#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
MASP2	10747	broad.mit.edu	37	1	11097845	11097845	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:11097845C>G	ENST00000400897.3	-	7	928	c.913G>C	c.(913-915)Gcg>Ccg	p.A305P		NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	305	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.A305P(1)		biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		TTAGGTGGCGCCATCGGATAA	0.517											OREG0013096	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(35;611 746 20780 22741 36496)											1	Substitution - Missense(1)	ovary(1)	1											122.0	118.0	119.0					1																	11097845		2203	4300	6503	11020432	SO:0001583	missense	10747			X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.913G>C	1.37:g.11097845C>G	ENSP00000383690:p.Ala305Pro	669	11020432	A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Missense_Mutation	SNP	ENST00000400897.3	37	CCDS123.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992485	0.54041	.	.	ENSG00000009724	ENST00000400897	T	0.62941	-0.01	4.6	3.64	0.41730	Complement control module (2);Sushi/SCR/CCP (3);	0.233737	0.34507	N	0.003910	T	0.48804	0.1520	L	0.45470	1.425	0.80722	D	1	B	0.12630	0.006	B	0.15052	0.012	T	0.41770	-0.9490	10	0.02654	T	1	.	12.6834	0.56934	0.0:0.835:0.1649:0.0	.	305	O00187	MASP2_HUMAN	P	305	ENSP00000383690:A305P	ENSP00000383690:A305P	A	-	1	0	MASP2	11020432	0.184000	0.23200	0.756000	0.31282	0.910000	0.53928	1.877000	0.39598	2.108000	0.64289	0.563000	0.77884	GCG		0.517	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006072.1	NM_006610		Missense_Mutation
FBXO42	54455	broad.mit.edu	37	1	16577626	16577626	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:16577626C>A	ENST00000375592.3	-	10	1909	c.1693G>T	c.(1693-1695)Gcg>Tcg	p.A565S		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	565								p.A565S(1)		autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		GAGGACATCGCTTTGATGGCT	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											46.0	42.0	43.0					1																	16577626		2203	4300	6503	16450213	SO:0001583	missense	54455			BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.1693G>T	1.37:g.16577626C>A	ENSP00000364742:p.Ala565Ser		16450213	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Missense_Mutation	SNP	ENST00000375592.3	37	CCDS30613.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	15.46	2.838880	0.51057	.	.	ENSG00000037637	ENST00000375592;ENST00000456164;ENST00000444116	T;T;T	0.51574	3.77;0.7;0.7	5.52	5.52	0.82312	.	0.102804	0.64402	D	0.000002	T	0.34513	0.0900	N	0.19112	0.55	0.52099	D	0.999948	B	0.29378	0.243	B	0.24541	0.054	T	0.08743	-1.0707	10	0.23302	T	0.38	-14.3873	18.7865	0.91957	0.0:1.0:0.0:0.0	.	565	Q6P3S6	FBX42_HUMAN	S	565;283;283	ENSP00000364742:A565S;ENSP00000415663:A283S;ENSP00000412416:A283S	ENSP00000364742:A565S	A	-	1	0	FBXO42	16450213	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	4.240000	0.58701	2.767000	0.95098	0.655000	0.94253	GCG		0.602	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006285.1			Missense_Mutation
AKR7A3	22977	broad.mit.edu	37	1	19610552	19610552	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:19610552C>A	ENST00000361640.4	-	6	1312	c.772G>T	c.(772-774)Gcc>Tcc	p.A258S		NM_012067.2	NP_036199.2	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)	258					cellular aldehyde metabolic process (GO:0006081)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)	p.A258S(1)		NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)	13		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GGGGCGCTGGCGCCATACGCG	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											60.0	59.0	59.0					1																	19610552		2199	4300	6499	19483139	SO:0001583	missense	22977			AF040639	CCDS193.1	1p36.13	2008-05-14			ENSG00000162482	ENSG00000162482		"""Aldo-keto reductases"""	390	protein-coding gene	gene with protein product		608477				10383892	Standard	NM_012067		Approved		uc001bbv.1	O95154	OTTHUMG00000002523	ENST00000361640.4:c.772G>T	1.37:g.19610552C>A	ENSP00000355377:p.Ala258Ser		19483139	Q86SR4|Q8IVN6|Q8N5V6|Q8TAX1|Q9NUC3	Missense_Mutation	SNP	ENST00000361640.4	37	CCDS193.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	.	0.012	-1.687709	0.00738	.	.	ENSG00000162482	ENST00000361640	T	0.04234	3.67	3.96	-7.93	0.01156	NADP-dependent oxidoreductase domain (3);	0.874481	0.10372	N	0.682663	T	0.01976	0.0062	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.46484	-0.9188	10	0.09843	T	0.71	.	1.3663	0.02202	0.3393:0.3059:0.2239:0.1309	.	258	O95154	ARK73_HUMAN	S	258	ENSP00000355377:A258S	ENSP00000355377:A258S	A	-	1	0	AKR7A3	19483139	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-1.769000	0.01792	-2.063000	0.00890	0.184000	0.17185	GCC		0.647	AKR7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007166.1	NM_012067		Missense_Mutation
COL16A1	1307	broad.mit.edu	37	1	32118385	32118385	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:32118385C>A	ENST00000373672.3	-	71	5198	c.4682G>T	c.(4681-4683)gGc>gTc	p.G1561V	RP11-73M7.6_ENST00000608246.1_RNA|RP11-73M7.6_ENST00000608888.1_RNA|RP11-73M7.6_ENST00000587445.1_RNA|RP11-73M7.6_ENST00000585660.1_RNA|RP11-73M7.6_ENST00000609373.1_RNA|RP11-73M7.6_ENST00000609549.1_RNA|COL16A1_ENST00000271069.6_Missense_Mutation_p.G1561V|RP11-73M7.6_ENST00000609625.1_RNA|RP11-73M7.6_ENST00000608332.1_RNA|COL16A1_ENST00000461217.1_5'Flank|RP11-73M7.6_ENST00000609338.1_RNA|RP11-73M7.6_ENST00000589462.1_RNA|RP11-73M7.6_ENST00000591592.1_RNA|RP11-73M7.6_ENST00000607926.1_RNA|RP11-73M7.6_ENST00000610216.1_RNA|RP11-73M7.6_ENST00000593188.1_RNA|RP11-73M7.6_ENST00000609033.1_RNA|RP11-73M7.6_ENST00000610043.1_RNA|RP11-73M7.6_ENST00000591929.1_RNA|RP11-73M7.6_ENST00000585413.1_RNA	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1561	Collagen-like 8.|Triple-helical region 1 (COL1) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.G1561V(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CCCAGGGATGCCAGGGATGCC	0.627																																					Colon(143;498 1786 21362 25193 36625)											1	Substitution - Missense(1)	ovary(1)	1											27.0	29.0	28.0					1																	32118385		1911	4134	6045	31890972	SO:0001583	missense	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.4682G>T	1.37:g.32118385C>A	ENSP00000362776:p.Gly1561Val		31890972	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684588	0.88639	.	.	ENSG00000084636	ENST00000373672;ENST00000271069	D;D	0.99353	-5.77;-5.77	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.99622	0.9862	H	0.95574	3.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97898	1.0301	10	0.87932	D	0	.	18.3647	0.90386	0.0:1.0:0.0:0.0	.	1561;1559	Q07092;Q07092-2	COGA1_HUMAN;.	V	1561	ENSP00000362776:G1561V;ENSP00000271069:G1561V	ENSP00000271069:G1561V	G	-	2	0	COL16A1	31890972	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.338000	0.79269	2.723000	0.93209	0.591000	0.81541	GGC		0.627	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856		Missense_Mutation
SPOCD1	90853	broad.mit.edu	37	1	32280758	32280758	+	Silent	SNP	G	G	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:32280758G>T	ENST00000360482.2	-	2	306	c.177C>A	c.(175-177)atC>atA	p.I59I	SPOCD1_ENST00000257100.3_Intron|SPOCD1_ENST00000373648.2_Silent_p.I59I|SPOCD1_ENST00000533231.1_Silent_p.I59I	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	59					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)			p.I59I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CCTTCCTGGGGATCTTCCTTC	0.657																																																1	Substitution - coding silent(1)	ovary(1)	1											29.0	31.0	30.0					1																	32280758		2203	4300	6503	32053345	SO:0001819	synonymous_variant	90853			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.177C>A	1.37:g.32280758G>T			32053345	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Silent	SNP	ENST00000360482.2	37	CCDS347.1	SNP	41	Broad																																																																																				0.657	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569		Silent
SSBP3	23648	broad.mit.edu	37	1	54694492	54694492	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:54694492A>T	ENST00000371320.3	-	15	1345	c.935T>A	c.(934-936)aTg>aAg	p.M312K	SSBP3_ENST00000371319.3_Missense_Mutation_p.M285K|SSBP3_ENST00000357475.4_Missense_Mutation_p.M292K|SSBP3_ENST00000326956.7_5'UTR|SSBP3_ENST00000417664.2_Missense_Mutation_p.M202K	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	312	Gly-rich.|Pro-rich.				head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)	p.M285K(1)		central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						GCCGGGACCCATCGGGAACTG	0.677																																																1	Substitution - Missense(1)	ovary(1)	1											16.0	16.0	16.0					1																	54694492		2195	4293	6488	54467080	SO:0001583	missense	23648				CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.935T>A	1.37:g.54694492A>T	ENSP00000360371:p.Met312Lys		54467080	A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Missense_Mutation	SNP	ENST00000371320.3	37	CCDS591.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	22.3	4.270316	0.80469	.	.	ENSG00000157216	ENST00000417664;ENST00000371320;ENST00000371319;ENST00000357475	.	.	.	3.86	3.86	0.44501	.	0.000000	0.85682	U	0.000000	T	0.62307	0.2417	M	0.72894	2.215	0.80722	D	1	P;P;P	0.49862	0.61;0.913;0.929	B;P;P	0.53313	0.142;0.69;0.723	T	0.63646	-0.6590	9	0.05959	T	0.93	.	13.3844	0.60787	1.0:0.0:0.0:0.0	.	285;292;312	Q9BWW4-2;Q9BWW4-3;Q9BWW4	.;.;SSBP3_HUMAN	K	202;312;285;292	.	ENSP00000350067:M292K	M	-	2	0	SSBP3	54467080	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	8.962000	0.93254	1.705000	0.51264	0.379000	0.24179	ATG		0.677	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022721.1	NM_018070		Missense_Mutation
INADL	10207	broad.mit.edu	37	1	62231957	62231957	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:62231957C>T	ENST00000371158.2	+	4	310	c.196C>T	c.(196-198)Cat>Tat	p.H66Y	INADL_ENST00000316485.6_Missense_Mutation_p.H66Y	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	66					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.H66Y(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						ACAGCTCAACCATATACCCTC	0.333																																																1	Substitution - Missense(1)	ovary(1)	1											106.0	105.0	105.0					1																	62231957		2203	4300	6503	62004545	SO:0001583	missense	10207			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.196C>T	1.37:g.62231957C>T	ENSP00000360200:p.His66Tyr		62004545	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	9.097	1.003100	0.19121	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.12879	2.75;2.64	6.08	4.22	0.49857	L27 (1);	0.229933	0.36200	N	0.002739	T	0.10508	0.0257	L	0.50919	1.6	0.80722	D	1	B;B;B	0.15930	0.015;0.012;0.015	B;B;B	0.18561	0.022;0.007;0.015	T	0.08146	-1.0736	10	0.02654	T	1	.	8.1801	0.31305	0.0:0.745:0.0:0.255	.	66;66;66	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	Y	66	ENSP00000360200:H66Y;ENSP00000326199:H66Y	ENSP00000255202:H66Y	H	+	1	0	INADL	62004545	1.000000	0.71417	0.992000	0.48379	0.668000	0.39293	1.348000	0.33987	1.589000	0.49982	0.591000	0.81541	CAT		0.333	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605		Missense_Mutation
FLG2	388698	broad.mit.edu	37	1	152327068	152327068	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:152327068C>A	ENST00000388718.5	-	3	3266	c.3194G>T	c.(3193-3195)gGa>gTa	p.G1065V	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1065	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G1065V(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCATATTGTCCAAAACCAGA	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											299.0	299.0	299.0					1																	152327068		2203	4300	6503	150593692	SO:0001583	missense	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.3194G>T	1.37:g.152327068C>A	ENSP00000373370:p.Gly1065Val		150593692	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	10.30	1.313420	0.23908	.	.	ENSG00000143520	ENST00000388718	T	0.06849	3.25	4.32	4.32	0.51571	.	.	.	.	.	T	0.14141	0.0342	M	0.72894	2.215	0.19775	N	0.999953	D	0.76494	0.999	D	0.64042	0.921	T	0.02942	-1.1091	9	0.52906	T	0.07	.	12.3212	0.54985	0.0:1.0:0.0:0.0	.	1065	Q5D862	FILA2_HUMAN	V	1065	ENSP00000373370:G1065V	ENSP00000373370:G1065V	G	-	2	0	FLG2	150593692	0.000000	0.05858	0.009000	0.14445	0.011000	0.07611	-0.697000	0.05098	1.947000	0.56498	0.650000	0.86243	GGA		0.478	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		Missense_Mutation
ATP8B2	57198	broad.mit.edu	37	1	154315956	154315956	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:154315956T>C	ENST00000368489.3	+	17	1769	c.1769T>C	c.(1768-1770)cTc>cCc	p.L590P		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	576					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.L590P(1)	IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AAGATCCGACTCTACTGCAAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											73.0	64.0	67.0					1																	154315956		2203	4300	6503	152582580	SO:0001583	missense	57198			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.1769T>C	1.37:g.154315956T>C	ENSP00000357475:p.Leu590Pro		152582580	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	ENST00000368489.3	37	CCDS1066.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	28.5	4.928330	0.92389	.	.	ENSG00000143515	ENST00000368489	D	0.85088	-1.94	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000001	D	0.92061	0.7484	H	0.99336	4.52	0.80722	D	1	P	0.34892	0.474	B	0.42386	0.386	D	0.93727	0.7038	10	0.87932	D	0	.	14.8457	0.70259	0.0:0.0:0.0:1.0	.	590	P98198-3	.	P	590	ENSP00000357475:L590P	ENSP00000357475:L590P	L	+	2	0	ATP8B2	152582580	1.000000	0.71417	0.974000	0.42286	0.998000	0.95712	7.868000	0.87116	2.288000	0.76882	0.482000	0.46254	CTC		0.507	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452		Missense_Mutation
ARHGEF2	9181	broad.mit.edu	37	1	155921756	155921756	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:155921756T>C	ENST00000361247.4	-	17	2225	c.2126A>G	c.(2125-2127)aAt>aGt	p.N709S	ARHGEF2_ENST00000368316.1_Missense_Mutation_p.N681S|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.N708S|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.N710S|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.N681S|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.N754S	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	709					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.N681S(1)		breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					AATGGAGCCATTGAAGGTTCT	0.547																																					Melanoma(178;35 2768 6610 28839)											1	Substitution - Missense(1)	ovary(1)	1											62.0	61.0	62.0					1																	155921756		2203	4300	6503	154188380	SO:0001583	missense	9181			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.2126A>G	1.37:g.155921756T>C	ENSP00000354837:p.Asn709Ser		154188380	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	37	CCDS53376.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	14.11	2.438877	0.43326	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.63744	-0.05;0.07;0.07;-0.05;-0.06	5.13	5.13	0.70059	.	0.000000	0.46442	D	0.000286	T	0.60090	0.2242	M	0.72118	2.19	0.35997	D	0.837148	B;D;B	0.67145	0.077;0.996;0.02	B;P;B	0.54759	0.053;0.76;0.054	T	0.62661	-0.6807	10	0.28530	T	0.3	-24.2421	11.2579	0.49065	0.0:0.0:0.0:1.0	.	753;709;708	D3DVA5;Q92974;Q92974-2	.;ARHG2_HUMAN;.	S	681;709;710;681;708	ENSP00000315325:N681S;ENSP00000354837:N709S;ENSP00000357298:N710S;ENSP00000357299:N681S;ENSP00000314787:N708S	ENSP00000314787:N708S	N	-	2	0	ARHGEF2	154188380	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.538000	0.60650	2.146000	0.66826	0.533000	0.62120	AAT		0.547	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723		Missense_Mutation
NHLH1	4807	broad.mit.edu	37	1	160340544	160340544	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:160340544T>C	ENST00000302101.5	+	2	469	c.23T>C	c.(22-24)aTg>aCg	p.M8T		NM_005598.3	NP_005589.1	Q02575	HEN1_HUMAN	nescient helix loop helix 1	8					cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.M8T(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	7	all_cancers(52;7.11e-19)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCAGACACCATGGAGCTGGAC	0.662																																																1	Substitution - Missense(1)	ovary(1)	1											17.0	22.0	20.0					1																	160340544		2190	4285	6475	158607168	SO:0001583	missense	4807			BC013789	CCDS1204.1	1q22	2013-05-21			ENSG00000171786	ENSG00000171786		"""Basic helix-loop-helix proteins"""	7817	protein-coding gene	gene with protein product		162360		HEN1			Standard	NM_005598		Approved	NSCL, NSCL1, bHLHa35	uc001fwa.2	Q02575	OTTHUMG00000033121	ENST00000302101.5:c.23T>C	1.37:g.160340544T>C	ENSP00000302189:p.Met8Thr		158607168		Missense_Mutation	SNP	ENST00000302101.5	37	CCDS1204.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	0.766	-0.767465	0.02974	.	.	ENSG00000171786	ENST00000302101	D	0.95103	-3.61	4.05	2.92	0.33932	.	0.388550	0.22214	N	0.063057	T	0.63082	0.2481	N	0.02539	-0.55	0.26580	N	0.9734	B	0.02656	0.0	B	0.01281	0.0	T	0.60677	-0.7216	10	0.07325	T	0.83	-13.921	5.4804	0.16721	0.0:0.3134:0.0:0.6865	.	8	Q02575	HEN1_HUMAN	T	8	ENSP00000302189:M8T	ENSP00000302189:M8T	M	+	2	0	NHLH1	158607168	0.364000	0.24997	0.985000	0.45067	0.990000	0.78478	3.046000	0.49846	0.715000	0.32103	0.533000	0.62120	ATG		0.662	NHLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080676.1	NM_005598		Missense_Mutation
SCYL3	57147	broad.mit.edu	37	1	169825046	169825046	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:169825046C>G	ENST00000367770.1	-	11	1412	c.1365G>C	c.(1363-1365)ttG>ttC	p.L455F	SCYL3_ENST00000367772.4_Missense_Mutation_p.L455F|SCYL3_ENST00000367771.6_Intron			Q8IZE3	PACE1_HUMAN	SCY1-like 3 (S. cerevisiae)	455					cell migration (GO:0016477)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AGGGGTTCTCCAAGATTGGCG	0.423																																																0			1											91.0	85.0	87.0					1																	169825046		2203	4300	6503	168091670	SO:0001583	missense	57147			BC014662	CCDS1286.1, CCDS1287.1	1q24.2	2008-02-05			ENSG00000000457	ENSG00000000457			19285	protein-coding gene	gene with protein product	"""ezrin-binding partner PACE-1"""	608192				12651155	Standard	NM_020423		Approved	PACE-1, PACE1	uc001ggs.3	Q8IZE3	OTTHUMG00000035941	ENST00000367770.1:c.1365G>C	1.37:g.169825046C>G	ENSP00000356744:p.Leu455Phe		168091670	A8K8Z2|Q5THA6|Q5THA8|Q8IZN9|Q96C56|Q9UBK6	Missense_Mutation	SNP	ENST00000367770.1	37	CCDS1287.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	12.50	1.956752	0.34565	.	.	ENSG00000000457	ENST00000367772;ENST00000367770	T;T	0.16743	2.32;2.32	4.09	2.11	0.27256	.	1.027090	0.07716	N	0.942838	T	0.04543	0.0124	L	0.44542	1.39	0.19300	N	0.999977	P	0.41748	0.761	B	0.35413	0.202	T	0.37103	-0.9720	10	0.30078	T	0.28	-0.0126	6.1169	0.20132	0.0:0.7532:0.0:0.2468	.	455	Q8IZE3	PACE1_HUMAN	F	455	ENSP00000356746:L455F;ENSP00000356744:L455F	ENSP00000356744:L455F	L	-	3	2	SCYL3	168091670	0.067000	0.21026	0.229000	0.23960	0.177000	0.22998	0.642000	0.24735	0.612000	0.30071	-0.355000	0.07637	TTG		0.423	SCYL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087550.4	NM_181093		Missense_Mutation
PLD5	200150	broad.mit.edu	37	1	242253345	242253345	+	Silent	SNP	T	T	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:242253345T>G	ENST00000536534.2	-	10	1663	c.1422A>C	c.(1420-1422)gcA>gcC	p.A474A	PLD5_ENST00000442594.2_Silent_p.A382A|PLD5_ENST00000427495.1_Silent_p.A412A			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	474						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.A382A(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TCCTCACATCTGCCTGGTTGA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	1											177.0	163.0	168.0					1																	242253345		2203	4300	6503	240319968	SO:0001819	synonymous_variant	200150			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1422A>C	1.37:g.242253345T>G			240319968	A1KXV0|B7Z324|Q494U9|Q8NB22	Silent	SNP	ENST00000536534.2	37	CCDS1621.2	SNP	55	Broad																																																																																				0.418	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666		Silent
OR2W3	343171	broad.mit.edu	37	1	248059394	248059394	+	Missense_Mutation	SNP	G	G	A	rs12083024	byFrequency	TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr1:248059394G>A	ENST00000360358.3	+	1	506	c.506G>A	c.(505-507)tGt>tAt	p.C169Y	OR2W3_ENST00000537741.1_Missense_Mutation_p.C169Y	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	169			C -> S (in dbSNP:rs12083024).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C169Y(1)		breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TTACCCCGCTGTGGGCACCAC	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											100.0	78.0	85.0					1																	248059394		2203	4300	6503	246126017	SO:0001583	missense	343171			N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.506G>A	1.37:g.248059394G>A	ENSP00000353516:p.Cys169Tyr		246126017	Q6IF06|Q8NG86	Missense_Mutation	SNP	ENST00000360358.3	37	CCDS31099.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622609	0.46840	.	.	ENSG00000238243	ENST00000537741;ENST00000360358	T;T	0.00245	8.45;8.45	5.28	3.43	0.39272	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000003	T	0.00784	0.0026	H	0.94847	3.59	0.39419	D	0.966893	D	0.89917	1.0	D	0.85130	0.997	T	0.55915	-0.8065	10	0.87932	D	0	.	11.3607	0.49642	0.1473:0.0:0.8527:0.0	.	169	Q7Z3T1	OR2W3_HUMAN	Y	169	ENSP00000445853:C169Y;ENSP00000353516:C169Y	ENSP00000353516:C169Y	C	+	2	0	OR2W3	246126017	1.000000	0.71417	0.944000	0.38274	0.434000	0.31775	4.678000	0.61641	0.818000	0.34468	0.603000	0.83216	TGT		0.647	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		Missense_Mutation
PIK3AP1	118788	broad.mit.edu	37	10	98380198	98380198	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr10:98380198C>T	ENST00000339364.5	-	12	1971	c.1852G>A	c.(1852-1854)Ggc>Agc	p.G618S	RNA5SP324_ENST00000365177.1_RNA|PIK3AP1_ENST00000371110.2_Missense_Mutation_p.G440S|PIK3AP1_ENST00000371109.3_Missense_Mutation_p.G217S	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	618					negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)	p.G618S(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		TTGACAATGCCCAGCTTCACC	0.537																																																1	Substitution - Missense(1)	ovary(1)	10											123.0	112.0	116.0					10																	98380198		2203	4300	6503	98370188	SO:0001583	missense	118788			AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.1852G>A	10.37:g.98380198C>T	ENSP00000339826:p.Gly618Ser		98370188	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Missense_Mutation	SNP	ENST00000339364.5	37	CCDS31259.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.847464	0.97023	.	.	ENSG00000155629	ENST00000339364;ENST00000371110;ENST00000371109	T;T;T	0.40756	1.02;1.02;1.02	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.63224	0.2493	M	0.69823	2.125	0.80722	D	1	D;D	0.76494	0.997;0.999	P;P	0.60682	0.878;0.878	T	0.64441	-0.6407	10	0.72032	D	0.01	-26.1348	19.2253	0.93816	0.0:1.0:0.0:0.0	.	618;217	Q6ZUJ8;Q6ZUJ8-3	BCAP_HUMAN;.	S	618;440;217	ENSP00000339826:G618S;ENSP00000360151:G440S;ENSP00000360150:G217S	ENSP00000339826:G618S	G	-	1	0	PIK3AP1	98370188	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.752000	0.85141	2.788000	0.95919	0.555000	0.69702	GGC		0.537	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049619.2	NM_152309		Missense_Mutation
AHNAK	79026	broad.mit.edu	37	11	62293922	62293922	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr11:62293922G>A	ENST00000378024.4	-	5	8241	c.7967C>T	c.(7966-7968)cCa>cTa	p.P2656L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2656					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.P2656L(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ATCCCCATCTGGGCCCTCTCC	0.527																																																1	Substitution - Missense(1)	ovary(1)	11											177.0	179.0	179.0					11																	62293922		2202	4299	6501	62050498	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.7967C>T	11.37:g.62293922G>A	ENSP00000367263:p.Pro2656Leu		62050498	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	g	16.80	3.223200	0.58668	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.05717	3.4	4.19	4.19	0.49359	.	.	.	.	.	T	0.35682	0.0940	H	0.96996	3.92	0.39417	D	0.966843	D	0.89917	1.0	D	0.85130	0.997	T	0.53258	-0.8464	9	0.56958	D	0.05	-3.1894	11.426	0.50012	0.0:0.0:0.8191:0.1809	.	2656	Q09666	AHNK_HUMAN	L	745;2656	ENSP00000367263:P2656L	ENSP00000244934:P745L	P	-	2	0	AHNAK	62050498	1.000000	0.71417	0.989000	0.46669	0.829000	0.46940	5.576000	0.67437	1.882000	0.54519	0.479000	0.44913	CCA		0.527	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		Missense_Mutation
MRPL49	740	broad.mit.edu	37	11	64893239	64893239	+	Silent	SNP	G	G	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr11:64893239G>T	ENST00000279242.2	+	4	415	c.396G>T	c.(394-396)ctG>ctT	p.L132L	MRPL49_ENST00000531705.1_Intron|MRPL49_ENST00000534078.1_3'UTR|MRPL49_ENST00000524482.1_3'UTR	NM_004927.3	NP_004918.1	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49	132					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)	p.L132L(1)		endometrium(1)|ovary(1)	2						GCCCGCTGCTGGGGAAGACAC	0.532																																																1	Substitution - coding silent(1)	ovary(1)	11											100.0	104.0	103.0					11																	64893239		2201	4297	6498	64649815	SO:0001819	synonymous_variant	740				CCDS8096.1	11q13.1	2012-11-14	2001-10-16	2001-10-19	ENSG00000149792	ENSG00000149792		"""Mitochondrial ribosomal proteins / large subunits"""	1176	protein-coding gene	gene with protein product	"""neighbor of FAU"", ""next to FAU"""	606866	"""chromosome 11 open reading frame 4"""	C11orf4		8786148	Standard	NM_004927		Approved	NOF, NOF1, L49mt	uc001oda.2	Q13405	OTTHUMG00000165608	ENST00000279242.2:c.396G>T	11.37:g.64893239G>T			64649815	B2R4G6	Silent	SNP	ENST00000279242.2	37	CCDS8096.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	9.163	1.019171	0.19355	.	.	ENSG00000149792	ENST00000533943	.	.	.	5.62	2.48	0.30137	.	.	.	.	.	T	0.47210	0.1433	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38802	-0.9644	4	.	.	.	-21.5256	4.3838	0.11307	0.0818:0.2845:0.487:0.1466	.	.	.	.	W	93	.	.	G	+	1	0	MRPL49	64649815	0.962000	0.33011	1.000000	0.80357	0.921000	0.55340	0.139000	0.16036	1.372000	0.46190	0.505000	0.49811	GGG		0.532	MRPL49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385293.1	NM_004927		Silent
C2CD3	26005	broad.mit.edu	37	11	73834106	73834106	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr11:73834106A>G	ENST00000334126.7	-	8	1518	c.1292T>C	c.(1291-1293)gTg>gCg	p.V431A	C2CD3_ENST00000313663.7_Missense_Mutation_p.V431A			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	431					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)		p.V431A(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GATGCAATACACATCACTCCC	0.453																																																1	Substitution - Missense(1)	ovary(1)	11											80.0	79.0	79.0					11																	73834106		2200	4293	6493	73511754	SO:0001583	missense	26005			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1292T>C	11.37:g.73834106A>G	ENSP00000334379:p.Val431Ala		73511754	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37		SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	11.55	1.671228	0.29693	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.13420	2.59;2.61	5.52	-0.098	0.13630	.	0.377637	0.26352	N	0.024861	T	0.09862	0.0242	L	0.45581	1.43	0.80722	D	1	B;B	0.22080	0.064;0.018	B;B	0.17722	0.019;0.016	T	0.16217	-1.0410	10	0.32370	T	0.25	-0.6089	5.4423	0.16515	0.6338:0.0:0.1432:0.223	.	431;431	Q4AC94;Q4AC94-1	C2CD3_HUMAN;.	A	431	ENSP00000334379:V431A;ENSP00000323339:V431A	ENSP00000323339:V431A	V	-	2	0	C2CD3	73511754	0.994000	0.37717	0.993000	0.49108	0.946000	0.59487	2.737000	0.47393	0.045000	0.15804	0.459000	0.35465	GTG		0.453	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531		Missense_Mutation
FAT3	120114	broad.mit.edu	37	11	92577313	92577313	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr11:92577313A>T	ENST00000298047.6	+	18	10797	c.10780A>T	c.(10780-10782)Agc>Tgc	p.S3594C	FAT3_ENST00000533797.1_5'Flank|FAT3_ENST00000525166.1_Missense_Mutation_p.S3444C|FAT3_ENST00000409404.2_Missense_Mutation_p.S3594C			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3594	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S169C(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGAGCAGAAAAGCTTATTTAA	0.483										TCGA Ovarian(4;0.039)																																						1	Substitution - Missense(1)	ovary(1)	11											174.0	178.0	177.0					11																	92577313		2039	4201	6240	92216961	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.10780A>T	11.37:g.92577313A>T	ENSP00000298047:p.Ser3594Cys		92216961	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	16.30	3.085347	0.55861	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.09255	3.0;3.0;3.0	5.82	5.82	0.92795	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.35189	0.0923	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;0.993	D;P	0.74348	0.983;0.848	T	0.08146	-1.0736	9	0.62326	D	0.03	.	16.1778	0.81874	1.0:0.0:0.0:0.0	.	3594;3594	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	C	3594;3594;3444	ENSP00000298047:S3594C;ENSP00000387040:S3594C;ENSP00000432586:S3444C	ENSP00000298047:S3594C	S	+	1	0	FAT3	92216961	1.000000	0.71417	0.990000	0.47175	0.783000	0.44284	4.233000	0.58651	2.225000	0.72522	0.459000	0.35465	AGC		0.483	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		Missense_Mutation
TMPRSS4	56649	broad.mit.edu	37	11	117978571	117978571	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr11:117978571C>T	ENST00000437212.3	+	6	737	c.523C>T	c.(523-525)Cgc>Tgc	p.R175C	TMPRSS4_ENST00000522824.1_Missense_Mutation_p.R170C|TMPRSS4_ENST00000534111.1_Missense_Mutation_p.R173C|TMPRSS4_ENST00000522307.1_Missense_Mutation_p.R28C|TMPRSS4_ENST00000523251.1_Missense_Mutation_p.R135C			Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4	175	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.R175C(2)		breast(2)|central_nervous_system(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		CCAGGAGCTTCGCATGCGGAA	0.542																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	11											72.0	64.0	67.0					11																	117978571		2200	4296	6496	117483781	SO:0001583	missense	56649			AF179224	CCDS31684.1, CCDS44743.1, CCDS53716.1, CCDS53717.1	11q23.3	2010-04-13			ENSG00000137648	ENSG00000137648		"""Serine peptidases / Transmembrane"""	11878	protein-coding gene	gene with protein product	"""transmembrane serine protease 3"", ""membrane-type serine protease 2"", ""type II membrane serine protease"""	606565				10825129	Standard	NM_001083947		Approved	TMPRSS3, MT-SP2	uc021qrd.1	Q9NRS4	OTTHUMG00000164122	ENST00000437212.3:c.523C>T	11.37:g.117978571C>T	ENSP00000416037:p.Arg175Cys		117483781	A8MU84|B0YJB0|B7Z8C5|E7ERX8|Q5XKQ6|Q6UX37|Q9NZA5	Missense_Mutation	SNP	ENST00000437212.3	37	CCDS31684.1	SNP	31	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.98|12.98	2.100554|2.100554	0.37048|0.37048	.|.	.|.	ENSG00000137648|ENSG00000137648	ENST00000534111;ENST00000522307;ENST00000523251;ENST00000437212;ENST00000522824;ENST00000522151|ENST00000517544	T;D;T;T;T;T|.	0.88896|.	0.74;-2.44;0.74;0.74;0.74;0.74|.	5.31|5.31	5.31|5.31	0.75309|0.75309	Speract/scavenger receptor-related (2);|.	0.611504|.	0.15422|.	N|.	0.263216|.	T|T	0.41396|0.41396	0.1157|0.1157	L|L	0.34521|0.34521	1.04|1.04	0.23754|0.23754	N|N	0.996939|0.996939	D;D;D;P;D|.	0.62365|.	0.964;0.978;0.991;0.951;0.987|.	B;B;B;B;P|.	0.46825|.	0.232;0.328;0.328;0.394;0.528|.	T|T	0.30995|0.30995	-0.9959|-0.9959	10|5	0.40728|.	T|.	0.16|.	.|.	14.4689|14.4689	0.67501|0.67501	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	150;135;28;175;173|.	B7Z900;E7ERX8;E7ESG9;Q9NRS4;Q9NRS4-3|.	.;.;.;TMPS4_HUMAN;.|.	C|L	173;28;135;175;170;122|141	ENSP00000435184:R173C;ENSP00000428814:R28C;ENSP00000429209:R135C;ENSP00000416037:R175C;ENSP00000430547:R170C;ENSP00000428407:R122C|.	ENSP00000416037:R175C|.	R|S	+|+	1|2	0|0	TMPRSS4|TMPRSS4	117483781|117483781	0.997000|0.997000	0.39634|0.39634	0.943000|0.943000	0.38184|0.38184	0.040000|0.040000	0.13550|0.13550	3.827000|3.827000	0.55745|0.55745	2.472000|2.472000	0.83506|0.83506	0.585000|0.585000	0.79938|0.79938	CGC|TCG		0.542	TMPRSS4-004	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377328.2	NM_019894		Missense_Mutation
TECTA	7007	broad.mit.edu	37	11	121031006	121031006	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr11:121031006G>T	ENST00000392793.1	+	15	5123	c.4852G>T	c.(4852-4854)Gtg>Ttg	p.V1618L	TECTA_ENST00000264037.2_Missense_Mutation_p.V1618L			O75443	TECTA_HUMAN	tectorin alpha	1618	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.V1618L(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GCAGAACAAAGTGTGCGGTCT	0.517																																																1	Substitution - Missense(1)	ovary(1)	11											131.0	126.0	128.0					11																	121031006		2203	4299	6502	120536216	SO:0001583	missense	7007			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4852G>T	11.37:g.121031006G>T	ENSP00000376543:p.Val1618Leu		120536216		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	18.76	3.693268	0.68386	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.60424	0.19;0.19	4.77	4.77	0.60923	von Willebrand factor, type D domain (3);	0.000000	0.64402	D	0.000002	T	0.61148	0.2324	N	0.11927	0.2	0.49051	D	0.999749	D	0.69078	0.997	D	0.80764	0.994	T	0.67669	-0.5611	10	0.51188	T	0.08	.	17.9956	0.89182	0.0:0.0:1.0:0.0	.	1618	O75443	TECTA_HUMAN	L	1618	ENSP00000376543:V1618L;ENSP00000264037:V1618L	ENSP00000264037:V1618L	V	+	1	0	TECTA	120536216	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.606000	0.82863	2.461000	0.83175	0.655000	0.94253	GTG		0.517	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422		Missense_Mutation
SLC38A4	55089	broad.mit.edu	37	12	47170716	47170716	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr12:47170716G>A	ENST00000447411.1	-	12	1351	c.1145C>T	c.(1144-1146)gCc>gTc	p.A382V	SLC38A4_ENST00000266579.4_Missense_Mutation_p.A382V	NM_001143824.1	NP_001137296.1	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	382					amino acid transport (GO:0006865)|ion transport (GO:0006811)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)	p.A382V(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	21	Lung SC(27;0.192)|Renal(347;0.236)					AAAGAGGGCGGCAAGCAGGTA	0.458																																																1	Substitution - Missense(1)	ovary(1)	12											124.0	123.0	124.0					12																	47170716		2203	4299	6502	45456983	SO:0001583	missense	55089			AF193836	CCDS8750.1	12q13	2013-05-22				ENSG00000139209		"""Solute carriers"""	14679	protein-coding gene	gene with protein product		608065				11414754	Standard	NM_018018		Approved	PAAT, NAT3, ATA3	uc001rpj.2	Q969I6		ENST00000447411.1:c.1145C>T	12.37:g.47170716G>A	ENSP00000389843:p.Ala382Val		45456983	A8K553	Missense_Mutation	SNP	ENST00000447411.1	37	CCDS8750.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.241513	0.95272	.	.	ENSG00000139209	ENST00000447411;ENST00000266579	T;T	0.01947	4.54;4.54	5.96	5.06	0.68205	.	0.169298	0.53938	N	0.000053	T	0.08802	0.0218	L	0.55213	1.73	0.58432	D	0.999993	D	0.63046	0.992	D	0.75484	0.986	T	0.46992	-0.9151	10	0.18710	T	0.47	-8.5361	15.0381	0.71764	0.068:0.0:0.932:0.0	.	382	Q969I6	S38A4_HUMAN	V	382	ENSP00000389843:A382V;ENSP00000266579:A382V	ENSP00000266579:A382V	A	-	2	0	SLC38A4	45456983	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	8.027000	0.88791	1.521000	0.48983	0.655000	0.94253	GCC		0.458	SLC38A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404574.1			Missense_Mutation
KMT2D	8085	broad.mit.edu	37	12	49437653	49437653	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-0979-01	TCGA-24-0979-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr12:49437653G>A	ENST00000301067.7	-	22	5316	c.5317C>T	c.(5317-5319)Cag>Tag	p.Q1773*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1773					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q1503*(1)									AGACCCACCTGCAAGTAAGCA	0.562											OREG0021780	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Nonsense(1)	ovary(1)	12											143.0	153.0	150.0					12																	49437653		2131	4223	6354	47723920	SO:0001587	stop_gained	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.5317C>T	12.37:g.49437653G>A	ENSP00000301067:p.Gln1773*	962	47723920	O14687	Nonsense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	43	10.384382	0.99395	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.19	5.19	0.71726	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.4916	0.87705	0.0:0.0:1.0:0.0	.	.	.	.	X	1773	.	ENSP00000301067:Q1773X	Q	-	1	0	MLL2	47723920	1.000000	0.71417	1.000000	0.80357	0.214000	0.24535	9.537000	0.98070	2.411000	0.81874	0.563000	0.77884	CAG		0.562	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			Nonsense_Mutation
SCN8A	6334	broad.mit.edu	37	12	52200932	52200932	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr12:52200932A>T	ENST00000354534.6	+	27	5840	c.5662A>T	c.(5662-5664)Acc>Tcc	p.T1888S	RP11-923I11.3_ENST00000565518.1_lincRNA|AC068987.1_ENST00000599343.1_5'Flank|SCN8A_ENST00000545061.1_Missense_Mutation_p.T1847S	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1888					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.T1888S(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	GCCAATCACAACCACACTGCG	0.572																																																1	Substitution - Missense(1)	ovary(1)	12											131.0	138.0	136.0					12																	52200932		2078	4224	6302	50487199	SO:0001583	missense	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.5662A>T	12.37:g.52200932A>T	ENSP00000346534:p.Thr1888Ser		50487199	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	13.83	2.353706	0.41700	.	.	ENSG00000196876	ENST00000354534;ENST00000545061	D;D	0.96522	-4.04;-3.97	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.92896	0.7740	L	0.33093	0.98	0.80722	D	1	P	0.46220	0.874	B	0.40702	0.338	D	0.92195	0.5763	10	0.29301	T	0.29	.	15.2553	0.73579	1.0:0.0:0.0:0.0	.	1888	Q9UQD0	SCN8A_HUMAN	S	1888;1847	ENSP00000346534:T1888S;ENSP00000440360:T1847S	ENSP00000346534:T1888S	T	+	1	0	SCN8A	50487199	1.000000	0.71417	0.995000	0.50966	0.951000	0.60555	9.139000	0.94554	2.254000	0.74563	0.533000	0.62120	ACC		0.572	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191		Missense_Mutation
ACVR1B	91	broad.mit.edu	37	12	52377951	52377951	+	Splice_Site	SNP	G	G	C			TCGA-24-0979-01	TCGA-24-0979-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr12:52377951G>C	ENST00000257963.4	+	5	1056		c.e5+1		ACVR1B_ENST00000541224.1_Splice_Site|ACVR1B_ENST00000426655.2_Splice_Site|ACVR1B_ENST00000542485.1_Splice_Site|ACVR1B_ENST00000415850.2_Splice_Site|ACVR1B_ENST00000563121.1_Splice_Site	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB						activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.?(1)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	GGCACCCAAGGTGAGTGGACT	0.537																																																1	Unknown(1)	ovary(1)	12											82.0	65.0	70.0					12																	52377951		2203	4300	6503	50664218	SO:0001630	splice_region_variant	91				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.979+1G>C	12.37:g.52377951G>C			50664218	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Splice_Site_SNP	SNP	ENST00000257963.4	37	CCDS8816.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972391	0.53614	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5039	0.95106	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACVR1B	50664218	1.000000	0.71417	1.000000	0.80357	0.390000	0.30446	9.827000	0.99397	2.692000	0.91855	0.655000	0.94253	.		0.537	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	Intron	Splice_Site_SNP
NCKAP1L	3071	broad.mit.edu	37	12	54911344	54911344	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr12:54911344T>C	ENST00000293373.6	+	12	1202	c.1123T>C	c.(1123-1125)Ttc>Ctc	p.F375L	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.F325L	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	375					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)	p.F375L(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						GGCCCTGTCCTTCATTCGTGA	0.443																																																1	Substitution - Missense(1)	ovary(1)	12											111.0	98.0	102.0					12																	54911344		2203	4300	6503	53197611	SO:0001583	missense	3071			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.1123T>C	12.37:g.54911344T>C	ENSP00000293373:p.Phe375Leu		53197611	B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	37	CCDS31813.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	28.2	4.901957	0.92035	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.26373	1.74;1.74	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.41213	0.1149	L	0.47016	1.485	0.53005	D	0.999969	D	0.69078	0.997	D	0.77004	0.989	T	0.11941	-1.0567	10	0.15499	T	0.54	-19.3442	14.1012	0.65056	0.0:0.0:0.0:1.0	.	375	P55160	NCKPL_HUMAN	L	375;325	ENSP00000293373:F375L;ENSP00000445596:F325L	ENSP00000293373:F375L	F	+	1	0	NCKAP1L	53197611	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.710000	0.84655	2.217000	0.71921	0.379000	0.24179	TTC		0.443	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337		Missense_Mutation
NACA	4666	broad.mit.edu	37	12	57111914	57111914	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr12:57111914G>A	ENST00000454682.1	-	3	3681	c.3400C>T	c.(3400-3402)Ccc>Tcc	p.P1134S	NACA_ENST00000550952.1_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000552540.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000551793.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1134	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						TTTGGGGAGGGAGGAGTTGCA	0.637			T	BCL6	NHL																																		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0			12											59.0	57.0	58.0					12																	57111914		1271	2785	4056	55398181	SO:0001583	missense	4666			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.3400C>T	12.37:g.57111914G>A	ENSP00000403817:p.Pro1134Ser		55398181		Missense_Mutation	SNP	ENST00000454682.1	37		SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	N	5.214	0.225062	0.09916	.	.	ENSG00000196531	ENST00000454682	T	0.46063	0.88	2.84	-4.41	0.03590	.	.	.	.	.	T	0.19886	0.0478	.	.	.	0.09310	N	1	B	0.20671	0.047	B	0.18263	0.021	T	0.25152	-1.0140	7	.	.	.	.	5.3408	0.15982	0.0:0.3043:0.3347:0.361	.	1134	E9PAV3	.	S	1134	ENSP00000403817:P1134S	.	P	-	1	0	NACA	55398181	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.108000	0.10857	-0.298000	0.08921	0.289000	0.19496	CCC		0.637	NACA-201	KNOWN	basic	protein_coding	protein_coding		NM_005594		Missense_Mutation
XPOT	11260	broad.mit.edu	37	12	64814261	64814261	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr12:64814261G>C	ENST00000332707.5	+	8	1332	c.803G>C	c.(802-804)tGt>tCt	p.C268S		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	268	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.C268S(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		GAATCTTTGTGTCAAGTATTA	0.343																																																1	Substitution - Missense(1)	ovary(1)	12											102.0	107.0	105.0					12																	64814261		2203	4299	6502	63100528	SO:0001583	missense	11260			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.803G>C	12.37:g.64814261G>C	ENSP00000327821:p.Cys268Ser		63100528	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	37	CCDS31852.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289968	0.59976	.	.	ENSG00000184575	ENST00000332707	T	0.20463	2.07	4.89	4.89	0.63831	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.16981	0.0408	N	0.25647	0.755	0.80722	D	1	B	0.20368	0.044	B	0.13407	0.009	T	0.06180	-1.0841	9	.	.	.	.	18.9398	0.92601	0.0:0.0:1.0:0.0	.	268	O43592	XPOT_HUMAN	S	268	ENSP00000327821:C268S	.	C	+	2	0	XPOT	63100528	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.655000	0.98512	2.649000	0.89929	0.655000	0.94253	TGT		0.343	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235		Missense_Mutation
GOLGA3	2802	broad.mit.edu	37	12	133365624	133365624	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr12:133365624T>C	ENST00000450791.2	-	12	2983	c.2800A>G	c.(2800-2802)Aca>Gca	p.T934A	GOLGA3_ENST00000537452.1_Missense_Mutation_p.T934A|GOLGA3_ENST00000545875.1_Missense_Mutation_p.T934A|GOLGA3_ENST00000456883.2_Missense_Mutation_p.T934A|GOLGA3_ENST00000204726.3_Missense_Mutation_p.T934A			Q08378	GOGA3_HUMAN	golgin A3	934					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.T934A(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TGCAAGTGTGTTTCCATCTCG	0.632																																																1	Substitution - Missense(1)	ovary(1)	12											104.0	90.0	94.0					12																	133365624		2203	4300	6503	131875697	SO:0001583	missense	2802			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.2800A>G	12.37:g.133365624T>C	ENSP00000410378:p.Thr934Ala		131875697	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	CCDS9281.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	11.68	1.710461	0.30322	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.31769	1.9;1.9;1.91;1.48;1.48	4.91	3.76	0.43208	.	0.385092	0.31031	N	0.008384	T	0.26011	0.0634	M	0.63843	1.955	0.80722	D	1	B;B;B	0.21147	0.052;0.007;0.015	B;B;B	0.16289	0.015;0.01;0.009	T	0.05566	-1.0877	10	0.11485	T	0.65	.	8.6234	0.33875	0.0:0.1577:0.0:0.8423	.	934;934;934	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	A	934	ENSP00000204726:T934A;ENSP00000410378:T934A;ENSP00000409303:T934A;ENSP00000442143:T934A;ENSP00000442603:T934A	ENSP00000204726:T934A	T	-	1	0	GOLGA3	131875697	0.008000	0.16893	0.747000	0.31113	0.814000	0.46013	0.743000	0.26231	0.838000	0.34948	0.383000	0.25322	ACA		0.632	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895		Missense_Mutation
ELF1	1997	broad.mit.edu	37	13	41517221	41517221	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0979-01	TCGA-24-0979-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr13:41517221G>C	ENST00000239882.3	-	7	987	c.673C>G	c.(673-675)Cct>Gct	p.P225A	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.P201A	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	225					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P225A(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		ATGTATTTAGGACAAGTAGCC	0.393																																																1	Substitution - Missense(1)	ovary(1)	13											87.0	83.0	84.0					13																	41517221		2203	4300	6503	40415221	SO:0001583	missense	1997			M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.673C>G	13.37:g.41517221G>C	ENSP00000239882:p.Pro225Ala		40415221	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	ENST00000239882.3	37	CCDS9374.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	28.8	4.948483	0.92593	.	.	ENSG00000120690	ENST00000442101;ENST00000239882	T;T	0.53857	0.6;0.6	5.76	5.76	0.90799	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (3);	0.000000	0.85682	D	0.000000	T	0.69646	0.3134	L	0.49513	1.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.67921	-0.5545	10	0.51188	T	0.08	.	19.9694	0.97278	0.0:0.0:1.0:0.0	.	201;225	E9PDQ9;P32519	.;ELF1_HUMAN	A	201;225	ENSP00000405580:P201A;ENSP00000239882:P225A	ENSP00000239882:P225A	P	-	1	0	ELF1	40415221	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.869000	0.99810	2.719000	0.93026	0.655000	0.94253	CCT		0.393	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	NM_172373		Missense_Mutation
OXGR1	27199	broad.mit.edu	37	13	97639139	97639140	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr13:97639139_97639140GC>AA	ENST00000298440.1	-	4	1117_1118	c.874_875GC>TT	c.(874-876)GCt>TTt	p.A292F	OXGR1_ENST00000543457.1_Missense_Mutation_p.A292F	NM_080818.3	NP_543008.3	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	292					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A292F(1)		NS(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			GGTGTTCAGAGCAGCTAATGGT	0.45																																																1	Substitution - Missense(1)	ovary(1)	13																																								96437141	SO:0001583	missense	27199			AF411109	CCDS9482.1	13q32.2	2014-04-09	2004-07-08	2004-07-09	ENSG00000165621	ENSG00000165621		"""GPCR / Class A : Orphans"""	4531	protein-coding gene	gene with protein product	"""2-oxoglutarate receptor 1"", ""alpha-ketoglutarate receptor 1"""	606922	"""G protein-coupled receptor 80"""	GPR99, GPR80		15141213, 12098360	Standard	NM_080818		Approved	P2RY15, P2Y15, aKGR	uc001vmx.1	Q96P68	OTTHUMG00000017236	ENST00000298440.1:c.874_875delinsAA	13.37:g.97639139_97639140delinsAA	ENSP00000298440:p.Ala292Phe		96437140	Q5T5A7|Q86TL1	Missense_Mutation	DNP	ENST00000298440.1	37	CCDS9482.1	DNP	34	Broad																																																																																				0.450	OXGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045521.3	NM_080818		Missense_Mutation
EDDM3B	64184	broad.mit.edu	37	14	21238385	21238385	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr14:21238385A>G	ENST00000326783.3	+	2	174	c.76A>G	c.(76-78)Aaa>Gaa	p.K26E		NM_022360.4	NP_071755.1	P56851	EP3B_HUMAN	epididymal protein 3B	26						extracellular region (GO:0005576)		p.K26E(1)		central_nervous_system(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						TGTACAGAGCAAAGAAGTTTC	0.473																																																1	Substitution - Missense(1)	ovary(1)	14											75.0	75.0	75.0					14																	21238385		2203	4300	6503	20308225	SO:0001583	missense	64184			X76386	CCDS9557.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181552	ENSG00000181552			19223	protein-coding gene	gene with protein product		611582	"""family with sequence similarity 12, member B (epididymal)"""	FAM12B		7514008	Standard	NM_022360		Approved	HE3-BETA	uc001vyd.3	P56851	OTTHUMG00000029583	ENST00000326783.3:c.76A>G	14.37:g.21238385A>G	ENSP00000314810:p.Lys26Glu		20308225	A0PK89	Missense_Mutation	SNP	ENST00000326783.3	37	CCDS9557.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	0.016	-1.539388	0.00942	.	.	ENSG00000181552	ENST00000326783	T	0.28454	1.61	3.68	-3.86	0.04230	Ribonuclease A, domain (2);	0.925329	0.08949	N	0.870413	T	0.15003	0.0362	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26849	-1.0091	10	0.39692	T	0.17	.	6.9247	0.24408	0.1887:0.3977:0.4135:0.0	.	26	P56851	EP3B_HUMAN	E	26	ENSP00000314810:K26E	ENSP00000314810:K26E	K	+	1	0	EDDM3B	20308225	0.008000	0.16893	0.002000	0.10522	0.010000	0.07245	-0.500000	0.06405	-0.514000	0.06488	-0.379000	0.06801	AAA		0.473	EDDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073745.2			Missense_Mutation
SLC39A2	29986	broad.mit.edu	37	14	21469412	21469412	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr14:21469412C>T	ENST00000298681.4	+	4	761	c.604C>T	c.(604-606)Cat>Tat	p.H202Y	RP11-84C10.4_ENST00000557335.1_RNA|SLC39A2_ENST00000554422.1_3'UTR	NM_014579.3	NP_055394.2	Q9NP94	S39A2_HUMAN	solute carrier family 39 (zinc transporter), member 2	202					transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)	p.H202Y(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	14	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0187)		TGTCCTGGCTCATAAGGGGCT	0.527																																																1	Substitution - Missense(1)	ovary(1)	14											140.0	117.0	125.0					14																	21469412		2203	4300	6503	20539252	SO:0001583	missense	29986			AF186081	CCDS9563.1, CCDS58303.1	14q11.1	2013-05-22			ENSG00000165794	ENSG00000165794		"""Solute carriers"""	17127	protein-coding gene	gene with protein product		612166				10681536, 7751801	Standard	NM_014579		Approved	ZIP2	uc001vyr.3	Q9NP94	OTTHUMG00000029616	ENST00000298681.4:c.604C>T	14.37:g.21469412C>T	ENSP00000298681:p.His202Tyr		20539252	B2RC76|G3V5X2|Q4QQJ1|Q4V9S4|Q96JT6|Q9UD20	Missense_Mutation	SNP	ENST00000298681.4	37	CCDS9563.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	24.5	4.536416	0.85812	.	.	ENSG00000165794	ENST00000298681	T	0.74737	-0.87	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.89619	0.6767	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91639	0.5325	10	0.87932	D	0	-9.9851	17.3289	0.87257	0.0:1.0:0.0:0.0	.	202	Q9NP94	S39A2_HUMAN	Y	202	ENSP00000298681:H202Y	ENSP00000298681:H202Y	H	+	1	0	SLC39A2	20539252	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.123000	0.77176	2.687000	0.91594	0.655000	0.94253	CAT		0.527	SLC39A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073829.2	NM_014579		Missense_Mutation
MLH3	27030	broad.mit.edu	37	14	75514887	75514887	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr14:75514887A>G	ENST00000556740.1	-	1	1507	c.1472T>C	c.(1471-1473)tTc>tCc	p.F491S	MLH3_ENST00000380968.2_5'UTR|MLH3_ENST00000555671.1_5'Flank|MLH3_ENST00000355774.2_Missense_Mutation_p.F491S|MLH3_ENST00000238662.7_Missense_Mutation_p.F491S|MLH3_ENST00000544985.1_5'Flank|MLH3_ENST00000556257.1_Missense_Mutation_p.F491S			Q9UHC1	MLH3_HUMAN	mutL homolog 3	491					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)	p.F491S(1)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		ATGTTCCAGGAAAGATTTTTT	0.378								Mismatch excision repair (MMR)																																								1	Substitution - Missense(1)	ovary(1)	14											89.0	97.0	94.0					14																	75514887		2203	4299	6502	74584640	SO:0001583	missense	27030			AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.1472T>C	14.37:g.75514887A>G	ENSP00000452316:p.Phe491Ser		74584640	P49751|Q56DK9|Q9P292|Q9UHC0	Missense_Mutation	SNP	ENST00000556740.1	37	CCDS32123.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	C	9.461	1.092991	0.20471	.	.	ENSG00000119684	ENST00000355774;ENST00000238662;ENST00000556257;ENST00000556740	T;T;T;T	0.79554	-1.24;-1.24;-1.28;-1.24	5.34	1.05	0.20165	.	0.909482	0.09557	N	0.786102	T	0.58977	0.2160	N	0.14661	0.345	0.09310	N	1	B;B	0.19817	0.039;0.0	B;B	0.18871	0.023;0.0	T	0.40384	-0.9566	10	0.15499	T	0.54	7.7872	2.0853	0.03644	0.386:0.3415:0.1196:0.1529	.	491;491	Q9UHC1-2;Q9UHC1	.;MLH3_HUMAN	S	491	ENSP00000348020:F491S;ENSP00000238662:F491S;ENSP00000451540:F491S;ENSP00000452316:F491S	ENSP00000238662:F491S	F	-	2	0	MLH3	74584640	0.000000	0.05858	0.104000	0.21259	0.340000	0.28889	0.178000	0.16820	-0.023000	0.13963	-0.195000	0.12781	TTC		0.378	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381		Missense_Mutation
CACNA1H	8912	broad.mit.edu	37	16	1250529	1250529	+	Silent	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr16:1250529C>T	ENST00000348261.5	+	7	1325	c.1077C>T	c.(1075-1077)atC>atT	p.I359I	CACNA1H_ENST00000565831.1_Silent_p.I359I|CACNA1H_ENST00000358590.4_Silent_p.I359I	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	359					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)	p.I359I(1)		breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	ACGGTGCCATCAACTTCGACA	0.652																																																1	Substitution - coding silent(1)	ovary(1)	16											58.0	63.0	61.0					16																	1250529		2130	4217	6347	1190530	SO:0001819	synonymous_variant	8912			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.1077C>T	16.37:g.1250529C>T			1190530	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	ENST00000348261.5	37	CCDS45375.1	SNP	29	Broad																																																																																				0.652	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407		Silent
FBXO39	162517	broad.mit.edu	37	17	6683691	6683691	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr17:6683691C>A	ENST00000321535.4	+	2	634	c.504C>A	c.(502-504)aaC>aaA	p.N168K		NM_153230.2	NP_694962.1	Q8N4B4	FBX39_HUMAN	F-box protein 39	168								p.N168K(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	26						ATTATCTCAACCTAAAAGGGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	17											55.0	55.0	55.0					17																	6683691		2203	4300	6503	6624415	SO:0001583	missense	162517			BC034782	CCDS11082.1	17p13.2	2014-01-21			ENSG00000177294	ENSG00000177294		"""F-boxes /  ""other"""""	28565	protein-coding gene	gene with protein product		609106				12477932	Standard	NM_153230		Approved	MGC35179, Fbx39, CT144	uc010vtg.2	Q8N4B4	OTTHUMG00000102062	ENST00000321535.4:c.504C>A	17.37:g.6683691C>A	ENSP00000321386:p.Asn168Lys		6624415		Missense_Mutation	SNP	ENST00000321535.4	37	CCDS11082.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	10.85	1.465685	0.26335	.	.	ENSG00000177294	ENST00000321535	T	0.54279	0.58	5.63	3.61	0.41365	.	0.244954	0.35555	N	0.003139	T	0.34890	0.0913	L	0.27053	0.805	0.28751	N	0.90141	B	0.27823	0.19	B	0.24155	0.051	T	0.19353	-1.0308	10	0.27082	T	0.32	-30.9098	9.2183	0.37362	0.0:0.8241:0.0:0.1759	.	168	Q8N4B4	FBX39_HUMAN	K	168	ENSP00000321386:N168K	ENSP00000321386:N168K	N	+	3	2	FBXO39	6624415	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	1.870000	0.39529	1.530000	0.49136	0.650000	0.86243	AAC		0.512	FBXO39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219866.2	NM_153230		Missense_Mutation
SLC47A2	146802	broad.mit.edu	37	17	19610043	19610043	+	Silent	SNP	G	G	T	rs529520024		TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr17:19610043G>T	ENST00000325411.5	-	9	917	c.867C>A	c.(865-867)ggC>ggA	p.G289G	SLC47A2_ENST00000350657.5_Silent_p.G253G|SLC47A2_ENST00000463318.1_5'UTR	NM_152908.3	NP_690872.2	Q86VL8	S47A2_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 2	289					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antiporter activity (GO:0015297)|drug transmembrane transporter activity (GO:0015238)	p.G289G(1)		endometrium(2)|kidney(3)|large_intestine(2)|lung(1)|ovary(1)	9	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)				Aciclovir(DB00787)	AGAAGAAGGGGCCCCAGTCCT	0.612																																																1	Substitution - coding silent(1)	ovary(1)	17											84.0	77.0	79.0					17																	19610043		2203	4300	6503	19550635	SO:0001819	synonymous_variant	146802			AB250364	CCDS11211.1, CCDS58530.1	17p11.2	2013-07-17	2013-07-17		ENSG00000180638	ENSG00000180638		"""Solute carriers"""	26439	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 2"""	609833				16996621, 16807400	Standard	NM_152908		Approved	FLJ31196, MATE2, MATE2-K	uc002gwf.4	Q86VL8	OTTHUMG00000059464	ENST00000325411.5:c.867C>A	17.37:g.19610043G>T			19550635	A0JBX9|A0P8Z7|Q63HJ9|Q8IV44|Q96NA1	Silent	SNP	ENST00000325411.5	37	CCDS11211.1	SNP	42	Broad																																																																																				0.612	SLC47A2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132242.2	NM_152908		Silent
FAM134C	162427	broad.mit.edu	37	17	40737233	40737233	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr17:40737233C>T	ENST00000309428.5	-	6	696	c.637G>A	c.(637-639)Gat>Aat	p.D213N	FAM134C_ENST00000543197.1_Missense_Mutation_p.D18N|FAM134C_ENST00000585894.1_Missense_Mutation_p.D116N	NM_178126.3	NP_835227.1	Q86VR2	F134C_HUMAN	family with sequence similarity 134, member C	213						integral component of membrane (GO:0016021)		p.D213N(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.134)		TATGCTCGATCCCACAGTCGG	0.522																																																1	Substitution - Missense(1)	ovary(1)	17											87.0	65.0	72.0					17																	40737233		2203	4300	6503	37990759	SO:0001583	missense	162427			BC049370	CCDS11432.1	17q21.2	2007-05-01							27258	protein-coding gene	gene with protein product						12477932	Standard	NM_178126		Approved	DKFZp686B1036, FLJ33806	uc002ial.2	Q86VR2		ENST00000309428.5:c.637G>A	17.37:g.40737233C>T	ENSP00000309432:p.Asp213Asn		37990759	B3KR75	Missense_Mutation	SNP	ENST00000309428.5	37	CCDS11432.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072892	0.76415	.	.	ENSG00000141699	ENST00000309428;ENST00000543197	T;T	0.45668	0.89;0.89	6.17	4.15	0.48705	.	0.257573	0.47852	N	0.000212	T	0.22044	0.0531	N	0.08118	0	0.36623	D	0.875865	B	0.06786	0.001	B	0.08055	0.003	T	0.11494	-1.0585	10	0.41790	T	0.15	-9.2111	9.1277	0.36826	0.0:0.5764:0.3362:0.0874	.	213	Q86VR2	F134C_HUMAN	N	213;18	ENSP00000309432:D213N;ENSP00000446235:D18N	ENSP00000309432:D213N	D	-	1	0	FAM134C	37990759	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.839000	0.75364	1.627000	0.50400	0.655000	0.94253	GAT		0.522	FAM134C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450536.1	NM_178126		Missense_Mutation
WNK4	65266	broad.mit.edu	37	17	40948560	40948560	+	Missense_Mutation	SNP	C	C	G	rs569324622		TCGA-24-0979-01	TCGA-24-0979-10			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr17:40948560C>G	ENST00000246914.5	+	18	3714	c.3693C>G	c.(3691-3693)agC>agG	p.S1231R	CNTD1_ENST00000588527.1_5'Flank|CNTD1_ENST00000588408.1_5'Flank	NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	1231					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)	p.S1219R(1)		NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		AGCGGGCAAGCAAGGGGGTGA	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		13753	0.001		0.0	False		,,,				2504	0.0				Esophageal Squamous(6;201 374 4964 23855 42828)											1	Substitution - Missense(1)	ovary(1)	17											58.0	57.0	58.0					17																	40948560		2203	4300	6503	38202086	SO:0001583	missense	65266			AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.3693C>G	17.37:g.40948560C>G	ENSP00000246914:p.Ser1231Arg		38202086	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	ENST00000246914.5	37	CCDS11439.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745617	0.49151	.	.	ENSG00000126562	ENST00000246914	T	0.75704	-0.96	5.51	5.51	0.81932	.	0.272298	0.26248	N	0.025470	D	0.83257	0.5215	L	0.55990	1.75	0.80722	D	1	D	0.69078	0.997	D	0.63597	0.916	D	0.84381	0.0549	10	0.72032	D	0.01	-13.0924	19.0022	0.92838	0.0:1.0:0.0:0.0	.	1231	Q96J92	WNK4_HUMAN	R	1231	ENSP00000246914:S1231R	ENSP00000246914:S1231R	S	+	3	2	WNK4	38202086	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.992000	0.40737	2.592000	0.87571	0.655000	0.94253	AGC		0.637	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1			Missense_Mutation
HDAC5	10014	broad.mit.edu	37	17	42164917	42164917	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0979-01	TCGA-24-0979-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr17:42164917G>C	ENST00000393622.2	-	13	2078	c.1747C>G	c.(1747-1749)Cag>Gag	p.Q583E	HDAC5_ENST00000586802.1_Missense_Mutation_p.Q583E|HDAC5_ENST00000225983.6_Missense_Mutation_p.Q584E|HDAC5_ENST00000336057.5_Missense_Mutation_p.Q583E	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	583					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.Q583E(1)		central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		AGGTCTTCCTGTGTGCTCTCA	0.632																																																1	Substitution - Missense(1)	ovary(1)	17											82.0	71.0	74.0					17																	42164917		2203	4300	6503	39520443	SO:0001583	missense	10014			AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.1747C>G	17.37:g.42164917G>C	ENSP00000377244:p.Gln583Glu		39520443	C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	ENST00000393622.2	37	CCDS45696.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722780	0.30503	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.05382	3.45;3.45;3.45	4.07	4.07	0.47477	.	0.227188	0.28301	N	0.015849	T	0.02807	0.0084	N	0.08118	0	0.50813	D	0.999897	P;B;B;B	0.37500	0.597;0.231;0.341;0.231	B;B;B;B	0.30646	0.118;0.055;0.118;0.055	T	0.41161	-0.9524	10	0.02654	T	1	-16.1674	15.1848	0.72993	0.0:0.0:1.0:0.0	.	583;583;584;583	Q9UQL6-2;B4DGT4;Q9UQL6-3;Q9UQL6	.;.;.;HDAC5_HUMAN	E	584;583;583	ENSP00000225983:Q584E;ENSP00000377244:Q583E;ENSP00000337290:Q583E	ENSP00000225983:Q584E	Q	-	1	0	HDAC5	39520443	0.759000	0.28416	0.998000	0.56505	0.967000	0.64934	1.699000	0.37804	2.098000	0.63641	0.491000	0.48974	CAG		0.632	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457686.1	NM_001015053		Missense_Mutation
COIL	8161	broad.mit.edu	37	17	55019486	55019486	+	Splice_Site	SNP	T	T	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr17:55019486T>A	ENST00000240316.4	-	6	1593		c.e6-2		RP5-1107A17.3_ENST00000572187.1_RNA	NM_004645.2	NP_004636.1	P38432	COIL_HUMAN	coilin							Cajal body (GO:0015030)|cytoplasm (GO:0005737)|female germ cell nucleus (GO:0001674)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	disulfide oxidoreductase activity (GO:0015036)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)	p.?(1)		NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	15	Breast(9;6.15e-08)					CTCTCAAGGCTGAAACAAGAA	0.388																																																1	Unknown(1)	ovary(1)	17											88.0	84.0	85.0					17																	55019486		2203	4300	6503	52374485	SO:0001630	splice_region_variant	8161			U06632	CCDS11592.1	17q22	2012-10-02			ENSG00000121058	ENSG00000121058			2184	protein-coding gene	gene with protein product		600272				7971277	Standard	NM_004645		Approved	CLN80, p80-coilin	uc002iuu.3	P38432	OTTHUMG00000178126	ENST00000240316.4:c.1559-2A>T	17.37:g.55019486T>A			52374485	B2R931	Splice_Site_SNP	SNP	ENST00000240316.4	37	CCDS11592.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	14.53	2.562215	0.45694	.	.	ENSG00000121058	ENST00000240316	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.351	0.60601	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	COIL	52374485	1.000000	0.71417	0.998000	0.56505	0.513000	0.34164	5.228000	0.65310	2.023000	0.59567	0.455000	0.32223	.		0.388	COIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440618.1		Intron	Splice_Site_SNP
LAMA1	284217	broad.mit.edu	37	18	7033075	7033075	+	Missense_Mutation	SNP	C	C	A	rs184077167		TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr18:7033075C>A	ENST00000389658.3	-	15	2164	c.2071G>T	c.(2071-2073)Gac>Tac	p.D691Y		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	691	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.D691Y(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CTGGCTATGTCCAGAGAGACG	0.507																																																1	Substitution - Missense(1)	ovary(1)	18											101.0	75.0	84.0					18																	7033075		2203	4299	6502	7023075	SO:0001583	missense	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2071G>T	18.37:g.7033075C>A	ENSP00000374309:p.Asp691Tyr		7023075		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	19.74	3.884224	0.72410	.	.	ENSG00000101680	ENST00000389658	T	0.38560	1.13	6.07	6.07	0.98685	Laminin B type IV (2);Laminin B, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.71031	0.3292	M	0.85710	2.77	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.71391	-0.4607	10	0.52906	T	0.07	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	691	P25391	LAMA1_HUMAN	Y	691	ENSP00000374309:D691Y	ENSP00000374309:D691Y	D	-	1	0	LAMA1	7023075	1.000000	0.71417	0.999000	0.59377	0.301000	0.27625	3.767000	0.55288	2.884000	0.98904	0.655000	0.94253	GAC		0.507	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		Missense_Mutation
LAMA3	3909	broad.mit.edu	37	18	21438765	21438765	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr18:21438765G>A	ENST00000313654.9	+	34	4635	c.4394G>A	c.(4393-4395)tGt>tAt	p.C1465Y	LAMA3_ENST00000399516.3_Missense_Mutation_p.C1465Y	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1465	Domain III B.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.C1465Y(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					AATAATCAATGTCACAGCTCA	0.428																																																1	Substitution - Missense(1)	ovary(1)	18											181.0	162.0	168.0					18																	21438765		1947	4151	6098	19692763	SO:0001583	missense	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.4394G>A	18.37:g.21438765G>A	ENSP00000324532:p.Cys1465Tyr		19692763	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	16.58	3.163506	0.57476	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.52295	0.75;0.67	5.47	5.47	0.80525	Growth factor, receptor (1);	.	.	.	.	T	0.75398	0.3844	M	0.88450	2.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.80259	-0.1457	9	0.87932	D	0	.	19.32	0.94234	0.0:0.0:1.0:0.0	.	1465;1465	Q6VU67;Q16787	.;LAMA3_HUMAN	Y	1465;1465;1463	ENSP00000324532:C1465Y;ENSP00000382432:C1465Y	ENSP00000324532:C1465Y	C	+	2	0	LAMA3	19692763	1.000000	0.71417	0.098000	0.21074	0.154000	0.21943	9.130000	0.94437	2.580000	0.87095	0.561000	0.74099	TGT		0.428	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		Missense_Mutation
MALT1	10892	broad.mit.edu	37	18	56414870	56414870	+	Silent	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr18:56414870C>T	ENST00000348428.3	+	17	2529	c.2271C>T	c.(2269-2271)ttC>ttT	p.F757F	RP11-126O1.4_ENST00000588835.1_RNA|MALT1_ENST00000345724.3_Silent_p.F746F	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	757					activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)	p.F746F(1)		central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						AAGACCCATTCCATGGTGTTT	0.448			T	BIRC3	MALT																																		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	1	Substitution - coding silent(1)	ovary(1)	18											180.0	169.0	173.0					18																	56414870		2203	4300	6503	54565850	SO:0001819	synonymous_variant	10892				CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.2271C>T	18.37:g.56414870C>T			54565850	Q9NTB7|Q9ULX4	Silent	SNP	ENST00000348428.3	37	CCDS11967.1	SNP	30	Broad																																																																																				0.448	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256132.2			Silent
INSR	3643	broad.mit.edu	37	19	7117323	7117323	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0979-01	TCGA-24-0979-10			A	G	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr19:7117323A>G	ENST00000302850.5	-	22	4035	c.3893T>C	c.(3892-3894)tTt>tCt	p.F1298S	INSR_ENST00000341500.5_Missense_Mutation_p.F1286S	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	1298	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.F1298S(1)		breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CACCTCTGGAAAGCTGGGGTG	0.562																																																1	Substitution - Missense(1)	ovary(1)	19											117.0	109.0	112.0					19																	7117323		2203	4300	6503	7068323	SO:0001583	missense	3643			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.3893T>C	19.37:g.7117323A>G	ENSP00000303830:p.Phe1298Ser		7068323	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	CCDS12176.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	18.47	3.630806	0.67015	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.78126	-1.14;-1.15	4.99	4.99	0.66335	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47455	D	0.000231	D	0.83133	0.5188	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84807	0.0788	10	0.87932	D	0	.	12.6952	0.56999	1.0:0.0:0.0:0.0	.	1286;1298	P06213-2;P06213	.;INSR_HUMAN	S	1298;1286	ENSP00000303830:F1298S;ENSP00000342838:F1286S	ENSP00000303830:F1298S	F	-	2	0	INSR	7068323	1.000000	0.71417	0.985000	0.45067	0.396000	0.30629	6.842000	0.75379	2.094000	0.63399	0.460000	0.39030	TTT		0.562	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1			Missense_Mutation
GADD45GIP1	90480	broad.mit.edu	37	19	13065202	13065202	+	Silent	SNP	G	G	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr19:13065202G>C	ENST00000316939.1	-	2	512	c.489C>G	c.(487-489)ctC>ctG	p.L163L		NM_052850.3	NP_443082.2	Q8TAE8	G45IP_HUMAN	growth arrest and DNA-damage-inducible, gamma interacting protein 1	163					cell cycle (GO:0007049)|viral process (GO:0016032)	mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.L163L(1)		ovary(2)|prostate(1)|skin(1)	4						GGTAGCCCAGGAGCTCCTGGG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	19											66.0	68.0	67.0					19																	13065202		2203	4300	6503	12926202	SO:0001819	synonymous_variant	90480			AF479749	CCDS12290.1	19p13.2	2014-02-12				ENSG00000179271			29996	protein-coding gene	gene with protein product	"""papillomavirus L2 interacting nuclear protein 1"", ""CKII beta binding protein 2"", ""CR6 interacting factor 1"", ""p53-responsive gene 6"""	605162				10441517, 12482659	Standard	NM_052850		Approved	PLINP-1, MGC4667, MGC4758, CKBBP2, PRG6, Plinp1, CRIF1, CKbetaBP2	uc002mwb.4	Q8TAE8		ENST00000316939.1:c.489C>G	19.37:g.13065202G>C			12926202	Q8IVM3|Q8TE51|Q969P9|Q9BSM6	Silent	SNP	ENST00000316939.1	37	CCDS12290.1	SNP	41	Broad																																																																																				0.612	GADD45GIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452759.2	NM_052850		Silent
EPS15L1	58513	broad.mit.edu	37	19	16528758	16528758	+	Splice_Site	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr19:16528758C>A	ENST00000248070.6	-	11	1247		c.e11+1		EPS15L1_ENST00000597937.1_Splice_Site|EPS15L1_ENST00000594975.1_Splice_Site|EPS15L1_ENST00000455140.2_Splice_Site|EPS15L1_ENST00000535753.2_Splice_Site|EPS15L1_ENST00000602009.1_Splice_Site	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1						endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						GCACCACTCACCGGGCCGGGC	0.622											OREG0025334	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Unknown(1)	ovary(1)	19											86.0	77.0	80.0					19																	16528758		2203	4300	6503	16389758	SO:0001630	splice_region_variant	58513			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.1107+1G>T	19.37:g.16528758C>A		711	16389758	A2RRF3|A5PL29|B4DKA3	Splice_Site_SNP	SNP	ENST00000248070.6	37	CCDS32944.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	20.0	3.931163	0.73327	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	.	.	.	4.35	4.35	0.52113	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0353	0.80625	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EPS15L1	16389758	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	7.333000	0.79214	2.246000	0.74042	0.655000	0.94253	.		0.622	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	Intron	Splice_Site_SNP
CPAMD8	27151	broad.mit.edu	37	19	17091496	17091496	+	Splice_Site	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10			C	A	C	C	Unknown	Valid	Somatic	x	x	454_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr19:17091496C>A	ENST00000443236.1	-	14	1568	c.1537G>T	c.(1537-1539)Gtt>Ttt	p.V513F	CPAMD8_ENST00000388925.4_Intron	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	466						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V513F(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						TCTTCCCCAACCTATGGAAGA	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											60.0	64.0	63.0					19																	17091496		2000	4170	6170	16952496	SO:0001630	splice_region_variant	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1537-1G>T	19.37:g.17091496C>A			16952496	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	SNP	18	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.23|17.23	3.336086|3.336086	0.60963|0.60963	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	2.6|2.6	2.6|2.6	0.31112|0.31112	.|Alpha-2-macroglobulin, N-terminal 2 (1);	.|0.000000	.|0.56097	.|U	.|0.000030	T|T	0.55242|0.55242	0.1908|0.1908	M|M	0.67625|0.67625	2.065|2.065	0.80722|0.80722	D|D	1|1	.|P	.|0.47484	.|0.896	.|B	.|0.41036	.|0.346	T|T	0.64993|0.64993	-0.6276|-0.6276	5|9	.|0.66056	.|D	.|0.02	.|.	13.4268|13.4268	0.61030|0.61030	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|466	.|Q8IZJ3	.|CPMD8_HUMAN	S|F	523|513	.|.	.|ENSP00000291440:V513F	R|V	-|-	3|1	2|0	CPAMD8|CPAMD8	16952496|16952496	1.000000|1.000000	0.71417|0.71417	0.458000|0.458000	0.27068|0.27068	0.392000|0.392000	0.30506|0.30506	4.290000|4.290000	0.59019|0.59019	1.184000|1.184000	0.42957|0.42957	0.467000|0.467000	0.42956|0.42956	AGG|GTT		0.567	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	Missense_Mutation	Missense_Mutation
ZNF99	7652	broad.mit.edu	37	19	22941246	22941246	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr19:22941246C>A	ENST00000596209.1	-	4	1555	c.1465G>T	c.(1465-1467)Gct>Tct	p.A489S	ZNF99_ENST00000397104.3_Missense_Mutation_p.A398S	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	489					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A398S(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CACTTAAAAGCTTTACCACAT	0.353																																																1	Substitution - Missense(1)	ovary(1)	19											46.0	47.0	47.0					19																	22941246		2019	4199	6218	22733086	SO:0001583	missense	7652			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1465G>T	19.37:g.22941246C>A	ENSP00000472969:p.Ala489Ser		22733086	M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	c	11.25	1.582433	0.28180	.	.	ENSG00000213973	ENST00000397104	T	0.13420	2.59	1.47	-1.75	0.08031	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11623	0.0283	N	0.16166	0.38	0.09310	N	1	D	0.56287	0.975	P	0.58820	0.846	T	0.23084	-1.0198	9	0.27785	T	0.31	.	2.8845	0.05657	0.4928:0.3079:0.0:0.1992	.	398	A8MXY4	ZNF99_HUMAN	S	398	ENSP00000380293:A398S	ENSP00000380293:A398S	A	-	1	0	ZNF99	22733086	0.000000	0.05858	0.003000	0.11579	0.160000	0.22226	-0.800000	0.04555	-0.024000	0.13941	0.400000	0.26472	GCT		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		Missense_Mutation
RYR1	6261	broad.mit.edu	37	19	39016137	39016137	+	Missense_Mutation	SNP	G	G	A	rs376338203		TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr19:39016137G>A	ENST00000359596.3	+	71	10621	c.10621G>A	c.(10621-10623)Gcc>Acc	p.A3541T	RYR1_ENST00000360985.3_Missense_Mutation_p.A3541T|RYR1_ENST00000355481.4_Missense_Mutation_p.A3536T|AC067969.1_ENST00000597015.1_RNA			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3541					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.A3541T(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GACCCGTTACGCCCTGGTGCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	19						G	THR/ALA,THR/ALA	0,4406		0,0,2203	67.0	50.0	56.0		10621,10606	4.2	1.0	19		56	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	RYR1	NM_000540.2,NM_001042723.1	58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	3541/5039,3536/5034	39016137	1,13005	2203	4300	6503	43707977	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10621G>A	19.37:g.39016137G>A	ENSP00000352608:p.Ala3541Thr		43707977	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	12.96	2.094222	0.36952	0.0	1.16E-4	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.96716	-4.1;-4.1;-4.1	4.15	4.15	0.48705	.	0.085401	0.47852	U	0.000209	D	0.88665	0.6498	L	0.29908	0.895	0.33082	D	0.53673	P;P;P	0.42757	0.789;0.789;0.685	B;B;B	0.34418	0.182;0.182;0.089	D	0.87105	0.2181	10	0.09084	T	0.74	.	5.3762	0.16166	0.0974:0.0:0.5663:0.3363	.	3541;3536;3541	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	T	3541;3536;3541;461	ENSP00000352608:A3541T;ENSP00000347667:A3536T;ENSP00000354254:A3541T	ENSP00000347667:A3536T	A	+	1	0	RYR1	43707977	0.910000	0.30920	0.976000	0.42696	0.996000	0.88848	1.682000	0.37628	2.302000	0.77476	0.655000	0.94253	GCC		0.617	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			Missense_Mutation
APOB	338	broad.mit.edu	37	2	21226147	21226147	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr2:21226147A>T	ENST00000233242.1	-	29	12274	c.12147T>A	c.(12145-12147)gaT>gaA	p.D4049E	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4049					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.D4049E(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGTTTCCTCATCAGATTCCC	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											219.0	243.0	235.0					2																	21226147		2203	4300	6503	21079652	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.12147T>A	2.37:g.21226147A>T	ENSP00000233242:p.Asp4049Glu		21079652	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	10.57	1.386157	0.25031	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.27402	1.67	5.75	3.33	0.38152	.	0.499835	0.17905	N	0.158067	T	0.25005	0.0607	L	0.48642	1.525	0.22737	N	0.998798	B	0.09022	0.002	B	0.08055	0.003	T	0.18587	-1.0332	10	0.27785	T	0.31	.	8.9938	0.36039	0.8082:0.1263:0.0655:0.0	.	4049	P04114	APOB_HUMAN	E	4049	ENSP00000233242:D4049E	ENSP00000233242:D4049E	D	-	3	2	APOB	21079652	0.100000	0.21855	0.001000	0.08648	0.235000	0.25334	2.629000	0.46485	0.513000	0.28278	-0.256000	0.11100	GAT		0.413	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			Missense_Mutation
MTIF2	4528	broad.mit.edu	37	2	55473531	55473531	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr2:55473531C>A	ENST00000263629.4	-	10	1363	c.1048G>T	c.(1048-1050)Gat>Tat	p.D350Y	MTIF2_ENST00000403721.1_Missense_Mutation_p.D350Y|MTIF2_ENST00000394600.3_Missense_Mutation_p.D350Y	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	350					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.D350Y(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						CCATTGGGATCTGCTTTCAAT	0.388																																																1	Substitution - Missense(1)	ovary(1)	2											172.0	158.0	163.0					2																	55473531		2203	4300	6503	55327035	SO:0001583	missense	4528			L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.1048G>T	2.37:g.55473531C>A	ENSP00000263629:p.Asp350Tyr		55327035	D6W5D0	Missense_Mutation	SNP	ENST00000263629.4	37	CCDS1853.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	25.5	4.649691	0.87958	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000418823;ENST00000535023	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.33	5.33	0.75918	.	0.105696	0.64402	D	0.000005	T	0.71953	0.3401	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.76105	-0.3081	10	0.87932	D	0	-17.6566	19.0262	0.92932	0.0:1.0:0.0:0.0	.	350	P46199	IF2M_HUMAN	Y	350;350;350;70;350	ENSP00000384481:D350Y;ENSP00000263629:D350Y;ENSP00000378099:D350Y;ENSP00000403492:D70Y	ENSP00000263629:D350Y	D	-	1	0	MTIF2	55327035	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.268000	0.78473	2.505000	0.84491	0.655000	0.94253	GAT		0.388	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251486.4	NM_002453		Missense_Mutation
EIF2AK3	9451	broad.mit.edu	37	2	88890440	88890440	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr2:88890440C>G	ENST00000303236.3	-	5	1199	c.898G>C	c.(898-900)Gaa>Caa	p.E300Q	EIF2AK3_ENST00000419748.1_Missense_Mutation_p.E149Q	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	300					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)	p.E299Q(1)		ovary(3)	3						GCTTCCTGTTCTTCCACATCT	0.418																																					GBM(138;671 1851 16235 39058 45249)											1	Substitution - Missense(1)	ovary(1)	2											155.0	149.0	151.0					2																	88890440		2203	4300	6503	88671555	SO:0001583	missense	9451			AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.898G>C	2.37:g.88890440C>G	ENSP00000307235:p.Glu300Gln		88671555	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Missense_Mutation	SNP	ENST00000303236.3	37	CCDS33241.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	16.05	3.014262	0.54468	.	.	ENSG00000172071	ENST00000419748;ENST00000303236;ENST00000535951;ENST00000415570	T;T;T	0.74526	-0.73;-0.68;-0.85	5.87	5.87	0.94306	Quinonprotein alcohol dehydrogenase-like (2);	0.253078	0.45126	D	0.000385	T	0.75466	0.3853	M	0.63843	1.955	0.35879	D	0.828836	P	0.41475	0.751	B	0.39503	0.301	T	0.82088	-0.0630	10	0.66056	D	0.02	-29.7421	20.2147	0.98293	0.0:1.0:0.0:0.0	.	300	Q9NZJ5	E2AK3_HUMAN	Q	149;300;149;179	ENSP00000408325:E149Q;ENSP00000307235:E300Q;ENSP00000412076:E179Q	ENSP00000307235:E300Q	E	-	1	0	EIF2AK3	88671555	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	2.964000	0.49192	2.785000	0.95823	0.591000	0.81541	GAA		0.418	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000338233.2	NM_004836		Missense_Mutation
GCC2	9648	broad.mit.edu	37	2	109087719	109087719	+	Missense_Mutation	SNP	T	T	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr2:109087719T>G	ENST00000309863.6	+	6	2648	c.1934T>G	c.(1933-1935)gTa>gGa	p.V645G		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	645					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)	p.V645G(1)		breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						GAACAAAAGGTAAATGAATTA	0.328																																																1	Substitution - Missense(1)	ovary(1)	2											81.0	95.0	90.0					2																	109087719		2203	4298	6501	108454151	SO:0001583	missense	9648			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.1934T>G	2.37:g.109087719T>G	ENSP00000307939:p.Val645Gly		108454151	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	ENST00000309863.6	37	CCDS33268.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	11.15	1.553028	0.27739	.	.	ENSG00000135968	ENST00000309863;ENST00000409896;ENST00000393318	T	0.35236	1.32	5.62	5.62	0.85841	.	0.192707	0.34314	N	0.004065	T	0.34337	0.0894	M	0.65975	2.015	0.30837	N	0.736084	P	0.42785	0.79	B	0.36719	0.231	T	0.49753	-0.8906	10	0.37606	T	0.19	.	11.2149	0.48821	0.0:0.0715:0.0:0.9285	.	645	Q8IWJ2	GCC2_HUMAN	G	645;608;390	ENSP00000307939:V645G	ENSP00000307939:V645G	V	+	2	0	GCC2	108454151	0.027000	0.19231	0.987000	0.45799	0.931000	0.56810	0.956000	0.29202	2.260000	0.74910	0.528000	0.53228	GTA		0.328	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358516.3	NM_014635		Missense_Mutation
IL36G	56300	broad.mit.edu	37	2	113742455	113742455	+	Silent	SNP	C	C	A	rs199911001	byFrequency	TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr2:113742455C>A	ENST00000259205.4	+	5	408	c.339C>A	c.(337-339)ccC>ccA	p.P113P	IL36G_ENST00000376489.2_Silent_p.P78P	NM_019618.2	NP_062564.1	Q9NZH8	IL36G_HUMAN	interleukin 36, gamma	113					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular space (GO:0005615)		p.P113P(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						AACCCGAGCCCGTGAAACCCT	0.502																																																1	Substitution - coding silent(1)	ovary(1)	2											142.0	130.0	134.0					2																	113742455		2203	4300	6503	113458926	SO:0001819	synonymous_variant	56300			AF200492	CCDS2108.1, CCDS62992.1	2q12-q21	2011-07-14	2011-06-06	2011-06-06	ENSG00000136688	ENSG00000136688		"""Interleukins and interleukin receptors"""	15741	protein-coding gene	gene with protein product	"""interleukin-1 homolog 1"", ""interleukin 1-related protein 2"", ""interleukin-1 epsilon"""	605542	"""interleukin 1 family, member 9"""	IL1F9		10860666, 10744718, 11991722, 11991723	Standard	NM_019618		Approved	IL-1H1, IL-1RP2, IL-1F9, IL1H1, IL1E	uc002tio.1	Q9NZH8	OTTHUMG00000131336	ENST00000259205.4:c.339C>A	2.37:g.113742455C>A			113458926	Q56B91|Q6UVX7|Q7RTZ9	Silent	SNP	ENST00000259205.4	37	CCDS2108.1	SNP	23	Broad																																																																																				0.502	IL36G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330713.2	NM_019618		Silent
MBD5	55777	broad.mit.edu	37	2	149247144	149247144	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr2:149247144G>T	ENST00000407073.1	+	12	4241	c.3244G>T	c.(3244-3246)Gat>Tat	p.D1082Y	MBD5_ENST00000404807.1_Missense_Mutation_p.D1315Y	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1082					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.D1082Y(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		TGGCCCAGGTGATGCTTCCGT	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											154.0	139.0	144.0					2																	149247144		2203	4300	6503	148963614	SO:0001583	missense	55777			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3244G>T	2.37:g.149247144G>T	ENSP00000386049:p.Asp1082Tyr		148963614	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	37	CCDS33302.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127428	0.56721	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	T;T	0.22134	1.97;1.97	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000005	T	0.32255	0.0823	N	0.19112	0.55	0.50171	D	0.999855	D;D	0.71674	0.998;0.997	P;P	0.61003	0.882;0.882	T	0.06481	-1.0824	10	0.87932	D	0	-10.1817	20.3593	0.98849	0.0:0.0:1.0:0.0	.	1315;1082	E9PHH0;Q9P267	.;MBD5_HUMAN	Y	1082;1315	ENSP00000386049:D1082Y;ENSP00000384672:D1315Y	ENSP00000384672:D1315Y	D	+	1	0	MBD5	148963614	.	.	0.991000	0.47740	0.997000	0.91878	.	.	2.822000	0.97130	0.557000	0.71058	GAT		0.498	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2			Missense_Mutation
PIKFYVE	200576	broad.mit.edu	37	2	209200596	209200596	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-0979-01	TCGA-24-0979-10			A	T	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr2:209200596A>T	ENST00000264380.4	+	26	4494	c.4336A>T	c.(4336-4338)Aaa>Taa	p.K1446*	PIKFYVE_ENST00000474721.1_3'UTR	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1446					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.K1446*(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AAGAGAGGAAAAAATGGAAGA	0.264																																																1	Substitution - Nonsense(1)	ovary(1)	2											54.0	58.0	57.0					2																	209200596		2198	4287	6485	208908841	SO:0001587	stop_gained	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.4336A>T	2.37:g.209200596A>T	ENSP00000264380:p.Lys1446*		208908841	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Nonsense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	44	10.633382	0.99441	.	.	ENSG00000115020	ENST00000264380	.	.	.	5.01	5.01	0.66863	.	0.052393	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-18.3759	14.6715	0.68948	1.0:0.0:0.0:0.0	.	.	.	.	X	1446	.	ENSP00000264380:K1446X	K	+	1	0	PIKFYVE	208908841	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.647000	0.91057	2.016000	0.59253	0.379000	0.24179	AAA		0.264	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040		Nonsense_Mutation
SPHKAP	80309	broad.mit.edu	37	2	228881409	228881409	+	Silent	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr2:228881409C>T	ENST00000392056.3	-	7	4207	c.4161G>A	c.(4159-4161)ttG>ttA	p.L1387L	SPHKAP_ENST00000344657.5_Silent_p.L1387L	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1387						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.L1387L(1)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CAGTTTTGCTCAAAGATGACA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	2											84.0	89.0	87.0					2																	228881409		2203	4300	6503	228589653	SO:0001819	synonymous_variant	80309				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4161G>A	2.37:g.228881409C>T			228589653	Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	ENST00000392056.3	37	CCDS46537.1	SNP	29	Broad																																																																																				0.478	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		Silent
DTD1	92675	broad.mit.edu	37	20	18576815	18576815	+	Silent	SNP	G	G	A			TCGA-24-0979-01	TCGA-24-0979-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr20:18576815G>A	ENST00000377452.3	+	3	480	c.300G>A	c.(298-300)gaG>gaA	p.E100E	DTD1_ENST00000494921.1_3'UTR	NM_080820.4	NP_543010.3	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1	100					D-amino acid catabolic process (GO:0019478)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)	p.E100E(2)		large_intestine(4)|lung(1)|ovary(2)	7						TGCCCACGGAGCAGGCAGAGG	0.527																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	20											80.0	70.0	73.0					20																	18576815		2203	4300	6503	18524815	SO:0001819	synonymous_variant	92675			AF332356	CCDS13138.1	20p11.23	2012-09-25	2012-09-25	2007-02-23	ENSG00000125821	ENSG00000125821			16219	protein-coding gene	gene with protein product		610996	"""chromosome 20 open reading frame 88"", ""D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)"""	C20orf88, HARS2			Standard	NM_080820		Approved	DUEB, MGC119131, MGC41905, bA379J5.3, bA555E18.1, pqn-68	uc002wrf.4	Q8TEA8	OTTHUMG00000031980	ENST00000377452.3:c.300G>A	20.37:g.18576815G>A			18524815	A8K5X5|D3DW37|Q496D1|Q5W184|Q8WXU8|Q9BW67|Q9H464|Q9H474	Silent	SNP	ENST00000377452.3	37	CCDS13138.1	SNP	34	Broad																																																																																				0.527	DTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078189.3	NM_080820		Silent
ZNF341	84905	broad.mit.edu	37	20	32371641	32371641	+	Missense_Mutation	SNP	A	A	G	rs372505263		TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr20:32371641A>G	ENST00000375200.1	+	12	2188	c.1823A>G	c.(1822-1824)tAt>tGt	p.Y608C	ZNF341_ENST00000342427.2_Missense_Mutation_p.Y601C	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	608					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y601C(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						CGGGAGCATTATCTCAAACTG	0.607																																																1	Substitution - Missense(1)	ovary(1)	20											83.0	71.0	75.0					20																	32371641		2203	4300	6503	31835302	SO:0001583	missense	84905			AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.1823A>G	20.37:g.32371641A>G	ENSP00000364346:p.Tyr608Cys		31835302	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	ENST00000375200.1	37		SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	19.23	3.786880	0.70337	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.07908	3.15;3.15	4.45	4.45	0.53987	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.391329	0.26457	N	0.024268	T	0.17577	0.0422	L	0.28694	0.88	0.53688	D	0.999977	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.02654	-1.1128	10	0.39692	T	0.17	-9.591	14.2085	0.65750	1.0:0.0:0.0:0.0	.	549;608;601	Q504V9;Q9BYN7;Q9BYN7-2	.;ZN341_HUMAN;.	C	601;608	ENSP00000344308:Y601C;ENSP00000364346:Y608C	ENSP00000344308:Y601C	Y	+	2	0	ZNF341	31835302	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	8.570000	0.90748	2.018000	0.59344	0.381000	0.24937	TAT		0.607	ZNF341-201	KNOWN	basic	protein_coding	protein_coding				Missense_Mutation
RBM12	10137	broad.mit.edu	37	20	34242182	34242182	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr20:34242182C>T	ENST00000374114.3	-	3	1326	c.1063G>A	c.(1063-1065)Gat>Aat	p.D355N	CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000397442.1_Intron|RBM12_ENST00000359646.1_Missense_Mutation_p.D355N|CPNE1_ENST00000397445.1_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.D355N|CPNE1_ENST00000317677.5_5'Flank|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000352393.4_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	355	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.D355N(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			TCAAATGTATCTTGAGGGGAG	0.433											OREG0004044	type=REGULATORY REGION|Gene=CPNE1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				1	Substitution - Missense(1)	ovary(1)	20											150.0	146.0	147.0					20																	34242182		2203	4300	6503	33705596	SO:0001583	missense	10137			AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.1063G>A	20.37:g.34242182C>T	ENSP00000363228:p.Asp355Asn	846	33705596	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	ENST00000374114.3	37	CCDS13261.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413356	0.62511	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.35421	1.31;1.31;1.31	4.92	3.97	0.46021	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.068850	0.56097	D	0.000029	T	0.67031	0.2850	M	0.93808	3.46	0.80722	D	1	D	0.57257	0.979	D	0.64321	0.924	T	0.77859	-0.2431	10	0.72032	D	0.01	-11.4275	14.8219	0.70080	0.1448:0.8552:0.0:0.0	.	355	Q9NTZ6	RBM12_HUMAN	N	355;355;355;154	ENSP00000363228:D355N;ENSP00000352668:D355N;ENSP00000363217:D355N	ENSP00000339879:D154N	D	-	1	0	RBM12	33705596	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.320000	0.79064	1.299000	0.44798	0.549000	0.68633	GAT		0.433	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047		Missense_Mutation
HNF4A	3172	broad.mit.edu	37	20	43057024	43057024	+	Silent	SNP	G	G	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr20:43057024G>A	ENST00000316099.4	+	9	1268	c.1179G>A	c.(1177-1179)ctG>ctA	p.L393L	HNF4A_ENST00000415691.2_Silent_p.L393L|HNF4A_ENST00000457232.1_Silent_p.L371L|HNF4A_ENST00000316673.4_Silent_p.L371L	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	393					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L371L(1)|p.L393L(1)		endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			ACCCTCACCTGATGCAGGAAC	0.602																																					Colon(79;2 1269 8820 14841 52347)											2	Substitution - coding silent(2)	ovary(2)	20											116.0	85.0	95.0					20																	43057024		2203	4300	6503	42490438	SO:0001819	synonymous_variant	3172			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.1179G>A	20.37:g.43057024G>A			42490438	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Silent	SNP	ENST00000316099.4	37	CCDS13330.1	SNP	45	Broad																																																																																				0.602	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3			Silent
PREX1	57580	broad.mit.edu	37	20	47324880	47324880	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr20:47324880C>A	ENST00000371941.3	-	6	723	c.701G>T	c.(700-702)tGc>tTc	p.C234F	PREX1_ENST00000396220.1_Missense_Mutation_p.C234F	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	234	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.C234F(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GATGTTGGAGCAAACGGTCTT	0.612																																																1	Substitution - Missense(1)	ovary(1)	20											139.0	143.0	141.0					20																	47324880		2203	4300	6503	46758287	SO:0001583	missense	57580			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.701G>T	20.37:g.47324880C>A	ENSP00000361009:p.Cys234Phe		46758287	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303006	0.81136	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.62639	0.01;0.01	5.64	4.7	0.59300	Dbl homology (DH) domain (5);	0.000000	0.64402	U	0.000010	T	0.79305	0.4423	M	0.80746	2.51	0.80722	D	1	D	0.71674	0.998	D	0.74348	0.983	T	0.82686	-0.0334	10	0.87932	D	0	.	14.5157	0.67818	0.0:0.9298:0.0:0.0702	.	234	Q8TCU6	PREX1_HUMAN	F	234	ENSP00000361009:C234F;ENSP00000379522:C234F	ENSP00000361009:C234F	C	-	2	0	PREX1	46758287	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	7.487000	0.81328	1.392000	0.46585	0.655000	0.94253	TGC		0.612	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		Missense_Mutation
RSPH1	89765	broad.mit.edu	37	21	43892958	43892958	+	Silent	SNP	T	T	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr21:43892958T>C	ENST00000291536.3	-	9	1067	c.900A>G	c.(898-900)gaA>gaG	p.E300E	RSPH1_ENST00000398352.3_Silent_p.E262E	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	300	Poly-Glu.				axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.E300E(1)		large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						GTCTAGTTTCTTCTTCTTCAG	0.383																																					Esophageal Squamous(23;63 706 6286 10288 12913)											1	Substitution - coding silent(1)	ovary(1)	21											136.0	118.0	124.0					21																	43892958		2203	4300	6503	42766027	SO:0001819	synonymous_variant	89765			AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.900A>G	21.37:g.43892958T>C			42766027	A8MWV0|B2RBN9|Q3MJA1	Silent	SNP	ENST00000291536.3	37	CCDS13688.1	SNP	56	Broad																																																																																				0.383	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195379.1			Silent
TRIOBP	11078	broad.mit.edu	37	22	38121000	38121000	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0979-01	TCGA-24-0979-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr22:38121000G>A	ENST00000406386.3	+	7	2692	c.2437G>A	c.(2437-2439)Gac>Aac	p.D813N		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	813					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.D813N(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CACCCAACAGGACAACCCCAG	0.517																																																1	Substitution - Missense(1)	ovary(1)	22											164.0	172.0	169.0					22																	38121000		1984	4175	6159	36450946	SO:0001583	missense	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.2437G>A	22.37:g.38121000G>A	ENSP00000384312:p.Asp813Asn		36450946	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933141	0.52866	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.21031	2.03	4.21	3.16	0.36331	.	.	.	.	.	T	0.15998	0.0385	L	0.42245	1.32	0.09310	N	0.999997	B	0.33694	0.421	B	0.29862	0.108	T	0.08638	-1.0712	9	0.30078	T	0.28	.	8.0841	0.30762	0.1166:0.0:0.8834:0.0	.	813	Q9H2D6	TARA_HUMAN	N	813	ENSP00000384312:D813N	ENSP00000384312:D813N	D	+	1	0	TRIOBP	36450946	0.002000	0.14202	0.017000	0.16124	0.540000	0.34992	0.617000	0.24359	2.185000	0.69588	0.460000	0.39030	GAC		0.517	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			Missense_Mutation
GRM7	2917	broad.mit.edu	37	3	7456806	7456806	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr3:7456806C>T	ENST00000357716.4	+	5	1404	c.1130C>T	c.(1129-1131)aCg>aTg	p.T377M	GRM7_ENST00000403881.1_Missense_Mutation_p.T377M|GRM7_ENST00000486284.1_Missense_Mutation_p.T377M|GRM7_ENST00000402647.2_Missense_Mutation_p.T377M|GRM7_ENST00000389336.4_Missense_Mutation_p.T377M	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	377					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.T377M(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						TGCAAGTTGACGATTAGTGGG	0.413																																																1	Substitution - Missense(1)	ovary(1)	3											108.0	99.0	102.0					3																	7456806		2203	4300	6503	7431806	SO:0001583	missense	2917			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1130C>T	3.37:g.7456806C>T	ENSP00000350348:p.Thr377Met		7431806	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228439	0.58777	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492;ENST00000445087	D;D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09;-2.09	5.8	5.8	0.92144	Extracellular ligand-binding receptor (1);	0.184921	0.49305	D	0.000148	D	0.92996	0.7771	M	0.69185	2.1	0.48901	D	0.999729	D;D;D	0.89917	1.0;1.0;0.989	D;D;P	0.83275	0.994;0.996;0.84	D	0.92570	0.6065	10	0.59425	D	0.04	.	18.981	0.92755	0.0:1.0:0.0:0.0	.	377;377;377	Q14831-5;Q14831;Q14831-2	.;GRM7_HUMAN;.	M	377;377;377;377;377;377;377;34	ENSP00000350348:T377M;ENSP00000417536:T377M;ENSP00000373987:T377M;ENSP00000385664:T377M;ENSP00000384585:T377M;ENSP00000395035:T34M	ENSP00000350348:T377M	T	+	2	0	GRM7	7431806	0.999000	0.42202	0.991000	0.47740	0.990000	0.78478	5.241000	0.65384	2.902000	0.99343	0.650000	0.86243	ACG		0.413	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		Missense_Mutation
FGD5	152273	broad.mit.edu	37	3	14862160	14862160	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr3:14862160G>C	ENST00000285046.5	+	1	1692	c.1582G>C	c.(1582-1584)Ggg>Cgg	p.G528R	FGD5_ENST00000543601.1_Missense_Mutation_p.G287R	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	528					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.G287R(1)		NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GTCATTGGAGGGGAAGCCCTT	0.597																																																1	Substitution - Missense(1)	ovary(1)	3											21.0	24.0	23.0					3																	14862160		1947	4134	6081	14837164	SO:0001583	missense	152273			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.1582G>C	3.37:g.14862160G>C	ENSP00000285046:p.Gly528Arg		14837164	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	37	CCDS46767.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690745	0.29962	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.77877	-1.13;-0.89	4.83	4.83	0.62350	.	0.109458	0.40640	N	0.001054	T	0.74129	0.3676	M	0.67953	2.075	0.36685	D	0.879286	P;P	0.45428	0.476;0.858	B;B	0.39379	0.172;0.298	T	0.82238	-0.0556	10	0.72032	D	0.01	-30.032	11.4534	0.50167	0.0823:0.0:0.9177:0.0	.	287;528	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	R	528;287	ENSP00000285046:G528R;ENSP00000445949:G287R	ENSP00000285046:G528R	G	+	1	0	FGD5	14837164	1.000000	0.71417	0.985000	0.45067	0.065000	0.16274	3.508000	0.53378	2.246000	0.74042	0.650000	0.86243	GGG		0.597	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536		Missense_Mutation
MYH15	22989	broad.mit.edu	37	3	108112940	108112940	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr3:108112940C>T	ENST00000273353.3	-	37	5313	c.5257G>A	c.(5257-5259)Gct>Act	p.A1753T		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1753						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						ACCTCTTCAGCTTCTTTCTGC	0.493																																																0			3											108.0	111.0	110.0					3																	108112940		2004	4181	6185	109595630	SO:0001583	missense	22989			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5257G>A	3.37:g.108112940C>T	ENSP00000273353:p.Ala1753Thr		109595630		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	16.38	3.106858	0.56291	.	.	ENSG00000144821	ENST00000273353	T	0.77620	-1.11	5.68	0.383	0.16239	Myosin tail (1);	.	.	.	.	T	0.61788	0.2375	N	0.24115	0.695	0.28550	N	0.911649	B	0.12630	0.006	B	0.20577	0.03	T	0.54761	-0.8245	9	0.54805	T	0.06	.	5.8019	0.18417	0.2344:0.5714:0.0:0.1941	.	1753	Q9Y2K3	MYH15_HUMAN	T	1753	ENSP00000273353:A1753T	ENSP00000273353:A1753T	A	-	1	0	MYH15	109595630	0.227000	0.23707	0.050000	0.19076	0.106000	0.19336	0.335000	0.19806	0.291000	0.22468	0.650000	0.86243	GCT		0.493	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		Missense_Mutation
PARP15	165631	broad.mit.edu	37	3	122354024	122354024	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr3:122354024G>A	ENST00000464300.2	+	11	1796	c.1730G>A	c.(1729-1731)aGt>aAt	p.S577N	PARP15_ENST00000493645.1_Missense_Mutation_p.S274N|PARP15_ENST00000465304.1_3'UTR|PARP15_ENST00000310366.4_Missense_Mutation_p.S343N|PARP15_ENST00000483793.1_Missense_Mutation_p.S382N	NM_001113523.1	NP_001106995.1	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	577	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.S343N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0531)		TTTAATAGAAGTTGTGCTGGG	0.413																																																1	Substitution - Missense(1)	ovary(1)	3											73.0	65.0	68.0					3																	122354024		2203	4300	6503	123836714	SO:0001583	missense	165631			AK097916	CCDS3016.1, CCDS46893.1	3q21	2010-02-16			ENSG00000173200	ENSG00000173200		"""Poly (ADP-ribose) polymerases"""	26876	protein-coding gene	gene with protein product		612066				15273990	Standard	NM_001113523		Approved	FLJ40597, pART7	uc003efm.2	Q460N3	OTTHUMG00000159523	ENST00000464300.2:c.1730G>A	3.37:g.122354024G>A	ENSP00000417214:p.Ser577Asn		123836714	J3KR47|Q8N1K3	Missense_Mutation	SNP	ENST00000464300.2	37	CCDS46893.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	9.012	0.982807	0.18889	.	.	ENSG00000173200	ENST00000464300;ENST00000483793;ENST00000542823;ENST00000310366;ENST00000493645	T;T;T;T	0.13778	2.56;2.56;2.56;2.56	4.03	2.03	0.26663	Poly(ADP-ribose) polymerase, catalytic domain (2);	.	.	.	.	T	0.33059	0.0850	M	0.82056	2.57	0.44079	D	0.99683	B;B;D;D;P	0.71674	0.075;0.307;0.998;0.975;0.674	B;B;P;P;B	0.62740	0.086;0.245;0.906;0.71;0.38	T	0.15321	-1.0441	9	0.52906	T	0.07	.	11.1205	0.48287	0.0:0.0:0.6681:0.3319	.	274;343;324;382;555	B7ZL48;Q460N3-2;F5H8I1;C9J7L3;Q460N3	.;.;.;.;PAR15_HUMAN	N	577;382;324;343;274	ENSP00000417214:S577N;ENSP00000417785:S382N;ENSP00000308436:S343N;ENSP00000419488:S274N	ENSP00000308436:S343N	S	+	2	0	PARP15	123836714	1.000000	0.71417	0.035000	0.18076	0.045000	0.14185	5.234000	0.65343	0.867000	0.35654	0.655000	0.94253	AGT		0.413	PARP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355964.2	NM_152615		Missense_Mutation
PARP14	54625	broad.mit.edu	37	3	122422732	122422732	+	Silent	SNP	A	A	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr3:122422732A>T	ENST00000474629.2	+	7	3491	c.3225A>T	c.(3223-3225)acA>acT	p.T1075T		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1075	Macro 2. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.T912T(1)		NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		GCATGGGCACAGTGCTCAAAA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	3											134.0	140.0	138.0					3																	122422732		2075	4214	6289	123905422	SO:0001819	synonymous_variant	54625			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.3225A>T	3.37:g.122422732A>T			123905422	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	ENST00000474629.2	37	CCDS46894.1	SNP	7	Broad																																																																																				0.537	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554		Silent
RPN1	6184	broad.mit.edu	37	3	128344411	128344411	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr3:128344411A>G	ENST00000296255.3	-	8	1409	c.1361T>C	c.(1360-1362)aTc>aCc	p.I454T	RPN1_ENST00000490166.1_5'Flank|RPN1_ENST00000497289.1_Missense_Mutation_p.I282T	NM_002950.3	NP_002941.1	P04843	RPN1_HUMAN	ribophorin I	454					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)|poly(A) RNA binding (GO:0044822)	p.I454T(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|stomach(2)	13				GBM - Glioblastoma multiforme(114;0.189)		AACATAGATGATAACGGTGAA	0.517			T	EVI1	AML																																		Dom	yes		3	3q21.3-q25.2	6184	ribophorin I		L	1	Substitution - Missense(1)	ovary(1)	3											198.0	191.0	194.0					3																	128344411		2203	4300	6503	129827101	SO:0001583	missense	6184				CCDS3051.1	3q21.3	2013-03-06			ENSG00000163902	ENSG00000163902			10381	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 1 homolog (S. cerevisiae)"", ""oligosaccharyltransferase complex subunit (non-catalytic)"""	180470					Standard	NM_002950		Approved	OST1	uc003ekr.1	P04843	OTTHUMG00000159691	ENST00000296255.3:c.1361T>C	3.37:g.128344411A>G	ENSP00000296255:p.Ile454Thr		129827101	B2R5Z0|D3DNB6|Q68DT1	Missense_Mutation	SNP	ENST00000296255.3	37	CCDS3051.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	25.7	4.663651	0.88251	.	.	ENSG00000163902	ENST00000296255;ENST00000497289;ENST00000537139;ENST00000545956	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.84383	0.5460	M	0.90759	3.145	0.80722	D	1	D	0.59767	0.986	D	0.68039	0.955	D	0.87427	0.2386	9	0.62326	D	0.03	-14.6467	15.9839	0.80133	1.0:0.0:0.0:0.0	.	454	P04843	RPN1_HUMAN	T	454;282;225;428	.	ENSP00000296255:I454T	I	-	2	0	RPN1	129827101	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	8.799000	0.91895	2.171000	0.68590	0.482000	0.46254	ATC		0.517	RPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356934.2	NM_002950		Missense_Mutation
KIAA0232	9778	broad.mit.edu	37	4	6862992	6862992	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr4:6862992G>T	ENST00000307659.5	+	7	1338	c.883G>T	c.(883-885)Gca>Tca	p.A295S	KIAA0232_ENST00000425103.1_Missense_Mutation_p.A295S	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	295							ATP binding (GO:0005524)	p.A295S(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						CTCCAGTGAAGCAGGCTCAAG	0.448																																																1	Substitution - Missense(1)	ovary(1)	4											56.0	56.0	56.0					4																	6862992		1950	4140	6090	6913893	SO:0001583	missense	9778			D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.883G>T	4.37:g.6862992G>T	ENSP00000303928:p.Ala295Ser		6913893	A7E2D2	Missense_Mutation	SNP	ENST00000307659.5	37	CCDS43209.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448067	0.84101	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.67	5.67	0.87782	.	0.103333	0.64402	D	0.000003	T	0.63943	0.2554	M	0.64997	1.995	0.58432	D	0.999999	P	0.39326	0.668	B	0.37601	0.254	T	0.68530	-0.5384	9	0.72032	D	0.01	-11.7693	19.7706	0.96363	0.0:0.0:1.0:0.0	.	295	Q92628	K0232_HUMAN	S	295	.	ENSP00000303928:A295S	A	+	1	0	KIAA0232	6913893	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	9.379000	0.97198	2.697000	0.92050	0.655000	0.94253	GCA		0.448	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743		Missense_Mutation
HERC5	51191	broad.mit.edu	37	4	89425453	89425453	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr4:89425453C>T	ENST00000264350.3	+	21	2806	c.2653C>T	c.(2653-2655)Cgg>Tgg	p.R885W	HERC5_ENST00000508159.1_Missense_Mutation_p.R523W	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	885	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.R885W(1)		NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		TGAAGAATTTCGGAGAGGATT	0.323																																					Esophageal Squamous(39;887 1012 34045 50514)											1	Substitution - Missense(1)	ovary(1)	4											77.0	82.0	80.0					4																	89425453		2203	4299	6502	89644476	SO:0001583	missense	51191			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.2653C>T	4.37:g.89425453C>T	ENSP00000264350:p.Arg885Trp		89644476	B2RTQ1|Q69G20	Missense_Mutation	SNP	ENST00000264350.3	37	CCDS3630.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	16.34	3.096753	0.56075	.	.	ENSG00000138646	ENST00000264350;ENST00000508159	T;T	0.51325	0.71;0.71	4.62	3.77	0.43336	HECT (4);	0.316302	0.21246	N	0.077721	T	0.56016	0.1957	L	0.54965	1.715	0.24700	N	0.993264	D	0.69078	0.997	P	0.61658	0.892	T	0.46233	-0.9206	10	0.56958	D	0.05	.	7.7916	0.29123	0.1856:0.635:0.1794:0.0	.	885	Q9UII4	HERC5_HUMAN	W	885;523	ENSP00000264350:R885W;ENSP00000424129:R523W	ENSP00000264350:R885W	R	+	1	2	HERC5	89644476	0.492000	0.26027	1.000000	0.80357	0.738000	0.42128	0.046000	0.14035	1.162000	0.42619	-0.165000	0.13383	CGG		0.323	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323		Missense_Mutation
MAML3	55534	broad.mit.edu	37	4	140811328	140811328	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0979-01	TCGA-24-0979-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr4:140811328G>C	ENST00000509479.2	-	2	2118	c.1262C>G	c.(1261-1263)cCa>cGa	p.P421R	MAML3_ENST00000327122.5_Missense_Mutation_p.P265R|MAML3_ENST00000398940.1_5'Flank	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)									p.P421R(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					GGCTTGGTTTGGAGTTTGAGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	4											116.0	113.0	114.0					4																	140811328		2100	4238	6338	141030778	SO:0001583	missense	55534			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1262C>G	4.37:g.140811328G>C	ENSP00000421180:p.Pro421Arg		141030778		Missense_Mutation	SNP	ENST00000509479.2	37	CCDS54805.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	18.44	3.625264	0.66901	.	.	ENSG00000196782	ENST00000509479;ENST00000327122	T	0.30182	1.54	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.56046	0.1959	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.54262	-0.8320	10	0.56958	D	0.05	.	19.7207	0.96142	0.0:0.0:1.0:0.0	.	421	Q96JK9	MAML3_HUMAN	R	421;265	ENSP00000421180:P421R	ENSP00000313316:P265R	P	-	2	0	MAML3	141030778	1.000000	0.71417	0.997000	0.53966	0.775000	0.43874	9.034000	0.93747	2.647000	0.89833	0.650000	0.86243	CCA		0.587	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2			Missense_Mutation
PLCXD3	345557	broad.mit.edu	37	5	41382241	41382241	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr5:41382241C>T	ENST00000377801.3	-	2	573	c.499G>A	c.(499-501)Gga>Aga	p.G167R	PLCXD3_ENST00000328457.3_Missense_Mutation_p.G167R			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	167	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)	p.G167R(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						ATTTTATTTCCATAGATGTCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	5											103.0	104.0	104.0					5																	41382241		2203	4300	6503	41417998	SO:0001583	missense	345557				CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.499G>A	5.37:g.41382241C>T	ENSP00000367032:p.Gly167Arg		41417998	A6NL04	Missense_Mutation	SNP	ENST00000377801.3	37	CCDS34150.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366557	0.82463	.	.	ENSG00000182836	ENST00000377801;ENST00000328457	T;T	0.68025	-0.3;-0.3	5.81	5.81	0.92471	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (2);	0.000000	0.85682	D	0.000000	D	0.83151	0.5192	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82583	-0.0385	10	0.49607	T	0.09	-14.2224	20.0784	0.97758	0.0:1.0:0.0:0.0	.	167	Q63HM9	PLCX3_HUMAN	R	167	ENSP00000367032:G167R;ENSP00000333751:G167R	ENSP00000333751:G167R	G	-	1	0	PLCXD3	41417998	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.453000	0.80700	2.736000	0.93811	0.655000	0.94253	GGA		0.423	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367109.1	XM_293875		Missense_Mutation
NSA2	10412	broad.mit.edu	37	5	74066518	74066518	+	Silent	SNP	T	T	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr5:74066518T>C	ENST00000296802.5	+	4	774	c.405T>C	c.(403-405)gtT>gtC	p.V135V	NSA2_ENST00000513356.1_3'UTR	NM_014886.3	NP_055701.1	O95478	NSA2_HUMAN	NSA2 ribosome biogenesis homolog (S. cerevisiae)	135	Lys-rich.				rRNA processing (GO:0006364)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.V135V(1)		breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|skin(1)	7						TATTAAAAGTTATTCGAACAG	0.363																																																1	Substitution - coding silent(1)	ovary(1)	5											84.0	85.0	85.0					5																	74066518		2203	4300	6503	74102274	SO:0001819	synonymous_variant	10412			AF077615	CCDS4025.1, CCDS75260.1	5q13.3	2010-01-18			ENSG00000164346	ENSG00000164346			30728	protein-coding gene	gene with protein product	"""hairy cell leukemia protein 1"", ""TGF beta-inducible nuclear protein 1"""	612497				11124703, 10486207	Standard	NM_014886		Approved	HUSSY-29, HCLG1, FLJ94393, TINP1	uc003kdk.2	O95478	OTTHUMG00000131273	ENST00000296802.5:c.405T>C	5.37:g.74066518T>C			74102274		Silent	SNP	ENST00000296802.5	37	CCDS4025.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	10.00	1.233338	0.22626	.	.	ENSG00000164346	ENST00000515524	.	.	.	5.63	-1.8	0.07907	.	.	.	.	.	T	0.48077	0.1480	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35151	-0.9800	4	.	.	.	.	4.728	0.12950	0.0989:0.1415:0.5038:0.2558	.	.	.	.	H	44	.	.	Y	+	1	0	NSA2	74102274	0.997000	0.39634	0.972000	0.41901	0.953000	0.61014	0.371000	0.20450	-0.423000	0.07394	0.528000	0.53228	TAT		0.363	NSA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254041.3	NM_014886		Silent
POLK	51426	broad.mit.edu	37	5	74865203	74865203	+	Silent	SNP	T	T	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr5:74865203T>C	ENST00000241436.4	+	4	466	c.294T>C	c.(292-294)aaT>aaC	p.N98N	POLK_ENST00000504026.1_Silent_p.N98N|POLK_ENST00000508526.1_Silent_p.N98N|POLK_ENST00000352007.5_Silent_p.N98N|POLK_ENST00000380481.3_Silent_p.N8N|POLK_ENST00000515295.1_Silent_p.N98N|POLK_ENST00000506928.1_3'UTR	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	98					DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.N98N(1)		endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		AAAGCCGAAATTTGAGCAATA	0.338								DNA polymerases (catalytic subunits)																																								1	Substitution - coding silent(1)	ovary(1)	5											94.0	89.0	91.0					5																	74865203		2203	4300	6503	74900959	SO:0001819	synonymous_variant	51426			AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.294T>C	5.37:g.74865203T>C			74900959	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Silent	SNP	ENST00000241436.4	37	CCDS4030.1	SNP	52	Broad																																																																																				0.338	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	NM_016218		Silent
GABRA6	2559	broad.mit.edu	37	5	161117309	161117309	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr5:161117309A>G	ENST00000274545.5	+	7	1209	c.776A>G	c.(775-777)cAg>cGg	p.Q259R	GABRA6_ENST00000523217.1_Missense_Mutation_p.Q249R|RP11-348M17.2_ENST00000521984.1_RNA			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	259					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.Q259R(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	ATTCTTTCCCAGGTGTCTTTC	0.388										TCGA Ovarian(5;0.080)																																						1	Substitution - Missense(1)	ovary(1)	5											165.0	153.0	157.0					5																	161117309		2203	4300	6503	161049887	SO:0001583	missense	2559				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.776A>G	5.37:g.161117309A>G	ENSP00000274545:p.Gln259Arg		161049887	A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	37	CCDS4356.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	21.7	4.191633	0.78902	.	.	ENSG00000145863	ENST00000274545;ENST00000523217;ENST00000523691	D;D;D	0.83914	-1.78;-1.78;-1.78	5.31	5.31	0.75309	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.91140	0.7210	M	0.80028	2.48	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.92334	0.5876	10	0.72032	D	0.01	.	15.2733	0.73723	1.0:0.0:0.0:0.0	.	259	Q16445	GBRA6_HUMAN	R	259;249;179	ENSP00000274545:Q259R;ENSP00000430527:Q249R;ENSP00000427989:Q179R	ENSP00000274545:Q259R	Q	+	2	0	GABRA6	161049887	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.228000	0.95250	2.016000	0.59253	0.533000	0.62120	CAG		0.388	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2			Missense_Mutation
TENM2	57451	broad.mit.edu	37	5	167674817	167674817	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr5:167674817C>G	ENST00000518659.1	+	27	6912	c.6873C>G	c.(6871-6873)aaC>aaG	p.N2291K	TENM2_ENST00000545108.1_Missense_Mutation_p.N2290K|TENM2_ENST00000403607.2_Missense_Mutation_p.N2115K|TENM2_ENST00000519204.1_Missense_Mutation_p.N2170K|TENM2_ENST00000520394.1_Missense_Mutation_p.N2052K	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2291					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.N2124K(1)									GAGCCTACAACAAGGCCAGCG	0.542																																																1	Substitution - Missense(1)	ovary(1)	5											84.0	86.0	85.0					5																	167674817		2019	4174	6193	167607395	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6873C>G	5.37:g.167674817C>G	ENSP00000429430:p.Asn2291Lys		167607395	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	12.05	1.820600	0.32145	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.89343	-2.02;-2.01;-2.11;-2.48;-2.5	5.44	4.57	0.56435	.	0.120909	0.85682	D	0.000000	D	0.85622	0.5739	M	0.72894	2.215	0.42943	D	0.994357	P;P;P	0.46142	0.68;0.552;0.873	B;B;B	0.38755	0.281;0.146;0.164	D	0.83937	0.0309	10	0.39692	T	0.17	.	8.4152	0.32668	0.0:0.7682:0.0:0.2318	.	2290;2291;2052	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	K	2291;2290;2170;2052;2115	ENSP00000429430:N2291K;ENSP00000438635:N2290K;ENSP00000428964:N2170K;ENSP00000427874:N2052K;ENSP00000384905:N2115K	ENSP00000384905:N2115K	N	+	3	2	ODZ2	167607395	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	1.719000	0.38011	1.298000	0.44778	0.561000	0.74099	AAC		0.542	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		Missense_Mutation
PANK3	79646	broad.mit.edu	37	5	167991007	167991007	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr5:167991007C>G	ENST00000239231.6	-	4	1015	c.699G>C	c.(697-699)gaG>gaC	p.E233D	PANK3_ENST00000520504.1_Intron	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	233					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)	p.E233D(1)		NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		TTTCAAGAGCCTCTTCAAAAC	0.413																																																1	Substitution - Missense(1)	ovary(1)	5											128.0	143.0	138.0					5																	167991007		2203	4300	6503	167923585	SO:0001583	missense	79646			AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.699G>C	5.37:g.167991007C>G	ENSP00000239231:p.Glu233Asp		167923585	D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	ENST00000239231.6	37	CCDS4368.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	13.41	2.229061	0.39399	.	.	ENSG00000120137	ENST00000239231	D	0.99660	-6.32	4.9	2.69	0.31865	.	0.000000	0.85682	D	0.000000	D	0.98454	0.9485	M	0.67517	2.055	0.49213	D	0.999769	B	0.17852	0.024	B	0.30251	0.113	D	0.97258	0.9902	10	0.37606	T	0.19	-12.7148	4.3031	0.10933	0.0:0.5476:0.0:0.4524	.	233	Q9H999	PANK3_HUMAN	D	233	ENSP00000239231:E233D	ENSP00000239231:E233D	E	-	3	2	PANK3	167923585	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	1.583000	0.36579	1.200000	0.43188	0.591000	0.81541	GAG		0.413	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252793.2	NM_024594		Missense_Mutation
MSH5	4439	broad.mit.edu	37	6	31727723	31727723	+	Silent	SNP	A	A	G			TCGA-24-0979-01	TCGA-24-0979-10			A	G	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr6:31727723A>G	ENST00000375755.3	+	18	1942	c.1656A>G	c.(1654-1656)caA>caG	p.Q552Q	MSH5_ENST00000375750.3_Silent_p.Q552Q|RNU6-850P_ENST00000516934.1_RNA|MSH5_ENST00000375742.3_Silent_p.Q569Q|MSH5_ENST00000375740.3_Silent_p.Q569Q|MSH5_ENST00000431848.2_Silent_p.Q251Q|MSH5_ENST00000534153.4_Silent_p.Q569Q|MSH5_ENST00000375703.3_Silent_p.Q552Q|MSH5-SAPCD1_ENST00000493662.2_Silent_p.Q569Q|MSH5_ENST00000395853.1_Silent_p.Q226Q	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	552					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.Q569Q(1)		breast(1)|ovary(2)|skin(2)	5						ACTCCCCACAAGTCCTTGGGG	0.567								Direct reversal of damage;Mismatch excision repair (MMR)																																								1	Substitution - coding silent(1)	ovary(1)	6											48.0	49.0	49.0					6																	31727723		2203	4300	6503	31835702	SO:0001819	synonymous_variant	4439			AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.1656A>G	6.37:g.31727723A>G			31835702	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Silent	SNP	ENST00000375755.3	37	CCDS4720.1	SNP	3	Broad																																																																																				0.567	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076243.4			Silent
ITPR3	3710	broad.mit.edu	37	6	33648441	33648441	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0979-01	TCGA-24-0979-10			A	G	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr6:33648441A>G	ENST00000374316.5	+	34	5520	c.4460A>G	c.(4459-4461)aAc>aGc	p.N1487S	ITPR3_ENST00000605930.1_Missense_Mutation_p.N1487S			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1487					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.N1487S(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TTCTCTGAGAACAGCACTTCC	0.542																																																1	Substitution - Missense(1)	ovary(1)	6											116.0	99.0	105.0					6																	33648441		2203	4300	6503	33756419	SO:0001583	missense	3710			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.4460A>G	6.37:g.33648441A>G	ENSP00000363435:p.Asn1487Ser		33756419	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	13.78	2.338243	0.41398	.	.	ENSG00000096433	ENST00000374316	T	0.62364	0.03	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.37865	0.1019	L	0.35288	1.05	0.53688	D	0.999974	B	0.24043	0.096	B	0.27076	0.076	T	0.30707	-0.9969	10	0.25751	T	0.34	-45.1102	15.439	0.75168	1.0:0.0:0.0:0.0	.	1487	Q14573	ITPR3_HUMAN	S	1487	ENSP00000363435:N1487S	ENSP00000363435:N1487S	N	+	2	0	ITPR3	33756419	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.332000	0.96446	2.034000	0.60081	0.533000	0.62120	AAC		0.542	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224		Missense_Mutation
HTR1E	3354	broad.mit.edu	37	6	87725198	87725198	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr6:87725198C>A	ENST00000305344.5	+	2	849	c.146C>A	c.(145-147)aCc>aAc	p.T49N		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	49					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.T49N(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	GCTATTGGCACCACCAAGAAG	0.547																																																1	Substitution - Missense(1)	ovary(1)	6											181.0	138.0	153.0					6																	87725198		2203	4300	6503	87781917	SO:0001583	missense	3354				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.146C>A	6.37:g.87725198C>A	ENSP00000307766:p.Thr49Asn		87781917	E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	CCDS5006.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851378	0.51270	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.38240	1.15;1.15	4.4	4.4	0.53042	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000010	T	0.48223	0.1488	M	0.77406	2.37	0.38928	D	0.957883	P	0.48640	0.913	P	0.55871	0.786	T	0.55250	-0.8170	10	0.54805	T	0.06	.	17.3169	0.87227	0.0:1.0:0.0:0.0	.	49	P28566	5HT1E_HUMAN	N	49	ENSP00000307766:T49N;ENSP00000358597:T49N	ENSP00000307766:T49N	T	+	2	0	HTR1E	87781917	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	3.313000	0.51935	2.151000	0.67156	0.508000	0.49915	ACC		0.547	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865		Missense_Mutation
PDE10A	10846	broad.mit.edu	37	6	165827029	165827029	+	Missense_Mutation	SNP	A	A	C			TCGA-24-0979-01	TCGA-24-0979-10			A	C	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr6:165827029A>C	ENST00000366882.1	-	14	1362	c.1208T>G	c.(1207-1209)aTg>aGg	p.M403R	PDE10A_ENST00000354448.4_Missense_Mutation_p.M403R|PDE10A_ENST00000539869.2_Missense_Mutation_p.M413R			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	403	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.M403R(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GACGGCAAACATTTTGAAGTT	0.378																																					Esophageal Squamous(22;308 615 5753 12038 40624)											1	Substitution - Missense(1)	ovary(1)	6											106.0	100.0	102.0					6																	165827029		2203	4300	6503	165747019	SO:0001583	missense	10846			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1208T>G	6.37:g.165827029A>C	ENSP00000355847:p.Met403Arg		165747019	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37		SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	24.5	4.534932	0.85812	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.67171	-0.25;-0.25	5.63	5.63	0.86233	GAF (2);	0.035237	0.85682	D	0.000000	T	0.67915	0.2944	L	0.33189	0.99	0.80722	D	1	D;P	0.60160	0.987;0.507	D;P	0.75020	0.985;0.538	T	0.73017	-0.4115	10	0.62326	D	0.03	.	15.87	0.79108	1.0:0.0:0.0:0.0	.	413;403	Q9ULW9;Q9Y233	.;PDE10_HUMAN	R	403;431;413;403;402	ENSP00000355847:M403R;ENSP00000346435:M403R	ENSP00000341187:M413R	M	-	2	0	PDE10A	165747019	1.000000	0.71417	0.987000	0.45799	0.996000	0.88848	8.749000	0.91619	2.145000	0.66743	0.533000	0.62120	ATG		0.378	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1			Missense_Mutation
INTS1	26173	broad.mit.edu	37	7	1539883	1539883	+	Missense_Mutation	SNP	C	C	A	rs369654195		TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr7:1539883C>A	ENST00000404767.3	-	4	554	c.469G>T	c.(469-471)Gac>Tac	p.D157Y	INTS1_ENST00000493531.1_5'UTR|INTS1_ENST00000389470.4_Missense_Mutation_p.D285Y	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	157					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		AGGGTGCTGTCAGGCTTGGCG	0.637																																																0			7											53.0	63.0	60.0					7																	1539883		2177	4268	6445	1506409	SO:0001583	missense	26173			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.469G>T	7.37:g.1539883C>A	ENSP00000385722:p.Asp157Tyr		1506409	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	37	CCDS47526.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414322	0.83449	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.57107	0.42;0.44	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.70465	0.3227	L	0.61218	1.895	0.80722	D	1	P;D	0.89917	0.951;1.0	P;D	0.80764	0.8;0.994	T	0.74423	-0.3670	10	0.87932	D	0	.	17.6996	0.88291	0.0:1.0:0.0:0.0	.	285;157	A4D212;Q8N201	.;INT1_HUMAN	Y	157;285	ENSP00000385722:D157Y;ENSP00000374121:D285Y	ENSP00000374121:D285Y	D	-	1	0	INTS1	1506409	1.000000	0.71417	0.723000	0.30687	0.953000	0.61014	7.480000	0.81109	2.415000	0.81967	0.643000	0.83706	GAC		0.637	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1			Missense_Mutation
PSMA2	5683	broad.mit.edu	37	7	42964387	42964387	+	Silent	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr7:42964387C>T	ENST00000223321.4	-	4	325	c.261G>A	c.(259-261)gtG>gtA	p.V87V	PSMA2_ENST00000442788.1_Silent_p.V87V|PSMA2_ENST00000538645.1_Silent_p.V9V|PSMA2_ENST00000445517.1_Silent_p.V17V	NM_002787.4	NP_002778.1	P25787	PSA2_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 2	87					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to virus (GO:0009615)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)	p.V87V(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)	10						GAGCTCTGTGCACAAGCACTC	0.413																																																2	Substitution - coding silent(2)	ovary(1)|kidney(1)	7											94.0	83.0	86.0					7																	42964387		2203	4300	6503	42930912	SO:0001819	synonymous_variant	5683			D00760	CCDS5467.1	7p13	2005-10-11			ENSG00000106588	ENSG00000106588		"""Proteasome (prosome, macropain) subunits"""	9531	protein-coding gene	gene with protein product		176842				2025653, 1888762	Standard	NM_002787		Approved	MU, HC3, PMSA2	uc003thy.3	P25787	OTTHUMG00000023916	ENST00000223321.4:c.261G>A	7.37:g.42964387C>T			42930912	Q6ICS6|Q9BU45	Silent	SNP	ENST00000223321.4	37	CCDS5467.1	SNP	25	Broad																																																																																				0.413	PSMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250816.1	NM_002787		Silent
URGCP	55665	broad.mit.edu	37	7	43917886	43917886	+	Silent	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr7:43917886C>T	ENST00000453200.1	-	6	1669	c.1176G>A	c.(1174-1176)ggG>ggA	p.G392G	URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Silent_p.G349G|URGCP_ENST00000447717.3_Silent_p.G349G|URGCP_ENST00000223341.7_Silent_p.G349G|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000402306.3_Silent_p.G383G|URGCP_ENST00000443736.1_Silent_p.G349G			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	392					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.G349G(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TGTTGCGCTTCCCACGGTAGG	0.418																																																1	Substitution - coding silent(1)	ovary(1)	7											129.0	124.0	126.0					7																	43917886		1968	4153	6121	43884411	SO:0001819	synonymous_variant	55665				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1176G>A	7.37:g.43917886C>T			43884411	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	ENST00000453200.1	37	CCDS47578.1	SNP	30	Broad																																																																																				0.418	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664		Silent
RABGEF1	27342	broad.mit.edu	37	7	66270245	66270245	+	Silent	SNP	T	T	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr7:66270245T>C	ENST00000284957.5	+	8	1016	c.939T>C	c.(937-939)gaT>gaC	p.D313D	KCTD7_ENST00000510829.2_Silent_p.D313D|KCTD7_ENST00000380828.2_Silent_p.D353D|RABGEF1_ENST00000439720.2_Silent_p.D326D|RABGEF1_ENST00000437078.2_Silent_p.D327D|RABGEF1_ENST00000484547.2_3'UTR|KCTD7_ENST00000451741.2_Silent_p.D313D|RABGEF1_ENST00000450873.2_Silent_p.D313D			Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	530					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein targeting to membrane (GO:0006612)	early endosome (GO:0005769)	DNA binding (GO:0003677)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|zinc ion binding (GO:0008270)	p.D313D(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|stomach(1)	27						CGTCAGCGGATGACTTCCTCC	0.537																																																1	Substitution - coding silent(1)	ovary(1)	7											144.0	115.0	125.0					7																	66270245		2203	4300	6503	65907680	SO:0001819	synonymous_variant	27342			AJ250042	CCDS5535.1, CCDS69308.1, CCDS75610.1	7q11.21	2010-07-09			ENSG00000154710	ENSG00000154710			17676	protein-coding gene	gene with protein product		609700				12505986, 11098082	Standard	NM_014504		Approved	rabex-5, RABEX5	uc003tvh.3	Q9UJ41	OTTHUMG00000129547	ENST00000284957.5:c.939T>C	7.37:g.66270245T>C			65907680	B4DZM7|Q3HKR2|Q3HKR3|Q53FG0	Silent	SNP	ENST00000284957.5	37	CCDS5535.1	SNP	51	Broad																																																																																				0.537	RABGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251737.3	NM_014504		Silent
RP1L1	94137	broad.mit.edu	37	8	10466183	10466183	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr8:10466183C>T	ENST00000382483.3	-	4	5648	c.5425G>A	c.(5425-5427)Ggg>Agg	p.G1809R		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1889					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.G1809R(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCCTCATGCCCAGAGCCTTGA	0.597																																																1	Substitution - Missense(1)	ovary(1)	8											173.0	196.0	188.0					8																	10466183		2117	4214	6331	10503593	SO:0001583	missense	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5425G>A	8.37:g.10466183C>T	ENSP00000371923:p.Gly1809Arg		10503593	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	10.66	1.412032	0.25465	.	.	ENSG00000183638	ENST00000382483	T	0.04603	3.59	4.59	0.631	0.17699	.	1.122700	0.07038	N	0.829584	T	0.04227	0.0117	L	0.27053	0.805	0.09310	N	1	B	0.28636	0.218	B	0.21546	0.035	T	0.44221	-0.9342	10	0.56958	D	0.05	-2.3662	7.7982	0.29160	0.0:0.5274:0.0:0.4726	.	1809	A6NKC6	.	R	1809	ENSP00000371923:G1809R	ENSP00000371923:G1809R	G	-	1	0	RP1L1	10503593	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	-0.039000	0.12124	0.058000	0.16222	0.455000	0.32223	GGG		0.597	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			Missense_Mutation
IDO2	169355	broad.mit.edu	37	8	39806756	39806756	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0979-01	TCGA-24-0979-10			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr8:39806756G>T	ENST00000389060.4	+	1	72	c.72G>T	c.(70-72)gaG>gaT	p.E24D	RP11-44K6.3_ENST00000517623.1_RNA|IDO2_ENST00000343295.4_3'UTR|IDO2_ENST00000502986.2_Missense_Mutation_p.E37D			Q6ZQW0	I23O2_HUMAN	indoleamine 2,3-dioxygenase 2	24					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)	p.E24D(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	18						TATCTGAAGAGTATGGCTTTC	0.393																																																1	Substitution - Missense(1)	ovary(1)	8											65.0	63.0	64.0					8																	39806756		1886	4111	5997	39925913	SO:0001583	missense	169355			AK128691		8p11.21	2012-04-19	2009-01-07	2009-01-07	ENSG00000188676	ENSG00000188676			27269	protein-coding gene	gene with protein product		612129	"""indoleamine-pyrrole 2,3 dioxygenase-like 1"""	INDOL1			Standard	NM_194294		Approved		uc010lwy.1	Q6ZQW0	OTTHUMG00000141271	ENST00000389060.4:c.72G>T	8.37:g.39806756G>T	ENSP00000426447:p.Glu24Asp		39925913	A4UD41	Missense_Mutation	SNP	ENST00000389060.4	37		SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	-	6.805	0.517572	0.13005	.	.	ENSG00000188676	ENST00000502986;ENST00000389060	T;T	0.43688	0.94;0.94	4.92	-8.18	0.01053	.	0.416420	0.21485	N	0.073771	T	0.12092	0.0294	N	0.05554	-0.025	0.21841	N	0.999513	B	0.14012	0.009	B	0.13407	0.009	T	0.14952	-1.0454	9	.	.	.	.	1.2636	0.02006	0.2512:0.2523:0.3479:0.1485	.	37	F5H5G0	.	D	37;24	ENSP00000443432:E37D;ENSP00000426447:E24D	.	E	+	3	2	IDO2	39925913	0.011000	0.17503	0.543000	0.28128	0.941000	0.58515	-2.609000	0.00886	-2.044000	0.00911	0.645000	0.84053	GAG		0.393	IDO2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372742.1	NM_194294		Missense_Mutation
PXDNL	137902	broad.mit.edu	37	8	52320807	52320807	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr8:52320807A>G	ENST00000356297.4	-	17	3477	c.3377T>C	c.(3376-3378)cTc>cCc	p.L1126P	PXDNL_ENST00000543296.1_Missense_Mutation_p.L1126P	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1126					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.L1126P(1)|p.L325P(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CGCGGAGAAGAGCCTCTGGGT	0.577																																																2	Substitution - Missense(2)	ovary(2)	8											67.0	73.0	71.0					8																	52320807		1912	4123	6035	52483360	SO:0001583	missense	137902				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3377T>C	8.37:g.52320807A>G	ENSP00000348645:p.Leu1126Pro		52483360	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	SNP	11	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.28|12.28	1.890415|1.890415	0.33348|0.33348	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000356297;ENST00000543296|ENST00000522933	T;T|.	0.71579|.	-0.58;-0.58|.	3.59|3.59	3.59|3.59	0.41128|0.41128	.|.	0.796490|.	0.10423|.	N|.	0.676440|.	D|D	0.88074|0.88074	0.6339|0.6339	H|H	0.99182|0.99182	4.46|4.46	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.90180|0.90180	0.4242|0.4242	10|5	0.87932|.	D|.	0|.	.|.	10.1066|10.1066	0.42537|0.42537	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1126|.	A1KZ92|.	PXDNL_HUMAN|.	P|P	1126|245	ENSP00000348645:L1126P;ENSP00000444865:L1126P|.	ENSP00000348645:L1126P|.	L|S	-|-	2|1	0|0	PXDNL|PXDNL	52483360|52483360	0.923000|0.923000	0.31300|0.31300	0.006000|0.006000	0.13384|0.13384	0.010000|0.010000	0.07245|0.07245	2.753000|2.753000	0.47524|0.47524	1.253000|1.253000	0.44018|0.44018	0.533000|0.533000	0.62120|0.62120	CTC|TCT		0.577	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		Missense_Mutation
ASAP1	50807	broad.mit.edu	37	8	131127887	131127887	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr8:131127887T>C	ENST00000518721.1	-	23	2386	c.2159A>G	c.(2158-2160)gAt>gGt	p.D720G	ASAP1_ENST00000357668.1_Missense_Mutation_p.D720G	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	720					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.D720G(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						GTCATCCAGATCATCATCGCT	0.418																																																1	Substitution - Missense(1)	ovary(1)	8											322.0	273.0	289.0					8																	131127887		2203	4300	6503	131197069	SO:0001583	missense	50807			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.2159A>G	8.37:g.131127887T>C	ENSP00000429900:p.Asp720Gly		131197069	B2RNV3	Missense_Mutation	SNP	ENST00000518721.1	37	CCDS6362.1	SNP	50	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.2|27.2	4.810774|4.810774	0.90707|0.90707	.|.	.|.	ENSG00000153317|ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721|ENST00000524124;ENST00000519483	T;T|.	0.09723|.	2.95;2.95|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	0.098624|.	0.64402|.	N|.	0.000002|.	T|.	0.75221|.	0.3820|.	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	D;D;D|.	0.71674|.	0.997;0.997;0.998|.	D;D;D|.	0.81914|.	0.989;0.989;0.995|.	T|.	0.76697|.	-0.2864|.	10|.	0.72032|.	D|.	0.01|.	.|.	14.4898|14.4898	0.67642|0.67642	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	720;720;723|.	B2RNV3;Q9ULH1;Q9ULH1-2|.	.;ASAP1_HUMAN;.|.	G|W	723;720;720|540;133	ENSP00000350297:D720G;ENSP00000429900:D720G|.	ENSP00000344591:D723G|.	D|X	-|-	2|3	0|0	ASAP1|ASAP1	131197069|131197069	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.993000|0.993000	0.82548|0.82548	7.948000|7.948000	0.87774|0.87774	2.087000|2.087000	0.62958|0.62958	0.528000|0.528000	0.53228|0.53228	GAT|TGA		0.418	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482		Missense_Mutation
PHF2	5253	broad.mit.edu	37	9	96416841	96416841	+	Silent	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chr9:96416841C>T	ENST00000359246.4	+	7	1303	c.936C>T	c.(934-936)acC>acT	p.T312T	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	312	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.T312T(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		AGGGCCAGACCCTCTTCATCC	0.587																																																1	Substitution - coding silent(1)	ovary(1)	9											127.0	112.0	117.0					9																	96416841		2203	4300	6503	95456662	SO:0001819	synonymous_variant	5253			AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.936C>T	9.37:g.96416841C>T			95456662	Q4VXG0|Q8N3K2|Q9Y6N4	Silent	SNP	ENST00000359246.4	37	CCDS35069.1	SNP	22	Broad																																																																																				0.587	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392		Silent
PHF8	23133	broad.mit.edu	37	X	54011432	54011432	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chrX:54011432C>G	ENST00000357988.5	-	18	2824	c.2466G>C	c.(2464-2466)tgG>tgC	p.W822C	PHF8_ENST00000338154.6_Missense_Mutation_p.W786C|PHF8_ENST00000338946.6_Missense_Mutation_p.W685C|PHF8_ENST00000322659.8_Missense_Mutation_p.W769C	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	822					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.W786C(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						TCTCGGTTCTCCAGTATGCTG	0.597																																																1	Substitution - Missense(1)	ovary(1)	X											108.0	89.0	95.0					X																	54011432		2203	4300	6503	54028157	SO:0001583	missense	23133			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.2466G>C	X.37:g.54011432C>G	ENSP00000350676:p.Trp822Cys		54028157	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	CCDS55420.1	SNP	30	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	13.76|13.76|13.76	2.332178|2.332178|2.332178	0.41297|0.41297|0.41297	.|.|.	.|.|.	ENSG00000172943|ENSG00000172943|ENSG00000172943	ENST00000443302|ENST00000396282;ENST00000375189|ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659	.|.|T;T;T;T	.|.|0.22134	.|.|2.56;2.3;2.28;1.97	5.61|5.61|5.61	4.69|4.69|4.69	0.59074|0.59074|0.59074	.|.|.	.|.|0.808276	.|.|0.11128	.|.|N	.|.|0.596654	T|T|T	0.26882|0.26882|0.26882	0.0658|0.0658|0.0658	N|N|N	0.19112|0.19112|0.19112	0.55|0.55|0.55	0.46096|0.46096|0.46096	D|D|D	0.998864|0.998864|0.998864	.|.|P;D;D;D;D	.|.|0.57257	.|.|0.94;0.979;0.964;0.979;0.964	.|.|P;P;B;P;B	.|.|0.57324	.|.|0.818;0.534;0.338;0.534;0.43	T|T|T	0.02020|0.02020|0.02020	-1.1228|-1.1228|-1.1228	5|6|10	.|0.87932|0.54805	.|D|T	.|0|0.06	-8.211|-8.211|-8.211	11.8345|11.8345|11.8345	0.52316|0.52316|0.52316	0.0:0.634:0.366:0.0|0.0:0.634:0.366:0.0|0.0:0.634:0.366:0.0	.|.|.	.|.|308;786;685;721;822	.|.|B3KMV4;Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1	.|.|.;.;.;.;PHF8_HUMAN	Q|A|C	550|690;262|822;786;685;715;769	.|.|ENSP00000350676:W822C;ENSP00000338868:W786C;ENSP00000340051:W685C;ENSP00000319473:W769C	.|ENSP00000364335:G262A|ENSP00000319473:W769C	E|G|W	-|-|-	1|2|3	0|0|0	PHF8|PHF8|PHF8	54028157|54028157|54028157	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.996000|0.996000|0.996000	0.88848|0.88848|0.88848	1.156000|1.156000|1.156000	0.31712|0.31712|0.31712	2.361000|2.361000|2.361000	0.80049|0.80049|0.80049	0.529000|0.529000|0.529000	0.55759|0.55759|0.55759	GAG|GGA|TGG		0.597	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107		Missense_Mutation
TRO	7216	broad.mit.edu	37	X	54950145	54950145	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chrX:54950145C>A	ENST00000173898.7	+	3	1292	c.1180C>A	c.(1180-1182)Ctg>Atg	p.L394M	TRO_ENST00000319167.8_Missense_Mutation_p.L394M|TRO_ENST00000484031.1_Intron|TRO_ENST00000420798.2_Intron|TRO_ENST00000375022.4_Missense_Mutation_p.L394M|TRO_ENST00000375041.2_Intron|TRO_ENST00000399736.1_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	394					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L394M(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						AGATGACTATCTGGCTCAGTT	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											35.0	41.0	39.0					X																	54950145		1950	4134	6084	54966870	SO:0001583	missense	7216			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1180C>A	X.37:g.54950145C>A	ENSP00000173898:p.Leu394Met		54966870	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	CCDS43959.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278761	0.40294	.	.	ENSG00000067445	ENST00000173898;ENST00000319167;ENST00000375022	T;T;T	0.44881	0.91;0.91;0.91	2.89	1.03	0.20045	.	.	.	.	.	T	0.39963	0.1098	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.71414	0.973;0.921	T	0.29822	-0.9999	8	.	.	.	.	3.5165	0.07727	0.0:0.5764:0.2625:0.161	.	394;394	Q96SX2;Q12816	.;TROP_HUMAN	M	394	ENSP00000173898:L394M;ENSP00000318278:L394M;ENSP00000364162:L394M	.	L	+	1	2	TRO	54966870	0.998000	0.40836	0.992000	0.48379	0.996000	0.88848	0.537000	0.23144	0.137000	0.18759	0.509000	0.49947	CTG		0.547	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157		Missense_Mutation
BEX2	84707	broad.mit.edu	37	X	102564881	102564881	+	Silent	SNP	C	C	T			TCGA-24-0979-01	TCGA-24-0979-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chrX:102564881C>T	ENST00000372677.3	-	3	291	c.24G>A	c.(22-24)gcG>gcA	p.A8A	BEX2_ENST00000536889.1_Silent_p.A40A|BEX2_ENST00000372674.1_Silent_p.A8A	NM_032621.3	NP_116010.1	Q9BXY8	BEX2_HUMAN	brain expressed X-linked 2	8					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A8A(1)		endometrium(1)|lung(1)|ovary(1)	3						GATTGTTTAACGCTCGTTCCT	0.458																																																1	Substitution - coding silent(1)	ovary(1)	X											61.0	55.0	57.0					X																	102564881		2203	4300	6503	102451537	SO:0001819	synonymous_variant	84707			BC015522	CCDS14505.1, CCDS55467.1	Xq22	2014-03-21			ENSG00000133134	ENSG00000133134			30933	protein-coding gene	gene with protein product		300691				16221301	Standard	NM_001168399		Approved	DJ79P11.1	uc004eka.3	Q9BXY8	OTTHUMG00000022095	ENST00000372677.3:c.24G>A	X.37:g.102564881C>T			102451537	B2R574|D3DXA2|F5H7H5|Q5JVV9	Silent	SNP	ENST00000372677.3	37	CCDS14505.1	SNP	19	Broad																																																																																				0.458	BEX2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057702.1	NM_032621		Silent
DUSP9	1852	broad.mit.edu	37	X	152915600	152915600	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0979-01	TCGA-24-0979-10			A	T	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-0979-01	TCGA-24-0979-10	g.chrX:152915600A>T	ENST00000342782.3	+	4	1260	c.995A>T	c.(994-996)aAc>aTc	p.N332I	DUSP9_ENST00000370167.4_Missense_Mutation_p.N332I			Q99956	DUS9_HUMAN	dual specificity phosphatase 9	332	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.N332I(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCAACTTCAACTTCATGGGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	X											231.0	201.0	212.0					X																	152915600		2203	4300	6503	152568794	SO:0001583	missense	1852			Y08302	CCDS14724.1	Xq28	2011-06-09			ENSG00000130829	ENSG00000130829		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3076	protein-coding gene	gene with protein product	"""map kinase phosphatase 4"""	300134				9030581, 9286695	Standard	NM_001395		Approved	MKP-4, MKP4	uc004fhx.4	Q99956	OTTHUMG00000024211	ENST00000342782.3:c.995A>T	X.37:g.152915600A>T	ENSP00000345853:p.Asn332Ile		152568794	D3DWU5	Missense_Mutation	SNP	ENST00000342782.3	37	CCDS14724.1	SNP	2	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	21.9|21.9	4.216033|4.216033	0.79352|0.79352	.|.	.|.	ENSG00000130829|ENSG00000130829	ENST00000370167;ENST00000342782|ENST00000433144	D;D|.	0.86497|.	-2.13;-2.13|.	4.53|4.53	3.36|3.36	0.38483|0.38483	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);|.	0.077228|.	0.52532|.	D|.	0.000075|.	T|T	0.76772|0.76772	0.4034|0.4034	M|M	0.90483|0.90483	3.12|3.12	0.54753|0.54753	D|D	0.999985|0.999985	D|.	0.56968|.	0.978|.	D|.	0.70227|.	0.968|.	T|T	0.77267|0.77267	-0.2651|-0.2651	10|5	0.87932|.	D|.	0|.	.|.	8.5938|8.5938	0.33703|0.33703	0.9043:0.0:0.0957:0.0|0.9043:0.0:0.0957:0.0	.|.	332|.	Q99956|.	DUS9_HUMAN|.	I|S	332|303	ENSP00000359186:N332I;ENSP00000345853:N332I|.	ENSP00000345853:N332I|.	N|T	+|+	2|1	0|0	DUSP9|DUSP9	152568794|152568794	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	4.998000|4.998000	0.63927|0.63927	0.693000|0.693000	0.31634|0.31634	0.430000|0.430000	0.28490|0.28490	AAC|ACT		0.592	DUSP9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061022.3	NM_001395		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-0979-01	TCGA-24-0979-10	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	17	GRCh37	CM920675	TP53	M	rs11540652	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	7518263	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln		7518263	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
SRRM2	23524	broad.mit.edu	37	16	2813698	2813699	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-0979-01	TCGA-24-0979-10	g.chr16:2813698_2813699insTG	ENST00000301740.8	+	11	3718_3719	c.3169_3170insTG	c.(3169-3171)ctgfs	p.L1057fs		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1057	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.K1058fs*1(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						ATCTCTGCAACTGAAAGGACAA	0.46																																																1	Insertion - Frameshift(1)	ovary(1)	16																																								2753700	SO:0001589	frameshift_variant	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.3170_3171dupTG	16.37:g.2813699_2813700dupTG	ENSP00000301740:p.Leu1057fs		2753699	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Frame_Shift_Ins	INS	ENST00000301740.8	37	CCDS32373.1	INS	20	Broad																																																																																				0.460	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			Frame_Shift_Ins
PTPRZ1	5803	broad.mit.edu	37	7	121678888	121678888	+	Frame_Shift_Del	DEL	G	G	-			TCGA-24-0979-01	TCGA-24-0979-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-0979-01	TCGA-24-0979-10	g.chr7:121678888delG	ENST00000393386.2	+	19	5858	c.5447delG	c.(5446-5448)tggfs	p.W1816fs	PTPRZ1_ENST00000449182.1_Frame_Shift_Del_p.W949fs	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1816	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.E1817fs*9(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AGAATGATATGGGAACATAAT	0.388																																																1	Deletion - Frameshift(1)	ovary(1)	7											113.0	106.0	109.0					7																	121678888		2203	4300	6503	121466124	SO:0001589	frameshift_variant	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5447delG	7.37:g.121678888delG	ENSP00000377047:p.Trp1816fs		121466124	A4D0W5|C9JFM0|O76043|Q9UDR6	Frame_Shift_Del	DEL	ENST00000393386.2	37	CCDS34740.1	DEL	47	Broad																																																																																				0.388	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		Frame_Shift_Del
