34316	9.618000	0.98365	2.317000	0.78254	0.650000	0.86243	GGC		0.567	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079786.2			Missense_Mutation
RBM38	55544	broad.mit.edu	37	20	55967738	55967738	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr20:55967738A>G	ENST00000356208.5	+	2	441	c.266A>G	c.(265-267)gAg>gGg	p.E89G	RP4-800J21.3_ENST00000417346.1_RNA|RBM38_ENST00000371219.2_Missense_Mutation_p.E8G|RBM38_ENST00000440234.2_Missense_Mutation_p.E89G	NM_017495.5	NP_059965.2	Q9H0Z9	RBM38_HUMAN	RNA binding motif protein 38	89	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell cycle (GO:0007049)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|regulation of myotube differentiation (GO:0010830)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E89G(1)		large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)			GCGGCAGCTGAGAGGGCTTGC	0.682																																																1	Substitution - Missense(1)	ovary(1)	20											28.0	34.0	32.0					20																	55967738		1952	4164	6116	55401144	SO:0001583	missense	55544			X75314	CCDS46617.1, CCDS46618.1	20q13.31	2013-02-12	2006-07-11	2006-07-11	ENSG00000132819	ENSG00000132819		"""RNA binding motif (RRM) containing"""	15818	protein-coding gene	gene with protein product		612428	"""RNA-binding region (RNP1, RRM) containing 1"""	RNPC1			Standard	NM_017495		Approved	HSRNASEB, SEB4D, seb4B, dJ800J21.2	uc010zzj.2	Q9H0Z9	OTTHUMG00000032820	ENST00000356208.5:c.266A>G	20.37:g.55967738A>G	ENSP00000348538:p.Glu89Gly		55401144	A6NDK1|A6NMU6|Q15350|Q15351|Q9BYK3|Q9BYK4	Missense_Mutation	SNP	ENST00000356208.5	37	CCDS46617.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	19.05	3.751047	0.69533	.	.	ENSG00000132819	ENST00000356208;ENST00000440234;ENST00000371219	D;D;T	0.86164	-2.08;-2.08;1.93	4.92	4.92	0.64577	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.104372	0.64402	D	0.000005	D	0.85898	0.5804	M	0.63208	1.945	0.80722	D	1	B	0.19817	0.039	B	0.27076	0.076	T	0.82876	-0.0240	10	0.38643	T	0.18	0.0059	14.1999	0.65696	1.0:0.0:0.0:0.0	.	89	Q9H0Z9	RBM38_HUMAN	G	89;89;8	ENSP00000348538:E89G;ENSP00000407848:E89G;ENSP00000360263:E8G	ENSP00000345248:E66G	E	+	2	0	RBM38	55401144	1.000000	0.71417	0.992000	0.48379	0.954000	0.61252	6.848000	0.75409	1.830000	0.53286	0.460000	0.39030	GAG		0.682	RBM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079843.4	NM_183425		Missense_Mutation
ZGPAT	84619	broad.mit.edu	37	20	62340348	62340348	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr20:62340348A>C	ENST00000328969.5	+	2	543	c.416A>C	c.(415-417)tAc>tCc	p.Y139S	ARFRP1_ENST00000359715.5_5'Flank|ZGPAT_ENST00000357119.4_Missense_Mutation_p.Y139S|RP4-583P15.15_ENST00000490623.2_Missense_Mutation_p.T45P|ARFRP1_ENST00000440854.1_5'Flank|ZGPAT_ENST00000355969.6_Missense_Mutation_p.Y139S|ARFRP1_ENST00000324228.2_5'Flank|ARFRP1_ENST00000609142.1_5'Flank|ZGPAT_ENST00000369967.3_Missense_Mutation_p.Y139S|ARFRP1_ENST00000607873.1_5'Flank|ZGPAT_ENST00000448100.2_Missense_Mutation_p.Y139S	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	139					negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y139S(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GCGCCCTACTACAGCTCCTGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	20											74.0	70.0	71.0					20																	62340348		2203	4300	6503	61810792	SO:0001583	missense	84619			AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.416A>C	20.37:g.62340348A>C	ENSP00000332013:p.Tyr139Ser		61810792	E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Missense_Mutation	SNP	ENST00000328969.5	37	CCDS13534.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	11.12	1.545071	0.27652	.	.	ENSG00000197114	ENST00000448100;ENST00000355969;ENST00000357119;ENST00000369967;ENST00000328969	T;T;T;T;T	0.21932	1.99;1.99;1.98;1.99;1.98	4.51	3.41	0.39046	.	0.512723	0.20979	N	0.082253	T	0.18173	0.0436	L	0.49126	1.545	0.34397	D	0.694825	P;P;P	0.44627	0.804;0.839;0.804	B;B;B	0.42692	0.234;0.372;0.395	T	0.18304	-1.0341	10	0.10377	T	0.69	-0.8254	8.5389	0.33379	0.9109:0.0:0.0891:0.0	.	139;139;139	Q8N5A5-3;Q8N5A5;Q8N5A5-2	.;ZGPAT_HUMAN;.	S	139	ENSP00000391176:Y139S;ENSP00000348242:Y139S;ENSP00000349634:Y139S;ENSP00000358984:Y139S;ENSP00000332013:Y139S	ENSP00000332013:Y139S	Y	+	2	0	ZGPAT	61810792	1.000000	0.71417	0.993000	0.49108	0.751000	0.42716	2.816000	0.48026	0.603000	0.29913	0.459000	0.35465	TAC		0.627	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484		Missense_Mutation
SAMD10	140700	broad.mit.edu	37	20	62607099	62607099	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr20:62607099C>A	ENST00000369886.3	-	4	706	c.532G>T	c.(532-534)Gtg>Ttg	p.V178L	ZNF512B_ENST00000450537.1_Intron|SAMD10_ENST00000498830.1_5'UTR|ZNF512B_ENST00000217130.3_Intron	NM_080621.4	NP_542188.1	Q9BYL1	SAM10_HUMAN	sterile alpha motif domain containing 10	178	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.							p.V178L(1)		kidney(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)	7	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					AGGCGGAGCACCTGCTGCAGC	0.687																																																1	Substitution - Missense(1)	ovary(1)	20											33.0	39.0	37.0					20																	62607099		2202	4299	6501	62077543	SO:0001583	missense	140700				CCDS13549.1	20q13.33	2013-01-10	2004-07-15	2004-07-16	ENSG00000130590	ENSG00000130590		"""Sterile alpha motif (SAM) domain containing"""	16129	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 136"""	C20orf136			Standard	NM_080621		Approved		uc002yhm.2	Q9BYL1	OTTHUMG00000033011	ENST00000369886.3:c.532G>T	20.37:g.62607099C>A	ENSP00000358902:p.Val178Leu		62077543		Missense_Mutation	SNP	ENST00000369886.3	37	CCDS13549.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	15.40	2.823859	0.50739	.	.	ENSG00000130590	ENST00000369886	D	0.85411	-1.98	3.99	3.03	0.35002	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.348037	0.25981	N	0.027073	T	0.77658	0.4163	L	0.32530	0.975	0.48696	D	0.999698	B	0.06786	0.001	B	0.12156	0.007	T	0.70212	-0.4934	10	0.37606	T	0.19	-3.5352	13.2529	0.60062	0.0:0.8301:0.1699:0.0	.	178	Q9BYL1	SAM10_HUMAN	L	178	ENSP00000358902:V178L	ENSP00000358902:V178L	V	-	1	0	SAMD10	62077543	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.940000	0.49003	0.667000	0.31107	0.491000	0.48974	GTG		0.687	SAMD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080255.1	NM_080621		Missense_Mutation
ENTHD1	150350	broad.mit.edu	37	22	40283747	40283747	+	Silent	SNP	C	C	T	rs143322957		TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr22:40283747C>T	ENST00000325157.6	-	2	256	c.6G>A	c.(4-6)gcG>gcA	p.A2A		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	2								p.A2A(1)		breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					GTCTCCTGAACGCCATAAGTA	0.403																																																1	Substitution - coding silent(1)	ovary(1)	22											53.0	52.0	53.0					22																	40283747		2203	4300	6503	38613693	SO:0001819	synonymous_variant	150350			AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.6G>A	22.37:g.40283747C>T			38613693	B0QYD5|Q5H9F7|Q96LK3	Silent	SNP	ENST00000325157.6	37	CCDS13998.1	SNP	19	Broad																																																																																				0.403	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512		Silent
CHKB	1120	broad.mit.edu	37	22	51019979	51019979	+	Silent	SNP	G	G	T	rs148857303		TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr22:51019979G>T	ENST00000406938.2	-	4	668	c.451C>A	c.(451-453)Cgg>Agg	p.R151R	CPT1B_ENST00000434492.2_5'Flank|CHKB-CPT1B_ENST00000453634.1_5'Flank|CHKB-AS1_ENST00000380711.3_RNA|CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000360719.2_5'Flank|CHKB_ENST00000463053.1_5'UTR|CPT1B_ENST00000457250.1_5'Flank|CPT1B_ENST00000440709.1_5'Flank	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta	151					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)	p.R151R(1)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	TTCAATGGCCGACTCTGCACC	0.562																																																1	Substitution - coding silent(1)	ovary(1)	22											54.0	50.0	52.0					22																	51019979		2203	4300	6503	49366845	SO:0001819	synonymous_variant	1120			AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275	ENST00000406938.2:c.451C>A	22.37:g.51019979G>T			49366845	A0PJM6|Q13388	Silent	SNP	ENST00000406938.2	37	CCDS14099.1	SNP	37	Broad																																																																																				0.562	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317267.3	NM_005198		Silent
ZCWPW2	152098	broad.mit.edu	37	3	28454696	28454696	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr3:28454696G>T	ENST00000383768.2	+	3	325	c.137G>T	c.(136-138)aGt>aTt	p.S46I	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.S46I			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	46							zinc ion binding (GO:0008270)	p.S46I(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						TTGTTATCAAGTGAGGATTCA	0.363																																																1	Substitution - Missense(1)	ovary(1)	3											138.0	132.0	134.0					3																	28454696		2203	4300	6503	28429700	SO:0001583	missense	152098			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.137G>T	3.37:g.28454696G>T	ENSP00000373278:p.Ser46Ile		28429700		Missense_Mutation	SNP	ENST00000383768.2	37	CCDS33723.1	SNP	36	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.76|11.76	1.736214|1.736214	0.30774|0.30774	.|.	.|.	ENSG00000206559|ENSG00000206559	ENST00000428875|ENST00000420223;ENST00000383768;ENST00000421010	.|T;T	.|0.32988	.|1.43;1.43	5.46|5.46	0.421|0.421	0.16451|0.16451	.|Zinc finger, CW-type (2);	.|0.425465	.|0.22405	.|N	.|0.060488	T|T	0.19725|0.19725	0.0474|0.0474	L|L	0.31578|0.31578	0.945|0.945	0.22842|0.22842	N|N	0.998661|0.998661	.|P	.|0.36789	.|0.57	.|B	.|0.39805	.|0.31	T|T	0.11108|0.11108	-1.0601|-1.0601	5|10	.|0.38643	.|T	.|0.18	-1.4113|-1.4113	5.0514|5.0514	0.14511|0.14511	0.2519:0.2965:0.4515:0.0|0.2519:0.2965:0.4515:0.0	.|.	.|46	.|Q504Y3	.|ZCPW2_HUMAN	N|I	29|46	.|ENSP00000373278:S46I;ENSP00000412386:S46I	.|ENSP00000373278:S46I	K|S	+|+	3|2	2|0	ZCWPW2|ZCWPW2	28429700|28429700	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.908000|0.908000	0.53690|0.53690	0.384000|0.384000	0.20668|0.20668	-0.226000|-0.226000	0.09899|0.09899	-0.216000|-0.216000	0.12614|0.12614	AAG|AGT		0.363	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384		Missense_Mutation
ROBO1	6091	broad.mit.edu	37	3	78649379	78649379	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1116-01	TCGA-23-1116-10			A	T	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr3:78649379A>T	ENST00000464233.1	-	30	4938	c.4825T>A	c.(4825-4827)Tca>Aca	p.S1609T	ROBO1_ENST00000466906.1_5'UTR|ROBO1_ENST00000436010.2_Missense_Mutation_p.S1570T|ROBO1_ENST00000467549.1_Missense_Mutation_p.S1509T|ROBO1_ENST00000495273.1_Missense_Mutation_p.S1564T	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1609					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.S1586T(1)|p.S1609T(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GATCCTCTTGATGACATTGAG	0.373																																																2	Substitution - Missense(2)	ovary(2)	3											168.0	155.0	159.0					3																	78649379		1891	4109	6000	78732069	SO:0001583	missense	6091			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.4825T>A	3.37:g.78649379A>T	ENSP00000420321:p.Ser1609Thr		78732069	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	19.32	3.804613	0.70682	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.73258	-0.58;-0.63;-0.68;-0.73	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.72301	0.3443	N	0.19112	0.55	0.58432	D	0.99999	P;P;P;P	0.52577	0.9;0.924;0.918;0.954	B;P;B;D	0.63597	0.344;0.827;0.316;0.916	T	0.71427	-0.4596	9	.	.	.	.	15.8056	0.78506	1.0:0.0:0.0:0.0	.	1609;1564;1509;1570	Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	ROBO1_HUMAN;.;.;.	T	1570;1564;1609;1564;1509;1613	ENSP00000406043:S1570T;ENSP00000420321:S1609T;ENSP00000420637:S1564T;ENSP00000417992:S1509T	.	S	-	1	0	ROBO1	78732069	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.711000	0.84669	2.143000	0.66587	0.454000	0.30748	TCA		0.373	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941		Missense_Mutation
CHST2	9435	broad.mit.edu	37	3	142840592	142840592	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr3:142840592G>A	ENST00000309575.3	+	2	2318	c.934G>A	c.(934-936)Gcg>Acg	p.A312T		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	312					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						CTTCGACGTGGCGGTCTTGGC	0.657																																																0			3											22.0	23.0	22.0					3																	142840592		2198	4299	6497	144323282	SO:0001583	missense	9435			BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.934G>A	3.37:g.142840592G>A	ENSP00000307911:p.Ala312Thr		144323282	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	37	CCDS3129.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638635	0.29157	.	.	ENSG00000175040	ENST00000309575	D	0.82255	-1.59	4.38	4.38	0.52667	Sulfotransferase domain (1);	0.552779	0.16880	N	0.195739	T	0.64227	0.2579	N	0.05306	-0.075	0.32287	N	0.566777	B	0.17268	0.021	B	0.18871	0.023	T	0.62320	-0.6879	10	0.15066	T	0.55	-21.1192	10.7305	0.46093	0.0882:0.0:0.9118:0.0	.	312	Q9Y4C5	CHST2_HUMAN	T	312	ENSP00000307911:A312T	ENSP00000307911:A312T	A	+	1	0	CHST2	144323282	1.000000	0.71417	0.995000	0.50966	0.871000	0.50021	5.077000	0.64419	2.269000	0.75478	0.407000	0.27541	GCG		0.657	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267		Missense_Mutation
MFSD7	84179	broad.mit.edu	37	4	680353	680353	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr4:680353A>C	ENST00000404286.2	-	2	277	c.262T>G	c.(262-264)Tgg>Ggg	p.W88G	MFSD7_ENST00000515118.1_Missense_Mutation_p.W88G|MFSD7_ENST00000503156.1_Missense_Mutation_p.W24G|MFSD7_ENST00000513740.1_5'UTR|MFSD7_ENST00000347950.5_Missense_Mutation_p.W66G|MFSD7_ENST00000322224.4_Missense_Mutation_p.W88G	NM_032219.2	NP_115595.2	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing 7	88					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.W88G(1)		cervix(1)|kidney(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	11						TCCAGGATCCAGATGGCCGCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	4											95.0	86.0	89.0					4																	680353		2203	4300	6503	670353	SO:0001583	missense	84179			AK025922	CCDS3338.1, CCDS75086.1	4p16.3	2013-05-22			ENSG00000169026	ENSG00000169026		"""Solute carriers"""	26177	protein-coding gene	gene with protein product						12975309	Standard	XM_005272295		Approved	FLJ22269, LP2561	uc003gax.3	Q6UXD7	OTTHUMG00000119001	ENST00000404286.2:c.262T>G	4.37:g.680353A>C	ENSP00000384616:p.Trp88Gly		670353	A8K7J5|Q6XYD4|Q8N6H1|Q9H6H6	Missense_Mutation	SNP	ENST00000404286.2	37		SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	14.22	2.469785	0.43839	.	.	ENSG00000169026	ENST00000347950;ENST00000322224;ENST00000404286;ENST00000515118;ENST00000503156;ENST00000512249;ENST00000507165	T;T;T;T;T;T;T	0.59502	0.32;0.26;0.26;0.32;0.26;0.26;0.26	4.62	4.62	0.57501	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.78142	0.4237	M	0.90542	3.125	0.44048	D	0.996785	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.996;0.996;0.998;0.998	T	0.81863	-0.0737	10	0.72032	D	0.01	-18.031	10.329	0.43812	1.0:0.0:0.0:0.0	.	24;88;66;88;88	D6RIZ6;D6R9R0;Q6UXD7-3;Q6UXD7;Q6UXD7-2	.;.;.;MFSD7_HUMAN;.	G	66;88;88;88;24;88;24	ENSP00000307545:W66G;ENSP00000320234:W88G;ENSP00000384616:W88G;ENSP00000423204:W88G;ENSP00000425753:W24G;ENSP00000425038:W88G;ENSP00000424556:W24G	ENSP00000320234:W88G	W	-	1	0	MFSD7	670353	1.000000	0.71417	0.971000	0.41717	0.034000	0.12701	5.519000	0.67074	1.925000	0.55765	0.379000	0.24179	TGG		0.632	MFSD7-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000358585.1	NM_032219		Missense_Mutation
HTRA3	94031	broad.mit.edu	37	4	8295868	8295868	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr4:8295868G>A	ENST00000307358.2	+	6	1195	c.991G>A	c.(991-993)Gcc>Acc	p.A331T	HTRA3_ENST00000382512.3_Missense_Mutation_p.A331T	NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	331	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.A331T(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						CATCTCCTTTGCCATCCCCTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	4											135.0	90.0	106.0					4																	8295868		2203	4299	6502	8346768	SO:0001583	missense	94031			AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.991G>A	4.37:g.8295868G>A	ENSP00000303766:p.Ala331Thr		8346768	Q7Z7A2	Missense_Mutation	SNP	ENST00000307358.2	37	CCDS3400.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	21.0	4.079552	0.76528	.	.	ENSG00000170801	ENST00000307358;ENST00000382512	D;D	0.90732	-2.72;-2.72	3.33	3.33	0.38152	Peptidase cysteine/serine, trypsin-like (1);	0.000000	0.85682	U	0.000000	D	0.94693	0.8288	M	0.85777	2.775	0.80722	D	1	D;D	0.69078	0.997;0.994	P;P	0.61800	0.894;0.829	D	0.95578	0.8644	10	0.87932	D	0	-10.3834	14.6368	0.68696	0.0:0.0:1.0:0.0	.	331;331	P83110;P83110-2	HTRA3_HUMAN;.	T	331	ENSP00000303766:A331T;ENSP00000371952:A331T	ENSP00000303766:A331T	A	+	1	0	HTRA3	8346768	1.000000	0.71417	0.999000	0.59377	0.665000	0.39181	8.992000	0.93519	1.410000	0.46936	0.313000	0.20887	GCC		0.592	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092669.1	NM_053044		Missense_Mutation
CABS1	85438	broad.mit.edu	37	4	71200994	71200994	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr4:71200994G>C	ENST00000273936.5	+	1	312	c.238G>C	c.(238-240)Gat>Cat	p.D80H		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	80					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)	p.D80H(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						ATCAGAAGATGATATGGGGAC	0.373																																																2	Substitution - Missense(2)	urinary_tract(1)|ovary(1)	4											65.0	68.0	67.0					4																	71200994		2203	4298	6501	71235583	SO:0001583	missense	85438			AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.238G>C	4.37:g.71200994G>C	ENSP00000273936:p.Asp80His		71235583	B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	ENST00000273936.5	37	CCDS3539.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	8.630	0.893502	0.17613	.	.	ENSG00000145309	ENST00000273936	T	0.28666	1.6	4.56	0.906	0.19314	.	0.650011	0.12762	N	0.441232	T	0.32763	0.0840	L	0.32530	0.975	0.09310	N	1	D	0.59767	0.986	P	0.55999	0.789	T	0.14337	-1.0476	10	0.72032	D	0.01	-28.9621	6.693	0.23183	0.3983:0.0:0.6017:0.0	.	80	Q96KC9	CABS1_HUMAN	H	80	ENSP00000273936:D80H	ENSP00000273936:D80H	D	+	1	0	CABS1	71235583	0.535000	0.26370	0.008000	0.14137	0.020000	0.10135	0.610000	0.24253	0.027000	0.15297	-0.140000	0.14226	GAT		0.373	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251561.3	NM_033122		Missense_Mutation
PCDHA8	56140	broad.mit.edu	37	5	140221935	140221935	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr5:140221935A>C	ENST00000531613.1	+	1	1029	c.1029A>C	c.(1027-1029)aaA>aaC	p.K343N	PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.K343N	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	343	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.K343N(1)		NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTTGGATAAAAATGATAACG	0.448																																																1	Substitution - Missense(1)	ovary(1)	5											45.0	47.0	46.0					5																	140221935		2201	4277	6478	140202119	SO:0001583	missense	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1029A>C	5.37:g.140221935A>C	ENSP00000434655:p.Lys343Asn		140202119	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	13.24	2.178956	0.38511	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.01745	4.66;4.66	3.69	-7.39	0.01402	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.975693	0.08237	U	0.976649	T	0.01254	0.0041	L	0.35542	1.07	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.49254	-0.8959	10	0.62326	D	0.03	.	0.4187	0.00452	0.2621:0.1562:0.2817:0.3	.	343;343	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	N	343	ENSP00000434655:K343N;ENSP00000367363:K343N	ENSP00000367363:K343N	K	+	3	2	PCDHA8	140202119	0.000000	0.05858	0.003000	0.11579	0.513000	0.34164	-7.051000	0.00045	-1.468000	0.01892	-0.533000	0.04299	AAA		0.448	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911		Missense_Mutation
PCDHB5	26167	broad.mit.edu	37	5	140516545	140516545	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr5:140516545G>A	ENST00000231134.5	+	1	1746	c.1529G>A	c.(1528-1530)gGc>gAc	p.G510D		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	510	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G510D(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGGACAACGGCCACCTGTTT	0.682																																																1	Substitution - Missense(1)	ovary(1)	5											84.0	85.0	85.0					5																	140516545		2203	4298	6501	140496729	SO:0001583	missense	26167			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1529G>A	5.37:g.140516545G>A	ENSP00000231134:p.Gly510Asp		140496729	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	16.73	3.202872	0.58234	.	.	ENSG00000113209	ENST00000231134;ENST00000537936	D	0.91464	-2.85	4.59	4.59	0.56863	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.97192	0.9082	H	0.97564	4.03	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	D	0.98982	1.0805	9	0.87932	D	0	.	17.7921	0.88555	0.0:0.0:1.0:0.0	.	510	Q9Y5E4	PCDB5_HUMAN	D	510;294	ENSP00000231134:G510D	ENSP00000231134:G510D	G	+	2	0	PCDHB5	140496729	1.000000	0.71417	0.565000	0.28409	0.263000	0.26337	9.718000	0.98758	2.282000	0.76494	0.430000	0.28490	GGC		0.682	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669		Missense_Mutation
C5orf45	51149	broad.mit.edu	37	5	179264682	179264682	+	Silent	SNP	T	T	A	rs200300835		TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr5:179264682T>A	ENST00000292586.6	-	7	831	c.741A>T	c.(739-741)ccA>ccT	p.P247P	C5orf45_ENST00000523084.1_Silent_p.P113P|SQSTM1_ENST00000389805.4_3'UTR|C5orf45_ENST00000520698.1_Intron|SQSTM1_ENST00000376929.3_3'UTR|C5orf45_ENST00000403396.2_Intron|C5orf45_ENST00000518219.1_3'UTR|C5orf45_ENST00000518235.1_Intron|C5orf45_ENST00000523267.1_5'UTR|C5orf45_ENST00000376931.2_Silent_p.P192P	NM_016175.3	NP_057259.2	Q6NTE8	CE045_HUMAN	chromosome 5 open reading frame 45	247								p.P247P(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12						GAAGAGACCTTGGCTGCTCAC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	5											76.0	80.0	78.0					5																	179264682		2203	4300	6503	179197288	SO:0001819	synonymous_variant	51149				CCDS34318.1, CCDS34319.1	5q35.3	2008-07-10			ENSG00000161010	ENSG00000161010			30817	protein-coding gene	gene with protein product	"""truncated calcium binding protein"""						Standard	NM_016175		Approved	MGC65027, MGC78537, DKFZp686L2452, LOC51149	uc003mla.3	Q6NTE8	OTTHUMG00000163490	ENST00000292586.6:c.741A>T	5.37:g.179264682T>A			179197288	B5MD09|E9PAK6|Q7Z3D8|Q9BUC1|Q9UN54	Silent	SNP	ENST00000292586.6	37	CCDS34319.1	SNP	63	Broad																																																																																				0.572	C5orf45-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373760.2	NM_016175		Silent
SCML4	256380	broad.mit.edu	37	6	108041957	108041957	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr6:108041957G>A	ENST00000369020.3	-	6	1168	c.923C>T	c.(922-924)cCa>cTa	p.P308L	SCML4_ENST00000369021.3_Missense_Mutation_p.P279L|SCML4_ENST00000369022.2_Missense_Mutation_p.P250L|SCML4_ENST00000479803.1_5'UTR|SCML4_ENST00000369025.2_Missense_Mutation_p.P66L	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	308	SAM.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P279L(1)		endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		GCTGGAGGCTGGAGGCCTCAG	0.597																																																1	Substitution - Missense(1)	ovary(1)	6											78.0	83.0	81.0					6																	108041957		2203	4300	6503	108148650	SO:0001583	missense	256380				CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.923C>T	6.37:g.108041957G>A	ENSP00000358016:p.Pro308Leu		108148650	B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	ENST00000369020.3	37	CCDS5060.2	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	7.234	0.599825	0.13939	.	.	ENSG00000146285	ENST00000369022;ENST00000369025;ENST00000369020;ENST00000369021	T;T;T	0.48201	0.84;0.82;0.86	5.19	3.26	0.37387	.	0.219173	0.32258	N	0.006341	T	0.21062	0.0507	L	0.51422	1.61	0.43740	D	0.996232	B;B;B	0.14805	0.011;0.0;0.0	B;B;B	0.11329	0.006;0.001;0.002	T	0.08806	-1.0704	10	0.32370	T	0.25	.	6.4782	0.22047	0.0939:0.0:0.5627:0.3434	.	308;308;279	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	L	250;66;308;279	ENSP00000358018:P250L;ENSP00000358016:P308L;ENSP00000358017:P279L	ENSP00000358016:P308L	P	-	2	0	SCML4	108148650	1.000000	0.71417	0.998000	0.56505	0.177000	0.22998	3.220000	0.51207	1.416000	0.47057	0.650000	0.86243	CCA		0.597	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000041700.3	XM_171128		Missense_Mutation
IL20RA	53832	broad.mit.edu	37	6	137322912	137322912	+	Nonsense_Mutation	SNP	C	C	T	rs201995170		TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr6:137322912C>T	ENST00000316649.5	-	7	1680	c.1445G>A	c.(1444-1446)tGg>tAg	p.W482*	IL20RA_ENST00000468393.1_5'Flank|RP11-204P2.3_ENST00000458017.1_RNA|IL20RA_ENST00000367748.1_Nonsense_Mutation_p.W371*|IL20RA_ENST00000541547.1_Nonsense_Mutation_p.W433*	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	482					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)		p.W482*(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		TTGGGGATCCCAGTCGACCAG	0.622																																																1	Substitution - Nonsense(1)	ovary(1)	6											66.0	70.0	68.0					6																	137322912		2203	4300	6503	137364605	SO:0001587	stop_gained	53832			AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.1445G>A	6.37:g.137322912C>T	ENSP00000314976:p.Trp482*		137364605	B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Nonsense_Mutation	SNP	ENST00000316649.5	37	CCDS5181.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	40	8.048491	0.98627	.	.	ENSG00000016402	ENST00000316649;ENST00000367748;ENST00000541547	.	.	.	5.96	5.96	0.96718	.	0.287311	0.35646	N	0.003080	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.029	17.12	0.86699	0.0:1.0:0.0:0.0	.	.	.	.	X	482;371;433	.	ENSP00000314976:W482X	W	-	2	0	IL20RA	137364605	1.000000	0.71417	0.998000	0.56505	0.279000	0.26890	4.459000	0.60102	2.826000	0.97356	0.655000	0.94253	TGG		0.622	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042393.1	NM_014432		Nonsense_Mutation
PKD1L1	168507	broad.mit.edu	37	7	47879093	47879093	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr7:47879093C>T	ENST00000289672.2	-	36	5770	c.5720G>A	c.(5719-5721)cGc>cAc	p.R1907H		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1907	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.R1907H(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CCGCTCCACGCGACCATCATG	0.662																																																1	Substitution - Missense(1)	ovary(1)	7											36.0	29.0	31.0					7																	47879093		2203	4300	6503	47845618	SO:0001583	missense	168507			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.5720G>A	7.37:g.47879093C>T	ENSP00000289672:p.Arg1907His		47845618	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	10.34	1.323829	0.24080	.	.	ENSG00000158683	ENST00000289672	T	0.21191	2.02	4.87	-3.1	0.05315	Lipoxygenase, LH2 (2);Lipase/lipooxygenase, PLAT/LH2 (1);	1.465050	0.04621	N	0.402066	T	0.17704	0.0425	L	0.41710	1.295	0.09310	N	1	B	0.20671	0.047	B	0.22386	0.039	T	0.34675	-0.9819	10	0.19590	T	0.45	-3.4881	10.9246	0.47184	0.0:0.3749:0.0:0.6251	.	1907	Q8TDX9	PK1L1_HUMAN	H	1907	ENSP00000289672:R1907H	ENSP00000289672:R1907H	R	-	2	0	PKD1L1	47845618	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.418000	0.02462	-0.629000	0.05575	-0.123000	0.14984	CGC		0.662	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		Missense_Mutation
TSPAN12	23554	broad.mit.edu	37	7	120428922	120428922	+	Silent	SNP	C	C	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr7:120428922C>T	ENST00000222747.3	-	8	1249	c.642G>A	c.(640-642)ttG>ttA	p.L214L	TSPAN12_ENST00000415871.1_Silent_p.L214L	NM_012338.3	NP_036470.1	O95859	TSN12_HUMAN	tetraspanin 12	214					angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|regulation of angiogenesis (GO:0045765)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.L214L(1)		endometrium(3)|kidney(1)|lung(4)|ovary(1)|skin(1)	10	all_neural(327;0.117)					TGGTTCCTCTCAAAAAGGAAT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	7											66.0	65.0	65.0					7																	120428922		2203	4300	6503	120216158	SO:0001819	synonymous_variant	23554			AF124522	CCDS5777.1	7q31.31	2013-02-14	2005-03-21	2005-03-21	ENSG00000106025	ENSG00000106025		"""Tetraspanins"""	21641	protein-coding gene	gene with protein product		613138	"""transmembrane 4 superfamily member 12"""	TM4SF12			Standard	NM_012338		Approved	NET-2	uc003vjk.3	O95859	OTTHUMG00000156980	ENST00000222747.3:c.642G>A	7.37:g.120428922C>T			120216158	A4D0V8|B4DRG6|Q549U9|Q8N5Y0	Silent	SNP	ENST00000222747.3	37	CCDS5777.1	SNP	29	Broad																																																																																				0.413	TSPAN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346951.1	NM_012338		Silent
CHCHD3	54927	broad.mit.edu	37	7	132709313	132709313	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr7:132709313G>C	ENST00000262570.5	-	3	388	c.244C>G	c.(244-246)Cag>Gag	p.Q82E	CHCHD3_ENST00000542753.1_Missense_Mutation_p.Q82E|CHCHD3_ENST00000448878.1_Missense_Mutation_p.Q82E|CHCHD3_ENST00000476546.1_5'UTR	NM_017812.2	NP_060282.1	Q9NX63	MIC19_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 3	82					inner mitochondrial membrane organization (GO:0007007)|mitochondrial fusion (GO:0008053)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein complex scaffold (GO:0032947)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)	p.Q82E(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	7						CACCGTTTCTGATCTTCGGAT	0.383																																																1	Substitution - Missense(1)	ovary(1)	7											171.0	170.0	170.0					7																	132709313		2203	4300	6503	132359853	SO:0001583	missense	54927			BC011596	CCDS5828.1	7q33	2012-10-02			ENSG00000106554	ENSG00000106554		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21906	protein-coding gene	gene with protein product	"""mitochondrial inner membrane organizing system 3"", ""protein phosphatase 1, regulatory subunit 22"""	613748				22252321, 23019327, 21081504, 17624330	Standard	NM_017812		Approved	FLJ20420, MINOS3, PPP1R22	uc003vre.3	Q9NX63	OTTHUMG00000155231	ENST00000262570.5:c.244C>G	7.37:g.132709313G>C	ENSP00000262570:p.Gln82Glu		132359853		Missense_Mutation	SNP	ENST00000262570.5	37	CCDS5828.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	8.870	0.949110	0.18356	.	.	ENSG00000106554	ENST00000262570;ENST00000448878;ENST00000542753	T;T;T	0.39406	1.08;1.08;1.08	5.81	4.91	0.64330	.	0.114347	0.64402	D	0.000010	T	0.41743	0.1172	L	0.57536	1.79	0.40417	D	0.979806	B;B;B	0.28128	0.138;0.201;0.125	B;B;B	0.33846	0.048;0.171;0.13	T	0.28744	-1.0034	10	0.13108	T	0.6	-14.627	15.0414	0.71793	0.0:0.0:0.8488:0.1512	.	82;82;82	G3V1K1;C9JRZ6;Q9NX63	.;.;CHCH3_HUMAN	E	82	ENSP00000262570:Q82E;ENSP00000389297:Q82E;ENSP00000440267:Q82E	ENSP00000262570:Q82E	Q	-	1	0	CHCHD3	132359853	0.999000	0.42202	0.898000	0.35279	0.016000	0.09150	3.186000	0.50942	1.557000	0.49525	0.609000	0.83330	CAG		0.383	CHCHD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338899.1	NM_017812		Missense_Mutation
CLCN1	1180	broad.mit.edu	37	7	143013444	143013444	+	Missense_Mutation	SNP	C	C	T	rs185031797	byFrequency	TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr7:143013444C>T	ENST00000343257.2	+	1	226	c.139C>T	c.(139-141)Cgg>Tgg	p.R47W		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	47					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.R47W(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					GCACAGGCTCCGGAAGGATGC	0.607													C|||	6	0.00119808	0.0	0.0	5008	,	,		11835	0.006		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	7											67.0	62.0	64.0					7																	143013444		2202	4300	6502	142723566	SO:0001583	missense	1180			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.139C>T	7.37:g.143013444C>T	ENSP00000339867:p.Arg47Trp		142723566	A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	CCDS5881.1	SNP	23	Broad	5	0.0022893772893772895	0	0.0	0	0.0	5	0.008741258741258742	0	0.0	.	12.17	1.859093	0.32884	.	.	ENSG00000188037	ENST00000343257	D	0.86769	-2.17	5.19	2.23	0.28157	.	1.157020	0.06421	N	0.722300	T	0.73024	0.3534	L	0.29908	0.895	0.09310	N	0.999995	B	0.09022	0.002	B	0.06405	0.002	T	0.63497	-0.6624	10	0.56958	D	0.05	.	3.0292	0.06101	0.2779:0.4368:0.1992:0.0861	.	47	P35523	CLCN1_HUMAN	W	47	ENSP00000339867:R47W	ENSP00000339867:R47W	R	+	1	2	CLCN1	142723566	0.003000	0.15002	0.765000	0.31456	0.773000	0.43773	0.836000	0.27545	0.589000	0.29677	0.650000	0.86243	CGG		0.607	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		Missense_Mutation
NOS3	4846	broad.mit.edu	37	7	150708000	150708000	+	Silent	SNP	C	C	G			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr7:150708000C>G	ENST00000297494.3	+	23	3267	c.2910C>G	c.(2908-2910)ccC>ccG	p.P970P	NOS3_ENST00000461406.1_Silent_p.P764P|NOS3_ENST00000477227.1_3'UTR|ATG9B_ENST00000494791.1_5'Flank	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.P970P(1)		NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGCTGGGCCCCCTGCACTATG	0.662																																																1	Substitution - coding silent(1)	ovary(1)	7											37.0	36.0	36.0					7																	150708000		2203	4300	6503	150338933	SO:0001819	synonymous_variant	4846				CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.2910C>G	7.37:g.150708000C>G			150338933	Q495E5	Silent	SNP	ENST00000297494.3	37	CCDS5912.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	11.49	1.653186	0.29425	.	.	ENSG00000164867	ENST00000475017	T	0.62105	0.05	4.75	1.79	0.24919	.	0.200763	0.33631	N	0.004715	T	0.44244	0.1284	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.10359	-1.0633	7	0.10902	T	0.67	-14.889	6.2542	0.20864	0.3025:0.6039:0.0:0.0936	.	.	.	.	R	264	ENSP00000418245:P264R	ENSP00000418245:P264R	P	+	2	0	NOS3	150338933	0.000000	0.05858	0.992000	0.48379	0.976000	0.68499	-0.955000	0.03869	0.176000	0.19873	0.491000	0.48974	CCC		0.662	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350750.2	NM_000603		Silent
SDC2	6383	broad.mit.edu	37	8	97620629	97620629	+	Missense_Mutation	SNP	G	G	A	rs200028820		TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr8:97620629G>A	ENST00000302190.4	+	4	1294	c.373G>A	c.(373-375)Gaa>Aaa	p.E125K	SDC2_ENST00000518385.1_Missense_Mutation_p.E89K|SDC2_ENST00000522911.1_Missense_Mutation_p.E96K|SDC2_ENST00000519914.1_Missense_Mutation_p.E96K	NM_002998.3	NP_002989.2	P34741	SDC2_HUMAN	syndecan 2	125					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dendrite morphogenesis (GO:0048813)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|regulation of dendrite morphogenesis (GO:0048814)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)	p.E125K(1)		breast(1)|cervix(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|stomach(2)	16	Breast(36;3.41e-05)				Sargramostim(DB00020)	GGACCCAGCCGAAGAGGATAC	0.458																																																1	Substitution - Missense(1)	ovary(1)	8						G	LYS/GLU	0,4406		0,0,2203	94.0	91.0	92.0		373	4.4	0.1	8		92	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SDC2	NM_002998.3	56	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	125/202	97620629	2,13004	2203	4300	6503	97689805	SO:0001583	missense	6383			BC030133	CCDS6272.1	8q22-q23	2011-08-11	2007-02-15		ENSG00000169439	ENSG00000169439		"""Proteoglycans / Cell Surface : Syndecans"", ""CD molecules"""	10659	protein-coding gene	gene with protein product	"""syndecan proteoglycan 2"""	142460	"""heparan sulfate proteoglycan 1, cell surface-associated"""	HSPG, HSPG1		8187643	Standard	NM_002998		Approved	fibroglycan, SYND2, CD362	uc003yhv.1	P34741	OTTHUMG00000164689	ENST00000302190.4:c.373G>A	8.37:g.97620629G>A	ENSP00000307046:p.Glu125Lys		97689805	B3KQA3|Q6PIS6|Q9H6V1	Missense_Mutation	SNP	ENST00000302190.4	37	CCDS6272.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	9.959	1.222336	0.22457	0.0	2.33E-4	ENSG00000169439	ENST00000302190;ENST00000518385;ENST00000545117;ENST00000546193;ENST00000522911;ENST00000519914;ENST00000521590;ENST00000523877	T;T;T;T;T	0.31247	1.52;1.5;1.53;1.53;1.51	6.17	4.37	0.52481	.	0.807226	0.12068	N	0.502522	T	0.13372	0.0324	N	0.08118	0	0.24271	N	0.995245	P	0.41524	0.753	B	0.35655	0.207	T	0.04522	-1.0945	10	0.07644	T	0.81	-3.8934	10.21	0.43134	0.2061:0.0:0.7939:0.0	.	125	P34741	SDC2_HUMAN	K	125;89;125;115;96;96;96;96	ENSP00000307046:E125K;ENSP00000429045:E89K;ENSP00000427784:E96K;ENSP00000428256:E96K;ENSP00000429121:E96K	ENSP00000307046:E125K	E	+	1	0	SDC2	97689805	1.000000	0.71417	0.082000	0.20525	0.178000	0.23041	3.450000	0.52957	0.918000	0.36919	-0.150000	0.13652	GAA		0.458	SDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379750.1	NM_002998		Missense_Mutation
COL22A1	169044	broad.mit.edu	37	8	139890005	139890005	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr8:139890005G>A	ENST00000303045.6	-	3	1092	c.646C>T	c.(646-648)Cgt>Tgt	p.R216C	COL22A1_ENST00000435777.1_Missense_Mutation_p.R216C	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	216					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R216C(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TCACAAAGACGGCGCCGCAGC	0.662										HNSCC(7;0.00092)																																						1	Substitution - Missense(1)	ovary(1)	8											30.0	33.0	32.0					8																	139890005		2203	4300	6503	139959187	SO:0001583	missense	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.646C>T	8.37:g.139890005G>A	ENSP00000303153:p.Arg216Cys		139959187	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996852	0.54147	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	T;T	0.78595	-1.19;-1.19	5.03	5.03	0.67393	von Willebrand factor, type A (1);	0.000000	0.50627	D	0.000116	D	0.84556	0.5498	L	0.59436	1.845	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.84066	0.0377	9	.	.	.	.	12.4636	0.55745	0.0:0.0:0.8328:0.1672	.	216	Q8NFW1	COMA1_HUMAN	C	216	ENSP00000303153:R216C;ENSP00000387655:R216C	.	R	-	1	0	COL22A1	139959187	0.999000	0.42202	0.998000	0.56505	0.274000	0.26718	2.039000	0.41193	2.295000	0.77249	0.655000	0.94253	CGT		0.662	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		Missense_Mutation
PLEC	5339	broad.mit.edu	37	8	144992534	144992534	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr8:144992534G>A	ENST00000322810.4	-	32	12035	c.11866C>T	c.(11866-11868)Ccc>Tcc	p.P3956S	PLEC_ENST00000357649.2_Missense_Mutation_p.P3823S|PLEC_ENST00000527096.1_Missense_Mutation_p.P3842S|PLEC_ENST00000354958.2_Missense_Mutation_p.P3797S|PLEC_ENST00000356346.3_Missense_Mutation_p.P3805S|PLEC_ENST00000345136.3_Missense_Mutation_p.P3819S|PLEC_ENST00000436759.2_Missense_Mutation_p.P3846S|PLEC_ENST00000398774.2_Missense_Mutation_p.P3787S|PLEC_ENST00000354589.3_Missense_Mutation_p.P3819S	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3956	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.P3956S(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						ACCTCCAGGGGAAGGTGGAAG	0.662																																																1	Substitution - Missense(1)	ovary(1)	8											15.0	20.0	19.0					8																	144992534		2026	4169	6195	145064522	SO:0001583	missense	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.11866C>T	8.37:g.144992534G>A	ENSP00000323856:p.Pro3956Ser		145064522	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	11.16	1.556220	0.27827	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34	3.78	3.78	0.43462	.	0.000000	0.64402	U	0.000016	T	0.74943	0.3783	L	0.42686	1.345	0.58432	D	0.999996	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.998;0.998;0.998;0.999;0.998;0.998;0.998;0.998	T	0.76217	-0.3040	10	0.48119	T	0.1	.	14.8963	0.70646	0.0:0.0:1.0:0.0	.	3846;3805;3797;3956;3787;3819;3823;3819	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	S	3819;3823;3819;3787;3956;3797;3805;3846;3842	ENSP00000344848:P3819S;ENSP00000350277:P3823S;ENSP00000346602:P3819S;ENSP00000381756:P3787S;ENSP00000323856:P3956S;ENSP00000347044:P3797S;ENSP00000348702:P3805S;ENSP00000388180:P3846S;ENSP00000434583:P3842S	ENSP00000323856:P3956S	P	-	1	0	PLEC	145064522	1.000000	0.71417	0.978000	0.43139	0.628000	0.37860	7.680000	0.84062	2.103000	0.63969	0.297000	0.19635	CCC		0.662	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445		Missense_Mutation
SLC52A2	79581	broad.mit.edu	37	8	145583658	145583658	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr8:145583658G>T	ENST00000532887.1	+	3	1089	c.506G>T	c.(505-507)cGc>cTc	p.R169L	FBXL6_ENST00000455319.2_5'Flank|SLC52A2_ENST00000527078.1_Missense_Mutation_p.R169L|SLC52A2_ENST00000526891.1_3'UTR|SLC52A2_ENST00000526752.1_Intron|FBXL6_ENST00000526524.1_5'Flank|SLC52A2_ENST00000402965.1_Missense_Mutation_p.R169L|SLC52A2_ENST00000329994.2_Missense_Mutation_p.R169L|SLC52A2_ENST00000540505.1_Missense_Mutation_p.R81L|SLC52A2_ENST00000530047.1_Missense_Mutation_p.R169L|FBXL6_ENST00000331890.5_5'Flank			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	169					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	GGTGTGGGCCGCCTCGAGTGC	0.662																																																0			8											66.0	73.0	71.0					8																	145583658		2203	4300	6503	145554466	SO:0001583	missense	79581			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.506G>T	8.37:g.145583658G>T	ENSP00000436768:p.Arg169Leu		145554466	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Missense_Mutation	SNP	ENST00000532887.1	37	CCDS6423.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	5.996	0.367702	0.11352	.	.	ENSG00000185803	ENST00000530047;ENST00000527078;ENST00000402965;ENST00000534725;ENST00000532887;ENST00000329994;ENST00000540505	T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	3.82	0.537	0.17144	.	0.393713	0.26812	N	0.022371	T	0.50718	0.1632	L	0.35288	1.05	0.34558	D	0.712014	B	0.32893	0.389	B	0.28991	0.097	T	0.50440	-0.8828	9	.	.	.	.	6.7798	0.23640	0.4115:0.0:0.5885:0.0	.	169	Q9HAB3	RFT3_HUMAN	L	169;169;169;169;169;169;81	ENSP00000435820:R169L;ENSP00000434728:R169L;ENSP00000385961:R169L;ENSP00000431965:R169L;ENSP00000436768:R169L;ENSP00000333638:R169L;ENSP00000440400:R81L	.	R	+	2	0	GPR172A	145554466	0.965000	0.33210	0.983000	0.44433	0.471000	0.32888	1.798000	0.38814	0.252000	0.21531	0.462000	0.41574	CGC		0.662	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382405.1	NM_024531		Missense_Mutation
FAM102A	399665	broad.mit.edu	37	9	130707144	130707144	+	Silent	SNP	G	G	A	rs145491632	byFrequency	TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chr9:130707144G>A	ENST00000373095.1	-	9	1326	c.951C>T	c.(949-951)acC>acT	p.T317T	FAM102A_ENST00000300434.3_5'UTR|FAM102A_ENST00000373084.4_Silent_p.T175T	NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A	317								p.T317T(1)		breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						CGTCCACCCAGGTCGGGTGGC	0.607													G|||	34	0.00678914	0.0257	0.0	5008	,	,		18096	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	9						G	,	72,4334	65.8+/-103.3	1,70,2132	69.0	55.0	60.0		951,525	-0.2	1.0	9	dbSNP_134	60	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	FAM102A	NM_001035254.2,NM_203305.2	,	1,70,6432	AA,AG,GG		0.0,1.6341,0.5536	,	317/385,175/243	130707144	72,12934	2203	4300	6503	129746965	SO:0001819	synonymous_variant	399665				CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.951C>T	9.37:g.130707144G>A			129746965	A2A329|Q8TEL4	Silent	SNP	ENST00000373095.1	37	CCDS35150.1	SNP	35	Broad																																																																																				0.607	FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054298.2			Silent
TCEAL3	85012	broad.mit.edu	37	X	102864108	102864108	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chrX:102864108A>T	ENST00000372628.1	+	3	474	c.116A>T	c.(115-117)gAg>gTg	p.E39V	TCEAL3_ENST00000243286.3_Missense_Mutation_p.E39V|TCEAL3_ENST00000477014.1_Intron|TCEAL3_ENST00000372627.5_Missense_Mutation_p.E39V			Q969E4	TCAL3_HUMAN	transcription elongation factor A (SII)-like 3	39	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.E39V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	16						ccagacgtggaggggaagaca	0.502																																																1	Substitution - Missense(1)	ovary(1)	X											157.0	115.0	129.0					X																	102864108		2203	4300	6503	102750764	SO:0001583	missense	85012			BC008703	CCDS14511.1	Xq22.2	2014-03-21			ENSG00000196507	ENSG00000196507			28247	protein-coding gene	gene with protein product						16221301	Standard	NM_032926		Approved	MGC15737, WEX8	uc004ekr.3	Q969E4	OTTHUMG00000022106	ENST00000372628.1:c.116A>T	X.37:g.102864108A>T	ENSP00000361711:p.Glu39Val		102750764	D3DXA4	Missense_Mutation	SNP	ENST00000372628.1	37	CCDS14511.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	a	14.22	2.469262	0.43839	.	.	ENSG00000196507	ENST00000372628;ENST00000372627;ENST00000243286	T;T;T	0.26518	1.73;1.73;1.73	4.03	1.58	0.23477	.	0.384384	0.18998	N	0.125423	T	0.33990	0.0882	M	0.74647	2.275	0.09310	N	1	D	0.54047	0.964	P	0.52159	0.691	T	0.16129	-1.0413	10	0.56958	D	0.05	.	4.1965	0.10445	0.5798:0.2122:0.0:0.208	.	39	Q969E4	TCAL3_HUMAN	V	39	ENSP00000361711:E39V;ENSP00000361710:E39V;ENSP00000243286:E39V	ENSP00000243286:E39V	E	+	2	0	TCEAL3	102750764	0.127000	0.22367	0.000000	0.03702	0.008000	0.06430	0.303000	0.19210	0.217000	0.20800	-0.407000	0.06327	GAG		0.502	TCEAL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057737.1	NM_032926		Missense_Mutation
IGSF1	3547	broad.mit.edu	37	X	130409963	130409963	+	Silent	SNP	G	G	A			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-1116-01	TCGA-23-1116-10	g.chrX:130409963G>A	ENST00000361420.3	-	15	2947	c.2868C>T	c.(2866-2868)ctC>ctT	p.L956L	IGSF1_ENST00000467244.1_5'UTR|IGSF1_ENST00000370910.1_Silent_p.L947L|IGSF1_ENST00000370904.1_Silent_p.L947L|IGSF1_ENST00000370903.3_Silent_p.L961L			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	956	Ig-like C2-type 9.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.L956L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						GGGGCATACTGAGATATGACC	0.502																																																1	Substitution - coding silent(1)	ovary(1)	X											89.0	68.0	75.0					X																	130409963		2203	4300	6503	130237644	SO:0001819	synonymous_variant	3547			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.2868C>T	X.37:g.130409963G>A			130237644	B5MEG2|H9KV64|O15070|Q9NTC8	Silent	SNP	ENST00000361420.3	37	CCDS14629.1	SNP	45	Broad																																																																																				0.502	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			Silent
TP53	7157	broad.mit.edu	37	17	7577146	7577156	+	Splice_Site	DEL	TAGATTACCAC	TAGATTACCAC	-	rs72661119|rs200579969		TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-23-1116-01	TCGA-23-1116-10	g.chr17:7577146_7577156delTAGATTACCAC	ENST00000269305.4	-	8	972_981	c.783_792delGTGGTAATCTA	c.(781-792)aggtggtaatct>ag	p.RW*S261fs	TP53_ENST00000455263.2_Splice_Site_p.RW*S261fs|TP53_ENST00000420246.2_Splice_Site_p.RW*S261fs|TP53_ENST00000445888.2_Splice_Site_p.RW*S261fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Splice_Site_p.RW*S261fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	261	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		S -> C (in a sporadic cancer; somatic mutation).|S -> G (in sporadic cancers; somatic mutation).|S -> I (in sporadic cancers; somatic mutation).|S -> N (in a sporadic cancer; somatic mutation).|S -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(26)|p.G262V(19)|p.0?(8)|p.L264L(5)|p.G262fs*83(5)|p.G262D(4)|p.L264fs*81(4)|p.L264del(4)|p.S261R(4)|p.L264I(3)|p.N263fs*82(3)|p.G262_F270delGNLLGRNSF(2)|p.N263D(2)|p.N263H(2)|p.N263I(2)|p.G262S(2)|p.G262del(2)|p.S261S(2)|p.G262_S269delGNLLGRNS(2)|p.L265del(2)|p.264_265insSSGNL(1)|p.L265fs*81(1)|p.G262G(1)|p.E258fs*71(1)|p.S261_G262insX(1)|p.N263K(1)|p.G262fs*2(1)|p.L264V(1)|p.L264P(1)|p.L264R(1)|p.S261_L264>R(1)|p.N263fs*5(1)|p.G262H(1)|p.N263fs*84(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCGTCCCAGTAGATTACCACTACTCAGGAT	0.521		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	117	Substitution - Missense(43)|Unknown(26)|Deletion - Frameshift(15)|Deletion - In frame(12)|Whole gene deletion(8)|Substitution - coding silent(8)|Insertion - Frameshift(2)|Insertion - In frame(2)|Complex - deletion inframe(1)	lung(18)|upper_aerodigestive_tract(16)|large_intestine(16)|urinary_tract(14)|ovary(13)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|breast(6)|stomach(5)|bone(4)|endometrium(2)|liver(2)|pancreas(2)|oesophagus(2)|eye(1)|genital_tract(1)|kidney(1)|skin(1)	17																																								7517881	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.783-1GTGGTAATCTA>-	17.37:g.7577146_7577156delTAGATTACCAC			7517871	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	57	Broad																																																																																				0.521	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Frame_Shift_Del	Splice_Site_Del
COL9A2	1298	broad.mit.edu	37	1	40771828	40771845	+	In_Frame_Del	DEL	CCTCCTTTTGTCCCAGGC	CCTCCTTTTGTCCCAGGC	-			TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-23-1116-01	TCGA-23-1116-10	g.chr1:40771828_40771845delCCTCCTTTTGTCCCAGGC	ENST00000372748.3	-	20	1119_1136	c.1023_1040delGCCTGGGACAAAAGGAGG	c.(1021-1041)cagcctgggacaaaaggaggc>cac	p.341_347QPGTKGG>H	COL9A2_ENST00000466267.1_5'Flank	NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	341	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.Q341_G347>H(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			GTCTCCAGGGCCTCCTTTTGTCCCAGGCTGGCCTGGCA	0.592																																																1	Complex - deletion inframe(1)	ovary(1)	1																																								40544432	SO:0001651	inframe_deletion	1298			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.1023_1040delGCCTGGGACAAAAGGAGG	1.37:g.40771828_40771845delCCTCCTTTTGTCCCAGGC	ENSP00000361834:p.Gln341_Gly347delinsHis		40544415	B2RMP9	In_Frame_Del	DEL	ENST00000372748.3	37	CCDS450.1	DEL	26	Broad																																																																																				0.592	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015764.3	NM_001852		In_Frame_Del
PRG4	10216	broad.mit.edu	37	1	186277190	186277237	+	In_Frame_Del	DEL	GGACTGCTCCAACTACCCTCAAGGAACCTGCACCCACTACTCCCAAGA	GGACTGCTCCAACTACCCTCAAGGAACCTGCACCCACTACTCCCAAGA	-	rs199583642|rs201174016|rs201869820|rs200200770|rs146627867|rs201639286|rs200495619|rs200022485|rs200953878|rs138548706	byFrequency	TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-23-1116-01	TCGA-23-1116-10	g.chr1:186277190_186277237delGGACTGCTCCAACTACCCTCAAGGAACCTGCACCCACTACTCCCAAGA	ENST00000445192.2	+	7	2384_2431	c.2339_2386delGGACTGCTCCAACTACCCTCAAGGAACCTGCACCCACTACTCCCAAGA	c.(2338-2388)gggactgctccaactaccctcaaggaacctgcacccactactcccaagaag>gag	p.780_796GTAPTTLKEPAPTTPKK>E	PRG4_ENST00000367486.3_In_Frame_Del_p.737_753GTAPTTLKEPAPTTPKK>E|PRG4_ENST00000367485.4_In_Frame_Del_p.687_703GTAPTTLKEPAPTTPKK>E|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367483.4_In_Frame_Del_p.739_755GTAPTTLKEPAPTTPKK>E	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	780	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.E788K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						ACCCCTAAGGGGACTGCTCCAACTACCCTCAAGGAACCTGCACCCACTACTCCCAAGAAGCCTGCCCC	0.593																																																1	Substitution - Missense(1)	skin(1)	1							,,,	22,4244		0,22,2111					,,,	2.0	0.0			189	46,8206		5,36,4085	no	coding,coding,coding,coding	PRG4	NM_005807.3,NM_001127710.1,NM_001127709.1,NM_001127708.1	,,,	5,58,6196	A1A1,A1R,RR		0.5574,0.5157,0.5432	,,,	,,,		68,12450				184543860	SO:0001651	inframe_deletion	10216			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2339_2386delGGACTGCTCCAACTACCCTCAAGGAACCTGCACCCACTACTCCCAAGA	1.37:g.186277190_186277237delGGACTGCTCCAACTACCCTCAAGGAACCTGCACCCACTACTCCCAAGA	ENSP00000399679:p.Gly780_Lys796delinsGlu		184543813	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	In_Frame_Del	DEL	ENST00000445192.2	37	CCDS1369.1	DEL	43	Broad																																																																																				0.593	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807		In_Frame_Del
SKIDA1	387640	broad.mit.edu	37	10	21805466	21805467	+	In_Frame_Ins	INS	-	-	CCTCCT	rs112207161	byFrequency	TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-23-1116-01	TCGA-23-1116-10	g.chr10:21805466_21805467insCCTCCT	ENST00000449193.2	-	4	3537_3538	c.1285_1286insAGGAGG	c.(1285-1287)ggg>gAGGAGGgg	p.428_429insEE	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_In_Frame_Ins_p.349_350insEE	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	347						nucleus (GO:0005634)		p.E428_G429insEE(2)									CCCGCTGCccccctcctcctcc	0.619														2708	0.540735	0.916	0.4063	5008	,	,		10303	0.3244		0.5408	False		,,,				2504	0.3517															2	Insertion - In frame(2)	soft_tissue(2)	10								3173,56,18,597		1435,46,11,246,5,0,0,3,1,175						3.0	1.0		dbSNP_132	7	4189,51,27,3619		1322,36,14,1495,1,0,13,2,9,1051	no	codingComplex	C10orf140	NM_207371.3		2757,82,25,1741,6,0,13,5,10,1226	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		46.8805,17.4558,37.2379				7362,107,45,4216				21845473	SO:0001652	inframe_insertion	387640			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1280_1285dupAGGAGG	10.37:g.21805467_21805472dupCCTCCT	ENSP00000410041:p.Glu427_Glu428dup		21845472	B1ANA5|Q6ZMX4|Q8N3C3	In_Frame_Ins	INS	ENST00000449193.2	37	CCDS44363.1	INS	22	Broad																																																																																				0.619	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371		In_Frame_Ins
FAM86B2	653333	broad.mit.edu	37	8	12291593	12291595	+	In_Frame_Del	DEL	CTG	CTG	-	rs146321506		TCGA-23-1116-01	TCGA-23-1116-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-23-1116-01	TCGA-23-1116-10	g.chr8:12291593_12291595delCTG	ENST00000262365.4	-	2	124_126	c.125_127delCAG	c.(124-129)tcagat>tat	p.42_43SD>Y	FAM86B2_ENST00000309608.5_In_Frame_Del_p.42_43SD>Y|FAM86B2_ENST00000393715.3_Intron|FAM86B2_ENST00000351291.4_In_Frame_Del_p.42_43SD>Y	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	42			D -> Y (in dbSNP:rs2684093).							endometrium(1)|kidney(2)	3						AGCTCAGAATCTGATGAGTCTCT	0.473																																																0			8																																								12335966	SO:0001651	inframe_deletion	653333				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.125_127delCAG	8.37:g.12291593_12291595delCTG	ENSP00000262365:p.Ser42_Asp43delinsTyr		12335964		In_Frame_Del	DEL	ENST00000262365.4	37	CCDS59092.1	DEL	32	Broad																																																																																				0.473	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_928336		In_Frame_Del
