#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
SLC52A3	113278	genome.wustl.edu	37	20	745986	745986	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr20:745986C>G	ENST00000217254.7	-	2	674	c.433G>C	c.(433-435)Gaa>Caa	p.E145Q	SLC52A3_ENST00000381944.3_Missense_Mutation_p.E145Q|SLC52A3_ENST00000473664.1_5'UTR	NM_033409.3	NP_212134.3	Q9NQ40	S52A3_HUMAN	solute carrier family 52 (riboflavin transporter), member 3	145					cellular response to heat (GO:0034605)|riboflavin metabolic process (GO:0006771)|riboflavin transport (GO:0032218)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	riboflavin transporter activity (GO:0032217)	p.E145Q(1)									CTGAGTCCTTCACCCACAAAG	0.597																																																1	Substitution - Missense(1)	ovary(1)	20											69.0	61.0	63.0					20																	745986		2203	4300	6503	693986	SO:0001583	missense	113278			AL118502	CCDS13007.1	20p13	2013-07-17	2013-07-17	2012-02-29	ENSG00000101276	ENSG00000101276		"""Solute carriers"""	16187	protein-coding gene	gene with protein product	"""hypothetical protein LOC113278"""	613350	"""chromosome 20 open reading frame 54"""	C20orf54		11780052, 19122205	Standard	NM_033409		Approved	bA371L19.1, hRFT2, RFVT3	uc002wed.4	Q9NQ40	OTTHUMG00000031647	ENST00000217254.7:c.433G>C	20.37:g.745986C>G	ENSP00000217254:p.Glu145Gln		693986	A8K6P1|Q5W1A0|Q5W1A1|Q8NCL7|Q96GD5	Missense_Mutation	SNP	ENST00000217254.7	37	CCDS13007.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	19.53	3.845046	0.71603	.	.	ENSG00000101276	ENST00000217254;ENST00000381944	D;D	0.89939	-2.59;-2.59	5.65	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.92453	0.7604	L	0.53561	1.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91307	0.5071	10	0.33141	T	0.24	-9.2925	15.3965	0.74798	0.0:0.8602:0.1398:0.0	.	145;145	Q9NQ40-2;Q9NQ40	.;RFT2_HUMAN	Q	145	ENSP00000217254:E145Q;ENSP00000371370:E145Q	ENSP00000217254:E145Q	E	-	1	0	C20orf54	693986	1.000000	0.71417	0.984000	0.44739	0.970000	0.65996	7.759000	0.85235	1.386000	0.46466	0.561000	0.74099	GAA		0.597	SLC52A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077482.2	NM_033409		Missense_Mutation
YES1	7525	genome.wustl.edu	37	18	724573	724573	+	Nonsense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr18:724573G>A	ENST00000584307.1	-	12	1653	c.1483C>T	c.(1483-1485)Cag>Tag	p.Q495*	YES1_ENST00000577961.1_Nonsense_Mutation_p.Q500*|YES1_ENST00000314574.4_Nonsense_Mutation_p.Q495*			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	495	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.Q495*(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	GGACAGCCCTGAGGGCACGGC	0.418																																																1	Substitution - Nonsense(1)	ovary(1)	18											92.0	94.0	93.0					18																	724573		2203	4300	6503	714573	SO:0001587	stop_gained	7525			M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.1483C>T	18.37:g.724573G>A	ENSP00000462468:p.Gln495*		714573	A6NLB3|D3DUH1	Nonsense_Mutation	SNP	ENST00000584307.1	37	CCDS11824.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	37	6.288145	0.97444	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	.	.	.	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	18.5435	0.91038	0.0:0.0:1.0:0.0	.	.	.	.	X	495	.	ENSP00000324740:Q495X	Q	-	1	0	YES1	714573	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.510000	0.98004	2.468000	0.83385	0.591000	0.81541	CAG		0.418	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2	NM_005433		Nonsense_Mutation
SLC6A3	6531	genome.wustl.edu	37	5	1441479	1441479	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr5:1441479A>C	ENST00000270349.9	-	3	540	c.413T>G	c.(412-414)cTg>cGg	p.L138R	SLC6A3_ENST00000453492.2_Missense_Mutation_p.L138R	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	138					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)	p.L138R(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	ATTACCTTTCAGTATGGGGCA	0.582																																																1	Substitution - Missense(1)	ovary(1)	5											76.0	69.0	72.0					5																	1441479		2203	4300	6503	1494479	SO:0001583	missense	6531				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.413T>G	5.37:g.1441479A>C	ENSP00000270349:p.Leu138Arg		1494479	A2RUN4|Q14996	Missense_Mutation	SNP	ENST00000270349.9	37	CCDS3863.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	15.15	2.748870	0.49257	.	.	ENSG00000142319	ENST00000270349;ENST00000453492;ENST00000513308	T;T;T	0.79141	-1.24;-1.24;-1.24	3.45	3.45	0.39498	.	0.141898	0.48286	D	0.000190	D	0.85741	0.5767	M	0.85542	2.76	0.36302	D	0.857084	P	0.46064	0.872	P	0.57620	0.824	D	0.89566	0.3810	10	0.87932	D	0	.	10.1692	0.42900	1.0:0.0:0.0:0.0	.	138	Q01959	SC6A3_HUMAN	R	138;138;64	ENSP00000270349:L138R;ENSP00000399806:L138R;ENSP00000429101:L64R	ENSP00000270349:L138R	L	-	2	0	SLC6A3	1494479	1.000000	0.71417	0.669000	0.29828	0.540000	0.34992	8.432000	0.90288	1.331000	0.45412	0.459000	0.35465	CTG		0.582	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044		Missense_Mutation
TLE6	79816	genome.wustl.edu	37	19	2991957	2991957	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr19:2991957C>A	ENST00000246112.4	+	14	1562	c.1361C>A	c.(1360-1362)cCt>cAt	p.P454H	TLE6_ENST00000452088.1_Missense_Mutation_p.P331H	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	454					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)		p.P331H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCATGAAACCTCTGGAGTAC	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											78.0	70.0	73.0					19																	2991957		2203	4300	6503	2942957	SO:0001583	missense	79816			AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.1361C>A	19.37:g.2991957C>A	ENSP00000246112:p.Pro454His		2942957	J3KMZ1	Missense_Mutation	SNP	ENST00000246112.4	37	CCDS45910.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	12.68	2.009434	0.35415	.	.	ENSG00000104953	ENST00000447920;ENST00000246112;ENST00000452088;ENST00000441927	T;T	0.11277	2.79;2.79	3.09	0.934	0.19477	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.	.	.	.	T	0.27313	0.0670	M	0.77820	2.39	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.70935	0.971;0.971;0.964;0.964	T	0.05666	-1.0871	9	0.72032	D	0.01	-5.884	5.3809	0.16192	0.0:0.7447:0.0:0.2553	.	454;312;331;331	C9JGZ7;Q9Y6S1;Q9H808;Q6PJM9	.;.;TLE6_HUMAN;.	H	454;454;331;331	ENSP00000246112:P454H;ENSP00000406893:P331H	ENSP00000246112:P454H	P	+	2	0	TLE6	2942957	0.919000	0.31177	0.001000	0.08648	0.025000	0.11179	1.797000	0.38804	0.345000	0.23873	0.462000	0.41574	CCT		0.567	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345996.3	NM_024760		Missense_Mutation
ZNF263	10127	genome.wustl.edu	37	16	3334004	3334004	+	Silent	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr16:3334004C>T	ENST00000219069.5	+	1	1062	c.186C>T	c.(184-186)ctC>ctT	p.L62L	ZNF263_ENST00000573578.1_Silent_p.L62L|ZNF263_ENST00000574253.1_Silent_p.L62L|ZNF263_ENST00000538765.1_Intron	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	62	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L62L(1)		NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						TCAGCCGGCTCCAAGAGCTTT	0.647																																																1	Substitution - coding silent(1)	ovary(1)	16											47.0	52.0	50.0					16																	3334004		2197	4300	6497	3274005	SO:0001819	synonymous_variant	10127			AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.186C>T	16.37:g.3334004C>T			3274005	B2R634|O43387|Q96H95	Silent	SNP	ENST00000219069.5	37	CCDS10499.1	SNP	30	WashU																																																																																				0.647	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251463.2			Silent
TRPV3	162514	genome.wustl.edu	37	17	3427556	3427556	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr17:3427556G>A	ENST00000576742.1	-	13	2000	c.1679C>T	c.(1678-1680)gCg>gTg	p.A560V	TRPV3_ENST00000301365.4_Missense_Mutation_p.A560V|TRPV3_ENST00000572519.1_Missense_Mutation_p.A560V	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	560					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)	p.A560V(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	GAGCATGTTCGCCCAGCCCAG	0.572																																																1	Substitution - Missense(1)	ovary(1)	17											127.0	116.0	119.0					17																	3427556		2203	4300	6503	3374306	SO:0001583	missense	162514			AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.1679C>T	17.37:g.3427556G>A	ENSP00000461518:p.Ala560Val		3374306	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	ENST00000576742.1	37	CCDS11029.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	g	7.892	0.732628	0.15507	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	D	0.84442	-1.85	5.23	5.23	0.72850	.	0.164522	0.42682	D	0.000677	T	0.63768	0.2539	N	0.11427	0.14	0.45439	D	0.998411	B;B;P;B;P;P;P	0.48834	0.255;0.107;0.843;0.107;0.632;0.916;0.897	B;B;B;B;B;B;B	0.35312	0.074;0.032;0.144;0.032;0.197;0.2;0.127	T	0.70655	-0.4812	10	0.05721	T	0.95	-13.3407	11.6278	0.51156	0.0814:0.0:0.9185:0.0	.	544;544;560;544;560;560;560	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	V	560;560;544	ENSP00000301365:A560V	ENSP00000301365:A560V	A	-	2	0	TRPV3	3374306	0.999000	0.42202	1.000000	0.80357	0.952000	0.60782	3.399000	0.52586	2.634000	0.89283	0.563000	0.77884	GCG		0.572	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068		Missense_Mutation
OR51B2	79345	genome.wustl.edu	37	11	5345006	5345006	+	Silent	SNP	A	A	C			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr11:5345006A>C	ENST00000328813.2	-	1	576	c.522T>G	c.(520-522)cgT>cgG	p.R174R	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R174R(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCAGAAAGCACGTGTGATAA	0.388																																																1	Substitution - coding silent(1)	ovary(1)	11											95.0	93.0	94.0					11																	5345006		2201	4297	6498	5301582	SO:0001819	synonymous_variant	79345			AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.522T>G	11.37:g.5345006A>C			5301582	Q96RD4	Silent	SNP	ENST00000328813.2	37	CCDS31377.1	SNP	6	WashU																																																																																				0.388	OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142983.1	NM_033180		Silent
OR52H1	390067	genome.wustl.edu	37	11	5566538	5566538	+	Silent	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr11:5566538G>C	ENST00000322653.4	-	1	241	c.216C>G	c.(214-216)tcC>tcG	p.S72S	HBG2_ENST00000380259.2_Intron	NM_001005289.1	NP_001005289.1	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H, member 1	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S72S(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGCCAGCATGGAGAGAAAGA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	11											88.0	76.0	80.0					11																	5566538		2201	4297	6498	5523114	SO:0001819	synonymous_variant	390067			AB065802	CCDS31386.1	11p15.4	2012-08-09			ENSG00000181616	ENSG00000181616		"""GPCR / Class A : Olfactory receptors"""	15218	protein-coding gene	gene with protein product							Standard	NM_001005289		Approved		uc010qzh.2	Q8NGJ2	OTTHUMG00000066909	ENST00000322653.4:c.216C>G	11.37:g.5566538G>C			5523114	B9EH26|Q6IF79	Silent	SNP	ENST00000322653.4	37	CCDS31386.1	SNP	47	WashU																																																																																				0.483	OR52H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143400.1	NM_001005289		Silent
LRRC23	10233	genome.wustl.edu	37	12	7023194	7023194	+	3'UTR	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr12:7023194C>T	ENST00000007969.8	+	0	1416				LRRC23_ENST00000443597.2_3'UTR|ENO2_ENST00000538763.1_5'Flank|ENO2_ENST00000229277.1_5'Flank|LRRC23_ENST00000323702.5_Missense_Mutation_p.P300S|ENO2_ENST00000535366.1_5'Flank|ENO2_ENST00000541477.1_5'Flank|ENO2_ENST00000544774.1_5'Flank|LRRC23_ENST00000429740.1_3'UTR|ENO2_ENST00000545045.2_5'Flank	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23									p.P300S(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						CTGCTCTGTGCCGGTCCTCTG	0.627																																																1	Substitution - Missense(1)	ovary(1)	12											120.0	112.0	115.0					12																	7023194		2203	4300	6503	6893455	SO:0001624	3_prime_UTR_variant	10233			BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.*164C>T	12.37:g.7023194C>T			6893455	A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Missense_Mutation	SNP	ENST00000007969.8	37	CCDS8569.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	7.446	0.641617	0.14451	.	.	ENSG00000010626	ENST00000323702	T	0.68765	-0.35	2.88	-5.07	0.02938	.	.	.	.	.	T	0.46034	0.1372	.	.	.	0.09310	N	0.999995	B	0.02656	0.0	B	0.08055	0.003	T	0.35674	-0.9779	8	0.87932	D	0	.	1.6198	0.02711	0.218:0.3958:0.2457:0.1405	.	300	Q53EV4-2	.	S	300	ENSP00000317464:P300S	ENSP00000317464:P300S	P	+	1	0	LRRC23	6893455	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.574000	0.05868	-1.160000	0.02804	0.462000	0.41574	CCG		0.627	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345214.1	NM_006992		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7578463	7578463	+	Missense_Mutation	SNP	C	C	G	rs371524413		TCGA-23-1124-01	TCGA-23-1124-10	C	C	G	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr17:7578463C>G	ENST00000269305.4	-	5	656	c.467G>C	c.(466-468)cGc>cCc	p.R156P	TP53_ENST00000413465.2_Missense_Mutation_p.R156P|TP53_ENST00000455263.2_Missense_Mutation_p.R156P|TP53_ENST00000445888.2_Missense_Mutation_p.R156P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R156P|TP53_ENST00000359597.4_Missense_Mutation_p.R156P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	156	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R156P(24)|p.R156H(10)|p.0?(8)|p.?(5)|p.R156L(3)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.P153fs*22(2)|p.T155_R156delTR(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156del(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*14(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.R156_V157del(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*25(1)|p.G154_R156delGTR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCGCGGACGCGGGTGCCGGG	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	72	Substitution - Missense(37)|Deletion - In frame(11)|Deletion - Frameshift(10)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(1)	breast(9)|lung(8)|ovary(8)|stomach(7)|upper_aerodigestive_tract(6)|large_intestine(5)|skin(5)|bone(5)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(3)|urinary_tract(3)|kidney(2)|liver(2)|oesophagus(2)|biliary_tract(1)|prostate(1)|pancreas(1)	17	GRCh37	CM984589	TP53	M							50.0	52.0	51.0					17																	7578463		2203	4300	6503	7519188	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.467G>C	17.37:g.7578463C>G	ENSP00000269305:p.Arg156Pro		7519188	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076061	0.36662	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99766	-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69	5.47	3.45	0.39498	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.599272	0.17934	N	0.157074	D	0.99576	0.9847	M	0.73598	2.24	0.09310	N	1	D;D;D;D;D;D;D	0.89917	1.0;0.988;0.96;0.985;0.982;0.996;1.0	D;P;P;D;P;D;D	0.74674	0.984;0.887;0.614;0.924;0.902;0.953;0.958	D	0.99552	1.0966	10	0.54805	T	0.06	-1.0137	6.8349	0.23931	0.3112:0.607:0.0:0.0817	.	117;156;156;63;156;156;156	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	156;156;156;156;156;156;145;63;24;63;24;156	ENSP00000410739:R156P;ENSP00000352610:R156P;ENSP00000269305:R156P;ENSP00000398846:R156P;ENSP00000391127:R156P;ENSP00000391478:R156P;ENSP00000425104:R24P;ENSP00000423862:R63P;ENSP00000424104:R156P	ENSP00000269305:R156P	R	-	2	0	TP53	7519188	0.333000	0.24731	0.002000	0.10522	0.138000	0.21146	4.631000	0.61304	0.779000	0.33543	0.563000	0.77884	CGC		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
CD163	9332	genome.wustl.edu	37	12	7651519	7651519	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr12:7651519T>A	ENST00000359156.4	-	4	925	c.723A>T	c.(721-723)caA>caT	p.Q241H	CD163_ENST00000432237.2_Missense_Mutation_p.Q241H|CD163_ENST00000541972.1_Missense_Mutation_p.Q229H|CD163_ENST00000396620.3_Missense_Mutation_p.Q241H	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	241	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.Q241H(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	TTCCCCATCCTTGATGTTTGC	0.438																																																1	Substitution - Missense(1)	ovary(1)	12											196.0	182.0	187.0					12																	7651519		2203	4300	6503	7542786	SO:0001583	missense	9332			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.723A>T	12.37:g.7651519T>A	ENSP00000352071:p.Gln241His		7542786	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	CCDS8578.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	11.35	1.611628	0.28712	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	5.16	-3.03	0.05429	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.570510	0.03376	N	0.199754	T	0.25457	0.0619	N	0.16166	0.38	0.09310	N	1	P;P;P	0.45634	0.863;0.457;0.598	P;B;B	0.48227	0.571;0.206;0.366	T	0.09640	-1.0665	10	0.51188	T	0.08	.	1.7487	0.02967	0.1327:0.3255:0.2728:0.2691	.	241;241;241	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	H	241;229;241;241	ENSP00000352071:Q241H;ENSP00000444071:Q229H;ENSP00000379863:Q241H;ENSP00000403885:Q241H	ENSP00000352071:Q241H	Q	-	3	2	CD163	7542786	0.000000	0.05858	0.022000	0.16811	0.734000	0.41952	-1.605000	0.02074	-0.473000	0.06871	0.528000	0.53228	CAA		0.438	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		Missense_Mutation
USP7	7874	genome.wustl.edu	37	16	9024254	9024254	+	Splice_Site	SNP	G	G	C	rs370070575		TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr16:9024254G>C	ENST00000344836.4	-	2	278	c.80C>G	c.(79-81)gCg>gGg	p.A27G	USP7_ENST00000535863.1_5'UTR|USP7_ENST00000566224.1_5'UTR|USP7_ENST00000381886.4_Splice_Site_p.A11G	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	27	Interaction with TSPYL5.				maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.A27G(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						TGTATCTCCCGCTTTAAAGAA	0.398																																																1	Substitution - Missense(1)	ovary(1)	16											97.0	74.0	82.0					16																	9024254		2197	4300	6497	8931755	SO:0001630	splice_region_variant	7874			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.80-1C>G	16.37:g.9024254G>C			8931755	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	37	CCDS32385.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334036	0.60853	.	.	ENSG00000187555	ENST00000344836;ENST00000381886	T	0.07114	3.22	5.59	5.59	0.84812	.	0.046972	0.85682	D	0.000000	T	0.07683	0.0193	N	0.19112	0.55	0.80722	D	1	B;B	0.20261	0.0;0.043	B;B	0.15052	0.0;0.012	T	0.39057	-0.9632	10	0.24483	T	0.36	.	19.5934	0.95525	0.0:0.0:1.0:0.0	.	27;11	Q93009;B7Z815	UBP7_HUMAN;.	G	27;35	ENSP00000343535:A27G	ENSP00000343535:A27G	A	-	2	0	USP7	8931755	1.000000	0.71417	1.000000	0.80357	0.537000	0.34900	9.719000	0.98760	2.635000	0.89317	0.467000	0.42956	GCG		0.398	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2		Missense_Mutation	Missense_Mutation
SWAP70	23075	genome.wustl.edu	37	11	9746380	9746380	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr11:9746380C>A	ENST00000318950.6	+	4	693	c.590C>A	c.(589-591)tCt>tAt	p.S197Y	SWAP70_ENST00000447399.2_Missense_Mutation_p.S139Y	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	197					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)	p.S197Y(1)		NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		CAGACTGTGTCTATGGCAATT	0.343																																																1	Substitution - Missense(1)	ovary(1)	11											107.0	107.0	107.0					11																	9746380		2201	4294	6495	9702956	SO:0001583	missense	23075			AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.590C>A	11.37:g.9746380C>A	ENSP00000315630:p.Ser197Tyr		9702956	D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Missense_Mutation	SNP	ENST00000318950.6	37	CCDS31426.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	26.8	4.773681	0.90108	.	.	ENSG00000133789	ENST00000447399;ENST00000318950;ENST00000534662	T;T;T	0.13196	2.61;2.61;2.61	5.79	5.79	0.91817	.	0.111114	0.64402	D	0.000005	T	0.38931	0.1059	M	0.72118	2.19	0.80722	D	1	D;D;D	0.71674	0.998;0.989;0.963	D;P;P	0.65573	0.936;0.817;0.642	T	0.07443	-1.0772	10	0.87932	D	0	-4.8497	20.0235	0.97511	0.0:1.0:0.0:0.0	.	139;197;139	E7EMB1;Q9UH65;B3KUB9	.;SWP70_HUMAN;.	Y	139;197;48	ENSP00000399056:S139Y;ENSP00000315630:S197Y;ENSP00000435587:S48Y	ENSP00000315630:S197Y	S	+	2	0	SWAP70	9702956	1.000000	0.71417	0.498000	0.27564	0.996000	0.88848	7.783000	0.85696	2.727000	0.93392	0.563000	0.77884	TCT		0.343	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386766.2	NM_015055		Missense_Mutation
TAS2R8	50836	genome.wustl.edu	37	12	10959143	10959143	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr12:10959143A>T	ENST00000240615.2	-	1	749	c.437T>A	c.(436-438)cTt>cAt	p.L146H		NM_023918.1	NP_076407.1	Q9NYW2	TA2R8_HUMAN	taste receptor, type 2, member 8	146					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.L146H(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TGCTGCTATAAGGCTGACCAA	0.398																																																1	Substitution - Missense(1)	ovary(1)	12											117.0	105.0	109.0					12																	10959143		2203	4300	6503	10850410	SO:0001583	missense	50836			AF227134	CCDS8632.1	12p13	2012-08-22			ENSG00000121314	ENSG00000121314		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14915	protein-coding gene	gene with protein product		604794				10761934, 10766242	Standard	NM_023918		Approved	T2R8, TRB5	uc010shh.2	Q9NYW2	OTTHUMG00000168506	ENST00000240615.2:c.437T>A	12.37:g.10959143A>T	ENSP00000240615:p.Leu146His		10850410	Q4KN29|Q645Y2	Missense_Mutation	SNP	ENST00000240615.2	37	CCDS8632.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	14.89	2.669581	0.47677	.	.	ENSG00000121314	ENST00000240615	T	0.46819	0.86	5.24	-0.279	0.12890	GPCR, rhodopsin-like superfamily (1);	0.657076	0.12233	U	0.487271	T	0.54727	0.1876	L	0.59912	1.85	0.09310	N	1	D	0.89917	1.0	D	0.77004	0.989	T	0.44190	-0.9344	10	0.87932	D	0	.	0.8822	0.01236	0.4303:0.1586:0.2577:0.1534	.	146	Q9NYW2	TA2R8_HUMAN	H	146	ENSP00000240615:L146H	ENSP00000240615:L146H	L	-	2	0	TAS2R8	10850410	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.402000	0.20965	0.307000	0.22880	0.455000	0.32223	CTT		0.398	TAS2R8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399932.1			Missense_Mutation
ERVFRD-1	405754	genome.wustl.edu	37	6	11104776	11104776	+	Silent	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr6:11104776G>C	ENST00000472091.1	-	2	1143	c.768C>G	c.(766-768)gtC>gtG	p.V256V	SMIM13_ENST00000416247.2_Intron|ERVFRD-1_ENST00000542862.1_Silent_p.V256V	NM_207582.2	NP_997465.1	P60508	SYCY2_HUMAN	endogenous retrovirus group FRD, member 1	256					syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)		p.V256V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(4)|stomach(1)	15						tgcctgctaagacttggacgc	0.453																																																1	Substitution - coding silent(1)	ovary(1)	6											28.0	26.0	27.0					6																	11104776		2195	4279	6474	11212762	SO:0001819	synonymous_variant	405754			AK075092, AK123938, AY358244	CCDS4519.1	6p24.2	2014-05-02			ENSG00000244476	ENSG00000244476			33823	other	endogenous retrovirus		610524				12970426, 14557543, 15476554, 21542922	Standard	NM_207582		Approved	HERV-W/FRD, HERV-FRD, envFRD, ERVFRDE1, syncytin-2	uc003mzt.3	P60508	OTTHUMG00000159193	ENST00000472091.1:c.768C>G	6.37:g.11104776G>C			11212762		Silent	SNP	ENST00000472091.1	37	CCDS4519.1	SNP	33	WashU																																																																																				0.453	ERVFRD-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353776.1	NM_207582		Silent
SYN2	6854	genome.wustl.edu	37	3	12211352	12211352	+	RNA	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr3:12211352G>T	ENST00000432424.2	+	0	1426							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)	p.L349L(1)		breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						ACCAGCTGCTGTCCAGGACTC	0.537																																																1	Substitution - coding silent(1)	ovary(1)	3											67.0	67.0	67.0					3																	12211352		2039	4218	6257	12186352			6854				CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12211352G>T			12186352	A8MY98	Missense_Mutation	SNP	ENST00000432424.2	37		SNP	48	WashU																																																																																				0.537	SYN2-002	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000339528.3	NM_133625		Missense_Mutation
PRAMEF12	390999	genome.wustl.edu	37	1	12835105	12835105	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr1:12835105C>G	ENST00000357726.4	+	1	122	c.95C>G	c.(94-96)cCc>cGc	p.P32R		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	32					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.P32R(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAGGAGCTGCCCAGGGAGCTC	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											61.0	68.0	66.0					1																	12835105		2203	4300	6503	12757692	SO:0001583	missense	390999				CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.95C>G	1.37:g.12835105C>G	ENSP00000350358:p.Pro32Arg		12757692		Missense_Mutation	SNP	ENST00000357726.4	37	CCDS41254.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	.	14.55	2.570291	0.45798	.	.	ENSG00000116726	ENST00000357726	T	0.08193	3.12	2.68	2.68	0.31781	.	0.000000	0.85682	D	0.000000	T	0.35248	0.0925	M	0.94021	3.485	0.25397	N	0.988479	D	0.89917	1.0	D	0.91635	0.999	T	0.20075	-1.0286	10	0.87932	D	0	.	11.5003	0.50433	0.0:1.0:0.0:0.0	.	32	O95522	PRA12_HUMAN	R	32	ENSP00000350358:P32R	ENSP00000350358:P32R	P	+	2	0	PRAMEF12	12757692	0.014000	0.17966	0.084000	0.20598	0.055000	0.15305	1.510000	0.35790	1.791000	0.52520	0.195000	0.17529	CCC		0.622	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1	XM_372760		Missense_Mutation
DGKB	1607	genome.wustl.edu	37	7	14733771	14733771	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr7:14733771C>T	ENST00000403951.2	-	9	1059	c.640G>A	c.(640-642)Gtg>Atg	p.V214M	DGKB_ENST00000402815.1_Missense_Mutation_p.V214M|DGKB_ENST00000444700.2_Missense_Mutation_p.V207M|DGKB_ENST00000258767.5_Missense_Mutation_p.V214M|DGKB_ENST00000399322.3_Missense_Mutation_p.V214M|DGKB_ENST00000407950.1_Missense_Mutation_p.V207M|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000406247.3_Missense_Mutation_p.V214M			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	214	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.V214M(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TCCAGAGACACGGTTCCATCA	0.423																																																1	Substitution - Missense(1)	ovary(1)	7											77.0	73.0	74.0					7																	14733771		1940	4153	6093	14700296	SO:0001583	missense	1607			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.640G>A	7.37:g.14733771C>T	ENSP00000385780:p.Val214Met		14700296	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	CCDS47547.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	31	5.096299	0.94197	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86	5.72	5.72	0.89469	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.89487	0.6729	M	0.90252	3.1	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.997;0.997;0.997	D	0.90880	0.4753	10	0.87932	D	0	.	19.8709	0.96851	0.0:1.0:0.0:0.0	.	214;207;214;214	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	M	214;214;214;214;207;207;214	ENSP00000385780:V214M;ENSP00000382260:V214M;ENSP00000258767:V214M;ENSP00000384909:V214M;ENSP00000385031:V207M;ENSP00000388451:V207M;ENSP00000386066:V214M	ENSP00000258767:V214M	V	-	1	0	DGKB	14700296	1.000000	0.71417	0.919000	0.36401	0.867000	0.49689	7.818000	0.86416	2.698000	0.92095	0.591000	0.81541	GTG		0.423	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080		Missense_Mutation
MYH11	4629	genome.wustl.edu	37	16	15841481	15841481	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr16:15841481A>G	ENST00000300036.5	-	19	2466	c.2357T>C	c.(2356-2358)aTc>aCc	p.I786T	MYH11_ENST00000576790.2_Missense_Mutation_p.I786T|MYH11_ENST00000452625.2_Missense_Mutation_p.I793T|MYH11_ENST00000396324.3_Missense_Mutation_p.I793T	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	786	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.I786T(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GACATCGGTGATCTTCAAATC	0.507			T	CBFB	AML																																		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	1	Substitution - Missense(1)	ovary(1)	16											120.0	110.0	113.0					16																	15841481		2197	4300	6497	15748982	SO:0001583	missense	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2357T>C	16.37:g.15841481A>G	ENSP00000300036:p.Ile786Thr		15748982	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	21.3	4.126877	0.77549	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	5.46	5.46	0.80206	.	0.062064	0.64402	D	0.000004	D	0.83275	0.5219	M	0.78637	2.42	0.80722	D	1	D;D;P;D;P	0.64830	0.994;0.987;0.932;0.987;0.932	D;D;D;D;D	0.67900	0.933;0.954;0.954;0.938;0.933	D	0.85731	0.1331	10	0.87932	D	0	.	14.7206	0.69302	1.0:0.0:0.0:0.0	.	793;786;793;786;793	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	T	786;786;793;793;793	ENSP00000300036:I786T;ENSP00000345136:I786T;ENSP00000379616:I793T;ENSP00000407821:I793T	ENSP00000300036:I786T	I	-	2	0	MYH11	15748982	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	9.339000	0.96797	2.075000	0.62263	0.459000	0.35465	ATC		0.507	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		Missense_Mutation
NWD1	284434	genome.wustl.edu	37	19	16860175	16860175	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr19:16860175C>G	ENST00000552788.1	+	4	722	c.722C>G	c.(721-723)aCc>aGc	p.T241S	NWD1_ENST00000524140.2_Missense_Mutation_p.T241S|NWD1_ENST00000549814.1_Missense_Mutation_p.T241S|NWD1_ENST00000523826.1_Missense_Mutation_p.T35S|NWD1_ENST00000379808.3_Missense_Mutation_p.T241S|NWD1_ENST00000339803.6_Missense_Mutation_p.T106S			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	241							ATP binding (GO:0005524)	p.T106S(1)		NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GTCCTCAAGACCCACCGCCTG	0.607																																																1	Substitution - Missense(1)	ovary(1)	19											49.0	46.0	47.0					19																	16860175		2203	4299	6502	16721175	SO:0001583	missense	284434			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.722C>G	19.37:g.16860175C>G	ENSP00000447224:p.Thr241Ser		16721175	C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37		SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	c	0.005	-2.179247	0.00308	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.57752	0.38;0.43;0.38;0.38;0.43;0.45	4.35	0.386	0.16254	.	1.231340	0.05583	N	0.573181	T	0.23289	0.0563	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.001;0.003;0.001	T	0.25433	-1.0132	10	0.02654	T	1	-2.4251	5.4002	0.16291	0.0:0.5537:0.0:0.4462	.	241;241;106	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	S	106;241;241;241;35;241;106	ENSP00000428579:T241S;ENSP00000447548:T241S;ENSP00000369136:T241S;ENSP00000428955:T35S;ENSP00000447224:T241S;ENSP00000340159:T106S	ENSP00000340159:T106S	T	+	2	0	NWD1	16721175	0.520000	0.26250	0.016000	0.15963	0.002000	0.02628	1.331000	0.33793	0.399000	0.25367	-0.170000	0.13304	ACC		0.607	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525		Missense_Mutation
PLCZ1	89869	genome.wustl.edu	37	12	18836226	18836226	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr12:18836226C>A	ENST00000538330.1	-	11	1501	c.1120G>T	c.(1120-1122)Ggt>Tgt	p.G374C	PLCZ1_ENST00000266505.7_Missense_Mutation_p.G592C|PLCZ1_ENST00000541695.1_3'UTR|PLCZ1_ENST00000447925.2_Missense_Mutation_p.G590C|PLCZ1_ENST00000534932.1_Missense_Mutation_p.G73C|PLCZ1_ENST00000539875.1_Missense_Mutation_p.G399C|PLCZ1_ENST00000435379.1_Missense_Mutation_p.G397C					phospholipase C, zeta 1									p.G592C(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					AGGCTCTCACCCATTCTGGAA	0.378																																																1	Substitution - Missense(1)	ovary(1)	12											122.0	110.0	114.0					12																	18836226		2203	4300	6503	18727493	SO:0001583	missense	89869			AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.1120G>T	12.37:g.18836226C>A	ENSP00000445880:p.Gly374Cys		18727493		Missense_Mutation	SNP	ENST00000538330.1	37		SNP	22	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.949412|3.949412	0.73787|0.73787	.|.	.|.	ENSG00000139151|ENSG00000139151	ENST00000534932;ENST00000538330;ENST00000266505;ENST00000447925;ENST00000435379;ENST00000539875|ENST00000536023	T;T;T;T;T;T|.	0.16897|.	2.31;2.31;2.31;2.31;2.31;2.31|.	5.34|5.34	5.34|5.34	0.76211|0.76211	C2 calcium/lipid-binding domain, CaLB (1);|.	0.059793|0.059793	0.64402|0.64402	D|D	0.000003|0.000003	D|D	0.84005|0.84005	0.5377|0.5377	M|M	0.91663|0.91663	3.23|3.23	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.86952|0.86952	0.2086|0.2086	10|6	0.87932|.	D|.	0|.	.|.	14.4155|14.4155	0.67148|0.67148	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	592;374|.	Q86YW0;Q8N7S5|.	PLCZ1_HUMAN;.|.	C|V	73;374;592;590;397;399|84	ENSP00000438826:G73C;ENSP00000445880:G374C;ENSP00000266505:G592C;ENSP00000402358:G590C;ENSP00000400504:G397C;ENSP00000445026:G399C|.	ENSP00000266505:G592C|.	G|G	-|-	1|2	0|0	PLCZ1|PLCZ1	18727493|18727493	0.977000|0.977000	0.34250|0.34250	0.758000|0.758000	0.31321|0.31321	0.820000|0.820000	0.46376|0.46376	4.117000|4.117000	0.57877|0.57877	2.776000|2.776000	0.95493|0.95493	0.655000|0.655000	0.94253|0.94253	GGT|GGG		0.378	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000401666.3	NM_033123		Missense_Mutation
PBX4	80714	genome.wustl.edu	37	19	19675835	19675835	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr19:19675835C>G	ENST00000251203.9	-	6	1118	c.832G>C	c.(832-834)Gag>Cag	p.E278Q		NM_025245.2	NP_079521.1	Q9BYU1	PBX4_HUMAN	pre-B-cell leukemia homeobox 4	278					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|XY body (GO:0001741)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E278Q(1)		large_intestine(1)|lung(4)|ovary(1)|prostate(3)	9						ATGGTAGCCTCTTCTTGAAAC	0.527																																																1	Substitution - Missense(1)	ovary(1)	19											338.0	343.0	342.0					19																	19675835		2203	4300	6503	19536835	SO:0001583	missense	80714			AJ300182	CCDS12406.1	19p13.11	2014-09-11	2007-01-30		ENSG00000105717			"""Homeoboxes / TALE class"""	13403	protein-coding gene	gene with protein product		608127	"""pre-B-cell leukemia transcription factor 4"""				Standard	NM_025245		Approved		uc002nmy.3	Q9BYU1	OTTHUMG00000172310	ENST00000251203.9:c.832G>C	19.37:g.19675835C>G	ENSP00000251203:p.Glu278Gln		19536835	A5D8Y0|B3KUK9	Missense_Mutation	SNP	ENST00000251203.9	37	CCDS12406.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	14.47	2.543930	0.45280	.	.	ENSG00000105717	ENST00000251203	D	0.83837	-1.77	3.85	2.81	0.32909	Homeodomain-related (1);	0.000000	0.85682	D	0.000000	D	0.82600	0.5072	M	0.78049	2.395	0.58432	D	0.999998	P	0.46784	0.884	B	0.43990	0.438	T	0.82440	-0.0456	10	0.62326	D	0.03	-4.9499	9.4242	0.38570	0.0:0.892:0.0:0.108	.	278	Q9BYU1	PBX4_HUMAN	Q	278	ENSP00000251203:E278Q	ENSP00000251203:E278Q	E	-	1	0	PBX4	19536835	1.000000	0.71417	0.862000	0.33874	0.141000	0.21300	4.905000	0.63286	0.852000	0.35287	0.505000	0.49811	GAG		0.527	PBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417784.6			Missense_Mutation
ZNF14	7561	genome.wustl.edu	37	19	19823201	19823201	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr19:19823201G>A	ENST00000344099.3	-	4	1027	c.889C>T	c.(889-891)Cat>Tat	p.H297Y		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	297					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H297Y(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				GTCCTTTTATGCCTTCGAAAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	19											42.0	42.0	42.0					19																	19823201		2203	4300	6503	19684201	SO:0001583	missense	7561			AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.889C>T	19.37:g.19823201G>A	ENSP00000340514:p.His297Tyr		19684201	B9EGA4|Q9ULZ5	Missense_Mutation	SNP	ENST00000344099.3	37	CCDS12409.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489857	0.64074	.	.	ENSG00000105708	ENST00000344099	D	0.86769	-2.17	1.8	1.8	0.24995	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94761	0.8309	H	0.96175	3.78	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85651	0.1282	9	0.87932	D	0	.	9.1514	0.36965	0.0:0.0:1.0:0.0	.	297	P17017	ZNF14_HUMAN	Y	297	ENSP00000340514:H297Y	ENSP00000340514:H297Y	H	-	1	0	ZNF14	19684201	1.000000	0.71417	0.012000	0.15200	0.946000	0.59487	6.627000	0.74258	0.977000	0.38444	0.467000	0.42956	CAT		0.373	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030		Missense_Mutation
OR11H4	390442	genome.wustl.edu	37	14	20711205	20711205	+	Silent	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr14:20711205C>T	ENST00000315409.2	+	1	308	c.255C>T	c.(253-255)tcC>tcT	p.S85S		NM_001004479.1	NP_001004479.1	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H, member 4	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S85S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	29	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		GGTATGTGTCCTCCACTATTC	0.453																																																1	Substitution - coding silent(1)	ovary(1)	14											168.0	162.0	164.0					14																	20711205		2203	4300	6503	19781045	SO:0001819	synonymous_variant	390442				CCDS32034.1	14q11.2	2013-09-24			ENSG00000176198	ENSG00000176198		"""GPCR / Class A : Olfactory receptors"""	15347	protein-coding gene	gene with protein product							Standard	NM_001004479		Approved		uc010tld.2	Q8NGC9	OTTHUMG00000170852	ENST00000315409.2:c.255C>T	14.37:g.20711205C>T			19781045	B2RNQ4|Q6IF07	Silent	SNP	ENST00000315409.2	37	CCDS32034.1	SNP	24	WashU																																																																																				0.453	OR11H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410678.1			Silent
SDC1	6382	genome.wustl.edu	37	2	20405145	20405145	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:20405145C>G	ENST00000254351.4	-	2	351	c.107G>C	c.(106-108)gGc>gCc	p.G36A	SDC1_ENST00000381150.1_Missense_Mutation_p.G36A|SDC1_ENST00000482879.1_5'UTR|SDC1_ENST00000403076.1_Missense_Mutation_p.G36A	NM_002997.4	NP_002988	P18827	SDC1_HUMAN	syndecan 1	36					canonical Wnt signaling pathway (GO:0060070)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|myoblast development (GO:0048627)|odontogenesis (GO:0042476)|phototransduction, visible light (GO:0007603)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to toxic substance (GO:0009636)|retinoid metabolic process (GO:0001523)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|striated muscle cell development (GO:0055002)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein C-terminus binding (GO:0008022)	p.G36A(1)		NS(1)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|skin(2)	21	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)		ATCCCCAGAGCCATCTTGATC	0.557																																																1	Substitution - Missense(1)	ovary(1)	2											84.0	86.0	85.0					2																	20405145		2203	4300	6503	20268626	SO:0001583	missense	6382			AJ551176	CCDS1697.1	2p24.1	2008-02-05			ENSG00000115884	ENSG00000115884		"""CD molecules"", ""Proteoglycans / Cell Surface : Syndecans"""	10658	protein-coding gene	gene with protein product	"""syndecan proteoglycan 1"""	186355		SDC			Standard	XM_005262621		Approved	CD138, syndecan, SYND1	uc002rdo.1	P18827	OTTHUMG00000090751	ENST00000254351.4:c.107G>C	2.37:g.20405145C>G	ENSP00000254351:p.Gly36Ala		20268626	D6W523|Q53QV0|Q546D3|Q96HB7	Missense_Mutation	SNP	ENST00000254351.4	37	CCDS1697.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	18.92	3.726417	0.69074	.	.	ENSG00000115884	ENST00000254351;ENST00000381150;ENST00000403076;ENST00000429035	T;T;T;T	0.45668	2.19;2.19;1.01;0.89	4.46	4.46	0.54185	.	0.228386	0.30410	N	0.009686	T	0.54935	0.1889	M	0.72118	2.19	0.29469	N	0.857155	D;P	0.56521	0.976;0.81	P;P	0.55824	0.785;0.601	T	0.57768	-0.7754	10	0.87932	D	0	-12.1344	11.2977	0.49288	0.0:0.8143:0.1857:0.0	.	36;36	E9PHH3;P18827	.;SDC1_HUMAN	A	36;36;36;44	ENSP00000254351:G36A;ENSP00000370542:G36A;ENSP00000384613:G36A;ENSP00000400773:G44A	ENSP00000254351:G36A	G	-	2	0	SDC1	20268626	0.992000	0.36948	0.924000	0.36721	0.826000	0.46750	2.737000	0.47393	2.415000	0.81967	0.462000	0.41574	GGC		0.557	SDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207495.1	NM_001006946		Missense_Mutation
CYFIP1	23191	genome.wustl.edu	37	15	22969246	22969246	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr15:22969246G>A	ENST00000313077.7	+	22	2597	c.2472G>A	c.(2470-2472)atG>atA	p.M824I	CYFIP1_ENST00000560848.1_Missense_Mutation_p.M824I|CYFIP1_ENST00000435939.2_Missense_Mutation_p.M393I	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1									p.M824I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		TCGACGCCATGTTCCGGGAGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	15											144.0	110.0	122.0					15																	22969246		2203	4300	6503	20520687	SO:0001583	missense	23191			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.2472G>A	15.37:g.22969246G>A	ENSP00000324549:p.Met824Ile		20520687		Missense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541603	0.85917	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.21932	1.98;1.98	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.21347	0.0514	L	0.38175	1.15	0.80722	D	1	B;B;B	0.24651	0.065;0.108;0.035	B;B;B	0.26864	0.037;0.054;0.074	T	0.02705	-1.1121	10	0.30854	T	0.27	-37.4563	19.1873	0.93649	0.0:0.0:1.0:0.0	.	852;393;824	E7EQ04;Q7L576-2;Q7L576	.;.;CYFP1_HUMAN	I	824;852;393	ENSP00000324549:M824I;ENSP00000405956:M393I	ENSP00000324549:M824I	M	+	3	0	CYFIP1	20520687	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.643000	0.98464	2.546000	0.85860	0.561000	0.74099	ATG		0.587	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608		Missense_Mutation
Unknown	0	genome.wustl.edu	37	16	21544401	21544401	+	IGR	SNP	T	T	G			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr16:21544401T>G								MIR3680-1 (26945 upstream) : SCARNA6 (54546 downstream)																							GAGTACGAAATGCAGAGAGCT	0.552																																																0			16																																								21451902	SO:0001628	intergenic_variant																																16.37:g.21544401T>G			21451902		Silent	SNP		37		SNP	51	WashU																																																																																			0	0.552									Silent
RAP1GAP	5909	genome.wustl.edu	37	1	21978037	21978037	+	Intron	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr1:21978037C>T	ENST00000374765.4	-	2	53				RAP1GAP_ENST00000290101.4_Intron|RAP1GAP_ENST00000374757.3_5'UTR|RAP1GAP_ENST00000542643.2_Intron	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein						GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)	p.V42V(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		CACCTCCCcacacatgcacat	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											22.0	19.0	20.0					1																	21978037		876	1989	2865	21850624	SO:0001627	intron_variant	5909			BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.148-1748G>A	1.37:g.21978037C>T			21850624	J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Silent	SNP	ENST00000374765.4	37	CCDS218.1	SNP	17	WashU																																																																																				0.562	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2	NM_002885		Silent
PPP3CC	5533	genome.wustl.edu	37	8	22380232	22380232	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr8:22380232C>T	ENST00000240139.5	+	8	1240	c.913C>T	c.(913-915)Ccc>Tcc	p.P305S	PPP3CC_ENST00000518852.1_Missense_Mutation_p.P305S|PPP3CC_ENST00000397775.3_Missense_Mutation_p.P305S|PPP3CC_ENST00000289963.8_Missense_Mutation_p.P305S	NM_005605.4	NP_005596.2	P48454	PP2BC_HUMAN	protein phosphatase 3, catalytic subunit, gamma isozyme	305					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.P305S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)		TTTCTCTGCCCCCAATTACCT	0.368																																																1	Substitution - Missense(1)	ovary(1)	8											87.0	87.0	87.0					8																	22380232		2203	4300	6503	22436177	SO:0001583	missense	5533				CCDS34859.1, CCDS59094.1, CCDS59093.1	8p21.3	2010-03-17	2010-03-05		ENSG00000120910	ENSG00000120910	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9316	protein-coding gene	gene with protein product	"""calcineurin A gamma"", ""protein phosphatase 2B, catalytic subunit, gamma isoform"""	114107	"""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform"""			1339277	Standard	NM_005605		Approved	CALNA3, PP2Bgamma	uc011kzi.2	P48454	OTTHUMG00000163802	ENST00000240139.5:c.913C>T	8.37:g.22380232C>T	ENSP00000240139:p.Pro305Ser		22436177	B4DRT5|Q9BSS6|Q9H4M5	Missense_Mutation	SNP	ENST00000240139.5	37	CCDS34859.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024705	0.75390	.	.	ENSG00000120910	ENST00000518852;ENST00000240139;ENST00000289963;ENST00000397775;ENST00000523620	T;T;T;T;T	0.08102	3.13;3.13;3.13;3.13;3.13	5.53	4.64	0.57946	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);	0.000000	0.85682	D	0.000000	T	0.31040	0.0784	M	0.79693	2.465	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;0.993;0.985;0.963	T	0.10520	-1.0626	10	0.87932	D	0	-12.2268	14.5757	0.68246	0.1477:0.8523:0.0:0.0	.	305;305;305;305	B4DRT5;P48454-2;P48454;G3V111	.;.;PP2BC_HUMAN;.	S	305;305;305;305;131	ENSP00000429379:P305S;ENSP00000240139:P305S;ENSP00000289963:P305S;ENSP00000380878:P305S;ENSP00000430555:P131S	ENSP00000240139:P305S	P	+	1	0	PPP3CC	22436177	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	7.776000	0.85560	1.303000	0.44873	0.563000	0.77884	CCC		0.368	PPP3CC-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375652.1	NM_005605		Missense_Mutation
ATAD2B	54454	genome.wustl.edu	37	2	23980761	23980761	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:23980761G>C	ENST00000238789.5	-	25	3948	c.3605C>G	c.(3604-3606)tCt>tGt	p.S1202C	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	1202						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)	p.S1202C(1)		central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTGGTCATAGATAAGTCTCC	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											146.0	142.0	143.0					2																	23980761		1963	4144	6107	23834265	SO:0001583	missense	54454			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.3605C>G	2.37:g.23980761G>C	ENSP00000238789:p.Ser1202Cys		23834265	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	37	CCDS46227.1	SNP	33	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.23|18.23	3.578903|3.578903	0.65878|0.65878	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000381024|ENST00000238789;ENST00000546030	.|D	.|0.92249	.|-3.0	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.656831	.|0.16012	.|N	.|0.233728	D|D	0.91442|0.91442	0.7299|0.7299	L|L	0.27053|0.27053	0.805|0.805	0.41527|0.41527	D|D	0.988432|0.988432	.|D;D	.|0.65815	.|0.983;0.995	.|B;P	.|0.55824	.|0.439;0.785	D|D	0.91110|0.91110	0.4921|0.4921	5|10	.|0.56958	.|D	.|0.05	.|.	14.2451|14.2451	0.65983|0.65983	0.0714:0.0:0.9286:0.0|0.0714:0.0:0.9286:0.0	.|.	.|1202;1197	.|Q9ULI0;Q9ULI0-2	.|ATD2B_HUMAN;.	V|C	478|1202;370	.|ENSP00000238789:S1202C	.|ENSP00000238789:S1202C	L|S	-|-	1|2	2|0	ATAD2B|ATAD2B	23834265|23834265	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.396000|6.396000	0.73234|0.73234	2.817000|2.817000	0.96982|0.96982	0.563000|0.563000	0.77884|0.77884	CTA|TCT		0.443	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552		Missense_Mutation
PRKCB	5579	genome.wustl.edu	37	16	24231294	24231294	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr16:24231294G>A	ENST00000321728.7	+	17	2051	c.1876G>A	c.(1876-1878)Gac>Aac	p.D626N	PRKCB_ENST00000303531.7_3'UTR	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	626	AGC-kinase C-terminal.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	AGACAAGAGAGACACCTCCAA	0.453																																																0			16											95.0	87.0	90.0					16																	24231294		2197	4300	6497	24138795	SO:0001583	missense	5579			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1876G>A	16.37:g.24231294G>A	ENSP00000318315:p.Asp626Asn		24138795	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	ENST00000321728.7	37	CCDS10618.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	18.23	3.577091	0.65878	.	.	ENSG00000166501	ENST00000321728	T	0.76578	-1.03	5.9	5.9	0.94986	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	.	.	.	.	D	0.84804	0.5553	M	0.93507	3.425	0.80722	D	1	B	0.14805	0.011	B	0.19148	0.024	T	0.82055	-0.0647	9	0.45353	T	0.12	.	19.2669	0.93990	0.0:0.0:1.0:0.0	.	626	P05771	KPCB_HUMAN	N	626	ENSP00000318315:D626N	ENSP00000318315:D626N	D	+	1	0	PRKCB	24138795	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.467000	0.97671	2.798000	0.96311	0.650000	0.86243	GAC		0.453	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535		Missense_Mutation
SLC5A11	115584	genome.wustl.edu	37	16	24902341	24902341	+	Silent	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr16:24902341G>T	ENST00000347898.3	+	9	1438	c.816G>T	c.(814-816)ccG>ccT	p.P272P	SLC5A11_ENST00000545376.1_Silent_p.P202P|SLC5A11_ENST00000539472.1_Silent_p.P208P|SLC5A11_ENST00000569071.1_Intron|SLC5A11_ENST00000424767.2_Silent_p.P237P|SLC5A11_ENST00000449109.2_Intron|SLC5A11_ENST00000565769.1_Silent_p.P208P|SLC5A11_ENST00000568579.1_Silent_p.P202P|SLC5A11_ENST00000567758.1_Silent_p.P237P	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11									p.P272P(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		TCCCGTGGCCGGGGGTCCTAT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	16											123.0	121.0	122.0					16																	24902341		2197	4300	6497	24809842	SO:0001819	synonymous_variant	115584			AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.816G>T	16.37:g.24902341G>T			24809842		Silent	SNP	ENST00000347898.3	37	CCDS10625.1	SNP	39	WashU																																																																																				0.562	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3	NM_052944		Silent
GINS1	9837	genome.wustl.edu	37	20	25405913	25405913	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr20:25405913G>C	ENST00000262460.4	+	5	491	c.397G>C	c.(397-399)Ggt>Cgt	p.G133R	GINS1_ENST00000429262.2_3'UTR	NM_021067.3	NP_066545.3	Q14691	PSF1_HUMAN	GINS complex subunit 1 (Psf1 homolog)	133					DNA strand elongation involved in DNA replication (GO:0006271)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G133R(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	7						AGGAGATGAAGGTTTGGACAT	0.313																																																1	Substitution - Missense(1)	ovary(1)	20											93.0	93.0	93.0					20																	25405913		2203	4299	6502	25353913	SO:0001583	missense	9837			BC012542	CCDS33451.1	20p11.21	2006-05-04			ENSG00000101003	ENSG00000101003			28980	protein-coding gene	gene with protein product		610608				8724849, 8786132	Standard	NM_021067		Approved	KIAA0186, PSF1	uc002wuv.1	Q14691	OTTHUMG00000032124	ENST00000262460.4:c.397G>C	20.37:g.25405913G>C	ENSP00000262460:p.Gly133Arg		25353913	Q9NQE2|Q9NQI7	Missense_Mutation	SNP	ENST00000262460.4	37	CCDS33451.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	27.2	4.813481	0.90790	.	.	ENSG00000101003	ENST00000262460	T	0.47528	0.84	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.71256	0.3318	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.69401	-0.5155	10	0.38643	T	0.18	-15.4848	18.8867	0.92381	0.0:0.0:1.0:0.0	.	133	Q14691	PSF1_HUMAN	R	133	ENSP00000262460:G133R	ENSP00000262460:G133R	G	+	1	0	GINS1	25353913	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	8.521000	0.90569	2.750000	0.94351	0.655000	0.94253	GGT		0.313	GINS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078433.1	NM_021067		Missense_Mutation
SF3A1	10291	genome.wustl.edu	37	22	30735183	30735183	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr22:30735183C>A	ENST00000215793.8	-	10	1587	c.1433G>T	c.(1432-1434)gGt>gTt	p.G478V	SF3A1_ENST00000439242.1_Missense_Mutation_p.G413V	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	478					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G478V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						TTCCTCTACACCGAAGATGTC	0.498																																																1	Substitution - Missense(1)	ovary(1)	22											229.0	186.0	201.0					22																	30735183		2203	4300	6503	29065183	SO:0001583	missense	10291			X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.1433G>T	22.37:g.30735183C>A	ENSP00000215793:p.Gly478Val		29065183	E9PAW1	Missense_Mutation	SNP	ENST00000215793.8	37	CCDS13875.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	16.30	3.083973	0.55861	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049	T;T	0.52526	0.66;0.72	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.74336	0.3703	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.76924	-0.2779	10	0.87932	D	0	-10.8267	20.3248	0.98698	0.0:1.0:0.0:0.0	.	478	Q15459	SF3A1_HUMAN	V	413;478;375	ENSP00000390336:G413V;ENSP00000215793:G478V	ENSP00000215793:G478V	G	-	2	0	SF3A1	29065183	1.000000	0.71417	0.999000	0.59377	0.902000	0.53008	7.649000	0.83500	2.818000	0.97014	0.655000	0.94253	GGT		0.498	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877		Missense_Mutation
RBPMS	11030	genome.wustl.edu	37	8	30332300	30332300	+	Silent	SNP	G	G	C	rs368733156		TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr8:30332300G>C	ENST00000320203.4	+	2	654	c.72G>C	c.(70-72)cgG>cgC	p.R24R	RBPMS_ENST00000538486.1_Silent_p.R24R|RBPMS_ENST00000339877.4_Silent_p.R24R|RBPMS_ENST00000520161.1_5'UTR|RBPMS_ENST00000520191.1_5'UTR|RBPMS_ENST00000287771.5_Silent_p.R24R|RBPMS_ENST00000517860.1_Silent_p.R24R|RBPMS_ENST00000519647.1_5'UTR|RBPMS_ENST00000397323.4_Silent_p.R24R	NM_006867.2	NP_006858.1	Q93062	RBPMS_HUMAN	RNA binding protein with multiple splicing	24	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.R24R(1)		autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13				KIRC - Kidney renal clear cell carcinoma(542;0.144)|Kidney(114;0.172)		TCCAGGTCCGGACCCTATTTG	0.388																																																1	Substitution - coding silent(1)	ovary(1)	8											169.0	177.0	174.0					8																	30332300		2203	4300	6503	30451842	SO:0001819	synonymous_variant	11030			D84110	CCDS6077.1, CCDS34875.1, CCDS34876.1	8p12	2013-06-07			ENSG00000157110	ENSG00000157110		"""RNA binding motif (RRM) containing"""	19097	protein-coding gene	gene with protein product		601558				8855282	Standard	NM_001008710		Approved	HERMES	uc003xib.3	Q93062	OTTHUMG00000163845	ENST00000320203.4:c.72G>C	8.37:g.30332300G>C			30451842	D3DSU9|Q92516|Q92517|Q92518|Q96J26	Silent	SNP	ENST00000320203.4	37	CCDS6077.1	SNP	41	WashU																																																																																				0.388	RBPMS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376357.2			Silent
RXRB	6257	genome.wustl.edu	37	6	33165605	33165605	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr6:33165605G>A	ENST00000374680.3	-	4	965	c.754C>T	c.(754-756)Cgc>Tgc	p.R252C	RXRB_ENST00000413614.2_Missense_Mutation_p.R156C|RNY4P10_ENST00000365571.1_RNA|RXRB_ENST00000544186.1_Missense_Mutation_p.R62C|RXRB_ENST00000374685.4_Missense_Mutation_p.R252C|SLC39A7_ENST00000374675.3_5'Flank	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	252					cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.R252C(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	TTCCGCTGGCGCTTGTCCACT	0.572																																																1	Substitution - Missense(1)	ovary(1)	6											79.0	66.0	71.0					6																	33165605		1511	2709	4220	33273583	SO:0001583	missense	6257			M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.754C>T	6.37:g.33165605G>A	ENSP00000363812:p.Arg252Cys		33273583	P28703|Q59G65|Q5JP92|Q5STQ1	Missense_Mutation	SNP	ENST00000374680.3	37	CCDS4768.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775024	0.70107	.	.	ENSG00000204231	ENST00000374685;ENST00000374680;ENST00000544186;ENST00000413614	D;D;D;D	0.97378	-4.36;-4.36;-4.36;-4.36	4.52	3.65	0.41850	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.116095	0.56097	D	0.000030	D	0.98232	0.9415	H	0.94345	3.525	0.54753	D	0.999988	D;D;D;D;D;D;D;D	0.89917	0.987;1.0;1.0;1.0;1.0;1.0;1.0;1.0	P;D;D;D;D;D;D;D	0.91635	0.705;0.997;0.996;0.994;0.999;0.999;0.999;0.999	D	0.98154	1.0443	10	0.87932	D	0	.	5.7085	0.17921	0.099:0.0:0.708:0.193	.	156;252;135;62;252;252;292;252	B7Z3E4;B7Z6J2;B7Z6X3;E9PK95;Q5STQ1;Q5STP9;Q59G65;P28702	.;.;.;.;.;.;.;RXRB_HUMAN	C	252;252;62;156	ENSP00000363817:R252C;ENSP00000363812:R252C;ENSP00000439222:R62C;ENSP00000415561:R156C	ENSP00000363812:R252C	R	-	1	0	RXRB	33273583	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.230000	0.58632	1.263000	0.44181	0.448000	0.29417	CGC		0.572	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	NM_021976		Missense_Mutation
LINC01317	104355287	genome.wustl.edu	37	2	33952137	33952137	+	lincRNA	SNP	A	A	T			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:33952137A>T	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA														p.Y236N(1)									TGGGCAGAGTACACCAGGTCG	0.562																																																1	Substitution - Missense(1)	ovary(1)	2																																								33805641			151325																															2.37:g.33952137A>T			33805641		Missense_Mutation	SNP	ENST00000366209.2	37		SNP	14	WashU																																																																																				0.562	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	lincRNA	OTTHUMT00000325406.1			Missense_Mutation
UBAP2	55833	genome.wustl.edu	37	9	33935776	33935776	+	Missense_Mutation	SNP	A	A	G	rs566910880		TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr9:33935776A>G	ENST00000379225.1	-	5	1352	c.929T>C	c.(928-930)aTa>aCa	p.I310T	UBAP2_ENST00000379238.1_Intron|UBAP2_ENST00000418786.2_Intron|UBAP2_ENST00000379239.4_Intron|SNORD121B_ENST00000458838.1_RNA|UBAP2_ENST00000360802.1_Intron|UBAP2_ENST00000539807.1_Intron|UBAP2_ENST00000449054.1_Intron					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		CACGTGAGCTATCCTCTTCCT	0.463																																																0			9											57.0	47.0	50.0					9																	33935776		692	1591	2283	33925776	SO:0001583	missense	55833			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379225.1:c.929T>C	9.37:g.33935776A>G	ENSP00000368527:p.Ile310Thr		33925776		Missense_Mutation	SNP	ENST00000379225.1	37		SNP	16	WashU	.	.	.	.	.	.	.	.	.	.	A	5.702	0.314079	0.10789	.	.	ENSG00000137073	ENST00000379225	T	0.26373	1.74	3.94	-1.35	0.09114	.	.	.	.	.	T	0.16214	0.0390	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28808	-1.0032	8	0.87932	D	0	.	3.999	0.09570	0.5012:0.1851:0.3137:0.0	.	310	A2A306	.	T	310	ENSP00000368527:I310T	ENSP00000368527:I310T	I	-	2	0	UBAP2	33925776	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.358000	0.20216	-0.244000	0.09639	0.482000	0.46254	ATA		0.463	UBAP2-008	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000207580.1	NM_018449		Missense_Mutation
C9orf24	84688	genome.wustl.edu	37	9	34382763	34382763	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr9:34382763G>A	ENST00000297623.2	-	3	583	c.385C>T	c.(385-387)Cgg>Tgg	p.R129W	C9orf24_ENST00000379127.1_5'Flank|C9orf24_ENST00000379133.3_5'Flank|C9orf24_ENST00000379124.1_5'Flank|C9orf24_ENST00000481295.1_5'Flank|C9orf24_ENST00000379126.3_5'Flank	NM_032596.3	NP_115985.2	Q8NCR6	SMRP1_HUMAN	chromosome 9 open reading frame 24	129					cell differentiation (GO:0030154)|cellular protein complex assembly (GO:0043623)|spermatogenesis (GO:0007283)	manchette (GO:0002177)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.R129W(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.123)		TTAGGCAGCCGAGGAAGGTAG	0.522																																																1	Substitution - Missense(1)	ovary(1)	9											236.0	195.0	209.0					9																	34382763		2203	4300	6503	34372763	SO:0001583	missense	84688			BC029484	CCDS6553.1, CCDS6554.1, CCDS6555.1, CCDS59121.1	9p11.2	2013-01-11			ENSG00000164972	ENSG00000164972			19919	protein-coding gene	gene with protein product	"""ciliated bronchial epithelium 1"", ""spermatid-specific manchette-related protein 1"""					12029067	Standard	NM_147168		Approved	bA573M23.4, NYD-SP22, MGC32921, MGC33614, CBE1, SMRP1	uc003zuh.1	Q8NCR6	OTTHUMG00000000437	ENST00000297623.2:c.385C>T	9.37:g.34382763G>A	ENSP00000297623:p.Arg129Trp		34372763	Q5T598|Q5T599|Q5T5A0|Q8N9G4|Q96KD1|Q96LN1	Missense_Mutation	SNP	ENST00000297623.2	37	CCDS6554.1	SNP	37	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.97|14.97	2.693848|2.693848	0.48202|0.48202	.|.	.|.	ENSG00000164972|ENSG00000164972	ENST00000297623|ENST00000444429	T|.	0.52754|.	0.65|.	5.69|5.69	3.65|3.65	0.41850|0.41850	.|.	0.676018|.	0.13386|.	N|.	0.391777|.	T|T	0.37598|0.37598	0.1009|0.1009	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	0.999999|0.999999	D|.	0.69078|.	0.997|.	P|.	0.50896|.	0.653|.	T|T	0.23655|0.23655	-1.0182|-1.0182	10|5	0.72032|.	D|.	0.01|.	-3.2259|-3.2259	13.7612|13.7612	0.62968|0.62968	0.0:0.0:0.7103:0.2897|0.0:0.0:0.7103:0.2897	.|.	129|.	Q8NCR6|.	CI024_HUMAN|.	W|L	129|94	ENSP00000297623:R129W|.	ENSP00000297623:R129W|.	R|S	-|-	1|2	2|0	C9orf24|C9orf24	34372763|34372763	0.401000|0.401000	0.25303|0.25303	0.401000|0.401000	0.26359|0.26359	0.569000|0.569000	0.35902|0.35902	2.816000|2.816000	0.48026|0.48026	1.405000|1.405000	0.46838|0.46838	-0.169000|-0.169000	0.13324|0.13324	CGG|TCG		0.522	C9orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001098.3	NM_147169		Missense_Mutation
TTC3	7267	genome.wustl.edu	37	21	38537877	38537877	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr21:38537877C>G	ENST00000399017.2	+	33	6108	c.3361C>G	c.(3361-3363)Cat>Gat	p.H1121D	TTC3_ENST00000355666.1_Missense_Mutation_p.H1121D|TTC3_ENST00000354749.2_Missense_Mutation_p.H1121D|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1121					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.H1121D(1)		breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TTTGGAGGAACATGGTCCCTT	0.333																																					Ovarian(38;194 1649 35661)											1	Substitution - Missense(1)	ovary(1)	21											108.0	118.0	114.0					21																	38537877		2202	4299	6501	37459747	SO:0001583	missense	7267			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.3361C>G	21.37:g.38537877C>G	ENSP00000381981:p.His1121Asp		37459747	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	37	CCDS13651.1	SNP	17	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.89|12.89	2.073989|2.073989	0.36566|0.36566	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000418766;ENST00000438055;ENST00000355666;ENST00000399017;ENST00000354749|ENST00000411496	T;T;T;T;T|.	0.16324|.	2.35;2.36;2.65;2.65;2.65|.	4.61|4.61	2.63|2.63	0.31362|0.31362	.|.	0.500739|.	0.19424|.	N|.	0.114611|.	T|T	0.68393|0.68393	0.2996|0.2996	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	P;B|.	0.34587|.	0.458;0.329|.	B;B|.	0.35039|.	0.194;0.095|.	T|T	0.65030|0.65030	-0.6267|-0.6267	10|5	0.72032|.	D|.	0.01|.	-7.8057|-7.8057	11.6451|11.6451	0.51257|0.51257	0.3574:0.6426:0.0:0.0|0.3574:0.6426:0.0:0.0	.|.	179;1121|.	Q5GIT6;P53804|.	.;TTC3_HUMAN|.	D|K	1121;1103;1121;1121;1121|276	ENSP00000403943:H1121D;ENSP00000391891:H1103D;ENSP00000347889:H1121D;ENSP00000381981:H1121D;ENSP00000346791:H1121D|.	ENSP00000346791:H1121D|.	H|N	+|+	1|3	0|2	TTC3|TTC3	37459747|37459747	0.999000|0.999000	0.42202|0.42202	0.211000|0.211000	0.23655|0.23655	0.944000|0.944000	0.59088|0.59088	1.902000|1.902000	0.39848|0.39848	0.395000|0.395000	0.25257|0.25257	0.491000|0.491000	0.48974|0.48974	CAT|AAC		0.333	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1			Missense_Mutation
PLA2G4F	255189	genome.wustl.edu	37	15	42436294	42436294	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr15:42436294C>G	ENST00000382396.4	-	18	2110	c.2024G>C	c.(2023-2025)tGc>tCc	p.C675S	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.C677S			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	675	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)	p.C675S(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CAGGTACAGGCAGTCCCGCAT	0.577																																																1	Substitution - Missense(1)	ovary(1)	15											94.0	80.0	85.0					15																	42436294		2203	4299	6502	40223586	SO:0001583	missense	255189				CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.2024G>C	15.37:g.42436294C>G	ENSP00000371833:p.Cys675Ser		40223586	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	37	CCDS32204.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	9.858	1.195540	0.22037	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000443825	T;T	0.08546	3.08;3.08	5.58	1.4	0.22301	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.439557	0.22584	N	0.058167	T	0.03220	0.0094	N	0.08118	0	0.20403	N	0.999909	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.43343	-0.9397	10	0.20519	T	0.43	-7.1612	3.9648	0.09426	0.1151:0.5871:0.1067:0.1911	.	462;675	A2RRC4;Q68DD2	.;PA24F_HUMAN	S	671;677;675;675	ENSP00000380442:C677S;ENSP00000371833:C675S	ENSP00000290497:C671S	C	-	2	0	PLA2G4F	40223586	0.000000	0.05858	0.983000	0.44433	0.885000	0.51271	-0.476000	0.06591	0.265000	0.21872	0.609000	0.83330	TGC		0.577	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600		Missense_Mutation
FAM187B	148109	genome.wustl.edu	37	19	35719434	35719434	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr19:35719434G>T	ENST00000324675.3	-	1	198	c.150C>A	c.(148-150)caC>caA	p.H50Q		NM_152481.1	NP_689694.1	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	50						integral component of membrane (GO:0016021)		p.H50Q(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	9						AATAGTACCAGTGCGCCCCCG	0.498																																																1	Substitution - Missense(1)	ovary(1)	19											63.0	67.0	66.0					19																	35719434		2203	4300	6503	40411274	SO:0001583	missense	148109			AK098526	CCDS12448.1	19q13.12	2008-10-16	2008-10-16	2008-10-16	ENSG00000177558	ENSG00000177558			26366	protein-coding gene	gene with protein product			"""transmembrane protein 162"""	TMEM162			Standard	NM_152481		Approved	FLJ25660	uc002nyk.1	Q17R55	OTTHUMG00000164450	ENST00000324675.3:c.150C>A	19.37:g.35719434G>T	ENSP00000323355:p.His50Gln		40411274	Q8N7G6	Missense_Mutation	SNP	ENST00000324675.3	37	CCDS12448.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	3.604	-0.080878	0.07141	.	.	ENSG00000177558	ENST00000324675	T	0.20738	2.05	4.87	-6.98	0.01611	Immunoglobulin-like fold (1);	2.545690	0.01112	N	0.005599	T	0.05823	0.0152	N	0.01576	-0.805	0.09310	N	0.999999	B	0.12013	0.005	B	0.09377	0.004	T	0.22452	-1.0216	10	0.24483	T	0.36	-4.1348	2.075	0.03622	0.1968:0.1985:0.4273:0.1773	.	50	Q17R55	F187B_HUMAN	Q	50	ENSP00000323355:H50Q	ENSP00000323355:H50Q	H	-	3	2	FAM187B	40411274	0.000000	0.05858	0.002000	0.10522	0.037000	0.13140	-1.232000	0.02936	-0.866000	0.04068	0.655000	0.94253	CAC		0.498	FAM187B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378854.1	NM_152481		Missense_Mutation
NIM1K	167359	genome.wustl.edu	37	5	43280531	43280531	+	Silent	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr5:43280531C>T	ENST00000512796.1	+	4	2510	c.1011C>T	c.(1009-1011)ttC>ttT	p.F337F	NIM1_ENST00000326035.2_Silent_p.F337F			Q8IY84	NIM1_HUMAN		337					protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.F337F(1)									TGGAACCTTTCCAACTGGATC	0.463																																																1	Substitution - coding silent(1)	ovary(1)	5											100.0	96.0	98.0					5																	43280531		2203	4300	6503	43316288	SO:0001819	synonymous_variant	167359																														ENST00000512796.1:c.1011C>T	5.37:g.43280531C>T			43316288	B3KVM1	Silent	SNP	ENST00000512796.1	37	CCDS3943.1	SNP	30	WashU																																																																																				0.463	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368017.1			Silent
POLM	27434	genome.wustl.edu	37	7	44120512	44120512	+	Silent	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr7:44120512G>A	ENST00000242248.5	-	2	293	c.192C>T	c.(190-192)tcC>tcT	p.S64S	POLM_ENST00000335195.6_Silent_p.S64S|POLM_ENST00000395831.3_Silent_p.S64S	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	64	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.S64S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						GTGTCGCTTCGGAGCTGGTGG	0.637								DNA polymerases (catalytic subunits)																																								1	Substitution - coding silent(1)	ovary(1)	7											56.0	56.0	56.0					7																	44120512		2203	4300	6503	44087037	SO:0001819	synonymous_variant	27434			AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.192C>T	7.37:g.44120512G>A			44087037	D3DVK4|Q6P5X8|Q86WQ9	Silent	SNP	ENST00000242248.5	37	CCDS34625.1	SNP	39	WashU																																																																																				0.637	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1	NM_013284		Silent
CPB2	1361	genome.wustl.edu	37	13	46627781	46627781	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr13:46627781T>G	ENST00000181383.4	-	11	1256	c.1240A>C	c.(1240-1242)Aaa>Caa	p.K414Q	CPB2-AS1_ENST00000415033.2_RNA|CPB2_ENST00000439329.3_Silent_p.L359L|ZC3H13_ENST00000282007.3_5'Flank|CPB2-AS1_ENST00000606991.1_RNA|ZC3H13_ENST00000242848.4_5'Flank|CPB2-AS1_ENST00000606351.1_RNA|CPB2-AS1_ENST00000606243.1_RNA	NM_001872.3	NP_001863.3	Q96IY4	CBPB2_HUMAN	carboxypeptidase B2 (plasma)	414					blood coagulation (GO:0007596)|cellular response to glucose stimulus (GO:0071333)|fibrinolysis (GO:0042730)|liver regeneration (GO:0097421)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of plasminogen activation (GO:0010757)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to heat (GO:0009408)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.K414Q(1)		NS(1)|cervix(1)|large_intestine(3)|liver(1)|lung(9)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		CAAGCTATTTTAGAGACAGCG	0.408																																																1	Substitution - Missense(1)	ovary(1)	13											93.0	97.0	96.0					13																	46627781		2203	4300	6503	45525782	SO:0001583	missense	1361			M75106	CCDS9401.1, CCDS73568.1	13q14.11	2012-02-10	2007-02-21		ENSG00000080618	ENSG00000080618			2300	protein-coding gene	gene with protein product	"""thrombin-activatable fibrinolysis inhibitor"", ""carboxypeptidase U"", ""plasma carboxypeptidase B"", ""carboxypeptidase R"""	603101	"""carboxypeptidase B2 (plasma, carboxypeptidase U)"""			1939207, 1427879	Standard	NM_001278541		Approved	CPU, PCPB, TAFI	uc001vaw.3	Q96IY4	OTTHUMG00000016867	ENST00000181383.4:c.1240A>C	13.37:g.46627781T>G	ENSP00000181383:p.Lys414Gln		45525782	A8K464|Q15114|Q5T9K1|Q5T9K2|Q9P2Y6	Missense_Mutation	SNP	ENST00000181383.4	37	CCDS9401.1	SNP	61	WashU	.	.	.	.	.	.	.	.	.	.	T	10.70	1.422983	0.25639	.	.	ENSG00000080618	ENST00000181383	T	0.28666	1.6	5.84	1.79	0.24919	.	0.409334	0.31113	N	0.008234	T	0.15912	0.0383	N	0.25890	0.77	0.48341	D	0.999632	B	0.28605	0.217	B	0.21546	0.035	T	0.07481	-1.0770	10	0.30854	T	0.27	.	4.7107	0.12872	0.1312:0.2478:0.0:0.621	.	414	Q96IY4	CBPB2_HUMAN	Q	414	ENSP00000181383:K414Q	ENSP00000181383:K414Q	K	-	1	0	CPB2	45525782	0.993000	0.37304	0.842000	0.33263	0.517000	0.34286	0.847000	0.27696	0.438000	0.26450	-0.366000	0.07423	AAA		0.408	CPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044803.2	NM_001872		Missense_Mutation
XCR1	2829	genome.wustl.edu	37	3	46062720	46062720	+	Silent	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr3:46062720G>A	ENST00000309285.3	-	2	1076	c.720C>T	c.(718-720)ccC>ccT	p.P240P	XCR1_ENST00000542109.1_Silent_p.P240P	NM_001024644.1	NP_001019815.1	P46094	XCR1_HUMAN	chemokine (C motif) receptor 1	240					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol (GO:0051209)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)	p.P240P(1)		NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		TGAAGTTGTAGGGACCCCAGC	0.602																																																1	Substitution - coding silent(1)	ovary(1)	3											70.0	71.0	71.0					3																	46062720		2203	4300	6503	46037724	SO:0001819	synonymous_variant	2829				CCDS2736.1	3p21.3-p21.1	2012-11-19	2006-01-13	2002-08-23	ENSG00000173578	ENSG00000173578		"""GPCR / Class A : Chemokine receptors : X-C motif"""	1625	protein-coding gene	gene with protein product		600552	"""chemokine (C motif) XC receptor 1"""	GPR5, CCXCR1		7832990, 10400311	Standard	NM_005283		Approved		uc003cpf.3	P46094	OTTHUMG00000133449	ENST00000309285.3:c.720C>T	3.37:g.46062720G>A			46037724		Silent	SNP	ENST00000309285.3	37	CCDS2736.1	SNP	35	WashU																																																																																				0.602	XCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257322.2			Silent
CEACAM21	90273	genome.wustl.edu	37	19	42085771	42085771	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr19:42085771C>A	ENST00000401445.2	+	3	516	c.490C>A	c.(490-492)Ctg>Atg	p.L164M	CEACAM21_ENST00000187608.9_Missense_Mutation_p.L164M|CEACAM21_ENST00000482870.2_3'UTR|CEACAM21_ENST00000407170.2_Missense_Mutation_p.L36M			Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 21	164	Ig-like C2-type.					integral component of membrane (GO:0016021)		p.L164M(1)		endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	13						CTCCGTGGTCCTGACCTGCCA	0.527																																																1	Substitution - Missense(1)	ovary(1)	19											55.0	60.0	58.0					19																	42085771		2073	4219	6292	46777611	SO:0001583	missense	90273			AK023602	CCDS46086.1, CCDS46087.1, CCDS74373.1	19q13.2	2013-01-29			ENSG00000007129	ENSG00000007129		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28834	protein-coding gene	gene with protein product						12477932	Standard	XM_005278397		Approved	R29124_1, FLJ13540	uc002ore.4	Q3KPI0	OTTHUMG00000151062	ENST00000401445.2:c.490C>A	19.37:g.42085771C>A	ENSP00000385739:p.Leu164Met		46777611	B7WNQ6|O75296|Q6UY47|Q96ER7	Missense_Mutation	SNP	ENST00000401445.2	37	CCDS46086.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	17.10	3.303534	0.60195	.	.	ENSG00000007129	ENST00000407170;ENST00000187608;ENST00000401445	T;T;T	0.01854	4.6;4.6;4.6	3.56	-0.183	0.13284	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.09862	0.0242	M	0.85462	2.755	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.17561	-1.0365	9	0.87932	D	0	.	2.5165	0.04669	0.229:0.4784:0.0:0.2926	.	164;164	Q3KPI0-2;Q3KPI0	.;CEA21_HUMAN	M	36;164;164	ENSP00000384380:L36M;ENSP00000187608:L164M;ENSP00000385739:L164M	ENSP00000187608:L164M	L	+	1	2	CEACAM21	46777611	0.000000	0.05858	0.148000	0.22405	0.768000	0.43524	-0.176000	0.09811	0.223000	0.20920	0.385000	0.25706	CTG		0.527	CEACAM21-005	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321140.1	NM_033543		Missense_Mutation
TNS3	64759	genome.wustl.edu	37	7	47440385	47440385	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr7:47440385T>G	ENST00000398879.1	-	14	1216	c.850A>C	c.(850-852)Aaa>Caa	p.K284Q	TNS3_ENST00000355730.3_Intron|TNS3_ENST00000311160.9_Missense_Mutation_p.K284Q			Q68CZ2	TENS3_HUMAN	tensin 3	284	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.K284Q(1)		NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GCCTCACCTTTGCTGGCATTG	0.577																																																1	Substitution - Missense(1)	ovary(1)	7											72.0	89.0	84.0					7																	47440385		2075	4206	6281	47406910	SO:0001583	missense	64759			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.850A>C	7.37:g.47440385T>G	ENSP00000381854:p.Lys284Gln		47406910	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	37	CCDS5506.2	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	14.63	2.593495	0.46214	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000457718;ENST00000450444	D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39	4.99	2.47	0.30058	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.365437	0.28409	N	0.015457	D	0.84451	0.5475	M	0.70842	2.15	0.80722	D	1	B	0.11235	0.004	B	0.14578	0.011	T	0.72161	-0.4374	10	0.17832	T	0.49	.	6.2934	0.21073	0.0:0.0886:0.2018:0.7095	.	284	Q68CZ2	TENS3_HUMAN	Q	284;394;284;387;373	ENSP00000312143:K284Q;ENSP00000381854:K284Q;ENSP00000414358:K387Q;ENSP00000396914:K373Q	ENSP00000312143:K284Q	K	-	1	0	TNS3	47406910	1.000000	0.71417	0.396000	0.26296	0.953000	0.61014	2.485000	0.45250	0.195000	0.20347	0.374000	0.22700	AAA		0.577	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748		Missense_Mutation
AGBL2	79841	genome.wustl.edu	37	11	47681860	47681860	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr11:47681860C>G	ENST00000525123.1	-	19	2859	c.2574G>C	c.(2572-2574)aaG>aaC	p.K858N	AGBL2_ENST00000298861.4_Missense_Mutation_p.K858N|AGBL2_ENST00000357610.3_Missense_Mutation_p.K860N	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	858						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.K858N(1)		NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						TTATGGTTCTCTTTGGAGAGC	0.433																																																1	Substitution - Missense(1)	ovary(1)	11											109.0	100.0	103.0					11																	47681860		2201	4298	6499	47638436	SO:0001583	missense	79841				CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.2574G>C	11.37:g.47681860C>G	ENSP00000435582:p.Lys858Asn		47638436	A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Missense_Mutation	SNP	ENST00000525123.1	37	CCDS7944.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	18.72	3.683612	0.68157	.	.	ENSG00000165923	ENST00000528609;ENST00000525123;ENST00000357610;ENST00000298861	T;T;T	0.10668	2.85;2.85;2.85	4.79	3.87	0.44632	.	0.141097	0.32987	N	0.005419	T	0.14270	0.0345	M	0.63428	1.95	0.24607	N	0.993748	D	0.53151	0.958	P	0.45343	0.477	T	0.09684	-1.0663	10	0.42905	T	0.14	-18.7905	9.4198	0.38544	0.0:0.9026:0.0:0.0974	.	858	Q5U5Z8	CBPC2_HUMAN	N	241;858;860;858	ENSP00000435582:K858N;ENSP00000350228:K860N;ENSP00000298861:K858N	ENSP00000298861:K858N	K	-	3	2	AGBL2	47638436	0.050000	0.20438	0.771000	0.31576	0.335000	0.28730	0.388000	0.20735	1.383000	0.46405	0.460000	0.39030	AAG		0.433	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	NM_024783		Missense_Mutation
TRIM51GP	120824	genome.wustl.edu	37	11	48997121	48997121	+	IGR	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr11:48997121G>A								OR4A47 (485789 upstream) : TRIM49B (53382 downstream)														p.L450L(1)									GTGTATATCAGGGAACTTCTA	0.423																																																1	Substitution - coding silent(1)	ovary(1)	11																																								48953697	SO:0001628	intergenic_variant	120824																															11.37:g.48997121G>A			48953697		Silent	SNP		37		SNP	35	WashU																																																																																			0	0.423									Silent
DMXL2	23312	genome.wustl.edu	37	15	51795104	51795104	+	Missense_Mutation	SNP	A	A	G	rs373891521		TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr15:51795104A>G	ENST00000251076.5	-	17	3178	c.2891T>C	c.(2890-2892)cTt>cCt	p.L964P	DMXL2_ENST00000449909.3_Intron|DMXL2_ENST00000543779.2_Missense_Mutation_p.L964P	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	964						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.L964P(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		GGCAGTTTGAAGATTGGCAAT	0.448																																																1	Substitution - Missense(1)	ovary(1)	15											148.0	149.0	149.0					15																	51795104		2195	4293	6488	49582396	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.2891T>C	15.37:g.51795104A>G	ENSP00000251076:p.Leu964Pro		49582396	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	22.4	4.283289	0.80803	.	.	ENSG00000104093	ENST00000251076;ENST00000543779	T;T	0.48836	0.8;0.8	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.67832	0.2935	M	0.74881	2.28	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.974;0.998	T	0.67975	-0.5531	10	0.36615	T	0.2	.	15.2424	0.73480	1.0:0.0:0.0:0.0	.	964;964	F5GWF1;Q8TDJ6	.;DMXL2_HUMAN	P	964	ENSP00000251076:L964P;ENSP00000441858:L964P	ENSP00000251076:L964P	L	-	2	0	DMXL2	49582396	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.698000	0.91311	1.990000	0.58119	0.524000	0.50904	CTT		0.448	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263		Missense_Mutation
BSN	8927	genome.wustl.edu	37	3	49699949	49699949	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr3:49699949G>T	ENST00000296452.4	+	6	10785	c.10671G>T	c.(10669-10671)gaG>gaT	p.E3557D		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3557					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.E3557D(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		AGCGTGAGGAGGGCTACATCC	0.597																																																1	Substitution - Missense(1)	ovary(1)	3											54.0	58.0	57.0					3																	49699949		2203	4300	6503	49674953	SO:0001583	missense	8927			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.10671G>T	3.37:g.49699949G>T	ENSP00000296452:p.Glu3557Asp		49674953	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	10.06	1.247914	0.22880	.	.	ENSG00000164061	ENST00000296452	T	0.17854	2.25	5.97	1.7	0.24286	.	0.054929	0.64402	D	0.000001	T	0.09379	0.0231	N	0.24115	0.695	0.34705	D	0.727124	B	0.24963	0.115	B	0.22386	0.039	T	0.30238	-0.9985	10	0.15952	T	0.53	-23.4864	8.7191	0.34430	0.4761:0.0:0.5239:0.0	.	3557	Q9UPA5	BSN_HUMAN	D	3557	ENSP00000296452:E3557D	ENSP00000296452:E3557D	E	+	3	2	BSN	49674953	0.990000	0.36364	1.000000	0.80357	0.998000	0.95712	0.297000	0.19101	0.427000	0.26145	0.655000	0.94253	GAG		0.597	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458		Missense_Mutation
UBA7	7318	genome.wustl.edu	37	3	49847748	49847748	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr3:49847748G>T	ENST00000333486.3	-	13	1739	c.1581C>A	c.(1579-1581)aaC>aaA	p.N527K	UBA7_ENST00000494212.1_5'Flank	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	527	2 approximate repeats.				cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)	p.N527K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GGGAGAAAAAGTTATCCCCAT	0.602																																																1	Substitution - Missense(1)	ovary(1)	3											89.0	90.0	90.0					3																	49847748		2203	4300	6503	49822752	SO:0001583	missense	7318			BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.1581C>A	3.37:g.49847748G>T	ENSP00000333266:p.Asn527Lys		49822752	Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	37	CCDS2805.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	14.57	2.574376	0.45902	.	.	ENSG00000182179	ENST00000333486	T	0.41400	1.0	5.67	1.88	0.25563	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	1.610700	0.02527	N	0.093168	T	0.33323	0.0859	N	0.26130	0.795	0.36394	D	0.862706	B	0.09022	0.002	B	0.15052	0.012	T	0.10042	-1.0647	10	0.41790	T	0.15	0.3008	7.1487	0.25597	0.1839:0.0:0.6919:0.1242	.	527	P41226	UBA7_HUMAN	K	527	ENSP00000333266:N527K	ENSP00000333266:N527K	N	-	3	2	UBA7	49822752	1.000000	0.71417	0.113000	0.21522	0.784000	0.44337	2.775000	0.47702	0.068000	0.16574	0.561000	0.74099	AAC		0.602	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335		Missense_Mutation
RPGRIP1L	23322	genome.wustl.edu	37	16	53726199	53726199	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr16:53726199C>A	ENST00000379925.3	-	4	358	c.308G>T	c.(307-309)gGa>gTa	p.G103V	RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.G103V|RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.G103V|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.G103V	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	103					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)	p.G103V(1)		endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CACATCTCGTCCCAGCCGCTT	0.433																																																1	Substitution - Missense(1)	ovary(1)	16											166.0	181.0	176.0					16																	53726199		2198	4300	6498	52283700	SO:0001583	missense	23322				CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.308G>T	16.37:g.53726199C>A	ENSP00000369257:p.Gly103Val		52283700	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	CCDS32447.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	16.36	3.102055	0.56183	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;T	0.80304	-1.36;-1.36	5.83	5.83	0.93111	.	0.109437	0.64402	D	0.000010	D	0.87581	0.6213	L	0.54908	1.71	0.80722	D	1	D;P;D;D	0.89917	0.985;0.911;0.999;1.0	P;B;D;D	0.80764	0.493;0.376;0.992;0.994	D	0.83394	0.0019	10	0.23891	T	0.37	-23.5607	20.1374	0.98035	0.0:1.0:0.0:0.0	.	103;103;103;103	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	V	103	ENSP00000369257:G103V;ENSP00000262135:G103V	ENSP00000262135:G103V	G	-	2	0	RPGRIP1L	52283700	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.873000	0.56093	2.763000	0.94921	0.563000	0.77884	GGA		0.433	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272		Missense_Mutation
LRRC1	55227	genome.wustl.edu	37	6	53743857	53743857	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr6:53743857A>T	ENST00000370888.1	+	3	621	c.344A>T	c.(343-345)aAc>aTc	p.N115I	LRRC1_ENST00000370882.1_Missense_Mutation_p.N115I	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	115						cytoplasm (GO:0005737)|membrane (GO:0016020)		p.N115I(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		TTCAGCGGAAACCCACTGACT	0.408																																																1	Substitution - Missense(1)	ovary(1)	6											65.0	55.0	58.0					6																	53743857		2203	4300	6503	53851816	SO:0001583	missense	55227			AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.344A>T	6.37:g.53743857A>T	ENSP00000359925:p.Asn115Ile		53851816	Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	ENST00000370888.1	37	CCDS4953.2	SNP	2	WashU	.	.	.	.	.	.	.	.	.	.	A	16.92	3.255477	0.59321	.	.	ENSG00000137269	ENST00000370888;ENST00000370882	T;T	0.67865	2.91;-0.29	5.06	5.06	0.68205	.	0.048115	0.85682	D	0.000000	T	0.74458	0.3719	H	0.96208	3.785	0.80722	D	1	P	0.40050	0.7	B	0.43575	0.424	T	0.82723	-0.0316	10	0.87932	D	0	.	13.0893	0.59158	1.0:0.0:0.0:0.0	.	115	Q9BTT6	LRRC1_HUMAN	I	115	ENSP00000359925:N115I;ENSP00000359919:N115I	ENSP00000359919:N115I	N	+	2	0	LRRC1	53851816	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.811000	0.86092	2.256000	0.74724	0.533000	0.62120	AAC		0.408	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2	NM_025168		Missense_Mutation
SMG8	55181	genome.wustl.edu	37	17	57289008	57289008	+	Silent	SNP	T	T	C			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr17:57289008T>C	ENST00000543872.2	+	2	1860	c.1596T>C	c.(1594-1596)ctT>ctC	p.L532L	SMG8_ENST00000300917.5_Silent_p.L532L|SMG8_ENST00000578922.1_Silent_p.L532L|SMG8_ENST00000580498.1_Intron|CTD-2510F5.6_ENST00000577660.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	532				L -> R (in Ref. 1; AAL83913). {ECO:0000305}.	gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)		p.L532L(1)		NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						CCCAGGCTCTTCGAGTGTACA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	17											85.0	77.0	80.0					17																	57289008		2203	4300	6503	54643790	SO:0001819	synonymous_variant	55181			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1596T>C	17.37:g.57289008T>C			54643790	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Silent	SNP	ENST00000543872.2	37	CCDS11615.1	SNP	62	WashU																																																																																				0.458	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149		Silent
IKZF4	64375	genome.wustl.edu	37	12	56417511	56417511	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr12:56417511C>A	ENST00000262032.5	+	6	511	c.144C>A	c.(142-144)gaC>gaA	p.D48E	IKZF4_ENST00000547167.1_Missense_Mutation_p.D48E|IKZF4_ENST00000548601.1_Intron|IKZF4_ENST00000431367.2_Intron|IKZF4_ENST00000547791.1_Intron			Q9H2S9	IKZF4_HUMAN	IKAROS family zinc finger 4 (Eos)	48					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D48E(1)		NS(1)|endometrium(2)|lung(3)|ovary(1)|prostate(1)	8			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			AGGCCCAAGACTCCAACCATT	0.453																																																1	Substitution - Missense(1)	ovary(1)	12											97.0	95.0	95.0					12																	56417511		1850	4092	5942	54703778	SO:0001583	missense	64375			AF230809	CCDS44917.1	12q13	2013-01-08	2006-08-25	2006-08-25		ENSG00000123411		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13179	protein-coding gene	gene with protein product		606239	"""zinc finger protein, subfamily 1A, 4 (Eos)"""	ZNFN1A4		10978333	Standard	NM_022465		Approved	Eos	uc001sjc.1	Q9H2S9		ENST00000262032.5:c.144C>A	12.37:g.56417511C>A	ENSP00000262032:p.Asp48Glu		54703778	Q96JP3	Missense_Mutation	SNP	ENST00000262032.5	37	CCDS44917.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	16.32	3.091361	0.55968	.	.	ENSG00000123411	ENST00000262032;ENST00000547167	T;T	0.08458	3.09;3.09	5.55	4.59	0.56863	.	.	.	.	.	T	0.02767	0.0083	N	0.08118	0	0.80722	D	1	P	0.42584	0.784	B	0.25884	0.064	T	0.54629	-0.8265	9	0.15499	T	0.54	-4.7527	8.4428	0.32824	0.0:0.895:0.0:0.105	.	48	Q9H2S9	IKZF4_HUMAN	E	48	ENSP00000262032:D48E;ENSP00000448419:D48E	ENSP00000262032:D48E	D	+	3	2	IKZF4	54703778	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.949000	0.40313	2.885000	0.99019	0.655000	0.94253	GAC		0.453	IKZF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407590.1	NM_022465		Missense_Mutation
GLS2	27165	genome.wustl.edu	37	12	56865559	56865559	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr12:56865559G>T	ENST00000311966.4	-	17	1928	c.1650C>A	c.(1648-1650)gaC>gaA	p.D550E	MIP_ENST00000555551.1_5'Flank|GLS2_ENST00000476991.1_5'Flank	NM_013267.2	NP_037399.2	Q9UI32	GLSL_HUMAN	glutaminase 2 (liver, mitochondrial)	550					cellular amino acid biosynthetic process (GO:0008652)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate secretion (GO:0014047)|glutamine metabolic process (GO:0006541)|neurotransmitter secretion (GO:0007269)|reactive oxygen species metabolic process (GO:0072593)|regulation of apoptotic process (GO:0042981)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)	p.D550E(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13					L-Glutamine(DB00130)	TTCCTCACCTGTCCTTGGCAA	0.493																																																1	Substitution - Missense(1)	ovary(1)	12											163.0	157.0	159.0					12																	56865559		2203	4300	6503	55151826	SO:0001583	missense	27165				CCDS8921.1, CCDS73482.1	12q13	2013-01-10			ENSG00000135423	ENSG00000135423		"""Ankyrin repeat domain containing"""	29570	protein-coding gene	gene with protein product		606365				11130979, 10620514	Standard	NM_013267		Approved	GA, GLS, LGA, hLGA	uc001slj.3	Q9UI32	OTTHUMG00000140379	ENST00000311966.4:c.1650C>A	12.37:g.56865559G>T	ENSP00000310447:p.Asp550Glu		55151826	B7Z8Q9|Q8IX91|Q9NYY2|Q9UI31	Missense_Mutation	SNP	ENST00000311966.4	37	CCDS8921.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288587	0.80914	.	.	ENSG00000135423	ENST00000311966	T	0.43688	0.94	4.81	2.98	0.34508	Ankyrin repeat-containing domain (4);	0.049158	0.85682	D	0.000000	T	0.65688	0.2715	M	0.88704	2.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.68010	-0.5522	10	0.87932	D	0	-34.9482	8.7622	0.34680	0.1827:0.0:0.8173:0.0	.	550	Q9UI32	GLSL_HUMAN	E	550	ENSP00000310447:D550E	ENSP00000310447:D550E	D	-	3	2	GLS2	55151826	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	2.476000	0.45171	0.710000	0.31997	0.563000	0.77884	GAC		0.493	GLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277113.1	NM_013267		Missense_Mutation
OTX2	5015	genome.wustl.edu	37	14	57269021	57269021	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr14:57269021T>G	ENST00000555006.1	-	4	710	c.302A>C	c.(301-303)cAg>cCg	p.Q101P	OTX2_ENST00000408990.3_Missense_Mutation_p.Q101P|OTX2_ENST00000554559.1_3'UTR|OTX2_ENST00000554788.1_3'UTR|RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000339475.5_Missense_Mutation_p.Q109P			P32243	OTX2_HUMAN	orthodenticle homeobox 2	101	Poly-Gln.				axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.Q109P(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					ACCTCCATTCTGCTGTTGTTG	0.448																																																1	Substitution - Missense(1)	ovary(1)	14											107.0	110.0	109.0					14																	57269021		2203	4300	6503	56338774	SO:0001583	missense	5015			AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.302A>C	14.37:g.57269021T>G	ENSP00000452336:p.Gln101Pro		56338774	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Missense_Mutation	SNP	ENST00000555006.1	37	CCDS41960.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	15.47	2.843487	0.51057	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006;ENST00000554845;ENST00000555804	D;D;D;D;D	0.92048	-2.79;-2.79;-2.79;-2.84;-2.96	5.78	5.78	0.91487	.	0.000000	0.40554	N	0.001076	D	0.92227	0.7535	M	0.65320	2	0.80722	D	1	P;P	0.52577	0.954;0.824	P;B	0.47470	0.548;0.327	D	0.92436	0.5958	10	0.52906	T	0.07	.	14.9485	0.71050	0.0:0.0:0.0:1.0	.	109;101	F1T0D1;P32243	.;OTX2_HUMAN	P	109;101;101;109;101	ENSP00000343819:Q109P;ENSP00000386185:Q101P;ENSP00000452336:Q101P;ENSP00000451357:Q109P;ENSP00000451272:Q101P	ENSP00000343819:Q109P	Q	-	2	0	OTX2	56338774	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	8.040000	0.89188	2.212000	0.71576	0.374000	0.22700	CAG		0.448	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.		Missense_Mutation
USP34	9736	genome.wustl.edu	37	2	61522381	61522381	+	Silent	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:61522381G>A	ENST00000398571.2	-	31	4375	c.4299C>T	c.(4297-4299)agC>agT	p.S1433S		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1433					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.S1433S(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GCTTGTGGGCGCTCTTAATTT	0.343																																																1	Substitution - coding silent(1)	ovary(1)	2											106.0	99.0	102.0					2																	61522381		1808	4069	5877	61375885	SO:0001819	synonymous_variant	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.4299C>T	2.37:g.61522381G>A			61375885	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	37	CCDS42686.1	SNP	38	WashU																																																																																				0.343	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			Silent
PLEKHO2	80301	genome.wustl.edu	37	15	65157820	65157820	+	Silent	SNP	C	C	A			TCGA-23-1124-01	TCGA-23-1124-10	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr15:65157820C>A	ENST00000323544.4	+	6	1334	c.1206C>A	c.(1204-1206)ccC>ccA	p.P402P	AC069368.3_ENST00000437723.1_Intron	NM_001195059.1|NM_025201.4	NP_001181988.1|NP_079477.2	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O member 2	402								p.P402P(1)		NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25						CGCGGCATCCCTTGCAGCCCA	0.637																																																1	Substitution - coding silent(1)	ovary(1)	15											55.0	54.0	54.0					15																	65157820		2202	4299	6501	62944873	SO:0001819	synonymous_variant	80301			AF318373	CCDS10196.1, CCDS73739.1	15q22.31	2013-01-10	2007-12-14	2007-12-14	ENSG00000241839	ENSG00000241839		"""Pleckstrin homology (PH) domain containing"""	30026	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family Q member 1"""	PLEKHQ1		12477932	Standard	NM_025201		Approved	DKFZp761K2312, PP1628, pp9099	uc002anv.3	Q8TD55	OTTHUMG00000133050	ENST00000323544.4:c.1206C>A	15.37:g.65157820C>A			62944873	Q7L4H4|Q8WYS8	Silent	SNP	ENST00000323544.4	37	CCDS10196.1	SNP	24	WashU																																																																																				0.637	PLEKHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256659.1	NM_025201		Silent
WIF1	11197	genome.wustl.edu	37	12	65445178	65445178	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr12:65445178T>C	ENST00000286574.4	-	10	1465	c.1091A>G	c.(1090-1092)aAa>aGa	p.K364R		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	364					multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)		p.K364R(1)		cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		CTCGGCCTTTTTAAGTGAAGG	0.498			T	HMGA2	pleomorphic salivary gland adenoma																																Esophageal Squamous(148;1595 1816 48559 49439 49664)		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	1	Substitution - Missense(1)	ovary(1)	12											62.0	63.0	63.0					12																	65445178		2203	4300	6503	63731445	SO:0001583	missense	11197			AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.1091A>G	12.37:g.65445178T>C	ENSP00000286574:p.Lys364Arg		63731445	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	ENST00000286574.4	37	CCDS8971.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	21.5	4.158634	0.78226	.	.	ENSG00000156076	ENST00000286574;ENST00000543094	D;T	0.89270	-2.49;-0.99	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.90484	0.7019	L	0.29908	0.895	0.53005	D	0.999966	D	0.63880	0.993	D	0.70935	0.971	D	0.89511	0.3771	9	.	.	.	.	16.226	0.82293	0.0:0.0:0.0:1.0	.	364	Q9Y5W5	WIF1_HUMAN	R	364;113	ENSP00000286574:K364R;ENSP00000439024:K113R	.	K	-	2	0	WIF1	63731445	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	5.403000	0.66338	2.371000	0.80710	0.533000	0.62120	AAA		0.498	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2			Missense_Mutation
ADAMTS6	11174	genome.wustl.edu	37	5	64510687	64510687	+	IGR	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr5:64510687C>G								ADAMTS6 (16095 upstream) : ADAMTS6 (82347 downstream)														p.D837H(1)									ACTTCATTATCTCCACTGCCA	0.468																																																1	Substitution - Missense(1)	ovary(1)	5											155.0	134.0	141.0					5																	64510687		2203	4300	6503	64546443	SO:0001628	intergenic_variant	11174																															5.37:g.64510687C>G			64546443		Missense_Mutation	SNP		37		SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371278	0.61624	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680	T;T	0.59502	0.26;0.38	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.73048	0.3537	L	0.60957	1.885	0.80722	D	1	D;D	0.67145	0.996;0.992	D;D	0.63597	0.916;0.916	T	0.73014	-0.4116	10	0.59425	D	0.04	.	20.0022	0.97423	0.0:1.0:0.0:0.0	.	837;837	D6R9L6;Q9UKP5	.;ATS6_HUMAN	H	837;787;837	ENSP00000370443:D837H;ENSP00000423551:D837H	ENSP00000261306:D787H	D	-	1	0	ADAMTS6	64546443	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.738000	0.93877	0.655000	0.94253	GAT	0	0.468									Missense_Mutation
TM7SF2	7108	genome.wustl.edu	37	11	64881061	64881061	+	Missense_Mutation	SNP	G	G	C	rs377167308		TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr11:64881061G>C	ENST00000279263.7	+	5	760	c.598G>C	c.(598-600)Ggc>Cgc	p.G200R	TM7SF2_ENST00000345348.5_Missense_Mutation_p.G200R|TM7SF2_ENST00000531029.1_Intron|AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000540748.1_Missense_Mutation_p.G84R	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	200					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)	p.G200R(1)		lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGGCCTCATCGGCTGGGTATG	0.557																																																1	Substitution - Missense(1)	ovary(1)	11											91.0	94.0	93.0					11																	64881061		1880	4088	5968	64637637	SO:0001583	missense	7108			BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.598G>C	11.37:g.64881061G>C	ENSP00000279263:p.Gly200Arg		64637637	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Missense_Mutation	SNP	ENST00000279263.7	37	CCDS41669.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	24.6	4.547391	0.86022	.	.	ENSG00000149809	ENST00000279263;ENST00000524986;ENST00000534371;ENST00000540748;ENST00000525385;ENST00000345348;ENST00000531321;ENST00000529414;ENST00000526085;ENST00000527968	D;D;D;D;D;D;D;D;D;D	0.98075	-4.7;-4.7;-4.7;-4.7;-4.7;-4.7;-4.7;-4.7;-4.7;-4.7	4.83	3.92	0.45320	.	0.101398	0.64402	D	0.000002	D	0.98924	0.9635	H	0.95712	3.71	0.53005	D	0.99996	D;D;D	0.71674	0.995;0.998;0.998	D;D;D	0.77557	0.973;0.983;0.99	D	0.99094	1.0841	10	0.62326	D	0.03	-7.5381	10.7792	0.46367	0.0926:0.0:0.9074:0.0	.	84;200;200	F5GYV3;O76062-2;O76062	.;.;ERG24_HUMAN	R	200;171;132;84;171;200;106;189;51;32	ENSP00000279263:G200R;ENSP00000435972:G171R;ENSP00000432187:G132R;ENSP00000441215:G84R;ENSP00000433325:G171R;ENSP00000329520:G200R;ENSP00000431300:G106R;ENSP00000433275:G189R;ENSP00000434447:G51R;ENSP00000431685:G32R	ENSP00000279263:G200R	G	+	1	0	TM7SF2	64637637	1.000000	0.71417	0.993000	0.49108	0.958000	0.62258	7.351000	0.79395	1.275000	0.44379	-0.339000	0.08088	GGC		0.557	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273		Missense_Mutation
GRIP1	23426	genome.wustl.edu	37	12	66856837	66856837	+	Silent	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr12:66856837G>T	ENST00000398016.3	-	9	977	c.909C>A	c.(907-909)tcC>tcA	p.S303S	GRIP1_ENST00000359742.4_Silent_p.S303S|GRIP1_ENST00000286445.7_Silent_p.S303S	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0	Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.				intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)	p.S303S(1)		NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TTCCATCGATGGAGAGGATGT	0.502																																																1	Substitution - coding silent(1)	ovary(1)	12											135.0	132.0	133.0					12																	66856837		2053	4206	6259	65143104	SO:0001819	synonymous_variant	23426			AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.909C>A	12.37:g.66856837G>T			65143104	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Silent	SNP	ENST00000398016.3	37	CCDS41807.1	SNP	47	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.371|5.371	0.253762|0.253762	0.10185|0.10185	.|.	.|.	ENSG00000155974|ENSG00000155974	ENST00000543172|ENST00000538164	.|.	.|.	.|.	5.23|5.23	3.18|3.18	0.36537|0.36537	.|.	.|.	.|.	.|.	.|.	T|T	0.52306|0.52306	0.1726|0.1726	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.44019|0.44019	-0.9355|-0.9355	4|4	.|.	.|.	.|.	-13.3827|-13.3827	4.8374|4.8374	0.13471|0.13471	0.0769:0.1234:0.5516:0.2481|0.0769:0.1234:0.5516:0.2481	.|.	.|.	.|.	.|.	N|Q	124|118	.|.	.|.	H|P	-|-	1|2	0|0	GRIP1|GRIP1	65143104|65143104	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.536000|0.536000	0.34869|0.34869	1.066000|1.066000	0.30604|0.30604	0.721000|0.721000	0.32231|0.32231	0.655000|0.655000	0.94253|0.94253	CAT|CCA		0.502	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2			Silent
Unknown	0	genome.wustl.edu	37	9	65595067	65595067	+	IGR	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr9:65595067G>A								SPATA31A7 (85457 upstream) : RP11-118H15.1 (285465 downstream)																							TTCTCCTACAGCTCTCTACGA	0.463																																																0			9																																								65334887	SO:0001628	intergenic_variant																																9.37:g.65595067G>A			65334887		Splice_Site_SNP	SNP		37		SNP	34	WashU																																																																																			0	0.463									Splice_Site_SNP
CDH16	1014	genome.wustl.edu	37	16	66946665	66946665	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr16:66946665G>C	ENST00000299752.4	-	10	1377	c.1184C>G	c.(1183-1185)cCc>cGc	p.P395R	CDH16_ENST00000565796.1_Missense_Mutation_p.P395R|CDH16_ENST00000570262.1_Missense_Mutation_p.P315R|CDH16_ENST00000394055.3_Missense_Mutation_p.P395R|CDH16_ENST00000568632.1_Missense_Mutation_p.P298R	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	395	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.P395R(1)		endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		GCCTGAAGTGGGGTCCACCTG	0.642																																																1	Substitution - Missense(1)	ovary(1)	16											65.0	63.0	64.0					16																	66946665		2200	4300	6500	65504166	SO:0001583	missense	1014			AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.1184C>G	16.37:g.66946665G>C	ENSP00000299752:p.Pro395Arg		65504166	B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	ENST00000299752.4	37	CCDS10823.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	0.532	-0.857417	0.02630	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	T;T	0.53640	0.61;0.61	4.98	2.98	0.34508	Cadherin (4);Cadherin-like (1);	0.863790	0.10479	N	0.669796	T	0.37376	0.1001	L	0.39020	1.185	0.09310	N	1	B;B;B	0.33826	0.017;0.427;0.01	B;B;B	0.37198	0.008;0.243;0.02	T	0.20840	-1.0263	10	0.20046	T	0.44	-0.2234	8.3325	0.32195	0.1959:0.0:0.8041:0.0	.	395;395;395	O75309-2;B2R7S8;O75309	.;.;CAD16_HUMAN	R	395;395;359	ENSP00000377619:P395R;ENSP00000299752:P395R	ENSP00000299752:P395R	P	-	2	0	CDH16	65504166	0.032000	0.19561	0.002000	0.10522	0.397000	0.30659	1.398000	0.34554	1.243000	0.43853	0.561000	0.74099	CCC		0.642	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062		Missense_Mutation
TRIM55	84675	genome.wustl.edu	37	8	67039617	67039617	+	Silent	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr8:67039617G>A	ENST00000315962.4	+	1	487	c.114G>A	c.(112-114)gtG>gtA	p.V38V	TRIM55_ENST00000276573.7_Silent_p.V38V|TRIM55_ENST00000353317.5_Silent_p.V38V|TRIM55_ENST00000350034.4_Silent_p.V38V	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	38					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.V38V(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			AACCTGTGGTGATTCTCCCTT	0.433																																																1	Substitution - coding silent(1)	ovary(1)	8											233.0	227.0	229.0					8																	67039617		2203	4300	6503	67202171	SO:0001819	synonymous_variant	84675			AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.114G>A	8.37:g.67039617G>A			67202171	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Silent	SNP	ENST00000315962.4	37	CCDS6184.1	SNP	45	WashU																																																																																				0.433	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085		Silent
PROKR1	10887	genome.wustl.edu	37	2	68882521	68882521	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:68882521T>G	ENST00000303786.3	+	3	1415	c.995T>G	c.(994-996)aTg>aGg	p.M332R	PROKR1_ENST00000394342.2_Missense_Mutation_p.M332R			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	332					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.M332R(1)		endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TGCATCGCCATGAGCAACAGC	0.512																																																1	Substitution - Missense(1)	ovary(1)	2											196.0	140.0	159.0					2																	68882521		2203	4300	6503	68736025	SO:0001583	missense	10887			AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.995T>G	2.37:g.68882521T>G	ENSP00000303775:p.Met332Arg		68736025	A5JUU2|Q53QT9|Q8NFJ7	Missense_Mutation	SNP	ENST00000303786.3	37	CCDS1889.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004102	0.74932	.	.	ENSG00000169618	ENST00000303786;ENST00000394342	T;T	0.72725	-0.68;-0.68	4.68	4.68	0.58851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.85703	0.5758	M	0.90252	3.1	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88386	0.3005	10	0.87932	D	0	.	12.7537	0.57321	0.0:0.0:0.0:1.0	.	332	Q8TCW9	PKR1_HUMAN	R	332	ENSP00000303775:M332R;ENSP00000377874:M332R	ENSP00000303775:M332R	M	+	2	0	PROKR1	68736025	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.582000	0.82546	2.326000	0.78906	0.533000	0.62120	ATG		0.512	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251760.2			Missense_Mutation
UACA	55075	genome.wustl.edu	37	15	70959142	70959142	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr15:70959142T>C	ENST00000322954.6	-	16	4066	c.3881A>G	c.(3880-3882)gAt>gGt	p.D1294G	UACA_ENST00000379983.2_Missense_Mutation_p.D1281G|UACA_ENST00000539319.1_Missense_Mutation_p.D1185G|UACA_ENST00000560441.1_Missense_Mutation_p.D1279G	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	1294					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.D1281G(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TAAGGACTTATCACATCGTTC	0.343																																																1	Substitution - Missense(1)	ovary(1)	15											181.0	155.0	164.0					15																	70959142		2199	4297	6496	68746196	SO:0001583	missense	55075			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.3881A>G	15.37:g.70959142T>C	ENSP00000314556:p.Asp1294Gly		68746196	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	CCDS10235.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	20.9	4.062390	0.76187	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000539319	T;T;T	0.36340	1.26;1.28;1.73	5.85	5.85	0.93711	.	0.085159	0.49916	D	0.000122	T	0.60856	0.2301	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.999	T	0.64063	-0.6495	10	0.72032	D	0.01	-26.0951	16.2303	0.82332	0.0:0.0:0.0:1.0	.	1185;1294;1294;1281	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	G	1294;1281;1185	ENSP00000314556:D1294G;ENSP00000369319:D1281G;ENSP00000438667:D1185G	ENSP00000314556:D1294G	D	-	2	0	UACA	68746196	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.404000	0.79996	2.233000	0.73108	0.533000	0.62120	GAT		0.343	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2			Missense_Mutation
XKR9	389668	genome.wustl.edu	37	8	71646497	71646497	+	Silent	SNP	T	T	C			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr8:71646497T>C	ENST00000408926.3	+	5	1494	c.960T>C	c.(958-960)ccT>ccC	p.P320P	XKR9_ENST00000520273.1_Intron|XKR9_ENST00000520030.1_Silent_p.P320P	NM_001011720.1	NP_001011720.1	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related family, member 9	320						integral component of membrane (GO:0016021)		p.P320P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)			ATTTTATACCTATCAGTATAA	0.343																																																1	Substitution - coding silent(1)	ovary(1)	8											73.0	73.0	73.0					8																	71646497		2203	4299	6502	71809051	SO:0001819	synonymous_variant	389668			AY534247	CCDS34905.1	8q13.3	2006-01-12	2006-01-12			ENSG00000221947			20937	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 9"""				Standard	NM_001287258		Approved		uc003xyq.3	Q5GH70		ENST00000408926.3:c.960T>C	8.37:g.71646497T>C			71809051	B2RNS9|B9EH74	Silent	SNP	ENST00000408926.3	37	CCDS34905.1	SNP	53	WashU																																																																																				0.343	XKR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378752.1	NM_001011720		Silent
MFSD11	79157	genome.wustl.edu	37	17	74774349	74774349	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr17:74774349G>T	ENST00000588460.1	+	13	3307	c.1265G>T	c.(1264-1266)gGg>gTg	p.G422V	MFSD11_ENST00000593181.1_Missense_Mutation_p.G370V|MFSD11_ENST00000586622.1_Missense_Mutation_p.G422V|MFSD11_ENST00000590514.1_Missense_Mutation_p.G422V|MFSD11_ENST00000590070.1_3'UTR|MFSD11_ENST00000355954.3_Missense_Mutation_p.G370V|MFSD11_ENST00000336509.4_Missense_Mutation_p.G422V	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	422						integral component of membrane (GO:0016021)		p.G422V(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						GTGATATTTGGGTTTTTTGGA	0.463																																																1	Substitution - Missense(1)	ovary(1)	17											185.0	170.0	175.0					17																	74774349		2203	4300	6503	72285944	SO:0001583	missense	79157			BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.1265G>T	17.37:g.74774349G>T	ENSP00000464932:p.Gly422Val		72285944	O43442|Q9NXI5	Missense_Mutation	SNP	ENST00000588460.1	37	CCDS11750.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328615	0.81690	.	.	ENSG00000092931	ENST00000336509;ENST00000355954	T;T	0.80304	-1.36;-1.36	6.07	6.07	0.98685	Major facilitator superfamily domain, general substrate transporter (1);	0.042696	0.85682	D	0.000000	D	0.86640	0.5981	L	0.45137	1.4	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.75484	0.986;0.959	T	0.82824	-0.0266	10	0.29301	T	0.29	-15.2757	20.2544	0.98414	0.0:0.0:1.0:0.0	.	370;422	O43934-2;O43934	.;MFS11_HUMAN	V	422;370	ENSP00000337240:G422V;ENSP00000348225:G370V	ENSP00000337240:G422V	G	+	2	0	MFSD11	72285944	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.744000	0.85034	2.885000	0.99019	0.655000	0.94253	GGG		0.463	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451516.1	NM_024311		Missense_Mutation
CYP11A1	1583	genome.wustl.edu	37	15	74631650	74631650	+	Missense_Mutation	SNP	G	G	T	rs537187397	byFrequency	TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr15:74631650G>T	ENST00000268053.6	-	7	1318	c.1164C>A	c.(1162-1164)caC>caA	p.H388Q	CYP11A1_ENST00000358632.4_Missense_Mutation_p.H230Q|CYP11A1_ENST00000419019.2_Missense_Mutation_p.H230Q	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	388					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.H388Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	CGGAGATGGGGTGAAGTCTGC	0.587																																					Esophageal Squamous(87;818 1337 4093 9268 37314)											1	Substitution - Missense(1)	ovary(1)	15											60.0	63.0	62.0					15																	74631650		2197	4297	6494	72418703	SO:0001583	missense	1583			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.1164C>A	15.37:g.74631650G>T	ENSP00000268053:p.His388Gln		72418703	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Missense_Mutation	SNP	ENST00000268053.6	37	CCDS32291.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	18.75	3.691592	0.68271	.	.	ENSG00000140459	ENST00000268053;ENST00000358632;ENST00000419019;ENST00000452422	T;T;T	0.70516	-0.49;-0.49;-0.49	5.03	3.13	0.36017	.	0.000000	0.85682	D	0.000000	T	0.79488	0.4454	L	0.58969	1.84	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80248	-0.1461	10	0.66056	D	0.02	-22.1762	11.296	0.49277	0.1543:0.0:0.8457:0.0	.	388	P05108	CP11A_HUMAN	Q	388;230;230;153	ENSP00000268053:H388Q;ENSP00000351455:H230Q;ENSP00000405488:H230Q	ENSP00000268053:H388Q	H	-	3	2	CYP11A1	72418703	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	1.330000	0.33781	1.104000	0.41587	0.549000	0.68633	CAC		0.587	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319737.1			Missense_Mutation
SEC14L1	6397	genome.wustl.edu	37	17	75205535	75205535	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr17:75205535G>A	ENST00000413679.2	+	14	1891	c.1588G>A	c.(1588-1590)Gtc>Atc	p.V530I	SEC14L1_ENST00000392476.2_Missense_Mutation_p.V530I|SEC14L1_ENST00000436233.4_Missense_Mutation_p.V530I|SEC14L1_ENST00000443798.4_Missense_Mutation_p.V530I|SEC14L1_ENST00000585618.1_Missense_Mutation_p.V530I|SEC14L1_ENST00000591437.1_Missense_Mutation_p.V496I|SEC14L1_ENST00000431431.2_Missense_Mutation_p.V496I|SEC14L1_ENST00000430767.4_Missense_Mutation_p.V530I	NM_001143998.1|NM_001143999.1|NM_003003.3	NP_001137470|NP_001137471|NP_002994	Q92503	S14L1_HUMAN	SEC14-like 1 (S. cerevisiae)	530	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.V530I(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(2)	31						GTCTGCAAGCGTCTTCAAAGG	0.622																																																1	Substitution - Missense(1)	ovary(1)	17											79.0	66.0	70.0					17																	75205535		2203	4300	6503	72717130	SO:0001583	missense	6397			D67029	CCDS11752.1, CCDS42385.1, CCDS45789.1	17q25.2	2008-02-01	2001-11-28			ENSG00000129657			10698	protein-coding gene	gene with protein product		601504	"""SEC14 (S. cerevisiae)-like 1"""	SEC14L		8697811	Standard	NM_001143998		Approved	PRELID4A	uc002jto.3	Q92503		ENST00000413679.2:c.1588G>A	17.37:g.75205535G>A	ENSP00000394716:p.Val530Ile		72717130	A8K4E8|B4DDI5|D5G3K1|Q99780	Missense_Mutation	SNP	ENST00000413679.2	37	CCDS11752.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	11.91	1.780767	0.31502	.	.	ENSG00000129657	ENST00000392476;ENST00000443798;ENST00000436233;ENST00000430767;ENST00000413679;ENST00000431431	T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75	5.48	5.48	0.80851	Cellular retinaldehyde-binding/triple function, C-terminal (1);GOLD (2);	0.114663	0.64402	D	0.000012	T	0.37046	0.0989	N	0.24115	0.695	0.49915	D	0.999838	B;B	0.20671	0.047;0.028	B;B	0.15484	0.013;0.008	T	0.09015	-1.0694	10	0.31617	T	0.26	-47.5095	18.3308	0.90268	0.0:0.0:1.0:0.0	.	530;530	Q92503-2;Q92503	.;S14L1_HUMAN	I	530;530;530;530;530;496	ENSP00000376268:V530I;ENSP00000406030:V530I;ENSP00000390392:V530I;ENSP00000408169:V530I;ENSP00000394716:V530I;ENSP00000389838:V496I	ENSP00000376268:V530I	V	+	1	0	SEC14L1	72717130	1.000000	0.71417	0.860000	0.33809	0.348000	0.29142	5.928000	0.70088	2.553000	0.86117	0.655000	0.94253	GTC		0.622	SEC14L1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000436240.1	NM_003003		Missense_Mutation
MPI	4351	genome.wustl.edu	37	15	75188616	75188616	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr15:75188616G>T	ENST00000352410.4	+	6	861	c.794G>T	c.(793-795)gGg>gTg	p.G265V	MPI_ENST00000566377.1_Missense_Mutation_p.G265V|MPI_ENST00000535694.1_Missense_Mutation_p.G215V|MPI_ENST00000562606.1_Missense_Mutation_p.G245V|MPI_ENST00000564003.1_Missense_Mutation_p.G154V|MPI_ENST00000563422.1_Missense_Mutation_p.G265V|MPI_ENST00000323744.6_Missense_Mutation_p.G204V|MPI_ENST00000563786.1_Missense_Mutation_p.G245V			P34949	MPI_HUMAN	mannose phosphate isomerase	265					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	mannose-6-phosphate isomerase activity (GO:0004476)|zinc ion binding (GO:0008270)	p.G265V(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						CTGAAGCCTGGGGAGGCCATG	0.572																																																1	Substitution - Missense(1)	ovary(1)	15											91.0	81.0	84.0					15																	75188616		2197	4295	6492	72975669	SO:0001583	missense	4351				CCDS10272.1, CCDS73756.1, CCDS73757.1, CCDS73758.1	15q24.1	2013-09-19			ENSG00000178802	ENSG00000178802	5.3.1.8		7216	protein-coding gene	gene with protein product	"""mannose-6-phosphate isomerase"""	154550					Standard	NM_002435		Approved		uc002azc.1	P34949	OTTHUMG00000142826	ENST00000352410.4:c.794G>T	15.37:g.75188616G>T	ENSP00000318318:p.Gly265Val		72975669	A8K8K9|Q96AB0	Missense_Mutation	SNP	ENST00000352410.4	37	CCDS10272.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943674	0.92593	.	.	ENSG00000178802	ENST00000352410;ENST00000535694;ENST00000379693;ENST00000323744	D;D;D	0.99287	-5.69;-5.69;-5.69	5.43	5.43	0.79202	Cupin, RmlC-type (1);RmlC-like jelly roll fold (1);	0.000000	0.85682	D	0.000000	D	0.99725	0.9893	H	0.98786	4.33	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.999;0.999	D	0.97120	0.9810	10	0.87932	D	0	.	18.2874	0.90119	0.0:0.0:1.0:0.0	.	154;265;204;245;265	B4DYB8;B4DFC4;P34949-2;Q8NHZ6;P34949	.;.;.;.;MPI_HUMAN	V	265;215;245;204	ENSP00000318318:G265V;ENSP00000440447:G215V;ENSP00000318192:G204V	ENSP00000318192:G204V	G	+	2	0	MPI	72975669	1.000000	0.71417	0.850000	0.33497	0.994000	0.84299	9.202000	0.95026	2.566000	0.86566	0.555000	0.69702	GGG		0.572	MPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286418.4			Missense_Mutation
KLF12	11278	genome.wustl.edu	37	13	74289529	74289529	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr13:74289529T>C	ENST00000377669.2	-	6	1029	c.1003A>G	c.(1003-1005)Aag>Gag	p.K335E	KLF12_ENST00000377666.4_Missense_Mutation_p.K335E	NM_007249.4	NP_009180.3	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	335					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.K335E(1)		central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		CGGTGAGCCTTCAGGTGAGAA	0.537																																																1	Substitution - Missense(1)	ovary(1)	13											172.0	141.0	151.0					13																	74289529		2203	4300	6503	73187530	SO:0001583	missense	11278			AJ243274	CCDS9449.1	13q22	2013-01-08			ENSG00000118922	ENSG00000118922		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6346	protein-coding gene	gene with protein product	"""KLF12 zinc finger transcriptional repressor"", ""AP-2rep transcription factor"", ""AP-2 repressor"""	607531				10704285	Standard	NM_007249		Approved	AP-2rep, HSPC122, AP2REP	uc001vjf.3	Q9Y4X4	OTTHUMG00000017078	ENST00000377669.2:c.1003A>G	13.37:g.74289529T>C	ENSP00000366897:p.Lys335Glu		73187530	A8K5T2|L0R3J4|Q5VZM7|Q9UHZ0	Missense_Mutation	SNP	ENST00000377669.2	37	CCDS9449.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	29.6	5.016432	0.93404	.	.	ENSG00000118922	ENST00000377669;ENST00000342812;ENST00000377666	T;T	0.39592	1.07;1.07	5.81	5.81	0.92471	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.59115	0.2170	L	0.58101	1.795	0.80722	D	1	D	0.69078	0.997	D	0.63283	0.913	T	0.62229	-0.6898	10	0.87932	D	0	.	15.3448	0.74327	0.0:0.0:0.0:1.0	.	335	Q9Y4X4	KLF12_HUMAN	E	335	ENSP00000366897:K335E;ENSP00000366894:K335E	ENSP00000344057:K335E	K	-	1	0	KLF12	73187530	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.978000	0.88095	2.216000	0.71823	0.533000	0.62120	AAG		0.537	KLF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045271.2	NM_007249		Missense_Mutation
GTF2IRD2	84163	genome.wustl.edu	37	7	74211464	74211464	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr7:74211464G>C	ENST00000405086.2	-	16	2576	c.2387C>G	c.(2386-2388)aCt>aGt	p.T796S	GTF2IRD2_ENST00000451013.2_Missense_Mutation_p.T343S	NM_173537.2	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	796					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T796S(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	11						cgtcaaatgagtctcccagag	0.498																																					NSCLC(40;560 1096 7501 40315 49546)											1	Substitution - Missense(1)	ovary(1)	7											56.0	60.0	58.0					7																	74211464		2193	4286	6479	73849400	SO:0001583	missense	84163			BC047706	CCDS5576.1, CCDS64682.1	7q11.23	2014-05-06			ENSG00000196275	ENSG00000196275			30775	protein-coding gene	gene with protein product	"""transcription factor GTF2IRD2"""	608899				15243160	Standard	NM_173537		Approved	FLJ37938, GTF2IRD2A	uc003ubd.1	Q86UP8	OTTHUMG00000181527	ENST00000405086.2:c.2387C>G	7.37:g.74211464G>C	ENSP00000385491:p.Thr796Ser		73849400	A8K5W6|B3KUZ2|Q69G40|Q6EKI8|Q6EKI9|Q6NVW2|Q6P7N8|Q86WX4|Q8ND85|Q8NDE5	Missense_Mutation	SNP	ENST00000405086.2	37	CCDS5576.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	g	10.38	1.334383	0.24253	.	.	ENSG00000196275	ENST00000405086;ENST00000451013	T;T	0.44881	0.91;0.91	1.74	1.74	0.24563	Ribonuclease H-like (1);	.	.	.	.	T	0.31167	0.0788	N	0.04018	-0.295	0.58432	D	0.999999	D	0.63880	0.993	D	0.65443	0.935	T	0.06463	-1.0825	9	0.13108	T	0.6	-11.6005	7.1297	0.25493	0.0:0.0:1.0:0.0	.	796	Q86UP8	GTD2A_HUMAN	S	796;343	ENSP00000385491:T796S;ENSP00000406723:T343S	ENSP00000385491:T796S	T	-	2	0	GTF2IRD2	73849400	0.961000	0.32948	0.711000	0.30485	0.898000	0.52572	2.258000	0.43249	1.317000	0.45149	0.442000	0.29010	ACT		0.498	GTF2IRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252712.3	NM_173537		Missense_Mutation
SLC4A5	57835	genome.wustl.edu	37	2	74491340	74491340	+	Missense_Mutation	SNP	G	G	A	rs374602113		TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:74491340G>A	ENST00000377634.4	-	10	1048	c.649C>T	c.(649-651)Cgc>Tgc	p.R217C	SLC4A5_ENST00000358683.4_Missense_Mutation_p.R153C|SLC4A5_ENST00000346834.4_Missense_Mutation_p.R217C|SLC4A5_ENST00000357822.5_Missense_Mutation_p.R217C|SLC4A5_ENST00000359484.4_Missense_Mutation_p.R153C|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Missense_Mutation_p.R217C|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000423644.1_Missense_Mutation_p.R217C|SLC4A5_ENST00000394019.2_Missense_Mutation_p.R217C					solute carrier family 4 (sodium bicarbonate cotransporter), member 5									p.R217C(3)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						GTTTGGTGGCGGTGCCTCCTC	0.557																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	2						G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	189.0	160.0	169.0		649,649	4.8	1.0	2		169	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SLC4A5	NM_021196.3,NM_133478.2	180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	217/1138,217/1122	74491340	1,13005	2203	4300	6503	74344848	SO:0001583	missense	57835			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.649C>T	2.37:g.74491340G>A	ENSP00000366861:p.Arg217Cys		74344848		Missense_Mutation	SNP	ENST00000377634.4	37	CCDS1936.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105952	0.77096	0.0	1.16E-4	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000423644;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634;ENST00000425249;ENST00000432728	T;T;T;T;T;T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46;-0.46;-0.46;-0.46;-0.46;-0.46	4.83	4.83	0.62350	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	T	0.81654	0.4868	M	0.85945	2.785	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.988;1.0;1.0;1.0;0.996	B;D;D;D;P	0.97110	0.445;0.999;1.0;1.0;0.81	D	0.83423	0.0034	10	0.66056	D	0.02	.	10.7977	0.46470	0.0:0.0:0.8111:0.1889	.	217;217;153;217;217	Q9BY07-4;E7EQT3;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;.;S4A5_HUMAN;.	C	217;217;217;153;217;153;217;217;217;217;101	ENSP00000377587:R217C;ENSP00000251768:R217C;ENSP00000352461:R153C;ENSP00000395804:R217C;ENSP00000351513:R153C;ENSP00000350475:R217C;ENSP00000366859:R217C;ENSP00000366861:R217C;ENSP00000405678:R217C;ENSP00000414162:R101C	ENSP00000251768:R217C	R	-	1	0	SLC4A5	74344848	1.000000	0.71417	0.999000	0.59377	0.879000	0.50718	6.292000	0.72725	2.648000	0.89879	0.655000	0.94253	CGC		0.557	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3			Missense_Mutation
MYCBP2	23077	genome.wustl.edu	37	13	77629819	77629819	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr13:77629819C>G	ENST00000544440.2	-	80	13424	c.13407G>C	c.(13405-13407)atG>atC	p.M4469I	MYCBP2_ENST00000407578.2_Missense_Mutation_p.M4507I|MYCBP2_ENST00000357337.6_Missense_Mutation_p.M4469I					MYC binding protein 2, E3 ubiquitin protein ligase									p.M4469I(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		ATTCCAATCTCATTAAGGCTT	0.348																																																1	Substitution - Missense(1)	ovary(1)	13											122.0	93.0	103.0					13																	77629819		2203	4300	6503	76527820	SO:0001583	missense	23077			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.13407G>C	13.37:g.77629819C>G	ENSP00000444596:p.Met4469Ile		76527820		Missense_Mutation	SNP	ENST00000544440.2	37		SNP	29	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.31|18.31	3.596094|3.596094	0.66332|0.66332	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000429715|ENST00000357337;ENST00000407578;ENST00000544440	.|T;T;T	.|0.31510	.|1.49;1.49;1.49	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.48003|0.48003	0.1476|0.1476	M|M	0.76002|0.76002	2.32|2.32	0.80722|0.80722	D|D	1|1	.|P	.|0.35872	.|0.525	.|P	.|0.45428	.|0.48	T|T	0.52253|0.52253	-0.8600|-0.8600	5|10	.|0.87932	.|D	.|0	.|.	18.7211|18.7211	0.91694|0.91694	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|4469	.|O75592	.|MYCB2_HUMAN	Q|I	890|4469;4507;4469	.|ENSP00000349892:M4469I;ENSP00000384288:M4507I;ENSP00000444596:M4469I	.|ENSP00000349892:M4469I	E|M	-|-	1|3	0|0	MYCBP2|MYCBP2	76527820|76527820	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.314000|7.314000	0.78988|0.78988	2.637000|2.637000	0.89404|0.89404	0.655000|0.655000	0.94253|0.94253	GAG|ATG		0.348	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		Missense_Mutation
NAV3	89795	genome.wustl.edu	37	12	78582112	78582112	+	Missense_Mutation	SNP	C	C	T	rs573838509		TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr12:78582112C>T	ENST00000397909.2	+	32	6048	c.5875C>T	c.(5875-5877)Cgt>Tgt	p.R1959C	NAV3_ENST00000536525.2_Missense_Mutation_p.R1937C|NAV3_ENST00000552300.1_3'UTR|NAV3_ENST00000228327.6_Missense_Mutation_p.R1937C|NAV3_ENST00000266692.7_Missense_Mutation_p.R1760C			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1959						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.R1937C(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TGTAATAAGACGTCTCTTTAA	0.343										HNSCC(70;0.22)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		17994	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	12											113.0	109.0	111.0					12																	78582112		1852	4089	5941	77106243	SO:0001583	missense	89795			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.5875C>T	12.37:g.78582112C>T	ENSP00000381007:p.Arg1959Cys		77106243	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		SNP	19	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.7|24.7	4.555528|4.555528	0.86231|0.86231	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	T;T;T;T;T|.	0.32753|.	1.51;1.49;1.5;1.44;2.34|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	0.000000|.	0.41097|.	U|.	0.000944|.	T|T	0.75199|0.75199	0.3817|0.3817	M|M	0.74881|0.74881	2.28|2.28	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.87578|.	0.985;0.996;0.951;0.998|.	T|T	0.74621|0.74621	-0.3604|-0.3604	10|5	0.87932|.	D|.	0|.	-4.2121|-4.2121	15.5263|15.5263	0.75910|0.75910	0.1387:0.8613:0.0:0.0|0.1387:0.8613:0.0:0.0	.|.	1937;1760;1959;1937|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	C|M	1937;1959;1937;1760;551;559|831	ENSP00000446132:R1937C;ENSP00000381007:R1959C;ENSP00000228327:R1937C;ENSP00000266692:R1760C;ENSP00000448303:R559C|.	ENSP00000228327:R1937C|.	R|T	+|+	1|2	0|0	NAV3|NAV3	77106243|77106243	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	5.931000|5.931000	0.70113|0.70113	2.722000|2.722000	0.93159|0.93159	0.591000|0.591000	0.81541|0.81541	CGT|ACG		0.343	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		Missense_Mutation
LPAR4	2846	genome.wustl.edu	37	X	78011285	78011285	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chrX:78011285G>C	ENST00000435339.3	+	2	1305	c.919G>C	c.(919-921)Gac>Cac	p.D307H		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	307					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)	p.D307N(1)|p.D307Y(1)|p.D307H(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						CTGTTGTTTTGACCCTTTCAT	0.418																																																3	Substitution - Missense(3)	ovary(2)|breast(1)	X											197.0	159.0	172.0					X																	78011285		2203	4300	6503	77897941	SO:0001583	missense	2846			U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.919G>C	X.37:g.78011285G>C	ENSP00000408205:p.Asp307His		77897941	B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	ENST00000435339.3	37	CCDS14441.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177791	0.57692	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.74106	-0.81;-0.81	3.99	3.99	0.46301	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	U	0.000000	D	0.88224	0.6379	M	0.91406	3.205	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.91010	0.4849	10	0.87932	D	0	.	13.9688	0.64225	0.0:0.0:1.0:0.0	.	307	Q99677	LPAR4_HUMAN	H	307	ENSP00000408205:D307H;ENSP00000362398:D307H	ENSP00000362398:D307H	D	+	1	0	LPAR4	77897941	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.112000	0.94314	1.832000	0.53329	0.422000	0.28245	GAC		0.418	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296		Missense_Mutation
USP33	23032	genome.wustl.edu	37	1	78180334	78180334	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr1:78180334G>C	ENST00000370793.1	-	20	2619	c.2273C>G	c.(2272-2274)cCt>cGt	p.P758R	USP33_ENST00000357428.1_Missense_Mutation_p.P758R|USP33_ENST00000370792.3_Missense_Mutation_p.P750R|USP33_ENST00000370794.3_Missense_Mutation_p.P727R	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	758	DUSP 1. {ECO:0000255|PROSITE- ProRule:PRU00613}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.P758R(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						ATTTGAAATAGGGCCAGGTTC	0.348																																					Melanoma(152;72 1870 11110 26780 42647)											1	Substitution - Missense(1)	ovary(1)	1											94.0	95.0	95.0					1																	78180334		2203	4300	6503	77952922	SO:0001583	missense	23032			AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.2273C>G	1.37:g.78180334G>C	ENSP00000359829:p.Pro758Arg		77952922	Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Missense_Mutation	SNP	ENST00000370793.1	37	CCDS678.1	SNP	35	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.5|24.5	4.535970|4.535970	0.85812|0.85812	.|.	.|.	ENSG00000077254|ENSG00000077254	ENST00000481579|ENST00000370794;ENST00000370793;ENST00000357428;ENST00000370792	.|T;T;T;T	.|0.12569	.|2.69;2.67;2.67;2.71	5.21|5.21	5.21|5.21	0.72293|0.72293	.|Peptidase C19, ubiquitin-specific peptidase, DUSP domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.38719|0.38719	0.1051|0.1051	M|M	0.86740|0.86740	2.835|2.835	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;0.999;0.997;1.0	T|T	0.45041|0.45041	-0.9288|-0.9288	5|10	.|0.87932	.|D	.|0	.|.	19.1552|19.1552	0.93507|0.93507	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|750;727;758;92	.|Q8TEY7-3;Q8TEY7-2;Q8TEY7;Q9Y417	.|.;.;UBP33_HUMAN;.	V|R	363|727;758;758;750	.|ENSP00000359830:P727R;ENSP00000359829:P758R;ENSP00000350009:P758R;ENSP00000359828:P750R	.|ENSP00000350009:P758R	L|P	-|-	1|2	2|0	USP33|USP33	77952922|77952922	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.461000|9.461000	0.97646|0.97646	2.586000|2.586000	0.87340|0.87340	0.655000|0.655000	0.94253|0.94253	CTA|CCT		0.348	USP33-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026923.2	NM_015017		Missense_Mutation
POU4F1	5457	genome.wustl.edu	37	13	79175768	79175768	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	G	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr13:79175768C>G	ENST00000377208.5	-	2	1253	c.1042G>C	c.(1042-1044)Gag>Cag	p.E348Q	RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000606124.1_RNA|RNF219-AS1_ENST00000560209.2_RNA|RP11-52L5.6_ENST00000607269.1_RNA|RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000607205.1_RNA|RNF219-AS1_ENST00000607220.1_RNA|RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000606376.1_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	348					axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)	p.E348Q(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		TTGAAGAGCTCAGGCTTGTTC	0.662																																					Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)											1	Substitution - Missense(1)	ovary(1)	13											30.0	32.0	31.0					13																	79175768		2203	4300	6503	78073769	SO:0001583	missense	5457			X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.1042G>C	13.37:g.79175768C>G	ENSP00000366413:p.Glu348Gln		78073769	Q14986|Q15318|Q5T227	Missense_Mutation	SNP	ENST00000377208.5	37	CCDS31996.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552654	0.65425	.	.	ENSG00000152192	ENST00000377208	D	0.85171	-1.95	4.14	4.14	0.48551	Homeodomain-related (1);Homeodomain-like (1);	0.180276	0.47852	D	0.000220	D	0.84506	0.5487	L	0.50847	1.595	0.49798	D	0.999821	P	0.45044	0.849	P	0.45377	0.478	D	0.86933	0.2074	10	0.62326	D	0.03	.	16.4369	0.83878	0.0:1.0:0.0:0.0	.	348	Q01851	PO4F1_HUMAN	Q	348	ENSP00000366413:E348Q	ENSP00000366413:E348Q	E	-	1	0	POU4F1	78073769	1.000000	0.71417	0.976000	0.42696	0.977000	0.68977	7.621000	0.83083	2.046000	0.60703	0.499000	0.49734	GAG		0.662	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045360.3			Missense_Mutation
BHMT	635	genome.wustl.edu	37	5	78423785	78423785	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr5:78423785C>G	ENST00000274353.5	+	7	1123	c.1016C>G	c.(1015-1017)aCc>aGc	p.T339S	BHMT_ENST00000524080.1_Missense_Mutation_p.T186S|DMGDH_ENST00000520388.1_Intron	NM_001713.2	NP_001704.2	Q93088	BHMT1_HUMAN	betaine--homocysteine S-methyltransferase	339					amino-acid betaine catabolic process (GO:0006579)|amino-acid betaine metabolic process (GO:0006577)|cellular nitrogen compound metabolic process (GO:0034641)|L-methionine salvage (GO:0071267)|protein methylation (GO:0006479)|regulation of homocysteine metabolic process (GO:0050666)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	betaine-homocysteine S-methyltransferase activity (GO:0047150)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)	p.T339S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)	29		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	GACATGCACACCAAACCCTGG	0.458																																																1	Substitution - Missense(1)	ovary(1)	5											32.0	33.0	33.0					5																	78423785		2203	4300	6503	78459541	SO:0001583	missense	635			BC012616	CCDS4046.1	5q14.1	2012-09-20	2010-04-28		ENSG00000145692	ENSG00000145692	2.1.1.5		1047	protein-coding gene	gene with protein product	"""betaine homocysteine methyltransferase"""	602888				8798461, 9281325	Standard	NM_001713		Approved	BHMT1	uc003kfu.4	Q93088	OTTHUMG00000108157	ENST00000274353.5:c.1016C>G	5.37:g.78423785C>G	ENSP00000274353:p.Thr339Ser		78459541	Q9UNI9	Missense_Mutation	SNP	ENST00000274353.5	37	CCDS4046.1	SNP	18	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.53|18.53	3.643092|3.643092	0.67244|0.67244	.|.	.|.	ENSG00000145692|ENSG00000145692	ENST00000436224|ENST00000274353;ENST00000524080	.|T;T	.|0.30182	.|1.54;1.54	5.25|5.25	5.25|5.25	0.73442|0.73442	.|Homocysteine S-methyltransferase (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.49949|0.49949	0.1587|0.1587	M|M	0.84433|0.84433	2.695|2.695	0.80722|0.80722	D|D	1|1	.|P;B	.|0.38642	.|0.641;0.005	.|P;B	.|0.45712	.|0.491;0.015	T|T	0.50242|0.50242	-0.8851|-0.8851	6|10	0.87932|0.33141	D|T	0|0.24	-22.1978|-22.1978	19.2188|19.2188	0.93788|0.93788	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|186;339	.|E5RJH0;Q93088	.|.;BHMT1_HUMAN	A|S	186|339;186	.|ENSP00000274353:T339S;ENSP00000428240:T186S	ENSP00000405681:P186A|ENSP00000274353:T339S	P|T	+|+	1|2	0|0	BHMT|BHMT	78459541|78459541	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.610000|7.610000	0.82949|0.82949	2.607000|2.607000	0.88179|0.88179	0.650000|0.650000	0.86243|0.86243	CCA|ACC		0.458	BHMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226961.1	NM_001713		Missense_Mutation
MBTPS1	8720	genome.wustl.edu	37	16	84127339	84127339	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr16:84127339G>T	ENST00000343411.3	-	5	1208	c.713C>A	c.(712-714)aCc>aAc	p.T238N	MBTPS1_ENST00000569770.1_5'Flank	NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	238	Peptidase S8.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.T238N(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TCGCTCGTTGGTCCAGTTGGT	0.488																																																1	Substitution - Missense(1)	ovary(1)	16											174.0	130.0	145.0					16																	84127339		2200	4300	6500	82684840	SO:0001583	missense	8720			D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.713C>A	16.37:g.84127339G>T	ENSP00000344223:p.Thr238Asn		82684840	A8K6V8|Q24JQ2|Q9UF67	Missense_Mutation	SNP	ENST00000343411.3	37	CCDS10941.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	35	5.469790	0.96274	.	.	ENSG00000140943	ENST00000343411	T	0.43688	0.94	5.44	5.44	0.79542	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	T	0.61689	0.2367	M	0.66378	2.025	0.80722	D	1	P	0.49862	0.929	P	0.58391	0.838	T	0.63937	-0.6524	10	0.72032	D	0.01	-30.9746	19.2669	0.93990	0.0:0.0:1.0:0.0	.	238	Q14703	MBTP1_HUMAN	N	238	ENSP00000344223:T238N	ENSP00000344223:T238N	T	-	2	0	MBTPS1	82684840	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.605000	0.98321	2.549000	0.85964	0.655000	0.94253	ACC		0.488	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791		Missense_Mutation
AKAP13	11214	genome.wustl.edu	37	15	86228052	86228052	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr15:86228052G>T	ENST00000394518.2	+	16	5332	c.5237G>T	c.(5236-5238)aGt>aTt	p.S1746I	AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000394510.2_5'UTR|AKAP13_ENST00000361243.2_Missense_Mutation_p.S1750I	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1746					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.S1750I(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						ACAAAAGTCAGTCGTACATTC	0.393																																					Melanoma(94;603 1453 3280 32295 32951)											1	Substitution - Missense(1)	ovary(1)	15											132.0	120.0	124.0					15																	86228052		2202	4299	6501	84029056	SO:0001583	missense	11214			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.5237G>T	15.37:g.86228052G>T	ENSP00000378026:p.Ser1746Ile		84029056	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	27.4	4.830294	0.91036	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000452008	T;T	0.13901	2.55;2.6	5.88	5.88	0.94601	.	.	.	.	.	T	0.39036	0.1063	M	0.68317	2.08	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.997;0.994;0.997	T	0.04242	-1.0966	9	0.87932	D	0	.	18.8019	0.92022	0.0:0.0:1.0:0.0	.	1728;1746;1750	Q12802-4;Q12802;Q12802-2	.;AKP13_HUMAN;.	I	1750;1746;1749;1727;368	ENSP00000354718:S1750I;ENSP00000378026:S1746I	ENSP00000354718:S1750I	S	+	2	0	AKAP13	84029056	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	7.686000	0.84128	2.779000	0.95612	0.650000	0.86243	AGT		0.393	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200		Missense_Mutation
SPP1	6696	genome.wustl.edu	37	4	88903788	88903788	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr4:88903788C>A	ENST00000395080.3	+	7	812	c.685C>A	c.(685-687)Cag>Aag	p.Q229K	SPP1_ENST00000360804.4_Missense_Mutation_p.Q202K|SPP1_ENST00000509659.1_3'UTR|SPP1_ENST00000237623.7_Missense_Mutation_p.Q215K	NM_001040058.1|NM_001251830.1	NP_001035147.1|NP_001238759.1	P10451	OSTP_HUMAN	secreted phosphoprotein 1	229					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|negative regulation of collateral sprouting of intact axon in response to injury (GO:0048685)|neutrophil chemotaxis (GO:0030593)|osteoblast differentiation (GO:0001649)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell-substrate adhesion (GO:0010811)|response to steroid hormone (GO:0048545)|response to vitamin D (GO:0033280)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix binding (GO:0050840)	p.Q229K(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(1)	13		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-05)		TGAAACGAGTCAGCTGGATGA	0.517																																																1	Substitution - Missense(1)	ovary(1)	4											152.0	139.0	143.0					4																	88903788		2203	4300	6503	89122812	SO:0001583	missense	6696				CCDS3626.1, CCDS34027.1, CCDS43250.1	4q22.1	2014-01-30	2008-07-31		ENSG00000118785	ENSG00000118785		"""Endogenous ligands"""	11255	protein-coding gene	gene with protein product	"""early T-lymphocyte activation 1"""	166490	"""osteopontin"", ""bone sialoprotein I"""	BNSP, OPN		1575754	Standard	NM_001251829		Approved	BSPI, ETA-1	uc003hra.3	P10451	OTTHUMG00000130599	ENST00000395080.3:c.685C>A	4.37:g.88903788C>A	ENSP00000378517:p.Gln229Lys		89122812	B2RDA1|Q15681|Q15682|Q15683|Q4W597|Q567T5|Q8NBK2|Q96IZ1	Missense_Mutation	SNP	ENST00000395080.3	37	CCDS43250.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	16.76	3.212074	0.58452	.	.	ENSG00000118785	ENST00000359072;ENST00000535912;ENST00000237623;ENST00000395080;ENST00000360804;ENST00000508233	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.13	4.27	0.50696	.	0.467756	0.20009	N	0.101164	T	0.59307	0.2184	L	0.61218	1.895	0.18873	N	0.999989	B;D;B;D;B	0.69078	0.375;0.985;0.229;0.997;0.057	B;D;B;D;B	0.76071	0.127;0.981;0.072;0.987;0.032	T	0.51718	-0.8670	10	0.66056	D	0.02	-5.5096	11.1777	0.48610	0.1839:0.8161:0.0:0.0	.	242;188;215;202;229	B7Z351;Q3LGB0;B2RDA1;Q567T5;P10451	.;.;.;.;OSTP_HUMAN	K	207;188;215;229;202;188	ENSP00000237623:Q215K;ENSP00000378517:Q229K;ENSP00000354042:Q202K;ENSP00000422973:Q188K	ENSP00000237623:Q215K	Q	+	1	0	SPP1	89122812	1.000000	0.71417	0.032000	0.17829	0.079000	0.17450	1.955000	0.40372	1.245000	0.43885	0.579000	0.79373	CAG		0.517	SPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253048.3			Missense_Mutation
GPR98	84059	genome.wustl.edu	37	5	89989844	89989844	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr5:89989844G>A	ENST00000405460.2	+	33	7367	c.7271G>A	c.(7270-7272)aGa>aAa	p.R2424K		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2424					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.R2424K(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CCACTTTGGAGAACTTGGATG	0.483																																																1	Substitution - Missense(1)	ovary(1)	5											80.0	78.0	78.0					5																	89989844		1909	4116	6025	90025600	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.7271G>A	5.37:g.89989844G>A	ENSP00000384582:p.Arg2424Lys		90025600	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	5.447	0.267493	0.10294	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.25749	1.78	5.92	5.92	0.95590	.	0.251771	0.44285	D	0.000467	T	0.17450	0.0419	L	0.38838	1.175	0.58432	D	0.999999	B;B	0.30605	0.287;0.156	B;B	0.28709	0.093;0.067	T	0.09618	-1.0666	10	0.31617	T	0.26	.	5.6778	0.17759	0.1467:0.0:0.6822:0.1711	.	2424;2424	E7ETI5;Q8WXG9	.;GPR98_HUMAN	K	2424	ENSP00000384582:R2424K	ENSP00000296619:R2424K	R	+	2	0	GPR98	90025600	1.000000	0.71417	0.983000	0.44433	0.010000	0.07245	2.212000	0.42835	2.795000	0.96236	0.655000	0.94253	AGA		0.483	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		Missense_Mutation
ZNF326	284695	genome.wustl.edu	37	1	90482997	90482997	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr1:90482997G>T	ENST00000340281.4	+	8	1191	c.1048G>T	c.(1048-1050)Gat>Tat	p.D350Y	ZNF326_ENST00000370447.3_Missense_Mutation_p.D261Y|ZNF326_ENST00000455342.2_Missense_Mutation_p.D144Y	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	350					mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)	p.D350Y(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		AACTAAATTTGATAAAGTAGT	0.299																																																1	Substitution - Missense(1)	ovary(1)	1											64.0	65.0	65.0					1																	90482997		2200	4288	6488	90255585	SO:0001583	missense	284695			BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.1048G>T	1.37:g.90482997G>T	ENSP00000340796:p.Asp350Tyr		90255585	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Missense_Mutation	SNP	ENST00000340281.4	37	CCDS727.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827649	0.71143	.	.	ENSG00000162664	ENST00000394590;ENST00000340281;ENST00000370447;ENST00000455342	T;T;T	0.49720	0.77;0.77;0.77	5.48	4.56	0.56223	.	0.053403	0.64402	D	0.000001	T	0.55529	0.1926	L	0.54323	1.7	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.977	T	0.57596	-0.7784	10	0.62326	D	0.03	-17.2863	14.5819	0.68298	0.0719:0.0:0.9281:0.0	.	350;350	A8MYX1;Q5BKZ1	.;ZN326_HUMAN	Y	350;350;261;144	ENSP00000340796:D350Y;ENSP00000359476:D261Y;ENSP00000403470:D144Y	ENSP00000340796:D350Y	D	+	1	0	ZNF326	90255585	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.033000	0.70925	2.578000	0.87016	0.650000	0.86243	GAT		0.299	ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781		Missense_Mutation
CCDC88C	440193	genome.wustl.edu	37	14	91779753	91779753	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr14:91779753G>C	ENST00000389857.6	-	15	2493	c.2407C>G	c.(2407-2409)Ctg>Gtg	p.L803V		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	803					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)	p.L803V(1)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				AGGGCCTCCAGGTCCCGCCGC	0.672																																																1	Substitution - Missense(1)	ovary(1)	14											13.0	15.0	14.0					14																	91779753		2060	4196	6256	90849506	SO:0001583	missense	440193				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2407C>G	14.37:g.91779753G>C	ENSP00000374507:p.Leu803Val		90849506	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	CCDS45151.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004063	0.35320	.	.	ENSG00000015133	ENST00000389857	T	0.18960	2.18	5.03	4.13	0.48395	.	0.189754	0.25324	U	0.031495	T	0.23370	0.0565	M	0.68317	2.08	0.80722	D	1	P	0.40515	0.719	B	0.41135	0.348	T	0.01670	-1.1299	10	0.42905	T	0.14	-12.8865	7.7863	0.29093	0.2371:0.0:0.7629:0.0	.	803	Q9P219	DAPLE_HUMAN	V	803	ENSP00000374507:L803V	ENSP00000374507:L803V	L	-	1	2	CCDC88C	90849506	0.737000	0.28175	1.000000	0.80357	0.987000	0.75469	0.409000	0.21082	2.338000	0.79540	0.561000	0.74099	CTG		0.672	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		Missense_Mutation
DDX24	57062	genome.wustl.edu	37	14	94528821	94528821	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr14:94528821C>G	ENST00000330836.5	-	3	996	c.865G>C	c.(865-867)Ggc>Cgc	p.G289R	DDX24_ENST00000555054.1_Missense_Mutation_p.G246R|DDX24_ENST00000544005.1_Missense_Mutation_p.G39R	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	289	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.G289R(1)		cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		TCAGCCTTGCCTGGTGATCTA	0.552																																																1	Substitution - Missense(1)	ovary(1)	14											131.0	107.0	115.0					14																	94528821		2203	4300	6503	93598574	SO:0001583	missense	57062			AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.865G>C	14.37:g.94528821C>G	ENSP00000328690:p.Gly289Arg		93598574	E7EMJ4|Q4V9L5	Missense_Mutation	SNP	ENST00000330836.5	37	CCDS9918.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	9.602	1.128839	0.21041	.	.	ENSG00000089737	ENST00000330836;ENST00000544005;ENST00000440370;ENST00000555054;ENST00000542247	T;T;T	0.03152	4.08;4.03;4.08	4.1	-8.21	0.01041	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	1.044510	0.07473	N	0.902534	T	0.02688	0.0081	L	0.38175	1.15	0.09310	N	1	B	0.21688	0.059	B	0.24974	0.057	T	0.43702	-0.9375	10	0.39692	T	0.17	-10.0209	3.6214	0.08097	0.1147:0.4143:0.1108:0.3602	.	289	Q9GZR7	DDX24_HUMAN	R	289;39;234;246;246	ENSP00000328690:G289R;ENSP00000440623:G39R;ENSP00000452145:G246R	ENSP00000328690:G289R	G	-	1	0	DDX24	93598574	0.000000	0.05858	0.000000	0.03702	0.240000	0.25518	-0.748000	0.04818	-1.659000	0.01488	-0.367000	0.07326	GGC		0.552	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412861.1	NM_020414		Missense_Mutation
FOLR4	390243	genome.wustl.edu	37	11	94040366	94040366	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr11:94040366T>A	ENST00000440961.2	+	3	407	c.363T>A	c.(361-363)aaT>aaA	p.N121K		NM_001199206.1	NP_001186135.1	A6ND01	JUNO_HUMAN	folate receptor 4, delta (putative)	128					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.N122K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14						GAGTTGTGAATGTGCCGCTGT	0.537																																																1	Substitution - Missense(1)	ovary(1)	11											93.0	100.0	98.0					11																	94040366		2185	4286	6471	93680014	SO:0001583	missense						11q14	2014-07-23	2012-12-07		ENSG00000183560	ENSG00000183560			32565	protein-coding gene	gene with protein product		615737	"""folate receptor 4 (delta) homolog (mouse)"""			11111049, 24739963	Standard	NM_001199206		Approved	Folbp3, JUNO	uc021qou.1	A6ND01		ENST00000440961.2:c.363T>A	11.37:g.94040366T>A	ENSP00000416935:p.Asn121Lys		93680014		Missense_Mutation	SNP	ENST00000440961.2	37		SNP	51	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.76|12.76	2.033120|2.033120	0.35893|0.35893	.|.	.|.	ENSG00000183560|ENSG00000183560	ENST00000328458|ENST00000440961	.|T	.|0.75477	.|-0.94	4.57|4.57	-6.96|-6.96	0.01622|0.01622	.|.	.|0.885835	.|0.09877	.|N	.|0.744177	T|T	0.53594|0.53594	0.1806|0.1806	N|N	0.25485|0.25485	0.75|0.75	0.09310|0.09310	N|N	1|1	.|P	.|0.40553	.|0.721	.|B	.|0.42030	.|0.373	T|T	0.50145|0.50145	-0.8862|-0.8862	5|9	.|.	.|.	.|.	-15.711|-15.711	3.8329|3.8329	0.08882|0.08882	0.1055:0.2616:0.1047:0.5283|0.1055:0.2616:0.1047:0.5283	.|.	.|121	.|A6ND01-2	.|.	K|K	122|121	.|ENSP00000416935:N121K	.|.	M|N	+|+	2|3	0|2	FOLR4|FOLR4	93680014|93680014	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-1.849000|-1.849000	0.01672|0.01672	-1.309000|-1.309000	0.02315|0.02315	0.402000|0.402000	0.26972|0.26972	ATG|AAT		0.537	FOLR4-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000396420.1	NM_001080486		Missense_Mutation
HHEX	3087	genome.wustl.edu	37	10	94454460	94454460	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr10:94454460A>G	ENST00000282728.5	+	4	2547	c.748A>G	c.(748-750)Att>Gtt	p.I250V	HHEX_ENST00000492654.2_Missense_Mutation_p.I78V|HHEX_ENST00000472590.2_Missense_Mutation_p.I78V	NM_002729.4	NP_002720.1	Q03014	HHEX_HUMAN	hematopoietically expressed homeobox	250					anterior/posterior pattern specification (GO:0009952)|B cell differentiation (GO:0030183)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|DNA conformation change (GO:0071103)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|forebrain morphogenesis (GO:0048853)|gall bladder development (GO:0061010)|hepatic duct development (GO:0061011)|hepatoblast differentiation (GO:0061017)|hepatocyte differentiation (GO:0070365)|in utero embryonic development (GO:0001701)|interkinetic nuclear migration (GO:0022027)|mRNA export from nucleus (GO:0006406)|multicellular organism growth (GO:0035264)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|pancreas development (GO:0031016)|poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|primary lung bud formation (GO:0060431)|primitive streak formation (GO:0090009)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|eukaryotic initiation factor 4E binding (GO:0008190)|protein homodimerization activity (GO:0042803)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.I250V(1)		kidney(2)|large_intestine(2)|lung(5)|ovary(1)	10						TGAATCAGAGATTTCAGAGGA	0.458																																																1	Substitution - Missense(1)	ovary(1)	10											90.0	90.0	90.0					10																	94454460		2203	4300	6503	94444440	SO:0001583	missense	3087			Z21533	CCDS7423.1	10q23.33	2011-06-20	2007-02-15		ENSG00000152804	ENSG00000152804		"""Homeoboxes / ANTP class : NKL subclass"""	4901	protein-coding gene	gene with protein product		604420		PRHX		8096636, 8103988	Standard	NM_002729		Approved	HEX, HOX11L-PEN	uc001kid.3	Q03014	OTTHUMG00000018762	ENST00000282728.5:c.748A>G	10.37:g.94454460A>G	ENSP00000282728:p.Ile250Val		94444440	B1AQ17|Q96CE9	Missense_Mutation	SNP	ENST00000282728.5	37	CCDS7423.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	7.729	0.698767	0.15106	.	.	ENSG00000152804	ENST00000282728;ENST00000472590;ENST00000492654	D;D;D	0.90324	-2.65;-1.59;-1.59	5.44	4.3	0.51218	.	0.131519	0.49305	D	0.000152	T	0.76421	0.3985	N	0.14661	0.345	0.27988	N	0.935775	B	0.02656	0.0	B	0.06405	0.002	T	0.61158	-0.7119	10	0.02654	T	1	-0.9239	5.8023	0.18420	0.7043:0.0:0.2957:0.0	.	250	Q03014	HHEX_HUMAN	V	250;78;78	ENSP00000282728:I250V;ENSP00000450017:I78V;ENSP00000447953:I78V	ENSP00000282728:I250V	I	+	1	0	HHEX	94444440	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.557000	0.36299	1.071000	0.40834	0.533000	0.62120	ATT		0.458	HHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049402.2			Missense_Mutation
DYNC1I1	1780	genome.wustl.edu	37	7	95705504	95705504	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr7:95705504A>C	ENST00000324972.6	+	15	1889	c.1696A>C	c.(1696-1698)Acc>Ccc	p.T566P	DYNC1I1_ENST00000437599.1_Missense_Mutation_p.T546P|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.T529P|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.T549P|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.T549P|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.T529P	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	566					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.T566P(1)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CAACAATGACACCGAGGTGAG	0.632											OREG0018174	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	7											50.0	48.0	49.0					7																	95705504		2203	4300	6503	95543440	SO:0001583	missense	1780			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1696A>C	7.37:g.95705504A>C	ENSP00000320130:p.Thr566Pro	1315	95543440	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	37	CCDS5644.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	19.84	3.901987	0.72754	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.07021	3.23;3.23;3.23;3.23;3.23;3.23	4.28	4.28	0.50868	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.047299	0.85682	D	0.000000	T	0.17492	0.0420	M	0.87827	2.91	0.80722	D	1	P;P;P;B;P	0.40553	0.6;0.721;0.721;0.225;0.525	B;B;B;B;B	0.40038	0.168;0.317;0.317;0.127;0.251	T	0.04650	-1.0936	10	0.62326	D	0.03	-9.5149	13.5646	0.61810	1.0:0.0:0.0:0.0	.	549;546;549;566;529	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	P	549;566;529;546;529;549	ENSP00000392337:T549P;ENSP00000320130:T566P;ENSP00000438377:T529P;ENSP00000398118:T546P;ENSP00000352348:T529P;ENSP00000412444:T549P	ENSP00000320130:T566P	T	+	1	0	DYNC1I1	95543440	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.945000	0.92985	1.938000	0.56188	0.260000	0.18958	ACC		0.632	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411		Missense_Mutation
BDKRB2	624	genome.wustl.edu	37	14	96707746	96707746	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr14:96707746A>T	ENST00000306005.3	+	3	1277	c.1081A>T	c.(1081-1083)Att>Ttt	p.I361F	BDKRB2_ENST00000542454.2_Missense_Mutation_p.I334F|BDKRB2_ENST00000539359.1_Missense_Mutation_p.I334F|BDKRB2_ENST00000554311.1_Missense_Mutation_p.I361F|RP11-404P21.8_ENST00000553811.1_Intron	NM_000623.3	NP_000614.1	P30411	BKRB2_HUMAN	bradykinin receptor B2	361					arachidonic acid secretion (GO:0050482)|blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress by p53 class mediator (GO:1902239)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of vascular permeability (GO:0043114)|regulation of vasoconstriction (GO:0019229)|response to salt stress (GO:0009651)|smooth muscle contraction (GO:0006939)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|phosphatidylinositol phospholipase C activity (GO:0004435)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|type 1 angiotensin receptor binding (GO:0031702)	p.I361F(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|lung(7)|ovary(3)|skin(1)	24		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)	Icatibant(DB06196)	GTCAGAACCCATTCAGATGGA	0.572																																																1	Substitution - Missense(1)	ovary(1)	14											57.0	56.0	57.0					14																	96707746		2203	4300	6503	95777499	SO:0001583	missense	624			S56772	CCDS9942.1	14q32.1-q32.2	2012-08-08				ENSG00000168398		"""GPCR / Class A : Bradykinin receptors"""	1030	protein-coding gene	gene with protein product		113503				7916737	Standard	NM_000623		Approved	BK-2	uc010avm.1	P30411		ENST00000306005.3:c.1081A>T	14.37:g.96707746A>T	ENSP00000307713:p.Ile361Phe		95777499		Missense_Mutation	SNP	ENST00000306005.3	37	CCDS9942.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	7.098	0.573484	0.13623	.	.	ENSG00000168398	ENST00000542454;ENST00000554311;ENST00000306005;ENST00000539359	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	4.68	-3.52	0.04682	.	1.243560	0.05824	N	0.616216	T	0.18882	0.0453	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.20140	-1.0284	10	0.27785	T	0.31	-4.9367	6.1658	0.20390	0.3617:0.2397:0.3986:0.0	.	361	P30411	BKRB2_HUMAN	F	334;361;361;334	ENSP00000439459:I334F;ENSP00000450482:I361F;ENSP00000307713:I361F;ENSP00000438376:I334F	ENSP00000307713:I361F	I	+	1	0	BDKRB2	95777499	0.000000	0.05858	0.000000	0.03702	0.230000	0.25150	-0.207000	0.09384	-0.991000	0.03476	0.402000	0.26972	ATT		0.572	BDKRB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413294.1			Missense_Mutation
CYP2C9	1559	genome.wustl.edu	37	10	96748644	96748644	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr10:96748644G>C	ENST00000260682.6	+	9	1344	c.1332G>C	c.(1330-1332)gaG>gaC	p.E444D		NM_000771.3	NP_000762.2	P11712	CP2C9_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 9	444					arachidonic acid metabolic process (GO:0019369)|cellular amide metabolic process (GO:0043603)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|urea metabolic process (GO:0019627)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|caffeine oxidase activity (GO:0034875)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|steroid hydroxylase activity (GO:0008395)	p.E444D(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		Colorectal(252;0.0902)		all cancers(201;6.93e-05)	Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Agomelatine(DB06594)|Alosetron(DB00969)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Atovaquone(DB01117)|Azelastine(DB00972)|Bexarotene(DB00307)|Bicalutamide(DB01128)|Bortezomib(DB00188)|Bosentan(DB00559)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabozantinib(DB08875)|Caffeine(DB00201)|Candesartan(DB00796)|Capecitabine(DB01101)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Celecoxib(DB00482)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Clevidipine(DB04920)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclizine(DB01176)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diclofenamide(DB01144)|Dicoumarol(DB00266)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disulfiram(DB00822)|Dolasetron(DB00757)|Donepezil(DB00843)|Dopamine(DB00988)|Dorzolamide(DB00869)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enzalutamide(DB08899)|Epinephrine(DB00668)|Epoprostenol(DB01240)|Eprosartan(DB00876)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Etodolac(DB00749)|Etoricoxib(DB01628)|Etravirine(DB06414)|Felodipine(DB01023)|Fenofibrate(DB01039)|Flecainide(DB01195)|Fluconazole(DB00196)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indinavir(DB00224)|Indomethacin(DB00328)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Lidocaine(DB00281)|Lopinavir(DB01601)|Loratadine(DB00455)|Lornoxicam(DB06725)|Losartan(DB00678)|Lovastatin(DB00227)|Lumiracoxib(DB01283)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Melatonin(DB01065)|Meloxicam(DB00814)|Mestranol(DB01357)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Metronidazole(DB00916)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Montelukast(DB00471)|Naproxen(DB00788)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Ospemifene(DB04938)|Oxaprozin(DB00991)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paroxetine(DB00715)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phentermine(DB00191)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quazepam(DB01589)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfadiazine(DB00359)|Sulfadimethoxine(DB06150)|Sulfamethizole(DB00576)|Sulfamethoxazole(DB01015)|Sulfamoxole(DB08798)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Sulfapyridine(DB00891)|Sulfinpyrazone(DB01138)|Sulfisoxazole(DB00263)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Temazepam(DB00231)|Teniposide(DB00444)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiamylal(DB01154)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Tolcapone(DB00323)|Tolterodine(DB01036)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Treprostinil(DB00374)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Valsartan(DB00177)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Ximelagatran(DB04898)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zidovudine(DB00495)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	CCGGCATGGAGCTGTTTTTAT	0.453																																					Ovarian(54;1266 1406 16072 35076)											1	Substitution - Missense(1)	ovary(1)	10											160.0	150.0	153.0					10																	96748644		2203	4300	6503	96738634	SO:0001583	missense	1559			M61855	CCDS7437.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138109	ENSG00000138109		"""Cytochrome P450s"""	2623	protein-coding gene	gene with protein product		601130	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9"""	CYP2C10		2009263, 7841444	Standard	NM_000771		Approved	P450IIC9	uc001kka.4	P11712	OTTHUMG00000018805	ENST00000260682.6:c.1332G>C	10.37:g.96748644G>C	ENSP00000260682:p.Glu444Asp		96738634	P11713|Q16756|Q16872|Q5VX92|Q6IRV8|Q8WW80	Missense_Mutation	SNP	ENST00000260682.6	37	CCDS7437.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	.	11.50	1.656849	0.29425	.	.	ENSG00000138109	ENST00000260682	T	0.75477	-0.94	3.42	0.332	0.15938	.	0.000000	0.64402	U	0.000001	D	0.84777	0.5547	M	0.90814	3.15	0.31235	N	0.695856	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.99	T	0.81256	-0.1015	10	0.87932	D	0	.	6.3541	0.21393	0.4754:0.0:0.5246:0.0	.	444;444	Q5VX92;P11712	.;CP2C9_HUMAN	D	444	ENSP00000260682:E444D	ENSP00000260682:E444D	E	+	3	2	CYP2C9	96738634	1.000000	0.71417	0.988000	0.46212	0.045000	0.14185	3.457000	0.53007	-0.032000	0.13758	-0.397000	0.06425	GAG		0.453	CYP2C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049501.1	NM_000771		Missense_Mutation
SYNM	23336	genome.wustl.edu	37	15	99672483	99672483	+	Silent	SNP	A	A	G			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr15:99672483A>G	ENST00000336292.6	+	5	4035	c.3915A>G	c.(3913-3915)acA>acG	p.T1305T	SYNM_ENST00000560674.1_Intron|SYNM_ENST00000561323.1_3'UTR|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000328642.7_Intron	NM_145728.2	NP_663780.2	O15061	SYNEM_HUMAN	synemin, intermediate filament protein	1306	Interaction with DMD and UTRN.|Interaction with TLN1 and VCL.|Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						GGAGCAGCACATCCATCAGGC	0.537																																					Pancreas(125;1071 1762 21750 40003 40381)											0			15											146.0	152.0	150.0					15																	99672483		2117	4239	6356	97490006	SO:0001819	synonymous_variant	23336			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000336292.6:c.3915A>G	15.37:g.99672483A>G			97490006	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	ENST00000336292.6	37		SNP	8	WashU																																																																																				0.537	SYNM-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_145728		Missense_Mutation
AMY2A	279	genome.wustl.edu	37	1	104166801	104166801	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr1:104166801G>T	ENST00000414303.2	+	9	1368	c.1304G>T	c.(1303-1305)gGg>gTg	p.G435V	AMY2A_ENST00000497748.1_3'UTR	NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	435					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)	p.G435V(1)		endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	GTGGCTTTTGGGAGAGGAAAC	0.343																																																1	Substitution - Missense(1)	ovary(1)	1											1.0	1.0	1.0					1																	104166801		50	162	212	103968324	SO:0001583	missense	279			BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.1304G>T	1.37:g.104166801G>T	ENSP00000397582:p.Gly435Val		103968324	B9EJG1|Q9UBH3	Missense_Mutation	SNP	ENST00000414303.2	37	CCDS783.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	-	12.38	1.920638	0.33908	.	.	ENSG00000243480	ENST00000414303	T	0.75260	-0.92	2.94	2.94	0.34122	Alpha-amylase, C-terminal all beta (2);Glycosyl hydrolase, family 13, all-beta (1);	0.125799	0.53938	D	0.000043	D	0.87111	0.6096	H	0.95780	3.72	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.89811	0.3982	10	0.51188	T	0.08	.	13.9272	0.63970	0.0:0.0:1.0:0.0	.	435	P04746	AMYP_HUMAN	V	435	ENSP00000397582:G435V	ENSP00000397582:G435V	G	+	2	0	AMY2A	103968324	1.000000	0.71417	1.000000	0.80357	0.158000	0.22134	9.214000	0.95140	1.652000	0.50683	0.305000	0.20034	GGG		0.343	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030315.1	NM_000699		Missense_Mutation
CFAP43	80217	genome.wustl.edu	37	10	105952029	105952029	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr10:105952029C>T	ENST00000278064.2	-	12	1592	c.1267G>A	c.(1267-1269)Gga>Aga	p.G423R	WDR96_ENST00000428666.1_Missense_Mutation_p.G493R|WDR96_ENST00000357060.3_Missense_Mutation_p.G492R														p.G492R(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TCTGCTGTTCCAACTAACAGA	0.338																																																1	Substitution - Missense(1)	ovary(1)	10											124.0	121.0	122.0					10																	105952029		2203	4300	6503	105942019	SO:0001583	missense	80217																														ENST00000278064.2:c.1267G>A	10.37:g.105952029C>T	ENSP00000278064:p.Gly423Arg		105942019		Missense_Mutation	SNP	ENST00000278064.2	37		SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	20.2	3.950309	0.73787	.	.	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064	T;T;T	0.37752	1.18;1.18;1.18	5.91	5.91	0.95273	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.42821	D	0.000656	T	0.50854	0.1640	M	0.74881	2.28	0.43025	D	0.994585	P;P	0.50272	0.933;0.898	P;P	0.50352	0.629;0.638	T	0.43426	-0.9392	10	0.29301	T	0.29	.	17.7923	0.88558	0.0:1.0:0.0:0.0	.	493;492	B4DHB6;Q8NDM7	.;WDR96_HUMAN	R	492;493;423	ENSP00000349568:G492R;ENSP00000400289:G493R;ENSP00000278064:G423R	ENSP00000278064:G423R	G	-	1	0	WDR96	105942019	0.976000	0.34144	0.961000	0.40146	0.693000	0.40251	2.868000	0.48436	2.793000	0.96121	0.655000	0.94253	GGA		0.338	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1			Missense_Mutation
STXBP3	6814	genome.wustl.edu	37	1	109315285	109315285	+	Splice_Site	SNP	A	A	T			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr1:109315285A>T	ENST00000370008.3	+	7	488		c.e7-1		STXBP3_ENST00000485167.1_Splice_Site	NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3						blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)	p.?(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		GTCTTAACTTAGGTGTATACT	0.289																																																2	Unknown(2)	ovary(1)|lung(1)	1											85.0	75.0	78.0					1																	109315285		2203	4300	6503	109116808	SO:0001630	splice_region_variant	6814			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.439-1A>T	1.37:g.109315285A>T			109116808	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Splice_Site_SNP	SNP	ENST00000370008.3	37	CCDS790.1	SNP	15	WashU	.	.	.	.	.	.	.	.	.	.	A	21.5	4.165249	0.78339	.	.	ENSG00000116266	ENST00000370008	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0072	0.80372	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STXBP3	109116808	1.000000	0.71417	0.985000	0.45067	0.847000	0.48162	8.856000	0.92245	2.260000	0.74910	0.528000	0.53228	.		0.289	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	Intron	Splice_Site_SNP
SLC9C1	285335	genome.wustl.edu	37	3	111899441	111899441	+	Silent	SNP	T	T	C			TCGA-23-1124-01	TCGA-23-1124-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr3:111899441T>C	ENST00000305815.5	-	22	2970	c.2718A>G	c.(2716-2718)ggA>ggG	p.G906G	SLC9C1_ENST00000487372.1_Silent_p.G858G	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	906					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										TGATATAGATTCCTTTGGGCT	0.333																																																0			3											143.0	146.0	145.0					3																	111899441		2203	4300	6503	113382131	SO:0001819	synonymous_variant	285335			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.2718A>G	3.37:g.111899441T>C			113382131	Q6ZRP4|Q7RTP2	Silent	SNP	ENST00000305815.5	37	CCDS33817.1	SNP	62	WashU																																																																																				0.333	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061		Silent
CCDC172	374355	genome.wustl.edu	37	10	118116907	118116907	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr10:118116907A>G	ENST00000333254.3	+	6	715	c.464A>G	c.(463-465)gAa>gGa	p.E155G		NM_198515.2	NP_940917.1	P0C7W6	CC172_HUMAN	coiled-coil domain containing 172	155								p.E155G(1)									AAGTCAATGGAACATGATAGT	0.289																																																1	Substitution - Missense(1)	ovary(1)	10											41.0	41.0	41.0					10																	118116907		2191	4271	6462	118106897	SO:0001583	missense	374355			BC044830	CCDS31291.1	10q26.11-q26.12	2012-05-31	2012-05-31	2012-05-31	ENSG00000182645	ENSG00000182645			30524	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 96"""	C10orf96		12477932	Standard	NM_198515		Approved	MGC35062	uc001lck.3	P0C7W6	OTTHUMG00000019098	ENST00000333254.3:c.464A>G	10.37:g.118116907A>G	ENSP00000329860:p.Glu155Gly		118106897		Missense_Mutation	SNP	ENST00000333254.3	37	CCDS31291.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	9.790	1.177572	0.21787	.	.	ENSG00000182645	ENST00000333254	.	.	.	5.59	4.46	0.54185	.	0.233427	0.38720	N	0.001600	T	0.46658	0.1404	L	0.34521	1.04	0.34202	D	0.673268	B	0.18166	0.026	B	0.19946	0.027	T	0.54840	-0.8233	9	0.52906	T	0.07	-18.3339	11.4406	0.50094	0.9296:0.0:0.0704:0.0	.	155	P0C7W6	CJ096_HUMAN	G	155	.	ENSP00000329860:E155G	E	+	2	0	C10orf96	118106897	1.000000	0.71417	0.959000	0.39883	0.601000	0.36947	4.478000	0.60230	0.959000	0.37980	0.528000	0.53228	GAA		0.289	CCDC172-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050516.2	NM_198515		Missense_Mutation
NOV	4856	genome.wustl.edu	37	8	120430510	120430510	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr8:120430510C>G	ENST00000259526.3	+	3	750	c.523C>G	c.(523-525)Cca>Gca	p.P175A	RP11-775B15.2_ENST00000519786.1_RNA	NM_002514.3	NP_002505.1	Q9UIW2	PLXA1_HUMAN	nephroblastoma overexpressed	0	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)	p.P175A(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(3)	21	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)			GATCTGTGGCCCAGATGAGGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	8											144.0	134.0	137.0					8																	120430510		2203	4300	6503	120499691	SO:0001583	missense	4856			X96584	CCDS6328.1	8q24.12	2012-02-27	2012-02-27		ENSG00000136999	ENSG00000136999			7885	protein-coding gene	gene with protein product		164958	"""nephroblastoma overexpressed gene"""			1334251	Standard	NM_002514		Approved	IGFBP9, CCN3	uc003yoq.2	P48745	OTTHUMG00000164984	ENST00000259526.3:c.523C>G	8.37:g.120430510C>G	ENSP00000259526:p.Pro175Ala		120499691		Missense_Mutation	SNP	ENST00000259526.3	37	CCDS6328.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	8.269	0.812940	0.16537	.	.	ENSG00000136999	ENST00000259526	T	0.78126	-1.15	5.51	2.48	0.30137	.	0.411457	0.29246	N	0.012720	T	0.52058	0.1711	N	0.08118	0	0.27704	N	0.945691	B	0.06786	0.001	B	0.06405	0.002	T	0.34179	-0.9839	10	0.29301	T	0.29	-1.7924	4.0268	0.09692	0.0:0.3764:0.1798:0.4438	.	175	P48745	NOV_HUMAN	A	175	ENSP00000259526:P175A	ENSP00000259526:P175A	P	+	1	0	NOV	120499691	0.000000	0.05858	0.766000	0.31476	0.874000	0.50279	-0.065000	0.11617	0.310000	0.22990	0.561000	0.74099	CCA		0.512	NOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381301.1	NM_002514		Missense_Mutation
TIMMDC1	51300	genome.wustl.edu	37	3	119219566	119219566	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr3:119219566C>G	ENST00000494664.1	+	2	421	c.219C>G	c.(217-219)gaC>gaG	p.D73E	TIMMDC1_ENST00000493694.1_Intron|RP11-190C22.8_ENST00000609598.1_lincRNA	NM_016589.3	NP_057673.2	Q9NPL8	TIDC1_HUMAN	translocase of inner mitochondrial membrane domain containing 1	73						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.D73E(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	15						TTTCAAAGGACCTTGCTAATA	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											133.0	133.0	133.0					3																	119219566		2203	4300	6503	120702256	SO:0001583	missense	51300			AF210057	CCDS33831.1	3q13.33	2013-12-05	2011-07-05	2011-07-05	ENSG00000113845	ENSG00000113845			1321	protein-coding gene	gene with protein product		615534	"""chromosome 3 open reading frame 1"""	C3orf1		11092749	Standard	NM_016589		Approved	FLJ22597	uc003ecn.3	Q9NPL8	OTTHUMG00000159388	ENST00000494664.1:c.219C>G	3.37:g.119219566C>G	ENSP00000418803:p.Asp73Glu		120702256	D3DN81|Q6IAJ7|Q6UWU6|Q9NPR3|Q9NPS5|Q9P0Y6	Missense_Mutation	SNP	ENST00000494664.1	37	CCDS33831.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.660201	0.00772	.	.	ENSG00000113845	ENST00000494664	T	0.21734	1.99	5.53	1.84	0.25277	.	0.050377	0.85682	N	0.000000	T	0.02193	0.0068	N	0.00027	-2.65	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36407	-0.9749	10	0.02654	T	1	-14.145	4.6368	0.12528	0.6658:0.1653:0.1689:0.0	.	73	Q9NPL8	TIDC1_HUMAN	E	73	ENSP00000418803:D73E	ENSP00000264244:D73E	D	+	3	2	TIMMDC1	120702256	0.998000	0.40836	0.998000	0.56505	0.034000	0.12701	0.656000	0.24948	0.170000	0.19704	-0.256000	0.11100	GAC		0.398	TIMMDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355077.3	NM_016589		Missense_Mutation
MLXIP	22877	genome.wustl.edu	37	12	122623472	122623472	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr12:122623472G>T	ENST00000319080.7	+	15	2627	c.2495G>T	c.(2494-2496)tGg>tTg	p.W832L	MLXIP_ENST00000538698.1_Missense_Mutation_p.W439L					MLX interacting protein									p.W832L(1)		NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		TTGCAGAATTGGAAGTTCTGG	0.507																																					Esophageal Squamous(105;787 1493 16200 18566 52466)											1	Substitution - Missense(1)	ovary(1)	12											81.0	83.0	82.0					12																	122623472		1876	4099	5975	121189425	SO:0001583	missense	22877			AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.2495G>T	12.37:g.122623472G>T	ENSP00000312834:p.Trp832Leu		121189425		Nonsense_Mutation	SNP	ENST00000319080.7	37		SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	33	5.230587	0.95207	.	.	ENSG00000175727	ENST00000319080;ENST00000538698;ENST00000366272	T;T;T	0.61742	2.35;1.61;0.08	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.77844	0.4191	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.79676	-0.1704	9	0.62326	D	0.03	-12.1622	19.2864	0.94072	0.0:0.0:1.0:0.0	.	832	Q9HAP2	MLXIP_HUMAN	L	832;439;303	ENSP00000312834:W832L;ENSP00000440769:W439L;ENSP00000445891:W303L	ENSP00000312834:W832L	W	+	2	0	MLXIP	121189425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.748000	0.98867	2.549000	0.85964	0.655000	0.94253	TGG		0.507	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938		Nonsense_Mutation
GOLGA2	2801	genome.wustl.edu	37	9	131022956	131022956	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr9:131022956C>T	ENST00000421699.2	-	17	1477	c.1465G>A	c.(1465-1467)Gac>Aac	p.D489N	AL590708.1_ENST00000408370.1_RNA|GOLGA2_ENST00000609374.1_Missense_Mutation_p.D477N	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	489					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)		p.D477N(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						CCCTCATTGTCTTGCACCTGG	0.682																																																1	Substitution - Missense(1)	ovary(1)	9											39.0	44.0	42.0					9																	131022956		2203	4300	6503	130062777	SO:0001583	missense	2801			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.1465G>A	9.37:g.131022956C>T	ENSP00000416097:p.Asp489Asn		130062777	Q6GRM9|Q9BRB0|Q9NYF9	Missense_Mutation	SNP	ENST00000421699.2	37	CCDS6896.2	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	c	18.93	3.727355	0.69074	.	.	ENSG00000167110	ENST00000421699	T	0.28895	1.59	5.3	4.41	0.53225	.	0.097640	0.64402	N	0.000002	T	0.32615	0.0835	L	0.28740	0.885	0.53688	D	0.999974	P	0.50272	0.933	P	0.52424	0.698	T	0.02491	-1.1151	10	0.25106	T	0.35	.	13.5747	0.61866	0.0:0.9252:0.0:0.0748	.	489	Q08379	GOGA2_HUMAN	N	489	ENSP00000416097:D489N	ENSP00000416097:D489N	D	-	1	0	GOLGA2	130062777	1.000000	0.71417	0.162000	0.22713	0.972000	0.66771	5.748000	0.68697	1.238000	0.43771	0.305000	0.20034	GAC		0.682	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486		Missense_Mutation
ENPP1	5167	genome.wustl.edu	37	6	132211589	132211589	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr6:132211589G>C	ENST00000360971.2	+	25	2736	c.2716G>C	c.(2716-2718)Gag>Cag	p.E906Q		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	906	Nuclease.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)	p.E854Q(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	ACAAAGAAAAGAGCCAGTTTC	0.388																																					Colon(104;336 1535 5856 11019 33782)											1	Substitution - Missense(1)	ovary(1)	6											107.0	100.0	103.0					6																	132211589		2203	4300	6503	132253282	SO:0001583	missense	5167			M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.2716G>C	6.37:g.132211589G>C	ENSP00000354238:p.Glu906Gln		132253282	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	ENST00000360971.2	37	CCDS5150.2	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	8.740	0.918718	0.17982	.	.	ENSG00000197594	ENST00000360971	T	0.70986	-0.53	5.82	4.93	0.64822	Extracellular Endonuclease, subunit A (2);	0.407179	0.26457	N	0.024269	T	0.38134	0.1029	L	0.41027	1.25	0.30844	N	0.735381	B	0.15141	0.012	B	0.18871	0.023	T	0.13124	-1.0521	10	0.11485	T	0.65	-14.9932	10.4224	0.44359	0.0:0.3282:0.5419:0.1299	.	906	P22413	ENPP1_HUMAN	Q	906	ENSP00000354238:E906Q	ENSP00000354238:E906Q	E	+	1	0	ENPP1	132253282	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.001000	0.40825	1.424000	0.47217	0.650000	0.86243	GAG		0.388	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042238.2			Missense_Mutation
NCAPD3	23310	genome.wustl.edu	37	11	134027822	134027822	+	Splice_Site	SNP	C	C	A			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr11:134027822C>A	ENST00000534548.2	-	31	4239		c.e31+1			NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.?(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		ATAAGGCTTACCCTGACTGCA	0.443																																																1	Unknown(1)	ovary(1)	11											215.0	221.0	219.0					11																	134027822		2201	4297	6498	133533032	SO:0001630	splice_region_variant	23310			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.4174+1G>T	11.37:g.134027822C>A			133533032	A6NFS2|Q4KMQ9	Splice_Site_SNP	SNP	ENST00000534548.2	37	CCDS31723.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051229	0.36181	.	.	ENSG00000151503	ENST00000534548	.	.	.	4.85	3.92	0.45320	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8872	0.46974	0.0:0.908:0.0:0.092	.	.	.	.	.	-1	.	.	.	-	.	.	NCAPD3	133533032	0.999000	0.42202	0.941000	0.38009	0.150000	0.21749	2.362000	0.44169	2.526000	0.85167	0.561000	0.74099	.		0.443	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	Intron	Splice_Site_SNP
MOSPD1	56180	genome.wustl.edu	37	X	134033376	134033376	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chrX:134033376C>T	ENST00000370783.3	-	2	274	c.88G>A	c.(88-90)Gat>Aat	p.D30N	MOSPD1_ENST00000491609.1_5'UTR|MOSPD1_ENST00000370777.1_Missense_Mutation_p.D30N|MOSPD1_ENST00000370779.4_Missense_Mutation_p.D30N	NM_019556.1	NP_062456.1	Q9UJG1	MSPD1_HUMAN	motile sperm domain containing 1	30	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)	p.D30N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)	9	Acute lymphoblastic leukemia(192;0.000127)					GTTGACTGATCATCTGCATAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	X											154.0	142.0	146.0					X																	134033376		2203	4300	6503	133861042	SO:0001583	missense	56180			Z83826	CCDS14645.1	Xq26.3	2008-02-05			ENSG00000101928	ENSG00000101928			25235	protein-coding gene	gene with protein product		300674				15533722	Standard	XM_005262446		Approved	dJ473B4	uc004eyb.3	Q9UJG1	OTTHUMG00000035315	ENST00000370783.3:c.88G>A	X.37:g.134033376C>T	ENSP00000359819:p.Asp30Asn		133861042	B2RE62|D3DTG5|Q5H9C5|Q5H9C7	Missense_Mutation	SNP	ENST00000370783.3	37	CCDS14645.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621218	0.87460	.	.	ENSG00000101928	ENST00000370783;ENST00000370779;ENST00000370777	T;T;T	0.71461	-0.57;-0.57;-0.57	5.91	5.91	0.95273	PapD-like (2);	0.092927	0.64402	D	0.000001	T	0.75042	0.3796	L	0.55743	1.74	0.80722	D	1	P;D;P	0.53619	0.943;0.961;0.93	P;P;P	0.51701	0.677;0.566;0.619	T	0.71213	-0.4659	10	0.24483	T	0.36	-1.2971	18.0725	0.89415	0.0:1.0:0.0:0.0	.	30;30;30	B4DR28;Q9UJG1;Q9UJG1-2	.;MSPD1_HUMAN;.	N	30	ENSP00000359819:D30N;ENSP00000359815:D30N;ENSP00000359813:D30N	ENSP00000359813:D30N	D	-	1	0	MOSPD1	133861042	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.491000	0.84063	0.594000	0.82650	GAT		0.403	MOSPD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000085439.1	NM_019556		Missense_Mutation
C3orf36	80111	genome.wustl.edu	37	3	133647488	133647488	+	Silent	SNP	T	T	G			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr3:133647488T>G	ENST00000408895.2	-	1	1168	c.160A>C	c.(160-162)Agg>Cgg	p.R54R		NM_025041.2	NP_079317.2	Q3SXR2	CC036_HUMAN	chromosome 3 open reading frame 36	54								p.R54R(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6						AATGCCTTCCTGAGCGTGGTT	0.647																																																1	Substitution - coding silent(1)	ovary(1)	3											39.0	41.0	41.0					3																	133647488		2203	4300	6503	135130178	SO:0001819	synonymous_variant	80111			AK025826	CCDS3083.1	3q22.1	2011-09-30			ENSG00000221972	ENSG00000221972			26170	protein-coding gene	gene with protein product						12477932	Standard	NM_025041		Approved	FLJ22173	uc003epz.1	Q3SXR2		ENST00000408895.2:c.160A>C	3.37:g.133647488T>G			135130178	Q3SXR3|Q9H6K8	Silent	SNP	ENST00000408895.2	37	CCDS3083.1	SNP	55	WashU																																																																																				0.647	C3orf36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_025041		Silent
LECT2	3950	genome.wustl.edu	37	5	135286975	135286975	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr5:135286975C>G	ENST00000274507.1	-	3	426	c.226G>C	c.(226-228)Ggc>Cgc	p.G76R	LECT2_ENST00000514447.2_Missense_Mutation_p.G76R|LECT2_ENST00000522943.1_Missense_Mutation_p.G76R|FBXL21_ENST00000467490.1_RNA|LECT2_ENST00000512872.1_Missense_Mutation_p.G4R|LECT2_ENST00000471827.1_5'UTR	NM_002302.2	NP_002293.2	O14960	LECT2_HUMAN	leukocyte cell-derived chemotaxin 2	76					chemotaxis (GO:0006935)|negative regulation of Wnt signaling pathway (GO:0030178)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	identical protein binding (GO:0042802)	p.G76R(1)		large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTCTCCTGGCCCACAATCATT	0.468																																																1	Substitution - Missense(1)	ovary(1)	5											139.0	128.0	131.0					5																	135286975		2203	4300	6503	135314874	SO:0001583	missense	3950			AB007546	CCDS4190.1	5q31.1	2008-05-15			ENSG00000145826	ENSG00000145826			6550	protein-coding gene	gene with protein product		602882				9545637	Standard	NM_002302		Approved	chm-II, chm2	uc003lbe.1	O14960	OTTHUMG00000129146	ENST00000274507.1:c.226G>C	5.37:g.135286975C>G	ENSP00000274507:p.Gly76Arg		135314874	B2RA90|O14565|Q52M49	Missense_Mutation	SNP	ENST00000274507.1	37	CCDS4190.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	10.45	1.353978	0.24512	.	.	ENSG00000145826	ENST00000522943;ENST00000274507;ENST00000512872;ENST00000514447	T;T;T;T	0.40225	3.03;1.04;3.03;3.03	5.86	3.0	0.34707	Peptidase M23 (1);	0.197223	0.53938	D	0.000049	T	0.26629	0.0651	L	0.35542	1.07	0.44345	D	0.997234	B	0.12013	0.005	B	0.17098	0.017	T	0.05225	-1.0898	10	0.13470	T	0.59	-3.9485	7.7341	0.28804	0.0:0.6922:0.1486:0.1592	.	76	O14960	LECT2_HUMAN	R	76;76;4;76	ENSP00000429618:G76R;ENSP00000274507:G76R;ENSP00000427012:G4R;ENSP00000421123:G76R	ENSP00000274507:G76R	G	-	1	0	LECT2	135314874	0.141000	0.22595	0.994000	0.49952	0.507000	0.33981	0.721000	0.25911	1.498000	0.48600	-0.142000	0.14014	GGC		0.468	LECT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251209.1	NM_002302		Missense_Mutation
CCDC183	84960	genome.wustl.edu	37	9	139697148	139697148	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr9:139697148G>C	ENST00000338005.6	+	6	611	c.576G>C	c.(574-576)aaG>aaC	p.K192N	KIAA1984_ENST00000371682.3_3'UTR|RP11-216L13.19_ENST00000415992.1_RNA|KIAA1984-AS1_ENST00000414656.1_RNA|RP11-216L13.18_ENST00000471502.1_RNA	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN		192								p.K192N(1)		biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		AGCTGGACAAGCTGCAGAACC	0.542																																																1	Substitution - Missense(1)	ovary(1)	9											116.0	125.0	122.0					9																	139697148		2030	4187	6217	138816969	SO:0001583	missense	84960																														ENST00000338005.6:c.576G>C	9.37:g.139697148G>C	ENSP00000338013:p.Lys192Asn		138816969	B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	Missense_Mutation	SNP	ENST00000338005.6	37	CCDS43906.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	11.02	1.514650	0.27123	.	.	ENSG00000213213	ENST00000423962;ENST00000338005	T	0.11604	2.76	4.83	2.59	0.31030	.	0.646888	0.12566	U	0.457724	T	0.08802	0.0218	L	0.47716	1.5	0.80722	D	1	B	0.20671	0.047	B	0.24701	0.055	T	0.17018	-1.0383	10	0.19147	T	0.46	-25.0294	2.9868	0.05971	0.2166:0.2789:0.5045:0.0	.	192	Q5T5S1	K1984_HUMAN	N	192	ENSP00000338013:K192N	ENSP00000338013:K192N	K	+	3	2	KIAA1984	138816969	1.000000	0.71417	1.000000	0.80357	0.050000	0.14768	1.073000	0.30691	1.014000	0.39417	0.561000	0.74099	AAG		0.542	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354899.1			Missense_Mutation
KDM7A	80853	genome.wustl.edu	37	7	139796808	139796808	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr7:139796808C>T	ENST00000397560.2	-	16	2153	c.2056G>A	c.(2056-2058)Gat>Aat	p.D686N	Y_RNA_ENST00000515919.1_RNA|JHDM1D_ENST00000006967.5_Missense_Mutation_p.D686N	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		686					histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.D686N(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					TTCTTTTCATCACCTGAACTT	0.353																																																1	Substitution - Missense(1)	ovary(1)	7											106.0	90.0	95.0					7																	139796808		1834	4091	5925	139443277	SO:0001583	missense	80853																														ENST00000397560.2:c.2056G>A	7.37:g.139796808C>T	ENSP00000380692:p.Asp686Asn		139443277	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Missense_Mutation	SNP	ENST00000397560.2	37	CCDS43658.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	23.2	4.389048	0.82902	.	.	ENSG00000006459	ENST00000397560;ENST00000006967	T;T	0.18810	2.39;2.19	5.54	5.54	0.83059	.	0.172390	0.50627	D	0.000103	T	0.42177	0.1191	M	0.62723	1.935	0.49130	D	0.999753	D	0.76494	0.999	D	0.64144	0.922	T	0.06303	-1.0834	10	0.19590	T	0.45	-20.1209	19.4865	0.95030	0.0:1.0:0.0:0.0	.	686	Q6ZMT4	KDM7_HUMAN	N	686	ENSP00000380692:D686N;ENSP00000006967:D686N	ENSP00000006967:D686N	D	-	1	0	JHDM1D	139443277	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.114000	0.64648	2.585000	0.87301	0.563000	0.77884	GAT		0.353	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1			Missense_Mutation
MKRN1	23608	genome.wustl.edu	37	7	140154928	140154928	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr7:140154928C>G	ENST00000255977.2	-	7	1427	c.1203G>C	c.(1201-1203)caG>caC	p.Q401H	MKRN1_ENST00000437223.2_Missense_Mutation_p.Q135H|MKRN1_ENST00000474576.1_Missense_Mutation_p.Q337H	NM_013446.3	NP_038474.2	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1	401					protein polyubiquitination (GO:0000209)		chromatin binding (GO:0003682)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q401H(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	16	Melanoma(164;0.00956)					CTTTCTGTCTCTGTGGCTCCT	0.483																																																1	Substitution - Missense(1)	ovary(1)	7											143.0	140.0	141.0					7																	140154928		2203	4300	6503	139801397	SO:0001583	missense	23608			AF192784	CCDS5860.1, CCDS47725.1	7q34	2013-01-09	2008-08-13		ENSG00000133606	ENSG00000133606		"""RING-type (C3HC4) zinc fingers"""	7112	protein-coding gene	gene with protein product		607754				10843807	Standard	NM_013446		Approved	RNF61	uc003vvt.2	Q9UHC7	OTTHUMG00000157412	ENST00000255977.2:c.1203G>C	7.37:g.140154928C>G	ENSP00000255977:p.Gln401His		139801397	A4D1T7|B3KXB4|Q256Y7|Q59G11|Q6GSF1|Q9H0G0|Q9UEZ7|Q9UHW2	Missense_Mutation	SNP	ENST00000255977.2	37	CCDS5860.1	SNP	32	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.13|17.13	3.312034|3.312034	0.60414|0.60414	.|.	.|.	ENSG00000133606|ENSG00000133606	ENST00000255977;ENST00000539898;ENST00000437223;ENST00000474576|ENST00000463142	T;T;T|.	0.40756|.	1.02;1.47;1.02|.	5.0|5.0	4.12|4.12	0.48240|0.48240	.|.	0.065987|.	0.64402|.	D|.	0.000009|.	T|T	0.66046|0.66046	0.2750|0.2750	M|M	0.67397|0.67397	2.05|2.05	0.58432|0.58432	D|D	0.999995|0.999995	D|.	0.89917|.	1.0|.	D|.	0.72982|.	0.979|.	T|T	0.68735|0.68735	-0.5330|-0.5330	10|6	0.40728|0.72032	T|D	0.16|0.01	.|.	10.2532|10.2532	0.43381|0.43381	0.0:0.8283:0.0:0.1717|0.0:0.8283:0.0:0.1717	.|.	401|.	Q9UHC7|.	MKRN1_HUMAN|.	H|T	401;337;135;337|54	ENSP00000255977:Q401H;ENSP00000439823:Q135H;ENSP00000417863:Q337H|.	ENSP00000255977:Q401H|ENSP00000417346:R54T	Q|R	-|-	3|2	2|0	MKRN1|MKRN1	139801397|139801397	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.021000|1.021000	0.30040|0.30040	1.328000|1.328000	0.45358|0.45358	0.650000|0.650000	0.86243|0.86243	CAG|AGA		0.483	MKRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348752.1	NM_013446		Missense_Mutation
PCDHGA1	56114	genome.wustl.edu	37	5	140712162	140712162	+	Silent	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr5:140712162G>A	ENST00000517417.1	+	1	1911	c.1911G>A	c.(1909-1911)gcG>gcA	p.A637A	PCDHGA1_ENST00000378105.3_Silent_p.A637A	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	637	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A637A(1)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGAGACGCGCTCAAGCAGA	0.697																																																1	Substitution - coding silent(1)	ovary(1)	5											38.0	43.0	41.0					5																	140712162		2200	4297	6497	140692346	SO:0001819	synonymous_variant	56114			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1911G>A	5.37:g.140712162G>A			140692346	Q2M273|Q9Y5D6	Silent	SNP	ENST00000517417.1	37	CCDS54922.1	SNP	38	WashU																																																																																				0.697	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		Silent
ACP6	51205	genome.wustl.edu	37	1	147131780	147131780	+	Silent	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr1:147131780G>A	ENST00000369238.6	-	2	777	c.330C>T	c.(328-330)taC>taT	p.Y110Y	ACP6_ENST00000392988.2_Silent_p.Y110Y	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	110	Substrate binding. {ECO:0000250}.				dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)	p.Y110Y(1)		breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					TGGTCTCATGGTATTGAGAGT	0.517																																																1	Substitution - coding silent(1)	ovary(1)	1											101.0	102.0	102.0					1																	147131780		2203	4300	6503	145598404	SO:0001819	synonymous_variant	51205			BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.330C>T	1.37:g.147131780G>A			145598404	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Silent	SNP	ENST00000369238.6	37	CCDS928.1	SNP	44	WashU																																																																																				0.517	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039420.2	NM_016361		Silent
ZNF16	7564	genome.wustl.edu	37	8	146156539	146156539	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr8:146156539T>C	ENST00000276816.4	-	4	1820	c.1634A>G	c.(1633-1635)tAt>tGt	p.Y545C	ZNF16_ENST00000394909.2_Missense_Mutation_p.Y545C	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	545					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y545C(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		AGTACATTCATAGGGCTTCTC	0.522																																																1	Substitution - Missense(1)	ovary(1)	8											92.0	89.0	90.0					8																	146156539		2203	4300	6503	146127343	SO:0001583	missense	7564			X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.1634A>G	8.37:g.146156539T>C	ENSP00000276816:p.Tyr545Cys		146127343	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	ENST00000276816.4	37	CCDS6437.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	13.92	2.382083	0.42207	.	.	ENSG00000170631	ENST00000276816;ENST00000394909	T;T	0.25414	1.8;1.8	4.0	4.0	0.46444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47451	0.1446	M	0.75777	2.31	0.26016	N	0.981927	D	0.89917	1.0	D	0.78314	0.991	T	0.30937	-0.9961	9	0.87932	D	0	.	7.7616	0.28955	0.187:0.0:0.0:0.813	.	545	P17020	ZNF16_HUMAN	C	545	ENSP00000276816:Y545C;ENSP00000378369:Y545C	ENSP00000276816:Y545C	Y	-	2	0	ZNF16	146127343	0.062000	0.20869	0.999000	0.59377	0.946000	0.59487	0.512000	0.22755	1.673000	0.50895	0.379000	0.24179	TAT		0.522	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958		Missense_Mutation
CA14	23632	genome.wustl.edu	37	1	150234556	150234556	+	Splice_Site	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr1:150234556G>A	ENST00000369111.4	+	4	1226		c.e4-1		snoU13_ENST00000458929.1_RNA	NM_012113.1	NP_036245.1	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV						bicarbonate transport (GO:0015701)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|metal ion binding (GO:0046872)	p.?(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	18	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)		Acetazolamide(DB00819)|Zonisamide(DB00909)	TTTCCTCACAGTGCAACTCTC	0.547																																																1	Unknown(1)	ovary(1)	1											124.0	106.0	112.0					1																	150234556		2203	4300	6503	148501180	SO:0001630	splice_region_variant	23632			AB025904	CCDS947.1	1q21	2008-02-05			ENSG00000118298	ENSG00000118298		"""Carbonic anhydrases"""	1372	protein-coding gene	gene with protein product		604832				10512682	Standard	XM_005245059		Approved		uc001etx.3	Q9ULX7	OTTHUMG00000012549	ENST00000369111.4:c.257-1G>A	1.37:g.150234556G>A			148501180	Q5TB24|Q8NCF4	Splice_Site_SNP	SNP	ENST00000369111.4	37	CCDS947.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068584	0.76301	.	.	ENSG00000118298	ENST00000369111	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9363	0.79712	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CA14	148501180	1.000000	0.71417	0.991000	0.47740	0.977000	0.68977	6.713000	0.74686	2.642000	0.89623	0.462000	0.41574	.		0.547	CA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035064.2	NM_012113	Intron	Splice_Site_SNP
POGZ	23126	genome.wustl.edu	37	1	151400755	151400755	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr1:151400755G>C	ENST00000271715.2	-	6	1017	c.703C>G	c.(703-705)Ctt>Gtt	p.L235V	POGZ_ENST00000531094.1_Missense_Mutation_p.L182V|POGZ_ENST00000361398.3_Missense_Mutation_p.L182V|POGZ_ENST00000368863.2_Missense_Mutation_p.L140V|POGZ_ENST00000491586.1_Missense_Mutation_p.L182V|POGZ_ENST00000409503.1_Missense_Mutation_p.L235V|POGZ_ENST00000540984.1_Intron|POGZ_ENST00000392723.1_Missense_Mutation_p.L182V	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	235					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L235V(1)		NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CGAATGGTAAGAGTGGCCGGG	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											292.0	279.0	284.0					1																	151400755		2203	4300	6503	149667379	SO:0001583	missense	23126			AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.703C>G	1.37:g.151400755G>C	ENSP00000271715:p.Leu235Val		149667379	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	37	CCDS997.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869012	0.72065	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000491586;ENST00000437847	D;D;D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53	5.04	5.04	0.67666	.	0.000000	0.64402	D	0.000011	T	0.79493	0.4455	N	0.19112	0.55	0.80722	D	1	D;P;D;D;D;D;D	0.71674	0.997;0.956;0.998;0.992;0.99;0.974;0.997	D;D;D;D;D;D;D	0.77557	0.978;0.931;0.99;0.984;0.979;0.969;0.978	T	0.82345	-0.0503	10	0.54805	T	0.06	-15.8125	17.1134	0.86682	0.0:0.0:1.0:0.0	.	182;235;140;235;182;182;235	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-4;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;.;POGZ_HUMAN	V	182;235;182;140;235;182;182;235	ENSP00000376484:L182V;ENSP00000271715:L235V;ENSP00000354467:L182V;ENSP00000357856:L140V;ENSP00000386836:L235V;ENSP00000431259:L182V;ENSP00000418408:L182V	ENSP00000271715:L235V	L	-	1	0	POGZ	149667379	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.881000	0.75584	2.615000	0.88500	0.467000	0.42956	CTT		0.597	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171		Missense_Mutation
ARFIP1	27236	genome.wustl.edu	37	4	153809373	153809373	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr4:153809373C>G	ENST00000451320.2	+	8	1044	c.880C>G	c.(880-882)Cag>Gag	p.Q294E	ARFIP1_ENST00000405727.2_Missense_Mutation_p.Q262E|ARFIP1_ENST00000429148.2_Missense_Mutation_p.Q114E|ARFIP1_ENST00000356064.3_Missense_Mutation_p.Q262E|ARFIP1_ENST00000353617.2_Missense_Mutation_p.Q294E			P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1	294	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				intracellular protein transport (GO:0006886)|regulation of protein secretion (GO:0050708)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)		p.Q294E(1)	ARFIP1/FHDC1(2)	cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(180;0.093)					TGAGCAGTCACAGCATCTCTT	0.368																																																1	Substitution - Missense(1)	ovary(1)	4											121.0	111.0	114.0					4																	153809373		2203	4300	6503	154028823	SO:0001583	missense	27236			U52521	CCDS3780.1, CCDS34080.1	4q31.3	2008-08-01	2008-08-01			ENSG00000164144			21496	protein-coding gene	gene with protein product	"""arfaptin 1"""	605928				9038142, 10413101	Standard	NM_001025595		Approved	HSU52521	uc003imz.3	P53367		ENST00000451320.2:c.880C>G	4.37:g.153809373C>G	ENSP00000395083:p.Gln294Glu		154028823	Q2M2X4|Q3SYL4|Q9Y2X6	Missense_Mutation	SNP	ENST00000451320.2	37	CCDS34080.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723568	0.89298	.	.	ENSG00000164144	ENST00000451320;ENST00000429148;ENST00000353617;ENST00000405727;ENST00000356064	T;T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4;-1.4	5.85	5.85	0.93711	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.88826	0.6542	M	0.68952	2.095	0.80722	D	1	P;P;D	0.61697	0.836;0.473;0.99	P;B;D	0.69824	0.463;0.11;0.966	D	0.86073	0.1539	10	0.33940	T	0.23	-8.7562	20.1731	0.98165	0.0:1.0:0.0:0.0	.	114;262;294	B4DS69;Q2M2X4;P53367	.;.;ARFP1_HUMAN	E	294;114;294;262;262	ENSP00000395083:Q294E;ENSP00000396653:Q114E;ENSP00000296557:Q294E;ENSP00000384189:Q262E;ENSP00000348360:Q262E	ENSP00000296557:Q294E	Q	+	1	0	ARFIP1	154028823	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.768000	0.95171	0.655000	0.94253	CAG		0.368	ARFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365032.1	NM_014447		Missense_Mutation
HTR5A	3361	genome.wustl.edu	37	7	154876012	154876012	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr7:154876012T>G	ENST00000287907.2	+	2	1465	c.889T>G	c.(889-891)Tgc>Ggc	p.C297G	HTR5A_ENST00000486819.1_3'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	297					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)	p.C297G(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	GTTCGTGCTCTGCTGGATCCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	7											229.0	185.0	200.0					7																	154876012		2203	4300	6503	154506945	SO:0001583	missense	3361				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.889T>G	7.37:g.154876012T>G	ENSP00000287907:p.Cys297Gly		154506945	Q2M2D2	Missense_Mutation	SNP	ENST00000287907.2	37	CCDS5936.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	t	20.9	4.059641	0.76074	.	.	ENSG00000157219	ENST00000287907	T	0.54071	0.59	4.93	4.93	0.64822	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.83344	0.5234	H	0.98965	4.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90189	0.4248	10	0.87932	D	0	.	14.594	0.68392	0.0:0.0:0.0:1.0	.	297	P47898	5HT5A_HUMAN	G	297	ENSP00000287907:C297G	ENSP00000287907:C297G	C	+	1	0	HTR5A	154506945	1.000000	0.71417	0.993000	0.49108	0.704000	0.40688	7.699000	0.84547	1.845000	0.53610	0.533000	0.62120	TGC		0.612	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012		Missense_Mutation
GPR149	344758	genome.wustl.edu	37	3	154146819	154146819	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr3:154146819T>C	ENST00000389740.2	-	1	685	c.586A>G	c.(586-588)Atc>Gtc	p.I196V		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	196					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I196V(1)		autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GCGTACACGATAGAGAGGAAT	0.642																																																1	Substitution - Missense(1)	ovary(1)	3											47.0	53.0	51.0					3																	154146819		2034	4186	6220	155629513	SO:0001583	missense	344758			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.586A>G	3.37:g.154146819T>C	ENSP00000374390:p.Ile196Val		155629513		Missense_Mutation	SNP	ENST00000389740.2	37	CCDS43162.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	0.709	-0.787796	0.02884	.	.	ENSG00000174948	ENST00000389740	T	0.36340	1.26	5.41	1.27	0.21489	GPCR, rhodopsin-like superfamily (1);	0.874705	0.10482	N	0.669506	T	0.19805	0.0476	N	0.17872	0.535	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27157	-1.0082	10	0.17832	T	0.49	-2.6402	6.1675	0.20398	0.1227:0.5418:0.0:0.3355	.	196	Q86SP6	GP149_HUMAN	V	196	ENSP00000374390:I196V	ENSP00000374390:I196V	I	-	1	0	GPR149	155629513	0.000000	0.05858	0.084000	0.20598	0.002000	0.02628	-0.116000	0.10724	0.640000	0.30582	-0.242000	0.12053	ATC		0.642	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580		Missense_Mutation
DUSP27	92235	genome.wustl.edu	37	1	167097259	167097259	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr1:167097259G>A	ENST00000361200.2	+	6	3057	c.2891G>A	c.(2890-2892)aGa>aAa	p.R964K	DUSP27_ENST00000271385.5_Missense_Mutation_p.R964K|DUSP27_ENST00000443333.1_Missense_Mutation_p.R964K|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	964	Ser-rich.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R964K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AAGTACACCAGATCGTCCCTG	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											61.0	55.0	57.0					1																	167097259		2203	4300	6503	165363883	SO:0001583	missense	92235			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2891G>A	1.37:g.167097259G>A	ENSP00000354483:p.Arg964Lys		165363883	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	CCDS30932.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	16.48	3.136070	0.56936	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03689	3.84;3.84;3.84	5.42	5.42	0.78866	.	0.000000	0.53938	D	0.000045	T	0.02610	0.0079	M	0.65975	2.015	0.27363	N	0.955915	P	0.48503	0.911	B	0.39185	0.293	T	0.19976	-1.0289	10	0.87932	D	0	-23.0185	12.5574	0.56261	0.0761:0.0:0.9239:0.0	.	964	Q5VZP5	DUS27_HUMAN	K	964	ENSP00000354483:R964K;ENSP00000271385:R964K;ENSP00000404874:R964K	ENSP00000271385:R964K	R	+	2	0	DUSP27	165363883	0.988000	0.35896	0.671000	0.29857	0.420000	0.31355	4.532000	0.60608	2.530000	0.85305	0.643000	0.83706	AGA		0.493	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		Missense_Mutation
SLC38A11	151258	genome.wustl.edu	37	2	165795967	165795967	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:165795967A>T	ENST00000409149.3	-	5	653	c.362T>A	c.(361-363)cTt>cAt	p.L121H	SLC38A11_ENST00000493887.1_5'Flank|SLC38A11_ENST00000303735.4_Missense_Mutation_p.L99H|SLC38A11_ENST00000409058.1_Missense_Mutation_p.L152H|SLC38A11_ENST00000409662.1_Missense_Mutation_p.L121H	NM_001199148.1	NP_001186077.1	Q08AI6	S38AB_HUMAN	solute carrier family 38, member 11	121					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)		p.L99H(1)		endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15						TACCTTTCCAAGCTTTGCTAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	2											96.0	94.0	95.0					2																	165795967		2203	4299	6502	165504213	SO:0001583	missense	151258				CCDS2224.1, CCDS56142.1	2q24.3	2013-05-22			ENSG00000169507	ENSG00000169507		"""Solute carriers"""	26836	protein-coding gene	gene with protein product							Standard	NM_173512		Approved	FLJ39822, AVT2	uc002ucw.2	Q08AI6	OTTHUMG00000132144	ENST00000409149.3:c.362T>A	2.37:g.165795967A>T	ENSP00000386272:p.Leu121His		165504213	B4DF99|Q8N887	Missense_Mutation	SNP	ENST00000409149.3	37	CCDS56142.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	23.4	4.410990	0.83340	.	.	ENSG00000169507	ENST00000303735;ENST00000409149;ENST00000409058;ENST00000409662	T;T;T;T	0.05649	3.41;3.41;3.41;3.41	5.97	5.97	0.96955	.	0.056893	0.64402	D	0.000001	T	0.32793	0.0841	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.29150	-1.0021	10	0.87932	D	0	-28.97	13.9686	0.64225	1.0:0.0:0.0:0.0	.	121;99	Q08AI6;Q08AI6-2	S38AB_HUMAN;.	H	99;121;152;121	ENSP00000306178:L99H;ENSP00000386272:L121H;ENSP00000387345:L152H;ENSP00000386774:L121H	ENSP00000306178:L99H	L	-	2	0	SLC38A11	165504213	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	8.105000	0.89553	2.275000	0.75901	0.533000	0.62120	CTT		0.363	SLC38A11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333390.1	NM_173512		Missense_Mutation
WWC1	23286	genome.wustl.edu	37	5	167894880	167894880	+	Silent	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr5:167894880G>A	ENST00000265293.4	+	22	3688	c.3186G>A	c.(3184-3186)caG>caA	p.Q1062Q	WWC1_ENST00000522140.1_3'UTR|WWC1_ENST00000521089.1_Silent_p.Q1068Q	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	1062	Interaction with histone H3.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)	p.Q1062Q(1)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		GTGAGCTTCAGACAGACAAGA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	5											76.0	73.0	74.0					5																	167894880		2203	4300	6503	167827458	SO:0001819	synonymous_variant	23286			AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.3186G>A	5.37:g.167894880G>A			167827458	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Silent	SNP	ENST00000265293.4	37	CCDS4366.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	8.980	0.975195	0.18736	.	.	ENSG00000113645	ENST00000393895;ENST00000524228	.	.	.	5.29	4.41	0.53225	.	.	.	.	.	T	0.62258	0.2413	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60063	-0.7336	4	.	.	.	.	10.8617	0.46831	0.1537:0.0:0.8463:0.0	.	.	.	.	N	1029;838	.	.	D	+	1	0	WWC1	167827458	0.999000	0.42202	0.642000	0.29436	0.969000	0.65631	0.469000	0.22067	1.203000	0.43233	0.591000	0.81541	GAC		0.582	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238		Silent
PALLD	23022	genome.wustl.edu	37	4	169824955	169824955	+	Silent	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr4:169824955C>T	ENST00000505667.1	+	15	2693	c.2520C>T	c.(2518-2520)caC>caT	p.H840H	CBR4_ENST00000509108.1_Intron|PALLD_ENST00000512127.1_Silent_p.H441H|PALLD_ENST00000507735.1_Silent_p.H336H|PALLD_ENST00000261509.6_Silent_p.H823H|PALLD_ENST00000335742.7_Silent_p.H665H			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	1047	Interaction with ACTN.|Pro-rich.				cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)	p.H823H(1)		breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		AGAGTGATCACTACACCATTC	0.413									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)											1	Substitution - coding silent(1)	ovary(1)	4											104.0	100.0	101.0					4																	169824955		2203	4300	6503	170061530	SO:0001819	synonymous_variant	23022	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.2520C>T	4.37:g.169824955C>T			170061530	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Silent	SNP	ENST00000505667.1	37	CCDS54818.1	SNP	20	WashU																																																																																				0.413	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081		Silent
CDCA7	83879	genome.wustl.edu	37	2	174230274	174230274	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:174230274A>G	ENST00000347703.3	+	6	896	c.752A>G	c.(751-753)gAg>gGg	p.E251G	CDCA7_ENST00000410019.3_Missense_Mutation_p.E209G|CDCA7_ENST00000410101.3_Missense_Mutation_p.E286G|CDCA7_ENST00000306721.3_Missense_Mutation_p.E330G|CDCA7_ENST00000392567.2_Missense_Mutation_p.E251G	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7	251	Mediates transcriptional activity.				apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E330G(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			GAGGAGTTGGAGAACGTCTGC	0.478																																																1	Substitution - Missense(1)	ovary(1)	2											76.0	71.0	73.0					2																	174230274		2203	4300	6503	173938520	SO:0001583	missense	83879			BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.752A>G	2.37:g.174230274A>G	ENSP00000272789:p.Glu251Gly		173938520	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Missense_Mutation	SNP	ENST00000347703.3	37	CCDS2253.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	16.13	3.037366	0.54896	.	.	ENSG00000144354	ENST00000347703;ENST00000392567;ENST00000306721;ENST00000410101;ENST00000410019	T;T;T;T;T	0.50277	0.79;0.75;0.77;0.8;0.79	5.71	3.3	0.37823	.	0.512426	0.24035	N	0.042146	T	0.45196	0.1330	L	0.54323	1.7	0.31247	N	0.694481	B;B;B;B	0.23185	0.081;0.081;0.081;0.057	B;B;B;B	0.32533	0.08;0.05;0.034;0.147	T	0.51647	-0.8679	10	0.59425	D	0.04	-7.0781	9.474	0.38860	0.7877:0.0:0.2123:0.0	.	209;286;251;330	B4DLP8;B4DV66;Q9BWT1;Q9BWT1-2	.;.;CDCA7_HUMAN;.	G	251;251;330;286;209	ENSP00000272789:E251G;ENSP00000376348:E251G;ENSP00000306968:E330G;ENSP00000386656:E286G;ENSP00000386833:E209G	ENSP00000306968:E330G	E	+	2	0	CDCA7	173938520	1.000000	0.71417	0.979000	0.43373	0.862000	0.49288	2.218000	0.42889	0.434000	0.26340	0.402000	0.26972	GAG		0.478	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255400.1	NM_031942		Missense_Mutation
MGAT1	4245	genome.wustl.edu	37	5	180219413	180219413	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr5:180219413G>A	ENST00000446023.2	-	3	1309	c.559C>T	c.(559-561)Cgc>Tgc	p.R187C	MGAT1_ENST00000333055.3_Missense_Mutation_p.R187C|MGAT1_ENST00000307826.4_Missense_Mutation_p.R187C|MGAT1_ENST00000427865.2_Missense_Mutation_p.R187C|MGAT1_ENST00000393340.3_Missense_Mutation_p.R187C	NM_001114617.1|NM_001114618.1	NP_001108089.1|NP_001108090.1	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	187					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine catabolic process (GO:0006049)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	acetylglucosaminyltransferase activity (GO:0008375)|alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0003827)|metal ion binding (GO:0046872)	p.R187C(1)		endometrium(1)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	13	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGGTAGTGGCGCGCGATCTTG	0.682																																																1	Substitution - Missense(1)	ovary(1)	5											40.0	46.0	44.0					5																	180219413		2201	4296	6497	180152019	SO:0001583	missense	4245			M61829	CCDS4458.1	5q35.3	2013-02-25			ENSG00000131446	ENSG00000131446	2.4.1.101	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7044	protein-coding gene	gene with protein product		160995		MGAT, GLYT1		1827260	Standard	NM_002406		Approved	GNT-1, GLCNAC-TI	uc003mmg.4	P26572	OTTHUMG00000130937	ENST00000446023.2:c.559C>T	5.37:g.180219413G>A	ENSP00000404718:p.Arg187Cys		180152019	A8K404|B3KRU8|D3DWR1|Q6IBE3	Missense_Mutation	SNP	ENST00000446023.2	37	CCDS4458.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	15.53	2.859990	0.51482	.	.	ENSG00000131446	ENST00000333055;ENST00000307826;ENST00000446023;ENST00000393340;ENST00000427865;ENST00000504671	D;D;D;D;D;D	0.88896	-2.44;-2.44;-2.44;-2.44;-2.44;-2.44	5.09	-0.559	0.11792	.	0.000000	0.85682	D	0.000000	D	0.93615	0.7961	M	0.88241	2.94	0.54753	D	0.999984	D	0.89917	1.0	D	0.97110	1.0	D	0.91893	0.5525	10	0.87932	D	0	-28.1319	9.0051	0.36106	0.0757:0.0:0.4613:0.463	.	187	P26572	MGAT1_HUMAN	C	187	ENSP00000332073:R187C;ENSP00000311888:R187C;ENSP00000404718:R187C;ENSP00000377010:R187C;ENSP00000402838:R187C;ENSP00000424891:R187C	ENSP00000311888:R187C	R	-	1	0	MGAT1	180152019	0.522000	0.26266	0.080000	0.20451	0.851000	0.48451	0.748000	0.26305	-0.004000	0.14419	0.655000	0.94253	CGC		0.682	MGAT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368189.1	NM_001114618		Missense_Mutation
FRZB	2487	genome.wustl.edu	37	2	183730937	183730937	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:183730937G>T	ENST00000295113.4	-	1	953	c.344C>A	c.(343-345)gCc>gAc	p.A115D		NM_001463.3	NP_001454.2	Q92765	SFRP3_HUMAN	frizzled-related protein	115	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				brain development (GO:0007420)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell development (GO:0010721)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hepatocyte differentiation (GO:0070367)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell differentiation (GO:0014033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fat cell differentiation (GO:0045600)|skeletal system development (GO:0001501)|somite development (GO:0061053)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.A115D(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			GCCCTGCCGGGCCCGCTCGCA	0.622																																																1	Substitution - Missense(1)	ovary(1)	2											42.0	43.0	43.0					2																	183730937		2203	4300	6503	183439182	SO:0001583	missense	2487			U24163	CCDS2286.1	2q32.1	2013-09-19			ENSG00000162998	ENSG00000162998		"""Secreted frizzled-related proteins"""	3959	protein-coding gene	gene with protein product		605083				8824257, 9118218	Standard	NM_001463		Approved	FRZB-PEN, FRZB1, SRFP3, FRP-3, SFRP3, FRE, FRITZ, FRZB-1, FZRB, hFIZ	uc002upa.2	Q92765	OTTHUMG00000132597	ENST00000295113.4:c.344C>A	2.37:g.183730937G>T	ENSP00000295113:p.Ala115Asp		183439182	O00181|Q99686	Missense_Mutation	SNP	ENST00000295113.4	37	CCDS2286.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	32	5.174333	0.94807	.	.	ENSG00000162998	ENST00000295113	T	0.81330	-1.48	5.04	5.04	0.67666	Frizzled domain (5);	0.000000	0.85682	D	0.000000	D	0.92538	0.7630	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94245	0.7488	10	0.87932	D	0	.	18.5725	0.91140	0.0:0.0:1.0:0.0	.	115	Q92765	SFRP3_HUMAN	D	115	ENSP00000295113:A115D	ENSP00000295113:A115D	A	-	2	0	FRZB	183439182	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.542000	0.98086	2.611000	0.88343	0.462000	0.41574	GCC		0.622	FRZB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255808.1	NM_001463		Missense_Mutation
MASP1	5648	genome.wustl.edu	37	3	186954120	186954120	+	Intron	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr3:186954120C>T	ENST00000337774.5	-	10	1693				MASP1_ENST00000296280.6_Silent_p.K513K|MASP1_ENST00000495249.1_5'UTR|MASP1_ENST00000392472.2_Silent_p.K400K	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)						complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TGACATGCTCCTTGGAGACTG	0.597																																																0			3											106.0	92.0	96.0					3																	186954120		2203	4300	6503	188436814	SO:0001627	intron_variant	5648			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1303+5148G>A	3.37:g.186954120C>T			188436814	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	ENST00000337774.5	37	CCDS33907.1	SNP	24	WashU																																																																																				0.597	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879		Silent
TFRC	7037	genome.wustl.edu	37	3	195798994	195798994	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr3:195798994C>T	ENST00000360110.4	-	5	633	c.464G>A	c.(463-465)cGt>cAt	p.R155H	RNU7-18P_ENST00000516365.1_RNA|TFRC_ENST00000420415.1_Missense_Mutation_p.R74H|TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000535031.1_De_novo_Start_OutOfFrame|TFRC_ENST00000392396.3_Missense_Mutation_p.R155H	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	155					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)	p.R155H(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	TCCAGCCTCACGAGGGACATA	0.333			T	BCL6	NHL																																		Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	1	Substitution - Missense(1)	ovary(1)	3											72.0	72.0	72.0					3																	195798994		2203	4300	6503	197283391	SO:0001583	missense	7037			X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.464G>A	3.37:g.195798994C>T	ENSP00000353224:p.Arg155His		197283391	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Missense_Mutation	SNP	ENST00000360110.4	37	CCDS3312.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884309	0.51908	.	.	ENSG00000072274	ENST00000360110;ENST00000420415;ENST00000392396	T;T;T	0.62105	0.05;0.05;0.05	5.68	4.8	0.61643	.	0.306462	0.40640	N	0.001058	T	0.52403	0.1732	M	0.62266	1.93	0.80722	D	1	B	0.25105	0.118	B	0.10450	0.005	T	0.47787	-0.9090	10	0.02654	T	1	-10.3439	13.2258	0.59914	0.0:0.9183:0.0:0.0817	.	155	P02786	TFR1_HUMAN	H	155;74;155	ENSP00000353224:R155H;ENSP00000390133:R74H;ENSP00000376197:R155H	ENSP00000353224:R155H	R	-	2	0	TFRC	197283391	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.160000	0.31761	2.847000	0.97988	0.591000	0.81541	CGT		0.333	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341346.1			Missense_Mutation
CPS1	1373	genome.wustl.edu	37	2	211476989	211476989	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:211476989G>C	ENST00000233072.5	+	20	2736	c.2540G>C	c.(2539-2541)aGc>aCc	p.S847T	CPS1_ENST00000430249.2_Missense_Mutation_p.S853T|CPS1_ENST00000451903.2_Missense_Mutation_p.S396T	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	847					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.S847T(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TCTGAACCAAGCAGCACGCGT	0.438																																																1	Substitution - Missense(1)	ovary(1)	2											105.0	103.0	104.0					2																	211476989		2203	4300	6503	211185234	SO:0001583	missense	1373			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2540G>C	2.37:g.211476989G>C	ENSP00000233072:p.Ser847Thr		211185234	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	1.629	-0.519526	0.04171	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.96168	-3.93;-3.93;-3.93	5.65	4.77	0.60923	Carbamoyl-phosphate synthetase, large subunit, oligomerisation (3);	0.207754	0.52532	N	0.000068	D	0.88247	0.6385	N	0.11154	0.105	0.39298	D	0.964858	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.005	T	0.83109	-0.0124	10	0.02654	T	1	0.7729	16.6933	0.85327	0.0:0.8685:0.1315:0.0	.	857;847	Q59HF8;P31327	.;CPSM_HUMAN	T	853;855;847;396	ENSP00000402608:S853T;ENSP00000233072:S847T;ENSP00000406136:S396T	ENSP00000233072:S847T	S	+	2	0	CPS1	211185234	1.000000	0.71417	0.987000	0.45799	0.402000	0.30811	4.713000	0.61895	1.380000	0.46344	-0.265000	0.10407	AGC		0.438	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			Missense_Mutation
UGT1A1	54658	genome.wustl.edu	37	2	234526510	234526510	+	Missense_Mutation	SNP	C	C	T	rs45504099	byFrequency	TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:234526510C>T	ENST00000373450.4	+	1	220	c.157C>T	c.(157-159)Cat>Tat	p.H53Y		NM_019076.4	NP_061949.3	P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	55					acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)	p.H53Y(1)		breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	CCTCAGGGGGCATGAGGTGGT	0.522																																																1	Substitution - Missense(1)	ovary(1)	2											98.0	84.0	89.0					2																	234526510		2203	4298	6501	234191249	SO:0001583	missense	54576			M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000373450.4:c.157C>T	2.37:g.234526510C>T	ENSP00000362549:p.His53Tyr		234191249	A6NJC3|B8K286	Missense_Mutation	SNP	ENST00000373450.4	37	CCDS33402.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058140	0.36277	.	.	ENSG00000242366	ENST00000373450	T	0.68903	-0.36	3.96	3.96	0.45880	.	.	.	.	.	D	0.87148	0.6105	H	0.95850	3.73	0.38961	D	0.958559	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.92518	0.6022	9	0.87932	D	0	.	16.6114	0.84884	0.0:1.0:0.0:0.0	.	53;53	Q5DSZ6;Q9HAW9	.;UD18_HUMAN	Y	53	ENSP00000362549:H53Y	ENSP00000362549:H53Y	H	+	1	0	UGT1A8	234191249	1.000000	0.71417	0.739000	0.30968	0.026000	0.11368	5.323000	0.65858	2.226000	0.72624	0.505000	0.49811	CAT		0.522	UGT1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130994.1			Missense_Mutation
BMP2K	55589	genome.wustl.edu	37	4	79786722	79786722	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	G	C	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr4:79786722C>G	ENST00000335016.5	+	10	1245	c.1079C>G	c.(1078-1080)aCc>aGc	p.T360S	BMP2K_ENST00000502871.1_Missense_Mutation_p.T360S	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	360					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)	p.T360S(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						ATAACAGATACCATTGGACCA	0.368																																																1	Substitution - Missense(1)	ovary(1)	4											98.0	91.0	93.0					4																	79786722		2203	4300	6503	80005746	SO:0001583	missense	55589			AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1079C>G	4.37:g.79786722C>G	ENSP00000334836:p.Thr360Ser		80005746	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	ENST00000335016.5	37	CCDS47083.1	SNP	18	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.43|15.43	2.831991|2.831991	0.50845|0.50845	.|.	.|.	ENSG00000138756|ENSG00000138756	ENST00000502871;ENST00000335016;ENST00000264889|ENST00000502613	T;T|.	0.71341|.	2.05;-0.56|.	5.26|5.26	5.26|5.26	0.73747|0.73747	Protein kinase-like domain (1);|.	0.378699|.	0.27437|.	N|.	0.019370|.	T|.	0.61350|.	0.2340|.	L|L	0.39020|0.39020	1.185|1.185	0.35972|0.35972	D|D	0.835412|0.835412	B;B|.	0.28998|.	0.112;0.23|.	B;B|.	0.27076|.	0.076;0.05|.	T|.	0.63301|.	-0.6668|.	10|.	0.23891|.	T|.	0.37|.	-12.5546|-12.5546	19.2484|19.2484	0.93912|0.93912	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	360;360|.	Q9NSY1;Q4W5H2|.	BMP2K_HUMAN;.|.	S|X	360;360;374|52	ENSP00000421768:T360S;ENSP00000334836:T360S|.	ENSP00000264889:T374S|.	T|Y	+|+	2|3	0|2	BMP2K|BMP2K	80005746|80005746	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	2.570000|2.570000	0.45981|0.45981	2.629000|2.629000	0.89072|0.89072	0.655000|0.655000	0.94253|0.94253	ACC|TAC		0.368	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593		Missense_Mutation
PTPRF	5792	genome.wustl.edu	37	1	44069511	44069511	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr1:44069511C>G	ENST00000359947.4	+	16	3028	c.2688C>G	c.(2686-2688)aaC>aaG	p.N896K	PTPRF_ENST00000438120.1_Missense_Mutation_p.N887K|PTPRF_ENST00000372414.3_Missense_Mutation_p.N896K|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000422171.2_Missense_Mutation_p.N244K|PTPRF_ENST00000372413.3_Missense_Mutation_p.N887K	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	896	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.N886K(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTGCCAAGAACCGGGCTGGCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											53.0	56.0	55.0					1																	44069511		2203	4300	6503	43842098	SO:0001583	missense	5792			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.2688C>G	1.37:g.44069511C>G	ENSP00000353030:p.Asn896Lys		43842098	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	SNP	18	WashU	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	15.56|15.56|15.56	2.868728|2.868728|2.868728	0.51588|0.51588|0.51588	.|.|.	.|.|.	ENSG00000142949|ENSG00000142949|ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171|ENST00000414879|ENST00000429895	T;T;T;T;T|.|.	0.62232|.|.	0.04;0.04;0.04;0.04;0.04|.|.	5.03|5.03|5.03	4.12|4.12|4.12	0.48240|0.48240|0.48240	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.|.	0.000000|.|.	0.37437|.|.	N|.|.	0.002090|.|.	T|T|T	0.80534|0.80534|0.80534	0.4641|0.4641|0.4641	M|M|M	0.92880|0.92880|0.92880	3.355|3.355|3.355	0.58432|0.58432|0.58432	D|D|D	0.999998|0.999998|0.999998	D;D;P;D|.|.	0.89917|.|.	0.999;0.994;0.884;1.0|.|.	D;D;P;D|.|.	0.91635|.|.	0.994;0.953;0.503;0.999|.|.	D|D|D	0.84066|0.84066|0.84066	0.0377|0.0377|0.0377	10|5|5	0.59425|.|.	D|.|.	0.04|.|.	.|.|.	10.9193|10.9193|10.9193	0.47154|0.47154|0.47154	0.0:0.8481:0.0:0.1519|0.0:0.8481:0.0:0.1519|0.0:0.8481:0.0:0.1519	.|.|.	541;244;887;896|.|.	Q59FI2;F2Z3B8;P10586-2;P10586|.|.	.;.;.;PTPRF_HUMAN|.|.	K|A|S	896;887;896;887;244|310|542	ENSP00000353030:N896K;ENSP00000398822:N887K;ENSP00000361491:N896K;ENSP00000361490:N887K;ENSP00000387885:N244K|.|.	ENSP00000353030:N896K|.|.	N|P|T	+|+|+	3|1|2	2|0|0	PTPRF|PTPRF|PTPRF	43842098|43842098|43842098	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.437000|0.437000|0.437000	0.31866|0.31866|0.31866	4.892000|4.892000|4.892000	0.63193|0.63193|0.63193	1.264000|1.264000|1.264000	0.44198|0.44198|0.44198	-0.136000|-0.136000|-0.136000	0.14681|0.14681|0.14681	AAC|CCG|ACC		0.607	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1			Missense_Mutation
CRTAC1	55118	genome.wustl.edu	37	10	99643995	99643995	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr10:99643995C>T	ENST00000370597.3	-	12	1955	c.1600G>A	c.(1600-1602)Gag>Aag	p.E534K	CRTAC1_ENST00000370591.2_Missense_Mutation_p.E534K|CRTAC1_ENST00000298819.4_Missense_Mutation_p.E534K|CRTAC1_ENST00000468549.1_5'UTR	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	534						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.E534K(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		AGTGTGTCCTCATCCCGGGGG	0.622																																																1	Substitution - Missense(1)	ovary(1)	10											66.0	44.0	51.0					10																	99643995		2201	4299	6500	99633985	SO:0001583	missense	55118			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.1600G>A	10.37:g.99643995C>T	ENSP00000359629:p.Glu534Lys		99633985	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	SNP	ENST00000370597.3	37	CCDS31266.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	16.28	3.079725	0.55753	.	.	ENSG00000095713	ENST00000413387;ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	T;T;T;T;T	0.73469	1.49;-0.75;1.49;0.1;0.1	5.45	5.45	0.79879	.	0.452872	0.23189	N	0.050925	T	0.59838	0.2223	L	0.42245	1.32	0.34104	D	0.662202	P;B;B	0.37276	0.589;0.255;0.309	B;B;B	0.30316	0.114;0.034;0.037	T	0.64601	-0.6369	10	0.07644	T	0.81	-12.4926	12.2784	0.54751	0.0:0.9176:0.0:0.0824	.	534;534;430	Q9NQ79-2;Q9NQ79;Q5T4F6	.;CRAC1_HUMAN;.	K	430;534;534;526;534	ENSP00000408445:E430K;ENSP00000359629:E534K;ENSP00000298819:E534K;ENSP00000310810:E526K;ENSP00000359623:E534K	ENSP00000298819:E534K	E	-	1	0	CRTAC1	99633985	0.308000	0.24509	0.794000	0.32065	0.769000	0.43574	2.326000	0.43849	2.572000	0.86782	0.462000	0.41574	GAG		0.622	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1	NM_018058		Missense_Mutation
PLCB3	5331	genome.wustl.edu	37	11	64029960	64029960	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr11:64029960G>A	ENST00000540288.1	+	18	2223	c.2120G>A	c.(2119-2121)cGg>cAg	p.R707Q	PLCB3_ENST00000325234.5_Missense_Mutation_p.R640Q|PLCB3_ENST00000279230.6_Missense_Mutation_p.R707Q	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	707					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.R707Q(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						TTCATGCGGCGGCCGGACAAG	0.652																																																1	Substitution - Missense(1)	ovary(1)	11											64.0	72.0	69.0					11																	64029960		2201	4297	6498	63786536	SO:0001583	missense	5331			Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.2120G>A	11.37:g.64029960G>A	ENSP00000443631:p.Arg707Gln		63786536	A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	ENST00000540288.1	37	CCDS8064.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.869140	0.97049	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.53206	0.63;0.63;0.63	5.36	5.36	0.76844	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.000000	0.85682	D	0.000000	T	0.60586	0.2280	L	0.38733	1.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.59150	-0.7508	10	0.44086	T	0.13	.	17.8548	0.88759	0.0:0.0:1.0:0.0	.	640;707	G5E960;Q01970	.;PLCB3_HUMAN	Q	707;707;640	ENSP00000279230:R707Q;ENSP00000443631:R707Q;ENSP00000324660:R640Q	ENSP00000279230:R707Q	R	+	2	0	PLCB3	63786536	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.753000	0.98904	2.518000	0.84900	0.591000	0.81541	CGG		0.652	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1			Missense_Mutation
COL2A1	1280	genome.wustl.edu	37	12	48386684	48386684	+	Missense_Mutation	SNP	G	G	A	rs372264296		TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr12:48386684G>A	ENST00000380518.3	-	16	1164	c.1000C>T	c.(1000-1002)Cgg>Tgg	p.R334W	COL2A1_ENST00000337299.6_Missense_Mutation_p.R265W	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	334	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.R265W(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GGGCCAGTCCGTCCTCTTTCA	0.542																																																1	Substitution - Missense(1)	ovary(1)	12						G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	91.0	71.0	78.0		1000,793	4.6	1.0	12		78	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	COL2A1	NM_001844.4,NM_033150.2	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	334/1488,265/1419	48386684	1,13005	2203	4300	6503	46672951	SO:0001583	missense	1280			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.1000C>T	12.37:g.48386684G>A	ENSP00000369889:p.Arg334Trp		46672951	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	37	CCDS41778.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	21.4	4.145913	0.77888	0.0	1.16E-4	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.93366	-3.21;-3.21	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	D	0.97167	0.9074	M	0.90705	3.14	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.979	D	0.97942	1.0326	10	0.87932	D	0	.	16.636	0.85060	0.0:0.0:1.0:0.0	.	265;334	P02458-1;P02458	.;CO2A1_HUMAN	W	334;265;265	ENSP00000369889:R334W;ENSP00000338213:R265W	ENSP00000338213:R265W	R	-	1	2	COL2A1	46672951	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.185000	0.65076	2.532000	0.85374	0.655000	0.94253	CGG		0.542	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844		Missense_Mutation
IGHD	3495	genome.wustl.edu	37	14	106306852	106306852	+	RNA	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr14:106306852G>A	ENST00000390556.2	-	0	975							P01880	IGHD_HUMAN	immunoglobulin heavy constant delta						immune response (GO:0006955)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										GGGCTGTGGAGGGGGGCGTGC	0.667																																																0			14											9.0	11.0	11.0					14																	106306852		2012	4074	6086	105377897						K02875		14q32.33	2012-03-09			ENSG00000211898	ENSG00000211898		"""Immunoglobulins / IGH locus"""	5480	other	immunoglobulin gene	"""immunoglobulin delta"", ""constant region of heavy chain of IgD"""	147170				3922054	Standard	NG_001019		Approved	FLJ00382, FLJ46727, MGC29633	uc001ysj.3	P01880	OTTHUMG00000152538		14.37:g.106306852G>A			105377897	Q6P4I8|Q8WU38	Missense_Mutation	SNP	ENST00000390556.2	37		SNP	35	WashU																																																																																				0.667	IGHD-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IG_C_gene	OTTHUMT00000326652.1	NG_001019		Missense_Mutation
NDNL2	56160	genome.wustl.edu	37	15	29561198	29561199	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr15:29561198_29561199TC>AT	ENST00000332303.4	-	1	834_835	c.711_712GA>AT	c.(709-714)cgGAta>cgATta	p.I238L	FAM189A1_ENST00000261275.4_Intron	NM_138704.3	NP_619649.1	Q96MG7	MAGG1_HUMAN	necdin-like 2	238	Interaction with NSMCE1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)|regulation of growth (GO:0040008)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)				breast(3)|large_intestine(2)|lung(3)	8		all_lung(180;4.69e-11)|Breast(32;0.0013)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00736)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GTGTGGGGTATCCGCCGGTATT	0.515																																																0			15																																								27348491	SO:0001583	missense	56160			AF490510	CCDS10023.1	15q13.1	2008-02-01			ENSG00000185115	ENSG00000185115			7677	protein-coding gene	gene with protein product		608243				18086888	Standard	NM_138704		Approved	HCA4, MAGEG1, MAGEL3, NSE3, NSMCE3	uc001zco.3	Q96MG7	OTTHUMG00000129261	ENST00000332303.4:c.711_712delinsAT	15.37:g.29561198_29561199delinsAT	ENSP00000330694:p.Ile238Leu		27348490	Q8IW16|Q8TEI6|Q9H214	Missense	DNP	ENST00000332303.4	37	CCDS10023.1	DNP	50	WashU																																																																																				0.515	NDNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251370.1	NM_138704		Missense
SPATA8	145946	genome.wustl.edu	37	15	97328234	97328234	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	C	T	T	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr15:97328234T>C	ENST00000328504.3	+	3	472	c.205T>C	c.(205-207)Tgt>Cgt	p.C69R	SPATA8_ENST00000558553.1_Missense_Mutation_p.L28P|SPATA8-AS1_ENST00000558722.1_RNA	NM_173499.3	NP_775770.1	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8	69								p.C69R(1)		large_intestine(4)|lung(8)|ovary(1)|skin(3)	16	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			AGAGAACAGCTGTTCTCACGG	0.453																																																1	Substitution - Missense(1)	ovary(1)	15											136.0	129.0	131.0					15																	97328234		2197	4298	6495	95129238	SO:0001583	missense	145946			AY489187	CCDS10376.1	15q26	2008-02-05			ENSG00000185594	ENSG00000185594			28676	protein-coding gene	gene with protein product		613948					Standard	NM_173499		Approved	MGC44294	uc002bue.3	Q6RVD6	OTTHUMG00000149847	ENST00000328504.3:c.205T>C	15.37:g.97328234T>C	ENSP00000328149:p.Cys69Arg		95129238	Q2KJ07	Missense_Mutation	SNP	ENST00000328504.3	37	CCDS10376.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	6.999	0.554483	0.13374	.	.	ENSG00000185594	ENST00000328504	T	0.33216	1.42	3.03	2.09	0.27110	.	.	.	.	.	T	0.15176	0.0366	N	0.08118	0	0.09310	N	1	B	0.30068	0.267	B	0.27380	0.079	T	0.18587	-1.0332	9	0.87932	D	0	.	7.286	0.26340	0.0:0.0:0.719:0.281	.	69	Q6RVD6	SPAT8_HUMAN	R	69	ENSP00000328149:C69R	ENSP00000328149:C69R	C	+	1	0	SPATA8	95129238	0.000000	0.05858	0.012000	0.15200	0.001000	0.01503	-0.181000	0.09740	0.831000	0.34780	-0.644000	0.03951	TGT		0.453	SPATA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313533.1	NM_173499		Missense_Mutation
SLC4A5	57835	genome.wustl.edu	37	2	74531799	74531799	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:74531799G>T	ENST00000377634.4	-	7	487	c.88C>A	c.(88-90)Cct>Act	p.P30T	SLC4A5_ENST00000358683.4_Intron|SLC4A5_ENST00000346834.4_Missense_Mutation_p.P30T|SLC4A5_ENST00000357822.5_Missense_Mutation_p.P30T|SLC4A5_ENST00000359484.4_Intron|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Missense_Mutation_p.P30T|SLC4A5_ENST00000483195.1_Intron|SLC4A5_ENST00000423644.1_Missense_Mutation_p.P30T|SLC4A5_ENST00000394019.2_Missense_Mutation_p.P30T					solute carrier family 4 (sodium bicarbonate cotransporter), member 5									p.P30T(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						ATGTGGATAGGAGGGCATTCT	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											62.0	62.0	62.0					2																	74531799		2203	4300	6503	74385307	SO:0001583	missense	57835			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.88C>A	2.37:g.74531799G>T	ENSP00000366861:p.Pro30Thr		74385307		Missense_Mutation	SNP	ENST00000377634.4	37	CCDS1936.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	2.559	-0.302379	0.05495	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000423644;ENST00000357822;ENST00000377632;ENST00000377634;ENST00000425249;ENST00000444570;ENST00000436454	T;T;T;T;T;T;T	0.75589	-0.95;-0.76;-0.4;-0.95;-0.76;-0.95;-0.12	4.93	1.21	0.21127	.	0.187555	0.47455	D	0.000237	T	0.29491	0.0735	N	0.00462	-1.47	0.09310	N	0.999999	B;B;B;B	0.14012	0.002;0.002;0.009;0.002	B;B;B;B	0.13407	0.006;0.004;0.009;0.006	T	0.43180	-0.9407	10	0.02654	T	1	.	3.818	0.08824	0.6112:0.1869:0.2018:0.0	.	30;30;30;30	Q9BY07-4;E7EQT3;Q9BY07;Q9BY07-3	.;.;S4A5_HUMAN;.	T	30	ENSP00000377587:P30T;ENSP00000251768:P30T;ENSP00000395804:P30T;ENSP00000350475:P30T;ENSP00000366859:P30T;ENSP00000366861:P30T;ENSP00000405678:P30T	ENSP00000251768:P30T	P	-	1	0	SLC4A5	74385307	0.957000	0.32711	0.523000	0.27875	0.052000	0.14988	1.080000	0.30779	0.115000	0.18071	-0.484000	0.04775	CCT		0.488	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3			Missense_Mutation
FMNL2	114793	genome.wustl.edu	37	2	153417433	153417433	+	Silent	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:153417433C>T	ENST00000288670.9	+	6	847	c.480C>T	c.(478-480)agC>agT	p.S160S		NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	160	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)		p.S160S(1)		central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CTGTGGAGAGCTCGGTGGACA	0.468																																																1	Substitution - coding silent(1)	ovary(1)	2											50.0	51.0	51.0					2																	153417433		1876	4109	5985	153125679	SO:0001819	synonymous_variant	114793			AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.480C>T	2.37:g.153417433C>T			153125679	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Silent	SNP	ENST00000288670.9	37	CCDS46429.1	SNP	28	WashU																																																																																				0.468	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905		Silent
RPL23AP12	391282	genome.wustl.edu	37	21	40499897	40499897	+	IGR	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr21:40499897G>A								AF064858.10 (98844 upstream) : PSMG1 (46797 downstream)																							ATGGAGAGAAGAAGGCATATG	0.423																																																0			21																																								39421767	SO:0001628	intergenic_variant	391282																															21.37:g.40499897G>A			39421767		Silent	SNP		37		SNP	33	WashU																																																																																			0	0.423									Silent
DSCAM	1826	genome.wustl.edu	37	21	41424001	41424001	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr21:41424001T>G	ENST00000400454.1	-	30	5546	c.5069A>C	c.(5068-5070)gAc>gCc	p.D1690A		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1690					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.D1690A(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CTCTCCAAAGTCAGCATCCGT	0.532																																					Melanoma(134;970 1778 1785 21664 32388)											1	Substitution - Missense(1)	ovary(1)	21											90.0	91.0	91.0					21																	41424001		2042	4194	6236	40345871	SO:0001583	missense	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.5069A>C	21.37:g.41424001T>G	ENSP00000383303:p.Asp1690Ala		40345871	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	19.31	3.803132	0.70682	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.62639	0.01;0.11	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.49236	0.1545	N	0.24115	0.695	0.50813	D	0.999891	P	0.43788	0.817	B	0.39339	0.297	T	0.48490	-0.9031	10	0.28530	T	0.3	.	16.1299	0.81422	0.0:0.0:0.0:1.0	.	1690	O60469	DSCAM_HUMAN	A	1690;1442	ENSP00000383303:D1690A;ENSP00000385342:D1442A	ENSP00000383303:D1690A	D	-	2	0	DSCAM	40345871	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	7.603000	0.82811	2.215000	0.71742	0.528000	0.53228	GAC		0.532	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		Missense_Mutation
KDELR3	11015	genome.wustl.edu	37	22	38877445	38877446	+	Missense_Mutation	DNP	TT	TT	GA			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr22:38877445_38877446TT>GA	ENST00000216014.4	+	4	752_753	c.580_581TT>GA	c.(580-582)TTc>GAc	p.F194D	KDELR3_ENST00000409006.3_Missense_Mutation_p.F194D|KDELR3_ENST00000471268.1_3'UTR	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	194					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)	p.F194V(1)|p.F194Y(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					CTACTGTGACTTCTTCTACTTG	0.441																																					Ovarian(11;103 529 24120 28493 32980)											2	Substitution - Missense(2)	ovary(2)	22																																								37207392	SO:0001583	missense	11015			AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	Exception_encountered	22.37:g.38877445_38877446delinsGA	ENSP00000216014:p.Phe194Asp		37207391	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Missense	DNP	ENST00000216014.4	37	CCDS13972.1	DNP	56	WashU																																																																																				0.441	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1			Missense
LRPAP1	4043	genome.wustl.edu	37	4	3519782	3519782	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	T	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr4:3519782G>T	ENST00000500728.2	-	5	876	c.730C>A	c.(730-732)Cag>Aag	p.Q244K	LRPAP1_ENST00000296325.5_5'UTR	NM_002337.3	NP_002328.1	P30533	AMRP_HUMAN	low density lipoprotein receptor-related protein associated protein 1	244	LDL receptor binding. {ECO:0000255}.				extracellular negative regulation of signal transduction (GO:1900116)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of protein binding (GO:0032091)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|protein folding (GO:0006457)|receptor-mediated endocytosis (GO:0006898)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum lumen (GO:0048237)|vesicle (GO:0031982)	asialoglycoprotein receptor activity (GO:0004873)|heparin binding (GO:0008201)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|unfolded protein binding (GO:0051082)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.Q244K(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.165)		CTGTAGCCCTGGTGGCTGACC	0.657																																																1	Substitution - Missense(1)	ovary(1)	4											44.0	39.0	41.0					4																	3519782		2203	4300	6503	3489580	SO:0001583	missense	4043				CCDS3371.1	4p16.3	2008-05-02	2003-03-17		ENSG00000163956	ENSG00000163956			6701	protein-coding gene	gene with protein product		104225	"""low density lipoprotein-related protein-associated protein 1 (alpha-2-macroglobulin receptor-associated protein 1)"""	A2MRAP		1712782	Standard	NM_002337		Approved	HBP44	uc003ghh.4	P30533	OTTHUMG00000090299	ENST00000500728.2:c.730C>A	4.37:g.3519782G>T	ENSP00000421922:p.Gln244Lys		3489580	D3DVR9|Q2M310|Q53HQ3|Q53HS6	Missense_Mutation	SNP	ENST00000500728.2	37	CCDS3371.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	1.798	-0.477718	0.04414	.	.	ENSG00000163956	ENST00000500728	T	0.40756	1.02	4.2	3.35	0.38373	Alpha-2-macroglobulin receptor-associated protein, domain 1 (1);Alpha-2-macroglobulin RAP, C-terminal (1);	0.258640	0.37809	N	0.001922	T	0.25754	0.0627	L	0.28694	0.88	0.30482	N	0.772289	B	0.15141	0.012	B	0.19666	0.026	T	0.26815	-1.0092	10	0.02654	T	1	-51.8463	10.6212	0.45481	0.0:0.3797:0.6203:0.0	.	244	P30533	AMRP_HUMAN	K	244	ENSP00000421922:Q244K	ENSP00000421922:Q244K	Q	-	1	0	LRPAP1	3489580	1.000000	0.71417	1.000000	0.80357	0.097000	0.18754	3.443000	0.52907	0.984000	0.38629	-0.304000	0.09214	CAG		0.657	LRPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206659.4			Missense_Mutation
TRERF1	55809	genome.wustl.edu	37	6	42196193	42196193	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr6:42196193C>T	ENST00000372922.4	-	18	4055	c.3493G>A	c.(3493-3495)Gac>Aac	p.D1165N	TRERF1_ENST00000340840.2_Missense_Mutation_p.D1094N|TRERF1_ENST00000354325.2_Missense_Mutation_p.D1082N|TRERF1_ENST00000372917.4_Missense_Mutation_p.D1094N|TRERF1_ENST00000541110.1_Missense_Mutation_p.D1185N	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1165	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.D1165N(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGGACGACGTCGTCGTCGAGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	6											148.0	140.0	143.0					6																	42196193		2203	4300	6503	42304171	SO:0001583	missense	55809			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.3493G>A	6.37:g.42196193C>T	ENSP00000362013:p.Asp1165Asn		42304171	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	24.8	4.576165	0.86645	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.20738	2.05;2.28;2.33;2.28;2.3	5.78	5.78	0.91487	.	0.190268	0.36374	N	0.002627	T	0.28732	0.0712	L	0.27053	0.805	0.46298	D	0.998976	D;P;P;D;D	0.89917	0.966;0.943;0.943;0.966;1.0	B;B;B;B;D	0.79108	0.418;0.238;0.238;0.418;0.992	T	0.08554	-1.0716	10	0.87932	D	0	-11.1455	19.9976	0.97389	0.0:1.0:0.0:0.0	.	1082;1185;1165;921;933	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	N	1185;1094;1165;1094;1082	ENSP00000439689:D1185N;ENSP00000362008:D1094N;ENSP00000362013:D1165N;ENSP00000339438:D1094N;ENSP00000346285:D1082N	ENSP00000339438:D1094N	D	-	1	0	TRERF1	42304171	0.999000	0.42202	0.034000	0.17996	0.612000	0.37316	5.338000	0.65947	2.737000	0.93849	0.563000	0.77884	GAC		0.582	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502		Missense_Mutation
TRERF1	55809	genome.wustl.edu	37	6	42196196	42196196	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr6:42196196C>T	ENST00000372922.4	-	18	4052	c.3490G>A	c.(3490-3492)Gac>Aac	p.D1164N	TRERF1_ENST00000340840.2_Missense_Mutation_p.D1093N|TRERF1_ENST00000354325.2_Missense_Mutation_p.D1081N|TRERF1_ENST00000372917.4_Missense_Mutation_p.D1093N|TRERF1_ENST00000541110.1_Missense_Mutation_p.D1184N	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1164	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.D1164N(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ACGACGTCGTCGTCGAGGATG	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											150.0	143.0	145.0					6																	42196196		2203	4300	6503	42304174	SO:0001583	missense	55809			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.3490G>A	6.37:g.42196196C>T	ENSP00000362013:p.Asp1164Asn		42304174	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	15.34	2.803405	0.50315	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.12879	2.82;2.64;2.84;2.64;2.64	5.78	4.89	0.63831	.	0.529823	0.18083	N	0.152222	T	0.03011	0.0089	N	0.14661	0.345	0.09310	N	1	B;B;B;B;P	0.51791	0.013;0.007;0.007;0.013;0.948	B;B;B;B;B	0.42771	0.003;0.001;0.001;0.003;0.397	T	0.28138	-1.0053	10	0.37606	T	0.19	-4.353	7.4591	0.27285	0.0:0.7183:0.1413:0.1405	.	1081;1184;1164;920;932	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	N	1184;1093;1164;1093;1081	ENSP00000439689:D1184N;ENSP00000362008:D1093N;ENSP00000362013:D1164N;ENSP00000339438:D1093N;ENSP00000346285:D1081N	ENSP00000339438:D1093N	D	-	1	0	TRERF1	42304174	0.038000	0.19896	0.003000	0.11579	0.602000	0.36980	2.109000	0.41863	1.411000	0.46957	0.563000	0.77884	GAC		0.577	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502		Missense_Mutation
AK9	221264	genome.wustl.edu	37	6	109854526	109854526	+	Silent	SNP	T	T	C			TCGA-23-1124-01	TCGA-23-1124-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr6:109854526T>C	ENST00000424296.2	-	28	3574	c.3498A>G	c.(3496-3498)gaA>gaG	p.E1166E	AK9_ENST00000341338.6_Silent_p.E245E|AK9_ENST00000355283.1_Silent_p.E245E	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1166	Adenylate kinase 2.				ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)	p.E245E(1)									GTTTCCACTTTTCAATTTGGG	0.358																																																1	Substitution - coding silent(1)	ovary(1)	6											169.0	151.0	157.0					6																	109854526		2203	4300	6503	109961219	SO:0001819	synonymous_variant	221264			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.3498A>G	6.37:g.109854526T>C			109961219	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Silent	SNP	ENST00000424296.2	37	CCDS55048.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	8.653	0.898716	0.17686	.	.	ENSG00000155085	ENST00000470564;ENST00000491875	.	.	.	5.16	-0.0333	0.13901	.	.	.	.	.	T	0.34077	0.0885	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.22941	-1.0202	4	.	.	.	.	4.5933	0.12317	0.1325:0.2279:0.0:0.6396	.	.	.	.	R	4;101	.	.	K	-	2	0	AKD1	109961219	0.456000	0.25744	0.472000	0.27241	0.889000	0.51656	0.241000	0.18065	0.047000	0.15862	0.448000	0.29417	AAA		0.358	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001145128		Silent
GPR146	115330	genome.wustl.edu	37	7	1097891	1097891	+	Missense_Mutation	SNP	C	C	G	rs144581322		TCGA-23-1124-01	TCGA-23-1124-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr7:1097891C>G	ENST00000397095.1	+	2	963	c.740C>G	c.(739-741)aCg>aGg	p.T247R	RP11-449P15.1_ENST00000549241.1_RNA|C7orf50_ENST00000397098.3_Intron|C7orf50_ENST00000397100.2_Intron|C7orf50_ENST00000357429.6_Intron|GPR146_ENST00000297468.3_Missense_Mutation_p.T247R|C7orf50_ENST00000488073.1_Intron			Q96CH1	GP146_HUMAN	G protein-coupled receptor 146	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T247R(1)		autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|ovary(1)|skin(1)	8		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		GGGCTCTGGACGCCACACTAT	0.652																																																1	Substitution - Missense(1)	ovary(1)	7											54.0	44.0	48.0					7																	1097891		2202	4298	6500	1064417	SO:0001583	missense	115330			BC014241	CCDS5321.1	7p22.3	2012-08-21			ENSG00000164849	ENSG00000164849		"""GPCR / Class A : Orphans"""	21718	protein-coding gene	gene with protein product							Standard	NM_138445		Approved	PGR8	uc003sjy.1	Q96CH1	OTTHUMG00000023934	ENST00000397095.1:c.740C>G	7.37:g.1097891C>G	ENSP00000380283:p.Thr247Arg		1064417	Q86SP5	Missense_Mutation	SNP	ENST00000397095.1	37	CCDS5321.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	19.21	3.784344	0.70222	.	.	ENSG00000164849	ENST00000444847;ENST00000397095;ENST00000500070;ENST00000297468	T;T;T	0.73258	-0.73;-0.73;-0.73	5.11	5.11	0.69529	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.77824	0.4188	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.80681	-0.1274	10	0.87932	D	0	-30.3921	17.5152	0.87771	0.0:1.0:0.0:0.0	.	247	Q96CH1	GP146_HUMAN	R	247;247;165;247	ENSP00000410743:T247R;ENSP00000380283:T247R;ENSP00000297468:T247R	ENSP00000297468:T247R	T	+	2	0	GPR146	1064417	1.000000	0.71417	0.970000	0.41538	0.300000	0.27592	7.217000	0.77982	2.389000	0.81357	0.561000	0.74099	ACG		0.652	GPR146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206855.1	NM_138445		Missense_Mutation
AKAP9	10142	genome.wustl.edu	37	7	91641910	91641910	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr7:91641910G>C	ENST00000359028.2	+	10	3747	c.3522G>C	c.(3520-3522)caG>caC	p.Q1174H	AKAP9_ENST00000358100.2_Missense_Mutation_p.Q1174H|AKAP9_ENST00000356239.3_Missense_Mutation_p.Q1162H			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1174					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.Q1174H(2)|p.Q1162H(2)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGGAACTTCAGAAAATACACC	0.328			T	BRAF	papillary thyroid																																		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	4	Substitution - Missense(4)	ovary(2)|lung(2)	7											76.0	79.0	78.0					7																	91641910		2203	4300	6503	91479846	SO:0001583	missense	10142			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.3522G>C	7.37:g.91641910G>C	ENSP00000351922:p.Gln1174His		91479846	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	7.797	0.712845	0.15306	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.03496	3.91;3.91;3.91	4.66	2.74	0.32292	.	0.717110	0.11507	N	0.557096	T	0.02193	0.0068	N	0.15975	0.35	0.22940	N	0.99854	B;B;B;B	0.12630	0.001;0.002;0.006;0.003	B;B;B;B	0.09377	0.002;0.004;0.003;0.004	T	0.48811	-0.9002	10	0.22109	T	0.4	.	3.5746	0.07930	0.0867:0.1407:0.4656:0.307	.	1174;1162;1162;1174	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	H	1162;1174;1174;1174;1174	ENSP00000348573:Q1162H;ENSP00000351922:Q1174H;ENSP00000350813:Q1174H	ENSP00000348573:Q1162H	Q	+	3	2	AKAP9	91479846	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.878000	0.28126	0.598000	0.29829	0.655000	0.94253	CAG		0.328	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		Missense_Mutation
XIRP2	129446	genome.wustl.edu	37	2	168100320	168100336	+	Frame_Shift_Del	DEL	TAAGGCAAAGTGGTTAT	TAAGGCAAAGTGGTTAT	-			TCGA-23-1124-01	TCGA-23-1124-10	TAAGGCAAAGTGGTTAT	TAAGGCAAAGTGGTTAT	TAAGGCAAAGTGGTTAT	-	TAAGGCAAAGTGGTTAT	TAAGGCAAAGTGGTTAT	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr2:168100320_168100336delTAAGGCAAAGTGGTTAT	ENST00000409195.1	+	9	2507_2523	c.2418_2434delTAAGGCAAAGTGGTTAT	c.(2416-2436)agtaaggcaaagtggttatttfs	p.KAKWLF807fs	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Frame_Shift_Del_p.KAKWLF807fs|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Frame_Shift_Del_p.KAKWLF585fs	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	632					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GTGGGGTGAGTAAGGCAAAGTGGTTATTTGAAACCCA	0.373																																																0			2																																								167808582	SO:0001589	frameshift_variant	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.2418_2434delTAAGGCAAAGTGGTTAT	2.37:g.168100320_168100336delTAAGGCAAAGTGGTTAT	ENSP00000386840:p.Lys807fs		167808566	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Frame_Shift_Del	DEL	ENST00000409195.1	37	CCDS42769.1	DEL	57	WashU																																																																																				0.373	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		Frame_Shift_Del
CSF3	1440	genome.wustl.edu	37	17	38171943	38171943	+	Splice_Site	SNP	G	G	A			TCGA-23-1124-01	TCGA-23-1124-10	G	G	G	A	G	G	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr17:38171943G>A	ENST00000225474.2	+	2	71		c.e2-1		RP11-387H17.6_ENST00000583462.1_lincRNA|CSF3_ENST00000577675.1_Missense_Mutation_p.A10T|CSF3_ENST00000331769.2_Missense_Mutation_p.A10T|CSF3_ENST00000394149.3_Splice_Site|CSF3_ENST00000394148.3_Splice_Site			P09919	CSF3_HUMAN	colony stimulating factor 3 (granulocyte)						cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|granulocyte differentiation (GO:0030851)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of neuron death (GO:1901215)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|enzyme binding (GO:0019899)|granulocyte colony-stimulating factor receptor binding (GO:0005130)	p.A10T(1)		endometrium(1)|ovary(1)|prostate(1)	3	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)				TCTGTCCCCAGCCCTGCAGCT	0.647																																																1	Substitution - Missense(1)	ovary(1)	17											22.0	22.0	22.0					17																	38171943		2198	4298	6496	35425469	SO:0001630	splice_region_variant	1440				CCDS11357.1, CCDS11358.1, CCDS42314.1, CCDS11358.2	17q11.2-q12	2014-01-30			ENSG00000108342	ENSG00000108342		"""Endogenous ligands"""	2438	protein-coding gene	gene with protein product	"""granulocyte colony stimulating factor"", ""pluripoietin"", ""filgrastim"", ""lenograstim"""	138970	"""chromosome 17 open reading frame 33"""	GCSF, G-CSF, C17orf33		3499671, 3501046	Standard	NM_000759		Approved	MGC45931	uc002htp.3	P09919	OTTHUMG00000133247	ENST00000225474.2:c.41-1G>A	17.37:g.38171943G>A			35425469	A8MXR7	Splice_Site_SNP	SNP	ENST00000225474.2	37	CCDS11357.1	SNP	34	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.17|18.17	3.564863|3.564863	0.65651|0.65651	.|.	.|.	ENSG00000108342|ENSG00000108342	ENST00000394149;ENST00000225474;ENST00000394148|ENST00000331769	.|T	.|0.34859	.|1.34	5.72|5.72	4.73|4.73	0.59995|0.59995	.|.	.|.	.|.	.|.	.|.	.|T	.|0.29556	.|0.0737	.|.	.|.	.|.	0.31018|0.31018	N|N	0.718419|0.718419	.|P;B	.|0.34522	.|0.455;0.281	.|B;B	.|0.30029	.|0.11;0.06	.|T	.|0.32402	.|-0.9908	.|8	.|0.56958	.|D	.|0.05	.|.	11.8547|11.8547	0.52431|0.52431	0.0:0.0:0.8254:0.1746|0.0:0.0:0.8254:0.1746	.|.	.|10;10	.|B4DNY7;Q8N4W3	.|.;.	.|T	-1|10	.|ENSP00000327766:A10T	.|ENSP00000327766:A10T	.|A	+|+	.|1	.|0	CSF3|CSF3	35425469|35425469	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.956000|0.956000	0.61745|0.61745	3.553000|3.553000	0.53713|0.53713	1.360000|1.360000	0.45960|0.45960	0.561000|0.561000	0.74099|0.74099	.|GCC		0.647	CSF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256988.2	NM_172220	Intron	Splice_Site_SNP
OTOP2	92736	genome.wustl.edu	37	17	72926820	72926820	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1124-01	TCGA-23-1124-10	A	A	A	G	A	A	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-23-1124-01	TCGA-23-1124-10	g.chr17:72926820A>G	ENST00000580223.1	+	5	1120	c.1090A>G	c.(1090-1092)Acg>Gcg	p.T364A	OTOP2_ENST00000331427.4_Missense_Mutation_p.T364A			Q7RTS6	OTOP2_HUMAN	otopetrin 2	364						integral component of membrane (GO:0016021)		p.T364A(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					TAAGAACCCCACGCGCACTCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	17											66.0	61.0	62.0					17																	72926820		2203	4300	6503	70438415	SO:0001583	missense	92736			BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.1090A>G	17.37:g.72926820A>G	ENSP00000463837:p.Thr364Ala		70438415		Missense_Mutation	SNP	ENST00000580223.1	37	CCDS11708.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	16.93	3.257240	0.59321	.	.	ENSG00000183034	ENST00000331427	T	0.21191	2.02	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.33933	0.0880	L	0.37697	1.125	0.54753	D	0.999985	D	0.76494	0.999	D	0.74023	0.982	T	0.04347	-1.0958	10	0.15499	T	0.54	-9.5329	15.592	0.76537	1.0:0.0:0.0:0.0	.	364	Q7RTS6	OTOP2_HUMAN	A	364	ENSP00000332528:T364A	ENSP00000332528:T364A	T	+	1	0	OTOP2	70438415	1.000000	0.71417	0.972000	0.41901	0.426000	0.31534	6.230000	0.72301	2.086000	0.62901	0.374000	0.22700	ACG		0.612	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445306.1	NM_178160		Missense_Mutation
