#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CASZ1	54897	broad.mit.edu	37	1	10705002	10705002	+	Silent	SNP	G	G	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr1:10705002G>A	ENST00000377022.3	-	18	4157	c.3840C>T	c.(3838-3840)ttC>ttT	p.F1280F	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1280					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F1280F(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CGCGCTTGGTGAAGTATTTGA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	1											64.0	74.0	70.0					1																	10705002		2022	4190	6212	10627589	SO:0001819	synonymous_variant	54897			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3840C>T	1.37:g.10705002G>A			10627589	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	ENST00000377022.3	37	CCDS41246.1	SNP	45	Broad																																																																																				0.627	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766		Silent
PLA2G2F	64600	broad.mit.edu	37	1	20466009	20466009	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0975-01	TCGA-24-0975-10			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr1:20466009G>T	ENST00000375102.3	+	1	191	c.89G>T	c.(88-90)gGg>gTg	p.G30V		NM_022819.3	NP_073730.3	Q9BZM2	PA2GF_HUMAN	phospholipase A2, group IIF	0					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.G30V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.000524)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		CCACGCTTCGGGGCCTCCTGT	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											31.0	37.0	35.0					1																	20466009		1874	4093	5967	20338596	SO:0001583	missense	64600			AL158172	CCDS204.2	1p35	2008-09-19			ENSG00000158786	ENSG00000158786	3.1.1.4		30040	protein-coding gene	gene with protein product						11112443	Standard	NM_022819		Approved		uc009vpp.1	Q9BZM2	OTTHUMG00000002704	ENST00000375102.3:c.89G>T	1.37:g.20466009G>T	ENSP00000364243:p.Gly30Val		20338596	Q5R385|Q8N217|Q9H506	Missense_Mutation	SNP	ENST00000375102.3	37	CCDS204.2	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	2.358	-0.347260	0.05208	.	.	ENSG00000158786	ENST00000375102	T	0.26810	1.71	5.14	0.956	0.19608	.	12.144800	0.00166	N	0.000000	T	0.19886	0.0478	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22695	-1.0209	9	0.52906	T	0.07	-12.6177	5.2192	0.15360	0.1895:0.3662:0.4443:0.0	.	30	Q9BZM2-2	.	V	30	ENSP00000364243:G30V	ENSP00000364243:G30V	G	+	2	0	PLA2G2F	20338596	0.027000	0.19231	0.000000	0.03702	0.001000	0.01503	0.236000	0.17967	0.236000	0.21180	0.655000	0.94253	GGG		0.597	PLA2G2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007687.1	NM_022819		Missense_Mutation
TARS2	80222	broad.mit.edu	37	1	150471004	150471004	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr1:150471004C>T	ENST00000369064.3	+	11	1299	c.1265C>T	c.(1264-1266)tCc>tTc	p.S422F	TARS2_ENST00000369054.2_Missense_Mutation_p.S292F|TARS2_ENST00000463555.1_3'UTR|TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000606933.1_Missense_Mutation_p.S340F	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	422					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	CGGCCCAGATCCTGGCGGGAA	0.657																																																0			1											51.0	53.0	52.0					1																	150471004		2203	4300	6503	148737628	SO:0001583	missense	80222			BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.1265C>T	1.37:g.150471004C>T	ENSP00000358060:p.Ser422Phe		148737628	Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	ENST00000369064.3	37	CCDS952.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	32	5.109093	0.94292	.	.	ENSG00000143374	ENST00000369054;ENST00000369064;ENST00000369051;ENST00000369052	T;T;T	0.69040	-0.37;-0.37;-0.37	5.11	5.11	0.69529	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.87301	0.6143	H	0.97611	4.04	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91340	0.5096	10	0.87932	D	0	-21.138	17.2889	0.87150	0.0:1.0:0.0:0.0	.	292;147;422	Q9H9V2;E7EVR9;Q9BW92	.;.;SYTM_HUMAN	F	292;422;147;147	ENSP00000358050:S292F;ENSP00000358060:S422F;ENSP00000358047:S147F	ENSP00000358047:S147F	S	+	2	0	TARS2	148737628	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.333000	0.79214	2.655000	0.90218	0.561000	0.74099	TCC		0.657	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1	NM_025150		Missense_Mutation
OBSCN	84033	broad.mit.edu	37	1	228469846	228469846	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr1:228469846G>A	ENST00000422127.1	+	31	8454	c.8410G>A	c.(8410-8412)Gcc>Acc	p.A2804T	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.A2804T|OBSCN_ENST00000570156.2_Missense_Mutation_p.A3233T|OBSCN_ENST00000359599.6_Missense_Mutation_p.A1651T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2804	Ig-like 27.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.A2858T(1)|p.A3087T(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACCAAGTGATGCCGGGGAGGT	0.642																																																2	Substitution - Missense(2)	ovary(2)	1											33.0	39.0	37.0					1																	228469846		1996	4170	6166	226536469	SO:0001583	missense	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.8410G>A	1.37:g.228469846G>A	ENSP00000409493:p.Ala2804Thr		226536469	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	9.012	0.982693	0.18889	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599;ENST00000366706;ENST00000366704	T;T;T	0.68025	-0.3;-0.3;-0.3	4.21	2.33	0.28932	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.544470	0.16490	N	0.212145	T	0.54367	0.1854	L	0.49640	1.575	0.32832	D	0.504224	B;B;P	0.36768	0.407;0.011;0.569	B;B;B	0.38683	0.217;0.015;0.279	T	0.54503	-0.8284	10	0.13108	T	0.6	.	5.5824	0.17256	0.238:0.0:0.6236:0.1384	.	2804;2804;2804	Q5VST9;Q5VST9-2;Q5VST9-3	OBSCN_HUMAN;.;.	T	2804;2804;1651;503;210	ENSP00000284548:A2804T;ENSP00000409493:A2804T;ENSP00000352613:A1651T	ENSP00000284548:A2804T	A	+	1	0	OBSCN	226536469	0.079000	0.21365	0.008000	0.14137	0.019000	0.09904	0.567000	0.23608	0.365000	0.24400	0.462000	0.41574	GCC		0.642	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		Missense_Mutation
ANKRD30A	91074	broad.mit.edu	37	10	37508587	37508587	+	Missense_Mutation	SNP	A	A	C			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr10:37508587A>C	ENST00000602533.1	+	34	3878	c.3779A>C	c.(3778-3780)cAg>cCg	p.Q1260P	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.Q1379P|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.Q1260P			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1316					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q1260P(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ACTGAACAGCAGGAGTCTCTA	0.373																																																1	Substitution - Missense(1)	ovary(1)	10											67.0	58.0	61.0					10																	37508587		1887	4106	5993	37548593	SO:0001583	missense	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3779A>C	10.37:g.37508587A>C	ENSP00000473551:p.Gln1260Pro		37548593	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	a	1.802	-0.476801	0.04414	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.18338	2.22;2.22	2.95	1.75	0.24633	.	.	.	.	.	T	0.31857	0.0810	M	0.79123	2.44	0.09310	N	1	D	0.61080	0.989	P	0.56474	0.799	T	0.10706	-1.0618	9	0.72032	D	0.01	.	6.2648	0.20919	0.7765:0.0:0.0:0.2235	.	1316	Q9BXX3	AN30A_HUMAN	P	1260;1379	ENSP00000354432:Q1260P;ENSP00000363792:Q1379P	ENSP00000354432:Q1260P	Q	+	2	0	ANKRD30A	37548593	1.000000	0.71417	0.002000	0.10522	0.004000	0.04260	2.845000	0.48254	0.214000	0.20742	0.386000	0.25728	CAG		0.373	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		Missense_Mutation
RASGEF1A	221002	broad.mit.edu	37	10	43696146	43696146	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr10:43696146A>G	ENST00000395809.1	-	5	3156	c.650T>C	c.(649-651)gTg>gCg	p.V217A	RASGEF1A_ENST00000374459.1_Missense_Mutation_p.V225A|RASGEF1A_ENST00000395810.1_Missense_Mutation_p.V217A|RASGEF1A_ENST00000472864.1_5'UTR			Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	217	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cell migration (GO:0016477)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.V164A(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)	11						CTGGGCCAGCACCAGGGGGTC	0.642																																																1	Substitution - Missense(1)	ovary(1)	10											48.0	44.0	45.0					10																	43696146		2203	4300	6503	43016152	SO:0001583	missense	221002			AK095136	CCDS7202.2, CCDS60517.1	10q11.21	2006-01-11			ENSG00000198915	ENSG00000198915			24246	protein-coding gene	gene with protein product		614531				12477932	Standard	XM_005271808		Approved	CG4853, FLJ37817	uc001jap.1	Q8N9B8	OTTHUMG00000018025	ENST00000395809.1:c.650T>C	10.37:g.43696146A>G	ENSP00000379154:p.Val217Ala		43016152	Q8TBF1	Missense_Mutation	SNP	ENST00000395809.1	37	CCDS7202.2	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	11.55	1.672807	0.29693	.	.	ENSG00000198915	ENST00000374459;ENST00000395810;ENST00000395809	T;T;T	0.28069	1.63;1.63;1.63	5.04	5.04	0.67666	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.193856	0.35235	N	0.003343	T	0.23094	0.0558	L	0.32530	0.975	0.31477	N	0.667618	B;B	0.11235	0.003;0.004	B;B	0.13407	0.009;0.008	T	0.14839	-1.0458	10	0.10636	T	0.68	.	14.7955	0.69873	1.0:0.0:0.0:0.0	.	217;225	Q8N9B8;Q8N9B8-2	RGF1A_HUMAN;.	A	225;217;217	ENSP00000363583:V225A;ENSP00000379155:V217A;ENSP00000379154:V217A	ENSP00000363583:V225A	V	-	2	0	RASGEF1A	43016152	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.677000	0.61634	1.891000	0.54761	0.374000	0.22700	GTG		0.642	RASGEF1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313989.1	NM_145313		Missense_Mutation
CCSER2	54462	broad.mit.edu	37	10	86131680	86131680	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr10:86131680A>G	ENST00000224756.8	+	2	1057	c.872A>G	c.(871-873)aAt>aGt	p.N291S	CCSER2_ENST00000372088.2_Missense_Mutation_p.N291S|CCSER2_ENST00000359979.4_Missense_Mutation_p.N291S	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	291					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)		p.N291S(1)									TATGGATTTAATAGGCCTTAT	0.433																																																1	Substitution - Missense(1)	ovary(1)	10											108.0	106.0	107.0					10																	86131680		2203	4300	6503	86121660	SO:0001583	missense	54462				CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.872A>G	10.37:g.86131680A>G	ENSP00000224756:p.Asn291Ser		86121660	B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Missense_Mutation	SNP	ENST00000224756.8	37	CCDS31235.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	8.687	0.906538	0.17833	.	.	ENSG00000107771	ENST00000359979;ENST00000224756;ENST00000372088	T;T;T	0.46063	0.88;2.23;2.19	5.97	3.66	0.41972	.	0.384238	0.26871	N	0.022064	T	0.34395	0.0896	L	0.46157	1.445	0.80722	D	1	B;B;P	0.44429	0.084;0.023;0.835	B;B;B	0.43889	0.04;0.02;0.435	T	0.06716	-1.0811	10	0.31617	T	0.26	-13.2934	4.9433	0.13976	0.6824:0.157:0.1606:0.0	.	291;291;291	Q9H7U1-3;Q9H7U1;Q9H7U1-2	.;F190B_HUMAN;.	S	291	ENSP00000353068:N291S;ENSP00000224756:N291S;ENSP00000361160:N291S	ENSP00000224756:N291S	N	+	2	0	FAM190B	86121660	0.748000	0.28294	0.557000	0.28306	0.995000	0.86356	0.251000	0.18257	0.519000	0.28406	0.533000	0.62120	AAT		0.433	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049132.2	NM_018999		Missense_Mutation
CCDC172	374355	broad.mit.edu	37	10	118101593	118101593	+	Missense_Mutation	SNP	A	A	C			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr10:118101593A>C	ENST00000333254.3	+	5	579	c.328A>C	c.(328-330)Aag>Cag	p.K110Q	CCDC172_ENST00000497093.1_3'UTR	NM_198515.2	NP_940917.1	P0C7W6	CC172_HUMAN	coiled-coil domain containing 172	110								p.K110Q(1)									CAAATTTATTAAGGAAATTAC	0.259																																																1	Substitution - Missense(1)	ovary(1)	10											31.0	36.0	34.0					10																	118101593		2161	4243	6404	118091583	SO:0001583	missense	374355			BC044830	CCDS31291.1	10q26.11-q26.12	2012-05-31	2012-05-31	2012-05-31	ENSG00000182645	ENSG00000182645			30524	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 96"""	C10orf96		12477932	Standard	NM_198515		Approved	MGC35062	uc001lck.3	P0C7W6	OTTHUMG00000019098	ENST00000333254.3:c.328A>C	10.37:g.118101593A>C	ENSP00000329860:p.Lys110Gln		118091583		Missense_Mutation	SNP	ENST00000333254.3	37	CCDS31291.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	16.94	3.261195	0.59431	.	.	ENSG00000182645	ENST00000333254;ENST00000423072	.	.	.	5.41	5.41	0.78517	.	0.114530	0.64402	D	0.000018	T	0.78773	0.4336	M	0.74881	2.28	0.37492	D	0.91644	D	0.89917	1.0	D	0.81914	0.995	D	0.83584	0.0119	9	0.66056	D	0.02	-17.1936	15.7228	0.77728	1.0:0.0:0.0:0.0	.	110	P0C7W6	CJ096_HUMAN	Q	110	.	ENSP00000329860:K110Q	K	+	1	0	C10orf96	118091583	1.000000	0.71417	1.000000	0.80357	0.436000	0.31835	3.681000	0.54648	2.179000	0.69175	0.533000	0.62120	AAG		0.259	CCDC172-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050516.2	NM_198515		Missense_Mutation
OR5F1	338674	broad.mit.edu	37	11	55761776	55761776	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr11:55761776G>T	ENST00000278409.1	-	1	325	c.326C>A	c.(325-327)aCa>aAa	p.T109K		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	109					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					GCATTCGGTTGTCGCCAGGGA	0.478																																																0			11											84.0	82.0	83.0					11																	55761776		2201	4296	6497	55518352	SO:0001583	missense	338674			AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.326C>A	11.37:g.55761776G>T	ENSP00000278409:p.Thr109Lys		55518352	Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	CCDS31515.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	0.100	-1.153980	0.01700	.	.	ENSG00000149133	ENST00000278409	T	0.01347	4.99	3.03	0.798	0.18660	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02970	0.0088	M	0.84846	2.72	0.09310	N	1	B	0.12630	0.006	B	0.17098	0.017	T	0.25779	-1.0122	9	0.54805	T	0.06	.	6.7519	0.23491	0.1157:0.1784:0.706:0.0	.	109	O95221	OR5F1_HUMAN	K	109	ENSP00000278409:T109K	ENSP00000278409:T109K	T	-	2	0	OR5F1	55518352	0.000000	0.05858	0.163000	0.22734	0.110000	0.19582	-2.620000	0.00879	0.395000	0.25257	0.297000	0.19635	ACA		0.478	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697		Missense_Mutation
ZBTB3	79842	broad.mit.edu	37	11	62521456	62521456	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr11:62521456C>A	ENST00000394807.3	-	1	204	c.79G>T	c.(79-81)Gga>Tga	p.G27*		NM_024784.3	NP_079060.1	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	27					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G27*(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|ovary(2)|prostate(2)	24						CCAACGGCTCCACGAAGTAGA	0.637																																																1	Substitution - Nonsense(1)	ovary(1)	11											89.0	79.0	82.0					11																	62521456		2202	4299	6501	62278032	SO:0001587	stop_gained	79842			AK027045	CCDS8034.1	11q12.3	2013-01-09				ENSG00000185670		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	22918	protein-coding gene	gene with protein product							Standard	NM_024784		Approved	FLJ23392	uc001nuz.3	Q9H5J0		ENST00000394807.3:c.79G>T	11.37:g.62521456C>A	ENSP00000378286:p.Gly27*		62278032		Nonsense_Mutation	SNP	ENST00000394807.3	37	CCDS8034.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625673	0.28889	.	.	ENSG00000185670	ENST00000394807	.	.	.	5.65	1.76	0.24704	.	0.877133	0.09594	N	0.781191	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	4.6334	0.12513	0.0:0.5301:0.1504:0.3195	.	.	.	.	X	27	.	ENSP00000378286:G27X	G	-	1	0	ZBTB3	62278032	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.144000	0.16135	0.185000	0.20105	0.655000	0.94253	GGA		0.637	ZBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395342.1	NM_024784		Nonsense_Mutation
TCIRG1	10312	broad.mit.edu	37	11	67812492	67812492	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr11:67812492G>T	ENST00000265686.3	+	10	1196	c.1088G>T	c.(1087-1089)cGc>cTc	p.R363L	TCIRG1_ENST00000532635.1_Missense_Mutation_p.R147L	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	363					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						ACACTCATCCGCACCAACCGC	0.662																																																0			11											103.0	89.0	93.0					11																	67812492		2200	4294	6494	67569068	SO:0001583	missense	10312			AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.1088G>T	11.37:g.67812492G>T	ENSP00000265686:p.Arg363Leu		67569068	O75877|Q8WVC5	Missense_Mutation	SNP	ENST00000265686.3	37	CCDS8177.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062034	0.76187	.	.	ENSG00000110719	ENST00000265686;ENST00000532635	D;D	0.86956	-2.19;-2.19	4.07	4.07	0.47477	.	0.056284	0.64402	D	0.000001	D	0.89269	0.6667	M	0.87038	2.855	0.42739	D	0.993734	P	0.42039	0.769	P	0.45343	0.477	D	0.90542	0.4503	10	0.87932	D	0	-31.8015	8.9162	0.35583	0.104:0.0:0.896:0.0	.	363	Q13488	VPP3_HUMAN	L	363;147	ENSP00000265686:R363L;ENSP00000434407:R147L	ENSP00000265686:R363L	R	+	2	0	TCIRG1	67569068	0.420000	0.25457	1.000000	0.80357	0.840000	0.47671	2.302000	0.43637	2.119000	0.64992	0.462000	0.41574	CGC		0.662	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019		Missense_Mutation
EED	8726	broad.mit.edu	37	11	85961403	85961403	+	Silent	SNP	A	A	G			TCGA-24-0975-01	TCGA-24-0975-10			A	G	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr11:85961403A>G	ENST00000263360.6	+	2	866	c.180A>G	c.(178-180)ccA>ccG	p.P60P	EED_ENST00000351625.6_Silent_p.P60P|EED_ENST00000327320.4_Silent_p.P60P|EED_ENST00000528180.1_Silent_p.P60P	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development	60					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)	p.P60P(1)		haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				CAAACACGCCAAATGCACCTG	0.383																																																1	Substitution - coding silent(1)	ovary(1)	11											110.0	97.0	101.0					11																	85961403		2203	4299	6502	85639051	SO:0001819	synonymous_variant	8726			AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.180A>G	11.37:g.85961403A>G			85639051	A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	Silent	SNP	ENST00000263360.6	37	CCDS8273.1	SNP	5	Broad																																																																																				0.383	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393733.1	NM_003797		Silent
ME3	10873	broad.mit.edu	37	11	86158135	86158135	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr11:86158135G>C	ENST00000393324.3	-	11	1605	c.1352C>G	c.(1351-1353)aCg>aGg	p.T451R	RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000359636.2_Missense_Mutation_p.T451R|ME3_ENST00000543262.1_Missense_Mutation_p.T451R	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	451					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)	p.T451R(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				CTTCTCAGCCGTGCACTCGGC	0.587																																																1	Substitution - Missense(1)	ovary(1)	11											68.0	60.0	63.0					11																	86158135		2202	4299	6501	85835783	SO:0001583	missense	10873			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1352C>G	11.37:g.86158135G>C	ENSP00000376998:p.Thr451Arg		85835783	B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	CCDS8277.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.170992	0.94807	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826	T;T;T;T	0.33654	1.4;1.4;1.4;1.4	5.23	5.23	0.72850	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.64371	0.2592	M	0.81179	2.53	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66208	-0.5981	9	.	.	.	-0.6326	19.1755	0.93601	0.0:0.0:1.0:0.0	.	451	Q16798	MAON_HUMAN	R	451	ENSP00000352657:T451R;ENSP00000440246:T451R;ENSP00000376998:T451R;ENSP00000431182:T451R	.	T	-	2	0	ME3	85835783	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.611000	0.98342	2.584000	0.87258	0.650000	0.86243	ACG		0.587	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2			Missense_Mutation
MMP27	64066	broad.mit.edu	37	11	102573489	102573489	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr11:102573489C>T	ENST00000260229.4	-	4	705	c.614G>A	c.(613-615)gGa>gAa	p.G205E		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	205					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G205E(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	CTCACCTGCTCCATCCTTGGT	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											93.0	101.0	98.0					11																	102573489		2203	4299	6502	102078699	SO:0001583	missense	64066			AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.614G>A	11.37:g.102573489C>T	ENSP00000260229:p.Gly205Glu		102078699	Q6UWK6	Missense_Mutation	SNP	ENST00000260229.4	37	CCDS8319.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	7.176	0.588575	0.13812	.	.	ENSG00000137675	ENST00000260229	T	0.19105	2.17	5.79	-0.0298	0.13917	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	3.224240	0.00531	N	0.000214	T	0.17874	0.0429	N	0.25825	0.765	0.09310	N	1	B	0.06786	0.001	B	0.15052	0.012	T	0.29941	-0.9995	10	0.31617	T	0.26	.	10.4187	0.44338	0.0671:0.5236:0.3323:0.077	.	205	Q9H306	MMP27_HUMAN	E	205	ENSP00000260229:G205E	ENSP00000260229:G205E	G	-	2	0	MMP27	102078699	0.001000	0.12720	0.007000	0.13788	0.554000	0.35429	0.613000	0.24299	-0.189000	0.10482	-0.344000	0.07964	GGA		0.413	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122		Missense_Mutation
CD4	920	broad.mit.edu	37	12	6926417	6926417	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr12:6926417G>T	ENST00000011653.4	+	7	1335	c.1077G>T	c.(1075-1077)tgG>tgT	p.W359C		NM_000616.4|NM_001195015.2|NM_001195016.2|NM_001195017.2	NP_000607.1|NP_001181944.1|NP_001181945.1|NP_001181946.1	P01730	CD4_HUMAN	CD4 molecule	359	Ig-like C2-type 3.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cytokine production (GO:0001816)|defense response to Gram-negative bacterium (GO:0050829)|entry into host cell (GO:0030260)|enzyme linked receptor protein signaling pathway (GO:0007167)|immune response (GO:0006955)|induction by virus of host cell-cell fusion (GO:0006948)|innate immune response (GO:0045087)|maintenance of protein location in cell (GO:0032507)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase activity (GO:0045860)|protein palmitoleylation (GO:0045234)|regulation of defense response to virus by virus (GO:0050690)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)|T cell selection (GO:0045058)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|enzyme binding (GO:0019899)|extracellular matrix structural constituent (GO:0005201)|glycoprotein binding (GO:0001948)|MHC class II protein binding (GO:0042289)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|zinc ion binding (GO:0008270)	p.W359C(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	23		Myeloproliferative disorder(1001;0.0122)			Antithymocyte globulin(DB00098)	AGGCGGTGTGGGTGCTGAACC	0.582																																																1	Substitution - Missense(1)	ovary(1)	12											82.0	65.0	71.0					12																	6926417		2203	4300	6503	6796678	SO:0001583	missense	920			M35160	CCDS8562.1	12p13.31	2013-01-11	2006-03-28		ENSG00000010610	ENSG00000010610		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1678	protein-coding gene	gene with protein product		186940	"""CD4 antigen (p55)"", ""T-cell surface glycoprotein CD4"""				Standard	NM_000616		Approved		uc001qqv.2	P01730	OTTHUMG00000168514	ENST00000011653.4:c.1077G>T	12.37:g.6926417G>T	ENSP00000011653:p.Trp359Cys		6796678	B2R737|D3DUS5|Q4ZGK2|Q5U066|Q9UDE5	Missense_Mutation	SNP	ENST00000011653.4	37	CCDS8562.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	13.87	2.364834	0.41902	.	.	ENSG00000010610	ENST00000011653	T	0.21734	1.99	4.3	0.0857	0.14443	Immunoglobulin C2-set (1);Immunoglobulin-like fold (1);	1.502520	0.04290	N	0.345373	T	0.31327	0.0793	L	0.44542	1.39	0.09310	N	1	D;D	0.69078	0.974;0.997	P;D	0.65140	0.9;0.932	T	0.11941	-1.0567	10	0.54805	T	0.06	.	1.0402	0.01557	0.2137:0.1782:0.4252:0.1829	.	180;359	B0AZV7;P01730	.;CD4_HUMAN	C	359	ENSP00000011653:W359C	ENSP00000011653:W359C	W	+	3	0	CD4	6796678	0.005000	0.15991	0.005000	0.12908	0.228000	0.25075	0.235000	0.17948	-0.088000	0.12506	0.561000	0.74099	TGG		0.582	CD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399978.1	NM_000616		Missense_Mutation
PTHLH	5744	broad.mit.edu	37	12	28116348	28116348	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr12:28116348T>C	ENST00000545234.1	-	5	997	c.457A>G	c.(457-459)Act>Gct	p.T153A	PTHLH_ENST00000354417.3_Missense_Mutation_p.T153A|PTHLH_ENST00000538310.1_Missense_Mutation_p.T153A|RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000539239.1_Missense_Mutation_p.T153A|PTHLH_ENST00000535992.1_Missense_Mutation_p.T153A|PTHLH_ENST00000395872.1_Missense_Mutation_p.T153A|PTHLH_ENST00000395868.3_Missense_Mutation_p.T153A|PTHLH_ENST00000201015.4_Missense_Mutation_p.T153A			P12272	PTHR_HUMAN	parathyroid hormone-like hormone	153					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					CCACTCCCAGTCACTCCAGAG	0.567																																																0			12											138.0	117.0	124.0					12																	28116348		2203	4300	6503	28007615	SO:0001583	missense	5744				CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.457A>G	12.37:g.28116348T>C	ENSP00000441765:p.Thr153Ala		28007615	Q15251|Q6FH74	Missense_Mutation	SNP	ENST00000545234.1	37	CCDS44853.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	0.849	-0.739151	0.03088	.	.	ENSG00000087494	ENST00000395872;ENST00000539239;ENST00000545234;ENST00000538310;ENST00000354417;ENST00000201015;ENST00000535992;ENST00000395868;ENST00000542963	D;D;D;D;D;D;D;D;D	0.82081	-1.53;-1.53;-1.53;-1.57;-1.57;-1.53;-1.53;-1.53;-1.53	4.99	1.99	0.26369	.	0.791612	0.11924	N	0.516409	T	0.47764	0.1463	N	0.00823	-1.155	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45086	-0.9285	10	0.07175	T	0.84	-0.0212	1.3817	0.02231	0.1589:0.4523:0.1366:0.2522	.	153	P12272	PTHR_HUMAN	A	153	ENSP00000379213:T153A;ENSP00000441571:T153A;ENSP00000441765:T153A;ENSP00000441890:T153A;ENSP00000346398:T153A;ENSP00000201015:T153A;ENSP00000440613:T153A;ENSP00000379209:T153A;ENSP00000444519:T153A	ENSP00000201015:T153A	T	-	1	0	PTHLH	28007615	0.000000	0.05858	0.003000	0.11579	0.983000	0.72400	-0.830000	0.04410	0.139000	0.18822	-0.285000	0.09966	ACT		0.567	PTHLH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402913.1	NM_198965		Missense_Mutation
PFKM	5213	broad.mit.edu	37	12	48529115	48529115	+	Silent	SNP	C	C	G			TCGA-24-0975-01	TCGA-24-0975-10			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr12:48529115C>G	ENST00000312352.7	+	10	924	c.885C>G	c.(883-885)gtC>gtG	p.V295V	PFKM_ENST00000359794.5_Silent_p.V295V|PFKM_ENST00000551804.1_Intron|PFKM_ENST00000340802.6_Silent_p.V366V|PFKM_ENST00000395233.2_Intron|PFKM_ENST00000547587.1_Silent_p.V295V	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	295	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.V295V(1)		NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						GGGTTACTGTCTTGGGGCATG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	12											136.0	114.0	122.0					12																	48529115		2203	4300	6503	46815382	SO:0001819	synonymous_variant	5213			M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.885C>G	12.37:g.48529115C>G			46815382	J3KNX3|Q16814|Q16815|Q6ZTT1	Silent	SNP	ENST00000312352.7	37	CCDS8760.1	SNP	32	Broad																																																																																				0.537	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406490.1	NM_000289		Silent
C12orf56	115749	broad.mit.edu	37	12	64668743	64668743	+	Missense_Mutation	SNP	A	A	C			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr12:64668743A>C	ENST00000543942.2	-	11	2148	c.1522T>G	c.(1522-1524)Ttg>Gtg	p.L508V	C12orf56_ENST00000333722.5_Missense_Mutation_p.L348V|C12orf56_ENST00000536975.1_5'UTR|RPS11P6_ENST00000535684.1_RNA	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	508								p.L348V(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		GTGGATCCCAATCCGAGATTT	0.348																																																1	Substitution - Missense(1)	ovary(1)	12											140.0	129.0	132.0					12																	64668743		1825	4080	5905	62955010	SO:0001583	missense	115749				CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.1522T>G	12.37:g.64668743A>C	ENSP00000446101:p.Leu508Val		62955010		Missense_Mutation	SNP	ENST00000543942.2	37		SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	11.98	1.801712	0.31869	.	.	ENSG00000185306	ENST00000333722;ENST00000543942;ENST00000433716	.	.	.	5.08	2.68	0.31781	.	0.187254	0.38217	N	0.001773	T	0.46870	0.1415	M	0.63428	1.95	0.24129	N	0.995776	D;P	0.54047	0.964;0.827	P;B	0.52758	0.708;0.416	T	0.32534	-0.9903	8	.	.	.	-1.5025	6.846	0.23988	0.816:0.0:0.184:0.0	.	348;511	Q8IXR9-2;Q8IXR9	.;CL056_HUMAN	V	348;509;511	.	.	L	-	1	2	C12orf56	62955010	1.000000	0.71417	0.999000	0.59377	0.421000	0.31385	1.600000	0.36762	0.485000	0.27652	0.533000	0.62120	TTG		0.348	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000401058.2	NM_001099676		Missense_Mutation
PABPC3	5042	broad.mit.edu	37	13	25670542	25670542	+	Missense_Mutation	SNP	T	T	G			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr13:25670542T>G	ENST00000281589.3	+	1	243	c.206T>G	c.(205-207)cTg>cGg	p.L69R		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	69	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.L69R(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		GAGCATGCTCTGGACACCATG	0.512																																																1	Substitution - Missense(1)	ovary(1)	13											83.0	74.0	77.0					13																	25670542		2203	4300	6503	24568542	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.206T>G	13.37:g.25670542T>G	ENSP00000281589:p.Leu69Arg		24568542	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	14.72	2.619291	0.46736	.	.	ENSG00000151846	ENST00000281589	T	0.21734	1.99	0.546	0.546	0.17196	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.36854	U	0.002362	T	0.33789	0.0875	M	0.78344	2.41	0.44345	D	0.997233	D	0.54397	0.966	P	0.57009	0.811	T	0.11591	-1.0581	10	0.87932	D	0	.	5.327	0.15913	0.0:1.0E-4:0.0:0.9999	.	69	Q9H361	PABP3_HUMAN	R	69	ENSP00000281589:L69R	ENSP00000281589:L69R	L	+	2	0	PABPC3	24568542	1.000000	0.71417	0.012000	0.15200	0.039000	0.13416	5.455000	0.66658	0.469000	0.27268	0.254000	0.18369	CTG		0.512	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979		Missense_Mutation
HSPH1	10808	broad.mit.edu	37	13	31726998	31726998	+	Missense_Mutation	SNP	T	T	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr13:31726998T>A	ENST00000320027.5	-	5	864	c.520A>T	c.(520-522)Atg>Ttg	p.M174L	HSPH1_ENST00000445273.2_Missense_Mutation_p.M176L|HSPH1_ENST00000380406.5_Missense_Mutation_p.M133L|HSPH1_ENST00000380405.4_Missense_Mutation_p.M174L|HSPH1_ENST00000429785.2_Intron	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	174					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.M174L(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		CCAGCTGTCATGTCATTCATA	0.388																																																1	Substitution - Missense(1)	ovary(1)	13											253.0	244.0	247.0					13																	31726998		2203	4299	6502	30624998	SO:0001583	missense	10808			AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.520A>T	13.37:g.31726998T>A	ENSP00000318687:p.Met174Leu		30624998	B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Missense_Mutation	SNP	ENST00000320027.5	37	CCDS9340.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	18.94	3.730512	0.69074	.	.	ENSG00000120694	ENST00000320027;ENST00000380405;ENST00000380406;ENST00000445273;ENST00000438061	T;T;T;T	0.03663	5.53;5.53;3.85;5.53	5.15	5.15	0.70609	.	0.155531	0.56097	N	0.000024	T	0.04092	0.0114	N	0.17312	0.475	0.80722	D	1	B;B;B;B;B	0.30236	0.274;0.032;0.157;0.067;0.157	B;B;B;B;B	0.34346	0.18;0.064;0.105;0.039;0.105	T	0.51803	-0.8659	10	0.87932	D	0	-29.7207	15.2738	0.73726	0.0:0.0:0.0:1.0	.	225;133;176;174;174	B4DZB4;Q92598-3;B4DYH1;Q92598-2;Q92598	.;.;.;.;HS105_HUMAN	L	174;174;133;176;225	ENSP00000318687:M174L;ENSP00000369768:M174L;ENSP00000369769:M133L;ENSP00000396090:M176L	ENSP00000318687:M174L	M	-	1	0	HSPH1	30624998	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	7.655000	0.83696	2.065000	0.61736	0.482000	0.46254	ATG		0.388	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044384.1			Missense_Mutation
FREM2	341640	broad.mit.edu	37	13	39262554	39262554	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr13:39262554A>G	ENST00000280481.7	+	1	1289	c.1073A>G	c.(1072-1074)aAc>aGc	p.N358S		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	358					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N358S(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TTGATCTTCAACCTTACTTCT	0.572																																																1	Substitution - Missense(1)	ovary(1)	13											126.0	114.0	118.0					13																	39262554		2203	4300	6503	38160554	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1073A>G	13.37:g.39262554A>G	ENSP00000280481:p.Asn358Ser		38160554	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	17.66	3.445022	0.63178	.	.	ENSG00000150893	ENST00000280481	T	0.25085	1.82	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.39572	0.1083	M	0.78285	2.405	0.80722	D	1	P	0.45283	0.855	P	0.45232	0.474	T	0.35724	-0.9777	10	0.56958	D	0.05	.	16.3979	0.83621	1.0:0.0:0.0:0.0	.	358	Q5SZK8	FREM2_HUMAN	S	358	ENSP00000280481:N358S	ENSP00000280481:N358S	N	+	2	0	FREM2	38160554	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	7.474000	0.81024	2.279000	0.76181	0.459000	0.35465	AAC		0.572	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		Missense_Mutation
SCEL	8796	broad.mit.edu	37	13	78176234	78176234	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr13:78176234C>T	ENST00000349847.3	+	16	1036	c.952C>T	c.(952-954)Caa>Taa	p.Q318*	SCEL-AS1_ENST00000457528.2_RNA|SCEL-AS1_ENST00000456280.2_RNA|SCEL_ENST00000469982.1_3'UTR|SCEL_ENST00000535157.1_Nonsense_Mutation_p.Q296*|SCEL_ENST00000377246.3_Nonsense_Mutation_p.Q298*	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	318	16 X approximate tandem repeats.				embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)	p.Q318*(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TAAAGTTAATCAAAGGACTGA	0.383																																																1	Substitution - Nonsense(1)	ovary(1)	13											92.0	91.0	91.0					13																	78176234		2203	4300	6503	77074235	SO:0001587	stop_gained	8796			AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.952C>T	13.37:g.78176234C>T	ENSP00000302579:p.Gln318*		77074235	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Nonsense_Mutation	SNP	ENST00000349847.3	37	CCDS9459.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006171	0.74932	.	.	ENSG00000136155	ENST00000348770;ENST00000535157;ENST00000377246;ENST00000349847	.	.	.	3.95	3.95	0.45737	.	0.704536	0.12479	N	0.465362	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-1.2982	11.6914	0.51519	0.0:1.0:0.0:0.0	.	.	.	.	X	275;296;298;318	.	ENSP00000315127:Q275X	Q	+	1	0	SCEL	77074235	0.843000	0.29541	0.728000	0.30774	0.032000	0.12392	2.883000	0.48554	2.211000	0.71520	0.591000	0.81541	CAA		0.383	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045339.2	NM_144777		Nonsense_Mutation
GMPR2	51292	broad.mit.edu	37	14	24707478	24707478	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0975-01	TCGA-24-0975-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr14:24707478G>C	ENST00000355299.4	+	9	1185	c.724G>C	c.(724-726)Ggt>Cgt	p.G242R	GMPR2_ENST00000420554.2_Missense_Mutation_p.G260R|GMPR2_ENST00000559104.1_Missense_Mutation_p.G227R|GMPR2_ENST00000456667.3_Missense_Mutation_p.G214R|GMPR2_ENST00000557854.1_Missense_Mutation_p.G260R|GMPR2_ENST00000399440.2_Missense_Mutation_p.G242R|GMPR2_ENST00000559836.1_Missense_Mutation_p.G242R|GMPR2_ENST00000348719.7_Missense_Mutation_p.G242R|GMPR2_ENST00000559910.1_Missense_Mutation_p.G209R	NM_001002000.1	NP_001002000.1	Q9P2T1	GMPR2_HUMAN	guanosine monophosphate reductase 2	242	GMP binding.		G -> D (in dbSNP:rs34354104).		GMP metabolic process (GO:0046037)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)	p.G242R(1)		large_intestine(4)|lung(3)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(265;0.0181)		CGTGATGCTGGGTGGCATGCT	0.542																																																1	Substitution - Missense(1)	ovary(1)	14											67.0	71.0	70.0					14																	24707478		2155	4259	6414	23777318	SO:0001583	missense	51292				CCDS41935.1, CCDS45087.1, CCDS61419.1, CCDS73624.1	14q11.2	2006-11-24							4377	protein-coding gene	gene with protein product		610781					Standard	XM_005267742		Approved		uc001wnw.3	Q9P2T1		ENST00000355299.4:c.724G>C	14.37:g.24707478G>C	ENSP00000347449:p.Gly242Arg		23777318	D3DS66|Q567T0|Q6IAJ8|Q86T14	Missense_Mutation	SNP	ENST00000355299.4	37	CCDS41935.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.203665	0.95033	.	.	ENSG00000100938	ENST00000355299;ENST00000421944;ENST00000420554;ENST00000399440;ENST00000348719;ENST00000456667	D;D;D;D;D	0.96802	-4.13;-4.13;-4.13;-4.13;-4.13	6.17	6.17	0.99709	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	D	0.99281	0.9749	H	0.99897	4.91	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.98294	1.0515	10	0.87932	D	0	3.1611	19.6509	0.95805	0.0:0.0:1.0:0.0	.	79;214;242;260;244;242	Q86SZ5;Q86T14;Q6PKC0;Q9P2T1-2;Q7Z527;Q9P2T1	.;.;.;.;.;GMPR2_HUMAN	R	242;242;260;242;242;214	ENSP00000347449:G242R;ENSP00000392859:G260R;ENSP00000382369:G242R;ENSP00000334409:G242R;ENSP00000405743:G214R	ENSP00000334409:G242R	G	+	1	0	GMPR2	23777318	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.864000	0.99589	2.941000	0.99782	0.655000	0.94253	GGT		0.542	GMPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415821.2	NM_016576		Missense_Mutation
TGM1	7051	broad.mit.edu	37	14	24730902	24730903	+	Splice_Site	DNP	GA	GA	AT			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr14:24730902_24730903GA>AT	ENST00000206765.6	-	3	629_630	c.506_507TC>AT	c.(505-507)aTC>aAT	p.I169N	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	169					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.I169N(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	CCCACTGACCGATGAGTAACTC	0.584																																																1	Substitution - Missense(1)	ovary(1)	14																																								23800743	SO:0001630	splice_region_variant	7051			D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.506_507delinsAT	14.37:g.24730902_24730903delinsAT			23800742	B4DWR7|Q197M4	Missense_Mutation	DNP	ENST00000206765.6	37	CCDS9622.1	DNP	37	Broad																																																																																				0.584	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	Missense_Mutation	Missense_Mutation
XRCC3	7517	broad.mit.edu	37	14	104177389	104177389	+	Missense_Mutation	SNP	A	A	C			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr14:104177389A>C	ENST00000553264.1	-	2	832	c.36T>G	c.(34-36)atT>atG	p.I12M	XRCC3_ENST00000554974.1_Intron|XRCC3_ENST00000554913.1_Missense_Mutation_p.I12M|XRCC3_ENST00000445556.1_Missense_Mutation_p.I12M|XRCC3_ENST00000555055.1_Missense_Mutation_p.I12M|AL049840.1_ENST00000429169.1_5'Flank|RP11-73M18.9_ENST00000602383.1_lincRNA|XRCC3_ENST00000352127.7_Missense_Mutation_p.I12M			O43542	XRCC3_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 3	12					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|response to organic substance (GO:0010033)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Rad51C-XRCC3 complex (GO:0033065)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)	p.I12M(1)		endometrium(1)|large_intestine(1)|ovary(1)|prostate(1)	4		Melanoma(154;0.155)|all_epithelial(191;0.19)		Epithelial(152;0.239)		TTGCAGCAATAATTCTGGGAT	0.423								Direct reversal of damage;Homologous recombination																																								1	Substitution - Missense(1)	ovary(1)	14											138.0	128.0	132.0					14																	104177389		2203	4300	6503	103247142	SO:0001583	missense	7517			AF035586	CCDS9984.1	14q32.3	2006-05-04				ENSG00000126215			12830	protein-coding gene	gene with protein product	"""RAD51-like"""	600675				7603995	Standard	NM_001100118		Approved		uc001ynz.4	O43542		ENST00000553264.1:c.36T>G	14.37:g.104177389A>C	ENSP00000451974:p.Ile12Met		103247142	O43568|Q9BU18	Missense_Mutation	SNP	ENST00000553264.1	37	CCDS9984.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	15.20	2.762255	0.49468	.	.	ENSG00000126215	ENST00000554913;ENST00000352127;ENST00000553264;ENST00000555055;ENST00000445556;ENST00000553361;ENST00000556980;ENST00000555964;ENST00000556682;ENST00000553332;ENST00000554170	T;T;T;T;T;T;T;T	0.61510	0.97;0.97;0.97;0.97;0.97;0.1;0.52;0.51	4.33	-2.75	0.05914	.	0.130835	0.52532	D	0.000073	T	0.59445	0.2194	M	0.61703	1.905	0.22446	N	0.999098	D	0.55800	0.973	P	0.57468	0.821	T	0.55224	-0.8174	10	0.38643	T	0.18	-16.4898	7.4616	0.27298	0.291:0.2355:0.4735:0.0	.	12	O43542	XRCC3_HUMAN	M	12	ENSP00000451362:I12M;ENSP00000343392:I12M;ENSP00000451974:I12M;ENSP00000452598:I12M;ENSP00000412990:I12M;ENSP00000451118:I12M;ENSP00000451252:I12M;ENSP00000451173:I12M	ENSP00000343392:I12M	I	-	3	3	XRCC3	103247142	0.000000	0.05858	0.022000	0.16811	0.956000	0.61745	-1.840000	0.01684	-0.454000	0.07066	0.459000	0.35465	ATT		0.423	XRCC3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414631.1	NM_005432		Missense_Mutation
CPNE2	221184	broad.mit.edu	37	16	57144714	57144714	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr16:57144714G>C	ENST00000535318.2	+	3	421	c.60G>C	c.(58-60)caG>caC	p.Q20H	CPNE2_ENST00000537605.1_5'UTR|CPNE2_ENST00000565874.1_Missense_Mutation_p.Q20H|CPNE2_ENST00000290776.8_Missense_Mutation_p.Q20H			Q96FN4	CPNE2_HUMAN	copine II	20	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)		p.Q20H(1)		central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(5)	21		all_neural(199;0.224)				TGGGCCCCCAGTATTGCGTGT	0.637																																																1	Substitution - Missense(1)	ovary(1)	16											58.0	50.0	53.0					16																	57144714		2198	4300	6498	55702215	SO:0001583	missense	221184				CCDS10774.1	16q13	2008-02-05			ENSG00000140848	ENSG00000140848			2315	protein-coding gene	gene with protein product		604206				9430674	Standard	NM_152727		Approved	CPN2	uc002eks.2	Q96FN4	OTTHUMG00000133471	ENST00000535318.2:c.60G>C	16.37:g.57144714G>C	ENSP00000439018:p.Gln20His		55702215	Q68D19|Q719H8|Q86XP9	Missense_Mutation	SNP	ENST00000535318.2	37	CCDS10774.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	13.09	2.134060	0.37630	.	.	ENSG00000140848	ENST00000290776;ENST00000535318	T;T	0.39997	1.05;1.05	5.27	3.31	0.37934	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.31857	0.0810	L	0.40543	1.245	0.80722	D	1	B;B	0.16166	0.016;0.016	B;B	0.12156	0.007;0.007	T	0.11251	-1.0595	10	0.54805	T	0.06	-18.0637	8.1877	0.31348	0.1416:0.1313:0.7271:0.0	.	20;20	A8K8A4;Q96FN4	.;CPNE2_HUMAN	H	20	ENSP00000290776:Q20H;ENSP00000439018:Q20H	ENSP00000290776:Q20H	Q	+	3	2	CPNE2	55702215	1.000000	0.71417	0.997000	0.53966	0.107000	0.19398	4.546000	0.60705	0.782000	0.33613	-0.175000	0.13238	CAG		0.637	CPNE2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432986.2	NM_152727		Missense_Mutation
EDC4	23644	broad.mit.edu	37	16	67913022	67913022	+	Missense_Mutation	SNP	A	A	G	rs370573849		TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr16:67913022A>G	ENST00000358933.5	+	12	1689	c.1450A>G	c.(1450-1452)Aat>Gat	p.N484D	EDC4_ENST00000574770.1_3'UTR|AC040162.1_ENST00000408599.1_RNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	484					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.N484D(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CGAAGAGGAAAATGACAGCCT	0.587													A|||	1	0.000199681	0.0	0.0	5008	,	,		19625	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	16						A	ASP/ASN	0,4396		0,0,2198	42.0	40.0	41.0		1450	4.4	1.0	16		41	1,8599	1.2+/-3.3	0,1,4299	no	missense	EDC4	NM_014329.3	23	0,1,6497	GG,GA,AA		0.0116,0.0,0.0077	benign	484/1402	67913022	1,12995	2198	4300	6498	66470523	SO:0001583	missense	23644			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.1450A>G	16.37:g.67913022A>G	ENSP00000351811:p.Asn484Asp		66470523	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	ENST00000358933.5	37	CCDS10849.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	6.254	0.414925	0.11870	0.0	1.16E-4	ENSG00000038358	ENST00000358933;ENST00000536072	.	.	.	5.53	4.41	0.53225	.	0.436377	0.28533	N	0.015001	T	0.17238	0.0414	N	0.03154	-0.405	0.30420	N	0.778255	B;B;B	0.24721	0.0;0.11;0.094	B;B;B	0.22152	0.001;0.038;0.016	T	0.14587	-1.0467	9	0.09084	T	0.74	-10.1088	9.8938	0.41306	0.9122:0.0:0.0878:0.0	.	416;103;484	B7Z7V8;Q6P2E9-2;Q6P2E9	.;.;EDC4_HUMAN	D	484;416	.	ENSP00000351811:N484D	N	+	1	0	EDC4	66470523	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.046000	0.71029	2.324000	0.78689	0.533000	0.62120	AAT		0.587	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329		Missense_Mutation
NFATC3	4775	broad.mit.edu	37	16	68260371	68260371	+	Silent	SNP	C	C	A			TCGA-24-0975-01	TCGA-24-0975-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr16:68260371C>A	ENST00000346183.3	+	10	3249	c.3225C>A	c.(3223-3225)ctC>ctA	p.L1075L	NFATC3_ENST00000329524.4_3'UTR|NFATC3_ENST00000349223.5_3'UTR|NFATC3_ENST00000535127.2_3'UTR|RP11-96D1.10_ENST00000571975.1_RNA|RP11-96D1.11_ENST00000571197.1_RNA	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	1075					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(1)|p.L1075L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		CTGATGGGCTCTAACAGTGCT	0.552																																																2	Unknown(1)|Substitution - coding silent(1)	ovary(2)	16											106.0	104.0	105.0					16																	68260371		2198	4300	6498	66817872	SO:0001819	synonymous_variant	4775			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.3225C>A	16.37:g.68260371C>A			66817872	O75211|Q14516|Q99840|Q99841|Q99842	Silent	SNP	ENST00000346183.3	37	CCDS10860.1	SNP	32	Broad																																																																																				0.552	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555		Silent
MPP2	4355	broad.mit.edu	37	17	41956733	41956733	+	Nonsense_Mutation	SNP	G	G	C			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr17:41956733G>C	ENST00000461854.1	-	13	1549	c.1464C>G	c.(1462-1464)taC>taG	p.Y488*	MPP2_ENST00000377184.3_Nonsense_Mutation_p.Y481*|MPP2_ENST00000536246.1_Nonsense_Mutation_p.Y453*|MPP2_ENST00000520305.1_Nonsense_Mutation_p.Y325*|MPP2_ENST00000523501.1_Nonsense_Mutation_p.Y453*|MPP2_ENST00000518766.1_Nonsense_Mutation_p.Y509*|MPP2_ENST00000269095.4_Nonsense_Mutation_p.Y464*			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)	488	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.Y464*(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		TGAACACCACGTAAGGGACAA	0.577																																																1	Substitution - Nonsense(1)	ovary(1)	17											110.0	98.0	102.0					17																	41956733		2203	4300	6503	39312259	SO:0001587	stop_gained	4355				CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.1464C>G	17.37:g.41956733G>C	ENSP00000428286:p.Tyr488*		39312259	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Nonsense_Mutation	SNP	ENST00000461854.1	37		SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	g	28.5	4.928629	0.92389	.	.	ENSG00000108852	ENST00000377184;ENST00000269095;ENST00000461854;ENST00000520305;ENST00000523501;ENST00000536246;ENST00000518766	.	.	.	4.83	-3.85	0.04243	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7131	0.51637	0.6667:0.0:0.3333:0.0	.	.	.	.	X	481;464;488;325;453;453;509	.	ENSP00000269095:Y464X	Y	-	3	2	MPP2	39312259	0.000000	0.05858	0.952000	0.39060	0.922000	0.55478	-2.845000	0.00735	-0.786000	0.04516	-0.306000	0.09157	TAC		0.577	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	protein_coding	OTTHUMT00000258388.2	NM_005374		Nonsense_Mutation
MAPT	4137	broad.mit.edu	37	17	44101372	44101372	+	Silent	SNP	C	C	T			TCGA-24-0975-01	TCGA-24-0975-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr17:44101372C>T	ENST00000571987.1	+	13	2112	c.2112C>T	c.(2110-2112)gaC>gaT	p.D704D	MAPT_ENST00000334239.8_Silent_p.D298D|MAPT_ENST00000576518.1_Silent_p.D287D|MAPT_ENST00000420682.2_Silent_p.D358D|MAPT_ENST00000340799.5_Silent_p.D358D|MAPT_ENST00000446361.3_Silent_p.D329D|MAPT_ENST00000262410.5_Silent_p.D704D|MAPT_ENST00000415613.2_Silent_p.D722D|MAPT_ENST00000351559.5_Silent_p.D387D|MAPT_ENST00000431008.3_Silent_p.D356D|MAPT_ENST00000344290.5_Silent_p.D722D|MAPT_ENST00000535772.1_Silent_p.D356D|MAPT_ENST00000574436.1_Silent_p.D387D|MAPT_ENST00000347967.5_Silent_p.D262D			P10636	TAU_HUMAN	microtubule-associated protein tau	704					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)	p.D704D(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	CCAAGACAGACCACGGGGCGG	0.572																																																1	Substitution - coding silent(1)	ovary(1)	17											106.0	90.0	95.0					17																	44101372		2203	4300	6503	41457217	SO:0001819	synonymous_variant	4137			J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.2112C>T	17.37:g.44101372C>T			41457217	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Silent	SNP	ENST00000571987.1	37	CCDS11501.1	SNP	18	Broad																																																																																				0.572	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	NM_016835		Silent
TSEN54	283989	broad.mit.edu	37	17	73520404	73520404	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr17:73520404G>T	ENST00000333213.6	+	11	1528	c.1492G>T	c.(1492-1494)Gtc>Ttc	p.V498F	LLGL2_ENST00000578363.1_5'Flank|LLGL2_ENST00000375227.4_5'Flank|LLGL2_ENST00000392550.3_5'Flank|LLGL2_ENST00000167462.5_5'Flank	NM_207346.2	NP_997229.2	Q7Z6J9	SEN54_HUMAN	TSEN54 tRNA splicing endonuclease subunit	498					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	nucleus (GO:0005634)		p.V498F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)	13	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAGTGGGGATGTCCCTCTGAT	0.557																																																1	Substitution - Missense(1)	ovary(1)	17											182.0	145.0	157.0					17																	73520404		2203	4300	6503	71031999	SO:0001583	missense	283989			AK097583	CCDS11724.1	17q25.1	2013-08-06	2013-08-06		ENSG00000182173	ENSG00000182173		"""tRNA splicing endonuclease subunits"""	27561	protein-coding gene	gene with protein product		608755	"""tRNA splicing endonuclease 54 homolog (SEN54, S. cerevisiae)"", ""tRNA splicing endonuclease 54 homolog (S. cerevisiae)"""			15109492	Standard	NM_207346		Approved	SEN54, SEN54L	uc002jof.1	Q7Z6J9		ENST00000333213.6:c.1492G>T	17.37:g.73520404G>T	ENSP00000327487:p.Val498Phe		71031999	Q86WV3|Q86XE4|Q8N9H2	Missense_Mutation	SNP	ENST00000333213.6	37	CCDS11724.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	16.17	3.046152	0.55110	.	.	ENSG00000182173	ENST00000333213	T	0.65732	-0.17	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.78528	0.4297	M	0.79258	2.445	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	T	0.80647	-0.1289	10	0.87932	D	0	-25.4774	14.1746	0.65532	0.0713:0.0:0.9287:0.0	.	498	Q7Z6J9	SEN54_HUMAN	F	498	ENSP00000327487:V498F	ENSP00000327487:V498F	V	+	1	0	TSEN54	71031999	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	4.261000	0.58841	2.723000	0.93209	0.655000	0.94253	GTC		0.557	TSEN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447618.1	NM_207346		Missense_Mutation
DSG3	1830	broad.mit.edu	37	18	29039048	29039048	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr18:29039048T>C	ENST00000257189.4	+	5	508	c.425T>C	c.(424-426)aTa>aCa	p.I142T		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	142	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I142T(1)		breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AAACCACTTATACTAACGGTT	0.358																																																1	Substitution - Missense(1)	ovary(1)	18											78.0	78.0	78.0					18																	29039048		2203	4300	6503	27293046	SO:0001583	missense	1830			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.425T>C	18.37:g.29039048T>C	ENSP00000257189:p.Ile142Thr		27293046	A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	37	CCDS11898.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	5.966	0.362199	0.11296	.	.	ENSG00000134757	ENST00000257189	T	0.45276	0.9	5.3	5.3	0.74995	Cadherin (4);Cadherin-like (1);	0.412768	0.21060	N	0.080841	T	0.26376	0.0644	N	0.20845	0.615	0.25036	N	0.991234	B	0.33345	0.409	B	0.36030	0.216	T	0.13308	-1.0514	10	0.33940	T	0.23	.	5.0551	0.14529	0.2039:0.0836:0.0:0.7125	.	142	P32926	DSG3_HUMAN	T	142	ENSP00000257189:I142T	ENSP00000257189:I142T	I	+	2	0	DSG3	27293046	0.756000	0.28383	0.896000	0.35187	0.064000	0.16182	1.966000	0.40481	2.125000	0.65367	0.482000	0.46254	ATA		0.358	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944		Missense_Mutation
LMAN1	3998	broad.mit.edu	37	18	57026264	57026264	+	Splice_Site	SNP	C	C	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr18:57026264C>A	ENST00000251047.5	-	1	930	c.213G>T	c.(211-213)ggG>ggT	p.G71G	RP11-27G24.1_ENST00000591331.1_lincRNA	NM_005570.3	NP_005561.1	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1	71	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|sarcomere (GO:0030017)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)	p.G71G(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	CCGGCTTACTCCCCGCGTGGG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	18											34.0	39.0	37.0					18																	57026264		2202	4299	6501	55177244	SO:0001630	splice_region_variant	3998			X71661	CCDS11974.1	18q21.3-q22	2014-09-17	2002-08-30		ENSG00000074695	ENSG00000074695			6631	protein-coding gene	gene with protein product	"""endoplasmic reticulum-golgi intermediate compartment protein 53"""	601567	"""coagulation factor V-factor VIII combined deficiency"""	F5F8D		9546392, 8854877	Standard	NM_005570		Approved	MR60, ERGIC-53, ERGIC53, gp58, MCFD1, FMFD1	uc002lhz.3	P49257	OTTHUMG00000132758	ENST00000251047.5:c.214+1G>T	18.37:g.57026264C>A			55177244	Q12895|Q8N5I7|Q9UQG1|Q9UQG2|Q9UQG3|Q9UQG4|Q9UQG5|Q9UQG6|Q9UQG7|Q9UQG8|Q9UQG9|Q9UQH0|Q9UQH1|Q9UQH2	Silent	SNP	ENST00000251047.5	37	CCDS11974.1	SNP	30	Broad																																																																																				0.657	LMAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256129.2	NM_005570	Silent	Silent
RFX1	5989	broad.mit.edu	37	19	14079457	14079457	+	Missense_Mutation	SNP	T	T	G			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr19:14079457T>G	ENST00000254325.4	-	12	1886	c.1652A>C	c.(1651-1653)aAc>aCc	p.N551T		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	551					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.N551T(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			CGCCACGCCGTTGGTCATGCC	0.672																																																1	Substitution - Missense(1)	ovary(1)	19											57.0	60.0	59.0					19																	14079457		2202	4299	6501	13940457	SO:0001583	missense	5989				CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.1652A>C	19.37:g.14079457T>G	ENSP00000254325:p.Asn551Thr		13940457		Missense_Mutation	SNP	ENST00000254325.4	37	CCDS12301.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	21.9	4.221860	0.79464	.	.	ENSG00000132005	ENST00000254325	T	0.60299	0.2	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.60431	0.2268	M	0.66939	2.045	0.53688	D	0.999978	P	0.50943	0.94	P	0.45913	0.497	T	0.62779	-0.6782	10	0.38643	T	0.18	-26.6958	14.0023	0.64442	0.0:0.0:0.0:1.0	.	551	P22670	RFX1_HUMAN	T	551	ENSP00000254325:N551T	ENSP00000254325:N551T	N	-	2	0	RFX1	13940457	1.000000	0.71417	0.992000	0.48379	0.937000	0.57800	3.701000	0.54793	1.960000	0.56953	0.459000	0.35465	AAC		0.672	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918		Missense_Mutation
KIRREL2	84063	broad.mit.edu	37	19	36357222	36357222	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr19:36357222G>A	ENST00000360202.5	+	15	2153	c.1955G>A	c.(1954-1956)tGc>tAc	p.C652Y	APLP1_ENST00000537454.2_5'Flank|APLP1_ENST00000221891.4_5'Flank|KIRREL2_ENST00000262625.7_Intron|NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000347900.6_Intron|KIRREL2_ENST00000592409.1_Missense_Mutation_p.C617Y	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	652	Pro-rich.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)		p.C652Y(1)		breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GTCCCCCCCTGCAGACTTTAC	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											89.0	92.0	91.0					19																	36357222		2203	4300	6503	41049062	SO:0001583	missense	84063			AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.1955G>A	19.37:g.36357222G>A	ENSP00000353331:p.Cys652Tyr		41049062	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	ENST00000360202.5	37	CCDS12481.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232510	0.39498	.	.	ENSG00000126259	ENST00000360202;ENST00000341658;ENST00000270294	T	0.64438	-0.1	5.1	2.72	0.32119	.	0.154603	0.31772	N	0.007094	T	0.53367	0.1792	N	0.14661	0.345	0.80722	D	1	D;D;D	0.71674	0.996;0.998;0.996	P;D;P	0.63381	0.823;0.914;0.823	T	0.49551	-0.8928	9	.	.	.	-17.4449	4.9864	0.14192	0.1187:0.2194:0.6619:0.0	.	652;632;652	F1T0I2;Q6UWL6-4;Q6UWL6	.;.;KIRR2_HUMAN	Y	652;632;163	ENSP00000353331:C652Y	.	C	+	2	0	KIRREL2	41049062	0.916000	0.31088	0.994000	0.49952	0.242000	0.25591	0.864000	0.27926	2.369000	0.80426	0.561000	0.74099	TGC		0.622	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123		Missense_Mutation
RYR1	6261	broad.mit.edu	37	19	39063890	39063890	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr19:39063890A>T	ENST00000359596.3	+	96	14072	c.14072A>T	c.(14071-14073)gAg>gTg	p.E4691V	RYR1_ENST00000360985.3_Missense_Mutation_p.E4686V|RYR1_ENST00000355481.4_Missense_Mutation_p.E4686V			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4691					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.E4691V(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TACATCACGGAGCAGCCTGAG	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											110.0	92.0	98.0					19																	39063890		2203	4300	6503	43755730	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14072A>T	19.37:g.39063890A>T	ENSP00000352608:p.Glu4691Val		43755730	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	13.07	2.128562	0.37533	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97620	-4.46;-4.46;-4.45	4.52	4.52	0.55395	.	0.000000	0.64402	U	0.000002	D	0.98213	0.9409	M	0.81112	2.525	0.58432	D	0.999995	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	D	0.99160	1.0861	10	0.87932	D	0	.	13.6586	0.62352	1.0:0.0:0.0:0.0	.	4686;4691	P21817-2;P21817	.;RYR1_HUMAN	V	4691;4686;4686	ENSP00000352608:E4691V;ENSP00000347667:E4686V;ENSP00000354254:E4686V	ENSP00000347667:E4686V	E	+	2	0	RYR1	43755730	1.000000	0.71417	0.992000	0.48379	0.537000	0.34900	8.951000	0.93025	1.909000	0.55274	0.379000	0.24179	GAG		0.622	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			Missense_Mutation
FCGBP	8857	broad.mit.edu	37	19	40368577	40368577	+	Silent	SNP	G	G	A	rs140562758	byFrequency	TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr19:40368577G>A	ENST00000221347.6	-	28	12778	c.12771C>T	c.(12769-12771)gaC>gaT	p.D4257D		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4257	VWFD 10. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)		p.D4257D(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCCGACATTCGTCCCAACACA	0.652																																																1	Substitution - coding silent(1)	ovary(1)	19						G		110,4248		1,108,2070	13.0	16.0	15.0		12771	-4.4	0.2	19	dbSNP_134	15	3,8451		0,3,4224	no	coding-synonymous	FCGBP	NM_003890.2		1,111,6294	AA,AG,GG		0.0355,2.5241,0.882		4257/5406	40368577	113,12699	2179	4227	6406	45060417	SO:0001819	synonymous_variant	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12771C>T	19.37:g.40368577G>A			45060417	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1	SNP	40	Broad																																																																																				0.652	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		Silent
POU2F2	5452	broad.mit.edu	37	19	42596274	42596274	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr19:42596274G>T	ENST00000526816.2	-	13	1362	c.1347C>A	c.(1345-1347)agC>agA	p.S449R	POU2F2_ENST00000342301.4_Missense_Mutation_p.S449R|POU2F2_ENST00000529067.1_Missense_Mutation_p.A388D|POU2F2_ENST00000560558.1_Missense_Mutation_p.S394R|POU2F2_ENST00000529952.1_Missense_Mutation_p.S449R|POU2F2_ENST00000389341.5_Missense_Mutation_p.S433R|POU2F2_ENST00000533720.1_Missense_Mutation_p.S433R|POU2F2_ENST00000560398.1_Missense_Mutation_p.S455R			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	449					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S433R(1)		kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	TGCCTTGAGGGCTGGGGTTTG	0.692																																																1	Substitution - Missense(1)	ovary(1)	19											25.0	29.0	27.0					19																	42596274		2203	4299	6502	47288114	SO:0001583	missense	5452				CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.1347C>A	19.37:g.42596274G>T	ENSP00000431603:p.Ser449Arg		47288114	Q16648|Q7M4M8|Q9BRS4	Missense_Mutation	SNP	ENST00000526816.2	37	CCDS56095.1	SNP	42	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.26|16.26	3.072520|3.072520	0.55646|0.55646	.|.	.|.	ENSG00000028277|ENSG00000028277	ENST00000529067|ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529952	T|D;D;D;D	0.80033|0.84442	-1.33|-1.61;-1.85;-1.85;-1.64	3.62|3.62	2.57|2.57	0.30868|0.30868	.|.	.|2.929940	.|0.00984	.|N	.|0.003423	T|T	0.80783|0.80783	0.4689|0.4689	N|N	0.08118|0.08118	0|0	0.31343|0.31343	N|N	0.68347|0.68347	P|P;D	0.38455|0.58268	0.632|0.86;0.982	B|P;P	0.29663|0.52217	0.105|0.693;0.455	T|T	0.73572|0.73572	-0.3940|-0.3940	9|10	0.72032|0.72032	D|D	0.01|0.01	.|.	7.5957|7.5957	0.28046|0.28046	0.2172:0.0:0.7828:0.0|0.2172:0.0:0.7828:0.0	.|.	388|449;433	P09086-4|P09086;P09086-3	.|PO2F2_HUMAN;.	D|R	388|433;449;449;433;448;449	ENSP00000437224:A388D|ENSP00000373992:S433R;ENSP00000339369:S449R;ENSP00000437221:S433R;ENSP00000436988:S449R	ENSP00000437224:A388D|ENSP00000292077:S449R	A|S	-|-	2|3	0|2	POU2F2|POU2F2	47288114|47288114	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.777000|1.777000	0.38604|0.38604	0.872000|0.872000	0.35775|0.35775	0.462000|0.462000	0.41574|0.41574	GCC|AGC		0.692	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3			Missense_Mutation
B3GALT1	8708	broad.mit.edu	37	2	168725920	168725920	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0975-01	TCGA-24-0975-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr2:168725920C>A	ENST00000392690.3	+	1	463	c.371C>A	c.(370-372)cCt>cAt	p.P124H	B3GALT1_ENST00000305861.1_Missense_Mutation_p.P124H|AC016723.4_ENST00000436982.2_RNA|AC016723.4_ENST00000430546.1_RNA			Q9Y5Z6	B3GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1	124					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)	p.P124H(1)		cervix(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18						AATGCTGATCCTGTTCTCAAT	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											78.0	71.0	74.0					2																	168725920		2203	4300	6503	168434166	SO:0001583	missense	8708			E07739	CCDS2227.1	2q24.3	2013-02-19			ENSG00000172318	ENSG00000172318		"""Beta 3-glycosyltransferases"""	916	protein-coding gene	gene with protein product		603093				9582303	Standard	NM_020981		Approved	beta3Gal-T1	uc002udz.1	Q9Y5Z6	OTTHUMG00000132163	ENST00000392690.3:c.371C>A	2.37:g.168725920C>A	ENSP00000376456:p.Pro124His		168434166	D3DPB8|Q53SS2	Missense_Mutation	SNP	ENST00000392690.3	37	CCDS2227.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679415	0.47886	.	.	ENSG00000172318	ENST00000305861;ENST00000392690	T;T	0.41065	1.01;1.01	6.16	6.16	0.99307	.	0.209095	0.47093	D	0.000247	T	0.49287	0.1548	L	0.45352	1.415	0.42985	D	0.99447	P	0.48764	0.915	P	0.48840	0.592	T	0.37478	-0.9704	10	0.51188	T	0.08	-15.6779	20.8598	0.99761	0.0:1.0:0.0:0.0	.	124	Q9Y5Z6	B3GT1_HUMAN	H	124	ENSP00000303740:P124H;ENSP00000376456:P124H	ENSP00000303740:P124H	P	+	2	0	B3GALT1	168434166	0.989000	0.36119	1.000000	0.80357	0.985000	0.73830	2.867000	0.48428	2.937000	0.99478	0.650000	0.86243	CCT		0.468	B3GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255211.2	NM_020981		Missense_Mutation
DOCK10	55619	broad.mit.edu	37	2	225668895	225668895	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr2:225668895G>T	ENST00000258390.7	-	39	4269	c.4202C>A	c.(4201-4203)aCc>aAc	p.T1401N	DOCK10_ENST00000409592.3_Missense_Mutation_p.T1395N	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1401					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ATTGTTCTGGGTGGACTGCAC	0.348																																																0			2											96.0	93.0	94.0					2																	225668895		1841	4092	5933	225377139	SO:0001583	missense	55619			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.4202C>A	2.37:g.225668895G>T	ENSP00000258390:p.Thr1401Asn		225377139	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	CCDS46528.1	SNP	44	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.58|16.58	3.164210|3.164210	0.57476|0.57476	.|.	.|.	ENSG00000135905|ENSG00000135905	ENST00000422684|ENST00000409592;ENST00000258390	.|T;T	.|0.01745	.|4.66;4.66	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	.|0.513306	.|0.22268	.|N	.|0.062306	T|T	0.02533|0.02533	0.0077|0.0077	L|L	0.44542|0.44542	1.39|1.39	0.54753|0.54753	D|D	0.999985|0.999985	.|P;P;P;P	.|0.43094	.|0.799;0.598;0.704;0.454	.|B;B;B;B	.|0.34722	.|0.162;0.188;0.113;0.057	T|T	0.65768|0.65768	-0.6088|-0.6088	5|10	.|0.31617	.|T	.|0.26	.|.	19.8009|19.8009	0.96506|0.96506	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1401;255;1395;63	.|Q96BY6;B4DF07;B3FL70;B4DEY4	.|DOC10_HUMAN;.;.;.	T|N	283|1395;1401	.|ENSP00000386694:T1395N;ENSP00000258390:T1401N	.|ENSP00000258390:T1401N	P|T	-|-	1|2	0|0	DOCK10|DOCK10	225377139|225377139	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.194000|6.194000	0.72082|0.72082	2.680000|2.680000	0.91292|0.91292	0.585000|0.585000	0.79938|0.79938	CCC|ACC		0.348	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1			Missense_Mutation
SH3BP4	23677	broad.mit.edu	37	2	235951018	235951018	+	Silent	SNP	G	G	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr2:235951018G>A	ENST00000409212.1	+	4	2112	c.1605G>A	c.(1603-1605)caG>caA	p.Q535Q	SH3BP4_ENST00000392011.2_Silent_p.Q535Q|SH3BP4_ENST00000344528.4_Silent_p.Q535Q			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	535					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)	p.Q535Q(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CCAGGCCCCAGGATCTCAAGG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	2											67.0	71.0	70.0					2																	235951018		2203	4300	6503	235615757	SO:0001819	synonymous_variant	23677			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.1605G>A	2.37:g.235951018G>A			235615757	O95082|Q309A3|Q53QD0|Q53TD1	Silent	SNP	ENST00000409212.1	37	CCDS2513.1	SNP	35	Broad																																																																																				0.592	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1			Silent
RASL10A	10633	broad.mit.edu	37	22	29707913	29707913	+	IGR	SNP	C	C	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr22:29707913C>A	ENST00000216101.6	-	0	1490				GAS2L1_ENST00000341313.6_3'UTR|RASL10A_ENST00000608559.1_5'Flank|GAS2L1_ENST00000407647.2_Missense_Mutation_p.P491Q|GAS2L1_ENST00000407854.1_Missense_Mutation_p.P491Q|GAS2L1_ENST00000406549.3_Intron|GAS2L1_ENST00000403764.1_Missense_Mutation_p.P491Q|GAS2L1_ENST00000360113.2_3'UTR|GAS2L1_ENST00000471961.1_Missense_Mutation_p.P491Q	NM_006477.4	NP_006468.1	Q92737	RSLAA_HUMAN	RAS-like, family 10, member A						small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)	1						TCTCCAGCCCCAGTCCAGAGT	0.711																																																0			22											14.0	18.0	17.0					22																	29707913		2032	4122	6154	28037913	SO:0001628	intergenic_variant	10634			Y07847	CCDS13854.1	22q12.2	2014-05-09			ENSG00000100276	ENSG00000100276			16954	protein-coding gene	gene with protein product		602220				8975699, 15731001	Standard	NM_006477		Approved	RRP22	uc031rxl.1	Q92737	OTTHUMG00000151106		22.37:g.29707913C>A			28037913	Q49AU5|Q6PI03	Missense_Mutation	SNP	ENST00000216101.6	37	CCDS13854.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	14.18	2.459924	0.43736	.	.	ENSG00000185340	ENST00000407647;ENST00000403764;ENST00000471961;ENST00000407854	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	3.6	1.4	0.22301	.	0.269378	0.22747	U	0.056130	T	0.32556	0.0833	N	0.08118	0	0.80722	D	1	B	0.12013	0.005	B	0.06405	0.002	T	0.08086	-1.0739	10	0.87932	D	0	-14.2082	6.893	0.24241	0.1725:0.7284:0.0:0.0992	.	491	E7EQM6	.	Q	491	ENSP00000385554:P491Q;ENSP00000385358:P491Q;ENSP00000450152:P491Q;ENSP00000385023:P491Q	ENSP00000385358:P491Q	P	+	2	0	GAS2L1	28037913	0.000000	0.05858	0.979000	0.43373	0.972000	0.66771	-1.654000	0.01984	0.201000	0.20466	0.491000	0.48974	CCA		0.711	RASL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321342.1			Missense_Mutation
SI	6476	broad.mit.edu	37	3	164783108	164783108	+	Missense_Mutation	SNP	G	G	A	rs200745562		TCGA-24-0975-01	TCGA-24-0975-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr3:164783108G>A	ENST00000264382.3	-	7	810	c.748C>T	c.(748-750)Cgt>Tgt	p.R250C		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	250	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.R250C(2)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AAATCATGACGAAATCTCTTA	0.343										HNSCC(35;0.089)																																						2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	3											76.0	75.0	75.0					3																	164783108		2203	4300	6503	166265802	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.748C>T	3.37:g.164783108G>A	ENSP00000264382:p.Arg250Cys		166265802	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035583	0.75617	.	.	ENSG00000090402	ENST00000264382	D	0.90955	-2.76	5.9	5.9	0.94986	Glycoside hydrolase-type carbohydrate-binding (1);	0.105792	0.64402	D	0.000003	D	0.97049	0.9036	H	0.97540	4.025	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.97789	1.0237	10	0.72032	D	0.01	.	14.5224	0.67859	0.0:0.0:0.7337:0.2663	.	250	P14410	SUIS_HUMAN	C	250	ENSP00000264382:R250C	ENSP00000264382:R250C	R	-	1	0	SI	166265802	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.105000	0.57797	2.788000	0.95919	0.650000	0.86243	CGT		0.343	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		Missense_Mutation
PELO	53918	broad.mit.edu	37	5	52096309	52096309	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr5:52096309G>A	ENST00000274311.2	+	2	1066	c.81G>A	c.(79-81)tgG>tgA	p.W27*	PELO_ENST00000506949.1_Intron|ITGA1_ENST00000282588.6_Intron|ITGA1_ENST00000504086.1_Intron	NM_015946.4	NP_057030.3	Q9BRX2	PELO_HUMAN	pelota homolog (Drosophila)	27					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA catabolic process, non-stop decay (GO:0070481)|RNA surveillance (GO:0071025)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.W27*(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	11		Lung NSC(810;4.94e-05)|Breast(144;0.0848)				AGGACATGTGGCACACTTACA	0.632																																																1	Substitution - Nonsense(1)	ovary(1)	5											52.0	52.0	52.0					5																	52096309		2203	4300	6503	52132066	SO:0001587	stop_gained	53918				CCDS3956.1	5q11.2	2008-07-18	2001-11-28		ENSG00000152684	ENSG00000152684			8829	protein-coding gene	gene with protein product		605757	"""pelota (Drosophila) homolog"""			11060452	Standard	NM_015946		Approved		uc003jos.3	Q9BRX2	OTTHUMG00000096973	ENST00000274311.2:c.81G>A	5.37:g.52096309G>A	ENSP00000274311:p.Trp27*		52132066	Q9GZS6|Q9Y306	Nonsense_Mutation	SNP	ENST00000274311.2	37	CCDS3956.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	45	11.474929	0.99566	.	.	ENSG00000152684	ENST00000274311	.	.	.	5.44	5.44	0.79542	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4143	17.0666	0.86561	0.0:0.0:1.0:0.0	.	.	.	.	X	27	.	ENSP00000274311:W27X	W	+	3	0	PELO	52132066	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.595000	0.90840	2.550000	0.86006	0.557000	0.71058	TGG		0.632	PELO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214040.1	NM_015946		Nonsense_Mutation
FAM53C	51307	broad.mit.edu	37	5	137682523	137682523	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr5:137682523G>A	ENST00000239906.5	+	5	1482	c.1054G>A	c.(1054-1056)Gtg>Atg	p.V352M	FAM53C_ENST00000434981.2_Missense_Mutation_p.V352M|RP11-256P1.1_ENST00000504539.1_RNA|FAM53C_ENST00000513056.1_3'UTR	NM_016605.2	NP_057689.1	Q9NYF3	FA53C_HUMAN	family with sequence similarity 53, member C	352								p.V352M(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TTCCTCCCAGGTGCTGAGTGA	0.657																																																1	Substitution - Missense(1)	ovary(1)	5											32.0	37.0	35.0					5																	137682523		2203	4300	6503	137710422	SO:0001583	missense	51307			AF251040	CCDS4204.1	5q31	2008-02-05	2004-11-24	2004-11-26	ENSG00000120709	ENSG00000120709			1336	protein-coding gene	gene with protein product		609372	"""chromosome 5 open reading frame 6"""	C5orf6		11087669, 11161817	Standard	NM_001135647		Approved		uc003lcv.3	Q9NYF3	OTTHUMG00000129201	ENST00000239906.5:c.1054G>A	5.37:g.137682523G>A	ENSP00000239906:p.Val352Met		137710422	B2RDJ5|D3DQB9	Missense_Mutation	SNP	ENST00000239906.5	37	CCDS4204.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878895	0.72294	.	.	ENSG00000120709	ENST00000434981;ENST00000239906	T;T	0.47177	0.85;0.85	5.72	5.72	0.89469	.	0.289920	0.29159	N	0.012977	T	0.55924	0.1951	L	0.36672	1.1	0.80722	D	1	D	0.53462	0.96	P	0.56865	0.808	T	0.50693	-0.8798	10	0.40728	T	0.16	-4.9298	18.6452	0.91408	0.0:0.0:1.0:0.0	.	352	Q9NYF3	FA53C_HUMAN	M	352	ENSP00000403705:V352M;ENSP00000239906:V352M	ENSP00000239906:V352M	V	+	1	0	FAM53C	137710422	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.952000	0.63618	2.687000	0.91594	0.655000	0.94253	GTG		0.657	FAM53C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251278.2	NM_016605		Missense_Mutation
KDM3B	51780	broad.mit.edu	37	5	137727864	137727864	+	Missense_Mutation	SNP	A	A	G	rs148445583	byFrequency	TCGA-24-0975-01	TCGA-24-0975-10			A	G	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr5:137727864A>G	ENST00000314358.5	+	8	2743	c.2543A>G	c.(2542-2544)aAt>aGt	p.N848S	KDM3B_ENST00000542866.1_Intron|KDM3B_ENST00000394866.1_Missense_Mutation_p.N504S	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	848					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.N848S(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						CTGGGCCCCAATGGGGAGCGC	0.607													A|||	2	0.000399361	0.0	0.0	5008	,	,		17648	0.0		0.002	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5						A	SER/ASN	2,4404	4.2+/-10.8	0,2,2201	43.0	49.0	47.0		2543	5.8	1.0	5	dbSNP_134	47	7,8593	6.4+/-24.3	0,7,4293	yes	missense	KDM3B	NM_016604.3	46	0,9,6494	GG,GA,AA		0.0814,0.0454,0.0692	benign	848/1762	137727864	9,12997	2203	4300	6503	137755763	SO:0001583	missense	51780			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2543A>G	5.37:g.137727864A>G	ENSP00000326563:p.Asn848Ser		137755763	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	CCDS34242.1	SNP	4	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	11.85	1.761087	0.31137	4.54E-4	8.14E-4	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866	T;T	0.69561	0.17;-0.41	5.84	5.84	0.93424	.	0.302632	0.36066	N	0.002802	T	0.52917	0.1764	L	0.36672	1.1	0.80722	D	1	B;B	0.17852	0.009;0.024	B;B	0.12156	0.007;0.005	T	0.48636	-0.9018	10	0.09338	T	0.73	-12.9489	12.0312	0.53399	0.9309:0.0:0.0691:0.0	.	504;848	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	S	848;638;504	ENSP00000326563:N848S;ENSP00000378335:N504S	ENSP00000326563:N848S	N	+	2	0	KDM3B	137755763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.801000	0.47908	2.229000	0.72834	0.460000	0.39030	AAT		0.607	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604		Missense_Mutation
PCDH12	51294	broad.mit.edu	37	5	141337204	141337204	+	Silent	SNP	C	C	G			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr5:141337204C>G	ENST00000231484.3	-	1	1423	c.213G>C	c.(211-213)ctG>ctC	p.L71L	PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	71	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L71L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCCTGAGGCAGCTGCAACA	0.642																																																1	Substitution - coding silent(1)	ovary(1)	5											54.0	54.0	54.0					5																	141337204		2203	4300	6503	141317388	SO:0001819	synonymous_variant	51294			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.213G>C	5.37:g.141337204C>G			141317388	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	ENST00000231484.3	37	CCDS4269.1	SNP	25	Broad																																																																																				0.642	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580		Silent
GALNT10	55568	broad.mit.edu	37	5	153789100	153789100	+	Splice_Site	SNP	G	G	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr5:153789100G>T	ENST00000297107.6	+	9	1301		c.e9-1		GALNT10_ENST00000377661.2_Splice_Site|SAP30L-AS1_ENST00000524264.1_RNA|GALNT10_ENST00000377657.3_Splice_Site|SAP30L-AS1_ENST00000519727.1_RNA	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			TTGCCCCATAGAACCTTAAGC	0.567																																																0			5											108.0	119.0	115.0					5																	153789100		2203	4300	6503	153769293	SO:0001630	splice_region_variant	55568			AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.1165-1G>T	5.37:g.153789100G>T			153769293	B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Splice_Site_SNP	SNP	ENST00000297107.6	37	CCDS4325.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652664	0.47362	.	.	ENSG00000164574	ENST00000297107;ENST00000377661;ENST00000377657	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8182	0.96579	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GALNT10	153769293	1.000000	0.71417	0.998000	0.56505	0.192000	0.23643	9.640000	0.98453	2.700000	0.92200	0.561000	0.74099	.		0.567	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252453.1	NM_198321	Intron	Splice_Site_SNP
GCM1	8521	broad.mit.edu	37	6	52996804	52996804	+	Splice_Site	SNP	C	C	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr6:52996804C>A	ENST00000259803.7	-	4	653		c.e4+1			NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)						anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.?(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					AAAAATCCAACCTGGAAAAAT	0.517																																																1	Unknown(1)	ovary(1)	6											55.0	54.0	54.0					6																	52996804		2203	4300	6503	53104763	SO:0001630	splice_region_variant	8521			D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.441+1G>T	6.37:g.52996804C>A			53104763	Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Splice_Site_SNP	SNP	ENST00000259803.7	37	CCDS4950.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	29.6	5.017023	0.93404	.	.	ENSG00000137270	ENST00000259803	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2618	0.98447	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GCM1	53104763	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.405000	0.80007	2.793000	0.96121	0.655000	0.94253	.		0.517	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040953.1		Intron	Splice_Site_SNP
ANKRD6	22881	broad.mit.edu	37	6	90326333	90326333	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr6:90326333A>G	ENST00000522441.1	+	8	1312	c.671A>G	c.(670-672)aAa>aGa	p.K224R	ANKRD6_ENST00000369408.5_Missense_Mutation_p.K224R|ANKRD6_ENST00000447838.2_Missense_Mutation_p.K224R|ANKRD6_ENST00000520793.1_Missense_Mutation_p.K191R|ANKRD6_ENST00000339746.4_Missense_Mutation_p.K224R|ANKRD6_ENST00000485637.1_Missense_Mutation_p.K224R	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	224					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.K224R(1)		NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		AAGGTGGCCAAAATCTTACTG	0.473																																																1	Substitution - Missense(1)	ovary(1)	6											156.0	157.0	157.0					6																	90326333		2018	4181	6199	90383054	SO:0001583	missense	22881			AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.671A>G	6.37:g.90326333A>G	ENSP00000430985:p.Lys224Arg		90383054	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Missense_Mutation	SNP	ENST00000522441.1	37	CCDS56441.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	11.58	1.679966	0.29783	.	.	ENSG00000135299	ENST00000369408;ENST00000339746;ENST00000447838;ENST00000522441;ENST00000485637;ENST00000520793	T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	5.66	4.5	0.54988	Ankyrin repeat-containing domain (4);	0.102767	0.42294	N	0.000738	T	0.48169	0.1485	N	0.04655	-0.195	0.80722	D	1	D;P;D;B	0.63046	0.992;0.843;0.98;0.17	D;P;P;B	0.76071	0.987;0.56;0.79;0.055	T	0.56962	-0.7892	10	0.27082	T	0.32	-15.1039	11.4585	0.50195	0.9296:0.0:0.0704:0.0	.	191;224;224;224	B3KUC3;Q9Y2G4;Q9Y2G4-1;C9JJE8	.;ANKR6_HUMAN;.;.	R	224;224;224;224;224;191	ENSP00000358416:K224R;ENSP00000345767:K224R;ENSP00000396771:K224R;ENSP00000430985:K224R;ENSP00000430954:K224R;ENSP00000429782:K191R	ENSP00000345767:K224R	K	+	2	0	ANKRD6	90383054	1.000000	0.71417	0.998000	0.56505	0.922000	0.55478	5.338000	0.65947	0.972000	0.38314	0.460000	0.39030	AAA		0.473	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376594.1			Missense_Mutation
AHI1	54806	broad.mit.edu	37	6	135787489	135787489	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr6:135787489A>G	ENST00000367800.4	-	5	428	c.212T>C	c.(211-213)cTt>cCt	p.L71P	AHI1_ENST00000457866.2_Missense_Mutation_p.L71P|AHI1_ENST00000327035.6_Missense_Mutation_p.L71P	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	71					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)		p.L71P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		AATATGGGGAAGATTGCTTCT	0.328																																																1	Substitution - Missense(1)	ovary(1)	6											218.0	200.0	205.0					6																	135787489		1845	4098	5943	135829182	SO:0001583	missense	54806			AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.212T>C	6.37:g.135787489A>G	ENSP00000356774:p.Leu71Pro		135829182	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	ENST00000367800.4	37	CCDS47483.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	6.679	0.493859	0.12702	.	.	ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000265602;ENST00000327035;ENST00000367801;ENST00000524469	T;T;T;T;T	0.54675	0.8;0.8;0.8;1.63;0.56	5.37	-0.182	0.13287	.	0.660669	0.12963	N	0.424802	T	0.18923	0.0454	L	0.33485	1.01	0.80722	D	1	B;B	0.18461	0.028;0.016	B;B	0.19666	0.026;0.011	T	0.15694	-1.0428	10	0.66056	D	0.02	-0.9998	3.1018	0.06328	0.6368:0.1186:0.1306:0.114	.	71;71	Q8N157-2;Q8N157	.;AHI1_HUMAN	P	71;71;71;71;71;53	ENSP00000356774:L71P;ENSP00000388650:L71P;ENSP00000265602:L71P;ENSP00000322478:L71P;ENSP00000433063:L53P	ENSP00000265602:L71P	L	-	2	0	AHI1	135829182	1.000000	0.71417	0.437000	0.26809	0.002000	0.02628	2.207000	0.42788	0.100000	0.17581	-0.438000	0.05819	CTT		0.328	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651		Missense_Mutation
IPCEF1	26034	broad.mit.edu	37	6	154587051	154587051	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr6:154587051C>T	ENST00000265198.4	-	3	186	c.31G>A	c.(31-33)Gct>Act	p.A11T	IPCEF1_ENST00000422970.2_Missense_Mutation_p.A11T|IPCEF1_ENST00000367220.4_Missense_Mutation_p.A11T	NM_001130700.1|NM_015553.2	NP_001124172.1|NP_056368.1	Q8WWN9	ICEF1_HUMAN	interaction protein for cytohesin exchange factors 1	11					oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|positive regulation of GTP catabolic process (GO:0033126)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	oxygen transporter activity (GO:0005344)|peroxidase activity (GO:0004601)	p.A11T(1)		breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	12						CTTACAAGAGCACTGCCATCA	0.323																																																1	Substitution - Missense(1)	ovary(1)	6											151.0	156.0	154.0					6																	154587051		2203	4300	6503	154628743	SO:0001583	missense	26034			AB007863	CCDS5245.1, CCDS47509.1	6q25.2	2013-01-10			ENSG00000074706	ENSG00000074706		"""Pleckstrin homology (PH) domain containing"""	21204	protein-coding gene	gene with protein product	"""phosphoinositide binding protein PIP3-E"""					11804589, 19756519	Standard	NM_001130699		Approved	PIP3-E, KIAA0403	uc021zhc.1	Q8WWN9	OTTHUMG00000015872	ENST00000265198.4:c.31G>A	6.37:g.154587051C>T	ENSP00000265198:p.Ala11Thr		154628743	A8K1K2|B7ZL78|B7ZL80|O43153|Q5HYL8	Missense_Mutation	SNP	ENST00000265198.4	37	CCDS5245.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	1.757	-0.487873	0.04352	.	.	ENSG00000074706	ENST00000265198;ENST00000422970;ENST00000367220;ENST00000520261	T;T;T	0.14022	2.55;2.54;2.54	4.68	-8.45	0.00946	.	3.059670	0.00783	N	0.001286	T	0.01189	0.0039	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.08055	0.003;0.001	T	0.34477	-0.9827	10	0.17369	T	0.5	-0.0446	2.593	0.04847	0.1901:0.171:0.1033:0.5356	.	11;11	Q8WWN9;Q8WWN9-2	ICEF1_HUMAN;.	T	11	ENSP00000265198:A11T;ENSP00000394751:A11T;ENSP00000356189:A11T	ENSP00000265198:A11T	A	-	1	0	IPCEF1	154628743	0.001000	0.12720	0.000000	0.03702	0.619000	0.37552	-1.274000	0.02820	-1.838000	0.01187	-0.793000	0.03317	GCT		0.323	IPCEF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042789.2	NM_001130699		Missense_Mutation
THSD7A	221981	broad.mit.edu	37	7	11419269	11419269	+	Silent	SNP	C	C	G	rs560502292	byFrequency	TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr7:11419269C>G	ENST00000423059.4	-	25	4829	c.4578G>C	c.(4576-4578)tcG>tcC	p.S1526S	AC004538.3_ENST00000445839.1_RNA|AC004538.3_ENST00000599875.1_RNA|AC004538.3_ENST00000428967.1_RNA|AC004538.3_ENST00000595972.1_RNA|AC004538.3_ENST00000421121.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1526					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1526S(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CGCTACAGTACGAGTGGGGTT	0.493										HNSCC(18;0.044)																																						1	Substitution - coding silent(1)	ovary(1)	7											74.0	76.0	75.0					7																	11419269		2044	4184	6228	11385794	SO:0001819	synonymous_variant	221981				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.4578G>C	7.37:g.11419269C>G			11385794		Silent	SNP	ENST00000423059.4	37	CCDS47543.1	SNP	19	Broad																																																																																				0.493	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2		Silent
ZMIZ2	83637	broad.mit.edu	37	7	44798945	44798945	+	Silent	SNP	C	C	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr7:44798945C>T	ENST00000309315.4	+	7	1002	c.879C>T	c.(877-879)ccC>ccT	p.P293P	ZMIZ2_ENST00000433667.1_Silent_p.P261P|ZMIZ2_ENST00000265346.7_Silent_p.P293P|ZMIZ2_ENST00000413916.1_Silent_p.P261P|ZMIZ2_ENST00000441627.1_Silent_p.P293P	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	293	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)	p.P293P(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						AGTTTGCGCCCAGCCCTGGGC	0.652																																					NSCLC(20;604 852 1948 16908 50522)											1	Substitution - coding silent(1)	ovary(1)	7											65.0	77.0	73.0					7																	44798945		2055	4176	6231	44765470	SO:0001819	synonymous_variant	83637			AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.879C>T	7.37:g.44798945C>T			44765470	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Silent	SNP	ENST00000309315.4	37	CCDS43576.1	SNP	21	Broad																																																																																				0.652	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449		Silent
SPAM1	6677	broad.mit.edu	37	7	123593641	123593641	+	Missense_Mutation	SNP	T	T	G	rs151116153	byFrequency	TCGA-24-0975-01	TCGA-24-0975-10			T	G	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr7:123593641T>G	ENST00000439500.1	+	4	630	c.17T>G	c.(16-18)tTc>tGc	p.F6C	SPAM1_ENST00000223028.7_Missense_Mutation_p.F6C|SPAM1_ENST00000402183.2_Missense_Mutation_p.F6C|SPAM1_ENST00000340011.5_Missense_Mutation_p.F6C|SPAM1_ENST00000460182.1_Missense_Mutation_p.F6C	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	6					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.F6C(1)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GTGCTAAAATTCAAGCACATC	0.358																																																1	Substitution - Missense(1)	ovary(1)	7											71.0	68.0	69.0					7																	123593641		2203	4300	6503	123380877	SO:0001583	missense	6677			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.17T>G	7.37:g.123593641T>G	ENSP00000402123:p.Phe6Cys		123380877	Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	37	CCDS5791.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	12.20	1.866171	0.32977	.	.	ENSG00000106304	ENST00000402183;ENST00000413927;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T;T	0.51325	2.42;0.71;2.42;2.39;2.42;2.42	6.02	4.86	0.63082	.	0.583545	0.19190	N	0.120457	T	0.39572	0.1083	L	0.52573	1.65	0.09310	N	1	B;B	0.20780	0.048;0.038	B;B	0.17433	0.018;0.013	T	0.35943	-0.9768	10	0.49607	T	0.09	-4.5789	6.4538	0.21918	0.2714:0.0:0.1413:0.5873	.	6;6	Q8TC30;P38567	.;HYALP_HUMAN	C	6	ENSP00000386028:F6C;ENSP00000391491:F6C;ENSP00000417934:F6C;ENSP00000345849:F6C;ENSP00000402123:F6C;ENSP00000223028:F6C	ENSP00000223028:F6C	F	+	2	0	SPAM1	123380877	0.002000	0.14202	0.001000	0.08648	0.267000	0.26476	1.328000	0.33758	1.073000	0.40885	0.528000	0.53228	TTC		0.358	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1			Missense_Mutation
EPPK1	83481	broad.mit.edu	37	8	144940729	144940729	+	Silent	SNP	C	C	T			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr8:144940729C>T	ENST00000525985.1	-	2	6764	c.6693G>A	c.(6691-6693)gtG>gtA	p.V2231V				P58107	EPIPL_HUMAN	epiplakin 1	2231						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.V2231V(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTTGGCGGGCACCAGGACGC	0.687																																																1	Substitution - coding silent(1)	ovary(1)	8											67.0	70.0	69.0					8																	144940729		2162	4238	6400	145012717	SO:0001819	synonymous_variant	83481			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6693G>A	8.37:g.144940729C>T			145012717	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37		SNP	25	Broad																																																																																				0.687	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308		Silent
OPLAH	26873	broad.mit.edu	37	8	145114849	145114849	+	Silent	SNP	G	G	A			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chr8:145114849G>A	ENST00000426825.1	-	2	168	c.87C>T	c.(85-87)caC>caT	p.H29H	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	29					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)	p.H29H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGACCCGCACGTGCCCCCCTG	0.667																																																1	Substitution - coding silent(1)	ovary(1)	8											32.0	38.0	36.0					8																	145114849		1921	4113	6034	145186837	SO:0001819	synonymous_variant	26873			AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.87C>T	8.37:g.145114849G>A			145186837	A5PKY8|Q75W65|Q9Y4Q0	Silent	SNP	ENST00000426825.1	37		SNP	40	Broad																																																																																				0.667	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570		Silent
GPR34	2857	broad.mit.edu	37	X	41555953	41555953	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chrX:41555953C>G	ENST00000378142.4	+	3	1351	c.1067C>G	c.(1066-1068)aCt>aGt	p.T356S	CASK_ENST00000421587.2_Intron|CASK_ENST00000361962.4_Intron|GPR34_ENST00000378138.5_Missense_Mutation_p.T356S|CASK_ENST00000442742.2_Intron|CASK_ENST00000378163.1_Intron|CASK_ENST00000378154.1_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000378158.1_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	356					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.T356S(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						AGTGAAAGCACTTCAGAATTT	0.368																																																1	Substitution - Missense(1)	ovary(1)	X											56.0	49.0	52.0					X																	41555953		2203	4299	6502	41440897	SO:0001583	missense	2857			AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.1067C>G	X.37:g.41555953C>G	ENSP00000367384:p.Thr356Ser		41440897	O95853	Missense_Mutation	SNP	ENST00000378142.4	37	CCDS14258.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	14.01	2.409192	0.42715	.	.	ENSG00000171659	ENST00000378142;ENST00000378138;ENST00000535368	T;T	0.34667	1.35;1.35	5.83	5.83	0.93111	.	0.134585	0.49916	D	0.000130	T	0.30262	0.0759	L	0.32530	0.975	0.48762	D	0.999706	B	0.26483	0.15	B	0.19946	0.027	T	0.05818	-1.0862	10	0.19147	T	0.46	-21.4865	19.1239	0.93375	0.0:1.0:0.0:0.0	.	356	Q9UPC5	GPR34_HUMAN	S	356;356;309	ENSP00000367384:T356S;ENSP00000367378:T356S	ENSP00000367378:T356S	T	+	2	0	GPR34	41440897	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.211000	0.42825	2.467000	0.83353	0.591000	0.81541	ACT		0.368	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056264.1	NM_005300		Missense_Mutation
FAAH2	158584	broad.mit.edu	37	X	57473468	57473468	+	Silent	SNP	C	C	G			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chrX:57473468C>G	ENST00000374900.4	+	9	1344	c.1224C>G	c.(1222-1224)tcC>tcG	p.S408S	FAAH2_ENST00000491179.1_Intron	NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	408						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)	p.S408S(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						CCATCCCTTCCATTGGTATGT	0.398										HNSCC(52;0.14)																																						1	Substitution - coding silent(1)	ovary(1)	X											107.0	76.0	86.0					X																	57473468		2203	4300	6503	57490193	SO:0001819	synonymous_variant	158584			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.1224C>G	X.37:g.57473468C>G			57490193	Q86VT2|Q96N98	Silent	SNP	ENST00000374900.4	37	CCDS14375.1	SNP	21	Broad																																																																																				0.398	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056919.1	NM_174912		Silent
AMER1	139285	broad.mit.edu	37	X	63410216	63410216	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chrX:63410216G>C	ENST00000330258.3	-	2	3223	c.2951C>G	c.(2950-2952)tCc>tGc	p.S984C	AMER1_ENST00000403336.1_Intron|AMER1_ENST00000374869.3_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	984	Pro-rich.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									AGACTGGCTGGAAGGCCTGTC	0.577																																																67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	X											34.0	36.0	35.0					X																	63410216		2021	4149	6170	63326941	SO:0001583	missense	139285			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2951C>G	X.37:g.63410216G>C	ENSP00000329117:p.Ser984Cys		63326941	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	6.014	0.370887	0.11409	.	.	ENSG00000184675	ENST00000330258	T	0.49139	0.79	4.44	3.56	0.40772	.	.	.	.	.	T	0.37461	0.1004	N	0.24115	0.695	0.09310	N	1	D	0.56287	0.975	P	0.49708	0.62	T	0.09640	-1.0665	8	.	.	.	-2.3374	4.9916	0.14216	0.1189:0.2118:0.6693:0.0	.	984	Q5JTC6	F123B_HUMAN	C	984	ENSP00000329117:S984C	.	S	-	2	0	FAM123B	63326941	0.499000	0.26083	0.040000	0.18447	0.023000	0.10783	1.821000	0.39041	1.206000	0.43276	0.529000	0.55759	TCC		0.577	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		Missense_Mutation
TAF1	6872	broad.mit.edu	37	X	70598110	70598110	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0975-01	TCGA-24-0975-10			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chrX:70598110C>G	ENST00000373790.4	+	7	1007	c.956C>G	c.(955-957)tCc>tGc	p.S319C	TAF1_ENST00000449580.1_Missense_Mutation_p.S319C|TAF1_ENST00000423759.1_Missense_Mutation_p.S340C|TAF1_ENST00000276072.3_Missense_Mutation_p.S340C	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	319	Protein kinase 1.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.S319C(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				CCTGTGGAGTCCAAATTTTCC	0.453																																																1	Substitution - Missense(1)	ovary(1)	X											96.0	78.0	84.0					X																	70598110		2203	4300	6503	70514835	SO:0001583	missense	6872				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.956C>G	X.37:g.70598110C>G	ENSP00000362895:p.Ser319Cys		70514835	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	.	18.82	3.705916	0.68615	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	4.89	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.65893	0.2735	M	0.66939	2.045	0.58432	D	0.999997	D;D	0.58268	0.969;0.982	P;P	0.58013	0.682;0.831	T	0.69928	-0.5012	10	0.72032	D	0.01	.	14.4991	0.67709	0.0:0.856:0.144:0.0	.	319;340	P21675;P21675-2	TAF1_HUMAN;.	C	319;319;340;340	ENSP00000362895:S319C;ENSP00000389000:S319C;ENSP00000406549:S340C;ENSP00000276072:S340C	ENSP00000276072:S340C	S	+	2	0	TAF1	70514835	1.000000	0.71417	0.998000	0.56505	0.820000	0.46376	4.588000	0.60999	0.929000	0.37192	0.436000	0.28706	TCC		0.453	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606		Missense_Mutation
TCEAL2	140597	broad.mit.edu	37	X	101381973	101381973	+	Silent	SNP	G	G	A			TCGA-24-0975-01	TCGA-24-0975-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chrX:101381973G>A	ENST00000372780.1	+	3	390	c.171G>A	c.(169-171)ccG>ccA	p.P57P	TCEAL2_ENST00000329035.2_Silent_p.P57P	NM_080390.3	NP_525129.1	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2	57					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.P57P(1)		NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						TTGAGGAACCGTTAAAGGATA	0.473																																																1	Substitution - coding silent(1)	ovary(1)	X											83.0	75.0	78.0					X																	101381973		2203	4300	6503	101268629	SO:0001819	synonymous_variant	140597			AF325115	CCDS14496.1	Xq22.1-q22.3	2014-03-21			ENSG00000184905	ENSG00000184905			29818	protein-coding gene	gene with protein product						16221301	Standard	NM_080390		Approved	my048, MY0876G05, WEX1	uc004eip.3	Q9H3H9	OTTHUMG00000022048	ENST00000372780.1:c.171G>A	X.37:g.101381973G>A			101268629	B2R5C7	Silent	SNP	ENST00000372780.1	37	CCDS14496.1	SNP	40	Broad																																																																																				0.473	TCEAL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057605.1	NM_080390		Silent
TFDP3	51270	broad.mit.edu	37	X	132351861	132351861	+	Missense_Mutation	SNP	C	C	G	rs199687528		TCGA-24-0975-01	TCGA-24-0975-10			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chrX:132351861C>G	ENST00000310125.4	-	1	515	c.427G>C	c.(427-429)Gct>Cct	p.A143P		NM_016521.2	NP_057605.3	Q5H9I0	TFDP3_HUMAN	transcription factor Dp family, member 3	143					cellular response to DNA damage stimulus (GO:0006974)|G1/S transition of mitotic cell cycle (GO:0000082)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A83P(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(1)|lung(8)|ovary(1)|prostate(2)	19	Acute lymphoblastic leukemia(192;0.000127)					TTGCTGGCAGCTCTGAACTTG	0.552																																																1	Substitution - Missense(1)	ovary(1)	X											88.0	82.0	84.0					X																	132351861		2202	4299	6501	132179527	SO:0001583	missense	51270			AF219119	CCDS14636.2	Xq26.2	2009-03-25			ENSG00000183434	ENSG00000183434			24603	protein-coding gene	gene with protein product	"""E2F-like protein"", ""cancer/testis antigen 30"""	300772				12097419	Standard	NM_016521		Approved	HCA661, E2F-like, CT30	uc004exb.1	Q5H9I0	OTTHUMG00000022433	ENST00000310125.4:c.427G>C	X.37:g.132351861C>G	ENSP00000385461:p.Ala143Pro		132179527	Q6DK49|Q9NZ54	Missense_Mutation	SNP	ENST00000310125.4	37	CCDS14636.2	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	c	11.31	1.601016	0.28534	.	.	ENSG00000183434	ENST00000310125	T	0.23552	1.9	0.226	0.226	0.15353	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	.	.	.	.	T	0.27731	0.0682	L	0.59436	1.845	0.41238	D	0.986629	P	0.38148	0.62	P	0.46885	0.53	T	0.12578	-1.0542	9	0.44086	T	0.13	.	3.0675	0.06219	0.4798:0.5199:2.0E-4:1.0E-4	.	143	Q5H9I0	TFDP3_HUMAN	P	143	ENSP00000385461:A143P	ENSP00000385461:A143P	A	-	1	0	TFDP3	132179527	1.000000	0.71417	0.036000	0.18154	0.037000	0.13140	1.616000	0.36933	0.283000	0.22279	0.287000	0.19450	GCT		0.552	TFDP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058337.1	NM_016521		Missense_Mutation
MAGEA3	4102	broad.mit.edu	37	X	151935929	151935929	+	Missense_Mutation	SNP	A	A	C			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0975-01	TCGA-24-0975-10	g.chrX:151935929A>C	ENST00000393902.3	-	3	805	c.238T>G	c.(238-240)Tgg>Ggg	p.W80G	MAGEA3_ENST00000370278.3_Missense_Mutation_p.W80G			P43357	MAGA3_HUMAN	melanoma antigen family A, 3	80								p.W80G(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	15	Acute lymphoblastic leukemia(192;6.56e-05)					GATTGGCTCCAGAGAGGGTAG	0.597																																																1	Substitution - Missense(1)	ovary(1)	X											47.0	43.0	44.0					X																	151935929		2202	4281	6483	151686585	SO:0001583	missense	4102				CCDS76045.1	Xq28	2009-03-13			ENSG00000221867	ENSG00000221867			6801	protein-coding gene	gene with protein product	"""melanoma-associated antigen 3"", ""antigen MZ2-D"", ""MAGE-3 antigen"", ""cancer/testis antigen family 1, member 3"""	300174		MAGE3		1840703, 8575766	Standard	NM_005362		Approved	HYPD, HIP8, MGC14613, CT1.3	uc004fgp.3	P43357	OTTHUMG00000022640	ENST00000393902.3:c.238T>G	X.37:g.151935929A>C	ENSP00000377480:p.Trp80Gly		151686585	Q6FHI6	Missense_Mutation	SNP	ENST00000393902.3	37	CCDS14715.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	N	0.014	-1.575345	0.00887	.	.	ENSG00000221867	ENST00000370278;ENST00000393902;ENST00000417212	T;T;T	0.04015	3.73;3.73;3.73	1.1	-2.19	0.07015	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.04407	0.0121	L	0.56769	1.78	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45848	-0.9233	9	0.24483	T	0.36	.	1.4156	0.02301	0.4143:0.0:0.2598:0.3259	.	80	P43357	MAGA3_HUMAN	G	80	ENSP00000359301:W80G;ENSP00000377480:W80G;ENSP00000392758:W80G	ENSP00000359301:W80G	W	-	1	0	MAGEA3	151686585	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.366000	0.02585	-0.867000	0.04063	-0.892000	0.02923	TGG		0.597	MAGEA3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058744.1	NM_005362		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578275	7578277	+	In_Frame_Del	DEL	GAG	GAG	-	rs587778718		TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-0975-01	TCGA-24-0975-10	g.chr17:7578275_7578277delGAG	ENST00000269305.4	-	6	761_763	c.572_574delCTC	c.(571-576)cctcag>cag	p.P191del	TP53_ENST00000420246.2_In_Frame_Del_p.P191del|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_In_Frame_Del_p.P191del|TP53_ENST00000455263.2_In_Frame_Del_p.P191del|TP53_ENST00000413465.2_In_Frame_Del_p.P191del|TP53_ENST00000445888.2_In_Frame_Del_p.P191del	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	191	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q192*(83)|p.0?(8)|p.P191del(7)|p.Q99*(6)|p.?(6)|p.Q60*(6)|p.P191delP(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.P191L(2)|p.P191R(2)|p.G187fs*16(2)|p.P59delP(2)|p.P98delP(2)|p.P191fs*56(1)|p.P191fs*6(1)|p.A189_Q192>E(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P191H(1)|p.P191P(1)|p.P191_Q192delPQ(1)|p.D186_P191delDGLAPP(1)|p.Q192K(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.Q192fs*56(1)|p.Q192del(1)|p.Q192fs*16(1)|p.L188_P191del(1)|p.Q192fs*30(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATAAGATGCTGAGGAGGGGCCAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	156	Substitution - Nonsense(95)|Deletion - In frame(23)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Substitution - Missense(6)|Insertion - Frameshift(2)|Complex - frameshift(1)|Substitution - coding silent(1)	breast(27)|ovary(21)|urinary_tract(15)|lung(13)|upper_aerodigestive_tract(12)|large_intestine(9)|skin(9)|oesophagus(8)|biliary_tract(7)|haematopoietic_and_lymphoid_tissue(6)|kidney(6)|stomach(5)|liver(5)|bone(4)|central_nervous_system(3)|pancreas(2)|cervix(1)|endometrium(1)|eye(1)|prostate(1)	17	GRCh37	CD972478	TP53	D																																				7519002	SO:0001651	inframe_deletion	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.572_574delCTC	17.37:g.7578278_7578280delGAG	ENSP00000269305:p.Pro191del		7519000	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	45	Broad																																																																																				0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		In_Frame_Del
PSTPIP1	9051	broad.mit.edu	37	15	77329453	77329454	+	Frame_Shift_Ins	INS	-	-	AAGT			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-0975-01	TCGA-24-0975-10	g.chr15:77329453_77329454insAAGT	ENST00000558012.1	+	15	1676_1677	c.1187_1188insAAGT	c.(1186-1191)tggtggfs	p.WW396fs	PSTPIP1_ENST00000379595.3_Frame_Shift_Ins_p.WW393fs|PSTPIP1_ENST00000557995.1_3'UTR|PSTPIP1_ENST00000267939.5_Frame_Shift_Ins_p.WW376fs|PSTPIP1_ENST00000559295.1_Frame_Shift_Ins_p.WW377fs	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	396	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)		p.W396fs*1(1)|p.W396C(1)		breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						GAGGATGGCTGGTGGACTGTGG	0.614																																																2	Substitution - Missense(1)|Insertion - Frameshift(1)	upper_aerodigestive_tract(1)|ovary(1)	15																																								75116509	SO:0001589	frameshift_variant	9051			U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	Exception_encountered	15.37:g.77329453_77329454insAAGT	ENSP00000452746:p.Trp396fs		75116508	B5BU74|B5BUK4|O43585|O95657	Frame_Shift_Ins	INS	ENST00000558012.1	37	CCDS45312.1	INS	47	Broad																																																																																				0.614	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419373.2	NM_003978		Frame_Shift_Ins
ITFG3	83986	broad.mit.edu	37	16	313325	313332	+	Frame_Shift_Del	DEL	GGCTCAGA	GGCTCAGA	-			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-0975-01	TCGA-24-0975-10	g.chr16:313325_313332delGGCTCAGA	ENST00000399932.3	+	9	1487_1494	c.1036_1043delGGCTCAGA	c.(1036-1044)ggctcagagfs	p.GSE346fs	ITFG3_ENST00000450082.2_Frame_Shift_Del_p.GSE346fs|ITFG3_ENST00000301678.3_Frame_Shift_Del_p.GSE346fs|ITFG3_ENST00000442458.2_Frame_Shift_Del_p.GSE346fs|ITFG3_ENST00000600536.1_Frame_Shift_Del_p.GSE346fs|ITFG3_ENST00000301679.2_Frame_Shift_Del_p.GSE346fs	NM_001284497.1	NP_001271426.1	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3	346						cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.S347fs*39(1)		central_nervous_system(3)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				GCTTCTTGTGGGCTCAGAGGCCTTCGTG	0.644																																																1	Deletion - Frameshift(1)	ovary(1)	16																																								253333	SO:0001589	frameshift_variant	83986			AL136542	CCDS10402.1	16p13.3	2006-03-31	2006-03-31	2006-03-31	ENSG00000167930	ENSG00000167930			14163	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 9"""	C16orf9			Standard	XM_005255622		Approved	DKFZP761D0211, FLJ32603	uc002cgf.3	Q9H0X4	OTTHUMG00000060728	ENST00000399932.3:c.1036_1043delGGCTCAGA	16.37:g.313325_313332delGGCTCAGA	ENSP00000382814:p.Gly346fs		253326	D3DU45|Q7L416|Q96FR1|Q96MC7|Q96S30	Frame_Shift_Del	DEL	ENST00000399932.3	37	CCDS10402.1	DEL	43	Broad																																																																																				0.644	ITFG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134227.2	NM_032039		Frame_Shift_Del
ZFPM1	161882	broad.mit.edu	37	16	88601257	88601266	+	Frame_Shift_Del	DEL	CGCCGGCGCC	CGCCGGCGCC	-	rs150516696		TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-0975-01	TCGA-24-0975-10	g.chr16:88601257_88601266delCGCCGGCGCC	ENST00000319555.3	+	10	3213_3222	c.2891_2900delCGCCGGCGCC	c.(2890-2901)acgccggcgccgfs	p.TPAP964fs		NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	964					atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)	p.T964T(1)|p.T964fs*39(1)		central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		AGCAAGGGCACGCCGGCGCCGCTGCCCAAC	0.705																																					Pancreas(49;850 1106 29641 32847 38344)											2	Deletion - Frameshift(1)|Substitution - coding silent(1)	ovary(2)	16																																								87128767	SO:0001589	frameshift_variant	161882			AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.2891_2900delCGCCGGCGCC	16.37:g.88601257_88601266delCGCCGGCGCC	ENSP00000326630:p.Thr964fs		87128758		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1	DEL	19	Broad																																																																																				0.705	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2			Frame_Shift_Del
SON	6651	broad.mit.edu	37	21	34925619	34925622	+	Frame_Shift_Del	DEL	AGTC	AGTC	-			TCGA-24-0975-01	TCGA-24-0975-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-0975-01	TCGA-24-0975-10	g.chr21:34925619_34925622delAGTC	ENST00000356577.4	+	3	4557_4560	c.4082_4085delAGTC	c.(4081-4086)gagtctfs	p.ES1361fs	SON_ENST00000290239.6_Frame_Shift_Del_p.ES1361fs|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Frame_Shift_Del_p.ES1361fs|SON_ENST00000300278.4_Frame_Shift_Del_p.ES1361fs	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1361	4 X 8 AA tandem repeats of V-L-E-SS- [AVT]-VT.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GCTGTCCTGGAGTCTTCGGCTGTG	0.578																																																0			21																																								33847492	SO:0001589	frameshift_variant	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.4082_4085delAGTC	21.37:g.34925619_34925622delAGTC	ENSP00000348984:p.Glu1361fs		33847489	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Frame_Shift_Del	DEL	ENST00000356577.4	37	CCDS13629.1	DEL	11	Broad																																																																																				0.578	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927		Frame_Shift_Del
