#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CBWD1	55871	genome.wustl.edu	37	9	178918	178918	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr9:178918C>A	ENST00000356521.4	-	1	140	c.52G>T	c.(52-54)Gat>Tat	p.D18Y	CBWD1_ENST00000431099.2_5'UTR|CBWD1_ENST00000377447.3_Missense_Mutation_p.D18Y|CBWD1_ENST00000314367.10_5'UTR|CBWD1_ENST00000382389.1_5'UTR|CBWD1_ENST00000382393.1_Missense_Mutation_p.D18Y|CBWD1_ENST00000382447.4_Missense_Mutation_p.D18Y|CBWD1_ENST00000377400.4_Missense_Mutation_p.D18Y	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1	18							ATP binding (GO:0005524)			kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		TCAGGACAATCCTCCTCCGCA	0.562																																																0			9											59.0	45.0	51.0					9																	178918		2097	3116	5213	168918	SO:0001583	missense	55871			AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.52G>T	9.37:g.178918C>A	ENSP00000348915:p.Asp18Tyr		168918	A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	Missense_Mutation	SNP	ENST00000356521.4	37	CCDS6438.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	.	17.13	3.311420	0.60414	.	.	ENSG00000172785	ENST00000356521;ENST00000377400;ENST00000382447;ENST00000377447;ENST00000377347;ENST00000417415;ENST00000382393	T;T;T;T;T	0.51574	2.9;2.83;2.91;1.31;0.7	3.76	2.8	0.32819	.	0.049217	0.85682	D	0.000000	T	0.51398	0.1672	L	0.29908	0.895	0.46609	D	0.999123	D;D	0.89917	0.998;1.0	D;D	0.66196	0.914;0.942	T	0.54964	-0.8214	10	0.66056	D	0.02	-26.0649	11.044	0.47849	0.0:0.8111:0.1889:0.0	.	18;18	Q9BRT8-3;Q9BRT8	.;CBWD1_HUMAN	Y	18	ENSP00000348915:D18Y;ENSP00000366617:D18Y;ENSP00000371885:D18Y;ENSP00000366666:D18Y;ENSP00000371830:D18Y	ENSP00000348915:D18Y	D	-	1	0	CBWD1	168918	1.000000	0.71417	0.998000	0.56505	0.755000	0.42902	3.111000	0.50360	1.925000	0.55765	0.479000	0.44913	GAT		0.562	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051463.1	NM_018491		Missense_Mutation
CARS	833	genome.wustl.edu	37	11	3038504	3038504	+	Silent	SNP	T	T	A			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr11:3038504T>A	ENST00000397111.5	-	15	1745	c.1500A>T	c.(1498-1500)gcA>gcT	p.A500A	CARS_ENST00000278224.9_Silent_p.A500A|CARS_ENST00000401769.3_Silent_p.A513A|CARS_ENST00000397114.3_Silent_p.A490A|CARS_ENST00000380525.4_Silent_p.A583A			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	500					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.A500A(1)|p.I501delI(1)	CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	CTTTGTGAATTGCTGTCTTCT	0.502			T	ALK	ALCL																																Ovarian(61;932 1157 5961 20446 52152)		Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	2	Substitution - coding silent(1)|Deletion - In frame(1)	large_intestine(1)|ovary(1)	11											90.0	78.0	82.0					11																	3038504		2202	4298	6500	2995080	SO:0001819	synonymous_variant	833			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.1500A>T	11.37:g.3038504T>A			2995080	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Silent	SNP	ENST00000397111.5	37	CCDS7742.1	SNP	63	WashU																																																																																				0.502	CARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030117.4	NM_001751		Silent
TRPV3	162514	genome.wustl.edu	37	17	3424276	3424276	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr17:3424276A>C	ENST00000576742.1	-	14	2122	c.1801T>G	c.(1801-1803)Ttt>Gtt	p.F601V	TRPV3_ENST00000301365.4_Missense_Mutation_p.F601V|TRPV3_ENST00000572519.1_Missense_Mutation_p.F601V	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	601					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)	p.F601V(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	CCTACTCCAAATCCAAGCAAA	0.338																																																1	Substitution - Missense(1)	ovary(1)	17											84.0	78.0	80.0					17																	3424276		2201	4300	6501	3371026	SO:0001583	missense	162514			AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.1801T>G	17.37:g.3424276A>C	ENSP00000461518:p.Phe601Val		3371026	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	ENST00000576742.1	37	CCDS11029.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	a	22.1	4.244964	0.79912	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	D	0.99167	-5.51	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000001	D	0.99233	0.9733	M	0.82323	2.585	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;0.998;1.0;0.998;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.99;0.998;0.993;0.994;0.998;0.996	D	0.99293	1.0899	10	0.87932	D	0	-5.8966	14.3707	0.66838	1.0:0.0:0.0:0.0	.	585;585;601;585;601;601;601	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	V	601;601;585	ENSP00000301365:F601V	ENSP00000301365:F601V	F	-	1	0	TRPV3	3371026	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.972000	0.88022	2.054000	0.61138	0.477000	0.44152	TTT		0.338	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068		Missense_Mutation
RPP40	10799	genome.wustl.edu	37	6	4999008	4999008	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr6:4999008C>T	ENST00000380051.2	-	5	545	c.501G>A	c.(499-501)tgG>tgA	p.W167*	RPP40_ENST00000319533.5_Nonsense_Mutation_p.W144*|RPP40_ENST00000464646.1_Nonsense_Mutation_p.W107*	NM_006638.2	NP_006629.2	O75818	RPP40_HUMAN	ribonuclease P/MRP 40kDa subunit	167					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)	p.W167*(1)		NS(1)|breast(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	14	Ovarian(93;0.11)	all_hematologic(90;0.0895)				CTTTGAAAGACCAAGATATTC	0.269																																																1	Substitution - Nonsense(1)	ovary(1)	6											31.0	33.0	32.0					6																	4999008		2183	4283	6466	4944007	SO:0001587	stop_gained	10799			U94317	CCDS34333.1, CCDS69040.1, CCDS75391.1	6p25.1	2012-05-21	2007-06-26	2004-03-19	ENSG00000124787	ENSG00000124787			20992	protein-coding gene	gene with protein product		606117	"""ribonuclease P1"", ""ribonuclease P 40kDa subunit"""	RNASEP1		9630247	Standard	NM_006638		Approved	bA428J1.3	uc003mwl.3	O75818	OTTHUMG00000014168	ENST00000380051.2:c.501G>A	6.37:g.4999008C>T	ENSP00000369391:p.Trp167*		4944007	Q5VX97|Q8WVK8	Nonsense_Mutation	SNP	ENST00000380051.2	37	CCDS34333.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	13.72	2.321316	0.41096	.	.	ENSG00000124787	ENST00000380051;ENST00000319533;ENST00000464646	.	.	.	5.61	4.74	0.60224	.	0.230323	0.47093	D	0.000256	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-11.5818	14.9611	0.71158	0.1439:0.8561:0.0:0.0	.	.	.	.	X	167;144;107	.	ENSP00000317998:W144X	W	-	3	0	RPP40	4944007	1.000000	0.71417	1.000000	0.80357	0.198000	0.23893	3.960000	0.56752	1.342000	0.45619	-0.188000	0.12872	TGG		0.269	RPP40-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039733.2	NM_006638		Nonsense_Mutation
RP1L1	94137	genome.wustl.edu	37	8	10464503	10464503	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr8:10464503C>A	ENST00000382483.3	-	4	7328	c.7105G>T	c.(7105-7107)Ggt>Tgt	p.G2369C		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2449					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.G2369C(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		AGGTCATAACCTTCACTGGCC	0.562																																																1	Substitution - Missense(1)	ovary(1)	8																																								10501913	SO:0001583	missense	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.7105G>T	8.37:g.10464503C>A	ENSP00000371923:p.Gly2369Cys		10501913	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	10.35	1.324551	0.24080	.	.	ENSG00000183638	ENST00000382483	T	0.05786	3.39	4.41	2.6	0.31112	.	.	.	.	.	T	0.10252	0.0251	N	0.24115	0.695	0.09310	N	1	D	0.76494	0.999	P	0.62885	0.908	T	0.21042	-1.0257	9	0.72032	D	0.01	-2.631	6.3015	0.21115	0.0:0.6692:0.1556:0.1753	.	2369	A6NKC6	.	C	2369	ENSP00000371923:G2369C	ENSP00000371923:G2369C	G	-	1	0	RP1L1	10501913	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.216000	0.17585	1.224000	0.43551	0.555000	0.69702	GGT		0.562	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			Missense_Mutation
HIVEP1	3096	genome.wustl.edu	37	6	12163572	12163572	+	Silent	SNP	A	A	C	rs201995479		TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr6:12163572A>C	ENST00000379388.2	+	9	7367	c.7035A>C	c.(7033-7035)gcA>gcC	p.A2345A	HIVEP1_ENST00000541134.1_Silent_p.A210A	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	2345					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A2345A(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CCCAGACAGCAGCGGGGATGC	0.527																																																1	Substitution - coding silent(1)	ovary(1)	6											152.0	159.0	157.0					6																	12163572		2020	4183	6203	12271558	SO:0001819	synonymous_variant	3096			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.7035A>C	6.37:g.12163572A>C			12271558	B2RTU3|Q14122|Q5MPB1|Q5VW60	Silent	SNP	ENST00000379388.2	37	CCDS43426.1	SNP	7	WashU																																																																																				0.527	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114		Silent
RAD23A	5886	genome.wustl.edu	37	19	13059538	13059538	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr19:13059538A>T	ENST00000586534.1	+	5	572	c.511A>T	c.(511-513)Atg>Ttg	p.M171L	RAD23A_ENST00000588826.2_3'UTR|RAD23A_ENST00000592268.1_Missense_Mutation_p.M171L|RAD23A_ENST00000316856.3_Missense_Mutation_p.M171L|RAD23A_ENST00000541222.1_Missense_Mutation_p.M6L			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	171	UBA 1. {ECO:0000255|PROSITE- ProRule:PRU00212}.				nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						GACGGAGATCATGTCCATGGG	0.617								Nucleotide excision repair (NER)																																								0			19											114.0	113.0	114.0					19																	13059538		2203	4300	6503	12920538	SO:0001583	missense	5886				CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.511A>T	19.37:g.13059538A>T	ENSP00000467024:p.Met171Leu		12920538	K7ESE3|Q59EU8|Q5M7Z1	Missense_Mutation	SNP	ENST00000586534.1	37	CCDS12289.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	14.22	2.470794	0.43942	.	.	ENSG00000179262	ENST00000316856;ENST00000541222	T;T	0.23348	1.91;1.91	4.61	3.59	0.41128	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);	0.051554	0.64402	D	0.000001	T	0.36552	0.0971	M	0.65498	2.005	0.43480	D	0.995705	B;B;P	0.38250	0.131;0.092;0.624	B;B;P	0.50082	0.248;0.195;0.63	T	0.05146	-1.0903	10	0.27082	T	0.32	-40.2862	9.0262	0.36232	0.9097:0.0:0.0903:0.0	.	171;188;171	A8K1J3;Q59EU8;P54725	.;.;RD23A_HUMAN	L	171;6	ENSP00000321365:M171L;ENSP00000438741:M6L	ENSP00000321365:M171L	M	+	1	0	RAD23A	12920538	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.635000	0.74295	0.630000	0.30394	0.459000	0.35465	ATG		0.617	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452752.1	NM_005053		Missense_Mutation
EMR3	84658	genome.wustl.edu	37	19	14757991	14757991	+	Splice_Site	SNP	A	A	C			TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr19:14757991A>C	ENST00000253673.5	-	8	983		c.e8+1		EMR3_ENST00000344373.4_Splice_Site|EMR3_ENST00000443157.2_Splice_Site|EMR3_ENST00000599900.1_Splice_Site	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.?(1)		NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						CCTGTGACCCACCTTCACGTG	0.512																																																1	Unknown(1)	ovary(1)	19											245.0	212.0	223.0					19																	14757991		2203	4300	6503	14618991	SO:0001630	splice_region_variant	84658			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.882+1T>G	19.37:g.14757991A>C			14618991		Splice_Site_SNP	SNP	ENST00000253673.5	37	CCDS12315.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	13.19	2.162063	0.38217	.	.	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	.	.	.	3.94	3.94	0.45596	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.2887	0.37773	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EMR3	14618991	0.992000	0.36948	0.544000	0.28141	0.079000	0.17450	3.320000	0.51991	1.433000	0.47394	0.524000	0.50904	.		0.512	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1	NM_032571	Intron	Splice_Site_SNP
MEIG1	644890	genome.wustl.edu	37	10	15008563	15008563	+	Nonsense_Mutation	SNP	T	T	A			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr10:15008563T>A	ENST00000378240.1	+	1	126	c.96T>A	c.(94-96)taT>taA	p.Y32*	MEIG1_ENST00000407572.1_Nonsense_Mutation_p.Y32*			Q5JSS6	MEIG1_HUMAN	meiosis/spermiogenesis associated 1	32					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)		p.Y32*(1)		kidney(1)|ovary(1)|prostate(1)	3						AAGCAGGATATCGGGATGAAA	0.363																																																1	Substitution - Nonsense(1)	ovary(1)	10											77.0	75.0	76.0					10																	15008563		2203	4300	6503	15048569	SO:0001587	stop_gained	644890				CCDS31151.1	10p13	2013-08-05	2013-08-05		ENSG00000197889	ENSG00000197889			23429	protein-coding gene	gene with protein product	"""spermatogenesis associated 39"""	614174	"""meiosis expressed gene 1 homolog (mouse)"""			23258628	Standard	NM_001080836		Approved	bA2K17.3, SPATA39	uc009xjk.1	Q5JSS6	OTTHUMG00000017717	ENST00000378240.1:c.96T>A	10.37:g.15008563T>A	ENSP00000367486:p.Tyr32*		15048569		Nonsense_Mutation	SNP	ENST00000378240.1	37	CCDS31151.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	t	36	5.793302	0.96952	.	.	ENSG00000197889	ENST00000407572;ENST00000378240	.	.	.	5.68	3.31	0.37934	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7053	7.5395	0.27729	0.0:0.3622:0.0:0.6378	.	.	.	.	X	32	.	ENSP00000367486:Y32X	Y	+	3	2	MEIG1	15048569	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.648000	0.46647	0.405000	0.25532	0.460000	0.39030	TAT		0.363	MEIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046942.1	XM_927975		Nonsense_Mutation
OSBPL1A	114876	genome.wustl.edu	37	18	21739675	21739675	+	IGR	SNP	A	A	G			TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr18:21739675A>G	ENST00000319481.3	-	0	4195				CABYR_ENST00000327201.6_Missense_Mutation_p.I163V|CABYR_ENST00000415309.2_Intron|CABYR_ENST00000399496.3_Missense_Mutation_p.I261V|RP11-799B12.4_ENST00000583267.1_lincRNA|CABYR_ENST00000399499.1_Missense_Mutation_p.I261V|CABYR_ENST00000581397.1_Missense_Mutation_p.I261V	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CCCACCTTTTATCTTAGTAGG	0.458																																																0			18											79.0	80.0	80.0					18																	21739675		2203	4300	6503	19993673	SO:0001628	intergenic_variant	26256			AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944		18.37:g.21739675A>G			19993673	B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	37	CCDS11884.1	SNP	16	WashU	.	.	.	.	.	.	.	.	.	.	A	14.08	2.428380	0.43122	.	.	ENSG00000154040	ENST00000399496;ENST00000327201;ENST00000399499	T;T	0.54479	0.57;0.57	4.85	4.85	0.62838	.	.	.	.	.	T	0.42854	0.1221	L	0.29908	0.895	0.80722	D	1	P	0.36282	0.546	B	0.41764	0.366	T	0.46442	-0.9191	9	0.87932	D	0	.	6.132	0.20211	0.7501:0.164:0.0859:0.0	.	261	O75952-3	.	V	261;163;261	ENSP00000382419:I261V;ENSP00000382421:I261V	ENSP00000317095:I163V	I	+	1	0	CABYR	19993673	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.249000	0.43169	1.807000	0.52817	0.460000	0.39030	ATC		0.458	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597		Missense_Mutation
RPGRIP1	57096	genome.wustl.edu	37	14	21762871	21762871	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1417-01	TCGA-24-1417-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr14:21762871A>G	ENST00000400017.2	+	2	121	c.121A>G	c.(121-123)Atg>Gtg	p.M41V	RPGRIP1_ENST00000556336.1_Missense_Mutation_p.M41V|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.M41V|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.M41V	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	41					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)		p.M41V(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		CTTGAGCAGGATGAACCGGGA	0.408																																																1	Substitution - Missense(1)	ovary(1)	14											104.0	103.0	103.0					14																	21762871		1862	4105	5967	20832711	SO:0001583	missense	57096			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.121A>G	14.37:g.21762871A>G	ENSP00000382895:p.Met41Val		20832711	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	37	CCDS45080.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	7.035	0.561403	0.13498	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18	4.52	3.34	0.38264	.	0.398942	0.27764	N	0.017958	T	0.59418	0.2192	L	0.39020	1.185	0.80722	D	1	P	0.34864	0.473	B	0.31442	0.13	T	0.55958	-0.8058	10	0.02654	T	1	-12.5175	7.9577	0.30053	0.7918:0.2082:0.0:0.0	.	41	Q96KN7	RPGR1_HUMAN	V	41	ENSP00000450445:M41V;ENSP00000451219:M41V;ENSP00000382895:M41V;ENSP00000206660:M41V	ENSP00000206660:M41V	M	+	1	0	RPGRIP1	20832711	0.998000	0.40836	0.339000	0.25562	0.790000	0.44656	1.124000	0.31320	0.730000	0.32425	0.459000	0.35465	ATG		0.408	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366		Missense_Mutation
HIST1H2AG	8969	genome.wustl.edu	37	6	27100858	27100858	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr6:27100858G>T	ENST00000359193.2	+	1	27	c.8G>T	c.(7-9)gGa>gTa	p.G3V	HIST1H2BJ_ENST00000339812.2_5'Flank|HIST1H2BJ_ENST00000607124.1_5'Flank|HIST1H2BJ_ENST00000541790.1_5'Flank	NM_021064.4	NP_066408.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	3						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.G3V(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	17						GCTATGTCTGGACGTGGCAAG	0.587																																																1	Substitution - Missense(1)	ovary(1)	6											42.0	47.0	45.0					6																	27100858		2198	4299	6497	27208837	SO:0001583	missense	8969			L19778	CCDS4619.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196787	ENSG00000196787		"""Histones / Replication-dependent"""	4737	protein-coding gene	gene with protein product		615012	"""H2A histone family, member P"", ""histone 1, H2ag"""	H2AFP		8179821, 12408966	Standard	NM_021064		Approved	pH2A/f, H2A/p, H2A.1b	uc003niw.3	P0C0S8	OTTHUMG00000014469	ENST00000359193.2:c.8G>T	6.37:g.27100858G>T	ENSP00000352119:p.Gly3Val		27208837	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000359193.2	37	CCDS4619.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	10.68	1.419141	0.25552	.	.	ENSG00000196787	ENST00000359193	D	0.94376	-3.41	4.08	4.08	0.47627	Histone-fold (2);Histone H2A (1);	0.000000	0.39475	N	0.001347	D	0.95156	0.8430	.	.	.	0.80722	D	1	D	0.63046	0.992	P	0.60886	0.88	D	0.95647	0.8703	9	0.87932	D	0	.	14.6102	0.68510	0.0:0.0:1.0:0.0	.	3	P0C0S8	H2A1_HUMAN	V	3	ENSP00000352119:G3V	ENSP00000352119:G3V	G	+	2	0	HIST1H2AG	27208837	1.000000	0.71417	0.998000	0.56505	0.162000	0.22319	8.726000	0.91474	2.217000	0.71921	0.655000	0.94253	GGA		0.587	HIST1H2AG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040137.1	NM_021064		Missense_Mutation
IL21R	50615	genome.wustl.edu	37	16	27456571	27456571	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr16:27456571G>A	ENST00000337929.3	+	7	1232	c.759G>A	c.(757-759)tgG>tgA	p.W253*	IL21R_ENST00000564583.1_3'UTR|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000395755.1_Nonsense_Mutation_p.W253*|IL21R_ENST00000395754.4_Nonsense_Mutation_p.W253*|IL21R_ENST00000564089.1_Nonsense_Mutation_p.W253*	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	253					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)	p.W253*(1)		breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						CTGCCTTCTGGAGCCTGAAGA	0.547			T	BCL6	NHL																																		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	1	Substitution - Nonsense(1)	ovary(1)	16											101.0	75.0	84.0					16																	27456571		2197	4300	6497	27364072	SO:0001587	stop_gained	50615			AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.759G>A	16.37:g.27456571G>A	ENSP00000338010:p.Trp253*		27364072	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Nonsense_Mutation	SNP	ENST00000337929.3	37	CCDS10630.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	13.70	2.316872	0.40996	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	.	.	.	3.29	0.0813	0.14424	.	1.924470	0.02196	N	0.061802	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-2.0264	9.1648	0.37046	0.1651:0.0:0.8349:0.0	.	.	.	.	X	253	.	ENSP00000338010:W253X	W	+	3	0	IL21R	27364072	0.889000	0.30405	0.214000	0.23707	0.194000	0.23727	0.474000	0.22148	0.037000	0.15575	0.561000	0.74099	TGG		0.547	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078		Nonsense_Mutation
KIAA0556	23247	genome.wustl.edu	37	16	27788939	27788939	+	Silent	SNP	G	G	T			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr16:27788939G>T	ENST00000261588.4	+	26	4579	c.4560G>T	c.(4558-4560)gtG>gtT	p.V1520V		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1520						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.V1520V(1)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						AGCTCCTGGTGGACGACCTGC	0.632																																																1	Substitution - coding silent(1)	ovary(1)	16											98.0	84.0	89.0					16																	27788939		2197	4300	6497	27696440	SO:0001819	synonymous_variant	23247			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.4560G>T	16.37:g.27788939G>T			27696440	A7E2C2	Silent	SNP	ENST00000261588.4	37	CCDS32415.1	SNP	47	WashU																																																																																				0.632	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202		Silent
OR14J1	442191	genome.wustl.edu	37	6	29275407	29275407	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr6:29275407G>A	ENST00000377160.2	+	1	1005	c.941G>A	c.(940-942)tGc>tAc	p.C314Y		NM_030946.1	NP_112208.1	Q9UGF5	O14J1_HUMAN	olfactory receptor, family 14, subfamily J, member 1	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C314Y(1)		endometrium(2)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(2)	17						AGAAAaatgtgcttaaaagcc	0.383																																																1	Substitution - Missense(1)	ovary(1)	6											58.0	65.0	63.0					6																	29275407		1511	2709	4220	29383386	SO:0001583	missense	442191				CCDS34362.1	6p21.3	2012-08-09	2008-04-02	2008-04-02	ENSG00000204695	ENSG00000204695		"""GPCR / Class A : Olfactory receptors"""	13971	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily U, member 1"""	OR5U1			Standard	NM_030946		Approved	hs6M1-28	uc011dln.2	Q9UGF5	OTTHUMG00000031184	ENST00000377160.2:c.941G>A	6.37:g.29275407G>A	ENSP00000366365:p.Cys314Tyr		29383386	A2BEC2|B0V078|Q5ST27	Missense_Mutation	SNP	ENST00000377160.2	37	CCDS34362.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	0.037	-1.302252	0.01353	.	.	ENSG00000204695	ENST00000377160	T	0.03920	3.76	4.33	-3.74	0.04385	.	1.385010	0.05430	N	0.545805	T	0.00496	0.0016	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43702	-0.9375	10	0.02654	T	1	.	3.796	0.08740	0.3515:0.0:0.2561:0.3924	.	314	Q9UGF5	O14J1_HUMAN	Y	314	ENSP00000366365:C314Y	ENSP00000366365:C314Y	C	+	2	0	OR14J1	29383386	0.000000	0.05858	0.000000	0.03702	0.344000	0.29017	-1.495000	0.02294	-0.333000	0.08476	-0.484000	0.04775	TGC		0.383	OR14J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076362.2			Missense_Mutation
ITGAD	3681	genome.wustl.edu	37	16	31413472	31413472	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr16:31413472T>C	ENST00000389202.2	+	6	513	c.464T>C	c.(463-465)aTt>aCt	p.I155T	RP11-120K18.2_ENST00000567545.1_RNA	NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	155	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.I155T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GTCTTCCTGATTGACGGCTCT	0.552																																																1	Substitution - Missense(1)	ovary(1)	16											150.0	129.0	136.0					16																	31413472		2197	4300	6497	31320973	SO:0001583	missense	3681			U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.464T>C	16.37:g.31413472T>C	ENSP00000373854:p.Ile155Thr		31320973	Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	37	CCDS32438.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	18.01	3.528361	0.64860	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.30714	1.52	4.84	4.84	0.62591	von Willebrand factor, type A (3);	.	.	.	.	T	0.60235	0.2253	M	0.89287	3.02	0.34520	D	0.708093	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.991;0.991	T	0.76321	-0.3002	9	0.87932	D	0	.	12.4256	0.55544	0.0:0.0:0.0:1.0	.	155;171;155	B7Z6V7;Q59H14;Q13349	.;.;ITAD_HUMAN	T	171;155	ENSP00000373854:I155T	ENSP00000373854:I155T	I	+	2	0	ITGAD	31320973	1.000000	0.71417	0.906000	0.35671	0.643000	0.38383	4.030000	0.57260	2.034000	0.60081	0.519000	0.50382	ATT		0.552	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353		Missense_Mutation
SPAST	6683	genome.wustl.edu	37	2	32361684	32361684	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr2:32361684T>G	ENST00000315285.3	+	10	1423	c.1298T>G	c.(1297-1299)cTt>cGt	p.L433R	SPAST_ENST00000345662.1_Missense_Mutation_p.L401R	NM_014946.3	NP_055761.2			spastin											breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GCTCGAGAACTTCAACCTTCT	0.338																																																0			2											103.0	108.0	106.0					2																	32361684		2203	4300	6503	32215188	SO:0001583	missense	6683			AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.1298T>G	2.37:g.32361684T>G	ENSP00000320885:p.Leu433Arg		32215188		Missense_Mutation	SNP	ENST00000315285.3	37	CCDS1778.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	21.2	4.111157	0.77210	.	.	ENSG00000021574	ENST00000345662;ENST00000315285	D;D	0.93019	-3.15;-3.15	5.62	5.62	0.85841	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.92632	0.7659	N	0.20766	0.605	0.80722	D	1	D;P	0.65815	0.995;0.94	P;P	0.62740	0.906;0.838	D	0.92489	0.5999	10	0.38643	T	0.18	-16.6495	14.0688	0.64849	0.0:0.0:0.0:1.0	.	401;433	E5KRP6;Q9UBP0	.;SPAST_HUMAN	R	401;433	ENSP00000340817:L401R;ENSP00000320885:L433R	ENSP00000320885:L433R	L	+	2	0	SPAST	32215188	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.682000	0.74528	2.150000	0.67090	0.533000	0.62120	CTT		0.338	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250253.1	NM_199436		Missense_Mutation
BMPER	168667	genome.wustl.edu	37	7	34192867	34192867	+	Silent	SNP	C	C	A			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr7:34192867C>A	ENST00000297161.2	+	16	2414	c.2040C>A	c.(2038-2040)gtC>gtA	p.V680V	BMPER_ENST00000426693.1_Silent_p.V680V	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	680	TIL.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.V680V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						TCAAGCCAGTCCTTTGTCCCC	0.498																																																1	Substitution - coding silent(1)	ovary(1)	7											136.0	107.0	117.0					7																	34192867		2203	4300	6503	34159392	SO:0001819	synonymous_variant	168667				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.2040C>A	7.37:g.34192867C>A			34159392	A8K1P8|Q8TF36	Silent	SNP	ENST00000297161.2	37	CCDS5442.1	SNP	30	WashU																																																																																				0.498	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468		Silent
ZNF536	9745	genome.wustl.edu	37	19	30936288	30936288	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr19:30936288T>A	ENST00000355537.3	+	2	1966	c.1819T>A	c.(1819-1821)Ttt>Att	p.F607I		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	607					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.F607I(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CAGTCGGGATTTTTTGTCACA	0.547																																																1	Substitution - Missense(1)	ovary(1)	19											95.0	102.0	100.0					19																	30936288		2203	4300	6503	35628128	SO:0001583	missense	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1819T>A	19.37:g.30936288T>A	ENSP00000347730:p.Phe607Ile		35628128	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	5.129	0.209485	0.09757	.	.	ENSG00000198597	ENST00000355537	T	0.41400	1.0	5.68	5.68	0.88126	.	0.114632	0.64402	D	0.000009	T	0.35248	0.0925	L	0.36672	1.1	0.46167	D	0.998908	B;B	0.30406	0.278;0.278	B;B	0.24974	0.057;0.057	T	0.13872	-1.0493	10	0.49607	T	0.09	-15.212	15.9325	0.79675	0.0:0.0:0.0:1.0	.	607;607	A7E228;O15090	.;ZN536_HUMAN	I	607	ENSP00000347730:F607I	ENSP00000347730:F607I	F	+	1	0	ZNF536	35628128	1.000000	0.71417	0.986000	0.45419	0.528000	0.34623	3.181000	0.50903	2.148000	0.66965	0.533000	0.62120	TTT		0.547	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		Missense_Mutation
NPR2	4882	genome.wustl.edu	37	9	35805826	35805826	+	Splice_Site	SNP	G	G	C	rs5814		TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr9:35805826G>C	ENST00000342694.2	+	14	2302		c.e14-1			NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.?(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CCTCTTTTCAGAGAAGCTGTG	0.582																																																1	Unknown(1)	ovary(1)	9											51.0	54.0	53.0					9																	35805826		2203	4300	6503	35795826	SO:0001630	splice_region_variant	4882			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.2048-1G>C	9.37:g.35805826G>C			35795826	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Splice_Site_SNP	SNP	ENST00000342694.2	37	CCDS6590.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	19.27	3.794667	0.70452	.	.	ENSG00000159899	ENST00000342694	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7127	0.91664	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NPR2	35795826	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.824000	0.99380	2.765000	0.95021	0.655000	0.94253	.		0.582	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		Intron	Splice_Site_SNP
KBTBD7	84078	genome.wustl.edu	37	13	41766661	41766661	+	Missense_Mutation	SNP	C	C	G	rs267603825		TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr13:41766661C>G	ENST00000379483.3	-	1	2041	c.1733G>C	c.(1732-1734)tGg>tCg	p.W578S		NM_032138.4	NP_115514.2	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	578								p.W578S(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(4)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		GTTCTTTTTCCATTGTGGGGT	0.408																																																1	Substitution - Missense(1)	ovary(1)	13											173.0	168.0	170.0					13																	41766661		2203	4300	6503	40664661	SO:0001583	missense	84078			AL136782	CCDS9377.1	13q13.3	2013-01-08			ENSG00000120696	ENSG00000120696		"""BTB/POZ domain containing"""	25266	protein-coding gene	gene with protein product						11230166	Standard	NM_032138		Approved	DKFZP434E2318	uc001uxw.1	Q8WVZ9	OTTHUMG00000016789	ENST00000379483.3:c.1733G>C	13.37:g.41766661C>G	ENSP00000368797:p.Trp578Ser		40664661	B5TZ86|Q5T6Y7|Q8NB99|Q9H0I6	Missense_Mutation	SNP	ENST00000379483.3	37	CCDS9377.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	0.624	-0.820075	0.02755	.	.	ENSG00000120696	ENST00000379483;ENST00000501885	T	0.63913	-0.07	5.58	4.73	0.59995	Kelch-type beta propeller (1);	0.356453	0.28730	U	0.014323	T	0.62551	0.2437	L	0.44542	1.39	0.80722	D	1	D	0.60160	0.987	P	0.56278	0.795	T	0.60010	-0.7346	10	0.06099	T	0.92	.	13.537	0.61652	0.1573:0.8426:0.0:0.0	.	578	Q8WVZ9	KBTB7_HUMAN	S	578;480	ENSP00000368797:W578S	ENSP00000368797:W578S	W	-	2	0	KBTBD7	40664661	1.000000	0.71417	0.964000	0.40570	0.172000	0.22775	4.509000	0.60448	1.320000	0.45209	0.557000	0.71058	TGG		0.408	KBTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044660.1	NM_032138		Missense_Mutation
BACE2	25825	genome.wustl.edu	37	21	42613763	42613763	+	Silent	SNP	G	G	A			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr21:42613763G>A	ENST00000330333.6	+	4	1099	c.636G>A	c.(634-636)gaG>gaA	p.E212E	BACE2_ENST00000466122.1_3'UTR|BACE2_ENST00000328735.6_Silent_p.E212E|BACE2_ENST00000347667.5_Silent_p.E212E	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	212					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				GTTCTCTGGAGACCTTCTTCG	0.592																																																0			21											131.0	129.0	130.0					21																	42613763		2203	4300	6503	41535633	SO:0001819	synonymous_variant	25825			AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.636G>A	21.37:g.42613763G>A			41535633	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Silent	SNP	ENST00000330333.6	37	CCDS13668.1	SNP	33	WashU																																																																																				0.592	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1			Silent
PLEKHG2	64857	genome.wustl.edu	37	19	39915544	39915544	+	Silent	SNP	G	G	C	rs201352095		TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr19:39915544G>C	ENST00000409794.3	+	19	4621	c.3771G>C	c.(3769-3771)acG>acC	p.T1257T	PLEKHG2_ENST00000378550.1_Intron|CTB-60E11.4_ENST00000601124.1_lincRNA|PLEKHG2_ENST00000458508.2_Intron|PLEKHG2_ENST00000425673.1_Silent_p.T1228T|PLEKHG2_ENST00000409797.2_Intron	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	1257					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CAGACTTGACGCCACCTCATA	0.592																																																0			19											114.0	116.0	115.0					19																	39915544		2203	4300	6503	44607384	SO:0001819	synonymous_variant	64857			AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.3771G>C	19.37:g.39915544G>C			44607384	B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Silent	SNP	ENST00000409794.3	37	CCDS33022.2	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	4.030	0.003053	0.07866	.	.	ENSG00000090924	ENST00000205135	.	.	.	4.71	-4.01	0.04045	.	.	.	.	.	T	0.39655	0.1086	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39121	-0.9629	4	.	.	.	.	3.1753	0.06566	0.1245:0.345:0.3691:0.1614	.	.	.	.	P	1125	.	.	R	+	2	0	PLEKHG2	44607384	0.012000	0.17670	0.680000	0.29994	0.509000	0.34042	-2.111000	0.01333	-0.328000	0.08539	-0.375000	0.07067	CGC		0.592	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1	NM_022835		Silent
SKA1	220134	genome.wustl.edu	37	18	47917616	47917616	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr18:47917616G>A	ENST00000285116.3	+	6	783	c.572G>A	c.(571-573)aGa>aAa	p.R191K	SKA1_ENST00000417656.2_Missense_Mutation_p.R145K|SKA1_ENST00000488454.1_Missense_Mutation_p.R40K|SKA1_ENST00000398452.2_Missense_Mutation_p.R191K	NM_001039535.2|NM_145060.3	NP_001034624.1|NP_659497.1	Q96BD8	SKA1_HUMAN	spindle and kinetochore associated complex subunit 1	191					cell division (GO:0051301)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|spindle microtubule (GO:0005876)	microtubule binding (GO:0008017)	p.R191K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(1)|prostate(1)	13						TCTGTGACCAGAAATCTCTAT	0.299																																																1	Substitution - Missense(1)	ovary(1)	18											61.0	63.0	62.0					18																	47917616		2202	4299	6501	46171614	SO:0001583	missense	220134			BC015706	CCDS11946.1	18q21.1	2013-01-17	2009-08-19	2009-08-19	ENSG00000154839	ENSG00000154839			28109	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 24"""	C18orf24		17093495	Standard	NM_145060		Approved	MGC10200	uc002leu.3	Q96BD8	OTTHUMG00000132685	ENST00000285116.3:c.572G>A	18.37:g.47917616G>A	ENSP00000285116:p.Arg191Lys		46171614	B2R9Y6|B4E0P4	Missense_Mutation	SNP	ENST00000285116.3	37	CCDS11946.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037481	0.75617	.	.	ENSG00000154839	ENST00000285116;ENST00000417656;ENST00000398452	T;T;T	0.55234	0.53;0.53;0.53	6.02	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.65964	0.2742	L	0.56396	1.775	0.58432	D	0.999994	D;D	0.67145	0.995;0.996	P;P	0.62885	0.852;0.908	T	0.66240	-0.5973	10	0.42905	T	0.14	-18.8619	14.5384	0.67976	0.0:0.0:0.8526:0.1474	.	145;191	Q96BD8-2;Q96BD8	.;SKA1_HUMAN	K	191;145;191	ENSP00000285116:R191K;ENSP00000397222:R145K;ENSP00000381470:R191K	ENSP00000285116:R191K	R	+	2	0	SKA1	46171614	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.180000	0.89694	1.544000	0.49359	0.655000	0.94253	AGA		0.299	SKA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255982.2	NM_145060		Missense_Mutation
MADD	8567	genome.wustl.edu	37	11	47310524	47310524	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1417-01	TCGA-24-1417-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr11:47310524G>A	ENST00000311027.5	+	16	2824	c.2659G>A	c.(2659-2661)Ggg>Agg	p.G887R	MADD_ENST00000342922.4_Intron|MADD_ENST00000402192.2_Intron|MADD_ENST00000407859.3_Missense_Mutation_p.G844R|MADD_ENST00000349238.3_Missense_Mutation_p.G887R|MADD_ENST00000395336.3_Missense_Mutation_p.G887R|MADD_ENST00000395344.3_Intron|MADD_ENST00000402799.1_Intron|MADD_ENST00000406482.1_Intron	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.G887R(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		CCCAGTATTTGGGCTAAATAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	11											166.0	172.0	170.0					11																	47310524		2201	4298	6499	47267100	SO:0001583	missense	8567			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.2659G>A	11.37:g.47310524G>A	ENSP00000310933:p.Gly887Arg		47267100		Missense_Mutation	SNP	ENST00000311027.5	37	CCDS7930.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	33	5.282368	0.95489	.	.	ENSG00000110514	ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395336	T;T;T;T	0.07688	3.4;3.42;3.17;3.41	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.20981	0.0505	L	0.27053	0.805	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	T	0.00651	-1.1626	10	0.59425	D	0.04	-21.928	20.422	0.99049	0.0:0.0:1.0:0.0	.	887;887;844;887	Q8WXG6-7;Q8WXG6-2;Q8WXG6-4;Q8WXG6	.;.;.;MADD_HUMAN	R	887;887;844;887	ENSP00000304505:G887R;ENSP00000310933:G887R;ENSP00000384204:G844R;ENSP00000378745:G887R	ENSP00000310933:G887R	G	+	1	0	MADD	47267100	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.832000	0.97577	0.655000	0.94253	GGG		0.473	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1			Missense_Mutation
NRXN1	9378	genome.wustl.edu	37	2	50318609	50318609	+	Silent	SNP	C	C	T			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr2:50318609C>T	ENST00000406316.2	-	19	5046	c.3570G>A	c.(3568-3570)aaG>aaA	p.K1190K	NRXN1_ENST00000342183.5_Silent_p.K155K|NRXN1_ENST00000405472.3_Silent_p.K1182K|NRXN1_ENST00000404971.1_Silent_p.K1230K|NRXN1_ENST00000406859.3_Silent_p.K1190K|NRXN1_ENST00000401710.1_Silent_p.K208K|NRXN1_ENST00000402717.3_Silent_p.K1182K|NRXN1_ENST00000401669.2_Silent_p.K1190K	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1190	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.K155K(1)|p.K1190K(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CAACATTAAACTTAACTCCAA	0.378																																																2	Substitution - coding silent(2)	ovary(2)	2											135.0	122.0	127.0					2																	50318609		2203	4300	6503	50172113	SO:0001819	synonymous_variant	9378			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3570G>A	2.37:g.50318609C>T			50172113	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	37	CCDS54360.1	SNP	20	WashU																																																																																				0.378	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			Silent
ICK	22858	genome.wustl.edu	37	6	52878517	52878517	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1417-01	TCGA-24-1417-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr6:52878517C>A	ENST00000350082.5	-	9	1441	c.1095G>T	c.(1093-1095)caG>caT	p.Q365H	ICK_ENST00000356971.3_Missense_Mutation_p.Q365H	NM_014920.3	NP_055735.1	Q9UPZ9	ICK_HUMAN	intestinal cell (MAK-like) kinase	365					intracellular signal transduction (GO:0035556)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.Q365H(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(3)|stomach(1)	31	Lung NSC(77;0.103)					GCTTGTCCTCCTGGAGATGGC	0.542																																																1	Substitution - Missense(1)	ovary(1)	6											187.0	172.0	177.0					6																	52878517		2203	4300	6503	52986476	SO:0001583	missense	22858			AB023153	CCDS4949.1	6p12.3-p11.2	2008-02-05			ENSG00000112144	ENSG00000112144			21219	protein-coding gene	gene with protein product		612325				12103360	Standard	NM_014920		Approved	MRK, LCK2, KIAA0936, MGC46090	uc003pbi.2	Q9UPZ9	OTTHUMG00000014870	ENST00000350082.5:c.1095G>T	6.37:g.52878517C>A	ENSP00000263043:p.Gln365His		52986476	A7MD41|O75985|Q5THL2|Q8IYH8|Q9BX17|Q9NYX3	Missense_Mutation	SNP	ENST00000350082.5	37	CCDS4949.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	13.70	2.314207	0.40996	.	.	ENSG00000112144	ENST00000350082;ENST00000356971	T;T	0.73258	-0.73;-0.73	5.85	-3.55	0.04639	.	0.448030	0.24899	N	0.034709	T	0.33059	0.0850	L	0.47716	1.5	0.21064	N	0.999794	B	0.02656	0.0	B	0.06405	0.002	T	0.23226	-1.0194	10	0.48119	T	0.1	-26.3486	3.4441	0.07474	0.1051:0.3339:0.1031:0.4579	.	365	Q9UPZ9	ICK_HUMAN	H	365	ENSP00000263043:Q365H;ENSP00000349458:Q365H	ENSP00000263043:Q365H	Q	-	3	2	ICK	52986476	0.000000	0.05858	0.346000	0.25655	0.864000	0.49448	-1.349000	0.02627	-0.504000	0.06577	0.655000	0.94253	CAG		0.542	ICK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040952.1	NM_016513		Missense_Mutation
PLA2G4C	8605	genome.wustl.edu	37	19	48603006	48603006	+	Silent	SNP	G	G	T			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr19:48603006G>T	ENST00000599921.1	-	5	726	c.369C>A	c.(367-369)acC>acA	p.T123T	PLA2G4C_ENST00000413144.2_Silent_p.T123T|PLA2G4C_ENST00000599111.1_Silent_p.T133T|PLA2G4C_ENST00000354276.3_Silent_p.T123T			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	123	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)	p.T123T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		CTGCTTGGATGGTTTTCTGTA	0.498																																																1	Substitution - coding silent(1)	ovary(1)	19											201.0	181.0	188.0					19																	48603006		2203	4300	6503	53294818	SO:0001819	synonymous_variant	8605			AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.369C>A	19.37:g.48603006G>T			53294818	B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Silent	SNP	ENST00000599921.1	37	CCDS12710.1	SNP	47	WashU																																																																																				0.498	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1			Silent
CDK2	1017	genome.wustl.edu	37	12	56364889	56364889	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr12:56364889G>T	ENST00000266970.4	+	6	890	c.650G>T	c.(649-651)cGg>cTg	p.R217L	CDK2_ENST00000553376.1_Missense_Mutation_p.R265L|RAB5B_ENST00000553116.1_5'Flank|CDK2_ENST00000556656.1_3'UTR|CDK2_ENST00000354056.4_Missense_Mutation_p.R183L|CDK2_ENST00000440311.2_Missense_Mutation_p.R157L|RAB5B_ENST00000448789.2_5'Flank|RAB5B_ENST00000360299.5_5'Flank	NM_001798.3	NP_001789.2	P24941	CDK2_HUMAN	cyclin-dependent kinase 2	217	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|blood coagulation (GO:0007596)|cellular response to nitric oxide (GO:0071732)|centrosome duplication (GO:0051298)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone phosphorylation (GO:0016572)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transport (GO:0006813)|Ras protein signal transduction (GO:0007265)|regulation of gene silencing (GO:0060968)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	Cajal body (GO:0015030)|centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|condensed chromosome (GO:0000793)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|X chromosome (GO:0000805)|Y chromosome (GO:0000806)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)	p.R217L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	18			UCEC - Uterine corpus endometrioid carcinoma (6;0.123)|OV - Ovarian serous cystadenocarcinoma(18;0.235)		Bosutinib(DB06616)	CGGATCTTTCGGACTCTGGGG	0.522																																																1	Substitution - Missense(1)	lung(1)	12											138.0	150.0	146.0					12																	56364889		2203	4300	6503	54651156	SO:0001583	missense	1017			M68520	CCDS8898.1, CCDS8899.1	12q13	2011-11-08				ENSG00000123374		"""Cyclin-dependent kinases"""	1771	protein-coding gene	gene with protein product		116953				1717994, 8275715	Standard	NM_001798		Approved		uc001sit.4	P24941		ENST00000266970.4:c.650G>T	12.37:g.56364889G>T	ENSP00000266970:p.Arg217Leu		54651156	A8K7C6|O75100	Missense_Mutation	SNP	ENST00000266970.4	37	CCDS8898.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	32	5.174522	0.94807	.	.	ENSG00000123374	ENST00000266970;ENST00000553376;ENST00000440311;ENST00000354056	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.22	5.22	0.72569	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.58864	0.2152	L	0.45352	1.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.983;0.98	T	0.60895	-0.7172	10	0.87932	D	0	-9.4123	17.9463	0.89039	0.0:0.0:1.0:0.0	.	157;183;217	E7ESI2;P24941-2;P24941	.;.;CDK2_HUMAN	L	217;265;157;183	ENSP00000266970:R217L;ENSP00000452514:R265L;ENSP00000393605:R157L;ENSP00000243067:R183L	ENSP00000266970:R217L	R	+	2	0	CDK2	54651156	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.786000	0.99046	2.616000	0.88540	0.591000	0.81541	CGG		0.522	CDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409650.1			Missense_Mutation
DENND6A	201627	genome.wustl.edu	37	3	57658142	57658142	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr3:57658142T>G	ENST00000311128.5	-	2	331	c.261A>C	c.(259-261)aaA>aaC	p.K87N		NM_152678.2	NP_689891.1	Q8IWF6	DEN6A_HUMAN	DENN/MADD domain containing 6A	87					positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)|recycling endosome (GO:0055037)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										TGTCAGTAAGTTTGGAATGCT	0.299																																																0			3											48.0	53.0	51.0					3																	57658142		2195	4297	6492	57633182	SO:0001583	missense	201627			AK074156	CCDS33773.1	3p14.3	2013-10-11	2012-10-03	2012-10-03	ENSG00000174839	ENSG00000174839		"""DENN/MADD domain containing"""	26635	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member A"""	FAM116A		21330364	Standard	NM_152678		Approved	FLJ34969, AFI1A	uc003dja.3	Q8IWF6	OTTHUMG00000158639	ENST00000311128.5:c.261A>C	3.37:g.57658142T>G	ENSP00000311401:p.Lys87Asn		57633182	Q7Z5T4|Q8N235|Q8TEG8	Missense_Mutation	SNP	ENST00000311128.5	37	CCDS33773.1	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	11.69	1.715314	0.30413	.	.	ENSG00000174839	ENST00000311128	T	0.42131	0.98	5.65	3.31	0.37934	Afi1, N-terminal (1);	0.084274	0.85682	D	0.000000	T	0.25791	0.0628	N	0.25890	0.77	0.44668	D	0.997657	B	0.20368	0.044	B	0.21917	0.037	T	0.05162	-1.0902	10	0.16420	T	0.52	-5.4573	7.3362	0.26611	0.0:0.279:0.0:0.721	.	87	Q8IWF6	F116A_HUMAN	N	87	ENSP00000311401:K87N	ENSP00000311401:K87N	K	-	3	2	FAM116A	57633182	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	0.612000	0.24283	0.441000	0.26529	0.392000	0.25879	AAA		0.299	DENND6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351594.1	NM_152678		Missense_Mutation
REL	5966	genome.wustl.edu	37	2	61118919	61118919	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr2:61118919G>C	ENST00000295025.8	+	2	432	c.112G>C	c.(112-114)Gag>Cag	p.E38Q	REL_ENST00000394479.3_Missense_Mutation_p.E38Q	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog	38	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E38Q(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			CATTCCAGGGGAGCACAGCAC	0.443			A		Hodgkin Lymphoma																																		Dom	yes		2	2p13-p12	5966	v-rel reticuloendotheliosis viral oncogene homolog (avian)		L	1	Substitution - Missense(1)	ovary(1)	2											193.0	173.0	180.0					2																	61118919		2203	4300	6503	60972423	SO:0001583	missense	5966			M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.112G>C	2.37:g.61118919G>C	ENSP00000295025:p.Glu38Gln		60972423	Q17RU2|Q2PNZ7|Q6LDY0	Missense_Mutation	SNP	ENST00000295025.8	37	CCDS1864.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	34	5.320010	0.95682	.	.	ENSG00000162924	ENST00000295025;ENST00000394479	T;T	0.47177	0.85;0.85	5.47	5.47	0.80525	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.70133	0.3189	M	0.73753	2.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.69394	-0.5157	10	0.42905	T	0.14	-10.8153	19.3204	0.94236	0.0:0.0:1.0:0.0	.	38;38	Q17RU2;Q04864	.;REL_HUMAN	Q	38	ENSP00000295025:E38Q;ENSP00000377989:E38Q	ENSP00000295025:E38Q	E	+	1	0	REL	60972423	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.863000	0.99569	2.554000	0.86153	0.650000	0.86243	GAG		0.443	REL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251576.3	NM_002908		Missense_Mutation
AHNAK	79026	genome.wustl.edu	37	11	62295496	62295496	+	Silent	SNP	G	G	C			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr11:62295496G>C	ENST00000378024.4	-	5	6667	c.6393C>G	c.(6391-6393)gtC>gtG	p.V2131V	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2131					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.V2131V(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CATCCCCTTTGACTTTGGGGC	0.522																																																1	Substitution - coding silent(1)	ovary(1)	11											185.0	198.0	194.0					11																	62295496		2202	4299	6501	62052072	SO:0001819	synonymous_variant	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.6393C>G	11.37:g.62295496G>C			62052072	A1A586	Silent	SNP	ENST00000378024.4	37	CCDS31584.1	SNP	45	WashU																																																																																				0.522	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		Silent
KDM2A	22992	genome.wustl.edu	37	11	67017881	67017881	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr11:67017881A>C	ENST00000529006.2	+	17	2826	c.2380A>C	c.(2380-2382)Atc>Ctc	p.I794L	KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000398645.2_Intron|KDM2A_ENST00000308783.5_Missense_Mutation_p.I252L|KDM2A_ENST00000530342.1_Missense_Mutation_p.I355L	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	794					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.I794L(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						GAAAGCCAAGATCCGGGGATC	0.587																																																1	Substitution - Missense(1)	ovary(1)	11											67.0	75.0	72.0					11																	67017881		2076	4210	6286	66774457	SO:0001583	missense	22992			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.2380A>C	11.37:g.67017881A>C	ENSP00000432786:p.Ile794Leu		66774457	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	ENST00000529006.2	37	CCDS44657.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	5.803	0.332454	0.10956	.	.	ENSG00000173120	ENST00000529006;ENST00000530342;ENST00000446134;ENST00000308783	T;T;T	0.21932	2.34;1.98;2.03	5.91	5.91	0.95273	.	0.396433	0.26919	N	0.021824	T	0.14013	0.0339	N	0.22421	0.69	0.32983	D	0.523866	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17319	-1.0373	9	.	.	.	-16.7533	11.0996	0.48166	0.7992:0.2008:0.0:0.0	.	252;794	D4QA03;Q9Y2K7	.;KDM2A_HUMAN	L	794;355;355;252	ENSP00000432786:I794L;ENSP00000435776:I355L;ENSP00000309302:I252L	.	I	+	1	0	KDM2A	66774457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.769000	0.47654	2.261000	0.74972	0.533000	0.62120	ATC		0.587	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	NM_012308		Missense_Mutation
DDX50	79009	genome.wustl.edu	37	10	70695821	70695821	+	Silent	SNP	C	C	T			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr10:70695821C>T	ENST00000373585.3	+	11	1688	c.1581C>T	c.(1579-1581)agC>agT	p.S527S	DDX50_ENST00000466265.1_3'UTR	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	527						membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.S527R(1)|p.S527S(1)		breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						AATCTAAAAGCATGGATGCCA	0.328																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|prostate(1)	10											69.0	65.0	66.0					10																	70695821		2203	4297	6500	70365827	SO:0001819	synonymous_variant	79009			AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.1581C>T	10.37:g.70695821C>T			70365827	Q5VX37|Q8WV76|Q9BWI8	Silent	SNP	ENST00000373585.3	37	CCDS7283.1	SNP	25	WashU																																																																																				0.328	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045		Silent
ALB	213	genome.wustl.edu	37	4	74272347	74272347	+	Splice_Site	SNP	G	G	A	rs372694396		TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr4:74272347G>A	ENST00000295897.4	+	3	228	c.139G>A	c.(139-141)Gtg>Atg	p.V47M	ALB_ENST00000503124.1_5'UTR|ALB_ENST00000509063.1_Splice_Site_p.V47M|ALB_ENST00000401494.3_Intron|ALB_ENST00000415165.2_Intron	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTGTTTCAGGGTGTTGATTGC	0.338																																																0			4						G	MET/VAL	0,4406		0,0,2203	135.0	128.0	131.0		139	2.5	0.7	4		131	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice	ALB	NM_000477.5	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	47/610	74272347	1,13005	2203	4300	6503	74491211	SO:0001630	splice_region_variant	213			V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000295897.4:c.138-1G>A	4.37:g.74272347G>A			74491211	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000295897.4	37	CCDS3555.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	11.36	1.617054	0.28801	0.0	1.16E-4	ENSG00000163631	ENST00000441319;ENST00000295897;ENST00000329326;ENST00000509063;ENST00000430202	T;T;T	0.74632	-0.86;-0.86;-0.86	5.54	2.54	0.30619	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.533381	0.18535	N	0.138399	T	0.81569	0.4850	M	0.80028	2.48	0.20196	N	0.999921	D;D	0.63046	0.992;0.985	P;P	0.62298	0.9;0.9	T	0.70454	-0.4867	10	0.87932	D	0	-8.6293	4.9131	0.13833	0.0771:0.2349:0.5382:0.1498	.	47;47	A6NBZ8;P02768	.;ALBU_HUMAN	M	49;47;47;47;56	ENSP00000392541:V49M;ENSP00000295897:V47M;ENSP00000422784:V47M	ENSP00000295897:V47M	V	+	1	0	ALB	74491211	0.040000	0.19996	0.708000	0.30435	0.099000	0.18886	0.409000	0.21082	0.856000	0.35383	0.650000	0.86243	GTG		0.338	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252173.3	NM_000477	Missense_Mutation	Missense_Mutation
ACTG1	71	genome.wustl.edu	37	17	79478319	79478319	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr17:79478319A>T	ENST00000575842.1	-	3	1123	c.697T>A	c.(697-699)Tcc>Acc	p.S233T	ACTG1_ENST00000575087.1_Missense_Mutation_p.S233T|AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000573283.1_Missense_Mutation_p.S233T|RP13-766D20.2_ENST00000430912.1_RNA|ACTG1_ENST00000331925.2_Missense_Mutation_p.S233T			P63261	ACTG_HUMAN	actin, gamma 1	233					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)	p.S233T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			AGAGAAGAGGAGGATGCGGCG	0.617																																																1	Substitution - Missense(1)	ovary(1)	17											57.0	62.0	60.0					17																	79478319		2201	4296	6497	77092914	SO:0001583	missense	71				CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.697T>A	17.37:g.79478319A>T	ENSP00000458162:p.Ser233Thr		77092914	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	37	CCDS11782.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	a	10.76	1.440769	0.25900	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.94497	-3.44	4.56	3.47	0.39725	.	0.155107	0.44097	D	0.000489	D	0.95726	0.8610	L	0.52759	1.655	0.45634	D	0.998562	B	0.34241	0.444	P	0.58210	0.835	D	0.94555	0.7757	10	0.87932	D	0	.	10.4413	0.44466	0.8356:0.1644:0.0:0.0	.	233	P63261	ACTG_HUMAN	T	233;191	ENSP00000331514:S233T	ENSP00000331514:S233T	S	-	1	0	ACTG1	77092914	0.945000	0.32115	0.322000	0.25334	0.662000	0.39071	2.766000	0.47629	0.614000	0.30107	0.452000	0.29995	TCC		0.617	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614		Missense_Mutation
HGS	9146	genome.wustl.edu	37	17	79653372	79653372	+	Silent	SNP	G	G	A	rs371953529		TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr17:79653372G>A	ENST00000329138.4	+	3	288	c.153G>A	c.(151-153)aaG>aaA	p.K51K	ARL16_ENST00000573392.1_5'Flank|ARL16_ENST00000397498.4_5'Flank|ARL16_ENST00000574938.1_5'Flank|ARL16_ENST00000570561.1_5'Flank|ARL16_ENST00000576135.1_5'Flank	NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	51	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.K51K(1)		endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			CCATCAAGAAGAAAGTCAACG	0.468																																																1	Substitution - coding silent(1)	ovary(1)	17						G		0,4404		0,0,2202	131.0	111.0	118.0		153	1.8	1.0	17		118	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	HGS	NM_004712.4		0,2,6500	AA,AG,GG		0.0233,0.0,0.0154		51/778	79653372	2,13002	2202	4300	6502	77263777	SO:0001819	synonymous_variant	9146			D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.153G>A	17.37:g.79653372G>A			77263777	Q9NR36	Silent	SNP	ENST00000329138.4	37	CCDS11784.1	SNP	33	WashU																																																																																				0.468	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440541.1	NM_004712		Silent
MMP16	4325	genome.wustl.edu	37	8	89209402	89209402	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr8:89209402T>C	ENST00000286614.6	-	2	547	c.266A>G	c.(265-267)gAc>gGc	p.D89G	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	89					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D89G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	TGTGTTTCTGTCCACTTTTCC	0.463																																																1	Substitution - Missense(1)	ovary(1)	8											111.0	85.0	94.0					8																	89209402		2203	4300	6503	89278518	SO:0001583	missense	4325			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.266A>G	8.37:g.89209402T>C	ENSP00000286614:p.Asp89Gly		89278518	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	37	CCDS6246.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	27.5	4.836449	0.91117	.	.	ENSG00000156103	ENST00000286614;ENST00000522726	T;T	0.43294	0.95;0.95	6.07	6.07	0.98685	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.77644	0.4161	H	0.97291	3.975	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.79108	0.955;0.992	D	0.85884	0.1424	10	0.87932	D	0	.	16.635	0.85050	0.0:0.0:0.0:1.0	.	89;89	P51512-2;P51512	.;MMP16_HUMAN	G	89;106	ENSP00000286614:D89G;ENSP00000429147:D106G	ENSP00000286614:D89G	D	-	2	0	MMP16	89278518	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.330000	0.79161	0.477000	0.44152	GAC		0.463	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941		Missense_Mutation
VPS33B	26276	genome.wustl.edu	37	15	91548135	91548135	+	Silent	SNP	G	G	C			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr15:91548135G>C	ENST00000333371.3	-	16	1550	c.1197C>G	c.(1195-1197)ctC>ctG	p.L399L	VPS33B_ENST00000535843.1_Silent_p.L308L|VPS33B_ENST00000535906.1_Silent_p.L372L	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	399					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)		p.L399L(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					AAAGGCACATGAGGCGCAGGC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	15											111.0	98.0	102.0					15																	91548135		2198	4298	6496	89349139	SO:0001819	synonymous_variant	26276			AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.1197C>G	15.37:g.91548135G>C			89349139	B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Silent	SNP	ENST00000333371.3	37	CCDS10369.1	SNP	45	WashU																																																																																				0.443	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313496.1	NM_018668		Silent
HFM1	164045	genome.wustl.edu	37	1	91781479	91781479	+	Silent	SNP	T	T	C	rs138444412		TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr1:91781479T>C	ENST00000370425.3	-	28	3131	c.3033A>G	c.(3031-3033)ttA>ttG	p.L1011L	HFM1_ENST00000294696.5_Silent_p.L243L|HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000370424.3_Silent_p.L690L	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1011	SEC63.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.L1011L(1)		breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CAAAATTTCTTAATATAACAG	0.308																																																1	Substitution - coding silent(1)	ovary(1)	1						T		0,4400		0,0,2200	66.0	66.0	66.0		3033	2.9	1.0	1	dbSNP_134	66	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	HFM1	NM_001017975.3		0,1,6496	CC,CT,TT		0.0116,0.0,0.0077		1011/1436	91781479	1,12993	2200	4297	6497	91554067	SO:0001819	synonymous_variant	164045			AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3033A>G	1.37:g.91781479T>C			91554067	B1B0B6|Q8N9Q0	Silent	SNP	ENST00000370425.3	37	CCDS30769.2	SNP	61	WashU																																																																																				0.308	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975		Silent
SLC24A4	123041	genome.wustl.edu	37	14	92953021	92953021	+	Silent	SNP	C	C	T			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr14:92953021C>T	ENST00000532405.1	+	14	1660	c.1434C>T	c.(1432-1434)atC>atT	p.I478I	SLC24A4_ENST00000531433.1_Silent_p.I459I|SLC24A4_ENST00000351924.5_Silent_p.I442I|SLC24A4_ENST00000393265.2_Silent_p.I414I|SLC24A4_ENST00000298877.1_Silent_p.I461I			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	478					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.I461I(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		TGACTATTATCGGATACACAC	0.478																																					NSCLC(10;315 435 10383 28450 38798)											1	Substitution - coding silent(1)	ovary(1)	14											143.0	101.0	115.0					14																	92953021		2203	4300	6503	92022774	SO:0001819	synonymous_variant	123041			AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1434C>T	14.37:g.92953021C>T			92022774	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Silent	SNP	ENST00000532405.1	37	CCDS9903.2	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	c	2.195	-0.384340	0.04966	.	.	ENSG00000140090	ENST00000525557	.	.	.	4.95	-9.9	0.00461	.	.	.	.	.	T	0.63402	0.2508	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.78021	-0.2367	4	.	.	.	.	17.6632	0.88198	0.0:0.5456:0.0:0.4544	.	.	.	.	W	344	.	.	R	+	1	2	SLC24A4	92022774	0.025000	0.19082	0.003000	0.11579	0.420000	0.31355	-0.873000	0.04214	-3.521000	0.00148	-3.264000	0.00049	CGG		0.478	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1	NM_153646		Silent
TRIM43	129868	genome.wustl.edu	37	2	96262063	96262063	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr2:96262063G>C	ENST00000272395.2	+	4	757	c.621G>C	c.(619-621)gaG>gaC	p.E207D		NM_001164464.1|NM_138800.1	NP_001157936.1|NP_620155.1	Q96BQ3	TRI43_HUMAN	tripartite motif containing 43	207						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.E207D(1)		breast(1)|large_intestine(3)|lung(7)|ovary(1)	12						AATACCAAGAGATTTTTCAGC	0.388																																																1	Substitution - Missense(1)	ovary(1)	2											6.0	5.0	6.0					2																	96262063		1852	3962	5814	95625790	SO:0001583	missense	129868			BK000505	CCDS2015.1	2q11	2014-02-17	2011-01-25		ENSG00000144015	ENSG00000144015		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19015	protein-coding gene	gene with protein product			"""tripartite motif-containing 43"""				Standard	NM_138800		Approved	TRIM43A	uc002suv.3	Q96BQ3	OTTHUMG00000130401	ENST00000272395.2:c.621G>C	2.37:g.96262063G>C	ENSP00000272395:p.Glu207Asp		95625790	Q53TJ7	Missense_Mutation	SNP	ENST00000272395.2	37	CCDS2015.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	.	0.034	-1.316465	0.01331	.	.	ENSG00000144015	ENST00000272395	T	0.09445	2.98	1.33	-0.471	0.12119	.	.	.	.	.	T	0.06188	0.0160	L	0.31371	0.925	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45101	-0.9284	9	0.15499	T	0.54	3.2105	4.0346	0.09724	0.3746:0.0:0.6254:0.0	.	207	Q96BQ3	TRI43_HUMAN	D	207	ENSP00000272395:E207D	ENSP00000272395:E207D	E	+	3	2	TRIM43	95625790	0.016000	0.18221	0.004000	0.12327	0.154000	0.21943	-0.802000	0.04545	-0.132000	0.11557	0.375000	0.23000	GAG		0.388	TRIM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252784.1	NM_138800		Missense_Mutation
LIX1	167410	genome.wustl.edu	37	5	96432518	96432518	+	Missense_Mutation	SNP	C	C	T	rs570322510		TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr5:96432518C>T	ENST00000274382.4	-	5	852	c.557G>A	c.(556-558)cGa>cAa	p.R186Q	CTD-2215E18.1_ENST00000509481.1_Intron	NM_153234.4	NP_694966.3	Q8N485	LIX1_HUMAN	Lix1 homolog (chicken)	186								p.R186Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)	10		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)		TCTTACCTGTCGGGAACACTT	0.408													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18767	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5											91.0	89.0	89.0					5																	96432518		2203	4300	6503	96458274	SO:0001583	missense	167410				CCDS4088.1	5q15	2008-03-06	2008-03-06	2005-02-07	ENSG00000145721	ENSG00000145721			18581	protein-coding gene	gene with protein product		610466	"""chromosome 5 open reading frame 11"", ""Lix1 homolog (mouse)"""	C5orf11		11731258	Standard	NM_153234		Approved		uc003kmy.4	Q8N485	OTTHUMG00000128720	ENST00000274382.4:c.557G>A	5.37:g.96432518C>T	ENSP00000274382:p.Arg186Gln		96458274	A8K4R9|Q8N7I2	Missense_Mutation	SNP	ENST00000274382.4	37	CCDS4088.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	36	5.816624	0.96982	.	.	ENSG00000145721	ENST00000274382	T	0.63417	-0.04	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.80226	0.4584	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.79883	-0.1615	10	0.87932	D	0	-10.7206	20.4745	0.99168	0.0:1.0:0.0:0.0	.	186	Q8N485	LIX1_HUMAN	Q	186	ENSP00000274382:R186Q	ENSP00000274382:R186Q	R	-	2	0	LIX1	96458274	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.323000	0.79105	2.941000	0.99782	0.655000	0.94253	CGA		0.408	LIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250625.1	NM_153234		Missense_Mutation
DNTT	1791	genome.wustl.edu	37	10	98082474	98082474	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr10:98082474C>A	ENST00000371174.2	+	5	841	c.739C>A	c.(739-741)Caa>Aaa	p.Q247K	DNTT_ENST00000419175.1_Missense_Mutation_p.Q247K			P04053	TDT_HUMAN	DNA nucleotidylexotransferase	247	Mediates interaction with DNTTIP2.				DNA modification (GO:0006304)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA nucleotidylexotransferase activity (GO:0003912)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.Q247K(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		TGAACGATATCAATCCTTCAA	0.294																																																1	Substitution - Missense(1)	ovary(1)	10											74.0	79.0	77.0					10																	98082474		2203	4299	6502	98072464	SO:0001583	missense	1791			AB046378	CCDS7447.1	10q23-q24	2013-05-21	2013-05-21		ENSG00000107447	ENSG00000107447	2.7.7.31	"""DNA polymerases"""	2983	protein-coding gene	gene with protein product	"""Terminal deoxynucleotidyltransferase"""	187410	"""deoxynucleotidyltransferase, terminal"""				Standard	NM_004088		Approved	TDT	uc001kmf.3	P04053	OTTHUMG00000018832	ENST00000371174.2:c.739C>A	10.37:g.98082474C>A	ENSP00000360216:p.Gln247Lys		98072464	Q53FH1|Q5W103|Q96E50	Missense_Mutation	SNP	ENST00000371174.2	37	CCDS7447.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	4.048	0.006482	0.07866	.	.	ENSG00000107447	ENST00000419175;ENST00000371174	T;T	0.39997	1.05;1.05	5.09	-2.36	0.06663	DNA-directed DNA polymerase X (1);DNA polymerase lambda, fingers domain (1);	0.592375	0.19087	N	0.123062	T	0.27866	0.0686	L	0.35341	1.055	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.002	T	0.30794	-0.9966	10	0.09590	T	0.72	-11.7634	16.9085	0.86134	0.3266:0.6734:0.0:0.0	.	247;247	P04053-2;P04053	.;TDT_HUMAN	K	247	ENSP00000401169:Q247K;ENSP00000360216:Q247K	ENSP00000360216:Q247K	Q	+	1	0	DNTT	98072464	0.981000	0.34729	0.735000	0.30896	0.579000	0.36224	0.524000	0.22940	-0.200000	0.10300	-0.457000	0.05445	CAA		0.294	DNTT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049607.1	NM_004088		Missense_Mutation
ADH1C	126	genome.wustl.edu	37	4	100268979	100268979	+	RNA	SNP	G	G	A			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr4:100268979G>A	ENST00000510055.1	-	0	217				ADH1C_ENST00000515683.1_RNA			P00326	ADH1G_HUMAN	alcohol dehydrogenase 1C (class I), gamma polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|zinc ion binding (GO:0008270)								OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	AACTCCCATAGCACAGCTGCT	0.413																																																0			4											87.0	83.0	84.0					4																	100268979		2203	4300	6503	100488002			126			M12272		4q23	2010-03-16			ENSG00000248144	ENSG00000248144	1.1.1.1	"""Alcohol dehydrogenases"""	251	protein-coding gene	gene with protein product		103730		ADH3		3006456	Standard	NM_000669		Approved		uc031sgp.1	P00326	OTTHUMG00000161422		4.37:g.100268979G>A			100488002	Q4PJ18|Q5WRV0|Q6LBW4|Q6NWV0|Q6NZA7	Silent	SNP	ENST00000510055.1	37		SNP	34	WashU																																																																																				0.413	ADH1C-004	KNOWN	mRNA_end_NF|basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000365189.2	NM_000669		Silent
NALCN	259232	genome.wustl.edu	37	13	101735219	101735219	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1417-01	TCGA-24-1417-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr13:101735219G>T	ENST00000251127.6	-	33	3787	c.3706C>A	c.(3706-3708)Ccg>Acg	p.P1236T		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1236					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.P1236T(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ACGGTCACCGGGTCCTCGACG	0.527																																																1	Substitution - Missense(1)	ovary(1)	13											121.0	108.0	112.0					13																	101735219		2203	4300	6503	100533220	SO:0001583	missense	259232			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3706C>A	13.37:g.101735219G>T	ENSP00000251127:p.Pro1236Thr		100533220	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	12.51	1.959748	0.34565	.	.	ENSG00000102452	ENST00000251127	D	0.97279	-4.32	5.64	5.64	0.86602	.	0.377447	0.30464	N	0.009563	D	0.93148	0.7818	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	D	0.88548	0.3114	10	0.27082	T	0.32	.	19.699	0.96045	0.0:0.0:1.0:0.0	.	1236	Q8IZF0	NALCN_HUMAN	T	1236	ENSP00000251127:P1236T	ENSP00000251127:P1236T	P	-	1	0	NALCN	100533220	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	4.198000	0.58419	2.645000	0.89757	0.650000	0.86243	CCG		0.527	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		Missense_Mutation
ABCA1	19	genome.wustl.edu	37	9	107589408	107589408	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr9:107589408C>A	ENST00000374736.3	-	16	2552	c.2158G>T	c.(2158-2160)Gtc>Ttc	p.V720F	ABCA1_ENST00000494467.1_5'UTR	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	720					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GACAGGAAGACAAACACCACG	0.527																																																0			9											148.0	109.0	123.0					9																	107589408		2203	4300	6503	106629229	SO:0001583	missense	19			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.2158G>T	9.37:g.107589408C>A	ENSP00000363868:p.Val720Phe		106629229	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	13.42	2.232942	0.39498	.	.	ENSG00000165029	ENST00000374736	D	0.87809	-2.3	5.3	1.11	0.20524	.	0.540009	0.19581	N	0.110849	T	0.75874	0.3909	N	0.17901	0.54	0.80722	D	1	B	0.02656	0.0	B	0.10450	0.005	T	0.66122	-0.6002	10	0.56958	D	0.05	.	8.6148	0.33824	0.0:0.5402:0.2474:0.2124	.	720	O95477	ABCA1_HUMAN	F	720	ENSP00000363868:V720F	ENSP00000363868:V720F	V	-	1	0	ABCA1	106629229	0.895000	0.30542	0.976000	0.42696	0.993000	0.82548	0.784000	0.26816	0.213000	0.20722	-0.150000	0.13652	GTC		0.527	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502		Missense_Mutation
SLC26A3	1811	genome.wustl.edu	37	7	107416979	107416979	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr7:107416979G>T	ENST00000340010.5	-	15	1779	c.1595C>A	c.(1594-1596)cCa>cAa	p.P532Q	SLC26A3_ENST00000422236.2_Missense_Mutation_p.P497Q	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	532	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)	p.P532Q(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						CACTCCTTCTGGCTCATACAT	0.378																																																1	Substitution - Missense(1)	ovary(1)	7											114.0	107.0	110.0					7																	107416979		2203	4300	6503	107204215	SO:0001583	missense	1811			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1595C>A	7.37:g.107416979G>T	ENSP00000345873:p.Pro532Gln		107204215		Missense_Mutation	SNP	ENST00000340010.5	37	CCDS5748.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	8.077	0.771495	0.16051	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.88124	-2.34;-2.34	5.82	4.01	0.46588	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.151495	0.64402	D	0.000011	D	0.92306	0.7559	M	0.79123	2.44	0.49582	D	0.999804	D;P	0.63046	0.992;0.787	D;P	0.63033	0.91;0.626	D	0.90865	0.4741	10	0.41790	T	0.15	.	15.582	0.76452	0.1252:0.0:0.8748:0.0	.	497;532	G5E9U3;P40879	.;S26A3_HUMAN	Q	497;532	ENSP00000415817:P497Q;ENSP00000345873:P532Q	ENSP00000345873:P532Q	P	-	2	0	SLC26A3	107204215	1.000000	0.71417	0.296000	0.24974	0.011000	0.07611	5.324000	0.65863	0.398000	0.25338	-1.094000	0.02160	CCA		0.378	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111		Missense_Mutation
ARMC2	84071	genome.wustl.edu	37	6	109197476	109197476	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr6:109197476T>A	ENST00000392644.4	+	5	762	c.594T>A	c.(592-594)gaT>gaA	p.D198E	ARMC2_ENST00000368972.3_Missense_Mutation_p.D33E	NM_032131.4	NP_115507.4	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2	198								p.D191E(1)		endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)	24		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		TAACTGATGATGGAGGCTTCA	0.348																																																1	Substitution - Missense(1)	ovary(1)	6											89.0	92.0	91.0					6																	109197476		2203	4300	6503	109304169	SO:0001583	missense	84071			BC030603	CCDS5069.2, CCDS69168.1	6q21	2013-02-14			ENSG00000118690	ENSG00000118690		"""Armadillo repeat containing"""	23045	protein-coding gene	gene with protein product							Standard	XM_005267154		Approved	DKFZp434P0714, bA787I22.1	uc003pss.4	Q8NEN0	OTTHUMG00000015335	ENST00000392644.4:c.594T>A	6.37:g.109197476T>A	ENSP00000376417:p.Asp198Glu		109304169	A8K8Y4|B4DGF5|G5E993|Q5VVY8|Q9H0K9	Missense_Mutation	SNP	ENST00000392644.4	37	CCDS5069.2	SNP	51	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.34|12.34	1.909212|1.909212	0.33721|0.33721	.|.	.|.	ENSG00000118690|ENSG00000118690	ENST00000368972;ENST00000392644;ENST00000237512|ENST00000414610	T;T;T|.	0.51574|.	0.7;0.7;0.7|.	5.0|5.0	-0.279|-0.279	0.12890|0.12890	.|.	0.331224|.	0.28209|.	N|.	0.016196|.	T|T	0.25158|0.25158	0.0611|0.0611	M|M	0.70595|0.70595	2.14|2.14	0.09310|0.09310	N|N	1|1	B|.	0.09022|.	0.002|.	B|.	0.08055|.	0.003|.	T|T	0.32745|0.32745	-0.9895|-0.9895	10|5	0.14252|.	T|.	0.57|.	.|.	4.4757|4.4757	0.11739|0.11739	0.1492:0.362:0.0:0.4888|0.1492:0.362:0.0:0.4888	.|.	198|.	Q8NEN0|.	ARMC2_HUMAN|.	E|K	33;198;198|50	ENSP00000357968:D33E;ENSP00000376417:D198E;ENSP00000237512:D198E|.	ENSP00000237512:D198E|.	D|M	+|+	3|2	2|0	ARMC2|ARMC2	109304169|109304169	0.144000|0.144000	0.22641|0.22641	0.375000|0.375000	0.26029|0.26029	0.809000|0.809000	0.45718|0.45718	-0.355000|-0.355000	0.07671|0.07671	-0.194000|-0.194000	0.10399|0.10399	0.254000|0.254000	0.18369|0.18369	GAT|ATG		0.348	ARMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041732.2	NM_032131		Missense_Mutation
ZBTB16	7704	genome.wustl.edu	37	11	113934241	113934241	+	Silent	SNP	C	C	T			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr11:113934241C>T	ENST00000335953.4	+	2	599	c.219C>T	c.(217-219)gaC>gaT	p.D73D	ZBTB16_ENST00000392996.2_Silent_p.D73D	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	73	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		ATACTTTGGACTTCCTCTCGC	0.562																																																0			11											98.0	78.0	85.0					11																	113934241		2201	4296	6497	113439451	SO:0001819	synonymous_variant	7704			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.219C>T	11.37:g.113934241C>T			113439451	Q8TAL4	Silent	SNP	ENST00000335953.4	37	CCDS8367.1	SNP	20	WashU																																																																																				0.562	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	NM_006006		Silent
ZBTB16	7704	genome.wustl.edu	37	11	113934832	113934832	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr11:113934832C>A	ENST00000335953.4	+	2	1190	c.810C>A	c.(808-810)gaC>gaA	p.D270E	ZBTB16_ENST00000392996.2_Missense_Mutation_p.D270E	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	270					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D270D(1)		central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		GGATGGGGGACAAGGTTGAGG	0.627																																																1	Substitution - coding silent(1)	endometrium(1)	11											42.0	36.0	38.0					11																	113934832		2201	4296	6497	113440042	SO:0001583	missense	7704			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.810C>A	11.37:g.113934832C>A	ENSP00000338157:p.Asp270Glu		113440042	Q8TAL4	Missense_Mutation	SNP	ENST00000335953.4	37	CCDS8367.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	10.93	1.490800	0.26774	.	.	ENSG00000109906	ENST00000335953;ENST00000392996	T;T	0.09350	2.99;2.99	5.63	5.63	0.86233	.	0.193387	0.48767	D	0.000166	T	0.05593	0.0147	N	0.08118	0	0.30828	N	0.737016	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.16247	-1.0409	10	0.25751	T	0.34	-16.4183	9.7324	0.40370	0.0:0.771:0.1527:0.0762	.	270;275	Q05516;Q59H43	ZBT16_HUMAN;.	E	270	ENSP00000338157:D270E;ENSP00000376721:D270E	ENSP00000338157:D270E	D	+	3	2	ZBTB16	113440042	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	2.405000	0.44548	2.651000	0.90000	0.655000	0.94253	GAC		0.627	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	NM_006006		Missense_Mutation
ABLIM1	3983	genome.wustl.edu	37	10	116417742	116417742	+	Missense_Mutation	SNP	C	C	T	rs146399793	byFrequency	TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr10:116417742C>T	ENST00000277895.5	-	1	315	c.218G>A	c.(217-219)cGt>cAt	p.R73H	ABLIM1_ENST00000369252.4_Intron|ABLIM1_ENST00000533213.2_Intron|snoU13_ENST00000458910.1_RNA	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	73					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		GTTACATACACGCCCACGTGG	0.483													C|||	3	0.000599042	0.0015	0.0014	5008	,	,		20301	0.0		0.0	False		,,,				2504	0.0															0			10						C	,,HIS/ARG	8,4398	14.3+/-33.2	0,8,2195	102.0	99.0	100.0		,,218	-6.7	0.0	10	dbSNP_134	100	0,8600		0,0,4300	yes	intron,intron,missense	ABLIM1	NM_001003407.1,NM_001003408.1,NM_002313.5	,,29	0,8,6495	TT,TC,CC		0.0,0.1816,0.0615	,,benign	,,73/779	116417742	8,12998	2203	4300	6503	116407732	SO:0001583	missense	3983			AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.218G>A	10.37:g.116417742C>T	ENSP00000277895:p.Arg73His		116407732	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	ENST00000277895.5	37	CCDS7590.1	SNP	19	WashU	3	0.0013736263736263737	2	0.0040650406504065045	1	0.0027624309392265192	0	0.0	0	0.0	C	11.11	1.542735	0.27563	0.001816	0.0	ENSG00000099204	ENST00000336585;ENST00000369262;ENST00000277895	T	0.27402	1.67	5.77	-6.71	0.01760	.	1.628730	0.03307	N	0.189902	T	0.10680	0.0261	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15178	-1.0446	10	0.14656	T	0.56	.	0.0949	0.00043	0.302:0.2366:0.1969:0.2646	.	73	O14639	ABLM1_HUMAN	H	73	ENSP00000277895:R73H	ENSP00000277895:R73H	R	-	2	0	ABLIM1	116407732	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.633000	0.05483	-0.898000	0.03906	-1.223000	0.01593	CGT		0.483	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3			Missense_Mutation
ARCN1	372	genome.wustl.edu	37	11	118454563	118454563	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr11:118454563G>C	ENST00000264028.4	+	4	582	c.487G>C	c.(487-489)Gca>Cca	p.A163P	ARCN1_ENST00000359415.4_Missense_Mutation_p.A204P|ARCN1_ENST00000392859.3_Missense_Mutation_p.A75P|ARCN1_ENST00000534182.2_Intron	NM_001655.4	NP_001646.2	P48444	COPD_HUMAN	archain 1	163					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer maturation (GO:0021691)|COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pigmentation (GO:0043473)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	clathrin adaptor complex (GO:0030131)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.A163P(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|urinary_tract(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		GCGTCGTAAAGCAAAGGAATT	0.453																																																1	Substitution - Missense(1)	ovary(1)	11											127.0	112.0	117.0					11																	118454563		2200	4295	6495	117959773	SO:0001583	missense	372			X81197	CCDS8400.1, CCDS44749.1	11q23.3	2010-04-21	2003-01-29		ENSG00000095139	ENSG00000095139			649	protein-coding gene	gene with protein product		600820	"""coatomer protein complex, subunit delta"""	COPD		7782067, 8854871	Standard	NM_001655		Approved		uc001ptq.3	P48444	OTTHUMG00000166340	ENST00000264028.4:c.487G>C	11.37:g.118454563G>C	ENSP00000264028:p.Ala163Pro		117959773	B4E1X2|E9PEU4|Q52M80	Missense_Mutation	SNP	ENST00000264028.4	37	CCDS8400.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	35	5.422405	0.96111	.	.	ENSG00000095139	ENST00000392859;ENST00000359415;ENST00000542521;ENST00000264028	T;T;T	0.42131	0.98;0.98;1.03	6.02	6.02	0.97574	.	0.045916	0.85682	D	0.000000	T	0.71508	0.3348	M	0.87180	2.865	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.998	P;D;D	0.75484	0.881;0.986;0.956	T	0.73898	-0.3837	10	0.62326	D	0.03	-16.5754	20.1358	0.98028	0.0:0.0:1.0:0.0	.	75;204;163	E9PEU4;B0YIW6;P48444	.;.;COPD_HUMAN	P	75;204;163;163	ENSP00000376599:A75P;ENSP00000352385:A204P;ENSP00000264028:A163P	ENSP00000264028:A163P	A	+	1	0	ARCN1	117959773	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.402000	0.97298	2.865000	0.98341	0.655000	0.94253	GCA		0.453	ARCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389278.1			Missense_Mutation
SORL1	6653	genome.wustl.edu	37	11	121485731	121485731	+	Silent	SNP	A	A	T			TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr11:121485731A>T	ENST00000260197.7	+	41	5700	c.5571A>T	c.(5569-5571)gcA>gcT	p.A1857A	SORL1_ENST00000527934.1_Silent_p.A472A|SORL1_ENST00000525532.1_Silent_p.A801A|SORL1_ENST00000534286.1_Silent_p.A767A|SORL1_ENST00000532694.1_Silent_p.A703A	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1857	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		ACCAGACTGCAGTGGAATGTA	0.562																																																0			11											96.0	78.0	85.0					11																	121485731		2202	4299	6501	120990941	SO:0001819	synonymous_variant	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.5571A>T	11.37:g.121485731A>T			120990941	B2RNX7|Q92856	Silent	SNP	ENST00000260197.7	37	CCDS8436.1	SNP	7	WashU																																																																																				0.562	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105		Silent
FNIP1	96459	genome.wustl.edu	37	5	131014826	131014826	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr5:131014826T>G	ENST00000510461.1	-	12	1340	c.1245A>C	c.(1243-1245)gaA>gaC	p.E415D	FNIP1_ENST00000307968.7_Missense_Mutation_p.E387D|FNIP1_ENST00000511848.1_Missense_Mutation_p.E415D|FNIP1_ENST00000307954.8_Missense_Mutation_p.E370D|CTC-432M15.3_ENST00000514667.1_Intron	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	415					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.E415D(1)		NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		GCCAGACAGGTTCTCCAATTC	0.373																																																1	Substitution - Missense(1)	ovary(1)	5											84.0	79.0	81.0					5																	131014826		2203	4300	6503	131042725	SO:0001583	missense	96459			DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.1245A>C	5.37:g.131014826T>G	ENSP00000421985:p.Glu415Asp		131042725	D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	CCDS34227.1	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	23.4	4.408475	0.83340	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461;ENST00000511848	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.06	0.304	0.15796	.	.	.	.	.	T	0.51261	0.1664	M	0.79805	2.47	0.50467	D	0.999871	D;D;D;P	0.71674	0.998;0.996;0.998;0.729	D;D;D;P	0.77557	0.99;0.987;0.99;0.537	T	0.50013	-0.8877	9	0.46703	T	0.11	-7.7774	9.423	0.38563	0.0:0.4826:0.0:0.5174	.	415;415;387;415	A8K8V8;Q8TF40-2;Q8TF40-3;Q8TF40	.;.;.;FNIP1_HUMAN	D	387;370;175;415;415	ENSP00000309266:E387D;ENSP00000310453:E370D;ENSP00000421985:E415D;ENSP00000425619:E415D	ENSP00000310453:E370D	E	-	3	2	FNIP1	131042725	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	0.597000	0.24059	0.195000	0.20347	0.533000	0.62120	GAA		0.373	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372		Missense_Mutation
ASAP1	50807	genome.wustl.edu	37	8	131181276	131181276	+	Nonsense_Mutation	SNP	T	T	A			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr8:131181276T>A	ENST00000518721.1	-	10	1011	c.784A>T	c.(784-786)Aaa>Taa	p.K262*	ASAP1_ENST00000357668.1_Nonsense_Mutation_p.K262*	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	262					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.K262*(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						ATGTACTGTTTCAACTTATCA	0.274																																																1	Substitution - Nonsense(1)	ovary(1)	8											65.0	70.0	68.0					8																	131181276		2201	4293	6494	131250458	SO:0001587	stop_gained	50807			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.784A>T	8.37:g.131181276T>A	ENSP00000429900:p.Lys262*		131250458	B2RNV3	Nonsense_Mutation	SNP	ENST00000518721.1	37	CCDS6362.1	SNP	62	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	40|40	8.076227|8.076227	0.98640|0.98640	.|.	.|.	ENSG00000153317|ENSG00000153317	ENST00000524124|ENST00000343135;ENST00000357668;ENST00000518721;ENST00000524367	.|.	.|.	.|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.37625|.	0.1010|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.36065|.	-0.9763|.	3|.	.|0.02654	.|T	.|1	.|.	15.0013|15.0013	0.71473|0.71473	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	V|X	79|262;262;262;232	.|.	.|ENSP00000344591:K262X	E|K	-|-	2|1	0|0	ASAP1|ASAP1	131250458|131250458	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	7.342000|7.342000	0.79310|0.79310	2.217000|2.217000	0.71921|0.71921	0.482000|0.482000	0.46254|0.46254	GAA|AAA		0.274	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482		Nonsense_Mutation
TUBBP5	643224	genome.wustl.edu	37	9	141071078	141071078	+	RNA	SNP	A	A	G	rs201043758	byFrequency	TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr9:141071078A>G	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5									p.M233V(7)									GTCTGCTACCATGAGTGGGGT	0.552																																																7	Substitution - Missense(7)	endometrium(4)|kidney(2)|ovary(1)	9																																								140190899			0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071078A>G			140190899		Missense_Mutation	SNP	ENST00000503395.1	37		SNP	8	WashU																																																																																				0.552	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		Missense_Mutation
ZBTB38	253461	genome.wustl.edu	37	3	141162535	141162535	+	Silent	SNP	T	T	G			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr3:141162535T>G	ENST00000514251.1	+	4	1584	c.1305T>G	c.(1303-1305)ggT>ggG	p.G435G	ZBTB38_ENST00000321464.5_Silent_p.G436G|ZBTB38_ENST00000441582.2_Silent_p.G435G					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						ATAGGATTGGTGAATTTTCCA	0.408																																																0			3											77.0	74.0	75.0					3																	141162535		1856	4100	5956	142645225	SO:0001819	synonymous_variant	253461			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.1305T>G	3.37:g.141162535T>G			142645225		Silent	SNP	ENST00000514251.1	37	CCDS43157.1	SNP	59	WashU																																																																																				0.408	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2			Silent
LIX1L	128077	genome.wustl.edu	37	1	145498604	145498604	+	Missense_Mutation	SNP	G	G	C	rs201567685		TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr1:145498604G>C	ENST00000369308.3	+	6	914	c.840G>C	c.(838-840)tgG>tgC	p.W280C	RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA	NM_153713.1	NP_714924.1	Q8IVB5	LIX1L_HUMAN	Lix1 homolog (chicken) like	280								p.W280C(1)		large_intestine(4)|lung(6)|ovary(2)|skin(1)	13	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCTTGGACTGGGTGAGCCGGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											56.0	56.0	56.0					1																	145498604		2203	4300	6503	144209961	SO:0001583	missense	128077			AK128733	CCDS72873.1	1q21.1	2014-07-15	2014-07-15		ENSG00000152022	ENSG00000271601			28715	protein-coding gene	gene with protein product			"""Lix1 homolog (mouse) like"", ""Lix1 homolog (chicken)-like"""			12477932	Standard	NM_153713		Approved	MGC46719	uc001enr.3	Q8IVB5	OTTHUMG00000013741	ENST00000369308.3:c.840G>C	1.37:g.145498604G>C	ENSP00000358314:p.Trp280Cys		144209961	Q6AI36	Missense_Mutation	SNP	ENST00000369308.3	37	CCDS915.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	22.8	4.332524	0.81801	.	.	ENSG00000152022	ENST00000369308;ENST00000449167	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.76062	0.3935	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78760	-0.2078	9	0.87932	D	0	-20.8558	16.2306	0.82341	0.0:0.0:1.0:0.0	.	280	Q8IVB5	LIX1L_HUMAN	C	280;227	.	ENSP00000358314:W280C	W	+	3	0	LIX1L	144209961	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.479000	0.97929	2.694000	0.91930	0.467000	0.42956	TGG		0.592	LIX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038513.1	NM_153713		Missense_Mutation
ZNF7	7553	genome.wustl.edu	37	8	146062801	146062801	+	Silent	SNP	G	G	A			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr8:146062801G>A	ENST00000528372.1	+	4	396	c.156G>A	c.(154-156)gaG>gaA	p.E52E	ZNF7_ENST00000529819.1_Silent_p.E51E|ZNF7_ENST00000325241.6_Silent_p.E52E|ZNF7_ENST00000525266.1_Silent_p.E52E|ZNF7_ENST00000446747.2_Silent_p.E63E|ZNF7_ENST00000544249.1_De_novo_Start_InFrame|ZNF7_ENST00000325217.5_Silent_p.E63E|ZNF7_ENST00000532393.1_3'UTR|ZNF7_ENST00000528130.1_Silent_p.E52E			P17097	ZNF7_HUMAN	zinc finger protein 7	52	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E52E(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		TCAAGCCTGAGCTGATCTCTC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	8											128.0	105.0	113.0					8																	146062801		2203	4300	6503	146033605	SO:0001819	synonymous_variant	7553			AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.156G>A	8.37:g.146062801G>A			146033605	B4DT08|D3DWN6|P17015|Q8N8Y4	Silent	SNP	ENST00000528372.1	37	CCDS6435.1	SNP	34	WashU																																																																																				0.582	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416		Silent
AFF2	2334	genome.wustl.edu	37	X	148048556	148048556	+	Silent	SNP	T	T	C			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chrX:148048556T>C	ENST00000370460.2	+	14	3629	c.3150T>C	c.(3148-3150)ctT>ctC	p.L1050L	AFF2_ENST00000286437.5_Silent_p.L691L|AFF2_ENST00000370457.5_Silent_p.L1015L|AFF2_ENST00000342251.3_Silent_p.L1017L	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	1050					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.L1050L(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CTCTGCCCCTTCTATCCAGCA	0.507																																																1	Substitution - coding silent(1)	ovary(1)	X											272.0	216.0	235.0					X																	148048556		2203	4300	6503	147856250	SO:0001819	synonymous_variant	2334			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.3150T>C	X.37:g.148048556T>C			147856250	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	ENST00000370460.2	37	CCDS14684.1	SNP	62	WashU																																																																																				0.507	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		Silent
ZNF425	155054	genome.wustl.edu	37	7	148802019	148802019	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr7:148802019C>T	ENST00000378061.2	-	4	1076	c.944G>A	c.(943-945)tGc>tAc	p.C315Y		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	315					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C315Y(1)		breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			CGTGAGCTCGCACTGCTGCAC	0.652																																																1	Substitution - Missense(1)	ovary(1)	7											37.0	35.0	36.0					7																	148802019		2203	4300	6503	148432952	SO:0001583	missense	155054			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.944G>A	7.37:g.148802019C>T	ENSP00000367300:p.Cys315Tyr		148432952	B3KPM1|Q08AG3	Missense_Mutation	SNP	ENST00000378061.2	37	CCDS34773.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	11.76	1.735070	0.30774	.	.	ENSG00000204947	ENST00000378061	T	0.07327	3.2	3.66	-0.55	0.11825	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.05031	-0.125	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40572	-0.9556	9	0.56958	D	0.05	.	3.8032	0.08767	0.0:0.305:0.3842:0.3108	.	315	Q6IV72	ZN425_HUMAN	Y	315	ENSP00000367300:C315Y	ENSP00000367300:C315Y	C	-	2	0	ZNF425	148432952	0.000000	0.05858	0.000000	0.03702	0.629000	0.37895	-6.796000	0.00053	-0.003000	0.14444	0.655000	0.94253	TGC		0.652	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352726.1	XM_088140		Missense_Mutation
ADAM15	8751	genome.wustl.edu	37	1	155029719	155029719	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr1:155029719C>T	ENST00000356955.2	+	12	1305	c.1204C>T	c.(1204-1206)Ctc>Ttc	p.L402F	ADAM15_ENST00000355956.2_Missense_Mutation_p.L402F|ADAM15_ENST00000368412.3_Missense_Mutation_p.L402F|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000447332.3_Missense_Mutation_p.L386F|ADAM15_ENST00000271836.6_Missense_Mutation_p.L402F|ADAM15_ENST00000360674.4_Missense_Mutation_p.L402F|ADAM15_ENST00000531455.1_Missense_Mutation_p.L412F|ADAM15_ENST00000368413.1_Missense_Mutation_p.L108F|ADAM15_ENST00000449910.2_Missense_Mutation_p.L402F|ADAM15_ENST00000368410.2_Missense_Mutation_p.L108F|ADAM15_ENST00000359280.4_Missense_Mutation_p.L402F	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	402	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.L402F(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GGAGAAAGCCCTCCTGGATGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	44.0	43.0					1																	155029719		2203	4300	6503	153296343	SO:0001583	missense	8751			U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.1204C>T	1.37:g.155029719C>T	ENSP00000349436:p.Leu402Phe		153296343	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Missense_Mutation	SNP	ENST00000356955.2	37	CCDS1087.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125822	0.77436	.	.	ENSG00000143537	ENST00000356955;ENST00000449910;ENST00000359280;ENST00000360674;ENST00000368412;ENST00000355956;ENST00000368410;ENST00000271836;ENST00000368413;ENST00000531455	T;T;T;T;T;T;T;T;T;T	0.12984	2.63;2.63;2.63;2.63;2.63;2.63;4.02;2.63;4.02;2.63	5.11	5.11	0.69529	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.39687	N	0.001285	T	0.27313	0.0670	M	0.71296	2.17	0.52501	D	0.999956	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;0.999;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.99;1.0;1.0;1.0;0.996;1.0;1.0	T	0.00589	-1.1656	10	0.33940	T	0.23	.	16.0787	0.80985	0.0:1.0:0.0:0.0	.	412;419;386;402;402;402;402;402;402;402;399	E9PN65;B7Z390;B4DMH8;Q13444-10;Q13444-2;Q13444-4;Q13444-5;Q13444-3;Q13444-9;Q13444;Q59GF2	.;.;.;.;.;.;.;.;.;ADA15_HUMAN;.	F	402;402;402;402;402;402;108;402;108;412	ENSP00000349436:L402F;ENSP00000403843:L402F;ENSP00000352226:L402F;ENSP00000353892:L402F;ENSP00000357397:L402F;ENSP00000348227:L402F;ENSP00000357395:L108F;ENSP00000271836:L402F;ENSP00000357398:L108F;ENSP00000432927:L412F	ENSP00000271836:L402F	L	+	1	0	ADAM15	153296343	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.412000	0.59787	2.668000	0.90789	0.643000	0.83706	CTC		0.627	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387168.1	NM_003815		Missense_Mutation
SCAMP3	10067	genome.wustl.edu	37	1	155226123	155226123	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr1:155226123G>A	ENST00000302631.3	-	9	1092	c.985C>T	c.(985-987)Cga>Tga	p.R329*	FAM189B_ENST00000472550.1_5'Flank|FAM189B_ENST00000368368.3_5'Flank|SCAMP3_ENST00000355379.3_Nonsense_Mutation_p.R303*|SCAMP3_ENST00000472397.1_5'UTR|FAM189B_ENST00000361361.2_5'Flank|FAM189B_ENST00000350210.2_5'Flank	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	329					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)	p.R329*(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCTGCGGTTCGCACCGCAGGG	0.612																																																1	Substitution - Nonsense(1)	ovary(1)	1											48.0	58.0	55.0					1																	155226123		2203	4300	6503	153492747	SO:0001587	stop_gained	10067			AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.985C>T	1.37:g.155226123G>A	ENSP00000307275:p.Arg329*		153492747	A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Nonsense_Mutation	SNP	ENST00000302631.3	37	CCDS1105.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	24.5	4.532989	0.85812	.	.	ENSG00000116521	ENST00000302631;ENST00000355379	.	.	.	4.98	3.09	0.35607	.	0.067310	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.6387	7.8919	0.29682	0.0852:0.0:0.7536:0.1612	.	.	.	.	X	329;303	.	ENSP00000307275:R329X	R	-	1	2	SCAMP3	153492747	1.000000	0.71417	0.994000	0.49952	0.164000	0.22412	7.594000	0.82698	0.801000	0.34066	0.655000	0.94253	CGA		0.612	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087399.1	NM_005698		Nonsense_Mutation
FCRL4	83417	genome.wustl.edu	37	1	157557705	157557705	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr1:157557705C>A	ENST00000271532.1	-	4	647	c.512G>T	c.(511-513)gGa>gTa	p.G171V	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	171	Ig-like C2-type 2.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G171V(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				ATTCTCGTCTCCATATCCAAT	0.318																																																1	Substitution - Missense(1)	ovary(1)	1											54.0	52.0	52.0					1																	157557705		2203	4300	6503	155824329	SO:0001583	missense	83417			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.512G>T	1.37:g.157557705C>A	ENSP00000271532:p.Gly171Val		155824329	Q96PJ3|Q96RE0	Missense_Mutation	SNP	ENST00000271532.1	37	CCDS1166.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	1.918	-0.449160	0.04572	.	.	ENSG00000163518	ENST00000271532	T	0.11821	2.74	3.97	-1.04	0.10068	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.246370	0.06103	N	0.665736	T	0.01627	0.0052	N	0.13299	0.325	0.09310	N	0.999999	B	0.12630	0.006	B	0.14023	0.01	T	0.46624	-0.9178	10	0.23302	T	0.38	.	0.2053	0.00149	0.2545:0.2861:0.1562:0.3032	.	171	Q96PJ5	FCRL4_HUMAN	V	171	ENSP00000271532:G171V	ENSP00000271532:G171V	G	-	2	0	FCRL4	155824329	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-0.852000	0.04308	-0.328000	0.08539	0.467000	0.42956	GGA		0.318	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282		Missense_Mutation
ASIC5	51802	genome.wustl.edu	37	4	156775394	156775394	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr4:156775394A>T	ENST00000537611.2	-	3	466	c.420T>A	c.(418-420)caT>caA	p.H140Q		NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	140					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)	p.H140Q(1)									TTTCTTGAAGATGGAGGACTT	0.388																																																1	Substitution - Missense(1)	ovary(1)	4											87.0	88.0	87.0					4																	156775394		2203	4300	6503	156994844	SO:0001583	missense	51802			AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.420T>A	4.37:g.156775394A>T	ENSP00000442477:p.His140Gln		156994844		Missense_Mutation	SNP	ENST00000537611.2	37	CCDS3793.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	4.666	0.123746	0.08931	.	.	ENSG00000256394	ENST00000537611	T	0.61859	0.07	4.4	1.39	0.22231	.	2.904090	0.00881	N	0.002135	T	0.47930	0.1472	L	0.33485	1.01	0.21527	N	0.999654	B	0.15473	0.013	B	0.20384	0.029	T	0.18304	-1.0341	10	0.21540	T	0.41	-5.0176	7.4451	0.27207	0.6788:0.0:0.3212:0.0	.	140	Q9NY37	ACCN5_HUMAN	Q	140	ENSP00000442477:H140Q	ENSP00000264432:H140Q	H	-	3	2	ACCN5	156994844	1.000000	0.71417	0.895000	0.35142	0.061000	0.15899	1.407000	0.34657	0.151000	0.19162	0.482000	0.46254	CAT		0.388	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1			Missense_Mutation
UCK2	7371	genome.wustl.edu	37	1	165872505	165872505	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1417-01	TCGA-24-1417-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr1:165872505T>C	ENST00000367879.4	+	5	889	c.586T>C	c.(586-588)Ttc>Ctc	p.F196L	UCK2_ENST00000470820.1_Missense_Mutation_p.F46L|UCK2_ENST00000462329.1_3'UTR|UCK2_ENST00000372212.4_3'UTR|UCK2_ENST00000469256.2_Missense_Mutation_p.F46L|RP11-525G13.2_ENST00000455257.2_RNA	NM_012474.4	NP_036606.2	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2	196					cellular response to oxygen levels (GO:0071453)|CTP salvage (GO:0044211)|feeding behavior (GO:0007631)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to axon injury (GO:0048678)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)	p.F196L(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					CTTTGAGGAATTCTGCTTGCC	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											227.0	187.0	201.0					1																	165872505		2203	4300	6503	164139129	SO:0001583	missense	7371			AF236637	CCDS1252.1	1p32	2012-10-02	2004-07-13	2004-07-14	ENSG00000143179	ENSG00000143179	2.7.1.48		12562	protein-coding gene	gene with protein product		609329	"""uridine monophosphate kinase"""	UMPK			Standard	NM_012474		Approved		uc001gdp.3	Q9BZX2	OTTHUMG00000040117	ENST00000367879.4:c.586T>C	1.37:g.165872505T>C	ENSP00000356853:p.Phe196Leu		164139129	Q5VV91|Q7KZV3|Q92528|Q96KG5|Q9BU42	Missense_Mutation	SNP	ENST00000367879.4	37	CCDS1252.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	31	5.088530	0.94100	.	.	ENSG00000143179	ENST00000367879	.	.	.	4.83	4.83	0.62350	Phosphoribulokinase/uridine kinase (1);	0.000000	0.85682	D	0.000000	T	0.79592	0.4472	H	0.97465	4.01	0.58432	D	0.999999	P;D	0.56521	0.759;0.976	P;P	0.57283	0.453;0.817	D	0.87165	0.2217	8	0.87932	D	0	-29.4412	12.4166	0.55496	0.0:0.0:0.0:1.0	.	46;196	Q9BZX2-2;Q9BZX2	.;UCK2_HUMAN	L	196	.	ENSP00000356853:F196L	F	+	1	0	UCK2	164139129	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	7.614000	0.82996	2.032000	0.59987	0.533000	0.62120	TTC		0.418	UCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096753.1	NM_012474		Missense_Mutation
POGK	57645	genome.wustl.edu	37	1	166819441	166819441	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr1:166819441C>T	ENST00000367875.1	+	5	1985	c.1625C>T	c.(1624-1626)cCa>cTa	p.P542L	POGK_ENST00000367876.4_Missense_Mutation_p.P542L|POGK_ENST00000536514.1_Missense_Mutation_p.P457L|POGK_ENST00000537173.1_Missense_Mutation_p.P424L			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	542	DDE.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P542L(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						gctaagaagccacccctgggc	0.567																																					GBM(76;192 1530 30153 48742)											1	Substitution - Missense(1)	ovary(1)	1											28.0	23.0	25.0					1																	166819441		2164	4237	6401	165086065	SO:0001583	missense	57645			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.1625C>T	1.37:g.166819441C>T	ENSP00000356849:p.Pro542Leu		165086065	Q5TIJ1|Q8TE07	Missense_Mutation	SNP	ENST00000367875.1	37	CCDS1254.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	22.7	4.328464	0.81690	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000367876;ENST00000367875	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.49	5.49	0.81192	.	0.000000	0.46442	D	0.000283	T	0.33673	0.0871	N	0.21282	0.65	0.38079	D	0.936622	P;P;D	0.63046	0.928;0.587;0.992	P;P;D	0.63957	0.671;0.504;0.92	T	0.03423	-1.1038	8	.	.	.	-18.1759	16.9205	0.86163	0.0:1.0:0.0:0.0	.	424;457;542	G3V1P0;B4DS22;Q9P215	.;.;POGK_HUMAN	L	424;457;542;542	ENSP00000442763:P424L;ENSP00000441187:P457L;ENSP00000356850:P542L;ENSP00000356849:P542L	.	P	+	2	0	POGK	165086065	0.977000	0.34250	0.983000	0.44433	0.935000	0.57460	2.711000	0.47177	2.857000	0.98124	0.650000	0.86243	CCA		0.567	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082888.1	NM_017542		Missense_Mutation
SCN2A	6326	genome.wustl.edu	37	2	166170591	166170591	+	Silent	SNP	G	G	A			TCGA-24-1417-01	TCGA-24-1417-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr2:166170591G>A	ENST00000375437.2	+	10	1646	c.1356G>A	c.(1354-1356)caG>caA	p.Q452Q	SCN2A_ENST00000375427.2_Silent_p.Q452Q|SCN2A_ENST00000283256.6_Silent_p.Q452Q|SCN2A_ENST00000357398.3_Silent_p.Q452Q	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	452					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.Q452Q(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCTCGAACAGTTGAAAAAGC	0.428																																																1	Substitution - coding silent(1)	ovary(1)	2											62.0	59.0	60.0					2																	166170591		2203	4300	6503	165878837	SO:0001819	synonymous_variant	6326			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1356G>A	2.37:g.166170591G>A			165878837	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	ENST00000375437.2	37	CCDS33314.1	SNP	36	WashU																																																																																				0.428	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007		Silent
XIRP2	129446	genome.wustl.edu	37	2	168104778	168104778	+	Silent	SNP	A	A	G			TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr2:168104778A>G	ENST00000409195.1	+	9	6965	c.6876A>G	c.(6874-6876)ccA>ccG	p.P2292P	XIRP2_ENST00000295237.9_Silent_p.P2292P|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Silent_p.P2070P|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2117					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.P2292P(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTCCACCTCCATCTCCACCTC	0.428																																																1	Substitution - coding silent(1)	ovary(1)	2											74.0	72.0	73.0					2																	168104778		1906	4120	6026	167813024	SO:0001819	synonymous_variant	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6876A>G	2.37:g.168104778A>G			167813024	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	CCDS42769.1	SNP	8	WashU																																																																																				0.428	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		Silent
SEC62	7095	genome.wustl.edu	37	3	169693429	169693429	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr3:169693429G>C	ENST00000337002.4	+	2	128	c.70G>C	c.(70-72)Gtg>Ctg	p.V24L	SEC62-AS1_ENST00000479626.1_RNA|SEC62_ENST00000480708.1_Missense_Mutation_p.V24L	NM_003262.3	NP_003253.1	Q99442	SEC62_HUMAN	SEC62 homolog (S. cerevisiae)	24					cotranslational protein targeting to membrane (GO:0006613)|posttranslational protein targeting to membrane (GO:0006620)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.V24L(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	9						AGAGAAGGCTGTGGCCAAGTA	0.343																																																1	Substitution - Missense(1)	ovary(1)	3											113.0	106.0	108.0					3																	169693429		2203	4300	6503	171176123	SO:0001583	missense	7095			D87127	CCDS3210.1	3q26.2	2008-04-22	2008-04-22	2008-04-22	ENSG00000008952	ENSG00000008952			11846	protein-coding gene	gene with protein product		602173	"""translocation protein 1"""	TLOC1		9020021, 10799540	Standard	NM_003262		Approved	Dtrp1, HTP1	uc003fgh.3	Q99442	OTTHUMG00000158753	ENST00000337002.4:c.70G>C	3.37:g.169693429G>C	ENSP00000337688:p.Val24Leu		171176123	D3DNQ0|O00682|O00729	Missense_Mutation	SNP	ENST00000337002.4	37	CCDS3210.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451983	0.63290	.	.	ENSG00000008952	ENST00000337002;ENST00000480708	T;T	0.15603	2.41;2.41	6.02	5.14	0.70334	.	0.057343	0.64402	D	0.000001	T	0.21307	0.0513	M	0.73962	2.25	0.58432	D	0.999999	B	0.21452	0.056	B	0.22152	0.038	T	0.02404	-1.1164	10	0.45353	T	0.12	-15.5175	9.8426	0.41008	0.1512:0.0:0.8488:0.0	.	24	Q99442	SEC62_HUMAN	L	24	ENSP00000337688:V24L;ENSP00000420331:V24L	ENSP00000337688:V24L	V	+	1	0	SEC62	171176123	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.187000	0.65087	2.865000	0.98341	0.655000	0.94253	GTG		0.343	SEC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352043.1			Missense_Mutation
OR2V2	285659	genome.wustl.edu	37	5	180582361	180582361	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1417-01	TCGA-24-1417-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr5:180582361G>T	ENST00000328275.1	+	1	419	c.419G>T	c.(418-420)aGg>aTg	p.R140M		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATGAATCAGAGGGTCTGTCTC	0.517																																																0			5											109.0	107.0	108.0					5																	180582361		2203	4300	6503	180514967	SO:0001583	missense	285659			AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.419G>T	5.37:g.180582361G>T	ENSP00000332185:p.Arg140Met		180514967	Q6IFL6|Q8NGV1	Missense_Mutation	SNP	ENST00000328275.1	37	CCDS4461.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	.	8.822	0.937826	0.18206	.	.	ENSG00000182613	ENST00000328275	T	0.43688	0.94	3.27	-2.07	0.07276	GPCR, rhodopsin-like superfamily (1);	0.731043	0.11239	N	0.584764	T	0.60444	0.2269	M	0.89414	3.03	0.09310	N	1	D	0.60160	0.987	P	0.59288	0.855	T	0.55354	-0.8154	10	0.62326	D	0.03	.	9.1059	0.36698	0.6374:0.0:0.3626:0.0	.	140	Q96R30	OR2V2_HUMAN	M	140	ENSP00000332185:R140M	ENSP00000332185:R140M	R	+	2	0	OR2V2	180514967	0.000000	0.05858	0.009000	0.14445	0.410000	0.31052	-0.803000	0.04540	-0.564000	0.06070	-1.842000	0.00583	AGG		0.517	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253529.1			Missense_Mutation
THPO	7066	genome.wustl.edu	37	3	184090779	184090779	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1417-01	TCGA-24-1417-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr3:184090779A>G	ENST00000204615.7	-	6	798	c.584T>C	c.(583-585)cTc>cCc	p.L195P	THPO_ENST00000421442.2_Intron|EIF2B5_ENST00000444495.1_Intron|THPO_ENST00000477594.1_Intron|THPO_ENST00000445696.2_Missense_Mutation_p.L191P	NM_000460.2|NM_001177597.1|NM_001177598.1	NP_000451.1|NP_001171068.1|NP_001171069.1	P40225	TPO_HUMAN	thrombopoietin	195					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|thrombopoietin-mediated signaling pathway (GO:0038163)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.L195P(1)		NS(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CCTGTTTGGGAGCTCGTTCAG	0.572																																																1	Substitution - Missense(1)	ovary(1)	3											82.0	83.0	82.0					3																	184090779		2203	4300	6503	185573473	SO:0001583	missense	7066				CCDS3265.1, CCDS54693.1	3q27	2014-01-30	2008-07-31		ENSG00000090534	ENSG00000090534		"""Endogenous ligands"""	11795	protein-coding gene	gene with protein product	"""prepro-thrombopoietin"", ""megakaryocyte stimulating factor"", ""myeloproliferative leukemia virus oncogene ligand"", ""megakaryocyte growth and development factor"", ""MPL ligand"", ""megakaryocyte colony-stimulating factor"", ""c-mpl ligand"", ""thrombopoietin nirs variant 1"""	600044		MGDF		8202154	Standard	XM_006713738		Approved	TPO, MPLLG	uc003fol.1	P40225	OTTHUMG00000156745	ENST00000204615.7:c.584T>C	3.37:g.184090779A>G	ENSP00000204615:p.Leu195Pro		185573473	A1L3Y0|B7ZLR8|B9EGA8|Q13020|Q15790|Q15791|Q15792	Missense_Mutation	SNP	ENST00000204615.7	37	CCDS3265.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	a	17.36	3.368994	0.61624	.	.	ENSG00000090534	ENST00000204615;ENST00000445696	T;T	0.45276	0.9;0.91	4.1	4.1	0.47936	.	0.181068	0.26855	N	0.022141	T	0.46756	0.1409	L	0.29908	0.895	0.80722	D	1	D;D	0.69078	0.997;0.994	D;P	0.63703	0.917;0.829	T	0.48186	-0.9057	10	0.87932	D	0	-23.5457	9.4116	0.38496	1.0:0.0:0.0:0.0	.	191;195	P40225-2;P40225	.;TPO_HUMAN	P	195;191	ENSP00000204615:L195P;ENSP00000410763:L191P	ENSP00000204615:L195P	L	-	2	0	THPO	185573473	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.715000	0.47210	1.722000	0.51474	0.373000	0.22412	CTC		0.572	THPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345554.1	NM_000460		Missense_Mutation
SLC11A1	6556	genome.wustl.edu	37	2	219259460	219259460	+	Silent	SNP	C	C	A			TCGA-24-1417-01	TCGA-24-1417-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1417-01	TCGA-24-1417-10	g.chr2:219259460C>A	ENST00000233202.6	+	14	1834	c.1494C>A	c.(1492-1494)ggC>ggA	p.G498G	SLC11A1_ENST00000539932.1_Silent_p.G380G	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	498					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)	p.G498G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTACTTCGGCCTTGCAGCCT	0.602																																																1	Substitution - coding silent(1)	ovary(1)	2											95.0	91.0	92.0					2																	219259460		2203	4300	6503	218967704	SO:0001819	synonymous_variant	6556			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.1494C>A	2.37:g.219259460C>A			218967704	C0H5Y3	Silent	SNP	ENST00000233202.6	37	CCDS2415.1	SNP	26	WashU																																																																																				0.602	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578		Silent
