#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PTPRF	5792	broad.mit.edu	37	1	44085815	44085815	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr1:44085815G>C	ENST00000359947.4	+	30	5501	c.5161G>C	c.(5161-5163)Gag>Cag	p.E1721Q	PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372413.3_Missense_Mutation_p.E1712Q|PTPRF_ENST00000372414.3_Missense_Mutation_p.E1721Q|PTPRF_ENST00000438120.1_Missense_Mutation_p.E1712Q|PTPRF_ENST00000422171.2_Missense_Mutation_p.E1080Q	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1721	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.E1711Q(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGAGAGCACCGAGGACTTCTG	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											110.0	105.0	106.0					1																	44085815		2203	4300	6503	43858402	SO:0001583	missense	5792			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.5161G>C	1.37:g.44085815G>C	ENSP00000353030:p.Glu1721Gln		43858402	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	SNP	37	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.6|23.6	4.441299|4.441299	0.83993|0.83993	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407|ENST00000412568;ENST00000414879	D;D;D;D;D;D|.	0.85088|.	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94|.	4.97|4.97	4.97|4.97	0.65823|0.65823	Protein-tyrosine phosphatase, receptor/non-receptor type (3);|.	0.000000|.	0.34750|.	N|.	0.003714|.	T|T	0.76772|0.76772	0.4034|0.4034	M|M	0.73430|0.73430	2.235|2.235	0.80722|0.80722	D|D	1|1	P;D;D;D;D|.	0.89917|.	0.815;0.999;0.997;0.999;1.0|.	B;D;D;D;D|.	0.91635|.	0.401;0.968;0.953;0.989;0.999|.	T|T	0.76250|0.76250	-0.3028|-0.3028	10|5	0.66056|.	D|.	0.02|.	.|.	19.129|19.129	0.93397|0.93397	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1366;1080;1298;1712;1721|.	Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586|.	.;.;.;.;PTPRF_HUMAN|.	Q|P	1721;1712;1721;1712;1080;793|1104;1145	ENSP00000353030:E1721Q;ENSP00000398822:E1712Q;ENSP00000361491:E1721Q;ENSP00000361490:E1712Q;ENSP00000387885:E1080Q;ENSP00000361484:E793Q|.	ENSP00000353030:E1721Q|.	E|R	+|+	1|2	0|0	PTPRF|PTPRF	43858402|43858402	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.807000|9.807000	0.99171|0.99171	2.700000|2.700000	0.92200|0.92200	0.563000|0.563000	0.77884|0.77884	GAG|CGA		0.592	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1			Missense_Mutation
ABL2	27	broad.mit.edu	37	1	179100549	179100549	+	Silent	SNP	G	G	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr1:179100549G>A	ENST00000502732.1	-	3	491	c.288C>T	c.(286-288)agC>agT	p.S96S	ABL2_ENST00000367623.4_Silent_p.S75S|ABL2_ENST00000504405.1_Silent_p.S60S|ABL2_ENST00000507173.1_Silent_p.S75S|ABL2_ENST00000344730.3_Silent_p.S81S|ABL2_ENST00000408940.3_Silent_p.S60S|ABL2_ENST00000392043.3_Silent_p.S75S|ABL2_ENST00000511413.1_Silent_p.S96S|ABL2_ENST00000512653.1_Silent_p.S81S	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	96	CAP.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TCTCCTTGGAGCTCCACCTGA	0.468			T	ETV6	AML																																		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	0			1											106.0	99.0	101.0					1																	179100549		2203	4300	6503	177367172	SO:0001819	synonymous_variant	0			M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.288C>T	1.37:g.179100549G>A			177367172	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Silent	SNP	ENST00000502732.1	37	CCDS30947.1	SNP	34	Broad																																																																																				0.468	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158		Silent
CEP350	9857	broad.mit.edu	37	1	180080188	180080188	+	Silent	SNP	G	G	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr1:180080188G>A	ENST00000367607.3	+	38	9664	c.9246G>A	c.(9244-9246)ttG>ttA	p.L3082L	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	3082					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.L3082L(1)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AGGATGAGTTGTGTGTGAAAA	0.438																																																1	Substitution - coding silent(1)	ovary(1)	1											149.0	131.0	137.0					1																	180080188		2203	4300	6503	178346811	SO:0001819	synonymous_variant	9857			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.9246G>A	1.37:g.180080188G>A			178346811	O75068|Q8TDK3|Q8WY20	Silent	SNP	ENST00000367607.3	37	CCDS1336.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	5.041	0.193280	0.09599	.	.	ENSG00000135837	ENST00000429851	.	.	.	6.05	4.14	0.48551	.	.	.	.	.	T	0.60792	0.2296	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59150	-0.7508	4	.	.	.	.	10.4489	0.44509	0.1398:0.1401:0.7201:0.0	.	.	.	.	M	1257	.	.	V	+	1	0	CEP350	178346811	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	0.794000	0.26958	1.576000	0.49790	0.650000	0.86243	GTG		0.438	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810		Silent
IGFN1	91156	broad.mit.edu	37	1	201182657	201182657	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr1:201182657G>A	ENST00000335211.4	+	12	8766	c.8636G>A	c.(8635-8637)aGg>aAg	p.R2879K	IGFN1_ENST00000295591.8_Missense_Mutation_p.R39K|IGFN1_ENST00000451870.2_Missense_Mutation_p.R422K	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	422						nucleus (GO:0005634)|Z disc (GO:0030018)		p.R39K(1)		autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						AAAGACGGCAGGTTGGACATC	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											83.0	79.0	80.0					1																	201182657		2203	4300	6503	199449280	SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.8636G>A	1.37:g.201182657G>A	ENSP00000334714:p.Arg2879Lys		199449280	F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	11.28	1.590733	0.28357	.	.	ENSG00000163395	ENST00000335211;ENST00000451870;ENST00000295591	T;T;T	0.60797	0.59;0.16;0.79	2.15	0.117	0.14652	.	1.558280	0.04522	N	0.384694	T	0.37489	0.1005	L	0.27053	0.805	0.09310	N	1	B	0.20988	0.05	B	0.15870	0.014	T	0.14144	-1.0483	10	0.06236	T	0.91	.	4.504	0.11878	0.1301:0.0:0.6526:0.2173	.	2879	F8WAI1	.	K	2879;422;39	ENSP00000334714:R2879K;ENSP00000398386:R422K;ENSP00000295591:R39K	ENSP00000295591:R39K	R	+	2	0	IGFN1	199449280	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	0.588000	0.23924	0.031000	0.15407	0.491000	0.48974	AGG		0.567	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275		Missense_Mutation
ANO9	338440	broad.mit.edu	37	11	433411	433411	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr11:433411T>C	ENST00000332826.6	-	4	337	c.253A>G	c.(253-255)Agt>Ggt	p.S85G		NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	85					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)	p.S85G(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						CCAAAGACACTGTTGTCAGCA	0.637																																																1	Substitution - Missense(1)	ovary(1)	11											135.0	134.0	134.0					11																	433411		2203	4299	6502	423411	SO:0001583	missense	338440			U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.253A>G	11.37:g.433411T>C	ENSP00000332788:p.Ser85Gly		423411	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	ENST00000332826.6	37	CCDS31326.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	t	0.356	-0.942090	0.02322	.	.	ENSG00000185101	ENST00000332826	T	0.66995	-0.24	3.42	-3.73	0.04398	.	1.922980	0.03111	N	0.162497	T	0.48714	0.1515	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.30179	-0.9987	10	0.46703	T	0.11	.	4.4407	0.11573	0.0:0.3369:0.3464:0.3167	.	85	A1A5B4	ANO9_HUMAN	G	85	ENSP00000332788:S85G	ENSP00000332788:S85G	S	-	1	0	ANO9	423411	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.640000	0.05440	-0.680000	0.05211	-0.692000	0.03713	AGT		0.637	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384116.1	NM_001012302		Missense_Mutation
MRVI1	10335	broad.mit.edu	37	11	10631309	10631309	+	Missense_Mutation	SNP	G	G	A	rs116772600	byFrequency	TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr11:10631309G>A	ENST00000436272.1	-	10	1534	c.1456C>T	c.(1456-1458)Cgc>Tgc	p.R486C	MRVI1_ENST00000541483.1_Missense_Mutation_p.R307C|MRVI1_ENST00000424001.1_Missense_Mutation_p.R198C|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000423302.2_Missense_Mutation_p.R513C|MRVI1_ENST00000545852.1_Missense_Mutation_p.R198C|MRVI1_ENST00000421747.1_Missense_Mutation_p.R504C|MRVI1_ENST00000531107.1_Missense_Mutation_p.R505C|MRVI1_ENST00000547195.1_Missense_Mutation_p.R422C|MRVI1_ENST00000552103.1_Missense_Mutation_p.R422C|MRVI1_ENST00000534266.2_Missense_Mutation_p.R198C|MRVI1_ENST00000558540.1_Missense_Mutation_p.R198C|MRVI1_ENST00000527509.2_Missense_Mutation_p.R422C			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	486					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)		p.R486C(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CGCAGTTTGCGCAGCAGCACA	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											52.0	53.0	53.0					11																	10631309		1905	4120	6025	10587885	SO:0001583	missense	10335			AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.1456C>T	11.37:g.10631309G>A	ENSP00000412229:p.Arg486Cys		10587885	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	ENST00000436272.1	37		SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.552303	0.96501	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22	6.17	6.17	0.99709	.	0.057917	0.64402	D	0.000001	T	0.43478	0.1249	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.72625	0.966;0.978;0.978;0.963	T	0.07829	-1.0752	10	0.87932	D	0	-12.0107	20.8794	0.99867	0.0:0.0:1.0:0.0	.	307;486;505;504	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	C	504;487;486;422;422;198;198;513;307;505;422	ENSP00000414598:R504C;ENSP00000412229:R486C;ENSP00000448278:R422C;ENSP00000446764:R422C;ENSP00000441971:R198C;ENSP00000401205:R198C;ENSP00000412130:R513C;ENSP00000437784:R307C;ENSP00000432436:R505C;ENSP00000432067:R422C	ENSP00000307885:R487C	R	-	1	0	MRVI1	10587885	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.301000	0.89951	2.941000	0.99782	0.655000	0.94253	CGC		0.498	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579		Missense_Mutation
CST6	1474	broad.mit.edu	37	11	65780321	65780321	+	Silent	SNP	C	C	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr11:65780321C>T	ENST00000312134.2	+	2	469	c.265C>T	c.(265-267)Ctg>Ttg	p.L89L		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	89					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.L89L(1)		large_intestine(1)|lung(1)|ovary(1)	3						CAAGTACTTCCTGACGATGGA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	11											79.0	66.0	70.0					11																	65780321		2201	4296	6497	65536897	SO:0001819	synonymous_variant	1474			U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.265C>T	11.37:g.65780321C>T			65536897	Q540N7	Silent	SNP	ENST00000312134.2	37	CCDS8126.1	SNP	24	Broad																																																																																				0.602	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323		Silent
CASP4	837	broad.mit.edu	37	11	104820470	104820470	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr11:104820470C>G	ENST00000444739.2	-	5	1491	c.581G>C	c.(580-582)aGa>aCa	p.R194T	CASP4_ENST00000393150.3_Missense_Mutation_p.R138T|CASP4_ENST00000531333.1_5'UTR	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	194					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)	p.R194T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		GTGCTCTGGTCTGGTAGCAAA	0.458																																																1	Substitution - Missense(1)	ovary(1)	11											142.0	125.0	131.0					11																	104820470		2202	4299	6501	104325680	SO:0001583	missense	837			U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.581G>C	11.37:g.104820470C>G	ENSP00000388566:p.Arg194Thr		104325680	A2NHL8|A2NHM0	Missense_Mutation	SNP	ENST00000444739.2	37	CCDS8327.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	10.01	1.234087	0.22626	.	.	ENSG00000196954	ENST00000444739;ENST00000393150;ENST00000355546	T;T	0.21031	2.03;2.03	4.57	-0.928	0.10448	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.455846	0.23891	N	0.043551	T	0.41719	0.1171	M	0.89534	3.04	0.09310	N	1	D;P	0.69078	0.997;0.946	D;P	0.65443	0.935;0.529	T	0.26538	-1.0100	10	0.66056	D	0.02	.	3.6832	0.08319	0.3012:0.4358:0.0:0.263	.	194;194	B4E2D2;P49662	.;CASP4_HUMAN	T	194;138;147	ENSP00000388566:R194T;ENSP00000376857:R138T	ENSP00000347741:R147T	R	-	2	0	CASP4	104325680	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-0.106000	0.10890	-0.373000	0.07979	-0.142000	0.14014	AGA		0.458	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387751.1	NM_001225		Missense_Mutation
GRIA4	2893	broad.mit.edu	37	11	105483009	105483009	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr11:105483009T>C	ENST00000530497.1	+	2	95	c.95T>C	c.(94-96)cTc>cCc	p.L32P	GRIA4_ENST00000282499.5_Missense_Mutation_p.L32P|GRIA4_ENST00000428631.2_Missense_Mutation_p.L32P|GRIA4_ENST00000527669.1_Missense_Mutation_p.L32P|GRIA4_ENST00000393125.2_Missense_Mutation_p.L32P|GRIA4_ENST00000525187.1_Missense_Mutation_p.L32P|GRIA4_ENST00000393127.2_Missense_Mutation_p.L32P			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	32					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.L32P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ATAGGTGGTCTCTTCATCCGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	11											123.0	107.0	112.0					11																	105483009		2202	4299	6501	104988219	SO:0001583	missense	2893			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.95T>C	11.37:g.105483009T>C	ENSP00000435775:p.Leu32Pro		104988219	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	24.9	4.577112	0.86645	.	.	ENSG00000152578	ENST00000527177;ENST00000393125;ENST00000531986;ENST00000282499;ENST00000393127;ENST00000527669;ENST00000525921;ENST00000428631;ENST00000531011;ENST00000530497;ENST00000525187	T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000015	T	0.56601	0.1996	M	0.73217	2.22	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.997	D;D;D;D;D	0.97110	0.986;1.0;1.0;0.998;0.991	T	0.59899	-0.7367	10	0.87932	D	0	.	16.3483	0.83171	0.0:0.0:0.0:1.0	.	32;32;62;32;32	P48058;G3V164;Q59GL7;Q86XE8;E9PQN1	GRIA4_HUMAN;.;.;.;.	P	32	ENSP00000376833:L32P;ENSP00000282499:L32P;ENSP00000376835:L32P;ENSP00000415551:L32P;ENSP00000432443:L32P;ENSP00000435775:L32P;ENSP00000432180:L32P	ENSP00000282499:L32P	L	+	2	0	GRIA4	104988219	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	2.254000	0.74563	0.533000	0.62120	CTC		0.418	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1			Missense_Mutation
CACNA1C	775	broad.mit.edu	37	12	2797734	2797734	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr12:2797734T>C	ENST00000347598.4	+	48	6050	c.6050T>C	c.(6049-6051)gTc>gCc	p.V2017A	CACNA1C_ENST00000399638.1_Missense_Mutation_p.V1997A|CACNA1C_ENST00000399601.1_Missense_Mutation_p.V1969A|CACNA1C_ENST00000327702.7_Missense_Mutation_p.V2004A|CACNA1C_ENST00000399644.1_Missense_Mutation_p.V1969A|CACNA1C_ENST00000399629.1_Missense_Mutation_p.V1986A|CACNA1C_ENST00000399649.1_Missense_Mutation_p.V1975A|CACNA1C_ENST00000399606.1_Missense_Mutation_p.V1989A|CACNA1C_ENST00000406454.3_Missense_Mutation_p.V2040A|CACNA1C_ENST00000399591.1_Missense_Mutation_p.V1977A|CACNA1C_ENST00000399595.1_Missense_Mutation_p.V1977A|CACNA1C_ENST00000399621.1_Missense_Mutation_p.V1988A|CACNA1C-AS1_ENST00000544517.1_RNA|CACNA1C_ENST00000402845.3_Missense_Mutation_p.V1988A|CACNA1C_ENST00000344100.3_Missense_Mutation_p.V2010A|CACNA1C_ENST00000399597.1_Missense_Mutation_p.V1969A|CACNA1C_ENST00000399655.1_Missense_Mutation_p.V1969A|CACNA1C_ENST00000399637.1_Missense_Mutation_p.V1988A|CACNA1C_ENST00000399641.1_Missense_Mutation_p.V1969A|CACNA1C_ENST00000399603.1_Missense_Mutation_p.V1969A|CACNA1C_ENST00000399634.1_Missense_Mutation_p.V2040A|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399617.1_Missense_Mutation_p.V2004A|CACNA1C_ENST00000335762.5_Missense_Mutation_p.V1994A|CACNA1C-AS1_ENST00000541673.1_RNA	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	2052					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.V2082A(1)|p.V1504A(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCACAGCCCGTCCCCACCCTG	0.667																																																2	Substitution - Missense(2)	ovary(2)	12											44.0	52.0	50.0					12																	2797734		1920	4123	6043	2667995	SO:0001583	missense	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.6050T>C	12.37:g.2797734T>C	ENSP00000266376:p.Val2017Ala		2667995	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	9.961	1.222743	0.22457	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66	4.97	4.97	0.65823	.	1.575540	0.03042	N	0.153431	T	0.44265	0.1285	L	0.27053	0.805	0.27409	N	0.954639	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.28258	0.039;0.108;0.085;0.003;0.064;0.205;0.053;0.127;0.006;0.019;0.205;0.042;0.085;0.127;0.051;0.044;0.085;0.0;0.205;0.0;0.042;0.127;0.205;0.085;0.085	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.31614	0.06;0.068;0.035;0.004;0.1;0.133;0.036;0.133;0.037;0.017;0.073;0.026;0.066;0.133;0.016;0.063;0.066;0.004;0.073;0.001;0.026;0.073;0.073;0.035;0.035	T	0.39482	-0.9612	10	0.25106	T	0.35	.	14.658	0.68847	0.0:0.0:0.0:1.0	.	660;2010;1966;2052;2004;1988;1969;1986;1997;1969;1989;1969;2000;2017;1969;2004;2040;1977;1975;1977;1958;1988;1988;1969;1969	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	A	1994;1969;1969;1997;1969;1988;1988;1977;1969;2017;1989;1969;2010;1986;2004;1975;1988;1969;2040;2004;2040;1977;1870	ENSP00000336982:V1994A;ENSP00000382563:V1969A;ENSP00000382552:V1969A;ENSP00000382547:V1997A;ENSP00000382506:V1969A;ENSP00000382530:V1988A;ENSP00000382546:V1988A;ENSP00000382500:V1977A;ENSP00000382549:V1969A;ENSP00000266376:V2017A;ENSP00000382515:V1989A;ENSP00000382510:V1969A;ENSP00000341092:V2010A;ENSP00000382537:V1986A;ENSP00000329877:V2004A;ENSP00000382557:V1975A;ENSP00000385724:V1988A;ENSP00000382512:V1969A;ENSP00000382542:V2040A;ENSP00000382526:V2004A;ENSP00000385896:V2040A;ENSP00000382504:V1977A	ENSP00000323129:V1870A	V	+	2	0	CACNA1C	2667995	0.988000	0.35896	0.997000	0.53966	0.350000	0.29205	3.682000	0.54656	1.874000	0.54306	0.379000	0.24179	GTC		0.667	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		Missense_Mutation
C12orf40	283461	broad.mit.edu	37	12	40076581	40076581	+	Missense_Mutation	SNP	C	C	A	rs201124119		TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr12:40076581C>A	ENST00000324616.5	+	8	1009	c.855C>A	c.(853-855)aaC>aaA	p.N285K	C12orf40_ENST00000405531.3_Missense_Mutation_p.N285K|C12orf40_ENST00000398716.1_Missense_Mutation_p.N208K	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	285								p.N285K(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						AAGATGTGAACCAGTCTACTC	0.318																																																1	Substitution - Missense(1)	ovary(1)	12											139.0	136.0	137.0					12																	40076581		1842	4080	5922	38362848	SO:0001583	missense	283461			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.855C>A	12.37:g.40076581C>A	ENSP00000317671:p.Asn285Lys		38362848	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	ENST00000324616.5	37	CCDS41770.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	2.371	-0.344421	0.05208	.	.	ENSG00000180116	ENST00000405531;ENST00000398716;ENST00000324616	T;T	0.49720	0.77;0.79	5.12	1.24	0.21308	.	0.190093	0.36268	N	0.002694	T	0.28234	0.0697	L	0.34521	1.04	0.09310	N	0.999995	P	0.41102	0.738	B	0.38562	0.276	T	0.13176	-1.0519	10	0.15952	T	0.53	.	5.2529	0.15532	0.0:0.5935:0.1521:0.2544	.	285	Q86WS4	CL040_HUMAN	K	285;208;285	ENSP00000383897:N285K;ENSP00000317671:N285K	ENSP00000317671:N285K	N	+	3	2	C12orf40	38362848	0.040000	0.19996	0.103000	0.21229	0.019000	0.09904	-0.016000	0.12613	0.389000	0.25086	-0.339000	0.08088	AAC		0.318	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257664.2	NM_173599		Missense_Mutation
NABP2	79035	broad.mit.edu	37	12	56622860	56622860	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr12:56622860C>A	ENST00000380198.2	+	6	997	c.499C>A	c.(499-501)Ccc>Acc	p.P167T	NABP2_ENST00000267023.4_Missense_Mutation_p.P167T|NABP2_ENST00000341463.5_Missense_Mutation_p.P167T|SLC39A5_ENST00000454355.2_5'Flank|SLC39A5_ENST00000266980.4_5'Flank			Q9BQ15	SOSB1_HUMAN	nucleic acid binding protein 2	167	Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)|SOSS complex (GO:0070876)	single-stranded DNA binding (GO:0003697)	p.P167T(1)									TGGCCCACATCCCCCTCATAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	12											29.0	31.0	31.0					12																	56622860		2203	4300	6503	54909127	SO:0001583	missense	79035			BC006171	CCDS8911.1	12q13.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000139579	ENSG00000139579			28412	protein-coding gene	gene with protein product	"""single strand DNA-binding protein 1"", ""sensor of single-strand DNA complex subunit B1"""	612104	"""oligonucleotide/oligosaccharide-binding fold containing 2B"""	OBFC2B			Standard	NM_024068		Approved	MGC2731, SSB1, hSSB1, SOSS-B1	uc001ski.3	Q9BQ15	OTTHUMG00000152527	ENST00000380198.2:c.499C>A	12.37:g.56622860C>A	ENSP00000369545:p.Pro167Thr		54909127	A6NDF8|Q6XYC8	Missense_Mutation	SNP	ENST00000380198.2	37	CCDS8911.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	7.694	0.691663	0.15039	.	.	ENSG00000139579	ENST00000267023;ENST00000380198;ENST00000341463	T;T;T	0.31510	1.49;1.49;1.49	5.39	3.42	0.39159	.	0.093716	0.43919	D	0.000505	T	0.23451	0.0567	L	0.43152	1.355	0.23215	N	0.998102	B	0.06786	0.001	B	0.04013	0.001	T	0.13098	-1.0522	9	.	.	.	-17.4392	9.5908	0.39545	0.1435:0.5765:0.28:0.0	.	167	Q9BQ15	SOSB1_HUMAN	T	167	ENSP00000267023:P167T;ENSP00000369545:P167T;ENSP00000368862:P167T	.	P	+	1	0	OBFC2B	54909127	0.076000	0.21285	0.735000	0.30896	0.541000	0.35023	0.311000	0.19380	1.388000	0.46506	0.655000	0.94253	CCC		0.582	NABP2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326610.1	NM_024068		Missense_Mutation
PAN2	9924	broad.mit.edu	37	12	56717139	56717139	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr12:56717139G>T	ENST00000425394.2	-	16	2689	c.2313C>A	c.(2311-2313)caC>caA	p.H771Q	PAN2_ENST00000257931.5_Missense_Mutation_p.H770Q|PAN2_ENST00000440411.3_Missense_Mutation_p.H767Q|PAN2_ENST00000548043.1_Missense_Mutation_p.H771Q	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)	p.H767Q(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	TTTCCCCACCGTGTTTCTTTA	0.428																																																1	Substitution - Missense(1)	ovary(1)	12											108.0	101.0	103.0					12																	56717139		2203	4300	6503	55003406	SO:0001583	missense	9924			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.2313C>A	12.37:g.56717139G>T	ENSP00000401721:p.His771Gln		55003406		Missense_Mutation	SNP	ENST00000425394.2	37	CCDS44922.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	6.971	0.549111	0.13312	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	T;T;T;T	0.05139	3.49;3.49;3.49;3.49	5.34	-7.27	0.01461	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.864182	0.10447	N	0.673571	T	0.02418	0.0074	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.0	T	0.45673	-0.9245	10	0.27082	T	0.32	-0.8611	7.2389	0.26086	0.1687:0.1201:0.5928:0.1184	.	770;767;771	Q504Q3-3;Q504Q3-2;Q504Q3	.;.;PAN2_HUMAN	Q	771;767;770;771	ENSP00000401721:H771Q;ENSP00000388231:H767Q;ENSP00000257931:H770Q;ENSP00000449861:H771Q	ENSP00000257931:H770Q	H	-	3	2	PAN2	55003406	0.003000	0.15002	0.178000	0.23040	0.907000	0.53573	-0.450000	0.06803	-0.829000	0.04268	-1.047000	0.02352	CAC		0.428	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871		Missense_Mutation
RIMBP2	23504	broad.mit.edu	37	12	130926553	130926553	+	Silent	SNP	G	G	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr12:130926553G>T	ENST00000261655.4	-	8	1456	c.1293C>A	c.(1291-1293)atC>atA	p.I431I	RIMBP2_ENST00000535703.1_Silent_p.I339I|RIMBP2_ENST00000536002.1_Silent_p.I339I	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	431	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.I431I(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CGGCCTTGACGATGTCGAACT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	12											130.0	93.0	106.0					12																	130926553		2203	4300	6503	129492506	SO:0001819	synonymous_variant	23504			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1293C>A	12.37:g.130926553G>T			129492506	Q96ID2	Silent	SNP	ENST00000261655.4	37	CCDS31925.1	SNP	37	Broad																																																																																				0.567	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347		Silent
XPO4	64328	broad.mit.edu	37	13	21396414	21396414	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr13:21396414G>C	ENST00000255305.6	-	8	926	c.855C>G	c.(853-855)atC>atG	p.I285M	XPO4_ENST00000400602.2_Missense_Mutation_p.I285M			Q9C0E2	XPO4_HUMAN	exportin 4	285					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I258M(1)		breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		AATCTTCTCTGATTTTTCGAT	0.398																																																1	Substitution - Missense(1)	ovary(1)	13											121.0	115.0	117.0					13																	21396414		1854	4090	5944	20294414	SO:0001583	missense	64328			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.855C>G	13.37:g.21396414G>C	ENSP00000255305:p.Ile285Met		20294414	Q5VUZ5|Q8N3V6|Q9H934	Missense_Mutation	SNP	ENST00000255305.6	37	CCDS41872.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338900	0.60963	.	.	ENSG00000132953	ENST00000400602;ENST00000456108;ENST00000255305	T;T	0.68331	-0.32;-0.32	5.57	5.57	0.84162	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.74619	0.3740	L	0.55481	1.735	0.58432	D	0.999997	D	0.64830	0.994	P	0.59221	0.854	T	0.75536	-0.3283	10	0.59425	D	0.04	-4.2233	14.1271	0.65228	0.072:0.0:0.928:0.0	.	285	Q9C0E2	XPO4_HUMAN	M	285;155;285	ENSP00000383444:I285M;ENSP00000255305:I285M	ENSP00000255305:I285M	I	-	3	3	XPO4	20294414	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.719000	0.54926	2.779000	0.95612	0.655000	0.94253	ATC		0.398	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044096.1	NM_022459		Missense_Mutation
RB1	5925	broad.mit.edu	37	13	48941648	48941648	+	Nonsense_Mutation	SNP	C	C	T	rs121913300		TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr13:48941648C>T	ENST00000267163.4	+	10	1096	c.958C>T	c.(958-960)Cga>Tga	p.R320*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	320					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.R320*(11)|p.?(7)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCTTTCTAAACGATACGAAGA	0.313	R320*(GMS10_CENTRAL_NERVOUS_SYSTEM)|R320*(ISHIKAWAHERAKLIO02ER_ENDOMETRIUM)	6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	33	Whole gene deletion(15)|Substitution - Nonsense(11)|Unknown(7)	bone(11)|eye(8)|breast(5)|endometrium(3)|central_nervous_system(2)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)	13	GRCh37	CM941205	RB1	M	rs121913300						54.0	64.0	61.0					13																	48941648		2194	4283	6477	47839649	SO:0001587	stop_gained	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.958C>T	13.37:g.48941648C>T	ENSP00000267163:p.Arg320*		47839649	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	ENST00000267163.4	37	CCDS31973.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	38	6.735464	0.97801	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.43	5.43	0.79202	.	0.126181	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	14.5633	0.68156	0.1469:0.8531:0.0:0.0	.	.	.	.	X	299;320	.	ENSP00000267163:R320X	R	+	1	2	RB1	47839649	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	2.830000	0.48136	2.521000	0.84997	0.591000	0.81541	CGA		0.313	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1			Nonsense_Mutation
TTC5	91875	broad.mit.edu	37	14	20757901	20757901	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr14:20757901T>A	ENST00000258821.3	-	10	1264	c.1208A>T	c.(1207-1209)tAt>tTt	p.Y403F	TTC5_ENST00000556592.1_5'Flank	NM_138376.2	NP_612385.2	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	403					DNA repair (GO:0006281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.Y403F(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		GGAAAAGGAATAGTCCTAGAA	0.522																																																1	Substitution - Missense(1)	ovary(1)	14											50.0	43.0	45.0					14																	20757901		2203	4300	6503	19827741	SO:0001583	missense	91875			BC008647	CCDS9546.1	14q11.2	2013-01-11			ENSG00000136319	ENSG00000136319		"""Tetratricopeptide (TTC) repeat domain containing"""	19274	protein-coding gene	gene with protein product						11511361	Standard	NM_138376		Approved	Strap	uc001vwt.3	Q8N0Z6	OTTHUMG00000029506	ENST00000258821.3:c.1208A>T	14.37:g.20757901T>A	ENSP00000258821:p.Tyr403Phe		19827741	A8MQ18|Q96HF9	Missense_Mutation	SNP	ENST00000258821.3	37	CCDS9546.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	0.197	-1.047803	0.01981	.	.	ENSG00000136319	ENST00000258821	T	0.28666	1.6	5.29	2.87	0.33458	.	0.185281	0.48286	N	0.000190	T	0.10078	0.0247	N	0.04203	-0.255	0.38334	D	0.943877	B	0.02656	0.0	B	0.01281	0.0	T	0.26744	-1.0094	10	0.02654	T	1	.	5.5068	0.16858	0.3066:0.0:0.1596:0.5338	.	403	Q8N0Z6	TTC5_HUMAN	F	403	ENSP00000258821:Y403F	ENSP00000258821:Y403F	Y	-	2	0	TTC5	19827741	0.997000	0.39634	0.997000	0.53966	0.479000	0.33129	1.356000	0.34079	0.434000	0.26340	-0.323000	0.08544	TAT		0.522	TTC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073529.4	NM_138376		Missense_Mutation
SALL2	6297	broad.mit.edu	37	14	21991569	21991569	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr14:21991569C>A	ENST00000327430.3	-	2	2587	c.2293G>T	c.(2293-2295)Gag>Tag	p.E765*	SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000538754.1_Intron|SALL2_ENST00000450879.2_Nonsense_Mutation_p.E628*	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	765	Poly-Glu.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E765*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		tcttcctcctcctcAGACAAC	0.557																																																1	Substitution - Nonsense(1)	ovary(1)	14											59.0	58.0	58.0					14																	21991569		2203	4300	6503	21061409	SO:0001587	stop_gained	6297			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2293G>T	14.37:g.21991569C>A	ENSP00000333537:p.Glu765*		21061409	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Nonsense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	SNP	30	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.588428|7.588428	0.98374|0.98374	.|.	.|.	ENSG00000165821|ENSG00000165821	ENST00000327430;ENST00000450879|ENST00000546363	.|.	.|.	.|.	4.76|4.76	4.76|4.76	0.60689|0.60689	.|.	0.000000|.	0.32548|.	N|.	0.005956|.	.|T	.|0.62974	.|0.2472	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69427	.|-0.5148	.|3	0.54805|.	T|.	0.06|.	.|.	13.1465|13.1465	0.59465|0.59465	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|S	765;628|623	.|.	ENSP00000333537:E765X|.	E|R	-|-	1|3	0|2	SALL2|SALL2	21061409|21061409	0.269000|0.269000	0.24143|0.24143	0.970000|0.970000	0.41538|0.41538	0.927000|0.927000	0.56198|0.56198	0.927000|0.927000	0.28818|0.28818	2.468000|2.468000	0.83385|0.83385	0.563000|0.563000	0.77884|0.77884	GAG|AGG		0.557	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407		Nonsense_Mutation
PMM2	5373	broad.mit.edu	37	16	8895757	8895757	+	Silent	SNP	G	G	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr16:8895757G>A	ENST00000268261.4	+	2	234	c.168G>A	c.(166-168)ctG>ctA	p.L56L	PMM2_ENST00000539622.1_5'UTR|PMM2_ENST00000566983.1_Silent_p.L29L|PMM2_ENST00000569958.1_Silent_p.L56L|PMM2_ENST00000537352.1_5'UTR	NM_000303.2	NP_000294.1	O15305	PMM2_HUMAN	phosphomannomutase 2	56					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)	phosphomannomutase activity (GO:0004615)	p.L56L(1)		breast(3)|cervix(1)|endometrium(2)|large_intestine(1)|ovary(1)|skin(1)	9						AGGAGCAACTGGGAAATGATG	0.393																																					Esophageal Squamous(154;1308 1842 2827 29799 42829)											1	Substitution - coding silent(1)	ovary(1)	16											72.0	73.0	73.0					16																	8895757		2197	4300	6497	8803258	SO:0001819	synonymous_variant	5373			BC008310	CCDS10536.1	16p13	2012-09-06			ENSG00000140650	ENSG00000140650	5.3.1.8		9115	protein-coding gene	gene with protein product	"""phosphomannose isomerase 1"""	601785		CDG1		9140401	Standard	NM_000303		Approved	CDGS, CDG1a, PMI, PMI1	uc002czf.4	O15305	OTTHUMG00000129697	ENST00000268261.4:c.168G>A	16.37:g.8895757G>A			8803258	A8K672|B7Z6R0|D3DUF3	Silent	SNP	ENST00000268261.4	37	CCDS10536.1	SNP	47	Broad																																																																																				0.393	PMM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251904.1	NM_000303		Silent
PARN	5073	broad.mit.edu	37	16	14530615	14530615	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr16:14530615T>A	ENST00000437198.2	-	24	2020	c.1879A>T	c.(1879-1881)Aac>Tac	p.N627Y	PARN_ENST00000420015.2_Missense_Mutation_p.N581Y|PARN_ENST00000539279.1_Missense_Mutation_p.N452Y|PARN_ENST00000341484.7_Missense_Mutation_p.N566Y	NM_001134477.2|NM_002582.3	NP_001127949.1|NP_002573.1	O95453	PARN_HUMAN	poly(A)-specific ribonuclease	627					female gamete generation (GO:0007292)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA metabolic process (GO:0016070)|RNA modification (GO:0009451)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|nuclease activity (GO:0004518)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(A)-specific ribonuclease activity (GO:0004535)|protein kinase binding (GO:0019901)	p.N627Y(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|urinary_tract(1)	21						GCAGGGCTGTTCTTCGAGATG	0.542																																																1	Substitution - Missense(1)	ovary(1)	16											48.0	49.0	49.0					16																	14530615		1977	4180	6157	14438116	SO:0001583	missense	5073			AJ005698	CCDS45419.1, CCDS45420.1, CCDS58425.1	16p13	2014-08-08	2011-07-07		ENSG00000140694	ENSG00000140694	3.1.13.4		8609	protein-coding gene	gene with protein product	"""deadenylation nuclease"""	604212	"""poly(A)-specific ribonuclease (deadenylation nuclease)"""			10640832	Standard	NM_002582		Approved	DAN	uc010uzd.2	O95453	OTTHUMG00000173199	ENST00000437198.2:c.1879A>T	16.37:g.14530615T>A	ENSP00000387911:p.Asn627Tyr		14438116	B2RCB3|B4DDG8|B4DWR4|B4E1H6	Missense_Mutation	SNP	ENST00000437198.2	37	CCDS45419.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	8.770	0.925723	0.18056	.	.	ENSG00000140694	ENST00000437198;ENST00000341484;ENST00000420015;ENST00000539279	.	.	.	5.39	3.07	0.35406	.	1.395560	0.04269	N	0.341772	T	0.21590	0.0520	N	0.08118	0	0.09310	N	1	B;B;B	0.31931	0.347;0.102;0.031	B;B;B	0.28232	0.087;0.028;0.017	T	0.21586	-1.0241	9	0.66056	D	0.02	-0.4988	7.2168	0.25965	0.0:0.7162:0.0:0.2838	.	452;581;627	B4DSB0;B4DWR4;O95453	.;.;PARN_HUMAN	Y	627;566;581;452	.	ENSP00000345456:N566Y	N	-	1	0	PARN	14438116	0.005000	0.15991	0.198000	0.23420	0.306000	0.27790	-0.027000	0.12371	1.258000	0.44101	-0.248000	0.11899	AAC		0.542	PARN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422383.1	NM_002582		Missense_Mutation
GTF3C1	2975	broad.mit.edu	37	16	27501066	27501066	+	Splice_Site	SNP	T	T	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr16:27501066T>A	ENST00000356183.4	-	20	3167		c.e20-2		GTF3C1_ENST00000561623.1_Splice_Site	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa						5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCACCACGCCTGGAAAACCAA	0.622																																																0			16											60.0	43.0	49.0					16																	27501066		2197	4300	6497	27408567	SO:0001630	splice_region_variant	2975			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.3152-2A>T	16.37:g.27501066T>A			27408567	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Splice_Site_SNP	SNP	ENST00000356183.4	37	CCDS32414.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	11.37	1.617382	0.28801	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8045	0.57605	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	GTF3C1	27408567	1.000000	0.71417	0.424000	0.26647	0.164000	0.22412	5.140000	0.64807	1.836000	0.53414	0.533000	0.62120	.		0.622	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	Intron	Splice_Site_SNP
LPO	4025	broad.mit.edu	37	17	56329650	56329650	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr17:56329650G>T	ENST00000262290.4	+	8	1204	c.888G>T	c.(886-888)caG>caT	p.Q296H	LPO_ENST00000582328.1_Missense_Mutation_p.Q213H|LPO_ENST00000421678.2_Missense_Mutation_p.Q213H|LPO_ENST00000543544.1_Missense_Mutation_p.Q237H	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	296					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)	p.Q296H(1)		breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						CCCGAGAGCAGATCAACGCTC	0.627																																																1	Substitution - Missense(1)	ovary(1)	17											95.0	84.0	88.0					17																	56329650		2203	4300	6503	53684649	SO:0001583	missense	4025			M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.888G>T	17.37:g.56329650G>T	ENSP00000262290:p.Gln296His		53684649	A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Missense_Mutation	SNP	ENST00000262290.4	37	CCDS32689.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284401	0.40394	.	.	ENSG00000167419	ENST00000262290;ENST00000421678;ENST00000543544;ENST00000389576	T;T;T	0.73789	-0.78;-0.78;-0.78	5.3	1.75	0.24633	.	0.000000	0.64402	D	0.000004	D	0.87803	0.6269	M	0.94142	3.5	0.52099	D	0.999947	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.87836	0.2648	10	0.87932	D	0	-22.8046	9.384	0.38331	0.3233:0.0:0.6767:0.0	.	213;296	E7EMJ3;P22079	.;PERL_HUMAN	H	296;213;237;41	ENSP00000262290:Q296H;ENSP00000400245:Q213H;ENSP00000445344:Q237H	ENSP00000262290:Q296H	Q	+	3	2	LPO	53684649	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	3.597000	0.54031	0.623000	0.30267	0.655000	0.94253	CAG		0.627	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443961.1			Missense_Mutation
DDX42	11325	broad.mit.edu	37	17	61886264	61886264	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr17:61886264G>A	ENST00000578681.1	+	11	1709	c.1108G>A	c.(1108-1110)Gcc>Acc	p.A370T	DDX42_ENST00000583590.1_Missense_Mutation_p.A370T|DDX42_ENST00000359353.5_Missense_Mutation_p.A251T|DDX42_ENST00000457800.2_Missense_Mutation_p.A370T|DDX42_ENST00000389924.2_Missense_Mutation_p.A370T	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	370	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.A370T(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						GTGGGAGCAGGCCAAGGCCCT	0.478																																																1	Substitution - Missense(1)	ovary(1)	17											172.0	156.0	161.0					17																	61886264		2203	4300	6503	59239996	SO:0001583	missense	11325			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.1108G>A	17.37:g.61886264G>A	ENSP00000464050:p.Ala370Thr		59239996	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	ENST00000578681.1	37	CCDS32704.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	18.30	3.592876	0.66219	.	.	ENSG00000198231	ENST00000389924;ENST00000457800;ENST00000359353	T;T	0.15256	2.44;2.44	5.42	5.42	0.78866	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.098404	0.64402	D	0.000001	T	0.15262	0.0368	L	0.27053	0.805	0.80722	D	1	B	0.25486	0.127	B	0.28465	0.09	T	0.08659	-1.0711	10	0.22706	T	0.39	-11.289	18.5614	0.91101	0.0:0.0:1.0:0.0	.	370	Q86XP3	DDX42_HUMAN	T	370;370;106	ENSP00000374574:A370T;ENSP00000390121:A370T	ENSP00000352308:A106T	A	+	1	0	DDX42	59239996	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.804000	0.99143	2.719000	0.93026	0.573000	0.79308	GCC		0.478	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372		Missense_Mutation
SRP68	6730	broad.mit.edu	37	17	74046604	74046604	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr17:74046604C>T	ENST00000307877.2	-	9	1143	c.982G>A	c.(982-984)Gaa>Aaa	p.E328K	SRP68_ENST00000355113.5_Missense_Mutation_p.E227K|SRP68_ENST00000542536.2_5'UTR|SRP68_ENST00000602720.1_5'UTR|SRP68_ENST00000539137.1_Missense_Mutation_p.E290K	NM_014230.3	NP_055045.2	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	328					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|ribosome (GO:0005840)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)	p.E328K(1)|p.E328*(1)		NS(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|lung(4)|ovary(2)|prostate(3)	23						TCTTCGCTTTCAGCCTAAACA	0.512																																																2	Substitution - Missense(1)|Substitution - Nonsense(1)	ovary(1)|lung(1)	17											89.0	76.0	80.0					17																	74046604		2203	4300	6503	71558199	SO:0001583	missense	6730			AF195951	CCDS11738.1, CCDS58600.1, CCDS58601.1	17q25.1	2010-04-30	2002-08-29		ENSG00000167881	ENSG00000167881			11302	protein-coding gene	gene with protein product		604858	"""signal recognition particle 68kD"""			10618370	Standard	NM_014230		Approved		uc002jqk.2	Q9UHB9		ENST00000307877.2:c.982G>A	17.37:g.74046604C>T	ENSP00000312066:p.Glu328Lys		71558199	B3KUU5|B3KWY7|G3V1U4|Q8NCJ4|Q8WUK2	Missense_Mutation	SNP	ENST00000307877.2	37	CCDS11738.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	15.30	2.793015	0.50102	.	.	ENSG00000167881	ENST00000411758;ENST00000539137;ENST00000540937;ENST00000307877;ENST00000304220;ENST00000355113	.	.	.	5.87	4.88	0.63580	.	0.136685	0.64402	D	0.000003	T	0.44414	0.1292	L	0.34521	1.04	0.53688	D	0.999977	B;B	0.26547	0.082;0.152	B;B	0.25140	0.037;0.058	T	0.35400	-0.9790	9	0.06757	T	0.87	-26.9773	16.0087	0.80380	0.0:0.8653:0.1347:0.0	.	290;328	G3V1U4;Q9UHB9	.;SRP68_HUMAN	K	68;290;328;328;297;227	.	ENSP00000307756:E297K	E	-	1	0	SRP68	71558199	0.999000	0.42202	0.984000	0.44739	0.969000	0.65631	4.339000	0.59322	1.459000	0.47892	0.655000	0.94253	GAA		0.512	SRP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449487.1	NM_014230		Missense_Mutation
RNF157	114804	broad.mit.edu	37	17	74152374	74152374	+	Missense_Mutation	SNP	T	T	G	rs553918046		TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr17:74152374T>G	ENST00000269391.6	-	14	1574	c.1442A>C	c.(1441-1443)aAt>aCt	p.N481T	RNF157-AS1_ENST00000590137.1_RNA|RNF157_ENST00000319945.6_Missense_Mutation_p.N481T|RNF157-AS1_ENST00000592748.1_RNA|RNF157-AS1_ENST00000586661.1_RNA|RNF157-AS1_ENST00000586627.1_RNA|RNF157-AS1_ENST00000585542.1_RNA	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	481	Ser-rich.						zinc ion binding (GO:0008270)	p.N1084T(1)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			CAAGGTGAGATTCTCACTTTC	0.562																																					GBM(186;507 2120 27388 27773 52994)											1	Substitution - Missense(1)	ovary(1)	17											113.0	99.0	104.0					17																	74152374		2203	4300	6503	71663969	SO:0001583	missense	114804			AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.1442A>C	17.37:g.74152374T>G	ENSP00000269391:p.Asn481Thr		71663969	Q8NB72|Q96N56	Missense_Mutation	SNP	ENST00000269391.6	37	CCDS32740.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	22.2	4.262672	0.80358	.	.	ENSG00000141576	ENST00000269391;ENST00000319945	T;T	0.27104	1.69;1.79	5.05	5.05	0.67936	.	0.148834	0.64402	D	0.000015	T	0.45115	0.1326	L	0.50333	1.59	0.80722	D	1	D;P	0.71674	0.998;0.948	D;P	0.81914	0.995;0.652	T	0.36311	-0.9753	10	0.54805	T	0.06	-15.0217	14.9596	0.71147	0.0:0.0:0.0:1.0	.	481;481	Q96PX1-2;Q96PX1	.;RN157_HUMAN	T	481	ENSP00000269391:N481T;ENSP00000321837:N481T	ENSP00000269391:N481T	N	-	2	0	RNF157	71663969	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	7.513000	0.81739	2.113000	0.64589	0.460000	0.39030	AAT		0.562	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255874.2	XM_290732		Missense_Mutation
ABCA7	10347	broad.mit.edu	37	19	1042357	1042357	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr19:1042357G>A	ENST00000263094.6	+	6	690	c.459G>A	c.(457-459)atG>atA	p.M153I	ABCA7_ENST00000433129.1_Missense_Mutation_p.M153I|ABCA7_ENST00000435683.2_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	153					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)	p.M153I(1)		NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AACCACCCATGCTGGATGTCG	0.672																																																1	Substitution - Missense(1)	ovary(1)	19											75.0	71.0	72.0					19																	1042357		2203	4300	6503	993357	SO:0001583	missense	10347			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.459G>A	19.37:g.1042357G>A	ENSP00000263094:p.Met153Ile		993357	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	7.764	0.705999	0.15172	.	.	ENSG00000064687	ENST00000263094;ENST00000524850;ENST00000433129	D;D;D	0.98221	-1.97;-4.8;-1.97	3.0	0.829	0.18847	.	.	.	.	.	D	0.92244	0.7540	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.09377	0.004;0.0	D	0.85982	0.1483	9	0.27785	T	0.31	.	5.2006	0.15262	0.281:0.0:0.719:0.0	.	153;153	B4DVJ5;Q8IZY2	.;ABCA7_HUMAN	I	153	ENSP00000263094:M153I;ENSP00000431473:M153I;ENSP00000414062:M153I	ENSP00000263094:M153I	M	+	3	0	ABCA7	993357	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.759000	0.04761	0.309000	0.22966	-0.258000	0.10820	ATG		0.672	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112		Missense_Mutation
TUBB4A	10382	broad.mit.edu	37	19	6495339	6495339	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr19:6495339G>A	ENST00000264071.2	-	4	1542	c.1171C>T	c.(1171-1173)Cgc>Tgc	p.R391C	TUBB4A_ENST00000540257.1_Missense_Mutation_p.R391C|CTD-2396E7.9_ENST00000599292.1_RNA|CTD-2396E7.10_ENST00000596027.1_RNA			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	391					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R391C(1)									AAGGCCTTGCGCCGGAACATG	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											152.0	137.0	142.0					19																	6495339		2202	4280	6482	6446339	SO:0001583	missense	10382			AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.1171C>T	19.37:g.6495339G>A	ENSP00000264071:p.Arg391Cys		6446339	B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	37	CCDS12168.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	12.19	1.862900	0.32884	.	.	ENSG00000104833	ENST00000264071;ENST00000540257;ENST00000412858	D;D	0.85861	-2.04;-2.04	3.43	3.43	0.39272	.	0.000000	0.64402	U	0.000001	D	0.94594	0.8258	H	0.97315	3.98	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	D	0.96137	0.9097	10	0.87932	D	0	.	13.6752	0.62449	0.0:0.0:1.0:0.0	.	391	P04350	TBB4A_HUMAN	C	391;391;309	ENSP00000264071:R391C;ENSP00000443590:R391C	ENSP00000264071:R391C	R	-	1	0	TUBB4	6446339	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.690000	0.98676	1.473000	0.48159	0.306000	0.20318	CGC		0.612	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087		Missense_Mutation
CENPO	79172	broad.mit.edu	37	2	25022649	25022649	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr2:25022649A>T	ENST00000380834.2	+	3	577	c.152A>T	c.(151-153)aAg>aTg	p.K51M	CENPO_ENST00000260662.1_Missense_Mutation_p.K51M|CENPO_ENST00000473706.1_Missense_Mutation_p.K45M			Q9BU64	CENPO_HUMAN	centromere protein O	51					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.K51M(1)		breast(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CTTGGAACCAAGATTCATAAA	0.547																																																1	Substitution - Missense(1)	ovary(1)	2											95.0	104.0	101.0					2																	25022649		2203	4300	6503	24876153	SO:0001583	missense	79172			AK027859	CCDS1714.1, CCDS56113.1	2p23.3	2013-11-05			ENSG00000138092	ENSG00000138092			28152	protein-coding gene	gene with protein product		611504				16622420, 16622419	Standard	NM_024322		Approved	MGC11266, CENP-O	uc002rfp.2	Q9BU64	OTTHUMG00000125525	ENST00000380834.2:c.152A>T	2.37:g.25022649A>T	ENSP00000370214:p.Lys51Met		24876153	B2RDC0|D6W536|Q53T55|Q96JV3	Missense_Mutation	SNP	ENST00000380834.2	37	CCDS1714.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	18.65	3.670566	0.67814	.	.	ENSG00000138092	ENST00000380834;ENST00000473706;ENST00000260662	T;T;T	0.57436	0.4;0.45;0.4	4.75	-0.946	0.10385	.	0.599365	0.17312	N	0.178837	T	0.55561	0.1928	L	0.46157	1.445	0.28675	N	0.905441	D;D	0.65815	0.995;0.992	P;P	0.60415	0.874;0.671	T	0.53308	-0.8457	10	0.66056	D	0.02	-9.5931	7.9772	0.30161	0.5494:0.0:0.4506:0.0	.	45;51	Q9BU64-2;Q9BU64	.;CENPO_HUMAN	M	51;45;51	ENSP00000370214:K51M;ENSP00000417787:K45M;ENSP00000260662:K51M	ENSP00000260662:K51M	K	+	2	0	CENPO	24876153	0.063000	0.20901	0.245000	0.24217	0.104000	0.19210	-0.107000	0.10873	-0.268000	0.09312	0.444000	0.29173	AAG		0.547	CENPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246856.2	NM_024322		Missense_Mutation
MYLK2	85366	broad.mit.edu	37	20	30414648	30414648	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr20:30414648T>A	ENST00000375994.2	+	7	1404	c.1131T>A	c.(1129-1131)caT>caA	p.H377Q	MYLK2_ENST00000375985.4_Missense_Mutation_p.H377Q|MYLK2_ENST00000468730.1_3'UTR			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	377	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.H377Q(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AGGACTACCATCTGACCGAGG	0.577																																																1	Substitution - Missense(1)	ovary(1)	20											152.0	120.0	131.0					20																	30414648		2203	4300	6503	29878309	SO:0001583	missense	85366			AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1131T>A	20.37:g.30414648T>A	ENSP00000365162:p.His377Gln		29878309	Q569L1|Q96I84	Missense_Mutation	SNP	ENST00000375994.2	37	CCDS13191.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	4.641	0.119210	0.08881	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	T;T	0.38887	1.11;1.11	3.66	-7.31	0.01441	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.18002	0.0432	N	0.17800	0.525	0.19300	N	0.999976	B	0.02656	0.0	B	0.06405	0.002	T	0.25433	-1.0132	9	0.10111	T	0.7	.	4.5963	0.12330	0.0766:0.306:0.1356:0.4819	.	377	Q9H1R3	MYLK2_HUMAN	Q	377	ENSP00000365162:H377Q;ENSP00000365152:H377Q	ENSP00000365152:H377Q	H	+	3	2	MYLK2	29878309	0.000000	0.05858	0.281000	0.24762	0.953000	0.61014	-6.623000	0.00059	-2.183000	0.00763	-1.663000	0.00750	CAT		0.577	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078583.2	NM_033118		Missense_Mutation
BPIFA3	128861	broad.mit.edu	37	20	31805447	31805447	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr20:31805447C>A	ENST00000375454.3	+	1	315	c.105C>A	c.(103-105)gaC>gaA	p.D35E	RP11-49G10.3_ENST00000419613.1_RNA|BPIFA3_ENST00000490499.1_3'UTR|BPIFA3_ENST00000375452.3_Missense_Mutation_p.D35E	NM_178466.3	NP_848561.2	Q9BQP9	BPIA3_HUMAN	BPI fold containing family A, member 3	35						extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.D35E(1)									CCCACAGAGACAACAAATCCA	0.622																																																1	Substitution - Missense(1)	ovary(1)	20											86.0	79.0	81.0					20																	31805447		2203	4300	6503	31269108	SO:0001583	missense	128861				CCDS13216.2, CCDS42865.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131059	ENSG00000131059		"""BPI fold containing"""	16204	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 71"""	C20orf71		11971875, 21787333	Standard	XR_244132		Approved	bA49G10.4, SPLUNC3	uc002wyr.3	Q9BQP9	OTTHUMG00000032245	ENST00000375454.3:c.105C>A	20.37:g.31805447C>A	ENSP00000364603:p.Asp35Glu		31269108	Q5JWG8|Q6NZ38	Missense_Mutation	SNP	ENST00000375454.3	37	CCDS13216.2	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	3.848	-0.032516	0.07543	.	.	ENSG00000131059	ENST00000375454;ENST00000375452	T;T	0.41400	1.0;1.17	4.36	-0.0074	0.14009	.	0.494508	0.17292	N	0.179589	T	0.25121	0.0610	N	0.19112	0.55	0.09310	N	1	B;B	0.14012	0.004;0.009	B;B	0.15052	0.006;0.012	T	0.21655	-1.0239	10	0.87932	D	0	-8.8923	8.153	0.31152	0.0:0.3135:0.5825:0.104	.	35;35	Q9BQP9-2;Q9BQP9	.;BPIA3_HUMAN	E	35	ENSP00000364603:D35E;ENSP00000364601:D35E	ENSP00000364601:D35E	D	+	3	2	BPIFA3	31269108	0.529000	0.26322	0.011000	0.14972	0.070000	0.16714	0.183000	0.16919	0.042000	0.15717	-0.150000	0.13652	GAC		0.622	BPIFA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078672.1	NM_178466		Missense_Mutation
KCNJ6	3763	broad.mit.edu	37	21	39086984	39086984	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr21:39086984A>C	ENST00000609713.1	-	3	1065	c.476T>G	c.(475-477)gTc>gGc	p.V159G	KCNJ6_ENST00000288309.6_Missense_Mutation_p.V159G|KCNJ6-IT1_ENST00000435001.1_RNA	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	159					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)	p.V159G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	ATCTGTGATGACCCGGTAGCC	0.443																																					Pancreas(48;379 1118 2936 19024 28214)											1	Substitution - Missense(1)	ovary(1)	21											62.0	67.0	65.0					21																	39086984		1833	4087	5920	38008854	SO:0001583	missense	3763			U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.476T>G	21.37:g.39086984A>C	ENSP00000477437:p.Val159Gly		38008854	Q3MJ74|Q53WW6	Missense_Mutation	SNP	ENST00000609713.1	37	CCDS42927.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	17.24	3.338990	0.60963	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.94376	-3.41;-3.41	6.03	6.03	0.97812	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.95604	0.8571	L	0.55743	1.74	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94866	0.8026	10	0.37606	T	0.19	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	159	P48051	IRK6_HUMAN	G	159	ENSP00000383330:V159G;ENSP00000288309:V159G	ENSP00000288309:V159G	V	-	2	0	KCNJ6	38008854	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.327000	0.79147	2.302000	0.77476	0.533000	0.62120	GTC		0.443	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240		Missense_Mutation
FAM208A	23272	broad.mit.edu	37	3	56667184	56667184	+	Nonsense_Mutation	SNP	A	A	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr3:56667184A>T	ENST00000493960.2	-	18	3645	c.3635T>A	c.(3634-3636)tTa>tAa	p.L1212*	FAM208A_ENST00000355628.5_Nonsense_Mutation_p.L1151*|FAM208A_ENST00000431842.2_Nonsense_Mutation_p.L775*	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1212							poly(A) RNA binding (GO:0044822)	p.L775*(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TTCAGGTTCTAACTGGCTTAT	0.368																																																1	Substitution - Nonsense(1)	ovary(1)	3											84.0	89.0	87.0					3																	56667184		2203	4300	6503	56642224	SO:0001587	stop_gained	23272			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3635T>A	3.37:g.56667184A>T	ENSP00000417509:p.Leu1212*		56642224	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Nonsense_Mutation	SNP	ENST00000493960.2	37	CCDS46853.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	44	10.709663	0.99454	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	.	.	.	5.62	5.62	0.85841	.	0.000000	0.52532	D	0.000061	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.3223	16.1116	0.81266	1.0:0.0:0.0:0.0	.	.	.	.	X	775;1212;1151	.	ENSP00000347845:L1151X	L	-	2	0	C3orf63	56642224	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.455000	0.90355	2.270000	0.75569	0.477000	0.44152	TTA		0.368	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224		Nonsense_Mutation
OSBPL11	114885	broad.mit.edu	37	3	125271465	125271465	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr3:125271465A>C	ENST00000296220.5	-	9	1503	c.1214T>G	c.(1213-1215)tTt>tGt	p.F405C		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	405					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)	p.F405C(1)		NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						ATGAGACATAAAGTCTGCATA	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											109.0	105.0	106.0					3																	125271465		2203	4300	6503	126754155	SO:0001583	missense	114885			AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.1214T>G	3.37:g.125271465A>C	ENSP00000296220:p.Phe405Cys		126754155	A8K9I7	Missense_Mutation	SNP	ENST00000296220.5	37	CCDS3033.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	21.6	4.178076	0.78564	.	.	ENSG00000144909	ENST00000296220	T	0.29917	1.55	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.62877	0.2464	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71563	-0.4555	10	0.66056	D	0.02	-11.7316	14.9798	0.71303	1.0:0.0:0.0:0.0	.	405	Q9BXB4	OSB11_HUMAN	C	405	ENSP00000296220:F405C	ENSP00000296220:F405C	F	-	2	0	OSBPL11	126754155	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.963000	0.93385	2.134000	0.65973	0.482000	0.46254	TTT		0.398	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776		Missense_Mutation
PPP2R3A	5523	broad.mit.edu	37	3	135722027	135722027	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr3:135722027C>A	ENST00000264977.3	+	2	2304	c.1687C>A	c.(1687-1689)Ccc>Acc	p.P563T	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	563					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)	p.P563T(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGTCTCTTCACCCATAGAAAA	0.418																																																1	Substitution - Missense(1)	ovary(1)	3											58.0	58.0	58.0					3																	135722027		2203	4299	6502	137204717	SO:0001583	missense	5523			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.1687C>A	3.37:g.135722027C>A	ENSP00000264977:p.Pro563Thr		137204717	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	ENST00000264977.3	37	CCDS3087.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	8.495	0.862993	0.17178	.	.	ENSG00000073711	ENST00000264977	T	0.05855	3.38	5.72	1.72	0.24424	.	0.684332	0.15104	N	0.280353	T	0.03220	0.0094	N	0.08118	0	0.48341	D	0.99963	B	0.17465	0.022	B	0.14023	0.01	T	0.44605	-0.9317	10	0.59425	D	0.04	.	5.1426	0.14967	0.1371:0.507:0.281:0.0749	.	563	Q06190	P2R3A_HUMAN	T	563	ENSP00000264977:P563T	ENSP00000264977:P563T	P	+	1	0	PPP2R3A	137204717	0.146000	0.22672	0.733000	0.30861	0.827000	0.46813	0.155000	0.16362	0.021000	0.15133	0.563000	0.77884	CCC		0.418	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718		Missense_Mutation
CC2D2A	57545	broad.mit.edu	37	4	15569104	15569104	+	Splice_Site	SNP	A	A	C			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr4:15569104A>C	ENST00000503292.1	+	26	3467	c.3287A>C	c.(3286-3288)cAg>cCg	p.Q1096P	CC2D2A_ENST00000424120.1_Splice_Site_p.Q1096P|CC2D2A_ENST00000413206.1_Splice_Site_p.Q1096P|CC2D2A_ENST00000389652.5_Splice_Site_p.Q1047P	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	1096	C2.		Q -> H (in JBTS9). {ECO:0000269|PubMed:18950740}.		cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)		p.Q1047P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						CCCCTCGGCCAGGTGAGAGAT	0.488																																																1	Substitution - Missense(1)	ovary(1)	4											53.0	53.0	53.0					4																	15569104		2049	4185	6234	15178202	SO:0001630	splice_region_variant	57545			AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.3288+1A>C	4.37:g.15569104A>C			15178202	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	ENST00000503292.1	37	CCDS47026.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	19.44	3.828679	0.71258	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000503292;ENST00000389652	D;D;D;D	0.97089	-4.24;-4.24;-4.24;-4.24	5.4	5.4	0.78164	C2 calcium-dependent membrane targeting (1);	0.000000	0.85682	D	0.000000	D	0.98030	0.9351	M	0.74881	2.28	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.67725	0.953;0.931	D	0.98346	1.0541	10	0.48119	T	0.1	.	15.4578	0.75330	1.0:0.0:0.0:0.0	.	1096;1047	Q9P2K1;Q9P2K1-2	C2D2A_HUMAN;.	P	1096;1096;1047;1047;1096;1047	ENSP00000403465:Q1096P;ENSP00000398391:Q1096P;ENSP00000421809:Q1096P;ENSP00000374303:Q1047P	ENSP00000374303:Q1047P	Q	+	2	0	CC2D2A	15178202	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	6.379000	0.73154	2.053000	0.61076	0.460000	0.39030	CAG		0.488	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	Missense_Mutation	Missense_Mutation
NEK1	4750	broad.mit.edu	37	4	170398372	170398372	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr4:170398372T>A	ENST00000439128.2	-	24	2893	c.2253A>T	c.(2251-2253)aaA>aaT	p.K751N	NEK1_ENST00000510533.1_Missense_Mutation_p.K707N|NEK1_ENST00000512193.1_Missense_Mutation_p.K682N|NEK1_ENST00000511633.1_Missense_Mutation_p.K735N|NEK1_ENST00000507142.1_Missense_Mutation_p.K779N	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	751					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.K779N(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		ATGAAACTGATTTTTCTTTTT	0.368																																																1	Substitution - Missense(1)	ovary(1)	4											80.0	71.0	74.0					4																	170398372		1870	4097	5967	170634947	SO:0001583	missense	4750			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.2253A>T	4.37:g.170398372T>A	ENSP00000408020:p.Lys751Asn		170634947	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	ENST00000439128.2	37	CCDS47162.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	1.377	-0.584515	0.03827	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.69306	-0.38;-0.39;-0.39;-0.39;-0.38	5.57	-11.1	0.00147	.	0.486738	0.22167	N	0.063695	T	0.40909	0.1136	N	0.25144	0.715	0.09310	N	1	B;B;B;B;B	0.15930	0.004;0.015;0.004;0.015;0.002	B;B;B;B;B	0.16289	0.015;0.015;0.015;0.015;0.007	T	0.04991	-1.0913	10	0.33940	T	0.23	.	11.6429	0.51244	0.2962:0.5371:0.0:0.1667	.	682;735;779;707;751	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	N	751;735;707;779;682	ENSP00000408020:K751N;ENSP00000423332:K735N;ENSP00000427653:K707N;ENSP00000424757:K779N;ENSP00000424938:K682N	ENSP00000408020:K751N	K	-	3	2	NEK1	170634947	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.956000	0.03865	-2.724000	0.00387	-1.093000	0.02169	AAA		0.368	NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3			Missense_Mutation
UGT3A1	133688	broad.mit.edu	37	5	35965531	35965531	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr5:35965531T>C	ENST00000274278.3	-	4	1157	c.800A>G	c.(799-801)tAt>tGt	p.Y267C	UGT3A1_ENST00000507113.1_Missense_Mutation_p.Y233C|UGT3A1_ENST00000503189.1_Missense_Mutation_p.Y267C|UGT3A1_ENST00000333811.4_Missense_Mutation_p.Y213C|UGT3A1_ENST00000513233.1_Intron	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	267						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.Y267C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCCTCCAATATAAACAGTGTT	0.433																																																1	Substitution - Missense(1)	ovary(1)	5											87.0	89.0	88.0					5																	35965531		2203	4300	6503	36001288	SO:0001583	missense	133688				CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.800A>G	5.37:g.35965531T>C	ENSP00000274278:p.Tyr267Cys		36001288	G5E961|Q8IYS9|Q8NAW4|Q96DM6	Missense_Mutation	SNP	ENST00000274278.3	37	CCDS3913.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	11.44	1.640368	0.29157	.	.	ENSG00000145626	ENST00000274278;ENST00000503189;ENST00000507113;ENST00000333811	T;T;T;T	0.60299	0.2;0.2;0.2;0.2	3.05	3.05	0.35203	.	0.314197	0.26586	N	0.023551	T	0.53318	0.1789	L	0.60904	1.88	0.42369	D	0.99244	B;B;B;B	0.28378	0.157;0.027;0.209;0.025	B;B;B;B	0.31245	0.126;0.049;0.113;0.049	T	0.59584	-0.7427	10	0.72032	D	0.01	.	10.867	0.46862	0.0:0.0:0.0:1.0	.	233;267;213;267	E9PD17;B7Z8Q8;G5E961;Q6NUS8	.;.;.;UD3A1_HUMAN	C	267;267;233;213	ENSP00000274278:Y267C;ENSP00000427079:Y267C;ENSP00000426100:Y233C;ENSP00000328033:Y213C	ENSP00000274278:Y267C	Y	-	2	0	UGT3A1	36001288	0.260000	0.24053	0.143000	0.22291	0.900000	0.52787	0.729000	0.26028	1.333000	0.45449	0.260000	0.18958	TAT		0.433	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253770.2	NM_152404		Missense_Mutation
MROH2B	133558	broad.mit.edu	37	5	41038893	41038893	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr5:41038893C>G	ENST00000399564.4	-	21	2609	c.2159G>C	c.(2158-2160)aGa>aCa	p.R720T	MROH2B_ENST00000506092.2_Missense_Mutation_p.R275T	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	720								p.R720T(1)									TTGATTAAGTCTGGAGAGAAG	0.502																																																1	Substitution - Missense(1)	ovary(1)	5											69.0	70.0	69.0					5																	41038893		1927	4132	6059	41074650	SO:0001583	missense	133558				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2159G>C	5.37:g.41038893C>G	ENSP00000382476:p.Arg720Thr		41074650	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	7.886	0.731259	0.15507	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.67865	4.49;-0.29	5.73	2.84	0.33178	Armadillo-type fold (1);	0.317328	0.26750	N	0.022698	T	0.58250	0.2109	L	0.55481	1.735	0.09310	N	0.99999	P	0.42692	0.787	B	0.41988	0.372	T	0.53429	-0.8440	10	0.52906	T	0.07	.	5.6659	0.17695	0.158:0.6699:0.0:0.1721	.	720	Q7Z745	HTRB2_HUMAN	T	275;425;720	ENSP00000441504:R275T;ENSP00000382476:R720T	ENSP00000296803:R425T	R	-	2	0	HEATR7B2	41074650	0.192000	0.23301	0.176000	0.23000	0.096000	0.18686	0.983000	0.29552	0.884000	0.36064	0.655000	0.94253	AGA		0.502	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		Missense_Mutation
KCNN2	3781	broad.mit.edu	37	5	113808788	113808788	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr5:113808788C>T	ENST00000512097.3	+	6	2199	c.1181C>T	c.(1180-1182)gCa>gTa	p.A394V	KCNN2_ENST00000503706.1_Missense_Mutation_p.A46V|KCNN2_ENST00000264773.3_Missense_Mutation_p.A394V|KCNN2_ENST00000507750.1_3'UTR			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	394					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.A394V(1)|p.A46V(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	GCTGTAGTGGCAAGGAAGCTA	0.413																																																2	Substitution - Missense(2)	ovary(2)	5											109.0	89.0	96.0					5																	113808788		2202	4300	6502	113836687	SO:0001583	missense	3781			AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.1181C>T	5.37:g.113808788C>T	ENSP00000427120:p.Ala394Val		113836687	A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Missense_Mutation	SNP	ENST00000512097.3	37	CCDS4114.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522523	0.85600	.	.	ENSG00000080709	ENST00000512097;ENST00000264773;ENST00000503706	T;T;T	0.30714	1.52;1.52;1.52	5.28	5.28	0.74379	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.43500	0.1250	L	0.39514	1.22	0.80722	D	1	P	0.49559	0.925	P	0.55161	0.77	T	0.33420	-0.9869	10	0.87932	D	0	-2.0271	18.8933	0.92413	0.0:1.0:0.0:0.0	.	394	Q9H2S1	KCNN2_HUMAN	V	394;394;46	ENSP00000427120:A394V;ENSP00000264773:A394V;ENSP00000421439:A46V	ENSP00000264773:A394V	A	+	2	0	KCNN2	113836687	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.674000	0.83992	2.624000	0.88883	0.655000	0.94253	GCA		0.413	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250775.2	NM_021614		Missense_Mutation
PCDHGA3	56112	broad.mit.edu	37	5	140725696	140725696	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr5:140725696C>T	ENST00000253812.6	+	1	2096	c.2096C>T	c.(2095-2097)gCg>gTg	p.A699V	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	699					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGTGGCCGCGGTCTCCTGC	0.677																																																0			5											42.0	49.0	47.0					5																	140725696		2202	4293	6495	140705880	SO:0001583	missense	56112			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.2096C>T	5.37:g.140725696C>T	ENSP00000253812:p.Ala699Val		140705880	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	CCDS47290.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	.	0.019	-1.463334	0.01062	.	.	ENSG00000254245	ENST00000253812	T	0.12039	2.72	5.16	-3.65	0.04502	.	0.573300	0.12740	U	0.443092	T	0.08223	0.0205	L	0.31065	0.9	0.09310	N	1	B;B	0.18166	0.026;0.012	B;B	0.19666	0.026;0.012	T	0.43180	-0.9407	10	0.02654	T	1	.	14.5668	0.68182	0.0:0.347:0.0:0.653	.	699;699	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	V	699	ENSP00000253812:A699V	ENSP00000253812:A699V	A	+	2	0	PCDHGA3	140705880	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.559000	0.00922	-0.785000	0.04522	0.563000	0.77884	GCG		0.677	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		Missense_Mutation
HLA-E	3133	broad.mit.edu	37	6	30460343	30460343	+	Silent	SNP	G	G	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr6:30460343G>A	ENST00000376630.4	+	7	1127	c.1062G>A	c.(1060-1062)gaG>gaA	p.E354E		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	354					antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)	p.E354E(1)		breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						AGGGGTCTGAGTCTCACAGCT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	6											50.0	57.0	55.0					6																	30460343		2203	4300	6503	30568322	SO:0001819	synonymous_variant	3133			M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.1062G>A	6.37:g.30460343G>A			30568322	Q30169|Q9BT83|Q9GIY7|Q9GIY8	Silent	SNP	ENST00000376630.4	37	CCDS34379.1	SNP	36	Broad																																																																																				0.547	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076282.2	NM_005516		Silent
TUBE1	51175	broad.mit.edu	37	6	112397247	112397247	+	Silent	SNP	C	C	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr6:112397247C>T	ENST00000368662.5	-	8	783	c.705G>A	c.(703-705)aaG>aaA	p.K235K	TUBE1_ENST00000604814.1_5'UTR	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1	235					centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.K235K(1)		cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	GACTCTTTGGCTTCACAGTTG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	6											161.0	174.0	170.0					6																	112397247		2203	4300	6503	112503940	SO:0001819	synonymous_variant	51175			AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.705G>A	6.37:g.112397247C>T			112503940	Q5H8W8|Q8NEG3	Silent	SNP	ENST00000368662.5	37	CCDS5100.1	SNP	28	Broad																																																																																				0.398	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041867.1	NM_016262		Silent
CHD7	55636	broad.mit.edu	37	8	61736434	61736434	+	Silent	SNP	C	C	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr8:61736434C>T	ENST00000423902.2	+	13	3716	c.3237C>T	c.(3235-3237)gcC>gcT	p.A1079A	CHD7_ENST00000525508.1_Silent_p.A1079A|CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1079	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.A1079A(1)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AGTTTCATGCCATCATCACTA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	8											115.0	107.0	109.0					8																	61736434		1935	4162	6097	61898988	SO:0001819	synonymous_variant	55636			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.3237C>T	8.37:g.61736434C>T			61898988	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	ENST00000423902.2	37	CCDS47865.1	SNP	21	Broad																																																																																				0.378	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		Silent
STMN2	11075	broad.mit.edu	37	8	80553642	80553642	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr8:80553642G>A	ENST00000220876.7	+	3	527	c.145G>A	c.(145-147)Gcc>Acc	p.A49T	STMN2_ENST00000518111.1_Missense_Mutation_p.A49T|STMN2_ENST00000518491.1_Missense_Mutation_p.A38T	NM_001199214.1|NM_007029.3	NP_001186143.1|NP_008960.2	Q93045	STMN2_HUMAN	stathmin 2	49	Regulatory/phosphorylation domain. {ECO:0000255}.|SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cellular response to nerve growth factor stimulus (GO:1990090)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|positive regulation of microtubule depolymerization (GO:0031117)|positive regulation of neuron projection development (GO:0010976)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)	p.A49T(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11	all_lung(9;8.34e-05)		Epithelial(68;0.0229)|all cancers(69;0.0874)			CAACAAACGTGCCTCTGGCCA	0.413																																																1	Substitution - Missense(1)	ovary(1)	8											88.0	85.0	86.0					8																	80553642		1948	4158	6106	80716197	SO:0001583	missense	11075				CCDS43748.1, CCDS56542.1	8q21.13	2014-04-01	2014-04-01	2001-07-13	ENSG00000104435	ENSG00000104435			10577	protein-coding gene	gene with protein product		600621	"""stathmin-like 2"""	SCGN10		8622778, 12140291	Standard	NM_007029		Approved	SCG10	uc022awk.1	Q93045	OTTHUMG00000164610	ENST00000220876.7:c.145G>A	8.37:g.80553642G>A	ENSP00000220876:p.Ala49Thr		80716197	A8K9M2|G3V110|O14952|Q6PK68	Missense_Mutation	SNP	ENST00000220876.7	37	CCDS43748.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	16.57	3.160411	0.57368	.	.	ENSG00000104435	ENST00000220876;ENST00000414622;ENST00000518111;ENST00000518491	.	.	.	5.68	5.68	0.88126	.	0.105053	0.64402	D	0.000004	T	0.69708	0.3141	M	0.75085	2.285	0.58432	D	0.999997	B;B	0.24920	0.114;0.074	B;B	0.27380	0.079;0.032	T	0.65220	-0.6221	9	0.26408	T	0.33	-4.0509	19.7823	0.96420	0.0:0.0:1.0:0.0	.	49;49	B7Z4K3;Q93045	.;STMN2_HUMAN	T	49;49;49;38	.	ENSP00000220876:A49T	A	+	1	0	STMN2	80716197	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.923000	0.87546	2.666000	0.90696	0.467000	0.42956	GCC		0.413	STMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379261.2	NM_007029		Missense_Mutation
TSPYL5	85453	broad.mit.edu	37	8	98289380	98289380	+	Silent	SNP	C	C	G			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr8:98289380C>G	ENST00000322128.3	-	1	796	c.693G>C	c.(691-693)ggG>ggC	p.G231G		NM_033512.2	NP_277047.2	Q86VY4	TSYL5_HUMAN	TSPY-like 5	231					cellular response to gamma radiation (GO:0071480)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|regulation of growth (GO:0040008)	nucleus (GO:0005634)		p.G231G(1)		cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	20	Breast(36;2.56e-06)					GTCGCAACTGCCCAAACTTCC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	8											65.0	66.0	66.0					8																	98289380		2203	4300	6503	98358556	SO:0001819	synonymous_variant	85453			AB051537	CCDS34927.1	8q22.1	2011-05-24			ENSG00000180543	ENSG00000180543			29367	protein-coding gene	gene with protein product		614721				11214970	Standard	NM_033512		Approved	KIAA1750	uc003yhy.3	Q86VY4	OTTHUMG00000164857	ENST00000322128.3:c.693G>C	8.37:g.98289380C>G			98358556	B3KRF0|Q9C0B3	Silent	SNP	ENST00000322128.3	37	CCDS34927.1	SNP	26	Broad																																																																																				0.582	TSPYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380611.1	NM_033512		Silent
RIMS2	9699	broad.mit.edu	37	8	104928759	104928759	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr8:104928759C>G	ENST00000436393.2	+	6	1605	c.1364C>G	c.(1363-1365)cCt>cGt	p.P455R	RIMS2_ENST00000406091.3_Missense_Mutation_p.P677R|RIMS2_ENST00000262231.10_Missense_Mutation_p.P532R|RIMS2_ENST00000507740.1_Missense_Mutation_p.P485R			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	755					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.P485R(1)|p.P455R(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GTTTCAAGGCCTATTGGGTAA	0.353										HNSCC(12;0.0054)																																						2	Substitution - Missense(2)	ovary(2)	8											124.0	117.0	119.0					8																	104928759		1857	4101	5958	104997935	SO:0001583	missense	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1364C>G	8.37:g.104928759C>G	ENSP00000390665:p.Pro455Arg		104997935	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37		SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301220	0.81136	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000378492;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.21031	2.03;2.5;2.1;2.15;2.13;2.08;2.53	5.98	5.1	0.69264	PDZ/DHR/GLGF (2);	.	.	.	.	T	0.37433	0.1003	L	0.34521	1.04	0.80722	D	1	P;P;D;D;B;D	0.76494	0.834;0.825;0.999;0.98;0.309;0.982	B;P;D;P;B;P	0.83275	0.278;0.612;0.996;0.67;0.197;0.874	T	0.24225	-1.0166	9	0.87932	D	0	.	16.5964	0.84797	0.1313:0.8687:0.0:0.0	.	755;755;455;532;485;677	Q9UQ26;Q9UQ26-2;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.;.	R	677;708;677;755;68;485;532;485;485;455	ENSP00000427018:P677R;ENSP00000384892:P677R;ENSP00000425205:P485R;ENSP00000262231:P532R;ENSP00000423559:P485R;ENSP00000386228:P485R;ENSP00000390665:P455R	ENSP00000262231:P532R	P	+	2	0	RIMS2	104997935	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	1.504000	0.48704	0.650000	0.86243	CCT		0.353	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		Missense_Mutation
RNF20	56254	broad.mit.edu	37	9	104323145	104323145	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr9:104323145C>A	ENST00000389120.3	+	17	2535	c.2445C>A	c.(2443-2445)aaC>aaA	p.N815K		NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	815					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.N815K(1)		breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TACAGAGCAACATTGGCACAG	0.413																																																1	Substitution - Missense(1)	ovary(1)	9											83.0	84.0	84.0					9																	104323145		2203	4300	6503	103362966	SO:0001583	missense	56254			AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.2445C>A	9.37:g.104323145C>A	ENSP00000373772:p.Asn815Lys		103362966	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	ENST00000389120.3	37	CCDS35084.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	14.41	2.526329	0.44969	.	.	ENSG00000155827	ENST00000389120	T	0.27557	1.66	5.48	5.48	0.80851	.	0.137128	0.64402	D	0.000003	T	0.15219	0.0367	N	0.04508	-0.205	0.40380	D	0.979431	B	0.26445	0.149	B	0.27076	0.076	T	0.18023	-1.0350	10	0.13853	T	0.58	-16.3199	13.9898	0.64359	0.0:0.9251:0.0:0.0749	.	815	Q5VTR2	BRE1A_HUMAN	K	815	ENSP00000373772:N815K	ENSP00000373772:N815K	N	+	3	2	RNF20	103362966	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	0.521000	0.22893	2.730000	0.93505	0.650000	0.86243	AAC		0.413	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592		Missense_Mutation
DFNB31	25861	broad.mit.edu	37	9	117165105	117165105	+	Missense_Mutation	SNP	C	C	A	rs143464875		TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chr9:117165105C>A	ENST00000362057.3	-	12	2821	c.2653G>T	c.(2653-2655)Gcc>Tcc	p.A885S	DFNB31_ENST00000374059.3_Missense_Mutation_p.A534S|DFNB31_ENST00000265134.6_Missense_Mutation_p.A502S	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	885	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)		p.A885S(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AAGGCCTCGGCGATAATGCGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	9											69.0	63.0	65.0					9																	117165105		2203	4300	6503	116204926	SO:0001583	missense	25861			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.2653G>T	9.37:g.117165105C>A	ENSP00000354623:p.Ala885Ser		116204926	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	CCDS6806.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	32	5.185236	0.94885	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.26660	1.72;1.72;1.72	4.69	4.69	0.59074	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.42291	0.1196	L	0.33339	1.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.42464	-0.9450	10	0.87932	D	0	-20.509	17.9846	0.89152	0.0:1.0:0.0:0.0	.	884;885;534	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	S	502;534;885	ENSP00000265134:A502S;ENSP00000363172:A534S;ENSP00000354623:A885S	ENSP00000265134:A502S	A	-	1	0	DFNB31	116204926	1.000000	0.71417	0.991000	0.47740	0.981000	0.71138	7.107000	0.77047	2.293000	0.77203	0.651000	0.88453	GCC		0.582	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404		Missense_Mutation
FAM47A	158724	broad.mit.edu	37	X	34150181	34150181	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chrX:34150181C>T	ENST00000346193.3	-	1	266	c.215G>A	c.(214-216)cGc>cAc	p.R72H		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	72								p.R72H(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						CTCGTCACGGCGACAAACGAG	0.537																																																1	Substitution - Missense(1)	ovary(1)	X											89.0	84.0	86.0					X																	34150181		2202	4300	6502	34060102	SO:0001583	missense	158724			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.215G>A	X.37:g.34150181C>T	ENSP00000345029:p.Arg72His		34060102	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	3.358	-0.131099	0.06753	.	.	ENSG00000185448	ENST00000346193	T	0.21191	2.02	1.17	1.17	0.20885	.	.	.	.	.	T	0.13415	0.0325	L	0.57536	1.79	0.09310	N	1	P	0.38280	0.625	B	0.24974	0.057	T	0.18023	-1.0350	9	0.14252	T	0.57	.	5.3637	0.16101	0.0:1.0:0.0:0.0	.	72	Q5JRC9	FA47A_HUMAN	H	72	ENSP00000345029:R72H	ENSP00000345029:R72H	R	-	2	0	FAM47A	34060102	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.184000	0.09698	0.880000	0.35969	0.544000	0.68410	CGC		0.537	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		Missense_Mutation
H2BFWT	158983	broad.mit.edu	37	X	103268205	103268205	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chrX:103268205G>T	ENST00000217926.5	-	1	54	c.28C>A	c.(28-30)Ccc>Acc	p.P10T	H2BFM_ENST00000243297.5_5'Flank	NM_001002916.3	NP_001002916.3	Q7Z2G1	H2BWT_HUMAN	H2B histone family, member W, testis-specific	10						membrane (GO:0016020)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P10T(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	16						GTGGACCGGGGAAGCCGGGGC	0.602																																																1	Substitution - Missense(1)	ovary(1)	X											35.0	30.0	31.0					X																	103268205		2203	4299	6502	103154861	SO:0001583	missense	158983			BC038109	CCDS35362.1	Xq22.2	2011-01-27			ENSG00000123569	ENSG00000123569		"""Histones / Replication-independent"""	27252	protein-coding gene	gene with protein product		300507				12477932	Standard	NM_001002916		Approved		uc004elr.3	Q7Z2G1	OTTHUMG00000022120	ENST00000217926.5:c.28C>A	X.37:g.103268205G>T	ENSP00000354723:p.Pro10Thr		103154861	B1AK72|Q147W3	Missense_Mutation	SNP	ENST00000217926.5	37	CCDS35362.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	.	6.533	0.466650	0.12402	.	.	ENSG00000123569	ENST00000217926	T	0.27720	1.65	2.33	0.381	0.16228	.	.	.	.	.	T	0.18882	0.0453	N	0.19112	0.55	0.09310	N	1	B	0.26081	0.141	B	0.24394	0.053	T	0.22173	-1.0224	9	0.72032	D	0.01	.	8.175	0.31276	0.0:0.4927:0.5073:0.0	.	10	Q7Z2G1	H2BWT_HUMAN	T	10	ENSP00000354723:P10T	ENSP00000354723:P10T	P	-	1	0	H2BFWT	103154861	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	-0.185000	0.09684	-0.013000	0.14199	-0.268000	0.10319	CCC		0.602	H2BFWT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057756.2	NM_001002916		Missense_Mutation
ARHGAP36	158763	broad.mit.edu	37	X	130218611	130218611	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2079-01	TCGA-23-2079-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-23-2079-01	TCGA-23-2079-10	g.chrX:130218611G>A	ENST00000276211.5	+	6	1105	c.760G>A	c.(760-762)Gtg>Atg	p.V254M	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.V242M|ARHGAP36_ENST00000370921.1_Missense_Mutation_p.V118M	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	254	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.V254M(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CTTAAGCGCAGTGGGGATTTT	0.488																																																1	Substitution - Missense(1)	ovary(1)	X											187.0	164.0	172.0					X																	130218611		2203	4300	6503	130046292	SO:0001583	missense	158763				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.760G>A	X.37:g.130218611G>A	ENSP00000276211:p.Val254Met		130046292	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305278	0.40795	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432;ENST00000370921	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	4.99	3.04	0.35103	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.47455	D	0.000239	T	0.57125	0.2032	M	0.86953	2.85	0.44719	D	0.997712	P;P;P	0.51147	0.928;0.928;0.942	P;P;P	0.55222	0.66;0.66;0.771	T	0.60306	-0.7289	10	0.59425	D	0.04	.	6.5973	0.22681	0.0:0.1961:0.5974:0.2065	.	223;242;254	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	M	254;242;206;223;118	ENSP00000276211:V254M;ENSP00000359960:V242M;ENSP00000409218:V206M;ENSP00000408515:V223M;ENSP00000359959:V118M	ENSP00000276211:V254M	V	+	1	0	ARHGAP36	130046292	1.000000	0.71417	0.919000	0.36401	0.104000	0.19210	5.837000	0.69381	1.178000	0.42870	0.529000	0.55759	GTG		0.488	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967		Missense_Mutation
