#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CREBBP	1387	genome.wustl.edu	37	16	3790520	3790520	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0966-01	TCGA-24-0966-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr16:3790520A>G	ENST00000262367.5	-	24	4822	c.4013T>C	c.(4012-4014)tTg>tCg	p.L1338S	CREBBP_ENST00000382070.3_Missense_Mutation_p.L1300S	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1338	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.L1338S(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TCGGTCTTCCAAGTGGTTTCC	0.552			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	1	Substitution - Missense(1)	ovary(1)	16											65.0	68.0	67.0					16																	3790520		2197	4300	6497	3730521	SO:0001583	missense	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4013T>C	16.37:g.3790520A>G	ENSP00000262367:p.Leu1338Ser		3730521	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	a	19.22	3.785827	0.70337	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.87571	-2.27;-2.19	5.05	5.05	0.67936	.	0.105342	0.40554	N	0.001078	D	0.91952	0.7451	M	0.81341	2.54	0.47778	D	0.999518	D;D	0.67145	0.996;0.996	P;P	0.56823	0.807;0.807	D	0.93222	0.6609	10	0.87932	D	0	-9.8303	15.1052	0.72315	1.0:0.0:0.0:0.0	.	1368;1338	Q4LE28;Q92793	.;CBP_HUMAN	S	1338;1368;1300	ENSP00000262367:L1338S;ENSP00000371502:L1300S	ENSP00000262367:L1338S	L	-	2	0	CREBBP	3730521	1.000000	0.71417	0.818000	0.32626	0.982000	0.71751	9.210000	0.95106	2.026000	0.59711	0.454000	0.30748	TTG		0.552	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7577547	7577547	+	Missense_Mutation	SNP	C	C	A	rs121912656|rs397516437		TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr17:7577547C>A	ENST00000269305.4	-	7	923	c.734G>T	c.(733-735)gGc>gTc	p.G245V	TP53_ENST00000455263.2_Missense_Mutation_p.G245V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.G245V|TP53_ENST00000359597.4_Missense_Mutation_p.G245V|TP53_ENST00000445888.2_Missense_Mutation_p.G245V|TP53_ENST00000420246.2_Missense_Mutation_p.G245V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245D(104)|p.G245V(66)|p.G245A(8)|p.0?(8)|p.?(5)|p.G152V(4)|p.G244_M246>V(3)|p.G152D(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.G245fs*2(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.C238_M246delCNSSCMGGM(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTTCATGCCGCCCATGCA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	219	Substitution - Missense(191)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	large_intestine(37)|lung(32)|oesophagus(23)|breast(22)|ovary(18)|upper_aerodigestive_tract(16)|haematopoietic_and_lymphoid_tissue(15)|liver(9)|prostate(7)|stomach(6)|central_nervous_system(6)|skin(6)|biliary_tract(5)|urinary_tract(5)|bone(5)|pancreas(4)|cervix(1)|vulva(1)|endometrium(1)	17	GRCh37	CM010464|CM900209	TP53	M	rs121912656						151.0	113.0	126.0					17																	7577547		2203	4300	6503	7518272	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.734G>T	17.37:g.7577547C>A	ENSP00000269305:p.Gly245Val		7518272	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563102	0.86335	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0;1.0	D	0.96045	0.9027	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	V	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245V;ENSP00000352610:G245V;ENSP00000269305:G245V;ENSP00000398846:G245V;ENSP00000391127:G245V;ENSP00000391478:G245V;ENSP00000425104:G113V;ENSP00000423862:G152V	ENSP00000269305:G245V	G	-	2	0	TP53	7518272	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
CHERP	10523	genome.wustl.edu	37	19	16638986	16638986	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0966-01	TCGA-24-0966-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr19:16638986C>T	ENST00000198939.6	-	9	1279	c.1243G>A	c.(1243-1245)Ggc>Agc	p.G415S	CHERP_ENST00000544299.1_5'Flank|CHERP_ENST00000546361.2_Missense_Mutation_p.G404S|CTD-3222D19.2_ENST00000409035.1_Intron					calcium homeostasis endoplasmic reticulum protein									p.G404S(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						ccccgggggccggcAGCTGCA	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											44.0	53.0	50.0					19																	16638986		1866	4076	5942	16499986	SO:0001583	missense	10523			U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.1243G>A	19.37:g.16638986C>T	ENSP00000198939:p.Gly415Ser		16499986		Missense_Mutation	SNP	ENST00000198939.6	37		SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	14.11	2.438047	0.43326	.	.	ENSG00000085872	ENST00000546361;ENST00000198939	T;T	0.23147	1.92;1.92	5.02	5.02	0.67125	.	.	.	.	.	T	0.24236	0.0587	L	0.29908	0.895	0.51767	D	0.999936	D	0.67145	0.996	P	0.45343	0.477	T	0.01652	-1.1303	9	0.31617	T	0.26	-20.0749	17.3571	0.87340	0.0:1.0:0.0:0.0	.	404	Q8IWX8	CHERP_HUMAN	S	404;415	ENSP00000439856:G404S;ENSP00000198939:G415S	ENSP00000198939:G415S	G	-	1	0	CHERP	16499986	0.999000	0.42202	0.806000	0.32338	0.234000	0.25298	5.523000	0.67099	2.342000	0.79632	0.561000	0.74099	GGC		0.627	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000403372.1	NM_006387		Missense_Mutation
LZTR1	8216	genome.wustl.edu	37	22	21340180	21340180	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0966-01	TCGA-24-0966-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr22:21340180G>T	ENST00000215739.8	+	3	673	c.314G>T	c.(313-315)tGg>tTg	p.W105L	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Intron	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	105					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W105L(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			GACTGCTCCTGGTGCAGGTGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	22											86.0	67.0	74.0					22																	21340180		2203	4300	6503	19670180	SO:0001583	missense	8216			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.314G>T	22.37:g.21340180G>T	ENSP00000215739:p.Trp105Leu		19670180	Q14776|Q20WK0	Missense_Mutation	SNP	ENST00000215739.8	37	CCDS33606.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	31	5.075613	0.94000	.	.	ENSG00000099949	ENST00000539817;ENST00000215739	T	0.61627	0.09	4.52	4.52	0.55395	.	0.145322	0.53938	D	0.000057	D	0.83940	0.5363	H	0.97491	4.015	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.87578	0.998;0.991	D	0.89514	0.3773	10	0.87932	D	0	-23.9298	15.1436	0.72630	0.0:0.0:1.0:0.0	.	105;64	Q8N653;F5GXU8	LZTR1_HUMAN;.	L	64;105	ENSP00000215739:W105L	ENSP00000215739:W105L	W	+	2	0	LZTR1	19670180	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.398000	0.97281	2.516000	0.84829	0.643000	0.83706	TGG		0.582	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767		Missense_Mutation
TWISTNB	221830	genome.wustl.edu	37	7	19738009	19738009	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr7:19738009C>G	ENST00000222567.5	-	4	1017	c.947G>C	c.(946-948)aGt>aCt	p.S316T		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	316	Lys-rich.				transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)	p.S316T(1)		kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						GGCCTCTTCACTGTGTTTTCT	0.373																																																1	Substitution - Missense(1)	ovary(1)	7											99.0	109.0	105.0					7																	19738009		2202	4298	6500	19704534	SO:0001583	missense	221830			AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.947G>C	7.37:g.19738009C>G	ENSP00000222567:p.Ser316Thr		19704534	A0PJ45|B7Z724	Missense_Mutation	SNP	ENST00000222567.5	37	CCDS34606.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	8.546	0.874341	0.17395	.	.	ENSG00000105849	ENST00000222567	.	.	.	5.48	2.75	0.32379	.	0.881604	0.10433	N	0.675282	T	0.38268	0.1034	L	0.51422	1.61	0.21822	N	0.999522	B	0.23937	0.094	B	0.18871	0.023	T	0.30446	-0.9978	9	0.12766	T	0.61	-1.3556	8.9221	0.35619	0.0:0.7174:0.0:0.2826	.	316	Q3B726	RPA43_HUMAN	T	316	.	ENSP00000222567:S316T	S	-	2	0	TWISTNB	19704534	0.064000	0.20934	0.997000	0.53966	0.483000	0.33249	1.787000	0.38704	0.315000	0.23110	-1.212000	0.01626	AGT		0.373	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326463.1			Missense_Mutation
HERC2	8924	genome.wustl.edu	37	15	28511071	28511071	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr15:28511071C>T	ENST00000261609.7	-	13	1756	c.1648G>A	c.(1648-1650)Ggg>Agg	p.G550R		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.G550R(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACGTGCTTCCCGGCCTGCTTT	0.592																																																1	Substitution - Missense(1)	ovary(1)	15											54.0	50.0	52.0					15																	28511071		2203	4300	6503	26184666	SO:0001583	missense	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.1648G>A	15.37:g.28511071C>T	ENSP00000261609:p.Gly550Arg		26184666		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	26.8	4.776214	0.90195	.	.	ENSG00000128731	ENST00000261609	T	0.45668	0.89	5.7	5.7	0.88788	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	T	0.33000	0.0848	L	0.28400	0.85	0.80722	D	1	P	0.44309	0.832	B	0.34138	0.176	T	0.16158	-1.0412	10	0.49607	T	0.09	.	20.263	0.98456	0.0:1.0:0.0:0.0	.	550	O95714	HERC2_HUMAN	R	550	ENSP00000261609:G550R	ENSP00000261609:G550R	G	-	1	0	HERC2	26184666	1.000000	0.71417	0.991000	0.47740	0.983000	0.72400	7.442000	0.80503	2.868000	0.98415	0.556000	0.70494	GGG		0.592	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		Missense_Mutation
CCDC73	493860	genome.wustl.edu	37	11	32636229	32636229	+	Silent	SNP	T	T	G			TCGA-24-0966-01	TCGA-24-0966-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr11:32636229T>G	ENST00000335185.5	-	16	1678	c.1635A>C	c.(1633-1635)atA>atC	p.I545I	CCDC73_ENST00000534415.1_5'Flank	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	545								p.I545I(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					TTTCTGTTTCTATTGCTGTAT	0.294																																																1	Substitution - coding silent(1)	ovary(1)	11											133.0	118.0	123.0					11																	32636229		1810	4073	5883	32592805	SO:0001819	synonymous_variant	493860			AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.1635A>C	11.37:g.32636229T>G			32592805	Q6P5Q7|Q6ZMW0|Q86WE7	Silent	SNP	ENST00000335185.5	37	CCDS41630.1	SNP	53	WashU																																																																																				0.294	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391		Silent
NBEA	26960	genome.wustl.edu	37	13	35615294	35615294	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0966-01	TCGA-24-0966-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr13:35615294G>A	ENST00000400445.3	+	2	1053	c.519G>A	c.(517-519)atG>atA	p.M173I	NBEA_ENST00000379939.2_Missense_Mutation_p.M173I|NBEA_ENST00000310336.4_Missense_Mutation_p.M173I|NBEA_ENST00000540320.1_Missense_Mutation_p.M173I	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	173					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.M173I(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TAGATGACATGATAGCAGGTA	0.343																																																1	Substitution - Missense(1)	ovary(1)	13											51.0	47.0	49.0					13																	35615294		1876	4111	5987	34513294	SO:0001583	missense	26960			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.519G>A	13.37:g.35615294G>A	ENSP00000383295:p.Met173Ile		34513294	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680273	0.47886	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	5.43	5.43	0.79202	.	0.046970	0.85682	D	0.000000	T	0.42494	0.1205	L	0.41492	1.28	0.80722	D	1	B	0.21905	0.062	B	0.15870	0.014	T	0.17961	-1.0352	10	0.29301	T	0.29	.	19.2626	0.93974	0.0:0.0:1.0:0.0	.	173	Q5T321	.	I	173	ENSP00000440951:M173I;ENSP00000383295:M173I;ENSP00000369271:M173I;ENSP00000308534:M173I	ENSP00000308534:M173I	M	+	3	0	NBEA	34513294	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.680000	0.74518	2.544000	0.85801	0.585000	0.79938	ATG		0.343	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678		Missense_Mutation
ARPP21	10777	genome.wustl.edu	37	3	35770914	35770914	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr3:35770914C>T	ENST00000187397.4	+	15	1801	c.1345C>T	c.(1345-1347)Cca>Tca	p.P449S	ARPP21_ENST00000337271.5_Missense_Mutation_p.P395S|ARPP21_ENST00000444190.1_Missense_Mutation_p.P395S|ARPP21_ENST00000417925.1_Missense_Mutation_p.P415S|ARPP21_ENST00000458225.1_Missense_Mutation_p.P415S	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	449					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)	p.P449S(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						TGTGCCTTATCCAGAGAATGG	0.597																																																1	Substitution - Missense(1)	ovary(1)	3											63.0	60.0	61.0					3																	35770914		2203	4300	6503	35745918	SO:0001583	missense	10777			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1345C>T	3.37:g.35770914C>T	ENSP00000187397:p.Pro449Ser		35745918	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	CCDS2661.1	SNP	30	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.912|7.912	0.736665|0.736665	0.15574|0.15574	.|.	.|.	ENSG00000172995|ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925|ENST00000425289	T;T;T;T;T|.	0.21543|.	2.0;2.0;2.0;2.06;2.0|.	6.06|6.06	-2.16|-2.16	0.07080|0.07080	.|.	0.522569|.	0.22241|.	N|.	0.062691|.	T|T	0.17365|0.17365	0.0417|0.0417	N|N	0.17345|0.17345	0.48|0.48	0.09310|0.09310	N|N	0.999998|0.999998	B;B;B|.	0.06786|.	0.0;0.0;0.001|.	B;B;B|.	0.09377|.	0.002;0.001;0.004|.	T|T	0.26643|0.26643	-1.0097|-1.0097	10|5	0.12103|.	T|.	0.63|.	-0.0985|-0.0985	2.715|2.715	0.05185|0.05185	0.1907:0.2608:0.3748:0.1737|0.1907:0.2608:0.3748:0.1737	.|.	415;449;395|.	Q9UBL0-3;Q9UBL0;Q9UBL0-4|.	.;ARP21_HUMAN;.|.	S|F	415;395;395;449;415|221	ENSP00000414351:P415S;ENSP00000337792:P395S;ENSP00000405276:P395S;ENSP00000187397:P449S;ENSP00000412326:P415S|.	ENSP00000187397:P449S|.	P|S	+|+	1|2	0|0	ARPP21|ARPP21	35745918|35745918	0.000000|0.000000	0.05858|0.05858	0.154000|0.154000	0.22540|0.22540	0.987000|0.987000	0.75469|0.75469	-0.648000|-0.648000	0.05391|0.05391	-0.124000|-0.124000	0.11724|0.11724	0.650000|0.650000	0.86243|0.86243	CCA|TCC		0.597	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399		Missense_Mutation
N4BP2	55728	genome.wustl.edu	37	4	40124773	40124773	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0966-01	TCGA-24-0966-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr4:40124773G>A	ENST00000261435.6	+	10	4641	c.4225G>A	c.(4225-4227)Gtt>Att	p.V1409I		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1409					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)	p.V1409I(1)		breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AGATTGTGTGGTTCATATAGA	0.373																																																1	Substitution - Missense(1)	ovary(1)	4											133.0	135.0	135.0					4																	40124773		2203	4300	6503	39801168	SO:0001583	missense	55728			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.4225G>A	4.37:g.40124773G>A	ENSP00000261435:p.Val1409Ile		39801168	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	CCDS3457.1	SNP	44	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.4|27.4	4.827162|4.827162	0.90955|0.90955	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000513269|ENST00000261435;ENST00000381804	.|T	.|0.46451	.|0.87	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	.|0.068037	.|0.56097	.|D	.|0.000024	T|T	0.63010|0.63010	0.2475|0.2475	L|L	0.60455|0.60455	1.87|1.87	0.51767|0.51767	D|D	0.999933|0.999933	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.83275	.|0.996;0.991	T|T	0.62369|0.62369	-0.6869|-0.6869	5|10	.|0.49607	.|T	.|0.09	-16.0302|-16.0302	19.0678|19.0678	0.93119|0.93119	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1409;1409	.|Q86UW6-2;Q86UW6	.|.;N4BP2_HUMAN	D|I	1055|1409;1329	.|ENSP00000261435:V1409I	.|ENSP00000261435:V1409I	G|V	+|+	2|1	0|0	N4BP2|N4BP2	39801168|39801168	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.916000|0.916000	0.54674|0.54674	8.444000|8.444000	0.90323|0.90323	2.494000|2.494000	0.84150|0.84150	0.591000|0.591000	0.81541|0.81541	GGT|GTT		0.373	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177		Missense_Mutation
MYO5C	55930	genome.wustl.edu	37	15	52571812	52571812	+	Silent	SNP	G	G	A	rs371621193		TCGA-24-0966-01	TCGA-24-0966-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr15:52571812G>A	ENST00000261839.7	-	3	359	c.198C>T	c.(196-198)ctC>ctT	p.L66L	MYO5C_ENST00000443683.2_5'UTR|MYO5C_ENST00000541028.1_5'UTR|MIR1266_ENST00000408125.1_RNA	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	66						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.L66L(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TCTCGCCCACGAGGATGTCAG	0.468																																																1	Substitution - coding silent(1)	ovary(1)	15						G		0,3772		0,0,1886	59.0	59.0	59.0		198	-9.8	0.9	15		59	1,8243		0,1,4121	no	coding-synonymous	MYO5C	NM_018728.3		0,1,6007	AA,AG,GG		0.0121,0.0,0.0083		66/1743	52571812	1,12015	1886	4122	6008	50359104	SO:0001819	synonymous_variant	55930			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.198C>T	15.37:g.52571812G>A			50359104	Q6P1W8	Silent	SNP	ENST00000261839.7	37	CCDS42036.1	SNP	37	WashU																																																																																				0.468	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728		Silent
CBLN4	140689	genome.wustl.edu	37	20	54573714	54573714	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0966-01	TCGA-24-0966-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr20:54573714G>T	ENST00000064571.2	-	3	1805	c.505C>A	c.(505-507)Cta>Ata	p.L169I		NM_080617.5	NP_542184.1	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	169	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein secretion (GO:0009306)	cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)		p.L169I(1)		endometrium(2)|large_intestine(1)|lung(10)|ovary(3)|pancreas(1)	17			Colorectal(105;0.202)			TCTTTATCTAGGTAGAGCAGG	0.438																																																1	Substitution - Missense(1)	ovary(1)	20											106.0	97.0	100.0					20																	54573714		2203	4300	6503	54007121	SO:0001583	missense	140689			AY358527	CCDS13448.1	20q13	2004-08-19	2004-08-19	2004-08-19	ENSG00000054803	ENSG00000054803			16231	protein-coding gene	gene with protein product		615029	"""cerebellin precursor-like 1"""	CBLNL1			Standard	NM_080617		Approved	dJ885A10.1	uc002xxa.4	Q9NTU7	OTTHUMG00000032782	ENST00000064571.2:c.505C>A	20.37:g.54573714G>T	ENSP00000064571:p.Leu169Ile		54007121	A8K0S5	Missense_Mutation	SNP	ENST00000064571.2	37	CCDS13448.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	11.35	1.613096	0.28712	.	.	ENSG00000054803	ENST00000064571	D	0.92397	-3.03	5.48	3.53	0.40419	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.93959	0.8066	M	0.92459	3.31	0.53005	D	0.99996	P	0.36837	0.571	B	0.42163	0.378	D	0.91837	0.5480	10	0.87932	D	0	-10.3883	9.6932	0.40141	0.1321:0.0:0.7509:0.117	.	169	Q9NTU7	CBLN4_HUMAN	I	169	ENSP00000064571:L169I	ENSP00000064571:L169I	L	-	1	2	CBLN4	54007121	1.000000	0.71417	0.545000	0.28153	0.690000	0.40134	1.379000	0.34340	0.292000	0.22492	-1.579000	0.00862	CTA		0.438	CBLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079783.2	NM_080617		Missense_Mutation
DIAPH3	81624	genome.wustl.edu	37	13	60407279	60407279	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0966-01	TCGA-24-0966-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr13:60407279A>T	ENST00000400324.4	-	24	3209	c.2989T>A	c.(2989-2991)Ttt>Att	p.F997I	DIAPH3_ENST00000400320.1_Missense_Mutation_p.F951I|DIAPH3_ENST00000377908.2_Missense_Mutation_p.F986I|DIAPH3_ENST00000400319.1_Missense_Mutation_p.F927I|DIAPH3_ENST00000267215.4_Missense_Mutation_p.F997I|DIAPH3_ENST00000400330.1_Missense_Mutation_p.F997I|DIAPH3_ENST00000465066.1_5'UTR	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	997	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.F997I(1)		cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TCAGTAAGAAAGTCTTCCACA	0.303																																																1	Substitution - Missense(1)	ovary(1)	13											140.0	127.0	131.0					13																	60407279		1839	4072	5911	59305280	SO:0001583	missense	81624			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.2989T>A	13.37:g.60407279A>T	ENSP00000383178:p.Phe997Ile		59305280	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	ENST00000400324.4	37	CCDS41898.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	18.71	3.683258	0.68157	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	T;T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0;2.0	6.03	2.22	0.28083	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.110120	0.64402	D	0.000004	T	0.43612	0.1255	M	0.85299	2.745	0.41093	D	0.985611	D;P	0.76494	0.999;0.845	D;B	0.70487	0.969;0.29	T	0.43327	-0.9398	10	0.87932	D	0	.	6.9489	0.24534	0.7415:0.1267:0.1318:0.0	.	734;997	Q9NSV4-1;Q9NSV4	.;DIAP3_HUMAN	I	997;997;986;951;927;986;927;951;997;734;997	ENSP00000383178:F997I;ENSP00000383184:F997I;ENSP00000367141:F986I;ENSP00000383173:F927I;ENSP00000383174:F951I;ENSP00000267215:F997I	ENSP00000267214:F734I	F	-	1	0	DIAPH3	59305280	1.000000	0.71417	0.901000	0.35422	0.958000	0.62258	2.638000	0.46562	1.118000	0.41863	0.455000	0.32223	TTT		0.303	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517		Missense_Mutation
PLA2G16	11145	genome.wustl.edu	37	11	63357675	63357675	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr11:63357675C>T	ENST00000323646.5	-	3	638	c.284G>A	c.(283-285)cGg>cAg	p.R95Q	PLA2G16_ENST00000394613.3_5'UTR|PLA2G16_ENST00000415826.1_Missense_Mutation_p.R95Q	NM_007069.3	NP_009000.2	P53816	HRSL3_HUMAN	phospholipase A2, group XVI	95					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|negative regulation of cell cycle (GO:0045786)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	1-acyl-2-lysophosphatidylserine acylhydrolase activity (GO:0052740)|phosphatidylcholine 1-acylhydrolase activity (GO:0008970)|phosphatidylserine 1-acylhydrolase activity (GO:0052739)|phospholipase A2 activity (GO:0004623)	p.R95Q(1)		kidney(2)|lung(1)|ovary(1)|skin(1)	5						CTCCTCCGCCCGCTGGATGAT	0.557																																																1	Substitution - Missense(1)	ovary(1)	11											119.0	100.0	107.0					11																	63357675		2201	4298	6499	63114251	SO:0001583	missense	11145			X92814	CCDS8047.1	11q12.3	2014-03-14	2008-09-19	2008-09-19	ENSG00000176485	ENSG00000176485	3.1.1.4		17825	protein-coding gene	gene with protein product	"""adipose-specific PLA2"""	613867	"""HRAS-like suppressor 3"""	HRASLS3		9771974, 18614531	Standard	NM_007069		Approved	HREV107, H-REV107-1, HREV107-3, MGC118754., AdPLA	uc009you.1	P53816	OTTHUMG00000167852	ENST00000323646.5:c.284G>A	11.37:g.63357675C>T	ENSP00000320337:p.Arg95Gln		63114251	B2R7Q4|B7XAK5|Q3SYI3|Q9HDD1	Missense_Mutation	SNP	ENST00000323646.5	37	CCDS8047.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	4.682	0.126819	0.08931	.	.	ENSG00000176485	ENST00000323646;ENST00000415826	T;T	0.27256	1.68;1.68	5.71	0.602	0.17535	NC (1);	0.625208	0.16964	N	0.192403	T	0.24353	0.0590	M	0.77313	2.365	0.24846	N	0.992432	B;B	0.31256	0.316;0.11	B;B	0.26614	0.071;0.029	T	0.16482	-1.0401	10	0.52906	T	0.07	-6.3765	5.2355	0.15445	0.1337:0.5695:0.0:0.2969	.	126;95	Q3MI98;P53816	.;PAG16_HUMAN	Q	95	ENSP00000320337:R95Q;ENSP00000389124:R95Q	ENSP00000320337:R95Q	R	-	2	0	PLA2G16	63114251	0.010000	0.17322	0.985000	0.45067	0.026000	0.11368	0.527000	0.22987	0.070000	0.16634	-0.196000	0.12772	CGG		0.557	PLA2G16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396632.1	NM_001128203		Missense_Mutation
ASB12	142689	genome.wustl.edu	37	X	63445259	63445259	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0966-01	TCGA-24-0966-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chrX:63445259A>T	ENST00000396130.2	-	1	244	c.245T>A	c.(244-246)gTc>gAc	p.V82D	MTMR8_ENST00000453546.1_Missense_Mutation_p.V466D|ASB12_ENST00000362002.2_Missense_Mutation_p.V91D			Q8WXK4	ASB12_HUMAN	ankyrin repeat and SOCS box containing 12	82					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.0?(2)|p.V82D(1)		endometrium(2)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14						GGCTAAGAGGACTTGCAAACA	0.532																																																3	Whole gene deletion(2)|Substitution - Missense(1)	ovary(2)|large_intestine(1)	X											78.0	50.0	60.0					X																	63445259		2203	4300	6503	63361984	SO:0001583	missense	142689			AF403030	CCDS14378.1, CCDS14378.2	Xq11.1	2013-01-10	2011-01-25		ENSG00000198881	ENSG00000198881		"""Ankyrin repeat domain containing"""	19763	protein-coding gene	gene with protein product		300891	"""ankyrin repeat and SOCS box-containing 12"""			12076535	Standard	NM_130388		Approved	FLJ39577		Q8WXK4	OTTHUMG00000021705	ENST00000396130.2:c.245T>A	X.37:g.63445259A>T	ENSP00000379435:p.Val82Asp		63361984	J3KP57|Q2M3D5|Q52LK4|Q6ISF9|Q8N8F5	Missense_Mutation	SNP	ENST00000396130.2	37		SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	13.36	2.213324	0.39102	.	.	ENSG00000198881;ENSG00000198881;ENSG00000198881;ENSG00000102043	ENST00000362002;ENST00000396130;ENST00000361287;ENST00000453546	T;T;T	0.65178	-0.14;-0.14;-0.14	3.56	3.56	0.40772	Ankyrin repeat-containing domain (4);	0.151264	0.44902	D	0.000403	T	0.67692	0.2920	L	0.41573	1.285	0.37735	D	0.92541	D;D	0.65815	0.995;0.995	D;P	0.65987	0.94;0.892	T	0.72928	-0.4143	10	0.72032	D	0.01	-22.6095	10.6129	0.45432	1.0:0.0:0.0:0.0	.	466;82	B4DQL0;Q8WXK4	.;ASB12_HUMAN	D	91;82;91;466	ENSP00000355195:V91D;ENSP00000379435:V82D;ENSP00000394003:V466D	ENSP00000354626:V91D	V	-	2	0	ASB12;MTMR8	63361984	0.990000	0.36364	0.846000	0.33378	0.157000	0.22087	6.605000	0.74155	1.436000	0.47453	0.430000	0.28490	GTC		0.532	ASB12-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				Missense_Mutation
TET1	80312	genome.wustl.edu	37	10	70446178	70446178	+	Missense_Mutation	SNP	T	T	A			TCGA-24-0966-01	TCGA-24-0966-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr10:70446178T>A	ENST00000373644.4	+	11	5327	c.5118T>A	c.(5116-5118)caT>caA	p.H1706Q		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1706					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.H1706Q(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						AGCAGCTCCATGTGCTACCTC	0.458																																																1	Substitution - Missense(1)	ovary(1)	10											78.0	75.0	76.0					10																	70446178		2203	4300	6503	70116184	SO:0001583	missense	80312			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.5118T>A	10.37:g.70446178T>A	ENSP00000362748:p.His1706Gln		70116184	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	20.5	3.997510	0.74818	.	.	ENSG00000138336	ENST00000373644	T	0.14640	2.49	5.39	-3.69	0.04450	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	0.000000	0.85682	D	0.000000	T	0.34019	0.0883	M	0.85373	2.75	0.33061	D	0.534054	D	0.54772	0.968	D	0.69142	0.962	T	0.49476	-0.8936	10	0.87932	D	0	.	12.6962	0.57005	0.0:0.4795:0.0:0.5205	.	1706	Q8NFU7	TET1_HUMAN	Q	1706	ENSP00000362748:H1706Q	ENSP00000362748:H1706Q	H	+	3	2	TET1	70116184	0.035000	0.19736	0.985000	0.45067	0.992000	0.81027	-0.733000	0.04898	-0.427000	0.07350	0.392000	0.25879	CAT		0.458	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625		Missense_Mutation
LRRC7	57554	genome.wustl.edu	37	1	70504682	70504682	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0966-01	TCGA-24-0966-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr1:70504682G>T	ENST00000035383.5	+	19	3091	c.3061G>T	c.(3061-3063)Gct>Tct	p.A1021S	LRRC7_ENST00000310961.5_Missense_Mutation_p.A1026S|LRRC7_ENST00000415775.2_Missense_Mutation_p.A305S	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1021						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.A1021S(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						ACAACAAAAAGCTTCTATGAC	0.448																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	42.0	41.0					1																	70504682		2203	4300	6503	70277270	SO:0001583	missense	57554				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.3061G>T	1.37:g.70504682G>T	ENSP00000035383:p.Ala1021Ser		70277270	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	3.588	-0.084187	0.07097	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.37058	1.22;1.29;2.38	5.63	4.7	0.59300	.	0.210330	0.42053	D	0.000765	T	0.06645	0.0170	N	0.04508	-0.205	0.30276	N	0.791804	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.08055	0.003;0.002;0.001	T	0.20874	-1.0262	10	0.21014	T	0.42	.	10.2298	0.43247	0.0:0.1798:0.6913:0.1289	.	305;1021;1021	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	S	1026;1021;305;844	ENSP00000309245:A1026S;ENSP00000035383:A1021S;ENSP00000394867:A305S	ENSP00000035383:A1021S	A	+	1	0	LRRC7	70277270	1.000000	0.71417	0.241000	0.24154	0.003000	0.03518	3.225000	0.51246	2.653000	0.90120	0.563000	0.77884	GCT		0.448	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		Missense_Mutation
DNM1P33	554175	genome.wustl.edu	37	15	74356050	74356050	+	IGR	SNP	G	G	A	rs554144537		TCGA-24-0966-01	TCGA-24-0966-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr15:74356050G>A								PML (15897 upstream) : GOLGA6A (6147 downstream)														p.S76S(1)									TTATCTTCTCGGAGCTGCTGG	0.602													.|||	1	0.000199681	0.0008	0.0	5008	,	,		20451	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	15																																								72143103	SO:0001628	intergenic_variant																																15.37:g.74356050G>A			72143103		Silent	SNP		37		SNP	39	WashU																																																																																			0	0.602									Silent
ZNF236	7776	genome.wustl.edu	37	18	74671772	74671772	+	Splice_Site	SNP	G	G	A			TCGA-24-0966-01	TCGA-24-0966-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr18:74671772G>A	ENST00000253159.8	+	29	5434	c.5236G>A	c.(5236-5238)Ggg>Agg	p.G1746R	ZNF236_ENST00000320610.9_Splice_Site_p.G1748R	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1746					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G1746R(1)		NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CATACATACAGGTAACGGGGA	0.468																																																1	Substitution - Missense(1)	ovary(1)	18											68.0	73.0	71.0					18																	74671772		2010	4178	6188	72800760	SO:0001630	splice_region_variant	7776			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.5236+1G>A	18.37:g.74671772G>A			72800760	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	13.81	2.349332	0.41599	.	.	ENSG00000130856	ENST00000253159	T	0.26223	1.75	4.8	4.8	0.61643	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.45357	0.1338	L	0.42487	1.325	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.45934	-0.9227	10	0.87932	D	0	.	17.8708	0.88810	0.0:0.0:1.0:0.0	.	1746	Q9UL36	ZN236_HUMAN	R	1746	ENSP00000253159:G1746R	ENSP00000253159:G1746R	G	+	1	0	ZNF236	72800760	1.000000	0.71417	0.994000	0.49952	0.538000	0.34931	9.129000	0.94430	2.226000	0.72624	0.561000	0.74099	GGG		0.468	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		Missense_Mutation	Missense_Mutation
DNM1P34	729809	genome.wustl.edu	37	15	75594056	75594056	+	RNA	SNP	C	C	T			TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr15:75594056C>T	ENST00000567292.1	-	0	513							Q6PK57	DMP34_HUMAN	DNM1 pseudogene 34							microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.S76S(1)									CCAGCAGCTCCGAGAAGATAA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	15																																								73381109						AJ576251		15q24.2	2013-04-25			ENSG00000260357	ENSG00000260357			35181	pseudogene	pseudogene				DNM1DN8@			Standard	NG_009143		Approved	DNM1DN8-1, DNM1DN8-5	uc002azx.1	Q6PK57	OTTHUMG00000172673		15.37:g.75594056C>T			73381109		Silent	SNP	ENST00000567292.1	37		SNP	23	WashU																																																																																				0.597	DNM1P34-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000419799.1	NG_009143		Silent
ADNP2	22850	genome.wustl.edu	37	18	77895899	77895899	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0966-01	TCGA-24-0966-10	G	G	T	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr18:77895899G>T	ENST00000262198.4	+	4	3058	c.2603G>T	c.(2602-2604)gGg>gTg	p.G868V		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	868					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G868V(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		GGCACCCCCGGGAGCACCGGC	0.587																																																1	Substitution - Missense(1)	ovary(1)	18											57.0	59.0	59.0					18																	77895899		2203	4300	6503	75996890	SO:0001583	missense	22850			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2603G>T	18.37:g.77895899G>T	ENSP00000262198:p.Gly868Val		75996890	A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	CCDS32853.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.710634	0.00712	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.04	3.05	0.35203	.	1.385650	0.04465	N	0.374961	T	0.32285	0.0824	L	0.36672	1.1	0.09310	N	0.999999	B	0.29037	0.231	B	0.25405	0.06	T	0.21211	-1.0252	8	.	.	.	-2.0231	4.4567	0.11647	0.3036:0.1716:0.5248:0.0	.	868	Q6IQ32	ADNP2_HUMAN	V	868	.	.	G	+	2	0	ADNP2	75996890	0.000000	0.05858	0.006000	0.13384	0.012000	0.07955	-0.194000	0.09559	0.532000	0.28657	0.655000	0.94253	GGG		0.587	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913		Missense_Mutation
LRRK1	79705	genome.wustl.edu	37	15	101566320	101566320	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0966-01	TCGA-24-0966-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr15:101566320G>A	ENST00000388948.3	+	17	2742	c.2383G>A	c.(2383-2385)Gac>Aac	p.D795N	LRRK1_ENST00000284395.5_Missense_Mutation_p.D792N	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.D807N(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AGGCTTCCCAGACATCACCTT	0.587																																																1	Substitution - Missense(1)	ovary(1)	15											60.0	66.0	64.0					15																	101566320		2080	4214	6294	99383843	SO:0001583	missense	79705			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.2383G>A	15.37:g.101566320G>A	ENSP00000373600:p.Asp795Asn		99383843		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382814	0.61845	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.72615	-0.63;-0.67	4.71	4.71	0.59529	ROC GTPase (1);	0.000000	0.85682	D	0.000000	T	0.74786	0.3762	N	0.26042	0.785	0.58432	D	0.999994	D	0.76494	0.999	D	0.75484	0.986	T	0.71781	-0.4489	10	0.22109	T	0.4	.	17.6842	0.88252	0.0:0.0:1.0:0.0	.	795	Q38SD2	LRRK1_HUMAN	N	795;792	ENSP00000373600:D795N;ENSP00000284395:D792N	ENSP00000284395:D792N	D	+	1	0	LRRK1	99383843	1.000000	0.71417	0.938000	0.37757	0.054000	0.15201	7.505000	0.81655	2.158000	0.67659	0.462000	0.41574	GAC		0.587	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652		Missense_Mutation
RELN	5649	genome.wustl.edu	37	7	103275980	103275980	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr7:103275980C>T	ENST00000428762.1	-	19	2516	c.2357G>A	c.(2356-2358)aGa>aAa	p.R786K	RELN_ENST00000424685.2_Missense_Mutation_p.R786K|RELN_ENST00000343529.5_Missense_Mutation_p.R786K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	786					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.R786K(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATCAGGGGCTCTGCACGTGCT	0.393																																					NSCLC(146;835 1944 15585 22231 52158)											1	Substitution - Missense(1)	ovary(1)	7											99.0	106.0	104.0					7																	103275980		2203	4300	6503	103063216	SO:0001583	missense	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.2357G>A	7.37:g.103275980C>T	ENSP00000392423:p.Arg786Lys		103063216	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	5.876	0.345808	0.11126	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.21031	2.03;2.03;2.03	6.08	-2.75	0.05914	.	0.515223	0.22959	N	0.053565	T	0.10208	0.0250	N	0.22421	0.69	0.22424	N	0.999113	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.40421	-0.9564	10	0.02654	T	1	.	13.659	0.62354	0.0:0.1748:0.0:0.8252	.	786;786	P78509-2;P78509	.;RELN_HUMAN	K	786	ENSP00000392423:R786K;ENSP00000345694:R786K;ENSP00000388446:R786K	ENSP00000345694:R786K	R	-	2	0	RELN	103063216	0.992000	0.36948	0.956000	0.39512	0.992000	0.81027	0.334000	0.19787	-0.365000	0.08076	-0.218000	0.12543	AGA		0.393	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		Missense_Mutation
SLC26A4	5172	genome.wustl.edu	37	7	107342281	107342281	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0966-01	TCGA-24-0966-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr7:107342281A>G	ENST00000265715.3	+	17	2037	c.1813A>G	c.(1813-1815)Ata>Gta	p.I605V	SLC26A4_ENST00000543100.1_Missense_Mutation_p.I174V|SLC26A4_ENST00000541474.1_Missense_Mutation_p.I166V|SLC26A4_ENST00000480841.1_3'UTR|SLC26A4_ENST00000544569.1_Missense_Mutation_p.I192V	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	605	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.I605V(1)		central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						GAATGGCATCATAAGTGATGC	0.343									Pendred syndrome																																							1	Substitution - Missense(1)	ovary(1)	7											86.0	85.0	85.0					7																	107342281		2203	4300	6503	107129517	SO:0001583	missense	5172	Familial Cancer Database	Goiter-Deafness syndrome	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1813A>G	7.37:g.107342281A>G	ENSP00000265715:p.Ile605Val		107129517	B7Z266|O43170	Missense_Mutation	SNP	ENST00000265715.3	37	CCDS5746.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	5.945	0.358421	0.11239	.	.	ENSG00000091137	ENST00000265715;ENST00000541474;ENST00000544569;ENST00000543100	D;D;D;D	0.94184	-3.08;-3.26;-3.35;-3.37	5.83	2.16	0.27623	Sulphate transporter/antisigma-factor antagonist STAS (3);	0.236657	0.42964	N	0.000629	D	0.83663	0.5303	N	0.16903	0.455	0.30718	N	0.748509	B;B;B	0.14805	0.011;0.004;0.002	B;B;B	0.15484	0.008;0.006;0.013	T	0.70927	-0.4739	10	0.08381	T	0.77	.	9.8984	0.41334	0.804:0.0:0.196:0.0	.	166;192;605	F5H104;B7Z6M6;O43511	.;.;S26A4_HUMAN	V	605;166;192;174	ENSP00000265715:I605V;ENSP00000439743:I166V;ENSP00000437427:I192V;ENSP00000441209:I174V	ENSP00000265715:I605V	I	+	1	0	SLC26A4	107129517	1.000000	0.71417	0.987000	0.45799	0.939000	0.58152	0.940000	0.28992	0.471000	0.27319	-0.274000	0.10170	ATA		0.343	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441		Missense_Mutation
C7orf66	154907	genome.wustl.edu	37	7	108524521	108524521	+	Silent	SNP	T	T	C			TCGA-24-0966-01	TCGA-24-0966-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr7:108524521T>C	ENST00000379007.2	-	1	123	c.69A>G	c.(67-69)agA>agG	p.R23R		NM_001024607.1	NP_001019778.1	A4D0T2	CG066_HUMAN	chromosome 7 open reading frame 66	23						integral component of membrane (GO:0016021)		p.R23R(1)		breast(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	15						GGCTCCAAAGTCTCTGATGAG	0.383																																																1	Substitution - coding silent(1)	ovary(1)	7											153.0	129.0	137.0					7																	108524521		2203	4300	6503	108311757	SO:0001819	synonymous_variant	154907			AF103078	CCDS34735.1	7q31.1	2009-03-06			ENSG00000205174	ENSG00000205174			33712	protein-coding gene	gene with protein product							Standard	NM_001024607		Approved		uc003vfo.3	A4D0T2	OTTHUMG00000154867	ENST00000379007.2:c.69A>G	7.37:g.108524521T>C			108311757		Silent	SNP	ENST00000379007.2	37	CCDS34735.1	SNP	58	WashU																																																																																				0.383	C7orf66-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337420.1	NM_001024607		Silent
KIAA1919	91749	genome.wustl.edu	37	6	111587449	111587449	+	Silent	SNP	C	C	T			TCGA-24-0966-01	TCGA-24-0966-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr6:111587449C>T	ENST00000368847.4	+	4	1037	c.684C>T	c.(682-684)aaC>aaT	p.N228N		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	228					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.N228N(1)		large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		AATATCACAACGCCCTTCTTT	0.368																																																1	Substitution - coding silent(1)	ovary(1)	6											108.0	98.0	101.0					6																	111587449		2203	4300	6503	111694142	SO:0001819	synonymous_variant	91749			BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.684C>T	6.37:g.111587449C>T			111694142	A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Silent	SNP	ENST00000368847.4	37	CCDS5090.1	SNP	19	WashU																																																																																				0.368	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041827.1	NM_153369		Silent
RNF10	9921	genome.wustl.edu	37	12	120995221	120995221	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0966-01	TCGA-24-0966-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr12:120995221G>A	ENST00000325954.4	+	5	1243	c.782G>A	c.(781-783)aGt>aAt	p.S261N	RNF10_ENST00000413266.2_Missense_Mutation_p.S261N	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	261					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S261N(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAGACGTGGAGTAAATGTCCC	0.468																																																1	Substitution - Missense(1)	ovary(1)	12											203.0	175.0	185.0					12																	120995221		2203	4300	6503	119479604	SO:0001583	missense	9921			AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.782G>A	12.37:g.120995221G>A	ENSP00000322242:p.Ser261Asn		119479604	Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	37	CCDS9201.1	SNP	36	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.29|14.29	2.491453|2.491453	0.44249|0.44249	.|.	.|.	ENSG00000022840|ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266|ENST00000542207;ENST00000541955	T;T|.	0.68181|.	-0.31;-0.31|.	5.74|5.74	5.74|5.74	0.90152|0.90152	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);|.	0.087523|.	0.85682|.	D|.	0.000000|.	T|T	0.49847|0.49847	0.1581|0.1581	N|N	0.11427|0.11427	0.14|0.14	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.998|.	T|T	0.42447|0.42447	-0.9451|-0.9451	10|5	0.38643|.	T|.	0.18|.	.|.	20.2982|20.2982	0.98569|0.98569	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	261;261|.	Q8N5U6-2;Q8N5U6|.	.;RNF10_HUMAN|.	N|I	261|59;54	ENSP00000322242:S261N;ENSP00000415682:S261N|.	ENSP00000322242:S261N|.	S|V	+|+	2|1	0|0	RNF10|RNF10	119479604|119479604	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	7.334000|7.334000	0.79224|0.79224	2.873000|2.873000	0.98535|0.98535	0.563000|0.563000	0.77884|0.77884	AGT|GTA		0.468	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401898.4			Missense_Mutation
NOTCH2	4853	genome.wustl.edu	37	1	120491095	120491095	+	Silent	SNP	T	T	C			TCGA-24-0966-01	TCGA-24-0966-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr1:120491095T>C	ENST00000256646.2	-	17	2913	c.2694A>G	c.(2692-2694)gaA>gaG	p.E898E		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	898	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.E898E(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGGTGGACATTCACACATGT	0.527			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome		OREG0013733	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	1	Substitution - coding silent(1)	ovary(1)	1											142.0	120.0	128.0					1																	120491095		2203	4300	6503	120292618	SO:0001819	synonymous_variant	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.2694A>G	1.37:g.120491095T>C		1504	120292618	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1	SNP	52	WashU																																																																																				0.527	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408		Silent
TENM1	10178	genome.wustl.edu	37	X	123518182	123518182	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0966-01	TCGA-24-0966-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chrX:123518182G>C	ENST00000371130.3	-	29	6641	c.6578C>G	c.(6577-6579)cCt>cGt	p.P2193R	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.P2200R	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2193					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.P2195R(1)									ATATCGGAGAGGAGTAAGACG	0.428																																																1	Substitution - Missense(1)	ovary(1)	X											126.0	117.0	120.0					X																	123518182		2203	4300	6503	123345863	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6578C>G	X.37:g.123518182G>C	ENSP00000360171:p.Pro2193Arg		123345863	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743635	0.69418	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86230	-2.09;-2.05	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.92244	0.7540	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.85130	0.997;0.928;0.965	D	0.92961	0.6389	10	0.87932	D	0	.	18.4768	0.90795	0.0:0.0:1.0:0.0	.	2199;2200;2193	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	R	2193;2200	ENSP00000360171:P2193R;ENSP00000403954:P2200R	ENSP00000360171:P2193R	P	-	2	0	ODZ1	123345863	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.304000	0.77564	0.544000	0.68410	CCT		0.428	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		Missense_Mutation
APLP2	334	genome.wustl.edu	37	11	129979400	129979400	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0966-01	TCGA-24-0966-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr11:129979400T>C	ENST00000263574.5	+	2	254	c.182T>C	c.(181-183)aTg>aCg	p.M61T	APLP2_ENST00000539648.1_Intron|APLP2_ENST00000528499.1_Missense_Mutation_p.M61T|APLP2_ENST00000278756.7_Missense_Mutation_p.M71T|APLP2_ENST00000345598.5_Missense_Mutation_p.M61T|APLP2_ENST00000543137.1_5'UTR|APLP2_ENST00000338167.5_Missense_Mutation_p.M61T|APLP2_ENST00000532456.1_3'UTR	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	61					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)	p.M61T(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		AAGTTAAATATGCATGTGAAC	0.443																																																1	Substitution - Missense(1)	ovary(1)	11											108.0	98.0	101.0					11																	129979400		2201	4297	6498	129484610	SO:0001583	missense	334			L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.182T>C	11.37:g.129979400T>C	ENSP00000263574:p.Met61Thr		129484610	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	ENST00000263574.5	37	CCDS8486.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	24.1	4.489378	0.84962	.	.	ENSG00000084234	ENST00000530416;ENST00000533195;ENST00000533713;ENST00000528499;ENST00000263574;ENST00000345598;ENST00000338167;ENST00000278756	D;D;D;D;D	0.94280	-3.39;-1.77;-3.35;-1.9;-1.9	6.17	6.17	0.99709	Amyloidogenic glycoprotein, extracellular (1);Amyloidogenic glycoprotein, heparin-binding (3);	0.000000	0.85682	D	0.000000	D	0.96445	0.8840	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D	0.62365	0.991;0.98;0.984;0.98;0.966	D;D;D;D;D	0.80764	0.994;0.953;0.946;0.953;0.935	D	0.96781	0.9575	10	0.87932	D	0	-35.499	16.0034	0.80327	0.0:0.0:0.0:1.0	.	61;61;61;61;61	Q06481;Q06481-2;Q06481-5;Q06481-4;Q06481-3	APLP2_HUMAN;.;.;.;.	T	8;86;46;61;61;61;61;71	ENSP00000435914:M61T;ENSP00000263574:M61T;ENSP00000263575:M61T;ENSP00000345444:M61T;ENSP00000278756:M71T	ENSP00000263574:M61T	M	+	2	0	APLP2	129484610	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	ATG		0.443	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386109.1	NM_001642		Missense_Mutation
FGF13	2258	genome.wustl.edu	37	X	137715074	137715074	+	Silent	SNP	C	C	T			TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chrX:137715074C>T	ENST00000315930.6	-	5	1336	c.675G>A	c.(673-675)aaG>aaA	p.K225K	FGF13_ENST00000370603.3_Silent_p.K235K|FGF13_ENST00000305414.4_Silent_p.K172K|FGF13_ENST00000441825.2_Silent_p.K206K|FGF13_ENST00000541469.1_Silent_p.K179K	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	225					cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)	p.K225K(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					CACTTCTGCTCTTGGTTGGGG	0.517																																																1	Substitution - coding silent(1)	ovary(1)	X											189.0	146.0	161.0					X																	137715074		2203	4300	6503	137542740	SO:0001819	synonymous_variant	2258			BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.675G>A	X.37:g.137715074C>T			137542740	B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Silent	SNP	ENST00000315930.6	37	CCDS14665.1	SNP	32	WashU																																																																																				0.517	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058534.2	NM_004114		Silent
KCNK9	51305	genome.wustl.edu	37	8	140630965	140630965	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr8:140630965C>T	ENST00000520439.1	-	2	724	c.661G>A	c.(661-663)Gtg>Atg	p.V221M	KCNK9_ENST00000303015.1_Missense_Mutation_p.V221M|KCNK9_ENST00000523477.1_5'Flank	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	221					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.V221M(1)		NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	CTAAAGGCCACGTAGAGCGGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	8											56.0	61.0	59.0					8																	140630965		2203	4300	6503	140700147	SO:0001583	missense	51305			AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.661G>A	8.37:g.140630965C>T	ENSP00000430676:p.Val221Met		140700147	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	37	CCDS6377.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998266	0.74818	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.28895	1.59;1.59;1.59	5.7	5.7	0.88788	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.53384	0.1793	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.49293	-0.8955	10	0.54805	T	0.06	.	18.8306	0.92137	0.0:1.0:0.0:0.0	.	221	Q9NPC2	KCNK9_HUMAN	M	221	ENSP00000429847:V221M;ENSP00000302166:V221M;ENSP00000430676:V221M	ENSP00000302166:V221M	V	-	1	0	KCNK9	140700147	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.917000	0.69989	2.673000	0.90976	0.655000	0.94253	GTG		0.557	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601		Missense_Mutation
KPRP	448834	genome.wustl.edu	37	1	152732092	152732092	+	Missense_Mutation	SNP	C	C	T	rs146340487		TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr1:152732092C>T	ENST00000606109.1	+	1	56	c.28C>T	c.(28-30)Cgc>Tgc	p.R10C	KPRP_ENST00000368773.1_Missense_Mutation_p.R10C			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	10	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.R10C(1)		NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GATCCAGTGCCGCCTGCCGCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	1						C	CYS/ARG	0,4406		0,0,2203	59.0	58.0	58.0		28	1.8	0.2	1	dbSNP_134	58	1,8599	1.2+/-3.3	0,1,4299	no	missense	KPRP	NM_001025231.1	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	10/580	152732092	1,13005	2203	4300	6503	150998716	SO:0001583	missense	448834			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.28C>T	1.37:g.152732092C>T	ENSP00000475216:p.Arg10Cys		150998716		Missense_Mutation	SNP	ENST00000606109.1	37	CCDS30862.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	0.563	-0.844435	0.02671	0.0	1.16E-4	ENSG00000203786	ENST00000368773	T	0.10382	2.88	5.54	1.84	0.25277	.	0.577262	0.15899	N	0.239152	T	0.00440	0.0014	N	0.00246	-1.78	0.21719	N	0.999572	B	0.02656	0.0	B	0.01281	0.0	T	0.41288	-0.9517	10	0.02654	T	1	-2.0206	2.5629	0.04776	0.143:0.0828:0.1654:0.6088	.	10	Q5T749	KPRP_HUMAN	C	10	ENSP00000357762:R10C	ENSP00000357762:R10C	R	+	1	0	KPRP	150998716	0.003000	0.15002	0.188000	0.23233	0.681000	0.39784	0.855000	0.27805	0.110000	0.17919	-0.294000	0.09567	CGC		0.592	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231		Missense_Mutation
TP53BP2	7159	genome.wustl.edu	37	1	223980221	223980221	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr1:223980221C>G	ENST00000343537.7	-	15	3157	c.2866G>C	c.(2866-2868)Gat>Cat	p.D956H	TP53BP2_ENST00000391879.2_Missense_Mutation_p.D189H|TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391878.2_Missense_Mutation_p.D827H	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	950	Mediates interaction with APC2.				cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)	p.D827H(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		CTTGGGTCATCAACCTATATC	0.473																																																1	Substitution - Missense(1)	ovary(1)	1											81.0	78.0	79.0					1																	223980221		2203	4300	6503	222046844	SO:0001583	missense	7159			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.2866G>C	1.37:g.223980221C>G	ENSP00000341957:p.Asp956His		222046844	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	37	CCDS44319.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006385	0.74932	.	.	ENSG00000143514	ENST00000391878;ENST00000343537;ENST00000391879	T;T;T	0.65364	-0.15;-0.15;-0.15	5.31	5.31	0.75309	Src homology-3 domain (1);Ankyrin repeat-containing domain (3);	0.255536	0.45126	D	0.000394	T	0.73916	0.3648	L	0.55481	1.735	0.50813	D	0.999891	D;P	0.61080	0.989;0.864	P;P	0.59703	0.862;0.458	T	0.75657	-0.3242	10	0.66056	D	0.02	.	19.346	0.94362	0.0:1.0:0.0:0.0	.	956;950	B4DG66;Q13625	.;ASPP2_HUMAN	H	827;956;189	ENSP00000375750:D827H;ENSP00000341957:D956H;ENSP00000375751:D189H	ENSP00000341957:D956H	D	-	1	0	TP53BP2	222046844	1.000000	0.71417	0.978000	0.43139	0.963000	0.63663	4.830000	0.62745	2.646000	0.89796	0.467000	0.42956	GAT		0.473	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426		Missense_Mutation
NYAP2	57624	genome.wustl.edu	37	2	226273690	226273690	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0966-01	TCGA-24-0966-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr2:226273690G>A	ENST00000272907.6	+	2	507	c.94G>A	c.(94-96)Gat>Aat	p.D32N	NYAP2_ENST00000409269.2_Missense_Mutation_p.D32N	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	32					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.D32N(1)									GAAGGCCTATGATGGCTTGGT	0.403																																																1	Substitution - Missense(1)	ovary(1)	2											147.0	132.0	137.0					2																	226273690		1900	4119	6019	225981934	SO:0001583	missense	57624			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.94G>A	2.37:g.226273690G>A	ENSP00000272907:p.Asp32Asn		225981934	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047933	0.75846	.	.	ENSG00000144460	ENST00000272907;ENST00000409269	T	0.41758	0.99	5.92	5.92	0.95590	.	0.133715	0.48767	D	0.000166	T	0.50973	0.1647	L	0.45698	1.435	0.42359	D	0.992407	P;P	0.51537	0.946;0.884	P;B	0.50270	0.636;0.203	T	0.46456	-0.9190	10	0.52906	T	0.07	-24.6172	20.3167	0.98654	0.0:0.0:1.0:0.0	.	32;32	Q9P242-2;Q9P242	.;K1486_HUMAN	N	32	ENSP00000272907:D32N	ENSP00000272907:D32N	D	+	1	0	KIAA1486	225981934	1.000000	0.71417	0.958000	0.39756	0.890000	0.51754	4.678000	0.61641	2.809000	0.96659	0.557000	0.71058	GAT		0.403	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864		Missense_Mutation
GPS2	2874	genome.wustl.edu	37	17	7216733	7216746	+	Frame_Shift_Del	DEL	ATAGGGCTGTGGCT	ATAGGGCTGTGGCT	-	rs11541830		TCGA-24-0966-01	TCGA-24-0966-10	ATAGGGCTGTGGCT	ATAGGGCTGTGGCT	ATAGGGCTGTGGCT	-	ATAGGGCTGTGGCT	ATAGGGCTGTGGCT	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr17:7216733_7216746delATAGGGCTGTGGCT	ENST00000380728.2	-	8	977_990	c.677_690delAGCCACAGCCCTAT	c.(676-690)cagccacagccctatfs	p.QPQPY226fs	RP11-542C16.2_ENST00000575474.1_3'UTR|GPS2_ENST00000391950.3_Frame_Shift_Del_p.QPQPY226fs|GPS2_ENST00000389167.5_Frame_Shift_Del_p.QPQPY226fs			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	226					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)	p.Q226fs*30(1)		breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				CATGCACAGCATAGGGCTGTGGCTGTGGCTGAGA	0.505											OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Deletion - Frameshift(1)	ovary(1)	17																																								7157470	SO:0001589	frameshift_variant	2874			U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.677_690delAGCCACAGCCCTAT	17.37:g.7216733_7216746delATAGGGCTGTGGCT	ENSP00000370104:p.Gln226fs	640	7157457	B4DXA1|Q6FHM8	Frame_Shift_Del	DEL	ENST00000380728.2	37	CCDS11100.1	DEL	8	WashU																																																																																				0.505	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489		Frame_Shift_Del
SSU72P8	136157	genome.wustl.edu	37	7	124116729	124116729	+	IGR	SNP	C	C	A			TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chr7:124116729C>A								RP5-921G16.1 (81557 upstream) : RNU6-102P (171043 downstream)																							CAGGAATGCACTGAATTCTTT	0.453																																																0			7											65.0	63.0	64.0					7																	124116729		1913	4139	6052	123903965	SO:0001628	intergenic_variant	136157																															7.37:g.124116729C>A			123903965		Missense_Mutation	SNP		37		SNP	20	WashU																																																																																			0	0.453									Missense_Mutation
CASK	8573	genome.wustl.edu	37	X	41530717	41530717	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0966-01	TCGA-24-0966-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-0966-01	TCGA-24-0966-10	g.chrX:41530717C>G	ENST00000378163.1	-	6	970	c.496G>C	c.(496-498)Gct>Cct	p.A166P	CASK_ENST00000361962.4_Missense_Mutation_p.A166P|CASK_ENST00000442742.2_Missense_Mutation_p.A166P|CASK_ENST00000378166.4_Missense_Mutation_p.A166P|CASK_ENST00000421587.2_Missense_Mutation_p.A166P|CASK_ENST00000318588.9_Missense_Mutation_p.A166P|CASK_ENST00000378158.1_Missense_Mutation_p.A166P|CASK_ENST00000378154.1_Missense_Mutation_p.A166P			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	166	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)	p.A166P(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						AATTGAATAGCTACCCCAAAG	0.403																																					NSCLC(42;104 1086 3090 27189 35040)											1	Substitution - Missense(1)	ovary(1)	X											74.0	70.0	71.0					X																	41530717		2203	4300	6503	41415661	SO:0001583	missense	8573			AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.496G>C	X.37:g.41530717C>G	ENSP00000367405:p.Ala166Pro		41415661	A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Missense_Mutation	SNP	ENST00000378163.1	37		SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	30	5.053791	0.93793	.	.	ENSG00000147044	ENST00000421587;ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378158;ENST00000378166;ENST00000442742;ENST00000378154	T;T;T;T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	5.61	5.61	0.85477	.	0.000000	0.48767	D	0.000163	D	0.90810	0.7114	H	0.95539	3.685	0.80722	D	1	D;D;D	0.89917	1.0;0.994;1.0	D;D;D	0.97110	0.998;0.961;1.0	D	0.93437	0.6790	10	0.87932	D	0	.	18.6393	0.91389	0.0:1.0:0.0:0.0	.	166;166;166	O14936-3;O14936-4;O14936-2	.;.;.	P	166	ENSP00000400526:A166P;ENSP00000322727:A166P;ENSP00000354641:A166P;ENSP00000367405:A166P;ENSP00000367400:A166P;ENSP00000367408:A166P;ENSP00000398007:A166P;ENSP00000367396:A166P	ENSP00000322727:A166P	A	-	1	0	CASK	41415661	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.215000	0.77966	2.345000	0.79718	0.600000	0.82982	GCT		0.403	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000056285.1	NM_003688		Missense_Mutation
