#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
MUC5B	727897	genome.wustl.edu	37	11	1267093	1267093	+	Missense_Mutation	SNP	G	G	A	rs199961794	byFrequency	TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	A	G	A	Unknown	Valid	Germline	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr11:1267093G>A	ENST00000529681.1	+	31	9041	c.8983G>A	c.(8983-8985)Gag>Aag	p.E2995K	MUC5B_ENST00000447027.1_Missense_Mutation_p.E2998K|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2995	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GATCCTCACAGAGCAGACCAC	0.662																																																0			11						G	LYS/GLU	28,4206		0,28,2089	104.0	134.0	124.0		8983	-0.3	0.0	11		124	29,8415		0,29,4193	yes	missense	MUC5B	NM_002458.2	56	0,57,6282	AA,AG,GG		0.3434,0.6613,0.4496	benign	2995/5763	1267093	57,12621	2117	4222	6339	1223669	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8983G>A	11.37:g.1267093G>A	ENSP00000436812:p.Glu2995Lys		1223669	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	g	4.144	0.025169	0.08054	0.006613	0.003434	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.16743	2.32;2.51	0.827	-0.261	0.12963	.	.	.	.	.	T	0.10809	0.0264	L	0.58101	1.795	0.09310	N	1	B;B	0.15141	0.012;0.003	B;B	0.09377	0.004;0.003	T	0.29610	-1.0006	9	0.87932	D	0	.	4.2297	0.10597	0.6191:0.0:0.3809:0.0	.	3578;2998	A7Y9J9;E9PBJ0	.;.	K	2995;2998;2967;2955	ENSP00000436812:E2995K;ENSP00000415793:E2998K	ENSP00000343037:E2967K	E	+	1	0	MUC5B	1223669	0.027000	0.19231	0.000000	0.03702	0.002000	0.02628	0.785000	0.26830	-0.086000	0.12550	-0.544000	0.04233	GAG		0.662	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		Missense_Mutation
KIAA0020	9933	genome.wustl.edu	37	9	2831319	2831319	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr9:2831319C>G	ENST00000397885.2	-	6	748	c.542G>C	c.(541-543)cGt>cCt	p.R181P	KIAA0020_ENST00000469168.1_5'Flank	NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	181	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.R181P(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		CTGGATCACACGAGTTGAATC	0.338																																																1	Substitution - Missense(1)	ovary(1)	9											108.0	106.0	107.0					9																	2831319		2203	4300	6503	2821319	SO:0001583	missense	9933			AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.542G>C	9.37:g.2831319C>G	ENSP00000380982:p.Arg181Pro		2821319	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Missense_Mutation	SNP	ENST00000397885.2	37	CCDS6448.2	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	26.6	4.757816	0.89843	.	.	ENSG00000080608	ENST00000397885	T	0.24350	1.86	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62478	0.2431	M	0.92604	3.325	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.974	T	0.71401	-0.4604	10	0.87932	D	0	-8.802	18.8511	0.92230	0.0:1.0:0.0:0.0	.	41;181	B2RDG4;Q15397	.;K0020_HUMAN	P	181	ENSP00000380982:R181P	ENSP00000380982:R181P	R	-	2	0	KIAA0020	2821319	1.000000	0.71417	0.687000	0.30102	0.988000	0.76386	7.037000	0.76531	2.779000	0.95612	0.650000	0.86243	CGT		0.338	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051529.3	NM_014878		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr17:7578265A>G	ENST00000269305.4	-	6	773	c.584T>C	c.(583-585)aTc>aCc	p.I195T	TP53_ENST00000359597.4_Missense_Mutation_p.I195T|TP53_ENST00000455263.2_Missense_Mutation_p.I195T|TP53_ENST00000413465.2_Missense_Mutation_p.I195T|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.I195T|TP53_ENST00000445888.2_Missense_Mutation_p.I195T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)	17											100.0	89.0	93.0					17																	7578265		2203	4300	6503	7518990	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>C	17.37:g.7578265A>G	ENSP00000269305:p.Ile195Thr		7518990	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324656	0.41197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	N	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.52099	D	0.999943	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.991;0.989;0.998;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.995;0.953;0.979;0.995;0.993;0.996	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195T;ENSP00000352610:I195T;ENSP00000269305:I195T;ENSP00000398846:I195T;ENSP00000391127:I195T;ENSP00000391478:I195T;ENSP00000425104:I63T;ENSP00000423862:I102T	ENSP00000269305:I195T	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
ZNF799	90576	genome.wustl.edu	37	19	12502419	12502419	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr19:12502419A>G	ENST00000430385.3	-	4	993	c.793T>C	c.(793-795)Tac>Cac	p.Y265H	ZNF799_ENST00000419318.1_Missense_Mutation_p.Y233H|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y52H(1)		breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						CAAGAACTGTAATCAGGGAAG	0.388																																																1	Substitution - Missense(1)	ovary(1)	19											102.0	105.0	104.0					19																	12502419		2203	4299	6502	12363419	SO:0001583	missense	90576			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.793T>C	19.37:g.12502419A>G	ENSP00000411084:p.Tyr265His		12363419		Missense_Mutation	SNP	ENST00000430385.3	37	CCDS45989.1	SNP	13	WashU	.	.	.	.	.	.	.	.	.	.	A	9.709	1.156635	0.21454	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.14893	2.47;2.47	1.31	-0.223	0.13118	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09069	0.0224	N	0.03268	-0.37	0.09310	N	1	P	0.37500	0.597	P	0.47705	0.555	T	0.33394	-0.9870	9	0.19590	T	0.45	.	3.3356	0.07100	0.4844:0.0:0.5156:0.0	.	265	Q96GE5	ZN799_HUMAN	H	233;265	ENSP00000415278:Y233H;ENSP00000411084:Y265H	ENSP00000415278:Y233H	Y	-	1	0	ZNF799	12363419	0.000000	0.05858	0.001000	0.08648	0.940000	0.58332	-0.938000	0.03938	-0.057000	0.13199	0.352000	0.21897	TAC		0.388	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821		Missense_Mutation
SOX6	55553	genome.wustl.edu	37	11	16340158	16340158	+	Silent	SNP	T	T	G			TCGA-24-1104-01	TCGA-24-1104-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr11:16340158T>G	ENST00000352083.6	-	3	356	c.279A>C	c.(277-279)cgA>cgC	p.R93R	SOX6_ENST00000316399.6_Silent_p.R93R|SOX6_ENST00000527619.1_Silent_p.R96R|SOX6_ENST00000528252.1_Silent_p.R93R|SOX6_ENST00000528429.1_Silent_p.R93R|SOX6_ENST00000396356.3_Silent_p.R93R|SOX6_ENST00000533658.1_5'UTR			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	93					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R93R(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						TAGAGGTATTTCGGAAGGAAT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	11											119.0	116.0	117.0					11																	16340158		2200	4294	6494	16296734	SO:0001819	synonymous_variant	55553			AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.279A>C	11.37:g.16340158T>G			16296734	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Silent	SNP	ENST00000352083.6	37		SNP	62	WashU																																																																																				0.408	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1	NM_033326		Silent
CECR2	27443	genome.wustl.edu	37	22	18016909	18016909	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr22:18016909A>G	ENST00000400585.2	+	10	1175	c.737A>G	c.(736-738)aAg>aGg	p.K246R	CECR2_ENST00000342247.5_Missense_Mutation_p.K359R|CECR2_ENST00000400573.5_Missense_Mutation_p.K387R|CECR2_ENST00000262608.8_Missense_Mutation_p.K388R			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	429					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)		p.K387R(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		GAGGAAAAAAAGACTAAAGAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	22											95.0	97.0	97.0					22																	18016909		1886	4106	5992	16396909	SO:0001583	missense	27443			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.737A>G	22.37:g.18016909A>G	ENSP00000383428:p.Lys246Arg		16396909	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	ENST00000400585.2	37		SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	6.439	0.449086	0.12223	.	.	ENSG00000099954	ENST00000342247;ENST00000400585;ENST00000400573;ENST00000262608	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	5.33	3.16	0.36331	Bromodomain (1);	0.338021	0.25130	N	0.032905	T	0.04543	0.0124	N	0.00926	-1.1	0.28032	N	0.934099	B;B;B	0.10296	0.001;0.003;0.003	B;B;B	0.06405	0.002;0.002;0.002	T	0.39583	-0.9607	10	0.10636	T	0.68	-21.2464	7.936	0.29931	0.6602:0.0:0.3398:0.0	.	429;246;387	Q9BXF3;B7WPH3;E2QRE6	CECR2_HUMAN;.;.	R	359;246;387;388	ENSP00000341219:K359R;ENSP00000383428:K246R;ENSP00000383417:K387R;ENSP00000262608:K388R	ENSP00000262608:K388R	K	+	2	0	CECR2	16396909	0.991000	0.36638	0.776000	0.31678	0.675000	0.39556	0.421000	0.21280	0.453000	0.26858	0.482000	0.46254	AAG		0.473	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000316226.2	NM_031413		Missense_Mutation
SDC1	6382	genome.wustl.edu	37	2	20403737	20403737	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr2:20403737C>A	ENST00000254351.4	-	3	708	c.464G>T	c.(463-465)aGg>aTg	p.R155M	SDC1_ENST00000482879.1_Intron|SDC1_ENST00000403076.1_Missense_Mutation_p.R155M|SDC1_ENST00000381150.1_Missense_Mutation_p.R155M	NM_002997.4	NP_002988	P18827	SDC1_HUMAN	syndecan 1	155					canonical Wnt signaling pathway (GO:0060070)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|myoblast development (GO:0048627)|odontogenesis (GO:0042476)|phototransduction, visible light (GO:0007603)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to toxic substance (GO:0009636)|retinoid metabolic process (GO:0001523)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|striated muscle cell development (GO:0055002)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein C-terminus binding (GO:0008022)	p.R155M(1)		NS(1)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|skin(2)	21	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)		CTGCATGTCCCTGTGGGGGTG	0.662																																																1	Substitution - Missense(1)	ovary(1)	2											93.0	91.0	92.0					2																	20403737		2203	4300	6503	20267218	SO:0001583	missense	6382			AJ551176	CCDS1697.1	2p24.1	2008-02-05			ENSG00000115884	ENSG00000115884		"""CD molecules"", ""Proteoglycans / Cell Surface : Syndecans"""	10658	protein-coding gene	gene with protein product	"""syndecan proteoglycan 1"""	186355		SDC			Standard	XM_005262621		Approved	CD138, syndecan, SYND1	uc002rdo.1	P18827	OTTHUMG00000090751	ENST00000254351.4:c.464G>T	2.37:g.20403737C>A	ENSP00000254351:p.Arg155Met		20267218	D6W523|Q53QV0|Q546D3|Q96HB7	Missense_Mutation	SNP	ENST00000254351.4	37	CCDS1697.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	12.19	1.863149	0.32884	.	.	ENSG00000115884	ENST00000254351;ENST00000381150;ENST00000403076;ENST00000429035	T;T;T;T	0.37584	2.16;2.16;1.19;1.31	3.87	2.99	0.34606	.	0.665977	0.14217	N	0.333639	T	0.50497	0.1619	M	0.68317	2.08	0.09310	N	0.999995	D;D	0.67145	0.996;0.992	P;P	0.61397	0.888;0.864	T	0.32161	-0.9917	10	0.87932	D	0	-9.0989	7.4358	0.27154	0.0:0.8822:0.0:0.1178	.	155;155	E9PHH3;P18827	.;SDC1_HUMAN	M	155;155;155;163	ENSP00000254351:R155M;ENSP00000370542:R155M;ENSP00000384613:R155M;ENSP00000400773:R163M	ENSP00000254351:R155M	R	-	2	0	SDC1	20267218	0.961000	0.32948	0.375000	0.26029	0.093000	0.18481	0.759000	0.26461	1.209000	0.43321	0.561000	0.74099	AGG		0.662	SDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207495.1	NM_001006946		Missense_Mutation
SKIDA1	387640	genome.wustl.edu	37	10	21804166	21804166	+	Silent	SNP	C	C	A			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr10:21804166C>A	ENST00000449193.2	-	4	4838	c.2586G>T	c.(2584-2586)ggG>ggT	p.G862G	SKIDA1_ENST00000444772.3_Silent_p.G783G	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	781						nucleus (GO:0005634)		p.G862G(1)									GCCACAAATCCCCATCTCTCC	0.463																																																1	Substitution - coding silent(1)	ovary(1)	10											100.0	92.0	95.0					10																	21804166		1870	4108	5978	21844172	SO:0001819	synonymous_variant	387640			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.2586G>T	10.37:g.21804166C>A			21844172	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1	SNP	22	WashU																																																																																				0.463	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371		Silent
USP48	84196	genome.wustl.edu	37	1	22021622	22021622	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1104-01	TCGA-24-1104-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr1:22021622T>A	ENST00000308271.9	-	23	3468	c.2820A>T	c.(2818-2820)aaA>aaT	p.K940N	USP48_ENST00000374732.3_Intron|USP48_ENST00000400301.1_Intron|USP48_ENST00000529637.1_Missense_Mutation_p.K952N	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	940	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.K940N(1)		NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CACCACGAACTTTTCTATGTC	0.378																																																1	Substitution - Missense(1)	ovary(1)	1											162.0	154.0	157.0					1																	22021622		2203	4299	6502	21894209	SO:0001583	missense	84196			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2820A>T	1.37:g.22021622T>A	ENSP00000309262:p.Lys940Asn		21894209	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	CCDS30623.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	20.9	4.059348	0.76074	.	.	ENSG00000090686	ENST00000308271;ENST00000529637	T;T	0.06218	3.33;3.35	5.95	2.5	0.30297	Ubiquitin supergroup (1);	0.000000	0.85682	D	0.000000	T	0.17238	0.0414	M	0.62723	1.935	0.80722	D	1	D;B;D;D	0.76494	0.998;0.378;0.999;0.985	D;B;D;P	0.80764	0.979;0.056;0.994;0.622	T	0.00638	-1.1632	10	0.48119	T	0.1	.	7.8839	0.29637	0.0:0.2719:0.0:0.7281	.	952;940;65;940	B7ZKS7;B7ZKS3;Q86UV5-6;Q86UV5	.;.;.;UBP48_HUMAN	N	940;952	ENSP00000309262:K940N;ENSP00000431949:K952N	ENSP00000309262:K940N	K	-	3	2	USP48	21894209	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.490000	0.22403	1.092000	0.41356	0.533000	0.62120	AAA		0.378	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236		Missense_Mutation
C14orf93	60686	genome.wustl.edu	37	14	23465339	23465339	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr14:23465339G>C	ENST00000299088.6	-	3	1165	c.736C>G	c.(736-738)Ctg>Gtg	p.L246V	C14orf93_ENST00000341470.4_Missense_Mutation_p.L246V|C14orf93_ENST00000406429.2_Missense_Mutation_p.L246V|C14orf93_ENST00000397377.1_Missense_Mutation_p.L66V|C14orf93_ENST00000557513.1_5'Flank|C14orf93_ENST00000397382.4_Missense_Mutation_p.L246V|RP11-298I3.4_ENST00000556503.1_RNA|RP11-298I3.4_ENST00000557615.1_RNA|RP11-298I3.4_ENST00000555294.1_RNA|C14orf93_ENST00000397379.3_Missense_Mutation_p.L246V	NM_001130708.1|NM_021944.2	NP_001124180.1|NP_068763.2	Q9H972	CN093_HUMAN	chromosome 14 open reading frame 93	246						extracellular region (GO:0005576)	poly(A) RNA binding (GO:0044822)	p.L246V(1)		kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	17	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		GGTGGTGGCAGCTTGGTTCCA	0.607																																																1	Substitution - Missense(1)	ovary(1)	14											134.0	109.0	117.0					14																	23465339		2203	4300	6503	22535179	SO:0001583	missense	60686			AK023026	CCDS9583.1, CCDS61399.1, CCDS61400.1	14q11.1	2012-09-25			ENSG00000100802	ENSG00000100802			20162	protein-coding gene	gene with protein product							Standard	XM_005267971		Approved	FLJ12154	uc001wih.3	Q9H972	OTTHUMG00000028712	ENST00000299088.6:c.736C>G	14.37:g.23465339G>C	ENSP00000299088:p.Leu246Val		22535179	B7WP03|D3DS38|D3DS39|Q86SE6|Q96CF7|Q9HA68	Missense_Mutation	SNP	ENST00000299088.6	37	CCDS9583.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	17.68	3.448970	0.63178	.	.	ENSG00000100802	ENST00000299088;ENST00000341470;ENST00000397379;ENST00000397382;ENST00000397377;ENST00000406429;ENST00000397376	T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89	5.19	3.37	0.38596	.	0.145037	0.32593	N	0.005896	T	0.35624	0.0938	N	0.24115	0.695	0.27877	N	0.939823	D;D	0.54207	0.965;0.965	P;P	0.50162	0.534;0.633	T	0.16808	-1.0390	10	0.66056	D	0.02	-11.8896	9.2415	0.37500	0.1689:0.0:0.8311:0.0	.	246;246	Q9H972;Q9H972-2	CN093_HUMAN;.	V	246;246;246;246;66;246;66	ENSP00000299088:L246V;ENSP00000341353:L246V;ENSP00000380535:L246V;ENSP00000380538:L246V;ENSP00000380533:L66V;ENSP00000384768:L246V;ENSP00000380532:L66V	ENSP00000299088:L246V	L	-	1	2	C14orf93	22535179	0.998000	0.40836	0.996000	0.52242	0.994000	0.84299	0.943000	0.29030	0.789000	0.33779	-0.119000	0.15052	CTG		0.607	C14orf93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071688.5	NM_021944		Missense_Mutation
UPB1	51733	genome.wustl.edu	37	22	24919597	24919597	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr22:24919597C>G	ENST00000326010.5	+	9	1271	c.927C>G	c.(925-927)gaC>gaG	p.D309E	UPB1_ENST00000413389.2_Missense_Mutation_p.D241E|UPB1_ENST00000498140.1_3'UTR	NM_016327.2	NP_057411.1	Q9UBR1	BUP1_HUMAN	ureidopropionase, beta	309	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	beta-ureidopropionase activity (GO:0003837)|metal ion binding (GO:0046872)	p.D309E(1)		endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	22	Colorectal(2;0.0339)					CTCACCAGGACTTTGGCTACT	0.562																																																1	Substitution - Missense(1)	ovary(1)	22											106.0	98.0	101.0					22																	24919597		2203	4300	6503	23249597	SO:0001583	missense	51733			AB013885	CCDS13827.1	22q11.2	2008-04-11			ENSG00000100024	ENSG00000100024			16297	protein-coding gene	gene with protein product		606673				10542323	Standard	XR_244378		Approved	BUP1	uc003aaf.3	Q9UBR1	OTTHUMG00000150749	ENST00000326010.5:c.927C>G	22.37:g.24919597C>G	ENSP00000324343:p.Asp309Glu		23249597	A3KMF8|Q9UIR3	Missense_Mutation	SNP	ENST00000326010.5	37	CCDS13827.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	10.68	1.419574	0.25552	.	.	ENSG00000100024	ENST00000413389;ENST00000326010	D;D	0.86297	-2.1;-2.1	5.54	1.09	0.20402	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (3);	0.043942	0.85682	N	0.000000	T	0.79499	0.4456	L	0.55017	1.72	0.58432	D	0.999999	B;B	0.27679	0.185;0.034	B;B	0.24394	0.053;0.029	T	0.69950	-0.5006	10	0.31617	T	0.26	-5.8975	5.6132	0.17416	0.0:0.4774:0.2575:0.2651	.	309;241	Q9UBR1;E7EUZ5	BUP1_HUMAN;.	E	241;309	ENSP00000406057:D241E;ENSP00000324343:D309E	ENSP00000324343:D309E	D	+	3	2	UPB1	23249597	0.979000	0.34478	0.979000	0.43373	0.218000	0.24690	0.094000	0.15107	0.688000	0.31529	-0.176000	0.13171	GAC		0.562	UPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319869.1			Missense_Mutation
KIAA1217	56243	genome.wustl.edu	37	10	24762210	24762210	+	Silent	SNP	C	C	T	rs200740349		TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr10:24762210C>T	ENST00000376454.3	+	6	930	c.900C>T	c.(898-900)ccC>ccT	p.P300P	KIAA1217_ENST00000396446.1_Silent_p.P18P|KIAA1217_ENST00000430453.2_Silent_p.P221P|KIAA1217_ENST00000376451.2_Silent_p.P18P|KIAA1217_ENST00000376462.1_Silent_p.P220P|KIAA1217_ENST00000396445.1_Silent_p.P18P|KIAA1217_ENST00000307544.6_Silent_p.P18P|KIAA1217_ENST00000458595.1_Silent_p.P300P|KIAA1217_ENST00000376452.3_Silent_p.P300P	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	300	Pro-rich. {ECO:0000255}.				embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)		p.P300P(1)		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CCCCTCGCCCCGGATCTACTG	0.527													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18607	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	10											79.0	76.0	77.0					10																	24762210		2203	4300	6503	24802216	SO:0001819	synonymous_variant	56243			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.900C>T	10.37:g.24762210C>T			24802216	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	ENST00000376454.3	37	CCDS31165.1	SNP	23	WashU																																																																																				0.527	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590		Silent
ITPR2	3709	genome.wustl.edu	37	12	26755416	26755416	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr12:26755416G>T	ENST00000381340.3	-	28	3981	c.3565C>A	c.(3565-3567)Cta>Ata	p.L1189I		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1189					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.L1189I(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AGTTTACTTAGCCTGATCAAA	0.328																																																1	Substitution - Missense(1)	ovary(1)	12											78.0	73.0	74.0					12																	26755416		1807	4068	5875	26646683	SO:0001583	missense	3709			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.3565C>A	12.37:g.26755416G>T	ENSP00000370744:p.Leu1189Ile		26646683	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033637	0.75504	.	.	ENSG00000123104	ENST00000381340	D	0.98474	-4.95	5.46	3.61	0.41365	Intracellular calcium-release channel (1);	0.000000	0.85682	D	0.000000	D	0.98033	0.9352	L	0.57536	1.79	0.80722	D	1	D	0.62365	0.991	D	0.68039	0.955	D	0.97018	0.9741	10	0.32370	T	0.25	.	10.8047	0.46509	0.2038:0.0:0.7962:0.0	.	1189	Q14571	ITPR2_HUMAN	I	1189	ENSP00000370744:L1189I	ENSP00000370744:L1189I	L	-	1	2	ITPR2	26646683	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.371000	0.44248	1.548000	0.49413	0.655000	0.94253	CTA		0.328	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		Missense_Mutation
HOXA1	3198	genome.wustl.edu	37	7	27135485	27135485	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr7:27135485C>G	ENST00000343060.4	-	1	108	c.47G>C	c.(46-48)aGc>aCc	p.S16T	HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000428939.3_RNA|HOXA1_ENST00000355633.5_Missense_Mutation_p.S16T|HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000495032.1_RNA|HOTAIRM1_ENST00000434063.3_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	16					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.S16T(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GTCGCCACTGCTAAGTATGGG	0.582											OREG0003750	type=REGULATORY REGION|Gene=BC031342|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				1	Substitution - Missense(1)	ovary(1)	7											93.0	102.0	99.0					7																	27135485		2203	4300	6503	27102010	SO:0001583	missense	3198				CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.47G>C	7.37:g.27135485C>G	ENSP00000343246:p.Ser16Thr	792	27102010	A4D184|B2R8U7|O43363	Missense_Mutation	SNP	ENST00000343060.4	37	CCDS5401.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	9.912	1.209832	0.22289	.	.	ENSG00000105991	ENST00000343060;ENST00000355633	T;T	0.30714	1.52;1.52	4.62	3.65	0.41850	.	0.311267	0.32785	N	0.005655	T	0.25269	0.0614	L	0.47190	1.495	0.32374	N	0.555498	B;B	0.22211	0.023;0.066	B;B	0.26864	0.007;0.074	T	0.23655	-1.0182	10	0.54805	T	0.06	.	6.6379	0.22893	0.1824:0.7128:0.0:0.1048	.	16;16	P49639;E7ERT8	HXA1_HUMAN;.	T	16	ENSP00000343246:S16T;ENSP00000347851:S16T	ENSP00000343246:S16T	S	-	2	0	HOXA1	27102010	1.000000	0.71417	1.000000	0.80357	0.609000	0.37215	2.232000	0.43018	2.398000	0.81561	0.297000	0.19635	AGC		0.582	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358454.1			Missense_Mutation
MAP3K7CL	56911	genome.wustl.edu	37	21	30532351	30532351	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr21:30532351G>C	ENST00000399947.2	+	8	799	c.522G>C	c.(520-522)aaG>aaC	p.K174N	MAP3K7CL_ENST00000339024.4_Missense_Mutation_p.K74N|MAP3K7CL_ENST00000399928.1_Missense_Mutation_p.K74N|MAP3K7CL_ENST00000399925.1_Missense_Mutation_p.K74N|MAP3K7CL_ENST00000545939.1_Missense_Mutation_p.K68N|MAP3K7CL_ENST00000399935.2_Missense_Mutation_p.K74N|MAP3K7CL_ENST00000286791.5_3'UTR|MAP3K7CL_ENST00000399934.1_Missense_Mutation_p.K74N|MAP3K7CL_ENST00000399926.1_Missense_Mutation_p.K74N|MAP3K7CL_ENST00000341618.4_Missense_Mutation_p.K174N	NM_020152.2	NP_064537.1	P57077	M3KCL_HUMAN	MAP3K7 C-terminal like	174						cytosol (GO:0005829)|nucleus (GO:0005634)		p.K174N(1)									AGGTCAAAAAGGAAATCACCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	21											167.0	141.0	150.0					21																	30532351		2203	4300	6503	29454222	SO:0001583	missense	56911			AF269161	CCDS13584.1, CCDS68182.1, CCDS74775.1	21q22.3	2013-02-22	2013-02-22	2013-02-22	ENSG00000156265	ENSG00000156265			16457	protein-coding gene	gene with protein product		611110	"""chromosome 21 open reading frame 7"""	C21orf7			Standard	NM_020152		Approved	TAKL, TAK1L, TAKL-1, TAKL-2, TAKL-4	uc002ynf.3	P57077	OTTHUMG00000078806	ENST00000399947.2:c.522G>C	21.37:g.30532351G>C	ENSP00000382828:p.Lys174Asn		29454222	D3DSE0|Q8TCL9	Missense_Mutation	SNP	ENST00000399947.2	37	CCDS13584.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605061	0.46423	.	.	ENSG00000156265	ENST00000545939;ENST00000341618;ENST00000399935;ENST00000399934;ENST00000399947;ENST00000339024;ENST00000399928;ENST00000399926;ENST00000399925;ENST00000451489	T;T	0.48836	0.8;0.8	4.65	-1.58	0.08479	.	0.186457	0.45126	D	0.000396	T	0.55289	0.1911	L	0.47716	1.5	0.40466	D	0.980299	D;D	0.71674	0.998;0.996	D;P	0.68943	0.961;0.856	T	0.55438	-0.8141	10	0.66056	D	0.02	-13.4452	12.208	0.54363	0.3538:0.0:0.6462:0.0	.	74;174	B0EVZ8;P57077	.;TAK1L_HUMAN	N	68;174;74;74;174;74;74;74;74;74	ENSP00000343212:K174N;ENSP00000382828:K174N	ENSP00000345777:K74N	K	+	3	2	C21orf7	29454222	0.979000	0.34478	0.934000	0.37439	0.892000	0.51952	0.143000	0.16115	-0.442000	0.07190	-0.793000	0.03317	AAG		0.522	MAP3K7CL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000171865.2	NM_020152		Missense_Mutation
PDCD6IP	10015	genome.wustl.edu	37	3	33894096	33894096	+	Silent	SNP	A	A	T			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr3:33894096A>T	ENST00000307296.3	+	13	2135	c.1758A>T	c.(1756-1758)acA>acT	p.T586T	PDCD6IP_ENST00000457054.2_Silent_p.T591T			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	586	Interaction with EIAV p9.|Self-association.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)	p.T586T(1)		central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						AGTTTTTGACAGCCCTGGCTC	0.378																																																1	Substitution - coding silent(1)	ovary(1)	3											21.0	22.0	22.0					3																	33894096		2102	4233	6335	33869100	SO:0001819	synonymous_variant	10015			BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.1758A>T	3.37:g.33894096A>T			33869100	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Silent	SNP	ENST00000307296.3	37	CCDS2660.1	SNP	7	WashU																																																																																				0.378	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2			Silent
UBAP2	55833	genome.wustl.edu	37	9	33986812	33986812	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr9:33986812C>G	ENST00000379238.1	-	6	583	c.466G>C	c.(466-468)Gat>Cat	p.D156H	UBAP2_ENST00000379239.4_5'UTR|UBAP2_ENST00000418786.2_Missense_Mutation_p.D156H|UBAP2_ENST00000360802.1_Missense_Mutation_p.D156H|UBAP2_ENST00000539807.1_Intron|UBAP2_ENST00000449054.1_Missense_Mutation_p.D156H					ubiquitin associated protein 2									p.D156H(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		TGATTGCAATCAATTCCATTT	0.413																																																1	Substitution - Missense(1)	ovary(1)	9											235.0	238.0	237.0					9																	33986812		2203	4300	6503	33976812	SO:0001583	missense	55833			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.466G>C	9.37:g.33986812C>G	ENSP00000368540:p.Asp156His		33976812		Missense_Mutation	SNP	ENST00000379238.1	37	CCDS6547.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	20.7	4.033618	0.75504	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379260;ENST00000418786;ENST00000412543;ENST00000421278	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	5.45	4.56	0.56223	.	0.097410	0.64402	D	0.000002	T	0.56046	0.1959	M	0.79475	2.455	0.58432	D	0.999997	D;D;D;D;D	0.89917	0.993;1.0;0.993;0.999;0.999	D;D;P;D;D	0.72625	0.918;0.978;0.832;0.951;0.969	T	0.61884	-0.6971	10	0.66056	D	0.02	-15.4385	14.4884	0.67634	0.0:0.9287:0.0:0.0713	.	156;81;118;81;156	E7EWG4;F5H4D5;F5H2C8;B4DH66;Q5T6F2	.;.;.;.;UBAP2_HUMAN	H	156;156;156;118;96;156;156;32	ENSP00000368540:D156H;ENSP00000416932:D156H;ENSP00000354039:D156H;ENSP00000404436:D156H;ENSP00000414800:D156H	ENSP00000354039:D156H	D	-	1	0	UBAP2	33976812	1.000000	0.71417	0.999000	0.59377	0.938000	0.57974	4.357000	0.59436	1.287000	0.44583	0.561000	0.74099	GAT		0.413	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001071.1	NM_018449		Missense_Mutation
SLC5A3	6526	genome.wustl.edu	37	21	35467850	35467850	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1104-01	TCGA-24-1104-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr21:35467850G>T	ENST00000381151.3	+	2	865	c.353G>T	c.(352-354)gGt>gTt	p.G118V	MRPS6_ENST00000399312.2_Intron|AP000320.7_ENST00000362077.4_RNA|SLC5A3_ENST00000608209.1_Missense_Mutation_p.G118V			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	118					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						AAGCGATTTGGTGGCCATAGG	0.443																																																0			21											210.0	208.0	209.0					21																	35467850		2203	4300	6503	34389720	SO:0001583	missense	6526				CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.353G>T	21.37:g.35467850G>T	ENSP00000370543:p.Gly118Val		34389720	O43489	Missense_Mutation	SNP	ENST00000381151.3	37	CCDS33549.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	18.78	3.697701	0.68386	.	.	ENSG00000198743	ENST00000381151	D	0.89270	-2.49	5.92	5.92	0.95590	.	0.050917	0.85682	D	0.000000	D	0.96291	0.8790	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96600	0.9444	10	0.87932	D	0	.	19.9244	0.97099	0.0:0.0:1.0:0.0	.	118	P53794	SC5A3_HUMAN	V	118	ENSP00000370543:G118V	ENSP00000370543:G118V	G	+	2	0	SLC5A3	34389720	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.858000	0.99539	2.805000	0.96524	0.609000	0.83330	GGT		0.443	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1			Missense_Mutation
FAM47C	442444	genome.wustl.edu	37	X	37028554	37028554	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	T	C	T	Unknown	Valid	Germline	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chrX:37028554C>T	ENST00000358047.3	+	1	2123	c.2071C>T	c.(2071-2073)Cgc>Tgc	p.R691C		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	691								p.R691C(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						ATCTCATCTCCGCCCAGAGCC	0.657																																																2	Substitution - Missense(2)	lung(2)	X											38.0	37.0	37.0					X																	37028554		2202	4299	6501	36938475	SO:0001583	missense	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2071C>T	X.37:g.37028554C>T	ENSP00000367913:p.Arg691Cys		36938475	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	-	2.988	-0.208750	0.06140	.	.	ENSG00000198173	ENST00000358047	T	0.21543	2.0	1.06	-0.16	0.13375	.	.	.	.	.	T	0.10380	0.0254	N	0.13272	0.32	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.29941	-0.9995	9	0.37606	T	0.19	.	4.5629	0.12168	0.0:0.5278:0.0:0.4722	.	691	Q5HY64	FA47C_HUMAN	C	691	ENSP00000367913:R691C	ENSP00000367913:R691C	R	+	1	0	FAM47C	36938475	0.000000	0.05858	0.007000	0.13788	0.007000	0.05969	0.436000	0.21526	-0.704000	0.05042	-0.741000	0.03529	CGC		0.657	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		Missense_Mutation
HEATR5B	54497	genome.wustl.edu	37	2	37215847	37215847	+	Silent	SNP	C	C	T			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr2:37215847C>T	ENST00000233099.5	-	35	5948	c.5853G>A	c.(5851-5853)gcG>gcA	p.A1951A	HEATR5B_ENST00000354531.2_Silent_p.A1862A	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1951						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.A1951A(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				CTTCTTGAACCGCTAAAAGCT	0.353																																																1	Substitution - coding silent(1)	ovary(1)	2											75.0	74.0	74.0					2																	37215847		2203	4300	6503	37069351	SO:0001819	synonymous_variant	54497			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.5853G>A	2.37:g.37215847C>T			37069351	B5MDU8|Q7Z3B2|Q9NVL7	Silent	SNP	ENST00000233099.5	37	CCDS33181.1	SNP	23	WashU																																																																																				0.353	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024		Silent
CNTNAP1	8506	genome.wustl.edu	37	17	40847741	40847741	+	Silent	SNP	T	T	A			TCGA-24-1104-01	TCGA-24-1104-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr17:40847741T>A	ENST00000264638.4	+	19	3412	c.3195T>A	c.(3193-3195)ccT>ccA	p.P1065P	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	1065					axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		ACCCCCGGCCTGGTCGGCCTG	0.652																																																0			17											58.0	57.0	57.0					17																	40847741		2203	4300	6503	38101267	SO:0001819	synonymous_variant	8506			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.3195T>A	17.37:g.40847741T>A			38101267		Silent	SNP	ENST00000264638.4	37	CCDS11436.1	SNP	55	WashU																																																																																				0.652	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632		Silent
PTPRT	11122	genome.wustl.edu	37	20	40714466	40714466	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1104-01	TCGA-24-1104-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr20:40714466T>C	ENST00000373187.1	-	28	3873	c.3874A>G	c.(3874-3876)Acc>Gcc	p.T1292A	PTPRT_ENST00000373193.3_Missense_Mutation_p.T1295A|PTPRT_ENST00000373198.4_Missense_Mutation_p.T1311A|PTPRT_ENST00000356100.2_Missense_Mutation_p.T1301A|PTPRT_ENST00000373184.1_Missense_Mutation_p.T1302A|PTPRT_ENST00000373190.1_Missense_Mutation_p.T1291A|PTPRT_ENST00000373201.1_Missense_Mutation_p.T1282A			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1292	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.T1314A(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CACCCGGAGGTCTTCTCAGGC	0.522																																																1	Substitution - Missense(1)	ovary(1)	20											72.0	74.0	73.0					20																	40714466		1943	4139	6082	40147880	SO:0001583	missense	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3874A>G	20.37:g.40714466T>C	ENSP00000362283:p.Thr1292Ala		40147880	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	14.53	2.561626	0.45590	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58;2.58;2.58	5.31	5.31	0.75309	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.113243	0.64402	D	0.000011	T	0.13372	0.0324	N	0.25825	0.765	0.44417	D	0.997339	B;B	0.24258	0.1;0.072	B;B	0.30029	0.067;0.11	T	0.06215	-1.0839	10	0.66056	D	0.02	.	15.4285	0.75072	0.0:0.0:0.0:1.0	.	1314;1292	O14522-1;O14522	.;PTPRT_HUMAN	A	1291;1292;1295;1301;1314;1302;1282	ENSP00000362286:T1291A;ENSP00000362283:T1292A;ENSP00000362289:T1295A;ENSP00000348408:T1301A;ENSP00000362294:T1314A;ENSP00000362280:T1302A;ENSP00000362297:T1282A	ENSP00000348408:T1301A	T	-	1	0	PTPRT	40147880	0.999000	0.42202	1.000000	0.80357	0.936000	0.57629	2.539000	0.45718	2.232000	0.73038	0.533000	0.62120	ACC		0.522	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			Missense_Mutation
KBTBD6	89890	genome.wustl.edu	37	13	41705167	41705167	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr13:41705167A>C	ENST00000379485.1	-	1	1715	c.1481T>G	c.(1480-1482)aTg>aGg	p.M494R	KBTBD6_ENST00000499385.2_Missense_Mutation_p.M428R	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	494								p.M494R(1)		NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		ATAACAGAACATGCGCTTACT	0.448																																																1	Substitution - Missense(1)	ovary(1)	13											75.0	72.0	73.0					13																	41705167		2203	4300	6503	40603167	SO:0001583	missense	89890			AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1481T>G	13.37:g.41705167A>C	ENSP00000368799:p.Met494Arg		40603167	Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	ENST00000379485.1	37	CCDS9376.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	a	17.03	3.285389	0.59867	.	.	ENSG00000165572	ENST00000379485;ENST00000499385	T;T	0.66995	-0.24;-0.24	3.8	3.8	0.43715	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.66436	0.2789	L	0.34521	1.04	0.46356	D	0.999002	D;D	0.61080	0.989;0.981	P;P	0.56612	0.802;0.567	T	0.69993	-0.4994	10	0.87932	D	0	.	10.7997	0.46480	1.0:0.0:0.0:0.0	.	428;494	F5GZN7;Q86V97	.;KBTB6_HUMAN	R	494;428	ENSP00000368799:M494R;ENSP00000444326:M428R	ENSP00000368799:M494R	M	-	2	0	KBTBD6	40603167	1.000000	0.71417	0.988000	0.46212	0.932000	0.56968	7.300000	0.78841	1.731000	0.51592	0.379000	0.24179	ATG		0.448	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903		Missense_Mutation
COX6B1	1340	genome.wustl.edu	37	19	36139786	36139786	+	5'UTR	SNP	C	C	T	rs5827936		TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr19:36139786C>T	ENST00000592141.1	+	0	245				COX6B1_ENST00000392201.1_5'UTR|COX6B1_ENST00000246554.3_Intron			P14854	CX6B1_HUMAN	cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)						cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)	p.Q6*(1)		lung(6)|prostate(1)|stomach(1)	8	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCCTCATCCTCAGATACCGGG	0.612																																																1	Substitution - Nonsense(1)	ovary(1)	19											54.0	50.0	52.0					19																	36139786		876	1991	2867	40831626	SO:0001623	5_prime_UTR_variant	1340			BC001015	CCDS12469.1	19q13.1	2011-07-04	2010-01-07	2004-08-12	ENSG00000126267	ENSG00000126267	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2280	protein-coding gene	gene with protein product		124089	"""cytochrome c oxidase subunit Vib"", ""cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)"""	COX6B		1650756	Standard	NM_001863		Approved	COXG	uc002oav.3	P14854	OTTHUMG00000048112	ENST00000592141.1:c.-21C>T	19.37:g.36139786C>T			40831626	B2R5C9|Q6IBL4	Nonsense_Mutation	SNP	ENST00000592141.1	37	CCDS12469.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	c	15.77	2.932199	0.52866	.	.	ENSG00000126267	ENST00000392201	.	.	.	2.83	-2.09	0.07232	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.9084	0.03282	0.1925:0.3005:0.3787:0.1283	.	.	.	.	X	6	.	ENSP00000376037:Q6X	Q	+	1	0	COX6B1	40831626	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.559000	0.05971	-0.339000	0.08401	0.639000	0.83563	CAG		0.612	COX6B1-004	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459068.3	NM_001863		Nonsense_Mutation
SHF	90525	genome.wustl.edu	37	15	45464501	45464501	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr15:45464501G>T	ENST00000290894.8	-	6	1303	c.809C>A	c.(808-810)cCg>cAg	p.P270Q	RP11-519G16.2_ENST00000560034.1_RNA|SHF_ENST00000318390.6_Missense_Mutation_p.P280Q|SHF_ENST00000561091.1_5'Flank|SHF_ENST00000560540.1_Missense_Mutation_p.P288Q|SHF_ENST00000458022.2_Missense_Mutation_p.P86Q|SHF_ENST00000560734.1_Intron|SHF_ENST00000560471.1_Missense_Mutation_p.P335Q	NM_138356.2	NP_612365			Src homology 2 domain containing F									p.P270Q(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(2)	12		all_cancers(109;8.13e-11)|all_epithelial(112;6.29e-09)|Lung NSC(122;3.57e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.1e-16)|GBM - Glioblastoma multiforme(94;5.98e-06)		GCTCTTCTCCGGTCCTTCAAA	0.582																																																1	Substitution - Missense(1)	ovary(1)	15											30.0	34.0	33.0					15																	45464501		2198	4298	6496	43251793	SO:0001583	missense	90525			BC007586	CCDS10120.2, CCDS73721.1	15q21.1	2013-02-14			ENSG00000138606	ENSG00000138606		"""SH2 domain containing"""	25116	protein-coding gene	gene with protein product						11095946	Standard	NM_138356		Approved		uc001zuy.3	Q7M4L6	OTTHUMG00000131353	ENST00000290894.8:c.809C>A	15.37:g.45464501G>T	ENSP00000290894:p.Pro270Gln		43251793		Missense_Mutation	SNP	ENST00000290894.8	37	CCDS10120.2	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323377	0.24080	.	.	ENSG00000138606	ENST00000290894;ENST00000361989;ENST00000318390;ENST00000458022;ENST00000413198	T;T;T	0.31247	1.5;1.5;1.5	4.06	3.12	0.35913	.	1.124360	0.06298	N	0.700406	T	0.26593	0.0650	L	0.29908	0.895	0.19300	N	0.999979	P;B;P;B	0.37141	0.584;0.041;0.507;0.19	B;B;B;B	0.40636	0.319;0.041;0.335;0.086	T	0.16012	-1.0417	10	0.21540	T	0.41	-0.9081	9.0493	0.36367	0.1115:0.0:0.8885:0.0	.	133;213;280;270	Q8N9I8;E7EWB7;F8W6K9;Q7M4L6	.;.;.;SHF_HUMAN	Q	270;270;280;86;213	ENSP00000290894:P270Q;ENSP00000315978:P280Q;ENSP00000411530:P86Q	ENSP00000290894:P270Q	P	-	2	0	SHF	43251793	0.051000	0.20477	0.994000	0.49952	0.987000	0.75469	1.661000	0.37408	1.976000	0.57569	0.563000	0.77884	CCG		0.582	SHF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254141.2	NM_138356		Missense_Mutation
HOXB1	3211	genome.wustl.edu	37	17	46608035	46608035	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1104-01	TCGA-24-1104-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr17:46608035T>A	ENST00000239174.6	-	1	324	c.232A>T	c.(232-234)Agc>Tgc	p.S78C	HOXB1_ENST00000577092.1_Missense_Mutation_p.S78C	NM_002144.3	NP_002135.2	P14653	HXB1_HUMAN	homeobox B1	78					anatomical structure formation involved in morphogenesis (GO:0048646)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|multicellular organismal development (GO:0007275)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)	p.S78C(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GGCGCGGAGCTGGGGAAGGGC	0.672																																																1	Substitution - Missense(1)	ovary(1)	17											36.0	42.0	40.0					17																	46608035		2203	4297	6500	43963034	SO:0001583	missense	3211				CCDS32675.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120094	ENSG00000120094		"""Homeoboxes / ANTP class : HOXL subclass"""	5111	protein-coding gene	gene with protein product		142968	"""homeo box B1"""	HOX2, HOX2I		1973146, 1358459	Standard	NM_002144		Approved		uc002ink.1	P14653	OTTHUMG00000159929	ENST00000239174.6:c.232A>T	17.37:g.46608035T>A	ENSP00000355140:p.Ser78Cys		43963034	Q4VB03	Missense_Mutation	SNP	ENST00000239174.6	37	CCDS32675.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	14.98	2.696485	0.48202	.	.	ENSG00000120094	ENST00000239174	D	0.89939	-2.59	4.57	4.57	0.56435	.	0.000000	0.52532	D	0.000073	D	0.84365	0.5456	L	0.51914	1.62	0.25838	N	0.984093	B	0.12630	0.006	B	0.08055	0.003	T	0.76743	-0.2847	10	0.59425	D	0.04	.	9.0846	0.36572	0.2061:0.0:0.0:0.7939	.	78	P14653	HXB1_HUMAN	C	78	ENSP00000355140:S78C	ENSP00000355140:S78C	S	-	1	0	HOXB1	43963034	0.011000	0.17503	1.000000	0.80357	0.946000	0.59487	0.781000	0.26774	1.920000	0.55613	0.450000	0.29827	AGC		0.672	HOXB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358383.3			Missense_Mutation
TESK2	10420	genome.wustl.edu	37	1	45810773	45810773	+	Silent	SNP	G	G	C			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr1:45810773G>C	ENST00000372086.3	-	11	1855	c.1455C>G	c.(1453-1455)cgC>cgG	p.R485R	TESK2_ENST00000538496.1_Silent_p.R402R|TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_Silent_p.R456R|TESK2_ENST00000341771.6_Silent_p.R456R	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	485					actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.R469R(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					GACTACTTAGGCGTGGTGGGG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											126.0	131.0	130.0					1																	45810773		1911	4121	6032	45583360	SO:0001819	synonymous_variant	10420			AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.1455C>G	1.37:g.45810773G>C			45583360	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Silent	SNP	ENST00000372086.3	37	CCDS41323.1	SNP	42	WashU																																																																																				0.562	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020523.1	NM_007170		Silent
HTR2A	3356	genome.wustl.edu	37	13	47466582	47466582	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr13:47466582A>G	ENST00000378688.4	-	2	687	c.556T>C	c.(556-558)Ttc>Ctc	p.F186L	HTR2A_ENST00000542664.1_Missense_Mutation_p.F186L|HTR2A_ENST00000543956.1_Missense_Mutation_p.F102L			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	186					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.F186L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CTGGAGTTGAAGCGGCTGTGG	0.493																																																1	Substitution - Missense(1)	ovary(1)	13											279.0	278.0	278.0					13																	47466582		2203	4300	6503	46364583	SO:0001583	missense	3356			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.556T>C	13.37:g.47466582A>G	ENSP00000367959:p.Phe186Leu		46364583	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	ENST00000378688.4	37	CCDS9405.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	34	5.320933	0.95682	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.70749	2.81;-0.51;2.81	6.16	6.16	0.99307	GPCR, rhodopsin-like superfamily (1);	0.052322	0.85682	D	0.000000	T	0.69949	0.3168	N	0.21194	0.64	0.58432	D	0.999993	P;D	0.56287	0.93;0.975	P;P	0.60886	0.669;0.88	T	0.64575	-0.6375	10	0.08381	T	0.77	.	15.9872	0.80168	1.0:0.0:0.0:0.0	.	102;186	F5GWE8;P28223	.;5HT2A_HUMAN	L	186;102;186	ENSP00000367959:F186L;ENSP00000441861:F102L;ENSP00000437737:F186L	ENSP00000367959:F186L	F	-	1	0	HTR2A	46364583	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.348000	0.79366	2.367000	0.80283	0.528000	0.53228	TTC		0.493	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621		Missense_Mutation
MED4	29079	genome.wustl.edu	37	13	48664501	48664501	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr13:48664501C>A	ENST00000258648.2	-	2	204	c.179G>T	c.(178-180)gGa>gTa	p.G60V	MED4_ENST00000378586.1_Missense_Mutation_p.G14V	NM_014166.3	NP_054885.1	Q9NPJ6	MED4_HUMAN	mediator complex subunit 4	60					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.G60V(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)	8		all_cancers(8;2.93e-25)|all_epithelial(8;4.38e-13)|all_lung(13;7.37e-06)|all_hematologic(8;8.61e-05)|Breast(56;0.000141)|Lung NSC(96;0.000518)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.00559)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;5.18e-07)		GTTTTCCTCTCCAGCCTGTAA	0.303																																					Pancreas(38;399 1016 9170 13426 20145)											1	Substitution - Missense(1)	ovary(1)	13											123.0	142.0	135.0					13																	48664501		2203	4300	6503	47562502	SO:0001583	missense	29079			AF161475	CCDS9408.1, CCDS59241.1	13q14.12	2008-02-05	2007-07-30	2004-11-09	ENSG00000136146	ENSG00000136146			17903	protein-coding gene	gene with protein product		605718	"""vitamin D receptor interacting protein"", ""mediator of RNA polymerase II transcription, subunit 4 homolog (S. cerevisiae)"""	VDRIP		10235266, 11042152	Standard	NM_014166		Approved	HSPC126, DRIP36, TRAP36	uc001vby.2	Q9NPJ6	OTTHUMG00000016891	ENST00000258648.2:c.179G>T	13.37:g.48664501C>A	ENSP00000258648:p.Gly60Val		47562502	B4DX67|Q53GB4|Q53H68|Q5T912|Q6FHC4|Q6IA79|Q9BS95|Q9NYR5	Missense_Mutation	SNP	ENST00000258648.2	37	CCDS9408.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	12.36	1.915088	0.33815	.	.	ENSG00000136146	ENST00000258648;ENST00000378594;ENST00000378586;ENST00000417167	.	.	.	6.17	2.3	0.28687	.	0.148370	0.64402	D	0.000008	T	0.42200	0.1192	L	0.39898	1.24	0.80722	D	1	B;B	0.19706	0.038;0.0	B;B	0.13407	0.009;0.002	T	0.16364	-1.0405	9	0.31617	T	0.26	-10.8346	6.3636	0.21443	0.1267:0.6565:0.0:0.2168	.	38;60	E9PDW1;Q9NPJ6	.;MED4_HUMAN	V	60;38;14;38	.	ENSP00000258648:G60V	G	-	2	0	MED4	47562502	1.000000	0.71417	0.990000	0.47175	0.581000	0.36288	2.594000	0.46189	0.429000	0.26202	0.655000	0.94253	GGA		0.303	MED4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044863.1	NM_014166		Missense_Mutation
ERCC6	2074	genome.wustl.edu	37	10	50708699	50708699	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr10:50708699G>A	ENST00000355832.5	-	7	1648	c.1570C>T	c.(1570-1572)Cag>Tag	p.Q524*	ERCC6_ENST00000542458.1_5'UTR	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	524	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)	p.Q524*(1)		breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CCTGCCTGCTGGCAGTGCAAT	0.478								Direct reversal of damage;Nucleotide excision repair (NER)																																								1	Substitution - Nonsense(1)	ovary(1)	10											124.0	109.0	114.0					10																	50708699		2203	4300	6503	50378705	SO:0001587	stop_gained	2074			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.1570C>T	10.37:g.50708699G>A	ENSP00000348089:p.Gln524*		50378705	D3DX94|Q5W0L9	Nonsense_Mutation	SNP	ENST00000355832.5	37	CCDS7229.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	38	7.083549	0.98051	.	.	ENSG00000225830	ENST00000355832	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-14.9592	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	524	.	ENSP00000348089:Q524X	Q	-	1	0	ERCC6	50378705	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.863000	0.87023	2.941000	0.99782	0.655000	0.94253	CAG		0.478	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124		Nonsense_Mutation
ALAS1	211	genome.wustl.edu	37	3	52239987	52239987	+	Silent	SNP	G	G	C			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr3:52239987G>C	ENST00000394965.2	+	7	1293	c.933G>C	c.(931-933)tcG>tcC	p.S311S	ALAS1_ENST00000469224.1_Silent_p.S311S|ALAS1_ENST00000484952.1_Silent_p.S311S|ALAS1_ENST00000310271.2_Silent_p.S311S	NM_000688.5	NP_000679.1	P13196	HEM1_HUMAN	aminolevulinate, delta-, synthase 1	311					cellular lipid metabolic process (GO:0044255)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5-aminolevulinate synthase activity (GO:0003870)|pyridoxal phosphate binding (GO:0030170)	p.S311S(1)		endometrium(3)|kidney(3)|large_intestine(7)|liver(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)	TGTTTTCCTCGTGCTTTGTGG	0.483																																																1	Substitution - coding silent(1)	ovary(1)	3											166.0	157.0	160.0					3																	52239987		2203	4300	6503	52215027	SO:0001819	synonymous_variant	211			X56351	CCDS2847.1	3p21	2004-11-18			ENSG00000023330	ENSG00000023330	2.3.1.37		396	protein-coding gene	gene with protein product		125290		ALAS3, ALAS			Standard	NM_000688		Approved		uc003dcz.2	P13196	OTTHUMG00000158108	ENST00000394965.2:c.933G>C	3.37:g.52239987G>C			52215027		Silent	SNP	ENST00000394965.2	37	CCDS2847.1	SNP	40	WashU																																																																																				0.483	ALAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350207.1			Silent
CA4	762	genome.wustl.edu	37	17	58235707	58235708	+	Missense_Mutation	DNP	GG	GG	TC			TCGA-24-1104-01	TCGA-24-1104-10	GG	GG	GG	TC	GG	GG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr17:58235707_58235708GG>TC	ENST00000300900.4	+	7	743_744	c.644_645GG>TC	c.(643-645)aGG>aTC	p.R215I		NM_000717.3	NP_000708.1	P22748	CAH4_HUMAN	carbonic anhydrase IV	215					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|organ development (GO:0048513)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(5)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	GAGAAACTGAGGCACTACTTCC	0.579																																																0			17																																								55590490	SO:0001583	missense	762			L10955	CCDS11624.1	17q23.1	2012-08-21			ENSG00000167434	ENSG00000167434	4.2.1.1	"""Carbonic anhydrases"""	1375	protein-coding gene	gene with protein product		114760	"""retinitis pigmentosa 17 (autosomal dominant)"""	RP17		8325641	Standard	NM_000717		Approved	CAIV, Car4	uc002iym.4	P22748		Exception_encountered	17.37:g.58235707_58235708delinsTC	ENSP00000300900:p.Arg215Ile		55590489	B4DQA4|Q6FHI7	Missense	DNP	ENST00000300900.4	37	CCDS11624.1	DNP	35	WashU																																																																																				0.579	CA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449189.1	NM_000717		Missense
OR4D8P	401696	genome.wustl.edu	37	11	59259427	59259427	+	IGR	SNP	G	G	A			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr11:59259427G>A								OR4D10 (13558 upstream) : RNU6-779P (7037 downstream)																							TCACTCAGATGTTTCTCTTCC	0.473																																																0			11																																								59016003	SO:0001628	intergenic_variant																																11.37:g.59259427G>A			59016003		Missense_Mutation	SNP		37		SNP	48	WashU																																																																																			0	0.473									Missense_Mutation
SLCO4A1	28231	genome.wustl.edu	37	20	61291851	61291851	+	Silent	SNP	C	C	T	rs572345402		TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr20:61291851C>T	ENST00000370507.1	+	3	1071	c.975C>T	c.(973-975)gcC>gcT	p.A325A	RP11-93B14.5_ENST00000433126.1_RNA|SLCO4A1_ENST00000217159.1_Silent_p.A325A|RP11-93B14.5_ENST00000451648.1_RNA|RP11-93B14.5_ENST00000411824.1_RNA			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	325					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.A325A(1)		endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TCTTCACCGCCGTTCCCATCC	0.652													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16133	0.0		0.0	False		,,,				2504	0.0				Pancreas(168;741 2006 10379 40139 45334)											1	Substitution - coding silent(1)	ovary(1)	20											75.0	71.0	72.0					20																	61291851		2203	4300	6503	60762296	SO:0001819	synonymous_variant	28231			AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.975C>T	20.37:g.61291851C>T			60762296	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Silent	SNP	ENST00000370507.1	37	CCDS13501.1	SNP	23	WashU																																																																																				0.652	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2	NM_016354		Silent
ABCA6	23460	genome.wustl.edu	37	17	67077281	67077281	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr17:67077281G>T	ENST00000284425.2	-	37	4796	c.4622C>A	c.(4621-4623)tCc>tAc	p.S1541Y	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1541					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S1541Y(1)		breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TAACAAAGAGGAATACCTGAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	17											86.0	88.0	87.0					17																	67077281		2203	4300	6503	64588876	SO:0001583	missense	23460			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4622C>A	17.37:g.67077281G>T	ENSP00000284425:p.Ser1541Tyr		64588876	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	CCDS11683.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	11.85	1.761550	0.31228	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.84146	-1.81	5.26	0.969	0.19686	.	0.705472	0.12772	N	0.440488	D	0.90442	0.7007	M	0.88105	2.93	0.09310	N	0.999992	D	0.61697	0.99	P	0.61201	0.885	T	0.80165	-0.1496	10	0.87932	D	0	.	4.5742	0.12225	0.262:0.0:0.5827:0.1553	.	1541	Q8N139	ABCA6_HUMAN	Y	1541;401	ENSP00000284425:S1541Y	ENSP00000284425:S1541Y	S	-	2	0	ABCA6	64588876	0.016000	0.18221	0.001000	0.08648	0.214000	0.24535	1.861000	0.39438	0.065000	0.16485	0.655000	0.94253	TCC		0.373	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284		Missense_Mutation
SLC28A3	64078	genome.wustl.edu	37	9	86900443	86900443	+	Silent	SNP	G	G	A	rs557666022	byFrequency	TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr9:86900443G>A	ENST00000376238.4	-	14	1513	c.1464C>T	c.(1462-1464)taC>taT	p.Y488Y	SLC28A3_ENST00000537648.1_Silent_p.Y419Y|RP11-380F14.2_ENST00000419815.1_RNA	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	488					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)	p.Y488Y(1)		endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	GCATGAAGATGTAGGAGCAGA	0.428																																					Ovarian(106;425 1539 34835 42413 43572)											1	Substitution - coding silent(1)	ovary(1)	9											84.0	81.0	82.0					9																	86900443		2203	4300	6503	86090263	SO:0001819	synonymous_variant	64078			AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1464C>T	9.37:g.86900443G>A			86090263	A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Silent	SNP	ENST00000376238.4	37	CCDS6670.1	SNP	48	WashU																																																																																				0.428	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052874.1	NM_022127		Silent
MMRN1	22915	genome.wustl.edu	37	4	90816148	90816148	+	Missense_Mutation	SNP	T	T	C	rs371041048		TCGA-24-1104-01	TCGA-24-1104-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr4:90816148T>C	ENST00000394980.1	+	2	345	c.26T>C	c.(25-27)cTt>cCt	p.L9P	MMRN1_ENST00000264790.2_Missense_Mutation_p.L9P|MMRN1_ENST00000394981.1_Missense_Mutation_p.L9P			Q13201	MMRN1_HUMAN	multimerin 1	9					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)		p.L9P(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TTATTTGTCCTTCTTTCTAGT	0.433																																																1	Substitution - Missense(1)	ovary(1)	4											79.0	85.0	83.0					4																	90816148		2203	4300	6503	91035171	SO:0001583	missense	22915			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.26T>C	4.37:g.90816148T>C	ENSP00000378431:p.Leu9Pro		91035171	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	ENST00000394980.1	37	CCDS3635.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	18.86	3.714084	0.68730	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000394981	T;T;D	0.83419	-0.57;-0.57;-1.72	4.91	4.91	0.64330	.	0.000000	0.41938	D	0.000781	D	0.89083	0.6614	M	0.66939	2.045	0.51767	D	0.999933	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.89889	0.4036	10	0.87932	D	0	.	11.5037	0.50451	0.0:0.0:0.0:1.0	.	9;9	Q13201-2;Q13201	.;MMRN1_HUMAN	P	9	ENSP00000378431:L9P;ENSP00000264790:L9P;ENSP00000378432:L9P	ENSP00000264790:L9P	L	+	2	0	MMRN1	91035171	0.942000	0.31987	0.987000	0.45799	0.934000	0.57294	3.748000	0.55142	2.137000	0.66172	0.460000	0.39030	CTT		0.433	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351		Missense_Mutation
FAT3	120114	genome.wustl.edu	37	11	92532486	92532486	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr11:92532486A>T	ENST00000298047.6	+	9	6324	c.6307A>T	c.(6307-6309)Att>Ttt	p.I2103F	FAT3_ENST00000409404.2_Missense_Mutation_p.I2103F|FAT3_ENST00000525166.1_Missense_Mutation_p.I1953F			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2103	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I2103F(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CGGGACTCTGATTTATCAGGT	0.448										TCGA Ovarian(4;0.039)																																						1	Substitution - Missense(1)	ovary(1)	11											50.0	51.0	51.0					11																	92532486		1915	4123	6038	92172134	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6307A>T	11.37:g.92532486A>T	ENSP00000298047:p.Ile2103Phe		92172134	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	15.77	2.931456	0.52866	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.64085	-0.08;-0.08;-0.08	5.9	5.9	0.94986	.	.	.	.	.	T	0.80549	0.4644	M	0.84082	2.675	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.82709	-0.0323	9	0.56958	D	0.05	.	16.3317	0.83023	1.0:0.0:0.0:0.0	.	2103	Q8TDW7-3	.	F	2103;2103;1953	ENSP00000298047:I2103F;ENSP00000387040:I2103F;ENSP00000432586:I1953F	ENSP00000298047:I2103F	I	+	1	0	FAT3	92172134	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	5.353000	0.66034	2.264000	0.75181	0.533000	0.62120	ATT		0.448	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		Missense_Mutation
ALCAM	214	genome.wustl.edu	37	3	105268974	105268974	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr3:105268974G>C	ENST00000306107.5	+	12	1878	c.1378G>C	c.(1378-1380)Gag>Cag	p.E460Q	ALCAM_ENST00000486979.2_Missense_Mutation_p.E409Q|ALCAM_ENST00000389927.4_Missense_Mutation_p.E182Q|ALCAM_ENST00000472644.2_Missense_Mutation_p.E460Q	NM_001627.3	NP_001618.2	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	460	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|motor neuron axon guidance (GO:0008045)|signal transduction (GO:0007165)	axon (GO:0030424)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	receptor binding (GO:0005102)	p.E460Q(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						TTTCCAGACAGAGGAATCTCC	0.358																																																1	Substitution - Missense(1)	ovary(1)	3											95.0	118.0	110.0					3																	105268974		2196	4294	6490	106751664	SO:0001583	missense	214			AK054632	CCDS33810.1, CCDS58841.1	3q13.1	2013-01-29	2002-08-08		ENSG00000170017	ENSG00000170017		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	400	protein-coding gene	gene with protein product		601662	"""activated leucocyte cell adhesion molecule"""			7760007	Standard	NM_001627		Approved	CD166, MEMD	uc003dvx.3	Q13740	OTTHUMG00000159192	ENST00000306107.5:c.1378G>C	3.37:g.105268974G>C	ENSP00000305988:p.Glu460Gln		106751664	B2RNS3|B4DTU0|O60892|Q1HGM8|Q1HGM9|Q6PEY4|Q6ZS95	Missense_Mutation	SNP	ENST00000306107.5	37	CCDS33810.1	SNP	33	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.92|16.92	3.256318|3.256318	0.59321|0.59321	.|.	.|.	ENSG00000170017|ENSG00000170017	ENST00000306107;ENST00000472644;ENST00000486979;ENST00000389927|ENST00000465413	T;T;T;T|.	0.74315|.	4.05;4.05;4.05;-0.83|.	5.92|5.92	5.92|5.92	0.95590|0.95590	Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.619093|.	0.18841|.	N|.	0.129698|.	T|T	0.59945|0.59945	0.2231|0.2231	L|L	0.29908|0.29908	0.895|0.895	0.37028|0.37028	D|D	0.896525|0.896525	P;B;P|.	0.47484|.	0.896;0.338;0.565|.	P;B;P|.	0.46419|.	0.516;0.355;0.475|.	T|T	0.57093|0.57093	-0.7870|-0.7870	10|5	0.24483|.	T|.	0.36|.	-1.0867|-1.0867	20.3343|20.3343	0.98733|0.98733	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	182;460;460|.	Q6ZS95;B4DTU0;Q13740|.	.;.;CD166_HUMAN|.	Q|T	460;460;409;182|220	ENSP00000305988:E460Q;ENSP00000419236:E460Q;ENSP00000418213:E409Q;ENSP00000374577:E182Q|.	ENSP00000305988:E460Q|.	E|R	+|+	1|2	0|0	ALCAM|ALCAM	106751664|106751664	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.399000|6.399000	0.73248|0.73248	2.822000|2.822000	0.97130|0.97130	0.650000|0.650000	0.86243|0.86243	GAG|AGA		0.358	ALCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353764.1	NM_001627		Missense_Mutation
CSMD3	114788	genome.wustl.edu	37	8	113504881	113504881	+	Silent	SNP	G	G	T			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr8:113504881G>T	ENST00000297405.5	-	31	5359	c.5115C>A	c.(5113-5115)ggC>ggA	p.G1705G	CSMD3_ENST00000455883.2_Silent_p.G1601G|CSMD3_ENST00000352409.3_Silent_p.G1705G|CSMD3_ENST00000343508.3_Silent_p.G1665G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1705	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G1705G(3)|p.G1665G(2)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCATTATATTGCCTGGATCAA	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						5	Substitution - coding silent(5)	lung(4)|ovary(1)	8											145.0	133.0	137.0					8																	113504881		2203	4300	6503	113574057	SO:0001819	synonymous_variant	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5115C>A	8.37:g.113504881G>T			113574057	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1	SNP	46	WashU																																																																																				0.378	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		Silent
SEMA6A	57556	genome.wustl.edu	37	5	115840593	115840593	+	Silent	SNP	A	A	C			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr5:115840593A>C	ENST00000343348.6	-	2	835	c.48T>G	c.(46-48)gcT>gcG	p.A16A	SEMA6A_ENST00000257414.8_Silent_p.A16A|SEMA6A_ENST00000510263.1_Silent_p.A16A|SEMA6A_ENST00000503962.1_5'Flank|CTB-118N6.3_ENST00000510682.1_RNA	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	16					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.A16A(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		AACCAGCCCCAGCAAAGTGTA	0.448																																																1	Substitution - coding silent(1)	ovary(1)	5											72.0	77.0	75.0					5																	115840593		1869	4106	5975	115868492	SO:0001819	synonymous_variant	57556			AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.48T>G	5.37:g.115840593A>C			115868492	Q9P2H9	Silent	SNP	ENST00000343348.6	37	CCDS47256.1	SNP	7	WashU																																																																																				0.448	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796		Silent
CCDC60	160777	genome.wustl.edu	37	12	119916949	119916949	+	Missense_Mutation	SNP	G	G	A	rs144234053		TCGA-24-1104-01	TCGA-24-1104-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr12:119916949G>A	ENST00000327554.2	+	4	857	c.392G>A	c.(391-393)cGc>cAc	p.R131H	CCDC60_ENST00000546345.1_3'UTR|RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	131								p.R131H(3)		endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		GTCACACGTCGCCCATTCACT	0.473													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19421	0.0		0.0	False		,,,				2504	0.0															3	Substitution - Missense(3)	lung(2)|ovary(1)	12						G	HIS/ARG	0,4406		0,0,2203	224.0	171.0	189.0		392	2.6	0.0	12	dbSNP_134	189	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC60	NM_178499.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	131/551	119916949	1,13005	2203	4300	6503	118401332	SO:0001583	missense	160777			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.392G>A	12.37:g.119916949G>A	ENSP00000333374:p.Arg131His		118401332		Missense_Mutation	SNP	ENST00000327554.2	37	CCDS9190.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873165	0.33069	0.0	1.16E-4	ENSG00000183273	ENST00000327554	T	0.37411	1.2	4.44	2.62	0.31277	.	0.000000	0.51477	D	0.000083	T	0.27731	0.0682	L	0.52126	1.63	0.09310	N	0.999997	B	0.25667	0.131	B	0.22880	0.042	T	0.14896	-1.0456	9	.	.	.	-7.2754	7.1847	0.25793	0.2043:0.0:0.7957:0.0	.	131	Q8IWA6	CCD60_HUMAN	H	131	ENSP00000333374:R131H	.	R	+	2	0	CCDC60	118401332	0.009000	0.17119	0.026000	0.17262	0.001000	0.01503	0.441000	0.21611	0.612000	0.30071	-0.143000	0.13931	CGC		0.473	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499		Missense_Mutation
SLC13A1	6561	genome.wustl.edu	37	7	122809297	122809297	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr7:122809297G>A	ENST00000194130.2	-	4	497	c.458C>T	c.(457-459)gCt>gTt	p.A153V	SLC13A1_ENST00000539873.1_Missense_Mutation_p.A89V	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	153					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)	p.A153V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	CTGCACTACAGCCTCCGCAAT	0.527																																																1	Substitution - Missense(1)	ovary(1)	7											158.0	125.0	136.0					7																	122809297		2203	4300	6503	122596533	SO:0001583	missense	6561				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.458C>T	7.37:g.122809297G>A	ENSP00000194130:p.Ala153Val		122596533	Q9H5Z0	Missense_Mutation	SNP	ENST00000194130.2	37	CCDS5786.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358896	0.82353	.	.	ENSG00000081800	ENST00000194130;ENST00000539873	T;T	0.03553	3.89;3.89	5.4	5.4	0.78164	.	0.098410	0.64402	D	0.000001	T	0.24890	0.0604	M	0.91140	3.18	0.80722	D	1	D	0.63880	0.993	D	0.65573	0.936	T	0.04825	-1.0924	10	0.72032	D	0.01	.	18.5178	0.90941	0.0:0.0:1.0:0.0	.	153	Q9BZW2	S13A1_HUMAN	V	153;89	ENSP00000194130:A153V;ENSP00000441309:A89V	ENSP00000194130:A153V	A	-	2	0	SLC13A1	122596533	1.000000	0.71417	1.000000	0.80357	0.152000	0.21847	9.783000	0.99037	2.680000	0.91292	0.643000	0.83706	GCT		0.527	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444		Missense_Mutation
CNTRL	11064	genome.wustl.edu	37	9	123931942	123931942	+	Silent	SNP	T	T	C			TCGA-24-1104-01	TCGA-24-1104-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr9:123931942T>C	ENST00000373855.1	+	39	6384	c.6124T>C	c.(6124-6126)Ttg>Ctg	p.L2042L	CNTRL_ENST00000373850.1_Silent_p.L1490L|CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000238341.5_Silent_p.L2042L			Q7Z7A1	CNTRL_HUMAN	centriolin	2042	Required for centrosome localization.|Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)		p.L2042L(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AGGTGAGCTGTTGGCCCTCCA	0.507																																																1	Substitution - coding silent(1)	ovary(1)	9											98.0	100.0	99.0					9																	123931942		2203	4300	6503	122971763	SO:0001819	synonymous_variant	11064			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6124T>C	9.37:g.123931942T>C			122971763	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Silent	SNP	ENST00000373855.1	37	CCDS35118.1	SNP	60	WashU																																																																																				0.507	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018		Silent
CCDC15	80071	genome.wustl.edu	37	11	124857709	124857709	+	Silent	SNP	C	C	G			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr11:124857709C>G	ENST00000344762.5	+	8	1846	c.1587C>G	c.(1585-1587)ggC>ggG	p.G529G	CCDC15_ENST00000529051.1_Silent_p.G529G	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	529			G -> D (in dbSNP:rs4936966).			centrosome (GO:0005813)		p.G529G(1)		central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		AATATCAAGGCCAGGATTTTC	0.403																																																1	Substitution - coding silent(1)	ovary(1)	11											176.0	168.0	170.0					11																	124857709		1808	4079	5887	124362919	SO:0001819	synonymous_variant	80071			BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.1587C>G	11.37:g.124857709C>G			124362919	Q9H8U7	Silent	SNP	ENST00000344762.5	37	CCDS44756.1	SNP	26	WashU																																																																																				0.403	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387131.1	NM_025004		Silent
RABGAP1	23637	genome.wustl.edu	37	9	125746949	125746949	+	Silent	SNP	A	A	C			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr9:125746949A>C	ENST00000373647.4	+	3	470	c.336A>C	c.(334-336)gtA>gtC	p.V112V		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	112					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)	p.V40V(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						TGCCATTAGTAGGGCTCCAAA	0.453																																																1	Substitution - coding silent(1)	ovary(1)	9											110.0	87.0	95.0					9																	125746949		2203	4300	6503	124786770	SO:0001819	synonymous_variant	23637			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.336A>C	9.37:g.125746949A>C			124786770	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Silent	SNP	ENST00000373647.4	37	CCDS6848.2	SNP	15	WashU																																																																																				0.453	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197		Silent
MRPS21P6	359770	genome.wustl.edu	37	10	126855431	126855431	+	IGR	SNP	G	G	T			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr10:126855431G>T								CTBP2 (5692 upstream) : RP11-118H17.1 (407508 downstream)																							GGTGCCGGCTGATCTATAGCA	0.532																																																0			10																																								126845421	SO:0001628	intergenic_variant																																10.37:g.126855431G>T			126845421		Silent	SNP		37		SNP	45	WashU																																																																																			0	0.532									Silent
POLE	5426	genome.wustl.edu	37	12	133201504	133201504	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr12:133201504G>T	ENST00000320574.5	-	48	6777	c.6734C>A	c.(6733-6735)aCc>aAc	p.T2245N	POLE_ENST00000535270.1_Missense_Mutation_p.T2218N	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	2245					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.T2245N(1)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GGTGTGGATGGTGAGGGCGAA	0.632								DNA polymerases (catalytic subunits)																																								1	Substitution - Missense(1)	ovary(1)	12											96.0	96.0	96.0					12																	133201504		2203	4300	6503	131711577	SO:0001583	missense	5426				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.6734C>A	12.37:g.133201504G>T	ENSP00000322570:p.Thr2245Asn		131711577	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	14.18	2.458538	0.43634	.	.	ENSG00000177084	ENST00000434528;ENST00000320574;ENST00000455752;ENST00000320557;ENST00000535270	T;T;T	0.03124	4.05;4.04;4.05	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.11922	0.0290	M	0.89840	3.065	0.51767	D	0.999936	P;P	0.44478	0.836;0.552	B;B	0.44044	0.439;0.248	T	0.00984	-1.1491	10	0.41790	T	0.15	.	13.6932	0.62559	0.0736:0.0:0.9264:0.0	.	2245;455	Q07864;B3KS74	DPOE1_HUMAN;.	N	455;2245;2256;215;2218	ENSP00000322570:T2245N;ENSP00000406383:T2256N;ENSP00000445753:T2218N	ENSP00000322473:T215N	T	-	2	0	POLE	131711577	1.000000	0.71417	1.000000	0.80357	0.138000	0.21146	4.825000	0.62708	2.609000	0.88269	0.561000	0.74099	ACC		0.632	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231		Missense_Mutation
TMEM71	137835	genome.wustl.edu	37	8	133764058	133764058	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr8:133764058C>G	ENST00000356838.3	-	4	429	c.287G>C	c.(286-288)aGc>aCc	p.S96T	TMEM71_ENST00000517538.1_5'UTR|TMEM71_ENST00000523829.1_Missense_Mutation_p.S96T|TMEM71_ENST00000377901.4_Missense_Mutation_p.S96T	NM_144649.2	NP_653250.2	Q6P5X7	TMM71_HUMAN	transmembrane protein 71	96						integral component of membrane (GO:0016021)		p.S96T(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			ATACATAACGCTGGTCTGGGA	0.403																																																1	Substitution - Missense(1)	ovary(1)	8											162.0	147.0	152.0					8																	133764058		2203	4300	6503	133833240	SO:0001583	missense	137835			AK057631	CCDS6366.1, CCDS47921.1	8q24.22	2005-09-02				ENSG00000165071			26572	protein-coding gene	gene with protein product						12477932	Standard	NM_144649		Approved	FLJ33069	uc003ytn.3	Q6P5X7		ENST00000356838.3:c.287G>C	8.37:g.133764058C>G	ENSP00000349296:p.Ser96Thr		133833240	Q3KRC2|Q8WVZ4|Q96LX9	Missense_Mutation	SNP	ENST00000356838.3	37	CCDS6366.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	10.99	1.507332	0.27036	.	.	ENSG00000165071	ENST00000523829;ENST00000356838;ENST00000377901;ENST00000519187	.	.	.	5.95	4.04	0.47022	.	0.208574	0.48767	N	0.000172	T	0.41026	0.1141	M	0.63843	1.955	0.28665	N	0.905938	B;B;B	0.29590	0.126;0.126;0.25	B;B;B	0.27887	0.051;0.035;0.084	T	0.31138	-0.9954	9	0.25106	T	0.35	-0.9598	9.1924	0.37207	0.0:0.647:0.278:0.075	.	96;96;96	Q6P5X7;Q6P5X7-3;Q6P5X7-2	TMM71_HUMAN;.;.	T	96	.	ENSP00000349296:S96T	S	-	2	0	TMEM71	133833240	0.999000	0.42202	0.990000	0.47175	0.148000	0.21650	1.367000	0.34204	1.507000	0.48752	0.655000	0.94253	AGC		0.403	TMEM71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379591.1	NM_144649		Missense_Mutation
SYCE1	93426	genome.wustl.edu	37	10	135369332	135369332	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1104-01	TCGA-24-1104-10	G	G	T	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr10:135369332G>T	ENST00000343131.5	-	10	775	c.671C>A	c.(670-672)aCc>aAc	p.T224N	SYCE1_ENST00000368517.3_Missense_Mutation_p.T188N|SYCE1_ENST00000432597.2_Missense_Mutation_p.T188N|SPRN_ENST00000541506.1_Intron	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	224					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.T188N(1)		breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		CTCATCAAGGGTGGAGGGGCC	0.622																																																1	Substitution - Missense(1)	ovary(1)	10											54.0	55.0	55.0					10																	135369332		2203	4300	6503	135219322	SO:0001583	missense	93426			AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.671C>A	10.37:g.135369332G>T	ENSP00000341282:p.Thr224Asn		135219322	B2RC80|Q9BWU3|Q9BWU4	Missense_Mutation	SNP	ENST00000343131.5	37	CCDS44501.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	4.314	0.057593	0.08339	.	.	ENSG00000171772	ENST00000303903;ENST00000432597;ENST00000368517;ENST00000343131	T;T;T;T	0.40756	1.46;1.02;1.02;3.16	4.12	0.0786	0.14413	.	0.836523	0.10821	N	0.630538	T	0.35998	0.0951	L	0.55481	1.735	0.09310	N	1	P;P;P	0.46784	0.844;0.884;0.557	P;P;B	0.46253	0.447;0.509;0.295	T	0.19257	-1.0311	10	0.33940	T	0.23	-6.1248	1.398	0.02264	0.1942:0.1686:0.4636:0.1736	.	96;224;188	Q8N0S2-3;Q8N0S2;Q8N0S2-2	.;SYCE1_HUMAN;.	N	224;188;188;224	ENSP00000303978:T224N;ENSP00000411779:T188N;ENSP00000357503:T188N;ENSP00000341282:T224N	ENSP00000303978:T224N	T	-	2	0	SYCE1	135219322	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.100000	0.15231	0.015000	0.14971	-0.768000	0.03414	ACC		0.622	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_201564		Missense_Mutation
GPR112	139378	genome.wustl.edu	37	X	135428708	135428708	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chrX:135428708G>A	ENST00000394143.1	+	6	3134	c.2843G>A	c.(2842-2844)gGa>gAa	p.G948E	GPR112_ENST00000394141.1_Missense_Mutation_p.G743E|GPR112_ENST00000412101.1_Missense_Mutation_p.G743E|GPR112_ENST00000287534.4_Missense_Mutation_p.G885E|GPR112_ENST00000370652.1_Missense_Mutation_p.G948E	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	948					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G948E(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACATCTGAGGGAATTTCAGCT	0.433																																																1	Substitution - Missense(1)	ovary(1)	X											150.0	144.0	146.0					X																	135428708		2203	4300	6503	135256374	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.2843G>A	X.37:g.135428708G>A	ENSP00000377699:p.Gly948Glu		135256374	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	9.209	1.030545	0.19512	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.55052	0.58;0.58;0.54;0.62;0.54	2.46	2.46	0.29980	.	.	.	.	.	T	0.56775	0.2008	L	0.29908	0.895	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.38607	-0.9653	9	0.49607	T	0.09	.	7.7423	0.28848	0.0:0.0:1.0:0.0	.	885;743;948	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	E	948;948;743;885;743	ENSP00000377699:G948E;ENSP00000359686:G948E;ENSP00000416526:G743E;ENSP00000287534:G885E;ENSP00000377697:G743E	ENSP00000287534:G885E	G	+	2	0	GPR112	135256374	0.376000	0.25098	0.026000	0.17262	0.120000	0.20174	1.456000	0.35201	1.530000	0.49136	0.179000	0.17066	GGA		0.433	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			Missense_Mutation
RYK	6259	genome.wustl.edu	37	3	133907752	133907752	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr3:133907752A>G	ENST00000427044.2	-	10	1074	c.464T>C	c.(463-465)aTt>aCt	p.I155T	RYK_ENST00000296084.4_Missense_Mutation_p.I345T			P34925	RYK_HUMAN	receptor-like tyrosine kinase	341	WIF. {ECO:0000255|PROSITE- ProRule:PRU00222}.				axon guidance (GO:0007411)|corpus callosum development (GO:0022038)|neuron differentiation (GO:0030182)|neuron projection development (GO:0031175)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of MAPK cascade (GO:0043410)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.I341T(1)		lung(1)|ovary(3)	4						CCCATGGAAAATACGCCCAAA	0.269																																																1	Substitution - Missense(1)	ovary(1)	3											67.0	63.0	64.0					3																	133907752		1795	4060	5855	135390442	SO:0001583	missense	6259			S59184	CCDS75016.1	3q22.1	2012-02-28	2012-02-28		ENSG00000163785	ENSG00000163785	2.7.10.1		10481	protein-coding gene	gene with protein product		600524	"""JTK5A protein tyrosine kinase"", ""RYK receptor-like tyrosine kinase"""	JTK5A		8386829	Standard	NM_001005861		Approved	D3S3195, RYK1, JTK5	uc003eqc.1	P34925	OTTHUMG00000159750	ENST00000427044.2:c.464T>C	3.37:g.133907752A>G	ENSP00000399527:p.Ile155Thr		135390442	Q04696	Missense_Mutation	SNP	ENST00000427044.2	37		SNP	4	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.42|16.42	3.119620|3.119620	0.56613|0.56613	.|.	.|.	ENSG00000163785|ENSG00000163785	ENST00000460933|ENST00000296084;ENST00000427044	.|T;D	.|0.89552	.|0.72;-2.53	5.35|5.35	5.35|5.35	0.76521|0.76521	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93249|0.93249	0.7849|0.7849	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	.|D;D	.|0.60160	.|0.987;0.984	.|D;D	.|0.72982	.|0.979;0.964	D|D	0.93982|0.93982	0.7259|0.7259	5|10	.|0.87932	.|D	.|0	-8.5785|-8.5785	15.6409|15.6409	0.77001|0.77001	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|341;344	.|P34925;P34925-2	.|RYK_HUMAN;.	L|T	324|345;155	.|ENSP00000296084:I345T;ENSP00000399527:I155T	.|ENSP00000296084:I345T	F|I	-|-	1|2	0|0	RYK|RYK	135390442|135390442	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.541000|8.541000	0.90644|0.90644	2.143000|2.143000	0.66587|0.66587	0.528000|0.528000	0.53228|0.53228	TTT|ATT		0.269	RYK-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001005861		Missense_Mutation
HIVEP2	3097	genome.wustl.edu	37	6	143095406	143095406	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr6:143095406C>T	ENST00000367604.1	-	4	1109	c.470G>A	c.(469-471)aGt>aAt	p.S157N	HIVEP2_ENST00000367603.2_Missense_Mutation_p.S157N|HIVEP2_ENST00000012134.2_Missense_Mutation_p.S157N			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S157N(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		AGGGTTCAGACTTGAAATCTT	0.448																																					Esophageal Squamous(107;843 1510 13293 16805 42198)											1	Substitution - Missense(1)	ovary(1)	6											131.0	128.0	129.0					6																	143095406		1869	4101	5970	143137099	SO:0001583	missense	3097			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.470G>A	6.37:g.143095406C>T	ENSP00000356576:p.Ser157Asn		143137099	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	9.919	1.211578	0.22289	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02579	4.24;4.24;4.24	5.69	1.82	0.25136	.	0.312448	0.43747	N	0.000533	T	0.00998	0.0033	L	0.56769	1.78	0.19775	N	0.999951	B	0.06786	0.001	B	0.06405	0.002	T	0.49093	-0.8975	10	0.22706	T	0.39	-17.1226	6.9847	0.24721	0.0:0.6235:0.115:0.2615	.	157	P31629	ZEP2_HUMAN	N	157	ENSP00000356576:S157N;ENSP00000356575:S157N;ENSP00000012134:S157N	ENSP00000012134:S157N	S	-	2	0	HIVEP2	143137099	0.999000	0.42202	0.633000	0.29310	0.998000	0.95712	2.333000	0.43912	0.043000	0.15746	0.655000	0.94253	AGT		0.448	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1			Missense_Mutation
ZNF16	7564	genome.wustl.edu	37	8	146157869	146157869	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr8:146157869G>A	ENST00000276816.4	-	4	490	c.304C>T	c.(304-306)Cag>Tag	p.Q102*	ZNF16_ENST00000394909.2_Nonsense_Mutation_p.Q102*	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	102	Necessary for transcription activation.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q102*(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		TCGGGTACCTGGGAAACATCA	0.502																																																1	Substitution - Nonsense(1)	ovary(1)	8											108.0	104.0	106.0					8																	146157869		2203	4300	6503	146128673	SO:0001587	stop_gained	7564			X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.304C>T	8.37:g.146157869G>A	ENSP00000276816:p.Gln102*		146128673	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Nonsense_Mutation	SNP	ENST00000276816.4	37	CCDS6437.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331227	0.24167	.	.	ENSG00000170631	ENST00000276816;ENST00000394909;ENST00000532351;ENST00000527811	.	.	.	4.17	3.28	0.37604	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	10.9088	0.47097	0.0:0.0:0.8109:0.1891	.	.	.	.	X	102	.	ENSP00000276816:Q102X	Q	-	1	0	ZNF16	146128673	0.940000	0.31905	0.004000	0.12327	0.017000	0.09413	2.811000	0.47986	0.930000	0.37217	0.563000	0.77884	CAG		0.502	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958		Nonsense_Mutation
GOLPH3L	55204	genome.wustl.edu	37	1	150634360	150634360	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr1:150634360A>T	ENST00000271732.3	-	4	404	c.360T>A	c.(358-360)gaT>gaA	p.D120E	GOLPH3L_ENST00000540514.1_Missense_Mutation_p.D76E	NM_018178.5	NP_060648.2	Q9H4A5	GLP3L_HUMAN	golgi phosphoprotein 3-like	120					Golgi organization (GO:0007030)|positive regulation of protein secretion (GO:0050714)	Golgi membrane (GO:0000139)|trans-Golgi network membrane (GO:0032588)	phosphatidylinositol-4-phosphate binding (GO:0070273)	p.D120E(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			TCAGAGTTTCATCCAGTAAAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	1											188.0	181.0	183.0					1																	150634360		2203	4300	6503	148900984	SO:0001583	missense	55204			AJ296153	CCDS966.1	1q21	2008-02-05			ENSG00000143457	ENSG00000143457			24882	protein-coding gene	gene with protein product		612208					Standard	NM_018178		Approved	GPP34R	uc001evj.2	Q9H4A5	OTTHUMG00000035009	ENST00000271732.3:c.360T>A	1.37:g.150634360A>T	ENSP00000271732:p.Asp120Glu		148900984	B1AN09|B7Z6N3|Q9NVK0	Missense_Mutation	SNP	ENST00000271732.3	37	CCDS966.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	19.74	3.883708	0.72410	.	.	ENSG00000143457	ENST00000271732;ENST00000369003;ENST00000540514;ENST00000427665	.	.	.	5.4	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.82139	0.4972	H	0.95470	3.675	0.58432	D	0.999999	D;D	0.76494	0.999;0.968	D;D	0.91635	0.999;0.968	D	0.85884	0.1424	9	0.72032	D	0.01	-19.317	10.3198	0.43758	0.9226:0.0:0.0773:0.0	.	76;120	F5H4M3;Q9H4A5	.;GLP3L_HUMAN	E	120;142;76;142	.	ENSP00000271732:D120E	D	-	3	2	GOLPH3L	148900984	1.000000	0.71417	1.000000	0.80357	0.679000	0.39708	1.034000	0.30204	1.071000	0.40834	0.528000	0.53228	GAT		0.373	GOLPH3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084734.1	NM_018178		Missense_Mutation
TCOF1	6949	genome.wustl.edu	37	5	149771583	149771583	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr5:149771583G>A	ENST00000504761.2	+	21	3361	c.3361G>A	c.(3361-3363)Ggg>Agg	p.G1121R	TCOF1_ENST00000377797.3_Missense_Mutation_p.G1121R|TCOF1_ENST00000451292.1_Missense_Mutation_p.G1158R|TCOF1_ENST00000445265.2_Missense_Mutation_p.G1044R|TCOF1_ENST00000323668.7_Missense_Mutation_p.G1044R|TCOF1_ENST00000439160.2_Missense_Mutation_p.G1083R|TCOF1_ENST00000513346.1_Missense_Mutation_p.G1120R			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1121					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)	p.G1044R(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCAGGCCAAAGGGACCAACAA	0.532																																																1	Substitution - Missense(1)	ovary(1)	5											75.0	72.0	73.0					5																	149771583		2203	4300	6503	149751776	SO:0001583	missense	6949				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.3361G>A	5.37:g.149771583G>A	ENSP00000421655:p.Gly1121Arg		149751776	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	ENST00000504761.2	37	CCDS54936.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952875	0.53293	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.92;-0.84;-0.84;-0.95;-0.84	5.45	-0.635	0.11512	.	1.583740	0.04157	N	0.322316	T	0.65678	0.2714	N	0.14661	0.345	0.09310	N	1	P;P;P;P;P	0.48503	0.911;0.911;0.911;0.855;0.911	P;P;P;B;P	0.47981	0.563;0.563;0.563;0.36;0.563	T	0.59418	-0.7458	10	0.52906	T	0.07	0.4829	9.6282	0.39763	0.4768:0.0:0.5232:0.0	.	1083;1044;1083;1121;1044	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8	.;.;.;TCOF_HUMAN;.	R	1158;1121;1044;1044;1083;1083;1121;1120	ENSP00000400939:G1158R;ENSP00000367028:G1121R;ENSP00000409944:G1044R;ENSP00000325223:G1044R;ENSP00000406888:G1083R;ENSP00000390717:G1083R;ENSP00000421655:G1121R;ENSP00000427484:G1120R	ENSP00000325223:G1044R	G	+	1	0	TCOF1	149751776	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	0.193000	0.17116	-0.107000	0.12088	-0.140000	0.14226	GGG		0.532	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656		Missense_Mutation
RASAL2	9462	genome.wustl.edu	37	1	178420710	178420710	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr1:178420710G>C	ENST00000462775.1	+	8	1313	c.1188G>C	c.(1186-1188)gaG>gaC	p.E396D	RASAL2_ENST00000367649.3_Missense_Mutation_p.E544D|RASAL2_ENST00000448150.3_Missense_Mutation_p.E526D	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	396	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)	p.E526D(1)		biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						AAATAGGGGAGTTTATCAAAG	0.378																																																1	Substitution - Missense(1)	ovary(1)	1											150.0	148.0	149.0					1																	178420710		2203	4300	6503	176687333	SO:0001583	missense	9462			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.1188G>C	1.37:g.178420710G>C	ENSP00000420558:p.Glu396Asp		176687333	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	37	CCDS1322.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	10.76	1.440130	0.25900	.	.	ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775	D;T;D	0.82433	-1.61;2.2;-1.61	5.84	0.615	0.17608	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.115453	0.56097	D	0.000022	T	0.63546	0.2520	N	0.11255	0.115	0.58432	D	0.999998	B;B	0.06786	0.001;0.0	B;B	0.17098	0.017;0.001	T	0.50659	-0.8802	10	0.52906	T	0.07	.	5.8512	0.18694	0.3258:0.0:0.5557:0.1185	.	396;544	Q9UJF2;F8W755	NGAP_HUMAN;.	D	526;544;396	ENSP00000407768:E526D;ENSP00000356621:E544D;ENSP00000420558:E396D	ENSP00000356621:E544D	E	+	3	2	RASAL2	176687333	1.000000	0.71417	0.999000	0.59377	0.373000	0.29922	1.519000	0.35888	0.116000	0.18110	-0.751000	0.03497	GAG		0.378	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692		Missense_Mutation
RGS8	85397	genome.wustl.edu	37	1	182617331	182617331	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr1:182617331G>C	ENST00000483095.2	-	6	558	c.301C>G	c.(301-303)Ctg>Gtg	p.L101V	RGS8_ENST00000367557.4_Missense_Mutation_p.L101V|RGS8_ENST00000258302.4_Missense_Mutation_p.L119V|RGS8_ENST00000367556.1_Missense_Mutation_p.L101V			P57771	RGS8_HUMAN	regulator of G-protein signaling 8	101	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.L119V(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	5						TTAGAGACCAGTTTTGCAGTT	0.542																																					Ovarian(189;1262 3804 41973)											1	Substitution - Missense(1)	ovary(1)	1											192.0	183.0	186.0					1																	182617331		2203	4300	6503	180883954	SO:0001583	missense	85397			AF297015	CCDS1349.1, CCDS41443.1	1q25	2008-07-18	2007-08-14		ENSG00000135824	ENSG00000135824		"""Regulators of G-protein signaling"""	16810	protein-coding gene	gene with protein product		607189	"""regulator of G-protein signalling 8"""			11318611	Standard	NM_001102450		Approved	MGC119067, MGC119068, MGC119069	uc001gpm.1	P57771	OTTHUMG00000035219	ENST00000483095.2:c.301C>G	1.37:g.182617331G>C	ENSP00000426289:p.Leu101Val		180883954	B4DGL9|Q3SYD2	Missense_Mutation	SNP	ENST00000483095.2	37	CCDS41443.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	22.3	4.270736	0.80469	.	.	ENSG00000135824	ENST00000483095;ENST00000258302;ENST00000367557;ENST00000367556	T;T;T;T	0.02067	4.47;4.47;4.47;4.47	5.51	4.54	0.55810	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.137638	0.50627	D	0.000112	T	0.06188	0.0160	L	0.45285	1.41	0.51233	D	0.999918	P;P	0.45474	0.859;0.49	P;P	0.55871	0.786;0.635	T	0.52366	-0.8585	10	0.30078	T	0.28	.	14.8071	0.69965	0.0:0.0:0.8551:0.1449	.	101;119	P57771;P57771-2	RGS8_HUMAN;.	V	101;119;101;101	ENSP00000426289:L101V;ENSP00000258302:L119V;ENSP00000356528:L101V;ENSP00000356527:L101V	ENSP00000258302:L119V	L	-	1	2	RGS8	180883954	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	2.913000	0.48790	2.595000	0.87683	0.558000	0.71614	CTG		0.542	RGS8-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358979.1	NM_033345		Missense_Mutation
RGL1	23179	genome.wustl.edu	37	1	183816732	183816732	+	Silent	SNP	A	A	G			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr1:183816732A>G	ENST00000360851.3	+	3	349	c.171A>G	c.(169-171)acA>acG	p.T57T	RGL1_ENST00000536277.1_Silent_p.T55T|RGL1_ENST00000304685.4_Silent_p.T92T|RGL1_ENST00000539189.1_Silent_p.T57T			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	57					cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.T92T(1)		breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						CAGGACACACAGTCAGTCAAT	0.418																																																1	Substitution - coding silent(1)	ovary(1)	1											173.0	182.0	179.0					1																	183816732		2203	4300	6503	182083355	SO:0001819	synonymous_variant	23179			AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.171A>G	1.37:g.183816732A>G			182083355	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Silent	SNP	ENST00000360851.3	37		SNP	7	WashU																																																																																				0.418	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149		Silent
SLC25A4	291	genome.wustl.edu	37	4	186066369	186066369	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1104-01	TCGA-24-1104-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr4:186066369G>A	ENST00000281456.6	+	2	695	c.563G>A	c.(562-564)aGa>aAa	p.R188K		NM_001151.3	NP_001142.2	P12235	ADT1_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	188					adenine transport (GO:0015853)|apoptotic mitochondrial changes (GO:0008637)|energy reserve metabolic process (GO:0006112)|generation of precursor metabolites and energy (GO:0006091)|mitochondrial genome maintenance (GO:0000002)|negative regulation of necroptotic process (GO:0060546)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)	p.R188K(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	ATTATCTATAGAGCTGCCTAC	0.512																																																1	Substitution - Missense(1)	ovary(1)	4											52.0	56.0	55.0					4																	186066369		2203	4300	6503	186303363	SO:0001583	missense	291			BC008664	CCDS34114.1	4q35	2014-09-17			ENSG00000151729	ENSG00000151729		"""Solute carriers"""	10990	protein-coding gene	gene with protein product		103220		PEO3, PEO2, ANT1		1582253	Standard	NM_001151		Approved	T1	uc003ixd.3	P12235	OTTHUMG00000134299	ENST00000281456.6:c.563G>A	4.37:g.186066369G>A	ENSP00000281456:p.Arg188Lys		186303363	D3DP59	Missense_Mutation	SNP	ENST00000281456.6	37	CCDS34114.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.710152	0.96821	.	.	ENSG00000151729	ENST00000281456	T	0.78595	-1.19	5.65	5.65	0.86999	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.89880	0.6843	M	0.87900	2.915	0.80722	D	1	D	0.62365	0.991	D	0.68765	0.96	D	0.90554	0.4511	10	0.87932	D	0	-0.0037	19.9142	0.97043	0.0:0.0:1.0:0.0	.	188	P12235	ADT1_HUMAN	K	188	ENSP00000281456:R188K	ENSP00000281456:R188K	R	+	2	0	SLC25A4	186303363	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.657000	0.98554	2.941000	0.99782	0.655000	0.94253	AGA		0.512	SLC25A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259170.3	NM_001151		Missense_Mutation
RGS18	64407	genome.wustl.edu	37	1	192128428	192128428	+	Silent	SNP	T	T	G			TCGA-24-1104-01	TCGA-24-1104-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr1:192128428T>G	ENST00000367460.3	+	2	379	c.198T>G	c.(196-198)tcT>tcG	p.S66S	RGS18_ENST00000481707.1_3'UTR	NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	66					G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.S66S(1)		kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CCAGTAGATCTGGGCACTTGG	0.363																																																1	Substitution - coding silent(1)	ovary(1)	1											43.0	47.0	45.0					1																	192128428		2203	4299	6502	190395051	SO:0001819	synonymous_variant	64407			AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.198T>G	1.37:g.192128428T>G			190395051	B2RD23	Silent	SNP	ENST00000367460.3	37	CCDS1374.1	SNP	55	WashU																																																																																				0.363	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086382.1	NM_130782		Silent
BOLL	66037	genome.wustl.edu	37	2	198646522	198646522	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr2:198646522A>G	ENST00000392296.4	-	2	362	c.53T>C	c.(52-54)tTg>tCg	p.L18S	BOLL_ENST00000282278.8_5'UTR|BOLL_ENST00000430004.1_Missense_Mutation_p.L18S|BOLL_ENST00000433157.1_Missense_Mutation_p.L18S|BOLL_ENST00000321801.7_Missense_Mutation_p.L30S	NM_033030.5	NP_149019.1	Q8N9W6	BOLL_HUMAN	boule-like RNA-binding protein	18					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)	p.L18S(1)		central_nervous_system(1)|endometrium(2)|lung(6)|ovary(3)|prostate(1)	13						TGGGTTATTCAAAGGCACAGG	0.378																																																1	Substitution - Missense(1)	ovary(1)	2											215.0	220.0	218.0					2																	198646522		2203	4300	6503	198354767	SO:0001583	missense	66037				CCDS2324.1, CCDS2325.1, CCDS63081.1	2q33	2013-10-17	2013-10-17		ENSG00000152430	ENSG00000152430		"""RNA binding motif (RRM) containing"""	14273	protein-coding gene	gene with protein product		606165	"""bol (Drosophila boule homolog)-like"", ""bol, boule-like (Drosophila)"""			11390979, 16001084	Standard	NM_197970		Approved	BOULE	uc002uut.2	Q8N9W6	OTTHUMG00000132747	ENST00000392296.4:c.53T>C	2.37:g.198646522A>G	ENSP00000376116:p.Leu18Ser		198354767	B4DZA4|Q0JW32|Q53T62|Q969U3	Missense_Mutation	SNP	ENST00000392296.4	37	CCDS2325.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	19.46	3.831981	0.71258	.	.	ENSG00000152430	ENST00000430004;ENST00000392296;ENST00000321801;ENST00000433157	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	5.62	5.62	0.85841	.	0.311986	0.27971	N	0.017105	T	0.43010	0.1228	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.995;0.997	D;D;D;D	0.83275	0.996;0.991;0.969;0.986	T	0.20638	-1.0269	10	0.15952	T	0.53	-18.8161	13.3359	0.60518	1.0:0.0:0.0:0.0	.	24;30;18;24	Q8N9W6-2;Q8N9W6-3;Q8N9W6;Q8N9W6-4	.;.;BOLL_HUMAN;.	S	18;18;30;18	ENSP00000397711:L18S;ENSP00000376116:L18S;ENSP00000314792:L30S;ENSP00000396099:L18S	ENSP00000314792:L30S	L	-	2	0	BOLL	198354767	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.231000	0.72307	2.134000	0.65973	0.459000	0.35465	TTG		0.378	BOLL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256107.3	NM_033030		Missense_Mutation
FCAMR	83953	genome.wustl.edu	37	1	207140975	207140975	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr1:207140975C>G	ENST00000324852.4	-	2	535	c.61G>C	c.(61-63)Gaa>Caa	p.E21Q	FCAMR_ENST00000450945.2_Missense_Mutation_p.E21Q|FCAMR_ENST00000400962.3_Missense_Mutation_p.E21Q	NM_001170631.1	NP_001164102.1	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	320					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E21Q(1)		endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						TAGTCCACTTCTCTTCCTCTC	0.443																																					Ovarian(199;1883 2142 16966 44409 45154)											1	Substitution - Missense(1)	ovary(1)	1											203.0	172.0	181.0					1																	207140975		1568	3582	5150	205207598	SO:0001583	missense	83953			AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000324852.4:c.61G>C	1.37:g.207140975C>G	ENSP00000316491:p.Glu21Gln		205207598	Q32M82|Q8WWV5|Q96SA2	Missense_Mutation	SNP	ENST00000324852.4	37	CCDS53468.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	6.106	0.387864	0.11581	.	.	ENSG00000162897	ENST00000400962;ENST00000324852;ENST00000450945	T;T;T	0.10005	2.92;3.28;2.92	2.82	-1.75	0.08031	.	.	.	.	.	T	0.03959	0.0111	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.39418	-0.9615	7	0.33940	T	0.23	.	0.4994	0.00577	0.1844:0.3286:0.2252:0.2617	.	.	.	.	Q	21	ENSP00000383746:E21Q;ENSP00000316491:E21Q;ENSP00000392707:E21Q	ENSP00000316491:E21Q	E	-	1	0	FCAMR	205207598	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.947000	0.03901	-0.368000	0.08040	-0.181000	0.13052	GAA		0.443	FCAMR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088969.2	NM_032029		Missense_Mutation
CR1	1378	genome.wustl.edu	37	1	207785120	207785120	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1104-01	TCGA-24-1104-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr1:207785120A>T	ENST00000367049.4	+	38	6394	c.6394A>T	c.(6394-6396)Agc>Tgc	p.S2132C	CR1_ENST00000367053.1_Missense_Mutation_p.S1682C|CR1_ENST00000367051.1_Missense_Mutation_p.S1682C|CR1_ENST00000367052.1_Missense_Mutation_p.S1682C|CR1_ENST00000400960.2_Missense_Mutation_p.S1682C	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1682					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.S1687C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CTGTGAGCCCAGCTATGACCT	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											121.0	122.0	122.0					1																	207785120		1956	4151	6107	205851743	SO:0001583	missense	1378			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6394A>T	1.37:g.207785120A>T	ENSP00000356016:p.Ser2132Cys		205851743	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298419	0.40694	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	3.48	-0.751	0.11076	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.62865	0.2463	L	0.49571	1.57	0.09310	N	1	P;D	0.59767	0.481;0.986	B;P	0.53912	0.318;0.737	T	0.55786	-0.8086	9	0.72032	D	0.01	.	7.6476	0.28329	0.6088:0.0:0.3912:0.0	.	1682;2132	P17927;E9PDY4	CR1_HUMAN;.	C	1682;1682;1682;1682;2132	ENSP00000356019:S1682C;ENSP00000356018:S1682C;ENSP00000356020:S1682C;ENSP00000383744:S1682C;ENSP00000356016:S2132C	ENSP00000356016:S2132C	S	+	1	0	CR1	205851743	0.002000	0.14202	0.000000	0.03702	0.320000	0.28249	-0.296000	0.08287	-0.424000	0.07382	-0.215000	0.12644	AGC		0.577	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573		Missense_Mutation
TRPM8	79054	genome.wustl.edu	37	2	234862615	234862616	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-24-1104-01	TCGA-24-1104-10	GC	GC	GC	AT	GC	GC	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr2:234862615_234862616GC>AT	ENST00000324695.4	+	10	1235_1236	c.1195_1196GC>AT	c.(1195-1197)GCt>ATt	p.A399I	TRPM8_ENST00000433712.2_Missense_Mutation_p.A87I|AC005538.5_ENST00000455991.1_RNA	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	399					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	AATGGAAGAAGCTGGGGATGAA	0.396																																																0			2																																								234527355	SO:0001583	missense	79054			AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	Exception_encountered	2.37:g.234862615_234862616delinsAT	ENSP00000323926:p.Ala399Ile		234527354	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense	DNP	ENST00000324695.4	37	CCDS33407.1	DNP	34	WashU																																																																																				0.396	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080		Missense
F2	2147	genome.wustl.edu	37	11	46747441	46747441	+	Missense_Mutation	SNP	C	C	T	rs146671243		TCGA-24-1104-01	TCGA-24-1104-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr11:46747441C>T	ENST00000311907.5	+	7	648	c.592C>T	c.(592-594)Cgc>Tgc	p.R198C	F2_ENST00000530231.1_Missense_Mutation_p.R198C	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	198		Cleavage; by thrombin.			acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)	p.R198C(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	GATGACTCCACGCTCCGAAGG	0.612													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19178	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(147;1147 1808 2148 38609 51144)											1	Substitution - Missense(1)	ovary(1)	11						C	CYS/ARG	7,4395	11.4+/-27.6	0,7,2194	87.0	78.0	81.0		592	1.5	0.0	11	dbSNP_134	81	0,8598		0,0,4299	yes	missense	F2	NM_000506.3	180	0,7,6493	TT,TC,CC		0.0,0.159,0.0538	probably-damaging	198/623	46747441	7,12993	2201	4299	6500	46704017	SO:0001583	missense	2147			M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.592C>T	11.37:g.46747441C>T	ENSP00000308541:p.Arg198Cys		46704017	B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	ENST00000311907.5	37	CCDS31476.1	SNP	19	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.61|15.61	2.885551|2.885551	0.51908|0.51908	0.00159|0.00159	0.0|0.0	ENSG00000180210|ENSG00000180210	ENST00000311907;ENST00000530231;ENST00000442468|ENST00000446804	D;D;D|.	0.93811|.	-2.66;-2.87;-3.29|.	4.48|4.48	1.47|1.47	0.22746|0.22746	.|.	0.638690|.	0.16425|.	N|.	0.214981|.	T|T	0.56485|0.56485	0.1988|0.1988	M|M	0.78456|0.78456	2.415|2.415	0.22468|0.22468	N|N	0.999077|0.999077	D|.	0.69078|.	0.997|.	P|.	0.50192|.	0.634|.	T|T	0.51124|0.51124	-0.8745|-0.8745	10|6	0.87932|0.87932	D|D	0|0	.|.	8.3|8.3	0.32008|0.32008	0.5135:0.413:0.0:0.0734|0.5135:0.413:0.0:0.0734	.|.	198|.	P00734|.	THRB_HUMAN|.	C|M	198;198;188|47	ENSP00000308541:R198C;ENSP00000433907:R198C;ENSP00000387413:R188C|.	ENSP00000308541:R198C|ENSP00000406403:T47M	R|T	+|+	1|2	0|0	F2|F2	46704017|46704017	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.143000|0.143000	0.21401|0.21401	0.886000|0.886000	0.28241|0.28241	0.197000|0.197000	0.20387|0.20387	0.591000|0.591000	0.81541|0.81541	CGC|ACG		0.612	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317706.1			Missense_Mutation
BZW2	28969	genome.wustl.edu	37	7	16734485	16734496	+	In_Frame_Del	DEL	TGTGGATCATTT	TGTGGATCATTT	-			TCGA-24-1104-01	TCGA-24-1104-10	TGTGGATCATTT	TGTGGATCATTT	TGTGGATCATTT	-	TGTGGATCATTT	TGTGGATCATTT	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1104-01	TCGA-24-1104-10	g.chr7:16734485_16734496delTGTGGATCATTT	ENST00000433922.2	+	8	856_867	c.678_689delTGTGGATCATTT	c.(676-690)agtgtggatcatttt>agt	p.VDHF227del	BZW2_ENST00000407633.1_In_Frame_Del_p.VDHF33del|BZW2_ENST00000405202.1_In_Frame_Del_p.VDHF151del|BZW2_ENST00000258761.3_In_Frame_Del_p.VDHF227del|AC073333.8_ENST00000418907.1_RNA|BZW2_ENST00000452975.2_3'UTR|BZW2_ENST00000432311.1_Intron	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	227					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)		p.V227_F230del(1)		cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		ACAGACAGAGTGTGGATCATTTTGCTAAATAC	0.448																																																1	Deletion - In frame(1)	ovary(1)	7																																								16701021	SO:0001651	inframe_deletion	28969			AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.678_689delTGTGGATCATTT	7.37:g.16734485_16734496delTGTGGATCATTT	ENSP00000397249:p.Val227_Phe230del		16701010	A4D123|Q3B779|Q96JW5|Q9H3F7	In_Frame_Del	DEL	ENST00000433922.2	37	CCDS5362.1	DEL	59	WashU																																																																																				0.448	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253256.2	NM_014038		In_Frame_Del
