#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ZMYM4	9202	broad.mit.edu	37	1	35853091	35853091	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr1:35853091G>A	ENST00000314607.6	+	13	2229	c.2149G>A	c.(2149-2151)Gat>Aat	p.D717N	ZMYM4_ENST00000373297.2_Missense_Mutation_p.D628N	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	717					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.D717N(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GAATTGTTCTGATGAATATAA	0.318																																																1	Substitution - Missense(1)	ovary(1)	1											66.0	73.0	70.0					1																	35853091		2203	4300	6503	35625678	SO:0001583	missense	9202			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2149G>A	1.37:g.35853091G>A	ENSP00000322915:p.Asp717Asn		35625678	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691074	0.88735	.	.	ENSG00000146463	ENST00000314607;ENST00000373297	T;T	0.25579	1.79;1.89	5.36	5.36	0.76844	TRASH (1);Zinc finger, MYM-type (1);	0.320878	0.32836	N	0.005589	T	0.49201	0.1543	M	0.70275	2.135	0.50632	D	0.99988	D	0.69078	0.997	D	0.67548	0.952	T	0.34129	-0.9841	10	0.26408	T	0.33	-17.0785	18.0677	0.89396	0.0:0.0:1.0:0.0	.	717	Q5VZL5	ZMYM4_HUMAN	N	717;628	ENSP00000322915:D717N;ENSP00000362394:D628N	ENSP00000322915:D717N	D	+	1	0	ZMYM4	35625678	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.189000	0.77747	2.498000	0.84270	0.655000	0.94253	GAT		0.318	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095		Missense_Mutation
TIE1	7075	broad.mit.edu	37	1	43772594	43772594	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr1:43772594A>T	ENST00000372476.3	+	4	647	c.568A>T	c.(568-570)Agc>Tgc	p.S190C	TIE1_ENST00000538015.1_Missense_Mutation_p.S190C|TIE1_ENST00000433781.2_5'Flank|TIE1_ENST00000441333.2_Missense_Mutation_p.S190C	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	190					angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S190C(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GCCACCATCGAGCGGCATCTA	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											66.0	68.0	67.0					1																	43772594		2203	4300	6503	43545181	SO:0001583	missense	7075			BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.568A>T	1.37:g.43772594A>T	ENSP00000361554:p.Ser190Cys		43545181	B5A949|B5A950	Missense_Mutation	SNP	ENST00000372476.3	37	CCDS482.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	13.70	2.316619	0.40996	.	.	ENSG00000066056	ENST00000372476;ENST00000441333;ENST00000538015	T;T;T	0.50813	0.73;0.73;0.73	5.26	4.13	0.48395	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.177535	0.27976	N	0.017098	T	0.53690	0.1812	L	0.36672	1.1	0.80722	D	1	P;D;D;D;D	0.76494	0.906;0.993;0.993;0.999;0.979	B;P;P;D;P	0.65443	0.43;0.628;0.72;0.935;0.512	T	0.56153	-0.8026	10	0.72032	D	0.01	.	9.6911	0.40129	0.8854:0.0:0.1146:0.0	.	145;190;190;190;190	B4DTW8;B5A952;B5A950;B5A948;P35590	.;.;.;.;TIE1_HUMAN	C	190	ENSP00000361554:S190C;ENSP00000401903:S190C;ENSP00000440063:S190C	ENSP00000361554:S190C	S	+	1	0	TIE1	43545181	0.901000	0.30685	0.713000	0.30519	0.116000	0.19942	3.217000	0.51184	1.984000	0.57885	0.459000	0.35465	AGC		0.612	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424		Missense_Mutation
CYP4A11	1579	broad.mit.edu	37	1	47402453	47402453	+	Missense_Mutation	SNP	C	C	G	rs144085677	byFrequency	TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr1:47402453C>G	ENST00000310638.4	-	4	424	c.393G>C	c.(391-393)ttG>ttC	p.L131F	CYP4A11_ENST00000462347.1_Missense_Mutation_p.L131F|CYP4A11_ENST00000457840.2_Missense_Mutation_p.L27F|CYP4A11_ENST00000496519.1_5'Flank|CYP4A11_ENST00000371904.4_Missense_Mutation_p.L131F|CYP4A11_ENST00000371905.1_Missense_Mutation_p.L131F	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	131	Poly-Leu.				arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)	p.L131F(1)		endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	TCAACAGGAGCAAGCCGTACC	0.532																																																1	Substitution - Missense(1)	ovary(1)	1						C	PHE/LEU	0,4406		0,0,2203	80.0	63.0	69.0		393	3.3	1.0	1	dbSNP_134	69	5,8595		0,5,4295	no	missense	CYP4A11	NM_000778.3	22	0,5,6498	GG,GC,CC		0.0581,0.0,0.0384	probably-damaging	131/520	47402453	5,13001	2203	4300	6503	47175040	SO:0001583	missense	1579			L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.393G>C	1.37:g.47402453C>G	ENSP00000311095:p.Leu131Phe		47175040	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	37	CCDS543.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	N	18.80	3.700540	0.68501	0.0	5.81E-4	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905;ENST00000457840	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.46	3.34	0.38264	.	0.000000	0.64402	D	0.000012	D	0.84028	0.5382	M	0.93150	3.385	0.42372	D	0.99245	D	0.89917	1.0	D	0.97110	1.0	D	0.84500	0.0616	10	0.87932	D	0	.	3.4568	0.07518	0.1438:0.5745:0.1393:0.1424	.	131	Q02928	CP4AB_HUMAN	F	131;131;131;27	ENSP00000311095:L131F;ENSP00000360971:L131F;ENSP00000360972:L131F;ENSP00000406272:L27F	ENSP00000311095:L131F	L	-	3	2	CYP4A11	47175040	0.847000	0.29606	1.000000	0.80357	0.965000	0.64279	-0.055000	0.11807	2.583000	0.87209	0.644000	0.83932	TTG		0.532	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778		Missense_Mutation
USP24	23358	broad.mit.edu	37	1	55603309	55603309	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr1:55603309T>C	ENST00000294383.6	-	28	3079	c.3080A>G	c.(3079-3081)gAa>gGa	p.E1027G	USP24_ENST00000407756.1_Missense_Mutation_p.E867G	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1027					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.E944G(1)		breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						AAGGATTTGTTCATCAGAAAA	0.443																																																1	Substitution - Missense(1)	ovary(1)	1											67.0	66.0	66.0					1																	55603309		1849	4101	5950	55375897	SO:0001583	missense	23358			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.3080A>G	1.37:g.55603309T>C	ENSP00000294383:p.Glu1027Gly		55375897	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	14.72	2.620234	0.46736	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.36699	1.24;1.24	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.30324	0.0761	L	0.38175	1.15	0.58432	D	0.999999	B	0.16166	0.016	B	0.16722	0.016	T	0.07927	-1.0747	10	0.17832	T	0.49	.	15.9568	0.79893	0.0:0.0:0.0:1.0	.	867	B7WPF4	.	G	1027;867	ENSP00000294383:E1027G;ENSP00000385700:E867G	ENSP00000294383:E1027G	E	-	2	0	USP24	55375897	1.000000	0.71417	0.937000	0.37676	0.331000	0.28603	7.698000	0.84413	2.158000	0.67659	0.460000	0.39030	GAA		0.443	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2			Missense_Mutation
KANK4	163782	broad.mit.edu	37	1	62740524	62740524	+	Silent	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr1:62740524T>C	ENST00000371153.4	-	3	630	c.252A>G	c.(250-252)gcA>gcG	p.A84A	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	84						cytoplasm (GO:0005737)		p.A84A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						GGGGCGGGGCTGCAGGGGGGC	0.587																																																1	Substitution - coding silent(1)	ovary(1)	1											76.0	88.0	84.0					1																	62740524		2203	4300	6503	62513112	SO:0001819	synonymous_variant	163782			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.252A>G	1.37:g.62740524T>C			62513112	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Silent	SNP	ENST00000371153.4	37	CCDS620.1	SNP	55	Broad																																																																																				0.587	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712		Silent
AP4B1	10717	broad.mit.edu	37	1	114438635	114438635	+	Silent	SNP	C	C	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr1:114438635C>A	ENST00000369569.1	-	9	1816	c.1536G>T	c.(1534-1536)cgG>cgT	p.R512R	AP4B1-AS1_ENST00000419536.1_RNA|AP4B1_ENST00000256658.4_Silent_p.R512R|AP4B1_ENST00000462591.1_5'UTR|AP4B1_ENST00000369567.1_Silent_p.R344R	NM_001253852.1	NP_001240781.1	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1 subunit	512					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|trans-Golgi network (GO:0005802)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.R512R(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|prostate(3)	25	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GACCTCGGTCCCGTACAGCCA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	1											82.0	81.0	81.0					1																	114438635		2203	4300	6503	114240158	SO:0001819	synonymous_variant	10717			AF092094	CCDS865.1	1p13.2	2012-03-30			ENSG00000134262	ENSG00000134262			572	protein-coding gene	gene with protein product	"""beta 4 subunit of AP-4"""	607245	"""spastic paraplegia 47"""	SPG47		10066790	Standard	NM_006594		Approved	BETA-4	uc001eeb.3	Q9Y6B7	OTTHUMG00000011943	ENST00000369569.1:c.1536G>T	1.37:g.114438635C>A			114240158	B7Z4X3|Q59EJ4|Q96CL6	Silent	SNP	ENST00000369569.1	37	CCDS865.1	SNP	22	Broad																																																																																				0.428	AP4B1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033037.1	NM_006594		Silent
SUCO	51430	broad.mit.edu	37	1	172579024	172579024	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr1:172579024A>G	ENST00000263688.3	+	24	3609	c.3390A>G	c.(3388-3390)atA>atG	p.I1130M	SUCO_ENST00000610051.1_Missense_Mutation_p.I759M|SUCO_ENST00000608151.1_Missense_Mutation_p.I1282M|SUCO_ENST00000367723.4_Missense_Mutation_p.I1281M	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	1130					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)		p.I1130M(1)									TGCACCCCATAGCCAATGGCG	0.378																																																1	Substitution - Missense(1)	ovary(1)	1											82.0	85.0	84.0					1																	172579024		2203	4299	6502	170845647	SO:0001583	missense	51430			AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.3390A>G	1.37:g.172579024A>G	ENSP00000263688:p.Ile1130Met		170845647	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	37	CCDS1303.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	13.27	2.187035	0.38609	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.56	-1.77	0.07982	.	0.421232	0.26052	N	0.026628	T	0.16257	0.0391	L	0.44542	1.39	0.27524	N	0.951316	D;P;P	0.67145	0.996;0.818;0.498	P;P;B	0.53649	0.731;0.468;0.348	T	0.09465	-1.0673	9	0.38643	T	0.18	-7.6563	2.6068	0.04880	0.3286:0.364:0.0711:0.2362	.	759;1282;1130	B4DYM4;Q5H945;Q9UBS9	.;.;OSPT_HUMAN	M	1282;1130	.	ENSP00000263688:I1130M	I	+	3	3	C1orf9	170845647	0.995000	0.38212	0.604000	0.28916	0.957000	0.61999	0.422000	0.21296	-0.213000	0.10094	0.528000	0.53228	ATA		0.378	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227		Missense_Mutation
KIAA1614	57710	broad.mit.edu	37	1	180913547	180913547	+	Missense_Mutation	SNP	G	G	T	rs376517410		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr1:180913547G>T	ENST00000367588.4	+	8	3237	c.3182G>T	c.(3181-3183)cGg>cTg	p.R1061L	KIAA1614_ENST00000461346.1_3'UTR|RP11-46A10.5_ENST00000358073.2_RNA|KIAA1614_ENST00000367587.1_Missense_Mutation_p.R682L	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	1061	Ser-rich.							p.R1061L(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						CACCAGCGTCGGAAAGCTGCC	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											69.0	72.0	71.0					1																	180913547		1997	4166	6163	179180170	SO:0001583	missense	57710			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.3182G>T	1.37:g.180913547G>T	ENSP00000356560:p.Arg1061Leu		179180170	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	CCDS41442.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	21.2	4.114553	0.77210	.	.	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.39406	1.63;1.08	5.06	2.12	0.27331	.	0.199071	0.31872	N	0.006925	T	0.57110	0.2031	M	0.69823	2.125	0.35356	D	0.787757	P;D	0.67145	0.872;0.996	P;D	0.65773	0.524;0.938	T	0.68176	-0.5478	9	0.66056	D	0.02	-8.1633	9.6468	0.39872	0.2366:0.0:0.7634:0.0	.	682;1061	Q5VZ46-2;Q5VZ46	.;K1614_HUMAN	L	1061;682	ENSP00000356560:R1061L;ENSP00000356559:R682L	ENSP00000356559:R682L	R	+	2	0	KIAA1614	179180170	0.988000	0.35896	0.994000	0.49952	0.965000	0.64279	1.346000	0.33964	0.539000	0.28788	0.491000	0.48974	CGG		0.572	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531		Missense_Mutation
C10orf71	118461	broad.mit.edu	37	10	50530959	50530959	+	Silent	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr10:50530959G>A	ENST00000374144.3	+	3	657	c.369G>A	c.(367-369)caG>caA	p.Q123Q	C10orf71_ENST00000323868.4_Silent_p.Q123Q			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	123								p.Q123Q(1)		endometrium(1)	1						CGCCAGTCCAGAGGAGACTGG	0.547																																																1	Substitution - coding silent(1)	ovary(1)	10											85.0	98.0	94.0					10																	50530959		1912	4130	6042	50200965	SO:0001819	synonymous_variant	118461			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.369G>A	10.37:g.50530959G>A			50200965	A0AVL8	Silent	SNP	ENST00000374144.3	37	CCDS44387.1	SNP	33	Broad																																																																																				0.547	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459		Silent
ZSWIM8	23053	broad.mit.edu	37	10	75556628	75556628	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr10:75556628A>T	ENST00000605216.1	+	16	3332	c.3115A>T	c.(3115-3117)Agg>Tgg	p.R1039W	ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.R1044W|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.R1044W|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.R1039W|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.R1006W	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1039							zinc ion binding (GO:0008270)										AGCCAGCCAGAGGTCTCCTTC	0.602																																																0			10											69.0	75.0	73.0					10																	75556628		1991	4172	6163	75226634	SO:0001583	missense	23053			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.3115A>T	10.37:g.75556628A>T	ENSP00000474748:p.Arg1039Trp		75226634	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	ENST00000605216.1	37		SNP	11	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	19.95|19.95|19.95	3.922090|3.922090|3.922090	0.73213|0.73213|0.73213	.|.|.	.|.|.	ENSG00000214655|ENSG00000214655|ENSG00000214655	ENST00000433366|ENST00000412198|ENST00000398706	.|.|T	.|.|0.48201	.|.|0.82	5.3|5.3|5.3	5.3|5.3|5.3	0.74995|0.74995|0.74995	.|.|.	.|0.205916|0.205916	.|0.30051|0.30051	.|U|U	.|0.010521|0.010521	T|T|T	0.51719|0.51719|0.51719	0.1691|0.1691|0.1691	L|L|L	0.34521|0.34521|0.34521	1.04|1.04|1.04	0.39487|0.39487|0.39487	D|D|D	0.967981|0.967981|0.967981	.|.|D;D;D;D	.|.|0.58268	.|.|0.982;0.979;0.969;0.982	.|.|P;P;P;P	.|.|0.56127	.|.|0.721;0.792;0.721;0.721	T|T|T	0.52381|0.52381|0.52381	-0.8583|-0.8583|-0.8583	5|6|10	.|.|0.38643	.|.|T	.|.|0.18	-6.994|-6.994|-6.994	15.2489|15.2489|15.2489	0.73529|0.73529|0.73529	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	.|.|1039;1051;1039;1044	.|.|A7E2V4;A7E2V4-3;A7E2V4-5;A7E2V4-4	.|.|K0913_HUMAN;.;.;.	V|S|W	754|313|1044	.|.|ENSP00000381693:R1044W	.|.|ENSP00000381693:R1044W	E|R|R	+|+|+	2|3|1	0|2|2	KIAA0913|KIAA0913|KIAA0913	75226634|75226634|75226634	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	6.923000|6.923000|6.923000	0.75817|0.75817|0.75817	2.009000|2.009000|2.009000	0.58944|0.58944|0.58944	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	GAG|AGA|AGG		0.602	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487		Missense_Mutation
SORCS3	22986	broad.mit.edu	37	10	107022106	107022106	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr10:107022106A>T	ENST00000369701.3	+	26	3688	c.3461A>T	c.(3460-3462)aAc>aTc	p.N1154I		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	1154					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.N1154I(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CCTTGGATTAACATCTATGCT	0.488																																					NSCLC(116;1497 1690 7108 13108 14106)											1	Substitution - Missense(1)	ovary(1)	10											97.0	88.0	91.0					10																	107022106		2203	4300	6503	107012096	SO:0001583	missense	22986			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.3461A>T	10.37:g.107022106A>T	ENSP00000358715:p.Asn1154Ile		107012096	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	25.0	4.591060	0.86851	.	.	ENSG00000156395	ENST00000369701	T	0.16324	2.35	5.69	5.69	0.88448	.	0.105903	0.64402	D	0.000005	T	0.35248	0.0925	L	0.46157	1.445	0.58432	D	0.999995	D	0.89917	1.0	D	0.77557	0.99	T	0.01930	-1.1245	9	.	.	.	.	15.9546	0.79876	1.0:0.0:0.0:0.0	.	1154	Q9UPU3	SORC3_HUMAN	I	1154	ENSP00000358715:N1154I	.	N	+	2	0	SORCS3	107012096	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.962000	0.93254	2.173000	0.68751	0.454000	0.30748	AAC		0.488	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		Missense_Mutation
PRLHR	2834	broad.mit.edu	37	10	120353894	120353894	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr10:120353894G>T	ENST00000369169.1	-	1	862	c.863C>A	c.(862-864)gCc>gAc	p.A288D	PRLHR_ENST00000239032.2_Missense_Mutation_p.A288D			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	288					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)	p.A288D(1)		large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		CCAGCAGACGGCGAACACCAC	0.697																																																1	Substitution - Missense(1)	ovary(1)	10											31.0	34.0	33.0					10																	120353894		2201	4291	6492	120343884	SO:0001583	missense	2834			AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.863C>A	10.37:g.120353894G>T	ENSP00000358167:p.Ala288Asp		120343884	O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	ENST00000369169.1	37	CCDS7606.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809823	0.70797	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.70282	-0.47;-0.47	4.38	3.42	0.39159	GPCR, rhodopsin-like superfamily (1);	0.194004	0.42821	D	0.000660	D	0.88228	0.6380	H	0.96633	3.855	0.46458	D	0.999051	D	0.89917	1.0	D	0.76575	0.988	D	0.91496	0.5215	10	0.87932	D	0	.	12.981	0.58564	0.0:0.3941:0.6059:0.0	.	288	P49683	PRLHR_HUMAN	D	288	ENSP00000239032:A288D;ENSP00000358167:A288D	ENSP00000239032:A288D	A	-	2	0	PRLHR	120343884	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	3.070000	0.50033	2.255000	0.74692	0.561000	0.74099	GCC		0.697	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050610.1	NM_004248		Missense_Mutation
CACUL1	143384	broad.mit.edu	37	10	120514067	120514067	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr10:120514067G>C	ENST00000369151.3	-	1	691	c.208C>G	c.(208-210)Ccc>Gcc	p.P70A	CACUL1_ENST00000340214.4_Missense_Mutation_p.P70A	NM_153810.4	NP_722517.3	Q86Y37	CACL1_HUMAN	CDK2-associated, cullin domain 1	70	Pro-rich.				G1/S transition of mitotic cell cycle (GO:0000082)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase activity (GO:0045860)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)	protein kinase binding (GO:0019901)	p.P70A(1)									CCCTCCTTGGGGCCTTTCCTG	0.741																																																1	Substitution - Missense(1)	ovary(1)	10											11.0	14.0	13.0					10																	120514067		1812	4035	5847	120504057	SO:0001583	missense	143384			AK097728	CCDS41570.1	10q26.13	2012-06-12	2012-06-12	2012-06-12	ENSG00000151893	ENSG00000151893			23727	protein-coding gene	gene with protein product	"""Cdk-Associated Cullin1"""		"""chromosome 10 open reading frame 46"""	C10orf46		19829063	Standard	NM_153810		Approved	FLJ40409, MGC33215, CAC1	uc001lds.1	Q86Y37	OTTHUMG00000019138	ENST00000369151.3:c.208C>G	10.37:g.120514067G>C	ENSP00000358147:p.Pro70Ala		120504057	Q5XPL7|Q8IY11|Q8N7S4	Missense_Mutation	SNP	ENST00000369151.3	37	CCDS41570.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	6.525	0.465160	0.12402	.	.	ENSG00000151893	ENST00000369151;ENST00000340214	.	.	.	4.59	3.67	0.42095	.	0.120840	0.37577	N	0.002023	T	0.21881	0.0527	N	0.19112	0.55	0.25461	N	0.987918	B	0.16603	0.018	B	0.14023	0.01	T	0.25537	-1.0129	9	0.02654	T	1	-3.6513	9.2246	0.37398	0.1037:0.0:0.8963:0.0	.	70	Q86Y37	CJ046_HUMAN	A	70	.	ENSP00000342487:P70A	P	-	1	0	C10orf46	120504057	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.148000	0.42235	1.034000	0.39945	0.561000	0.74099	CCC		0.741	CACUL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050612.2	NM_153810		Missense_Mutation
FAM53B	9679	broad.mit.edu	37	10	126370335	126370335	+	Silent	SNP	T	T	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr10:126370335T>G	ENST00000337318.3	-	4	958	c.747A>C	c.(745-747)acA>acC	p.T249T	FAM53B_ENST00000280780.6_Silent_p.T249T|FAM53B_ENST00000392754.3_Silent_p.T249T|RP11-12J10.3_ENST00000494792.1_3'UTR	NM_014661.3	NP_055476.3	Q14153	FA53B_HUMAN	family with sequence similarity 53, member B	249								p.T249T(1)		cervix(1)|lung(5)|ovary(2)|pancreas(1)	9		all_lung(145;0.0191)|Lung NSC(174;0.0301)|Colorectal(57;0.106)|all_neural(114;0.117)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.15)		TTGAGGCAGGTGTGCTGTTGG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	10											33.0	32.0	32.0					10																	126370335		2203	4300	6503	126360325	SO:0001819	synonymous_variant	9679			D50930	CCDS7641.1	10q26.13	2004-11-24	2004-11-24	2004-11-24	ENSG00000189319	ENSG00000189319			28968	protein-coding gene	gene with protein product			"""KIAA0140"""	KIAA0140		8590280	Standard	NM_014661		Approved	bA12J10.2	uc001lhv.1	Q14153	OTTHUMG00000019215	ENST00000337318.3:c.747A>C	10.37:g.126370335T>G			126360325	D3DRF1|Q5VUW1|Q5VUW2|Q8N5S6	Silent	SNP	ENST00000337318.3	37	CCDS7641.1	SNP	59	Broad																																																																																				0.607	FAM53B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050879.1	NM_014661		Silent
PSMD13	5719	broad.mit.edu	37	11	247370	247370	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1422-01	TCGA-24-1422-10			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr11:247370C>G	ENST00000532097.1	+	7	994	c.490C>G	c.(490-492)Caa>Gaa	p.Q164E	PSMD13_ENST00000352303.5_Missense_Mutation_p.Q164E|PSMD13_ENST00000431206.2_Missense_Mutation_p.Q166E	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13	164					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)		p.Q164E(1)|p.Q166E(1)		NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		TAAATACTATCAAACAATCGG	0.423																																																2	Substitution - Missense(2)	ovary(2)	11											113.0	97.0	103.0					11																	247370		2203	4300	6503	237370	SO:0001583	missense	5719			AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.490C>G	11.37:g.247370C>G	ENSP00000436186:p.Gln164Glu		237370	B3KT15|O75831|Q53XU2|Q9UNV3	Missense_Mutation	SNP	ENST00000532097.1	37	CCDS7692.1	SNP	29	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.57|18.57	3.653190|3.653190	0.67472|0.67472	.|.	.|.	ENSG00000185627|ENSG00000185627	ENST00000526783|ENST00000532097;ENST00000538343;ENST00000431206;ENST00000528906;ENST00000352303	.|T;T;T;T	.|0.16897	.|2.33;2.32;2.32;2.31	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	.|0.275074	.|0.42294	.|D	.|0.000734	T|T	0.19446|0.19446	0.0467|0.0467	L|L	0.48877|0.48877	1.53|1.53	0.50467|0.50467	D|D	0.999876|0.999876	.|B;B;B;B	.|0.28820	.|0.016;0.001;0.224;0.224	.|B;B;B;B	.|0.27500	.|0.023;0.009;0.08;0.08	T|T	0.01720|0.01720	-1.1288|-1.1288	5|10	.|0.32370	.|T	.|0.25	.|.	18.8888|18.8888	0.92389|0.92389	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|166;99;164;164	.|Q9UNM6-2;B4DJ66;B2RBM7;Q9UNM6	.|.;.;.;PSD13_HUMAN	M|E	74|164;99;166;126;164	.|ENSP00000436186:Q164E;ENSP00000396937:Q166E;ENSP00000433364:Q126E;ENSP00000333811:Q164E	.|ENSP00000333811:Q164E	I|Q	+|+	3|1	3|0	PSMD13|PSMD13	237370|237370	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.898000|0.898000	0.52572|0.52572	6.076000|6.076000	0.71267|0.71267	2.890000|2.890000	0.99128|0.99128	0.650000|0.650000	0.86243|0.86243	ATC|CAA		0.423	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239286.2	NM_002817		Missense_Mutation
OR52A4	390053	broad.mit.edu	37	11	5142506	5142506	+	RNA	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr11:5142506G>C	ENST00000498233.1	-	0	892							A6NMU1	O52A4_HUMAN	olfactory receptor, family 52, subfamily A, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C101W(1)		breast(1)|endometrium(2)|kidney(1)|lung(12)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		TCTGAAAGAGGCAAGCATCAA	0.463																																																1	Substitution - Missense(1)	ovary(1)	11											56.0	51.0	53.0					11																	5142506		2201	4298	6499	5099082			390053					11p15.4	2012-10-03	2012-10-03	2012-10-03	ENSG00000205494	ENSG00000205494		"""GPCR / Class A : Olfactory receptors"""	19579	pseudogene	pseudogene							Standard	NG_029079		Approved			A6NMU1	OTTHUMG00000066610		11.37:g.5142506G>C			5099082		Missense_Mutation	SNP	ENST00000498233.1	37		SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	11.53	1.667378	0.29604	.	.	ENSG00000248953	ENST00000380369	.	.	.	3.89	0.733	0.18289	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.66954	0.2842	.	.	.	0.29662	N	0.843137	D	0.89917	1.0	D	0.97110	1.0	T	0.70364	-0.4892	6	0.87932	D	0	.	7.1666	0.25693	0.3427:0.0:0.6573:0.0	.	101	A6NMU1	O52A4_HUMAN	W	101	.	ENSP00000369727:C101W	C	-	3	2	OR52A4	5099082	0.946000	0.32159	0.718000	0.30602	0.989000	0.77384	1.285000	0.33261	0.037000	0.15575	-0.142000	0.14014	TGC		0.463	OR52A4-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000268565.1	NG_029079		Missense_Mutation
SLC35C1	55343	broad.mit.edu	37	11	45827584	45827584	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr11:45827584T>G	ENST00000314134.3	+	1	1628	c.232T>G	c.(232-234)Ttc>Gtc	p.F78V	SLC35C1_ENST00000442528.2_Missense_Mutation_p.F65V|SLC35C1_ENST00000456334.1_Missense_Mutation_p.F65V	NM_018389.4	NP_060859.4	Q96A29	FUCT1_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C1	78					carbohydrate transport (GO:0008643)|lipid glycosylation (GO:0030259)|negative regulation of Notch signaling pathway (GO:0045746)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)		p.F78V(1)		endometrium(3)|kidney(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10				GBM - Glioblastoma multiforme(35;0.227)		CTTCGTCACCTTCTACCAGTG	0.627																																																1	Substitution - Missense(1)	ovary(1)	11											85.0	76.0	79.0					11																	45827584		2203	4299	6502	45784160	SO:0001583	missense	55343				CCDS7914.1, CCDS44575.1	11p11.2	2014-09-17	2013-07-17			ENSG00000181830		"""Solute carriers"""	20197	protein-coding gene	gene with protein product		605881	"""solute carrier family 35, member C1"""			11326279, 11326280	Standard	NM_018389		Approved	FUCT1, FLJ11320	uc010rgm.2	Q96A29		ENST00000314134.3:c.232T>G	11.37:g.45827584T>G	ENSP00000313318:p.Phe78Val		45784160	B2RDB2|Q9BV76|Q9NUJ8	Missense_Mutation	SNP	ENST00000314134.3	37	CCDS7914.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	35	5.565925	0.96540	.	.	ENSG00000181830	ENST00000442528;ENST00000456334;ENST00000526817;ENST00000314134;ENST00000530471;ENST00000540685	T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53	4.97	4.97	0.65823	Drug/metabolite transporter (1);	0.000000	0.85682	D	0.000000	T	0.57917	0.2086	M	0.81497	2.545	0.80722	D	1	P	0.51449	0.945	P	0.44732	0.459	T	0.60969	-0.7157	10	0.23891	T	0.37	-39.0929	14.6703	0.68939	0.0:0.0:0.0:1.0	.	78	Q96A29	FUCT1_HUMAN	V	65;65;65;78;65;78	ENSP00000412408:F65V;ENSP00000399779:F65V;ENSP00000432145:F65V;ENSP00000313318:F78V;ENSP00000432669:F65V	ENSP00000313318:F78V	F	+	1	0	SLC35C1	45784160	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.649000	0.83500	1.876000	0.54355	0.455000	0.32223	TTC		0.627	SLC35C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390139.1	NM_018389		Missense_Mutation
OR4A47	403253	broad.mit.edu	37	11	48510886	48510886	+	Missense_Mutation	SNP	C	C	T	rs374169955		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr11:48510886C>T	ENST00000446524.1	+	1	618	c.542C>T	c.(541-543)cCc>cTc	p.P181L		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P181L(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						GACATGTATCCCTTATTGAAA	0.443																																																1	Substitution - Missense(1)	ovary(1)	11											167.0	159.0	162.0					11																	48510886		2201	4298	6499	48467462	SO:0001583	missense	403253			BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.542C>T	11.37:g.48510886C>T	ENSP00000412752:p.Pro181Leu		48467462		Missense_Mutation	SNP	ENST00000446524.1	37	CCDS31490.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	N	10.65	1.409398	0.25378	.	.	ENSG00000237388	ENST00000446524	T	0.00224	8.51	4.84	4.84	0.62591	GPCR, rhodopsin-like superfamily (1);	0.117629	0.38778	N	0.001571	T	0.00666	0.0022	M	0.89785	3.06	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.28490	-1.0042	10	0.87932	D	0	.	10.6704	0.45755	0.1913:0.8087:0.0:0.0	.	181	Q6IF82	O4A47_HUMAN	L	181	ENSP00000412752:P181L	ENSP00000412752:P181L	P	+	2	0	OR4A47	48467462	0.001000	0.12720	0.146000	0.22360	0.047000	0.14425	1.387000	0.34430	2.218000	0.71995	0.511000	0.50034	CCC		0.443	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	NM_001005512		Missense_Mutation
C11orf57	55216	broad.mit.edu	37	11	111953638	111953638	+	Missense_Mutation	SNP	G	G	A	rs201262827		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr11:111953638G>A	ENST00000280352.9	+	6	1457	c.821G>A	c.(820-822)cGc>cAc	p.R274H	TIMM8B_ENST00000507614.1_5'Flank|C11orf57_ENST00000532163.1_Missense_Mutation_p.R246H|C11orf57_ENST00000420986.2_Missense_Mutation_p.R274H|C11orf57_ENST00000393047.3_Missense_Mutation_p.R275H	NM_001082970.1|NM_018195.3	NP_001076439.1|NP_060665.3	Q6ZUT1	CK057_HUMAN	chromosome 11 open reading frame 57	274								p.R274H(1)		autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		ACAAACAAACGCACAAATTGG	0.398																																																1	Substitution - Missense(1)	ovary(1)	11											67.0	68.0	68.0					11																	111953638		2200	4292	6492	111458848	SO:0001583	missense	55216			BX538107	CCDS8356.2, CCDS41715.1, CCDS73383.1	11q23.1	2006-03-09			ENSG00000150776	ENSG00000150776			25569	protein-coding gene	gene with protein product						12477932	Standard	NM_001082970		Approved	FLJ10726	uc001pmw.4	Q6ZUT1	OTTHUMG00000150213	ENST00000280352.9:c.821G>A	11.37:g.111953638G>A	ENSP00000339076:p.Arg274His		111458848	Q5RL41|Q6IN53|Q7Z357|Q8N2T3	Missense_Mutation	SNP	ENST00000280352.9	37	CCDS41715.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	22.2	4.255683	0.80135	.	.	ENSG00000150776	ENST00000420986;ENST00000532163;ENST00000280352;ENST00000393047;ENST00000393048	.	.	.	5.39	5.39	0.77823	.	0.369313	0.28889	N	0.013810	T	0.66963	0.2843	L	0.27053	0.805	0.44570	D	0.997538	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.982	T	0.70121	-0.4959	9	0.87932	D	0	-2.6889	19.3429	0.94350	0.0:0.0:1.0:0.0	.	275;274	Q6ZUT1-2;Q6ZUT1	.;CK057_HUMAN	H	274;246;274;275;129	.	ENSP00000339076:R274H	R	+	2	0	C11orf57	111458848	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.211000	0.65219	2.795000	0.96236	0.655000	0.94253	CGC		0.398	C11orf57-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316852.1	NM_018195		Missense_Mutation
NXPE4	54827	broad.mit.edu	37	11	114453017	114453017	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr11:114453017A>G	ENST00000375478.3	-	3	1003	c.823T>C	c.(823-825)Ttt>Ctt	p.F275L	NXPE4_ENST00000424261.2_Intron	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	275						extracellular vesicular exosome (GO:0070062)		p.F275L(1)									TACCTTTCAAAGAGGCTCTTT	0.363																																																1	Substitution - Missense(1)	ovary(1)	11											72.0	68.0	70.0					11																	114453017		1851	4097	5948	113958227	SO:0001583	missense	54827			AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.823T>C	11.37:g.114453017A>G	ENSP00000364627:p.Phe275Leu		113958227	Q6QDB4|Q9NXP5	Missense_Mutation	SNP	ENST00000375478.3	37	CCDS41718.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	14.77	2.635644	0.47049	.	.	ENSG00000137634	ENST00000375478	T	0.12147	2.71	5.25	5.25	0.73442	.	0.087254	0.49916	D	0.000123	T	0.13628	0.0330	L	0.48642	1.525	0.80722	D	1	B	0.23854	0.092	B	0.24006	0.05	T	0.07520	-1.0768	10	0.19590	T	0.45	.	13.4358	0.61084	1.0:0.0:0.0:0.0	.	275	Q6UWF7	FA55D_HUMAN	L	275	ENSP00000364627:F275L	ENSP00000364627:F275L	F	-	1	0	FAM55D	113958227	1.000000	0.71417	0.958000	0.39756	0.986000	0.74619	6.208000	0.72165	2.105000	0.64084	0.533000	0.62120	TTT		0.363	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399179.1	NM_017678		Missense_Mutation
CHD4	1108	broad.mit.edu	37	12	6707105	6707105	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr12:6707105C>T	ENST00000357008.2	-	12	2010	c.1847G>A	c.(1846-1848)gGg>gAg	p.G616E	CHD4_ENST00000544040.1_Missense_Mutation_p.G609E|CHD4_ENST00000544484.1_Missense_Mutation_p.G613E|CHD4_ENST00000309577.6_Missense_Mutation_p.G616E	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	616					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.G616E(1)		central_nervous_system(2)	2						GGGTTTTATCCCATAGCGATA	0.522																																					Colon(32;586 792 4568 16848 45314)											1	Substitution - Missense(1)	ovary(1)	12											176.0	175.0	176.0					12																	6707105		2203	4300	6503	6577366	SO:0001583	missense	1108			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.1847G>A	12.37:g.6707105C>T	ENSP00000349508:p.Gly616Glu		6577366	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488272	0.84854	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51	3.83	3.83	0.44106	Chromo domain-like (1);	0.000000	0.85682	D	0.000000	D	0.86460	0.5938	M	0.89785	3.06	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.90120	0.4198	10	0.87932	D	0	0.0017	15.927	0.79624	0.0:1.0:0.0:0.0	.	616;616;609	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	E	613;609;616;616;590	ENSP00000440392:G613E;ENSP00000440542:G609E;ENSP00000312419:G616E;ENSP00000349508:G616E	ENSP00000312419:G616E	G	-	2	0	CHD4	6577366	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	7.625000	0.83145	1.967000	0.57214	0.467000	0.42956	GGG		0.522	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273		Missense_Mutation
TAS2R46	259292	broad.mit.edu	37	12	11214529	11214529	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr12:11214529T>C	ENST00000533467.1	-	1	364	c.365A>G	c.(364-366)aAg>aGg	p.K122R	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176887.2	NP_795368.2	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	122					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.K122R(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		AACTCTCCTCTTTAAGTGAAG	0.363																																																1	Substitution - Missense(1)	ovary(1)	12											91.0	95.0	93.0					12																	11214529		2022	4205	6227	11105796	SO:0001583	missense	259292			AF494227	CCDS53748.1	12p13.2	2012-08-22				ENSG00000226761		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18877	protein-coding gene	gene with protein product		612774				12379855	Standard	NM_176887		Approved	T2R54	uc001qzp.1	P59540		ENST00000533467.1:c.365A>G	12.37:g.11214529T>C	ENSP00000436450:p.Lys122Arg		11105796	P59548|Q645X6	Missense_Mutation	SNP	ENST00000533467.1	37	CCDS53748.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	13.89	2.372099	0.42003	.	.	ENSG00000226761	ENST00000533467	T	0.01323	5.01	2.54	2.54	0.30619	.	.	.	.	.	T	0.04137	0.0115	M	0.79614	2.46	0.09310	N	1	P	0.43314	0.803	P	0.47827	0.558	T	0.20273	-1.0280	9	0.72032	D	0.01	.	8.5923	0.33695	0.0:0.0:0.0:1.0	.	122	P59540	T2R46_HUMAN	R	122	ENSP00000436450:K122R	ENSP00000436450:K122R	K	-	2	0	TAS2R46	11105796	0.151000	0.22747	0.005000	0.12908	0.097000	0.18754	1.499000	0.35671	1.189000	0.43028	0.163000	0.16589	AAG		0.363	TAS2R46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383559.1	NM_176887		Missense_Mutation
SOX5	6660	broad.mit.edu	37	12	23757376	23757376	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr12:23757376G>A	ENST00000451604.2	-	9	1210	c.1109C>T	c.(1108-1110)tCt>tTt	p.S370F	SOX5_ENST00000541536.1_Missense_Mutation_p.S357F|SOX5_ENST00000537393.1_Missense_Mutation_p.S335F|SOX5_ENST00000545921.1_Missense_Mutation_p.S360F|SOX5_ENST00000546136.1_Missense_Mutation_p.S357F|SOX5_ENST00000309359.1_Missense_Mutation_p.S357F|SOX5_ENST00000381381.2_Missense_Mutation_p.S357F			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	370					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.S370F(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						GCTGGTAGGAGATACAGCAGC	0.502																																																1	Substitution - Missense(1)	ovary(1)	12											163.0	133.0	143.0					12																	23757376		2203	4300	6503	23648643	SO:0001583	missense	6660			AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.1109C>T	12.37:g.23757376G>A	ENSP00000398273:p.Ser370Phe		23648643	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	CCDS8699.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	25.6	4.657444	0.88154	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921	D;D;D;D;D;D;D	0.98105	-4.7;-4.7;-4.34;-4.71;-4.72;-4.34;-4.71	6.16	6.16	0.99307	.	0.171135	0.53938	D	0.000045	D	0.98526	0.9508	M	0.76170	2.325	0.58432	D	0.999998	D;D;D	0.67145	0.996;0.984;0.993	D;D;P	0.74348	0.956;0.983;0.904	D	0.97379	0.9981	10	0.20046	T	0.44	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	335;357;370	F5H0I3;P35711-4;P35711	.;.;SOX5_HUMAN	F	357;357;357;370;322;335;357;360	ENSP00000437487:S357F;ENSP00000308927:S357F;ENSP00000370788:S357F;ENSP00000398273:S370F;ENSP00000439832:S335F;ENSP00000441973:S357F;ENSP00000443520:S360F	ENSP00000308927:S357F	S	-	2	0	SOX5	23648643	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.241000	0.89816	2.937000	0.99478	0.650000	0.86243	TCT		0.502	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940		Missense_Mutation
ALG10B	144245	broad.mit.edu	37	12	38714238	38714238	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr12:38714238G>T	ENST00000308742.4	+	3	961	c.645G>T	c.(643-645)aaG>aaT	p.K215N	AC117372.1_ENST00000401168.2_RNA|ALG10B_ENST00000551464.1_Intron	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	215					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)	p.K215N(1)		breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				AGCTACAAAAGAAGGAAGACA	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											114.0	118.0	116.0					12																	38714238		2203	4298	6501	37000505	SO:0001583	missense	144245			AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.645G>T	12.37:g.38714238G>T	ENSP00000310120:p.Lys215Asn		37000505	B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	37	CCDS31772.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	N	14.10	2.435919	0.43224	.	.	ENSG00000175548	ENST00000308742	T	0.57273	0.41	3.24	3.24	0.37175	.	0.048292	0.85682	D	0.000000	T	0.56978	0.2022	M	0.64170	1.965	0.80722	D	1	D	0.54772	0.968	P	0.52909	0.713	T	0.54098	-0.8344	10	0.19147	T	0.46	.	12.7485	0.57296	0.0:0.0:1.0:0.0	.	215	Q5I7T1	AG10B_HUMAN	N	215	ENSP00000310120:K215N	ENSP00000310120:K215N	K	+	3	2	ALG10B	37000505	1.000000	0.71417	0.997000	0.53966	0.690000	0.40134	2.469000	0.45110	2.115000	0.64714	0.549000	0.68633	AAG		0.383	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620		Missense_Mutation
POU6F1	5463	broad.mit.edu	37	12	51584194	51584194	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr12:51584194C>A	ENST00000389243.4	-	11	1681	c.742G>T	c.(742-744)Gct>Tct	p.A248S	POU6F1_ENST00000333640.10_Missense_Mutation_p.A248S|POU6F1_ENST00000550824.1_Missense_Mutation_p.A248S			Q14863	PO6F1_HUMAN	POU class 6 homeobox 1	248					brain development (GO:0007420)|heart development (GO:0007507)|muscle organ development (GO:0007517)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A248S(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	11						GCATTGAGAGCCTCTATGGCC	0.572																																																1	Substitution - Missense(1)	ovary(1)	12											116.0	115.0	115.0					12																	51584194		2203	4300	6503	49870461	SO:0001583	missense	5463			AL832881	CCDS31803.1	12q13.13	2011-06-20	2007-07-13			ENSG00000184271		"""Homeoboxes / POU class"""	9224	protein-coding gene	gene with protein product			"""POU domain, class 6, transcription factor 1"""			7908264	Standard	NM_002702		Approved	BRN5, MPOU, TCFB1	uc001rxz.3	Q14863		ENST00000389243.4:c.742G>T	12.37:g.51584194C>A	ENSP00000373895:p.Ala248Ser		49870461	Q15944|Q6DK47|Q7Z7P6	Missense_Mutation	SNP	ENST00000389243.4	37	CCDS31803.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270415	0.59540	.	.	ENSG00000184271	ENST00000389243;ENST00000333640;ENST00000550824	D;D;D	0.96334	-3.98;-3.98;-3.98	5.43	4.53	0.55603	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);	0.054356	0.85682	D	0.000000	D	0.92593	0.7647	N	0.25031	0.7	0.46586	D	0.999113	B	0.14805	0.011	B	0.21546	0.035	D	0.89101	0.3489	10	0.56958	D	0.05	.	14.4889	0.67637	0.1483:0.8517:0.0:0.0	.	248	Q14863	PO6F1_HUMAN	S	248	ENSP00000373895:A248S;ENSP00000330190:A248S;ENSP00000448389:A248S	ENSP00000330190:A248S	A	-	1	0	POU6F1	49870461	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	1.450000	0.35134	1.272000	0.44329	0.561000	0.74099	GCT		0.572	POU6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405126.1	NM_002702		Missense_Mutation
SLC4A8	9498	broad.mit.edu	37	12	51868222	51868222	+	Silent	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr12:51868222G>T	ENST00000453097.2	+	15	2218	c.2001G>T	c.(1999-2001)ctG>ctT	p.L667L	SLC4A8_ENST00000394856.1_Silent_p.L614L|SLC4A8_ENST00000358657.3_Silent_p.L694L|SLC4A8_ENST00000535225.2_Silent_p.L614L|SLC4A8_ENST00000514353.3_Silent_p.L614L	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8									p.L667L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		GGGCTAACCTGACTGTCAGTG	0.522																																																1	Substitution - coding silent(1)	ovary(1)	12											146.0	101.0	116.0					12																	51868222		2203	4300	6503	50154489	SO:0001819	synonymous_variant	9498			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.2001G>T	12.37:g.51868222G>T			50154489		Silent	SNP	ENST00000453097.2	37	CCDS44890.1	SNP	45	Broad																																																																																				0.522	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858		Silent
ZNF385A	25946	broad.mit.edu	37	12	54765326	54765326	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr12:54765326G>A	ENST00000338010.5	-	5	648	c.595C>T	c.(595-597)Cgg>Tgg	p.R199W	RP11-753H16.3_ENST00000550474.1_RNA|ZNF385A_ENST00000546970.1_Missense_Mutation_p.R179W|ZNF385A_ENST00000352268.6_Intron|ZNF385A_ENST00000394313.2_Missense_Mutation_p.R179W|RP11-753H16.5_ENST00000552785.1_RNA|ZNF385A_ENST00000551771.1_Intron|ZNF385A_ENST00000551109.1_Missense_Mutation_p.R179W|ZNF385A_ENST00000552382.1_5'UTR	NM_001130967.1	NP_001124439.1	Q96PM9	Z385A_HUMAN	zinc finger protein 385A	199	Necessary for binding to ITPR1, CEBPA and p53/TP53 mRNAs. {ECO:0000250}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|hemostasis (GO:0007599)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)|positive regulation of DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:1902164)|positive regulation of fat cell differentiation (GO:0045600)|regulation of cytoplasmic translation (GO:2000765)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA 3'-UTR binding (GO:0003730)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R179W(2)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(1)	15						TAGAGCAGCCGCTTGGCTTTC	0.597																																																2	Substitution - Missense(2)	ovary(2)	12											101.0	99.0	100.0					12																	54765326		2203	4300	6503	53051593	SO:0001583	missense	25946			AF304052	CCDS8879.1, CCDS44910.1, CCDS44911.1	12q13.13	2012-10-05	2007-12-06	2007-12-06		ENSG00000161642			17521	protein-coding gene	gene with protein product		609124	"""zinc finger protein 385"""	ZNF385			Standard	XM_005268785		Approved	DKFZp586G1122, Hzf, ZFP385	uc001sfy.3	Q96PM9	OTTHUMG00000169840	ENST00000338010.5:c.595C>T	12.37:g.54765326G>A	ENSP00000338927:p.Arg199Trp		53051593	B2RDN5|B4DKH2|F1T0F1|J3KNS3|Q5VH53|Q9H7R6|Q9UFU3	Missense_Mutation	SNP	ENST00000338010.5	37	CCDS44911.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213576	0.58452	.	.	ENSG00000161642	ENST00000551109;ENST00000394313;ENST00000338010;ENST00000546970;ENST00000546919;ENST00000549937;ENST00000549962	T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85;0.85	3.07	0.927	0.19437	Zinc finger, U1-type (1);	0.074595	0.52532	D	0.000069	T	0.40272	0.1110	N	0.08118	0	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;P;P	0.63488	0.915;0.824;0.824	T	0.40059	-0.9583	10	0.87932	D	0	-7.0529	8.0657	0.30659	0.0:0.0:0.4163:0.5836	.	179;179;179	F8VRY0;Q96PM9;F1T0F1	.;Z385A_HUMAN;.	W	179;179;199;179;179;207;162	ENSP00000449161:R179W;ENSP00000377849:R179W;ENSP00000338927:R199W;ENSP00000446913:R179W;ENSP00000448466:R179W;ENSP00000448567:R207W;ENSP00000450149:R162W	ENSP00000338927:R199W	R	-	1	2	ZNF385A	53051593	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.617000	0.36943	0.602000	0.29896	-0.538000	0.04264	CGG		0.597	ZNF385A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406162.1	NM_015481		Missense_Mutation
TAC3	6866	broad.mit.edu	37	12	57407449	57407449	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr12:57407449G>T	ENST00000458521.2	-	3	280	c.121C>A	c.(121-123)Cca>Aca	p.P41T	TAC3_ENST00000415231.1_Missense_Mutation_p.P41T|TAC3_ENST00000441881.1_Missense_Mutation_p.P41T	NM_013251.3	NP_037383.1	Q9UHF0	TKNK_HUMAN	tachykinin 3	41					female pregnancy (GO:0007565)|neuropeptide signaling pathway (GO:0007218)|tachykinin receptor signaling pathway (GO:0007217)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)	p.P41T(1)		cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7						TAGAGATCTGGATCCCTCTAG	0.567																																																1	Substitution - Missense(1)	ovary(1)	12											42.0	44.0	43.0					12																	57407449		2203	4300	6503	55693716	SO:0001583	missense	6866			AF186112	CCDS8928.1, CCDS53803.1	12q13-q21	2013-02-26	2008-07-31		ENSG00000166863	ENSG00000166863		"""Endogenous ligands"""	11521	protein-coding gene	gene with protein product	"""preprotachykinin-B"""	162330	"""neuromedin K"", ""neurokinin beta"""	NKNB		3479225, 10866201	Standard	NM_013251		Approved	ZNEUROK1, NKB	uc001smp.3	Q9UHF0	OTTHUMG00000156958	ENST00000458521.2:c.121C>A	12.37:g.57407449G>T	ENSP00000404056:p.Pro41Thr		55693716	Q6IAG2|Q71BC6|Q71BC9	Missense_Mutation	SNP	ENST00000458521.2	37	CCDS8928.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	2.962	-0.214450	0.06101	.	.	ENSG00000166863	ENST00000458521;ENST00000441881;ENST00000415231	D;T;D	0.82255	-1.59;-1.01;-1.59	6.02	-7.9	0.01169	.	1.881030	0.02105	N	0.054272	T	0.60573	0.2279	N	0.14661	0.345	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.11329	0.006;0.003	T	0.57412	-0.7816	10	0.10636	T	0.68	3.4784	1.4398	0.02352	0.2086:0.2378:0.3434:0.2102	.	41;41	Q9UHF0;Q9UHF0-3	TKNK_HUMAN;.	T	41	ENSP00000404056:P41T;ENSP00000408208:P41T;ENSP00000402995:P41T	ENSP00000300108:P41T	P	-	1	0	TAC3	55693716	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.519000	0.02243	-1.840000	0.01184	-1.251000	0.01509	CCA		0.567	TAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346793.1	NM_001006667		Missense_Mutation
LRP1	4035	broad.mit.edu	37	12	57587774	57587774	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr12:57587774G>A	ENST00000243077.3	+	48	8363	c.7897G>A	c.(7897-7899)Gcc>Acc	p.A2633T	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2633	LDL-receptor class A 13. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.A2633T(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TTGTGAGGACGCCTCAGATGA	0.617																																																1	Substitution - Missense(1)	ovary(1)	12											107.0	103.0	104.0					12																	57587774		2203	4300	6503	55874041	SO:0001583	missense	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.7897G>A	12.37:g.57587774G>A	ENSP00000243077:p.Ala2633Thr		55874041	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	16.78	3.216536	0.58452	.	.	ENSG00000123384	ENST00000243077	D	0.95518	-3.73	5.0	5.0	0.66597	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000002	D	0.96753	0.8940	L	0.49640	1.575	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.96704	0.9520	10	0.51188	T	0.08	.	17.231	0.86984	0.0:0.0:1.0:0.0	.	2633	Q07954	LRP1_HUMAN	T	2633	ENSP00000243077:A2633T	ENSP00000243077:A2633T	A	+	1	0	LRP1	55874041	1.000000	0.71417	0.998000	0.56505	0.355000	0.29361	5.438000	0.66550	2.586000	0.87340	0.563000	0.77884	GCC		0.617	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		Missense_Mutation
TRPV4	59341	broad.mit.edu	37	12	110240898	110240898	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr12:110240898T>A	ENST00000418703.2	-	3	704	c.610A>T	c.(610-612)Aat>Tat	p.N204Y	TRPV4_ENST00000544971.1_Missense_Mutation_p.N204Y|TRPV4_ENST00000541794.1_Missense_Mutation_p.N204Y|TRPV4_ENST00000392719.2_Missense_Mutation_p.N204Y|TRPV4_ENST00000261740.2_Missense_Mutation_p.N204Y|TRPV4_ENST00000537083.1_Missense_Mutation_p.N204Y|TRPV4_ENST00000536838.1_Missense_Mutation_p.N170Y|TRPV4_ENST00000346520.2_Missense_Mutation_p.N204Y	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	204					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)	p.N204Y(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						TTGCGGCCATTGCTCAGGTTC	0.577																																																1	Substitution - Missense(1)	ovary(1)	12											128.0	101.0	110.0					12																	110240898		2203	4300	6503	108725281	SO:0001583	missense	59341			AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.610A>T	12.37:g.110240898T>A	ENSP00000406191:p.Asn204Tyr		108725281	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	37	CCDS9134.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	10.59	1.392097	0.25118	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	D;D;D;D;D;D;D;D	0.89875	-2.55;-2.55;-2.4;-2.58;-2.41;-2.58;-2.4;-2.55	4.51	-1.05	0.10036	.	1.084340	0.06861	N	0.799043	D	0.83358	0.5237	L	0.48642	1.525	0.09310	N	1	P;P;P;P;P	0.46952	0.856;0.767;0.887;0.548;0.647	B;B;B;B;B	0.42030	0.215;0.116;0.298;0.275;0.373	T	0.72001	-0.4422	10	0.35671	T	0.21	-8.6135	5.5277	0.16967	0.0:0.1699:0.4634:0.3668	.	204;204;204;204;170	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	Y	204;204;204;204;204;204;204;170	ENSP00000406191:N204Y;ENSP00000261740:N204Y;ENSP00000376480:N204Y;ENSP00000319003:N204Y;ENSP00000443611:N204Y;ENSP00000442738:N204Y;ENSP00000442167:N204Y;ENSP00000444336:N170Y	ENSP00000261740:N204Y	N	-	1	0	TRPV4	108725281	0.000000	0.05858	0.129000	0.21949	0.488000	0.33401	0.262000	0.18460	-0.085000	0.12573	0.459000	0.35465	AAT		0.577	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625		Missense_Mutation
ACAD10	80724	broad.mit.edu	37	12	112147427	112147427	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr12:112147427T>G	ENST00000313698.4	+	5	784	c.629T>G	c.(628-630)tTt>tGt	p.F210C	ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000549590.1_Missense_Mutation_p.F210C|ACAD10_ENST00000392636.2_5'UTR|ACAD10_ENST00000455480.2_Missense_Mutation_p.F210C	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	210						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.F210C(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						GAGTCCATCTTTCTTGATGAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											79.0	79.0	79.0					12																	112147427		2203	4300	6503	110631810	SO:0001583	missense	80724			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.629T>G	12.37:g.112147427T>G	ENSP00000325137:p.Phe210Cys		110631810	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	37	CCDS31903.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	22.5	4.294235	0.81025	.	.	ENSG00000111271	ENST00000509936;ENST00000413681;ENST00000549590;ENST00000455480;ENST00000507135;ENST00000313698	T;T;T	0.09630	2.96;2.96;2.96	5.74	5.74	0.90152	Predicted HAD-superfamily phosphatase, subfamily IA/Epoxide hydrolase, N-terminal (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.64402	D	0.000004	T	0.40546	0.1121	M	0.88906	2.99	0.80722	D	1	D;D;D;D;D	0.89917	0.997;1.0;0.999;0.999;1.0	D;D;D;D;D	0.79108	0.913;0.992;0.967;0.944;0.992	T	0.47368	-0.9123	10	0.87932	D	0	.	15.6835	0.77391	0.0:0.0:0.0:1.0	.	210;210;210;210;210	G3XAJ0;F8VZG7;Q6JQN1;Q6JQN1-2;Q6JQN1-4	.;.;ACD10_HUMAN;.;.	C	210	ENSP00000446959:F210C;ENSP00000389813:F210C;ENSP00000325137:F210C	ENSP00000325137:F210C	F	+	2	0	ACAD10	110631810	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.571000	0.67404	2.185000	0.69588	0.459000	0.35465	TTT		0.478	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247		Missense_Mutation
TM9SF2	9375	broad.mit.edu	37	13	100207864	100207864	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr13:100207864C>T	ENST00000376387.4	+	15	1905	c.1715C>T	c.(1714-1716)gCa>gTa	p.A572V		NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	572					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)		p.A572V(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					TGTTCTGAAGCAACTATACTT	0.343																																																1	Substitution - Missense(1)	ovary(1)	13											253.0	216.0	229.0					13																	100207864		2202	4300	6502	99005865	SO:0001583	missense	9375			U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.1715C>T	13.37:g.100207864C>T	ENSP00000365567:p.Ala572Val		99005865	A8K399|Q2TAY5	Missense_Mutation	SNP	ENST00000376387.4	37	CCDS9493.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	19.65	3.867436	0.72065	.	.	ENSG00000125304	ENST00000376387	T	0.32272	1.46	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.15522	0.0374	N	0.03000	-0.44	0.80722	D	1	B;B	0.14012	0.009;0.004	B;B	0.12156	0.007;0.007	T	0.17137	-1.0379	10	0.09084	T	0.74	-22.5112	20.1467	0.98079	0.0:1.0:0.0:0.0	.	538;572	E9PHW5;Q99805	.;TM9S2_HUMAN	V	572	ENSP00000365567:A572V	ENSP00000365567:A572V	A	+	2	0	TM9SF2	99005865	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.729000	0.84864	2.838000	0.97847	0.655000	0.94253	GCA		0.343	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045602.3			Missense_Mutation
ZFP36L1	677	broad.mit.edu	37	14	69262890	69262890	+	5'Flank	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr14:69262890G>C	ENST00000439696.2	-	0	0				ZFP36L1_ENST00000336440.3_5'Flank|ZFP36L1_ENST00000408913.2_Missense_Mutation_p.P41R	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1						gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P41R(1)		breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GTCCCTTCGTGGGGAGGGGCG	0.657																																																1	Substitution - Missense(1)	ovary(1)	14											28.0	35.0	32.0					14																	69262890		1752	3611	5363	68332643	SO:0001631	upstream_gene_variant	400223			X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352			14.37:g.69262890G>C	Exception_encountered		68332643	Q13851	Missense_Mutation	SNP	ENST00000439696.2	37	CCDS9791.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	10.08	1.251559	0.22880	.	.	ENSG00000185650	ENST00000408913	.	.	.	2.99	0.986	0.19784	.	.	.	.	.	T	0.43166	0.1235	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39440	-0.9614	5	0.87932	D	0	.	8.7357	0.34528	0.0:0.4629:0.5371:0.0	.	.	.	.	R	41	.	ENSP00000386220:P41R	P	-	2	0	ZFP36L1	68332643	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	0.097000	0.15168	0.252000	0.21531	0.313000	0.20887	CCA		0.657	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1			Missense_Mutation
PNMA1	9240	broad.mit.edu	37	14	74179405	74179405	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr14:74179405G>T	ENST00000316836.3	-	1	1723	c.938C>A	c.(937-939)gCt>gAt	p.A313D		NM_006029.4	NP_006020.4	Q8ND90	PNMA1_HUMAN	paraneoplastic Ma antigen 1	313					inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)		p.A313D(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|urinary_tract(2)	13				BRCA - Breast invasive adenocarcinoma(234;0.00331)|KIRC - Kidney renal clear cell carcinoma(182;0.0797)		cccttccccagccccggtaag	0.617																																																1	Substitution - Missense(1)	ovary(1)	14											26.0	26.0	26.0					14																	74179405		2202	4300	6502	73249158	SO:0001583	missense	9240			AF037364	CCDS9818.1	14q24.3	2012-02-09	2012-02-09		ENSG00000176903	ENSG00000176903		"""Paraneoplastic Ma antigens"""	9158	protein-coding gene	gene with protein product		604010	"""paraneoplastic antigen MA1"""			10050892	Standard	NM_006029		Approved	MA1	uc001xor.1	Q8ND90	OTTHUMG00000169183	ENST00000316836.3:c.938C>A	14.37:g.74179405G>T	ENSP00000318914:p.Ala313Asp		73249158	A8K4L5|O95144|Q8NG07	Missense_Mutation	SNP	ENST00000316836.3	37	CCDS9818.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	14.45	2.538729	0.45176	.	.	ENSG00000176903	ENST00000316836	T	0.10005	2.92	4.59	3.7	0.42460	.	0.320800	0.22908	N	0.054169	T	0.03651	0.0104	N	0.01352	-0.895	0.37305	D	0.908856	B	0.13145	0.007	B	0.12156	0.007	T	0.36335	-0.9752	10	0.33141	T	0.24	-6.9884	9.0457	0.36345	0.0984:0.0:0.9016:0.0	.	313	Q8ND90	PNMA1_HUMAN	D	313	ENSP00000318914:A313D	ENSP00000318914:A313D	A	-	2	0	PNMA1	73249158	0.667000	0.27484	0.869000	0.34112	0.933000	0.57130	2.357000	0.44125	1.540000	0.49301	0.655000	0.94253	GCT		0.617	PNMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402774.1	NM_006029		Missense_Mutation
PTPN21	11099	broad.mit.edu	37	14	88946519	88946519	+	Missense_Mutation	SNP	G	G	T	rs146978840		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr14:88946519G>T	ENST00000556564.1	-	13	1540	c.1256C>A	c.(1255-1257)cCt>cAt	p.P419H	PTPN21_ENST00000328736.3_Missense_Mutation_p.P419H	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	419					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)	p.P419H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GGTGATGCTAGGGTTGGACGA	0.592																																																1	Substitution - Missense(1)	ovary(1)	14											112.0	66.0	81.0					14																	88946519		2203	4300	6503	88016272	SO:0001583	missense	11099			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.1256C>A	14.37:g.88946519G>T	ENSP00000452414:p.Pro419His		88016272		Missense_Mutation	SNP	ENST00000556564.1	37	CCDS9884.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185905	0.78789	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	T;T	0.73469	-0.75;-0.75	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.86012	0.5831	M	0.71581	2.175	0.52099	D	0.999949	D	0.89917	1.0	D	0.91635	0.999	D	0.85282	0.1062	10	0.45353	T	0.12	.	19.3874	0.94563	0.0:0.0:1.0:0.0	.	419	Q16825	PTN21_HUMAN	H	419	ENSP00000330276:P419H;ENSP00000452414:P419H	ENSP00000330276:P419H	P	-	2	0	PTPN21	88016272	1.000000	0.71417	0.924000	0.36721	0.820000	0.46376	8.062000	0.89475	2.590000	0.87494	0.561000	0.74099	CCT		0.592	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1			Missense_Mutation
DISP2	85455	broad.mit.edu	37	15	40661149	40661149	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr15:40661149T>C	ENST00000267889.3	+	8	2923	c.2836T>C	c.(2836-2838)Tgg>Cgg	p.W946R	RP11-64K12.4_ENST00000558421.1_RNA|LINC00594_ENST00000561261.1_lincRNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	946					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)		p.W946R(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CCGCCGTGGTTGGTTCACTAG	0.617																																																1	Substitution - Missense(1)	ovary(1)	15											77.0	79.0	78.0					15																	40661149		2203	4300	6503	38448441	SO:0001583	missense	85455			AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.2836T>C	15.37:g.40661149T>C	ENSP00000267889:p.Trp946Arg		38448441	Q6AHW3|Q9C0C1	Missense_Mutation	SNP	ENST00000267889.3	37	CCDS10056.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	17.68	3.449800	0.63290	.	.	ENSG00000140323	ENST00000267889	D	0.91996	-2.95	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.96009	0.8700	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96071	0.9046	10	0.51188	T	0.08	-14.149	15.0909	0.72192	0.0:0.0:0.0:1.0	.	946	A7MBM2	DISP2_HUMAN	R	946	ENSP00000267889:W946R	ENSP00000267889:W946R	W	+	1	0	DISP2	38448441	1.000000	0.71417	0.982000	0.44146	0.874000	0.50279	7.867000	0.87062	2.150000	0.67090	0.454000	0.30748	TGG		0.617	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510		Missense_Mutation
LDHAL6B	92483	broad.mit.edu	37	15	59499805	59499805	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr15:59499805G>C	ENST00000307144.4	+	1	764	c.666G>C	c.(664-666)ttG>ttC	p.L222F	MYO1E_ENST00000288235.4_Intron	NM_033195.2	NP_149972.1	Q9BYZ2	LDH6B_HUMAN	lactate dehydrogenase A-like 6B	222					cellular carbohydrate metabolic process (GO:0044262)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)	p.L222F(1)		endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)	10						TTCGTTTCTTGATTGGACAAA	0.438																																																1	Substitution - Missense(1)	ovary(1)	15											78.0	79.0	79.0					15																	59499805		2191	4290	6481	57287097	SO:0001583	missense	92483			AY009108	CCDS10171.1	15q21.3	2011-01-27	2004-07-27	2004-07-28	ENSG00000171989	ENSG00000171989			21481	protein-coding gene	gene with protein product			"""lactate dehydrogenase A-like 6"""	LDHAL6		15870898	Standard	NM_033195		Approved	LDHL, LDH6B	uc002agb.4	Q9BYZ2	OTTHUMG00000132714	ENST00000307144.4:c.666G>C	15.37:g.59499805G>C	ENSP00000302393:p.Leu222Phe		57287097	Q6DUY4|Q96LI2	Missense_Mutation	SNP	ENST00000307144.4	37	CCDS10171.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	12.13	1.844886	0.32606	.	.	ENSG00000171989	ENST00000307144	T	0.64085	-0.08	1.69	-2.6	0.06190	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.121275	0.32533	U	0.005972	T	0.52757	0.1754	M	0.71871	2.18	0.51767	D	0.99993	P	0.40660	0.726	B	0.41571	0.36	T	0.44360	-0.9333	10	0.49607	T	0.09	.	3.1767	0.06571	0.3105:0.0:0.4817:0.2078	.	222	Q9BYZ2	LDH6B_HUMAN	F	222	ENSP00000302393:L222F	ENSP00000302393:L222F	L	+	3	2	LDHAL6B	57287097	1.000000	0.71417	0.002000	0.10522	0.561000	0.35649	0.878000	0.28126	-0.497000	0.06641	0.305000	0.20034	TTG		0.438	LDHAL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256015.1	NM_033195		Missense_Mutation
LCTL	197021	broad.mit.edu	37	15	66850069	66850069	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr15:66850069C>T	ENST00000341509.5	-	8	1044	c.913G>A	c.(913-915)Gac>Aac	p.D305N	LCTL_ENST00000537670.1_Missense_Mutation_p.D132N	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	305					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.D305N(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCAATGTAGTCCTTCATGACT	0.502																																																1	Substitution - Missense(1)	ovary(1)	15											81.0	83.0	82.0					15																	66850069		2201	4299	6500	64637123	SO:0001583	missense	197021			AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.913G>A	15.37:g.66850069C>T	ENSP00000343490:p.Asp305Asn		64637123	B3KQY0	Missense_Mutation	SNP	ENST00000341509.5	37	CCDS10220.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	15.57	2.871528	0.51695	.	.	ENSG00000188501	ENST00000537670;ENST00000341509	T;T	0.51817	0.69;1.55	5.44	5.44	0.79542	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.335667	0.37530	N	0.002059	T	0.37758	0.1015	L	0.38175	1.15	0.54753	D	0.999988	B;B	0.14012	0.004;0.009	B;B	0.17098	0.009;0.017	T	0.14504	-1.0470	10	0.33141	T	0.24	-21.5001	11.6285	0.51160	0.0:0.91:0.0:0.09	.	132;305	B3KQY0;Q6UWM7	.;LCTL_HUMAN	N	132;305	ENSP00000445419:D132N;ENSP00000343490:D305N	ENSP00000343490:D305N	D	-	1	0	LCTL	64637123	1.000000	0.71417	0.996000	0.52242	0.761000	0.43186	3.474000	0.53129	2.558000	0.86282	0.655000	0.94253	GAC		0.502	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256921.2	NM_207338		Missense_Mutation
HYDIN	54768	broad.mit.edu	37	16	71026023	71026023	+	Silent	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr16:71026023T>C	ENST00000393567.2	-	24	3885	c.3735A>G	c.(3733-3735)gcA>gcG	p.A1245A	HYDIN_ENST00000448089.2_Silent_p.A1197A	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1245					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.A1197A(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TAACTAGGATTGCTGGTGGGC	0.458																																																1	Substitution - coding silent(1)	ovary(1)	16											42.0	43.0	43.0					16																	71026023		1840	4088	5928	69583524	SO:0001819	synonymous_variant	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.3735A>G	16.37:g.71026023T>C			69583524	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1	SNP	63	Broad																																																																																				0.458	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			Silent
CHST6	4166	broad.mit.edu	37	16	75512981	75512981	+	Missense_Mutation	SNP	T	T	A	rs72547540		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr16:75512981T>A	ENST00000332272.4	-	3	925	c.746A>T	c.(745-747)cAc>cTc	p.H249L	CHST6_ENST00000390664.2_Missense_Mutation_p.H249L|RP11-77K12.4_ENST00000530512.3_RNA	NM_021615.4	NP_067628.1	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6	249			H -> P (in MCDC1). {ECO:0000269|PubMed:14609920}.		carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)	p.H249L(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GATGCGTACGTGGCTACGGCA	0.721																																																1	Substitution - Missense(1)	ovary(1)	16	GRCh37	CM032877|CM091067	CHST6	M	rs72547540						22.0	26.0	24.0					16																	75512981		2187	4287	6474	74070482	SO:0001583	missense	4166			AF280086	CCDS10918.1	16q22	2008-02-05			ENSG00000183196	ENSG00000183196		"""Sulfotransferases, membrane-bound"""	6938	protein-coding gene	gene with protein product		605294		MCDC1		8644739, 11017086	Standard	NM_021615		Approved		uc002fef.3	Q9GZX3	OTTHUMG00000137612	ENST00000332272.4:c.746A>T	16.37:g.75512981T>A	ENSP00000328983:p.His249Leu		74070482	D3DUK3	Missense_Mutation	SNP	ENST00000332272.4	37	CCDS10918.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	19.49	3.837231	0.71373	.	.	ENSG00000183196	ENST00000332272;ENST00000390664	D;D	0.85484	-1.99;-1.99	4.62	4.62	0.57501	Sulfotransferase domain (1);	0.052898	0.85682	N	0.000000	D	0.87684	0.6239	L	0.49778	1.585	0.80722	D	1	D	0.71674	0.998	D	0.74348	0.983	D	0.84054	0.0371	10	0.11182	T	0.66	.	11.9777	0.53103	0.0:0.0:0.0:1.0	.	249	Q9GZX3	CHST6_HUMAN	L	249	ENSP00000328983:H249L;ENSP00000375079:H249L	ENSP00000328983:H249L	H	-	2	0	CHST6	74070482	1.000000	0.71417	0.999000	0.59377	0.608000	0.37181	7.892000	0.87324	1.723000	0.51488	0.482000	0.46254	CAC		0.721	CHST6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435478.1	NM_021615		Missense_Mutation
SPNS3	201305	broad.mit.edu	37	17	4337372	4337373	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr17:4337372_4337373GG>TT	ENST00000355530.2	+	1	390_391	c.110_111GG>TT	c.(109-111)tGG>tTT	p.W37F	SPNS3_ENST00000333476.2_5'UTR|SPNS3_ENST00000576069.1_3'UTR	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	37					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.W37F(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						CCCACCTCCTGGAGCCTGCCCC	0.653																																																1	Substitution - Missense(1)	ovary(1)	17																																								4284122	SO:0001583	missense	201305				CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	Exception_encountered	17.37:g.4337372_4337373delinsTT	ENSP00000347721:p.Trp37Phe		4284121	Q8IZ31	Missense_Mutation	DNP	ENST00000355530.2	37	CCDS11045.1	DNP	47	Broad																																																																																				0.653	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438793.1	NM_182538		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	17	GRCh37	CM010465|CM900211	TP53	M	rs121912651						151.0	112.0	125.0					17																	7577539		2203	4300	6503	7518264	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp		7518264	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
GGNBP2	79893	broad.mit.edu	37	17	34913149	34913149	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr17:34913149A>T	ENST00000304718.4	+	4	717	c.401A>T	c.(400-402)aAg>aTg	p.K134M		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	134					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)		p.K134M(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GATGCAAAGAAGCTTTATACA	0.398																																																1	Substitution - Missense(1)	ovary(1)	17											92.0	87.0	89.0					17																	34913149		2203	4300	6503	31987262	SO:0001583	missense	79893			AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.401A>T	17.37:g.34913149A>T	ENSP00000307617:p.Lys134Met		31987262	B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	ENST00000304718.4	37	CCDS11314.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	16.66	3.184499	0.57800	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.14	5.14	0.70334	.	0.095322	0.64402	D	0.000001	T	0.50137	0.1598	L	0.43152	1.355	0.80722	D	1	B;B	0.30605	0.287;0.073	B;B	0.27380	0.079;0.059	T	0.50659	-0.8802	9	0.42905	T	0.14	-0.1148	15.2899	0.73857	1.0:0.0:0.0:0.0	.	134;134	Q9H3C7;Q9H3C7-3	GGNB2_HUMAN;.	M	134	.	ENSP00000307617:K134M	K	+	2	0	GGNBP2	31987262	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	8.496000	0.90485	2.083000	0.62718	0.477000	0.44152	AAG		0.398	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835		Missense_Mutation
NDC80	10403	broad.mit.edu	37	18	2608740	2608740	+	Silent	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr18:2608740G>A	ENST00000261597.4	+	15	1781	c.1599G>A	c.(1597-1599)gaG>gaA	p.E533E		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	533	Interaction with NEK2 and ZWINT.|Interaction with PSMC2 and SMC1A.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.E533E(1)		NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						GTGAGCTTGAGTCCTTGGAGA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	18											119.0	111.0	114.0					18																	2608740		2203	4300	6503	2598740	SO:0001819	synonymous_variant	10403			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1599G>A	18.37:g.2608740G>A			2598740	Q6PJX2	Silent	SNP	ENST00000261597.4	37	CCDS11827.1	SNP	36	Broad																																																																																				0.428	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101		Silent
EPB41L3	23136	broad.mit.edu	37	18	5397143	5397143	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10			T	C	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr18:5397143T>C	ENST00000341928.2	-	18	3095	c.2755A>G	c.(2755-2757)Aca>Gca	p.T919A	EPB41L3_ENST00000427684.2_Missense_Mutation_p.T216A|EPB41L3_ENST00000542146.1_Missense_Mutation_p.T224A|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000400111.3_Missense_Mutation_p.T697A|EPB41L3_ENST00000342933.3_Missense_Mutation_p.T919A|EPB41L3_ENST00000540638.2_Missense_Mutation_p.T697A|EPB41L3_ENST00000544123.1_Missense_Mutation_p.T750A	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	919	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.T919A(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GCAGCGGCTGTCTCTTCCTGT	0.507																																																1	Substitution - Missense(1)	ovary(1)	18											111.0	91.0	98.0					18																	5397143		2203	4300	6503	5387143	SO:0001583	missense	23136			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2755A>G	18.37:g.5397143T>C	ENSP00000343158:p.Thr919Ala		5387143	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	0.094	-1.161774	0.01673	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.87	-0.857	0.10693	.	1.563540	0.02974	N	0.144748	T	0.15869	0.0382	N	0.02539	-0.55	0.09310	N	1	B;B;B;B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.10450	0.0;0.005;0.001;0.001;0.0;0.005;0.001;0.0	T	0.12578	-1.0542	10	0.09338	T	0.73	.	2.7623	0.05310	0.1174:0.36:0.128:0.3946	.	750;216;224;311;588;697;919;154	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	A	919;588;750;588;216;224;919;697	ENSP00000343158:T919A;ENSP00000441174:T750A;ENSP00000392195:T216A;ENSP00000442233:T224A;ENSP00000341138:T919A;ENSP00000382981:T697A	ENSP00000343158:T919A	T	-	1	0	EPB41L3	5387143	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-0.330000	0.07925	-0.364000	0.08088	0.482000	0.46254	ACA		0.507	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307		Missense_Mutation
LAMA3	3909	broad.mit.edu	37	18	21485530	21485530	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1422-01	TCGA-24-1422-10			T	A	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr18:21485530T>A	ENST00000313654.9	+	52	6901	c.6660T>A	c.(6658-6660)agT>agA	p.S2220R	LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Missense_Mutation_p.S611R|LAMA3_ENST00000587184.1_Missense_Mutation_p.S555R|LAMA3_ENST00000399516.3_Missense_Mutation_p.S2164R	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2220	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.S2220R(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					AAACCCTGAGTTCCAACAGTG	0.398																																																1	Substitution - Missense(1)	ovary(1)	18											125.0	118.0	121.0					18																	21485530		2203	4300	6503	19739528	SO:0001583	missense	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.6660T>A	18.37:g.21485530T>A	ENSP00000324532:p.Ser2220Arg		19739528	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	9.175	1.022186	0.19433	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.25579	2.31;2.31;1.79	5.0	2.58	0.30949	.	.	.	.	.	T	0.22704	0.0548	L	0.57536	1.79	0.38822	D	0.955656	D;D;B;P	0.54964	0.961;0.969;0.44;0.749	P;P;B;B	0.49752	0.541;0.621;0.169;0.282	T	0.45600	-0.9250	9	0.07175	T	0.84	.	1.3311	0.02135	0.1336:0.1629:0.2312:0.4723	.	555;611;2164;2220	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	R	2220;2164;611	ENSP00000324532:S2220R;ENSP00000382432:S2164R;ENSP00000269217:S611R	ENSP00000269217:S611R	S	+	3	2	LAMA3	19739528	0.859000	0.29813	0.994000	0.49952	0.928000	0.56348	0.194000	0.17135	0.865000	0.35603	0.533000	0.62120	AGT		0.398	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		Missense_Mutation
TRAPPC8	22878	broad.mit.edu	37	18	29432581	29432581	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr18:29432581G>C	ENST00000283351.4	-	23	3814	c.3479C>G	c.(3478-3480)gCa>gGa	p.A1160G	TRAPPC8_ENST00000582539.1_Missense_Mutation_p.A1106G	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	1160					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.A1160G(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ACATCTTATTGCCTTAAAGCA	0.308																																																1	Substitution - Missense(1)	ovary(1)	18											188.0	205.0	199.0					18																	29432581		2203	4300	6503	27686579	SO:0001583	missense	22878			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.3479C>G	18.37:g.29432581G>C	ENSP00000283351:p.Ala1160Gly		27686579	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	9.886	1.202987	0.22121	.	.	ENSG00000153339	ENST00000283351	T	0.18338	2.22	5.78	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.22513	0.0543	M	0.69823	2.125	0.80722	D	1	B	0.26363	0.147	B	0.28849	0.095	T	0.02860	-1.1101	10	0.22109	T	0.4	.	14.6026	0.68450	0.0698:0.0:0.9302:0.0	.	1160	Q9Y2L5	TPPC8_HUMAN	G	1160	ENSP00000283351:A1160G	ENSP00000283351:A1160G	A	-	2	0	TRAPPC8	27686579	1.000000	0.71417	0.978000	0.43139	0.299000	0.27559	6.795000	0.75140	1.448000	0.47680	0.585000	0.79938	GCA		0.308	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939		Missense_Mutation
FBXO15	201456	broad.mit.edu	37	18	71793283	71793283	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr18:71793283G>C	ENST00000419743.2	-	6	918	c.839C>G	c.(838-840)tCt>tGt	p.S280C	FBXO15_ENST00000269500.5_Missense_Mutation_p.S204C	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	280						SCF ubiquitin ligase complex (GO:0019005)		p.S204C(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		AATCATGGTAGATATGGTCAA	0.468																																																1	Substitution - Missense(1)	ovary(1)	18											135.0	119.0	124.0					18																	71793283		2203	4300	6503	69944263	SO:0001583	missense	201456			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.839C>G	18.37:g.71793283G>C	ENSP00000393154:p.Ser280Cys		69944263	B3KST3	Missense_Mutation	SNP	ENST00000419743.2	37	CCDS45884.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	2.033	-0.421937	0.04734	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	T;T	0.49432	0.79;0.78	5.4	3.51	0.40186	.	0.497540	0.23289	N	0.049814	T	0.61098	0.2320	M	0.76574	2.34	0.09310	N	1	D;D	0.76494	0.999;0.997	P;P	0.55667	0.781;0.751	T	0.57370	-0.7823	10	0.40728	T	0.16	-25.6906	14.7082	0.69208	0.0:0.2765:0.7235:0.0	.	280;204	B3KST3;Q8NCQ5	.;FBX15_HUMAN	C	204;280	ENSP00000269500:S204C;ENSP00000393154:S280C	ENSP00000269500:S204C	S	-	2	0	FBXO15	69944263	0.000000	0.05858	0.004000	0.12327	0.048000	0.14542	0.177000	0.16801	0.686000	0.31488	0.650000	0.86243	TCT		0.468	FBXO15-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000444223.1	NM_152676		Missense_Mutation
DIRAS1	148252	broad.mit.edu	37	19	2717666	2717666	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr19:2717666C>T	ENST00000323469.4	-	2	322	c.139G>A	c.(139-141)Gtg>Atg	p.V47M	DIRAS1_ENST00000585334.1_Missense_Mutation_p.V47M	NM_145173.3	NP_660156.1	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	47					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.V47M(1)		kidney(1)|lung(2)|ovary(2)|prostate(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCTGATCACCTGCCGGTAG	0.662																																																1	Substitution - Missense(1)	ovary(1)	19											99.0	74.0	83.0					19																	2717666		2203	4300	6503	2668666	SO:0001583	missense	148252			BC030660	CCDS12092.1	19p13.3	2014-05-09				ENSG00000176490			19127	protein-coding gene	gene with protein product		607862				12107278	Standard	NM_145173		Approved	Di-Ras1, GBTS1, RIG	uc002lwf.3	O95057		ENST00000323469.4:c.139G>A	19.37:g.2717666C>T	ENSP00000325836:p.Val47Met		2668666		Missense_Mutation	SNP	ENST00000323469.4	37	CCDS12092.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	21.9	4.217798	0.79352	.	.	ENSG00000176490	ENST00000323469	T	0.76839	-1.05	4.07	4.07	0.47477	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.82245	0.4995	L	0.42008	1.315	0.80722	D	1	D	0.71674	0.998	D	0.66351	0.943	D	0.84330	0.0521	10	0.72032	D	0.01	.	13.7485	0.62890	0.0:1.0:0.0:0.0	.	47	O95057	DIRA1_HUMAN	M	47	ENSP00000325836:V47M	ENSP00000325836:V47M	V	-	1	0	DIRAS1	2668666	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.539000	0.82063	1.813000	0.52934	0.549000	0.68633	GTG		0.662	DIRAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451350.1			Missense_Mutation
TNFSF9	8744	broad.mit.edu	37	19	6534682	6534682	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr19:6534682C>G	ENST00000245817.3	+	3	408	c.370C>G	c.(370-372)Ctg>Gtg	p.L124V		NM_003811.3	NP_003802.1	P41273	TNFL9_HUMAN	tumor necrosis factor (ligand) superfamily, member 9	124					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|myeloid dendritic cell differentiation (GO:0043011)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.L124V(1)		central_nervous_system(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	5						GACGGGGGGCCTGAGCTACAA	0.607																																																1	Substitution - Missense(1)	ovary(1)	19											54.0	54.0	54.0					19																	6534682		2184	4290	6474	6485682	SO:0001583	missense	8744			U03398	CCDS12169.1	19p13.3	2008-07-22				ENSG00000125657		"""Tumor necrosis factor (ligand) superfamily"""	11939	protein-coding gene	gene with protein product	"""receptor 4-1BB ligand"", ""homolog of mouse 4-1BB-L"""	606182				8405064, 8088337	Standard	NM_003811		Approved	4-1BB-L	uc002mfh.2	P41273		ENST00000245817.3:c.370C>G	19.37:g.6534682C>G	ENSP00000245817:p.Leu124Val		6485682	Q2M3S2	Missense_Mutation	SNP	ENST00000245817.3	37	CCDS12169.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	c	12.08	1.830426	0.32329	.	.	ENSG00000125657	ENST00000245817	D	0.94497	-3.44	3.91	-2.78	0.05859	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.684983	0.11993	N	0.509655	D	0.84633	0.5515	N	0.21583	0.68	0.09310	N	1	B	0.16166	0.016	B	0.15052	0.012	T	0.71842	-0.4470	10	0.33940	T	0.23	-7.1748	0.5231	0.00615	0.174:0.2862:0.188:0.3518	.	124	P41273	TNFL9_HUMAN	V	124	ENSP00000245817:L124V	ENSP00000245817:L124V	L	+	1	2	TNFSF9	6485682	0.007000	0.16637	0.017000	0.16124	0.047000	0.14425	-0.506000	0.06359	-0.024000	0.13941	0.466000	0.42574	CTG		0.607	TNFSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457856.1	NM_003811		Missense_Mutation
RAB11B	9230	broad.mit.edu	37	19	8467134	8467134	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr19:8467134T>C	ENST00000328024.6	+	3	619	c.401T>C	c.(400-402)gTg>gCg	p.V134A	RAB11B_ENST00000601897.1_Missense_Mutation_p.V15A|RAB11B_ENST00000594216.1_Missense_Mutation_p.V134A	NM_004218.3	NP_004209.2	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family	134					cellular response to acidic pH (GO:0071468)|constitutive secretory pathway (GO:0045054)|establishment of protein localization to membrane (GO:0090150)|GTP catabolic process (GO:0006184)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|melanosome transport (GO:0032402)|receptor recycling (GO:0001881)|regulated secretory pathway (GO:0045055)|regulation of anion transport (GO:0044070)|regulation of endocytic recycling (GO:2001135)|regulation of protein localization to cell surface (GO:2000008)|retrograde transport, endosome to plasma membrane (GO:1990126)|small GTPase mediated signal transduction (GO:0007264)|transferrin transport (GO:0033572)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)|synaptic vesicle (GO:0008021)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.V134A(1)		large_intestine(2)|lung(1)|ovary(1)	4						CTGCGGGCTGTGCCCACTGAC	0.652																																																1	Substitution - Missense(1)	ovary(1)	19											39.0	23.0	29.0					19																	8467134		2188	4281	6469	8373134	SO:0001583	missense	9230			X79780	CCDS12201.1	19p13.2	2012-07-02			ENSG00000185236	ENSG00000185236		"""RAB, member RAS oncogene"""	9761	protein-coding gene	gene with protein product		604198				7811277	Standard	NM_004218		Approved	H-YPT3	uc002mju.4	Q15907		ENST00000328024.6:c.401T>C	19.37:g.8467134T>C	ENSP00000333547:p.Val134Ala		8373134	A5YM50|B2R7I4|B4DMK0|D6W671|Q2YDT2|Q5U0I1|Q6FHR0|Q6FI42|Q8NI07	Missense_Mutation	SNP	ENST00000328024.6	37	CCDS12201.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	19.15	3.771889	0.69992	.	.	ENSG00000185236	ENST00000328024	D	0.83837	-1.77	4.6	1.11	0.20524	Small GTP-binding protein domain (1);	0.122879	0.56097	D	0.000035	D	0.90431	0.7004	M	0.91872	3.25	0.53688	D	0.999976	D;D	0.89917	0.999;1.0	D;D	0.81914	0.995;0.983	D	0.87427	0.2386	10	0.87932	D	0	.	6.1787	0.20459	0.2793:0.0:0.1455:0.5752	.	134;134	B4DMK0;Q15907	.;RB11B_HUMAN	A	134	ENSP00000333547:V134A	ENSP00000333547:V134A	V	+	2	0	RAB11B	8373134	1.000000	0.71417	0.772000	0.31596	0.711000	0.40976	7.868000	0.87116	0.007000	0.14760	0.402000	0.26972	GTG		0.652	RAB11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460343.2	NM_004218		Missense_Mutation
MUC16	94025	broad.mit.edu	37	19	9011463	9011463	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10			C	T	C	C	Unknown	Valid	Somatic	x	x	454_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr19:9011463C>T	ENST00000397910.4	-	36	38973	c.38770G>A	c.(38770-38772)Gat>Aat	p.D12924N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12926	SEA 6. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.D76N(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGATGGCATCCATTCCAGTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	19											148.0	132.0	137.0					19																	9011463		1928	4133	6061	8872463	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38770G>A	19.37:g.9011463C>T	ENSP00000381008:p.Asp12924Asn		8872463	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	.	14.57	2.574738	0.45902	.	.	ENSG00000181143	ENST00000397910;ENST00000441155	T	0.35048	1.33	2.94	2.94	0.34122	.	.	.	.	.	T	0.62816	0.2459	M	0.89658	3.05	.	.	.	D	0.71674	0.998	D	0.72338	0.977	T	0.75895	-0.3156	8	0.87932	D	0	-14.2633	9.9835	0.41828	0.0:1.0:0.0:0.0	.	12924	B5ME49	.	N	12924;77	ENSP00000381008:D12924N	ENSP00000381008:D12924N	D	-	1	0	MUC16	8872463	0.384000	0.25164	0.034000	0.17996	0.025000	0.11179	1.980000	0.40618	1.589000	0.49982	0.305000	0.20034	GAT		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Missense_Mutation
RDH8	50700	broad.mit.edu	37	19	10124252	10124252	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr19:10124252C>G	ENST00000171214.1	+	1	328	c.79C>G	c.(79-81)Cat>Gat	p.H27D	RDH8_ENST00000591589.1_Missense_Mutation_p.H47D	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	27					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)	p.H27D(1)		endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	GCAACTGGCCCATGACCCCAA	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											87.0	80.0	82.0					19																	10124252		2203	4300	6503	9985252	SO:0001583	missense	50700			AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.79C>G	19.37:g.10124252C>G	ENSP00000171214:p.His27Asp		9985252	Q9H838	Missense_Mutation	SNP	ENST00000171214.1	37		SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	10.24	1.296838	0.23650	.	.	ENSG00000080511	ENST00000171214	D	0.92495	-3.05	4.93	3.82	0.43975	NAD(P)-binding domain (1);	0.558425	0.17597	N	0.168560	T	0.76608	0.4011	N	0.01656	-0.775	0.25398	N	0.988469	B	0.14805	0.011	B	0.21360	0.034	T	0.63915	-0.6529	10	0.15499	T	0.54	.	9.7545	0.40496	0.3331:0.6669:0.0:0.0	.	27	Q9NYR8	RDH8_HUMAN	D	27	ENSP00000171214:H27D	ENSP00000171214:H27D	H	+	1	0	RDH8	9985252	0.005000	0.15991	0.875000	0.34327	0.774000	0.43823	1.893000	0.39758	2.283000	0.76528	0.591000	0.81541	CAT		0.612	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				Missense_Mutation
PDCD2L	84306	broad.mit.edu	37	19	34900210	34900210	+	Missense_Mutation	SNP	C	C	G	rs61740326	byFrequency	TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr19:34900210C>G	ENST00000246535.3	+	4	528	c.481C>G	c.(481-483)Cgg>Ggg	p.R161G	PDCD2L_ENST00000587065.2_Intron	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	161					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.R161G(1)		breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			CTGGACTGCTCGGCTCCAAGA	0.572																																																1	Substitution - Missense(1)	ovary(1)	19											124.0	110.0	115.0					19																	34900210		2203	4300	6503	39592050	SO:0001583	missense	84306			BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.481C>G	19.37:g.34900210C>G	ENSP00000246535:p.Arg161Gly		39592050		Missense_Mutation	SNP	ENST00000246535.3	37	CCDS12438.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	14.30	2.493766	0.44352	.	.	ENSG00000126249	ENST00000246535	.	.	.	5.8	3.62	0.41486	.	0.463430	0.26677	N	0.023076	T	0.18800	0.0451	N	0.14661	0.345	0.23628	N	0.997251	B	0.29612	0.251	B	0.28465	0.09	T	0.15521	-1.0434	9	0.20046	T	0.44	-6.0154	8.4839	0.33061	0.1557:0.7642:0.0:0.0801	.	161	Q9BRP1	PDD2L_HUMAN	G	161	.	ENSP00000246535:R161G	R	+	1	2	PDCD2L	39592050	0.937000	0.31787	0.751000	0.31187	0.012000	0.07955	1.908000	0.39907	1.397000	0.46682	0.650000	0.86243	CGG		0.572	PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459251.3	NM_032346		Missense_Mutation
NLRP5	126206	broad.mit.edu	37	19	56569776	56569776	+	Splice_Site	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr19:56569776G>T	ENST00000390649.3	+	14	3470	c.3470G>T	c.(3469-3471)gGg>gTg	p.G1157V		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	1157					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.G1157V(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CAGATAATTGGGTAAGTCGCC	0.468																																																1	Substitution - Missense(1)	ovary(1)	19											46.0	46.0	46.0					19																	56569776		2000	4171	6171	61261588	SO:0001630	splice_region_variant	126206			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.3470+1G>T	19.37:g.56569776G>T			61261588	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079807	0.55753	.	.	ENSG00000171487	ENST00000390649	T	0.53206	0.63	2.96	2.96	0.34315	.	.	.	.	.	T	0.70413	0.3221	M	0.90082	3.085	0.54753	D	0.999987	D	0.89917	1.0	D	0.83275	0.996	T	0.75102	-0.3436	9	0.72032	D	0.01	.	9.6355	0.39804	0.0:0.0:1.0:0.0	.	1157	P59047	NALP5_HUMAN	V	1157	ENSP00000375063:G1157V	ENSP00000375063:G1157V	G	+	2	0	NLRP5	61261588	0.954000	0.32549	0.887000	0.34795	0.232000	0.25224	0.934000	0.28910	1.980000	0.57719	0.591000	0.81541	GGG		0.468	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	Missense_Mutation	Missense_Mutation
TRAPPC12	51112	broad.mit.edu	37	2	3391550	3391550	+	Silent	SNP	G	G	A	rs145615349	byFrequency	TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:3391550G>A	ENST00000324266.5	+	2	351	c.156G>A	c.(154-156)tcG>tcA	p.S52S	TRAPPC12_ENST00000382110.2_Silent_p.S52S	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	52					vesicle-mediated transport (GO:0016192)			p.S52S(1)									AGACCGCATCGGAAGGCTCGA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	2						G		0,4406		0,0,2203	54.0	47.0	49.0		156	-6.8	0.2	2	dbSNP_134	49	5,8593	4.3+/-15.6	0,5,4294	no	coding-synonymous	TTC15	NM_016030.5		0,5,6497	AA,AG,GG		0.0582,0.0,0.0384		52/736	3391550	5,12999	2203	4299	6502	3370557	SO:0001819	synonymous_variant	51112			BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.156G>A	2.37:g.3391550G>A			3370557	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Silent	SNP	ENST00000324266.5	37	CCDS1652.1	SNP	39	Broad																																																																																				0.612	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030		Silent
LCLAT1	253558	broad.mit.edu	37	2	30682501	30682501	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10			T	C	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:30682501T>C	ENST00000309052.4	+	2	232	c.23T>C	c.(22-24)aTt>aCt	p.I8T	LCLAT1_ENST00000319406.4_Missense_Mutation_p.I8T|LCLAT1_ENST00000491680.2_Intron|LCLAT1_ENST00000359433.1_Missense_Mutation_p.I8T|LCLAT1_ENST00000379509.3_Intron|LCLAT1_ENST00000540623.1_5'UTR	NM_182551.3	NP_872357.2	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1	8					cardiolipin acyl-chain remodeling (GO:0035965)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|multicellular organismal development (GO:0007275)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.I8T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)	19						GGAAGGGAAATTGTGGTGCTT	0.438																																																1	Substitution - Missense(1)	ovary(1)	2											284.0	274.0	277.0					2																	30682501		2203	4300	6503	30536005	SO:0001583	missense	253558			AK095284	CCDS1772.1, CCDS42670.1	2p23.1	2008-12-15	2008-12-15	2008-12-15	ENSG00000172954	ENSG00000172954			26756	protein-coding gene	gene with protein product		614241	"""lysocardiolipin acyltransferase"""	LYCAT		18931347, 15152008, 16620771, 17675553	Standard	NM_001002257		Approved	FLJ37965, ALCAT1, AGPAT8	uc002rnl.3	Q6UWP7	OTTHUMG00000099349	ENST00000309052.4:c.23T>C	2.37:g.30682501T>C	ENSP00000310551:p.Ile8Thr		30536005	A6H8Z7|Q8N1Q7	Missense_Mutation	SNP	ENST00000309052.4	37	CCDS1772.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	6.173	0.400154	0.11696	.	.	ENSG00000172954	ENST00000319406;ENST00000309052;ENST00000359433;ENST00000497423	T;T;T	0.54071	0.59;1.36;0.59	3.15	-2.63	0.06133	.	24.407300	0.00664	U	0.000601	T	0.33381	0.0861	N	0.08118	0	0.09310	N	0.999999	B;B	0.10296	0.003;0.0	B;B	0.08055	0.003;0.0	T	0.37842	-0.9688	10	0.87932	D	0	0.1381	7.9102	0.29787	0.0:0.5377:0.0:0.4623	.	8;8	Q6UWP7-2;Q6UWP7	.;LCLT1_HUMAN	T	8	ENSP00000368826:I8T;ENSP00000310551:I8T;ENSP00000352406:I8T	ENSP00000310551:I8T	I	+	2	0	LCLAT1	30536005	0.149000	0.22717	0.000000	0.03702	0.004000	0.04260	-0.219000	0.09228	-0.550000	0.06183	0.459000	0.35465	ATT		0.438	LCLAT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000216780.1	NM_182551		Missense_Mutation
SNRNP200	23020	broad.mit.edu	37	2	96965080	96965080	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:96965080G>A	ENST00000323853.5	-	6	793	c.716C>T	c.(715-717)aCc>aTc	p.T239I	SNRNP200_ENST00000349783.5_Missense_Mutation_p.T239I	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	239					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.T239I(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						AGCCGAGAGGGTGCAGCGCAC	0.502																																																1	Substitution - Missense(1)	ovary(1)	2											262.0	235.0	244.0					2																	96965080		2203	4300	6503	96328807	SO:0001583	missense	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.716C>T	2.37:g.96965080G>A	ENSP00000317123:p.Thr239Ile		96328807	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	16.09	3.024167	0.54683	.	.	ENSG00000144028	ENST00000323853;ENST00000349783	T;T	0.44881	0.91;0.91	5.07	5.07	0.68467	.	0.101209	0.64402	D	0.000003	T	0.40979	0.1139	L	0.53249	1.67	0.58432	D	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.17930	-1.0353	10	0.30078	T	0.28	-18.0189	17.375	0.87390	0.0:0.0:1.0:0.0	.	239	O75643	U520_HUMAN	I	239	ENSP00000317123:T239I;ENSP00000326937:T239I	ENSP00000317123:T239I	T	-	2	0	SNRNP200	96328807	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.242000	0.78210	2.629000	0.89072	0.555000	0.69702	ACC		0.502	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014		Missense_Mutation
SEMA4C	54910	broad.mit.edu	37	2	97526942	97526942	+	Nonsense_Mutation	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:97526942G>C	ENST00000305476.5	-	15	2055	c.1923C>G	c.(1921-1923)taC>taG	p.Y641*		NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	641	Ig-like C2-type.				cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)	p.Y641*(1)		NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						CAGCCACAAGGTAGCCTTCAG	0.711																																																1	Substitution - Nonsense(1)	ovary(1)	2											20.0	27.0	25.0					2																	97526942		2182	4262	6444	96890669	SO:0001587	stop_gained	54910			AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.1923C>G	2.37:g.97526942G>C	ENSP00000306844:p.Tyr641*		96890669	Q32MJ3|Q7Z5X0	Nonsense_Mutation	SNP	ENST00000305476.5	37	CCDS2029.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	37	6.573270	0.97676	.	.	ENSG00000168758	ENST00000305476	.	.	.	4.69	4.69	0.59074	.	0.652897	0.15769	N	0.245537	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.5234	0.84322	0.0:0.0:1.0:0.0	.	.	.	.	X	641	.	ENSP00000306844:Y641X	Y	-	3	2	SEMA4C	96890669	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.745000	0.68672	2.417000	0.82017	0.561000	0.74099	TAC		0.711	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252957.1	NM_017789		Nonsense_Mutation
PLEKHB2	55041	broad.mit.edu	37	2	131884288	131884288	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:131884288C>G	ENST00000403716.1	+	4	782	c.222C>G	c.(220-222)gaC>gaG	p.D74E	PLEKHB2_ENST00000234115.6_Missense_Mutation_p.D74E|PLEKHB2_ENST00000404460.1_Missense_Mutation_p.D74E|PLEKHB2_ENST00000439822.2_Missense_Mutation_p.D74E|PLEKHB2_ENST00000303908.3_Missense_Mutation_p.D74E|PLEKHB2_ENST00000409158.1_Missense_Mutation_p.D74E|PLEKHB2_ENST00000409279.1_Missense_Mutation_p.D74E|PLEKHB2_ENST00000438882.2_Missense_Mutation_p.D74E|PLEKHB2_ENST00000538982.1_Missense_Mutation_p.D26E|PLEKHB2_ENST00000409612.1_Missense_Mutation_p.D74E	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	74	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					endosome (GO:0005768)|membrane (GO:0016020)		p.D74E(1)		large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		AGTCAAAAGACTGCATGCTCC	0.358																																																1	Substitution - Missense(1)	ovary(1)	2											103.0	102.0	103.0					2																	131884288		2203	4300	6503	131600758	SO:0001583	missense	55041				CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.222C>G	2.37:g.131884288C>G	ENSP00000385892:p.Asp74Glu		131600758	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Missense_Mutation	SNP	ENST00000403716.1	37	CCDS46413.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	11.78	1.740986	0.30865	.	.	ENSG00000115762	ENST00000409158;ENST00000403716;ENST00000234115;ENST00000439822;ENST00000438882;ENST00000538982;ENST00000404460;ENST00000409612;ENST00000409279;ENST00000303908	T;T;T;T;T;T;T;T;T;T	0.29655	2.78;2.78;2.78;2.78;2.78;1.56;2.78;2.78;2.78;2.78	4.58	1.67	0.24075	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.121856	0.52532	N	0.000063	T	0.14227	0.0344	N	0.16862	0.45	0.44660	D	0.997645	P;B;B;B;B;B;B	0.41978	0.767;0.046;0.002;0.002;0.196;0.002;0.002	B;B;B;B;B;B;B	0.38683	0.279;0.036;0.005;0.003;0.04;0.005;0.008	T	0.09729	-1.0661	10	0.29301	T	0.29	-17.4179	3.861	0.08996	0.3373:0.4797:0.0:0.183	.	74;74;74;74;74;74;74	B4DZ66;B4DF08;Q53FF1;Q96CS7-3;B7WPA5;Q96CS7;B8ZZN1	.;.;.;.;.;PKHB2_HUMAN;.	E	74;74;74;74;74;26;74;74;74;74	ENSP00000386410:D74E;ENSP00000385892:D74E;ENSP00000234115:D74E;ENSP00000389629:D74E;ENSP00000401193:D74E;ENSP00000444389:D26E;ENSP00000385609:D74E;ENSP00000386662:D74E;ENSP00000386666:D74E;ENSP00000306852:D74E	ENSP00000234115:D74E	D	+	3	2	PLEKHB2	131600758	0.711000	0.27906	0.999000	0.59377	0.957000	0.61999	-0.087000	0.11215	0.095000	0.17434	-0.253000	0.11424	GAC		0.358	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331304.2	NM_017958		Missense_Mutation
UBR3	130507	broad.mit.edu	37	2	170871846	170871846	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:170871846G>T	ENST00000272793.5	+	30	4473	c.4423G>T	c.(4423-4425)Gca>Tca	p.A1475S	UBR3_ENST00000465630.1_3'UTR|UBR3_ENST00000392631.1_Missense_Mutation_p.A296S|UBR3_ENST00000418381.1_Missense_Mutation_p.A1475S			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1475					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A328S(1)|p.A1475S(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						TTCAGGTGGTGCAAGCACAGC	0.333																																																2	Substitution - Missense(2)	ovary(2)	2											92.0	95.0	94.0					2																	170871846		2203	4300	6503	170580092	SO:0001583	missense	130507			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.4423G>T	2.37:g.170871846G>T	ENSP00000272793:p.Ala1475Ser		170580092	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	ENST00000272793.5	37		SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	13.96	2.391930	0.42410	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381;ENST00000392631;ENST00000439681	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.93	5.05	0.67936	.	0.093722	0.64402	D	0.000001	T	0.35595	0.0937	L	0.38175	1.15	0.37565	D	0.919208	B;B;B	0.28900	0.208;0.011;0.227	B;B;B	0.24269	0.052;0.021;0.036	T	0.30297	-0.9983	10	0.06365	T	0.9	.	17.0631	0.86552	0.0:0.1268:0.8732:0.0	.	1475;296;1475	Q6ZT12;Q6ZT12-2;E7EVK3	UBR3_HUMAN;.;.	S	1475;1475;1475;296;146	ENSP00000272793:A1475S;ENSP00000396068:A1475S;ENSP00000376408:A296S;ENSP00000389097:A146S	ENSP00000272793:A1475S	A	+	1	0	UBR3	170580092	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.963000	0.70372	1.484000	0.48361	0.655000	0.94253	GCA		0.333	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070		Missense_Mutation
SCRN3	79634	broad.mit.edu	37	2	175269043	175269043	+	Splice_Site	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:175269043G>C	ENST00000272732.6	+	5	836	c.754G>C	c.(754-756)Gga>Cga	p.G252R	SCRN3_ENST00000409673.3_Splice_Site_p.G245R	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	252							dipeptidase activity (GO:0016805)	p.G252R(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			TAAGCACAAAGGTAATTTTAT	0.328																																																1	Substitution - Missense(1)	ovary(1)	2											49.0	46.0	47.0					2																	175269043		2203	4300	6503	174977289	SO:0001630	splice_region_variant	79634			AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.754+1G>C	2.37:g.175269043G>C			174977289	B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Missense_Mutation	SNP	ENST00000272732.6	37	CCDS2258.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.074685	0.94000	.	.	ENSG00000144306	ENST00000409673;ENST00000272732	T;T	0.10099	2.91;2.92	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.31231	0.0790	L	0.49699	1.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00351	-1.1796	10	0.72032	D	0.01	-17.7213	20.088	0.97803	0.0:0.0:1.0:0.0	.	245;252	B4DI11;Q0VDG4	.;SCRN3_HUMAN	R	245;252	ENSP00000387142:G245R;ENSP00000272732:G252R	ENSP00000272732:G252R	G	+	1	0	SCRN3	174977289	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.808000	0.99193	2.739000	0.93911	0.655000	0.94253	GGA		0.328	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255451.2	NM_024583	Missense_Mutation	Missense_Mutation
FAM171B	165215	broad.mit.edu	37	2	187558977	187558977	+	Missense_Mutation	SNP	T	T	G	rs199591394		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:187558977T>G	ENST00000304698.5	+	1	280	c.77T>G	c.(76-78)gTc>gGc	p.V26G	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	26						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GCGCGGCTGGTCCCCGCGGCC	0.672																																																0			2											11.0	14.0	13.0					2																	187558977		2165	4239	6404	187267222	SO:0001583	missense	165215			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.77T>G	2.37:g.187558977T>G	ENSP00000304108:p.Val26Gly		187267222	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	37	CCDS33347.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	16.88	3.244104	0.59103	.	.	ENSG00000144369	ENST00000304698;ENST00000272804	T	0.51574	0.7	3.92	3.92	0.45320	.	0.493190	0.15136	N	0.278548	T	0.46521	0.1397	N	0.14661	0.345	0.51012	D	0.9999	D	0.54601	0.967	D	0.64595	0.927	T	0.35151	-0.9800	10	0.38643	T	0.18	-7.1756	9.1356	0.36872	0.0:0.0:0.0:1.0	.	26	Q6P995	F171B_HUMAN	G	26	ENSP00000304108:V26G	ENSP00000272804:V26G	V	+	2	0	FAM171B	187267222	0.937000	0.31787	1.000000	0.80357	0.303000	0.27691	1.432000	0.34936	1.637000	0.50538	0.472000	0.43445	GTC		0.672	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454		Missense_Mutation
MDH1B	130752	broad.mit.edu	37	2	207622058	207622058	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:207622058C>G	ENST00000374412.3	-	3	448	c.173G>C	c.(172-174)aGt>aCt	p.S58T	MDH1B_ENST00000454776.2_Missense_Mutation_p.S58T|MDH1B_ENST00000449792.1_5'UTR|MDH1B_ENST00000392214.2_Missense_Mutation_p.S58T	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	58					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)	p.S58T(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		ATTCTTGTGACTCCACTTATT	0.403																																					Pancreas(76;29 1355 28675 37177 51207)											1	Substitution - Missense(1)	ovary(1)	2											129.0	125.0	126.0					2																	207622058		2203	4300	6503	207330303	SO:0001583	missense	130752				CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.173G>C	2.37:g.207622058C>G	ENSP00000363533:p.Ser58Thr		207330303	A8K8M1|Q53TK9|Q8IV51	Missense_Mutation	SNP	ENST00000374412.3	37	CCDS33365.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	7.301	0.613081	0.14066	.	.	ENSG00000138400	ENST00000374412;ENST00000454776;ENST00000392214	T;T;T	0.59772	0.24;0.24;0.24	5.84	-1.96	0.07525	.	0.458064	0.27768	N	0.017931	T	0.50480	0.1618	L	0.54323	1.7	0.09310	N	1	B;B	0.27117	0.168;0.105	B;B	0.32805	0.153;0.073	T	0.44877	-0.9299	10	0.35671	T	0.21	-8.3725	13.1504	0.59486	0.0:0.3697:0.0:0.6303	.	58;58	Q5I0G3-2;Q5I0G3	.;MDH1B_HUMAN	T	58	ENSP00000363533:S58T;ENSP00000389916:S58T;ENSP00000376049:S58T	ENSP00000363533:S58T	S	-	2	0	MDH1B	207330303	0.031000	0.19500	0.074000	0.20217	0.524000	0.34500	0.126000	0.15769	-0.768000	0.04626	-0.136000	0.14681	AGT		0.403	MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256429.2	NM_001039845		Missense_Mutation
FASTKD2	22868	broad.mit.edu	37	2	207636671	207636671	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:207636671G>A	ENST00000236980.6	+	5	1392	c.1044G>A	c.(1042-1044)atG>atA	p.M348I	FASTKD2_ENST00000403094.3_Missense_Mutation_p.M348I|FASTKD2_ENST00000402774.3_Missense_Mutation_p.M348I	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	348					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.M348I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		GCCAACACATGTTTGAAGTAC	0.338																																																1	Substitution - Missense(1)	ovary(1)	2											112.0	116.0	115.0					2																	207636671		2203	4300	6503	207344916	SO:0001583	missense	22868			BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.1044G>A	2.37:g.207636671G>A	ENSP00000236980:p.Met348Ile		207344916	Q9NVX6|Q9Y2H7	Missense_Mutation	SNP	ENST00000236980.6	37	CCDS2371.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650460	0.47362	.	.	ENSG00000118246	ENST00000236980;ENST00000402774;ENST00000403094	T;T;T	0.13901	2.55;2.55;2.55	5.59	5.59	0.84812	.	0.093584	0.64402	N	0.000001	T	0.18173	0.0436	M	0.74881	2.28	0.37513	D	0.917221	P;B	0.45715	0.865;0.376	B;B	0.42555	0.391;0.141	T	0.10042	-1.0647	10	0.08179	T	0.78	-29.2224	13.9975	0.64411	0.0:0.0:0.8479:0.1521	.	348;348	Q9NYY8-2;Q9NYY8	.;FAKD2_HUMAN	I	348	ENSP00000236980:M348I;ENSP00000385990:M348I;ENSP00000384929:M348I	ENSP00000236980:M348I	M	+	3	0	FASTKD2	207344916	1.000000	0.71417	1.000000	0.80357	0.543000	0.35085	5.585000	0.67497	2.638000	0.89438	0.460000	0.39030	ATG		0.338	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256428.2	NM_014929		Missense_Mutation
DNER	92737	broad.mit.edu	37	2	230231640	230231640	+	Missense_Mutation	SNP	C	C	T	rs530602445		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:230231640C>T	ENST00000341772.4	-	12	2185	c.2051G>A	c.(2050-2052)cGc>cAc	p.R684H		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	684					central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)	p.R684H(1)		NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		GTCGATGCTGCGGCAGTTGTA	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		18281	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	2											65.0	61.0	62.0					2																	230231640		2203	4300	6503	229939884	SO:0001583	missense	92737			AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.2051G>A	2.37:g.230231640C>T	ENSP00000345229:p.Arg684His		229939884	A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Missense_Mutation	SNP	ENST00000341772.4	37	CCDS33390.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.546715	0.96488	.	.	ENSG00000187957	ENST00000341772;ENST00000543700	D	0.86627	-2.15	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.89808	0.6822	N	0.24115	0.695	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.89432	0.3717	10	0.45353	T	0.12	.	20.3382	0.98754	0.0:1.0:0.0:0.0	.	684	Q8NFT8	DNER_HUMAN	H	684;402	ENSP00000345229:R684H	ENSP00000345229:R684H	R	-	2	0	DNER	229939884	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.397000	0.79903	2.817000	0.96982	0.551000	0.68910	CGC		0.557	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1	NM_139072		Missense_Mutation
TRIP12	9320	broad.mit.edu	37	2	230657764	230657764	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:230657764G>C	ENST00000283943.5	-	26	4019	c.3841C>G	c.(3841-3843)Cag>Gag	p.Q1281E	TRIP12_ENST00000389044.4_Missense_Mutation_p.Q1329E|TRIP12_ENST00000389045.3_Missense_Mutation_p.Q1011E	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1281					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.Q1281E(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CCCTTCCACTGCTTCACATTT	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											126.0	120.0	122.0					2																	230657764		2203	4300	6503	230366008	SO:0001583	missense	9320			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.3841C>G	2.37:g.230657764G>C	ENSP00000283943:p.Gln1281Glu		230366008	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	22.4	4.291624	0.80914	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.53423	0.64;1.02;0.62	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.57562	0.2062	L	0.41415	1.275	0.80722	D	1	P;P;P	0.45715	0.713;0.865;0.713	P;P;P	0.54706	0.68;0.759;0.68	T	0.55792	-0.8085	10	0.52906	T	0.07	.	19.6261	0.95678	0.0:0.0:1.0:0.0	.	1011;1329;1281	Q14CF1;Q14CA3;Q14669	.;.;TRIPC_HUMAN	E	1281;1011;1329	ENSP00000283943:Q1281E;ENSP00000373697:Q1011E;ENSP00000373696:Q1329E	ENSP00000283943:Q1281E	Q	-	1	0	TRIP12	230366008	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.431000	0.97494	2.615000	0.88500	0.650000	0.86243	CAG		0.418	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238		Missense_Mutation
RBM44	375316	broad.mit.edu	37	2	238732966	238732966	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr2:238732966T>C	ENST00000409864.1	+	10	2610	c.2356T>C	c.(2356-2358)Tgg>Cgg	p.W786R	RBM44_ENST00000316997.4_Missense_Mutation_p.W786R			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	785						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)	p.W786R(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		AAGCGAAGACTGGTCTGATGC	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											124.0	126.0	125.0					2																	238732966		1978	4162	6140	238397705	SO:0001583	missense	375316			AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.2356T>C	2.37:g.238732966T>C	ENSP00000386727:p.Trp786Arg		238397705	A0AUW3	Missense_Mutation	SNP	ENST00000409864.1	37	CCDS46554.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	18.14	3.557616	0.65425	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.61274	0.12;0.12	5.32	5.32	0.75619	.	.	.	.	.	T	0.74566	0.3733	M	0.76574	2.34	0.38993	D	0.959187	D	0.89917	1.0	D	0.85130	0.997	T	0.79509	-0.1774	9	0.87932	D	0	-4.9625	12.6551	0.56784	0.0:0.0:0.0:1.0	.	785	Q6ZP01	RBM44_HUMAN	R	786	ENSP00000321179:W786R;ENSP00000386727:W786R	ENSP00000321179:W786R	W	+	1	0	RBM44	238397705	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	4.498000	0.60373	2.018000	0.59344	0.528000	0.53228	TGG		0.443	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504		Missense_Mutation
GGT7	2686	broad.mit.edu	37	20	33442336	33442336	+	Silent	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr20:33442336G>A	ENST00000336431.5	-	10	1361	c.1317C>T	c.(1315-1317)ctC>ctT	p.L439L	GGT7_ENST00000469018.1_5'Flank	NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	439					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.L439L(1)		NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						AGACCCACCTGAGCATGTCAT	0.532																																																1	Substitution - coding silent(1)	ovary(1)	20											50.0	42.0	45.0					20																	33442336		2203	4300	6503	32905997	SO:0001819	synonymous_variant	2686			AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.1317C>T	20.37:g.33442336G>A			32905997	Q8N899|Q8NF66|Q9BYP5|Q9BYP6	Silent	SNP	ENST00000336431.5	37	CCDS13242.2	SNP	45	Broad																																																																																				0.532	GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078816.2	NM_178026		Silent
FAM83C	128876	broad.mit.edu	37	20	33874560	33874560	+	Silent	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr20:33874560G>T	ENST00000374408.3	-	4	2118	c.2022C>A	c.(2020-2022)acC>acA	p.T674T	EIF6_ENST00000374443.3_5'Flank|EIF6_ENST00000462894.1_5'Flank|EIF6_ENST00000374450.3_5'Flank|EIF6_ENST00000374436.3_5'Flank|FAM83C-AS1_ENST00000429167.1_RNA	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	674								p.T674T(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			TGTGGCCCAGGGTTAGCCGTT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	20											66.0	59.0	61.0					20																	33874560		2203	4300	6503	33337974	SO:0001819	synonymous_variant	128876			AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.2022C>A	20.37:g.33874560G>T			33337974	Q14D67|Q5JWN6|Q8N276	Silent	SNP	ENST00000374408.3	37	CCDS13251.1	SNP	43	Broad																																																																																				0.627	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3			Silent
EYA2	2139	broad.mit.edu	37	20	45725729	45725729	+	Silent	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr20:45725729G>C	ENST00000327619.5	+	9	1184	c.810G>C	c.(808-810)gtG>gtC	p.V270V	EYA2_ENST00000357410.3_Silent_p.V270V|EYA2_ENST00000317304.6_Silent_p.V270V	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	270					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)	p.V270V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				CACAGCGTGTGTTCGTGTGGG	0.423																																					Pancreas(120;56 1725 18501 25218 43520)											1	Substitution - coding silent(1)	ovary(1)	20											246.0	222.0	230.0					20																	45725729		2203	4300	6503	45159136	SO:0001819	synonymous_variant	2139				CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.810G>C	20.37:g.45725729G>C			45159136	Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Silent	SNP	ENST00000327619.5	37	CCDS13403.1	SNP	48	Broad																																																																																				0.423	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080326.2	NM_005244		Silent
SPATA2	9825	broad.mit.edu	37	20	48522209	48522209	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr20:48522209T>G	ENST00000422556.1	-	3	1859	c.1510A>C	c.(1510-1512)Aac>Cac	p.N504H	SPATA2_ENST00000543716.1_Missense_Mutation_p.N367H|SPATA2_ENST00000289431.5_Missense_Mutation_p.N504H	NM_001135773.1	NP_001129245.1	Q9UM82	SPAT2_HUMAN	spermatogenesis associated 2	504					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.N504H(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	20	Hepatocellular(150;0.133)		BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			AGCTGGTTGTTGGGCATGAAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	20											191.0	180.0	184.0					20																	48522209		2203	4300	6503	47955616	SO:0001583	missense	9825			AB018300	CCDS13422.1	20q13.13	2014-06-13			ENSG00000158480	ENSG00000158480			14681	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 145"""	607662					Standard	NM_001135773		Approved	KIAA0757, PD1, tamo, PPP1R145	uc002xuw.3	Q9UM82	OTTHUMG00000032704	ENST00000422556.1:c.1510A>C	20.37:g.48522209T>G	ENSP00000416799:p.Asn504His		47955616	E1P626|O94857	Missense_Mutation	SNP	ENST00000422556.1	37	CCDS13422.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	10.62	1.401757	0.25291	.	.	ENSG00000158480	ENST00000289431;ENST00000422556;ENST00000543716	T;T;T	0.60797	0.16;0.16;0.19	5.22	2.84	0.33178	.	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	M	0.63843	1.955	0.58432	D	0.99999	B	0.29085	0.232	B	0.29176	0.099	T	0.53158	-0.8478	10	0.56958	D	0.05	-35.3942	12.0836	0.53686	0.0:0.0:0.2714:0.7286	.	504	Q9UM82	SPAT2_HUMAN	H	504;504;367	ENSP00000289431:N504H;ENSP00000416799:N504H;ENSP00000438855:N367H	ENSP00000289431:N504H	N	-	1	0	SPATA2	47955616	1.000000	0.71417	0.997000	0.53966	0.322000	0.28314	4.522000	0.60539	0.380000	0.24823	0.455000	0.32223	AAC		0.537	SPATA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079658.1	NM_006038		Missense_Mutation
DIDO1	11083	broad.mit.edu	37	20	61513697	61513698	+	Missense_Mutation	DNP	TT	TT	GC			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr20:61513697_61513698TT>GC	ENST00000266070.4	-	16	3935_3936	c.3610_3611AA>GC	c.(3610-3612)AAc>GCc	p.N1204A	DIDO1_ENST00000395343.1_Missense_Mutation_p.N1204A	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1204					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.N1204A(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CTCTCCACTGTTTGCGGGACGT	0.455																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)											1	Substitution - Missense(1)	ovary(1)	20																																								60984143	SO:0001583	missense	11083			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.3610_3611delinsGC	20.37:g.61513697_61513698delinsGC	ENSP00000266070:p.Asn1204Ala		60984142	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	DNP	ENST00000266070.4	37	CCDS33506.1	DNP	60	Broad																																																																																				0.455	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		Missense_Mutation
TMPRSS15	5651	broad.mit.edu	37	21	19775815	19775815	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr21:19775815G>T	ENST00000284885.3	-	1	158	c.125C>A	c.(124-126)aCa>aAa	p.T42K		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	42						brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.T42K(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TTCCTTGATTGTCAGGCAGGA	0.438																																																1	Substitution - Missense(1)	ovary(1)	21											141.0	128.0	132.0					21																	19775815		2203	4300	6503	18697686	SO:0001583	missense	5651				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.125C>A	21.37:g.19775815G>T	ENSP00000284885:p.Thr42Lys		18697686	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	CCDS13571.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	12.10	1.835259	0.32421	.	.	ENSG00000154646	ENST00000284885	D	0.86694	-2.16	5.16	2.34	0.29019	.	0.629193	0.16619	N	0.206577	T	0.77418	0.4127	L	0.40543	1.245	0.24187	N	0.995567	B	0.33583	0.418	B	0.27380	0.079	T	0.63056	-0.6722	9	.	.	.	.	7.121	0.25444	0.0895:0.3333:0.5772:0.0	.	42	P98073	ENTK_HUMAN	K	42	ENSP00000284885:T42K	.	T	-	2	0	TMPRSS15	18697686	0.971000	0.33674	0.766000	0.31476	0.484000	0.33280	0.861000	0.27885	0.336000	0.23639	0.563000	0.77884	ACA		0.438	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		Missense_Mutation
AGPAT3	56894	broad.mit.edu	37	21	45389009	45389009	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr21:45389009T>A	ENST00000398063.2	+	4	851	c.359T>A	c.(358-360)gTc>gAc	p.V120D	AGPAT3_ENST00000398058.1_Missense_Mutation_p.V120D|AGPAT3_ENST00000291572.8_Missense_Mutation_p.V120D|AGPAT3_ENST00000327505.2_Missense_Mutation_p.V120D|AGPAT3_ENST00000479117.1_3'UTR|AGPAT3_ENST00000546158.1_Missense_Mutation_p.V120D|AGPAT3_ENST00000398061.1_Missense_Mutation_p.V120D	NM_001037553.1	NP_001032642.1	Q9NRZ7	PLCC_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 3	120					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.V120D(1)		large_intestine(4)|lung(5)|ovary(1)|prostate(1)	11				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)		AGCTCCAAGGTCCTCGCTAAG	0.632																																					Pancreas(60;623 1650 5574 52796)											1	Substitution - Missense(1)	ovary(1)	21											111.0	86.0	95.0					21																	45389009		2203	4300	6503	44213437	SO:0001583	missense	56894			AF156774	CCDS13703.1	21q22.3	2013-02-05			ENSG00000160216	ENSG00000160216	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	326	protein-coding gene	gene with protein product		614794					Standard	XM_005261159		Approved	LPAAT-gamma	uc002zdw.3	Q9NRZ7	OTTHUMG00000086892	ENST00000398063.2:c.359T>A	21.37:g.45389009T>A	ENSP00000381140:p.Val120Asp		44213437	D3DSL2|Q3ZCU2|Q6UWP6|Q6ZUC6|Q8N3Q7|Q9NRZ6	Missense_Mutation	SNP	ENST00000398063.2	37	CCDS13703.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	23.3	4.396126	0.83011	.	.	ENSG00000160216	ENST00000291572;ENST00000398061;ENST00000327505;ENST00000445582;ENST00000398063;ENST00000438598;ENST00000398058;ENST00000457068;ENST00000422850;ENST00000546158	D;D;D;D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22	4.5	4.5	0.54988	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.96327	0.8802	M	0.80616	2.505	0.80722	D	1	D;D	0.71674	0.998;0.983	D;D	0.74348	0.983;0.969	D	0.96772	0.9569	10	0.72032	D	0.01	-9.6834	13.8003	0.63196	0.0:0.0:0.0:1.0	.	140;120	Q9NRZ7-3;Q9NRZ7	.;PLCC_HUMAN	D	120	ENSP00000291572:V120D;ENSP00000381138:V120D;ENSP00000332989:V120D;ENSP00000381140:V120D;ENSP00000381135:V120D;ENSP00000413906:V120D;ENSP00000414440:V120D;ENSP00000443510:V120D	ENSP00000291572:V120D	V	+	2	0	AGPAT3	44213437	1.000000	0.71417	0.815000	0.32552	0.904000	0.53231	7.470000	0.80973	1.667000	0.50832	0.402000	0.26972	GTC		0.632	AGPAT3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195722.1	NM_020132		Missense_Mutation
ZNF74	7625	broad.mit.edu	37	22	20759703	20759703	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr22:20759703G>A	ENST00000400451.2	+	5	894	c.380G>A	c.(379-381)gGc>gAc	p.G127D	ZNF74_ENST00000356671.5_Missense_Mutation_p.G127D|ZNF74_ENST00000405993.1_Missense_Mutation_p.G95D|ZNF74_ENST00000403682.3_Silent_p.G98G|ZNF74_ENST00000357502.5_Silent_p.G132G	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	127					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G127D(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CAACAGCAGGGCATTTGCAAA	0.577																																																1	Substitution - Missense(1)	ovary(1)	22											66.0	72.0	70.0					22																	20759703		1883	4100	5983	19089703	SO:0001583	missense	7625			X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.380G>A	22.37:g.20759703G>A	ENSP00000383301:p.Gly127Asp		19089703	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	ENST00000400451.2	37	CCDS42982.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	4.448	0.083008	0.08533	.	.	ENSG00000185252	ENST00000400451;ENST00000420626;ENST00000356671;ENST00000405993	T;T;T;T	0.68903	3.49;-0.36;3.49;3.37	2.98	-5.95	0.02241	.	1.443190	0.04812	N	0.435430	T	0.37376	0.1001	N	0.20845	0.615	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41963	-0.9479	10	0.02654	T	1	-1.8416	0.5613	0.00679	0.3208:0.1361:0.3022:0.2409	.	127	Q16587	ZNF74_HUMAN	D	127;24;127;95	ENSP00000383301:G127D;ENSP00000397011:G24D;ENSP00000349098:G127D;ENSP00000385855:G95D	ENSP00000349098:G127D	G	+	2	0	ZNF74	19089703	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.026000	0.01434	-1.580000	0.01644	-0.302000	0.09304	GGC		0.577	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319648.2	NM_003426		Missense_Mutation
WNT7B	7477	broad.mit.edu	37	22	46318830	46318830	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr22:46318830G>T	ENST00000339464.4	-	4	1330	c.956C>A	c.(955-957)aCc>aAc	p.T319N	WNT7B_ENST00000410089.1_Missense_Mutation_p.T303N|WNT7B_ENST00000409496.3_Missense_Mutation_p.T323N	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	319					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.T319N(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		CCACACCTTGGTGTACTGGTG	0.637																																																1	Substitution - Missense(1)	ovary(1)	22											115.0	90.0	99.0					22																	46318830		2203	4300	6503	44697494	SO:0001583	missense	7477			AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.956C>A	22.37:g.46318830G>T	ENSP00000341032:p.Thr319Asn		44697494	B8A596|Q96Q12	Missense_Mutation	SNP	ENST00000339464.4	37	CCDS33667.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	21.3	4.122446	0.77436	.	.	ENSG00000188064	ENST00000339464;ENST00000410089;ENST00000409496	T;T;T	0.76060	-0.99;-0.99;-0.99	4.23	4.23	0.50019	.	0.000000	0.85682	U	0.000000	T	0.80330	0.4603	M	0.70842	2.15	0.80722	D	1	P;P	0.49447	0.924;0.867	P;P	0.52598	0.703;0.616	T	0.80679	-0.1275	10	0.36615	T	0.2	.	15.5893	0.76512	0.0:0.0:1.0:0.0	.	323;319	A8K0G1;P56706	.;WNT7B_HUMAN	N	319;303;323	ENSP00000341032:T319N;ENSP00000386781:T303N;ENSP00000386546:T323N	ENSP00000341032:T319N	T	-	2	0	WNT7B	44697494	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.507000	0.81676	1.903000	0.55091	0.561000	0.74099	ACC		0.637	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336418.1	NM_058238		Missense_Mutation
XPC	7508	broad.mit.edu	37	3	14190213	14190213	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr3:14190213C>G	ENST00000285021.7	-	13	2483	c.2269G>C	c.(2269-2271)Ggg>Cgg	p.G757R	AC093495.4_ENST00000420253.1_RNA|XPC_ENST00000449060.2_Missense_Mutation_p.G720R|AC093495.4_ENST00000428681.3_RNA	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	757	Minimal sensor domain involved in damage recognition.				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)	p.G757R(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TACACATTCCCAAACTCGTTC	0.597			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	1	Substitution - Missense(1)	ovary(1)	3											72.0	80.0	77.0					3																	14190213		2114	4230	6344	14165214	SO:0001583	missense	7508	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.2269G>C	3.37:g.14190213C>G	ENSP00000285021:p.Gly757Arg		14165214	B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	Missense_Mutation	SNP	ENST00000285021.7	37	CCDS46763.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	26.2	4.718665	0.89205	.	.	ENSG00000154767	ENST00000285021;ENST00000449060	T;T	0.71461	-0.57;-0.41	5.65	5.65	0.86999	DNA repair protein Rad4, DNA-binding domain 3 (1);	0.000000	0.85682	D	0.000000	D	0.88959	0.6579	M	0.94021	3.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91209	0.4997	10	0.87932	D	0	-41.9206	19.7205	0.96142	0.0:1.0:0.0:0.0	.	720;757	E9PH69;Q01831	.;XPC_HUMAN	R	757;720	ENSP00000285021:G757R;ENSP00000404002:G720R	ENSP00000285021:G757R	G	-	1	0	XPC	14165214	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	7.617000	0.83032	2.671000	0.90904	0.462000	0.41574	GGG		0.597	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340517.3	NM_004628		Missense_Mutation
CCDC13	152206	broad.mit.edu	37	3	42799682	42799682	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr3:42799682C>A	ENST00000310232.6	-	2	239	c.156G>T	c.(154-156)gaG>gaT	p.E52D	CCDC13_ENST00000435327.2_5'UTR	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	52								p.E52D(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						CATCTGAAACCTCCAAGGGCT	0.488																																																1	Substitution - Missense(1)	ovary(1)	3											204.0	172.0	183.0					3																	42799682		2203	4300	6503	42774686	SO:0001583	missense	152206			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.156G>T	3.37:g.42799682C>A	ENSP00000309836:p.Glu52Asp		42774686		Missense_Mutation	SNP	ENST00000310232.6	37	CCDS2705.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	6.885	0.532667	0.13127	.	.	ENSG00000244607	ENST00000310232	T	0.23754	1.89	4.59	3.63	0.41609	.	1.154010	0.06178	N	0.678874	T	0.20700	0.0498	L	0.44542	1.39	0.09310	N	0.999999	B;B;B	0.24721	0.11;0.11;0.065	B;B;B	0.27715	0.082;0.082;0.059	T	0.35699	-0.9778	10	0.13108	T	0.6	.	4.352	0.11160	0.2274:0.6539:0.0:0.1187	.	52;52;52	B4DZD2;Q96LI1;Q8IYE1	.;.;CCD13_HUMAN	D	52	ENSP00000309836:E52D	ENSP00000309836:E52D	E	-	3	2	CCDC13	42774686	0.000000	0.05858	0.008000	0.14137	0.112000	0.19704	0.270000	0.18607	2.367000	0.80283	0.655000	0.94253	GAG		0.488	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719		Missense_Mutation
ITIH1	3697	broad.mit.edu	37	3	52822248	52822248	+	Splice_Site	SNP	T	T	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr3:52822248T>A	ENST00000273283.2	+	18	2030	c.2006T>A	c.(2005-2007)gTg>gAg	p.V669E	ITIH1_ENST00000542827.1_Intron|ITIH1_ENST00000540715.1_Splice_Site_p.V527E|ITIH1_ENST00000405128.3_Splice_Site_p.V35E|ITIH1_ENST00000537050.1_Splice_Site_p.V381E	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	669	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.V669E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		GTGCCCCCAGTGGACACAGAC	0.567																																																1	Substitution - Missense(1)	ovary(1)	3											101.0	83.0	89.0					3																	52822248		2203	4300	6503	52797288	SO:0001630	splice_region_variant	3697				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2006-1T>A	3.37:g.52822248T>A			52797288	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	26.8	4.775559	0.90195	.	.	ENSG00000055957	ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133;ENST00000405128	T;T;T;T;T	0.18960	4.45;4.34;4.14;3.65;2.18	5.39	5.39	0.77823	.	0.067056	0.64402	D	0.000016	T	0.52075	0.1712	M	0.88640	2.97	0.54753	D	0.999989	D;D;D;D	0.89917	0.998;1.0;0.999;1.0	D;D;D;D	0.77557	0.979;0.99;0.941;0.99	T	0.60398	-0.7271	9	.	.	.	.	13.6539	0.62327	0.0:0.0:0.0:1.0	.	527;35;270;669	F5H165;B5MCP1;Q9P1C5;P19827	.;.;.;ITIH1_HUMAN	E	669;527;381;222;35	ENSP00000273283:V669E;ENSP00000443973:V527E;ENSP00000443847:V381E;ENSP00000395836:V222E;ENSP00000384589:V35E	.	V	+	2	0	ITIH1	52797288	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.330000	0.79181	2.043000	0.60533	0.533000	0.62120	GTG		0.567	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	Missense_Mutation	Missense_Mutation
ITIH3	3699	broad.mit.edu	37	3	52828859	52828859	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr3:52828859C>T	ENST00000449956.2	+	1	46	c.40C>T	c.(40-42)Ctc>Ttc	p.L14F	ITIH3_ENST00000416872.2_Missense_Mutation_p.L14F	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	14					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L14F(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CTTGGCTCTGCTCTCCAGCTT	0.582																																																1	Substitution - Missense(1)	ovary(1)	3											130.0	141.0	137.0					3																	52828859		2070	4213	6283	52803899	SO:0001583	missense	3699				CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.40C>T	3.37:g.52828859C>T	ENSP00000415769:p.Leu14Phe		52803899	Q3B7H5|Q53F06|Q6LAM2|Q99085	Missense_Mutation	SNP	ENST00000449956.2	37	CCDS46845.1	SNP	28	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.08|10.08	1.252863|1.252863	0.22965|0.22965	.|.	.|.	ENSG00000162267|ENSG00000162267	ENST00000273291|ENST00000398670;ENST00000536431;ENST00000416872;ENST00000449956	.|T;T	.|0.03272	.|3.99;4.63	4.89|4.89	1.83|1.83	0.25207|0.25207	.|.	0.603585|.	0.17227|.	N|.	0.182086|.	T|T	0.02888|0.02888	0.0086|0.0086	N|N	0.19112|0.19112	0.55|0.55	0.30957|0.30957	N|N	0.724062|0.724062	.|B;B	.|0.11235	.|0.0;0.004	.|B;B	.|0.09377	.|0.002;0.004	T|T	0.20140|0.20140	-1.0284|-1.0284	7|9	0.11182|0.72032	T|D	0.66|0.01	-0.3673|-0.3673	7.0569|7.0569	0.25104|0.25104	0.0:0.6871:0.0:0.3129|0.0:0.6871:0.0:0.3129	.|.	.|14;14	.|E7ET33;Q06033	.|.;ITIH3_HUMAN	V|F	10|14	.|ENSP00000413922:L14F;ENSP00000415769:L14F	ENSP00000273291:A10V|ENSP00000381662:L14F	A|L	+|+	2|1	0|0	ITIH3|ITIH3	52803899|52803899	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.361000|0.361000	0.29550|0.29550	0.725000|0.725000	0.25970|0.25970	0.261000|0.261000	0.21753|0.21753	0.591000|0.591000	0.81541|0.81541	GCT|CTC		0.582	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	NM_002217		Missense_Mutation
OR5H1	26341	broad.mit.edu	37	3	97852398	97852398	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr3:97852398A>T	ENST00000354565.2	+	1	857	c.857A>T	c.(856-858)aAt>aTt	p.N286I	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N286I(1)		breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						CCTTTGTTAAATCCTATCATC	0.373																																																1	Substitution - Missense(1)	ovary(1)	3											92.0	98.0	96.0					3																	97852398		2203	4298	6501	99335088	SO:0001583	missense	26341			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.857A>T	3.37:g.97852398A>T	ENSP00000346575:p.Asn286Ile		99335088		Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	12.41	1.928480	0.34002	.	.	ENSG00000231192	ENST00000354565	T	0.59638	0.25	3.38	3.38	0.38709	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000117	T	0.79969	0.4538	H	0.94925	3.6	0.31927	N	0.612637	D	0.89917	1.0	D	0.91635	0.999	D	0.83999	0.0342	10	0.87932	D	0	.	9.7725	0.40598	1.0:0.0:0.0:0.0	.	286	A6NKK0	OR5H1_HUMAN	I	286	ENSP00000346575:N286I	ENSP00000346575:N286I	N	+	2	0	OR5H1	99335088	1.000000	0.71417	0.697000	0.30258	0.007000	0.05969	8.216000	0.89764	1.397000	0.46682	0.164000	0.16699	AAT		0.373	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338		Missense_Mutation
UMPS	7372	broad.mit.edu	37	3	124456804	124456804	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1422-01	TCGA-24-1422-10			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr3:124456804C>G	ENST00000232607.2	+	3	806	c.700C>G	c.(700-702)Ccc>Gcc	p.P234A	UMPS_ENST00000538242.1_Missense_Mutation_p.P56A|UMPS_ENST00000536109.1_Missense_Mutation_p.P142A|UMPS_ENST00000498715.1_3'UTR|UMPS_ENST00000413078.2_Missense_Mutation_p.P56A	NM_000373.3	NP_000364.1	P11172	UMPS_HUMAN	uridine monophosphate synthetase	234	OMPdecase.				'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|cellular response to drug (GO:0035690)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|small molecule metabolic process (GO:0044281)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	orotate phosphoribosyltransferase activity (GO:0004588)|orotidine-5'-phosphate decarboxylase activity (GO:0004590)	p.P234A(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(114;0.146)	Fluorouracil(DB00544)	TGCAGAGCTGCCCAGGATCCA	0.483																																																1	Substitution - Missense(1)	ovary(1)	3											111.0	101.0	105.0					3																	124456804		2203	4300	6503	125939494	SO:0001583	missense	7372				CCDS3029.1	3q13	2008-02-04	2008-02-04		ENSG00000114491	ENSG00000114491	2.4.2.10, 4.1.1.23		12563	protein-coding gene	gene with protein product	"""orotate phosphoribosyl transferase and orotidine-5'-decarboxylase"""	613891				2767686	Standard	NM_000373		Approved		uc003ehl.4	P11172	OTTHUMG00000159431	ENST00000232607.2:c.700C>G	3.37:g.124456804C>G	ENSP00000232607:p.Pro234Ala		125939494	B5LY68|B5LY72|O00758|O00759|O00760|Q16862|Q9H3Q2|Q9UG49	Missense_Mutation	SNP	ENST00000232607.2	37	CCDS3029.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	18.35	3.603704	0.66445	.	.	ENSG00000114491	ENST00000232607;ENST00000536109;ENST00000538242;ENST00000413078	T;T;T;T	0.68025	0.12;-0.3;0.72;0.74	5.65	5.65	0.86999	Aldolase-type TIM barrel (1);	0.106742	0.64402	D	0.000003	T	0.49184	0.1542	N	0.25245	0.725	0.58432	D	0.999995	B;B;B	0.27450	0.179;0.007;0.001	B;B;B	0.17098	0.017;0.002;0.0	T	0.49133	-0.8971	10	0.02654	T	1	-16.3587	18.0832	0.89449	0.0:1.0:0.0:0.0	.	56;56;234	B5LY72;B5LY70;P11172	.;.;UMPS_HUMAN	A	234;142;56;56	ENSP00000232607:P234A;ENSP00000443577:P142A;ENSP00000444988:P56A;ENSP00000397965:P56A	ENSP00000232607:P234A	P	+	1	0	UMPS	125939494	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	3.557000	0.53741	2.941000	0.99782	0.655000	0.94253	CCC		0.483	UMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355271.1	NM_000373		Missense_Mutation
EFCAB12	90288	broad.mit.edu	37	3	129130174	129130174	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr3:129130174C>T	ENST00000505956.1	-	5	1024	c.862G>A	c.(862-864)Gat>Aat	p.D288N	EFCAB12_ENST00000326085.3_Missense_Mutation_p.D288N	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	288							calcium ion binding (GO:0005509)	p.D288N(1)									TTCAGGGAATCTCTGTGCTTG	0.557																																																1	Substitution - Missense(1)	ovary(1)	3											60.0	60.0	60.0					3																	129130174		2032	4180	6212	130612864	SO:0001583	missense	90288			AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.862G>A	3.37:g.129130174C>T	ENSP00000420854:p.Asp288Asn		130612864	Q69YX4	Missense_Mutation	SNP	ENST00000505956.1	37	CCDS54638.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	6.040	0.375680	0.11409	.	.	ENSG00000172771	ENST00000505956;ENST00000326085;ENST00000503957	T;T;T	0.30448	4.02;4.02;1.53	3.39	-4.3	0.03710	.	4.712770	0.01032	N	0.004159	T	0.14874	0.0359	N	0.08118	0	0.09310	N	1	B	0.25169	0.119	B	0.26416	0.069	T	0.12319	-1.0552	10	0.17832	T	0.49	12.6852	6.5664	0.22515	0.0:0.1804:0.1525:0.6671	.	288	Q6NXP0	CC025_HUMAN	N	288;288;138	ENSP00000420854:D288N;ENSP00000324241:D288N;ENSP00000421462:D138N	ENSP00000324241:D288N	D	-	1	0	C3orf25	130612864	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.572000	0.05881	-1.063000	0.03177	0.462000	0.41574	GAT		0.557	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355530.1	NM_207307		Missense_Mutation
IFT122	55764	broad.mit.edu	37	3	129218838	129218838	+	Missense_Mutation	SNP	G	G	T	rs561825107		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr3:129218838G>T	ENST00000348417.2	+	19	2379	c.2302G>T	c.(2302-2304)Gtg>Ttg	p.V768L	IFT122_ENST00000504021.1_Missense_Mutation_p.V644L|IFT122_ENST00000347300.2_Missense_Mutation_p.V709L|IFT122_ENST00000296266.3_Missense_Mutation_p.V819L|IFT122_ENST00000431818.2_Missense_Mutation_p.V618L|IFT122_ENST00000349441.2_Missense_Mutation_p.V657L|IFT122_ENST00000507564.1_Missense_Mutation_p.V760L|IFT122_ENST00000440957.2_Missense_Mutation_p.V559L|IFT122_ENST00000513932.1_3'UTR	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	768					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)		p.V819L(1)		breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						CAAAGCCGCCGTGGAGATGTA	0.527																																																1	Substitution - Missense(1)	ovary(1)	3											157.0	142.0	147.0					3																	129218838		2203	4300	6503	130701528	SO:0001583	missense	55764			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.2302G>T	3.37:g.129218838G>T	ENSP00000324005:p.Val768Leu		130701528	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Missense_Mutation	SNP	ENST00000348417.2	37	CCDS3061.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939921	0.73557	.	.	ENSG00000163913	ENST00000347300;ENST00000296266;ENST00000507564;ENST00000454840;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957;ENST00000509522;ENST00000507221	T;T;T;T;T;T;T;T;T	0.60672	0.81;0.17;0.29;0.34;0.95;0.94;0.81;0.34;0.93	5.06	5.06	0.68205	.	0.063147	0.64402	D	0.000005	T	0.59266	0.2181	L	0.55481	1.735	0.53005	D	0.999965	P;P;B;P;B;B;B;B;P;P	0.46457	0.628;0.591;0.353;0.546;0.273;0.273;0.273;0.393;0.662;0.878	B;B;B;B;B;B;B;B;B;B	0.43478	0.209;0.421;0.089;0.325;0.124;0.124;0.124;0.246;0.145;0.35	T	0.66156	-0.5994	10	0.72032	D	0.01	-22.0937	18.4268	0.90612	0.0:0.0:1.0:0.0	.	559;94;760;155;644;608;657;709;768;819	E9PDG2;B3KUD1;E7EQF4;B3KT43;B4DEY9;B4DPW7;Q9BTY4;Q9HBG6-3;Q9HBG6;G3XAB1	.;.;.;.;.;.;.;.;IF122_HUMAN;.	L	709;819;760;709;618;644;657;768;608;559;265;130	ENSP00000323973:V709L;ENSP00000296266:V819L;ENSP00000425536:V760L;ENSP00000410946:V618L;ENSP00000422179:V644L;ENSP00000324165:V657L;ENSP00000324005:V768L;ENSP00000401569:V559L;ENSP00000424727:V265L	ENSP00000296266:V819L	V	+	1	0	IFT122	130701528	1.000000	0.71417	0.962000	0.40283	0.979000	0.70002	9.525000	0.98039	2.338000	0.79540	0.655000	0.94253	GTG		0.527	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262		Missense_Mutation
SLC33A1	9197	broad.mit.edu	37	3	155560338	155560338	+	Silent	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr3:155560338G>A	ENST00000392845.3	-	2	1226	c.846C>T	c.(844-846)aaC>aaT	p.N282N	SLC33A1_ENST00000460729.1_5'Flank|SLC33A1_ENST00000359479.3_Silent_p.N282N			O00400	ACATN_HUMAN	solute carrier family 33 (acetyl-CoA transporter), member 1	282					acetyl-CoA transport (GO:0015876)|cell death (GO:0008219)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	acetyl-CoA transporter activity (GO:0008521)	p.N282N(2)		endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	22			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CTGATACTTCGTTTTCTTTTT	0.308																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	3											84.0	75.0	78.0					3																	155560338		2203	4299	6502	157043032	SO:0001819	synonymous_variant	9197			D88152	CCDS3173.1	3q25.31	2013-05-22		2002-12-06	ENSG00000169359	ENSG00000169359		"""Solute carriers"""	95	protein-coding gene	gene with protein product		603690	"""acetyl-Coenzyme A transporter"", ""spastic paraplegia 42 (autosomal dominant)"""	ACATN, SPG42		9096318, 19061983	Standard	NM_004733		Approved	AT-1, AT1	uc003fao.2	O00400	OTTHUMG00000158481	ENST00000392845.3:c.846C>T	3.37:g.155560338G>A			157043032	B2R5Q2|D3DNK4	Silent	SNP	ENST00000392845.3	37	CCDS3173.1	SNP	40	Broad																																																																																				0.308	SLC33A1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351130.3	NM_004733		Silent
NRROS	375387	broad.mit.edu	37	3	196388449	196388449	+	Silent	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr3:196388449G>T	ENST00000328557.4	+	3	2138	c.1935G>T	c.(1933-1935)cgG>cgT	p.R645R		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	645					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R645R(1)									AGTGGGAGCGGCTGGACCTGG	0.642																																																1	Substitution - coding silent(1)	ovary(1)	3											81.0	88.0	85.0					3																	196388449		2203	4300	6503	197872846	SO:0001819	synonymous_variant	375387			AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.1935G>T	3.37:g.196388449G>T			197872846		Silent	SNP	ENST00000328557.4	37	CCDS3319.1	SNP	42	Broad																																																																																				0.642	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565		Silent
TBC1D1	23216	broad.mit.edu	37	4	38016492	38016492	+	Silent	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr4:38016492C>T	ENST00000261439.4	+	3	1135	c.780C>T	c.(778-780)ttC>ttT	p.F260F	TBC1D1_ENST00000508802.1_Silent_p.F260F	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	260	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)	p.F260F(1)		NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						GCAGCGGCTTCTTCAGCTCCT	0.577																																																1	Substitution - coding silent(1)	ovary(1)	4											28.0	32.0	30.0					4																	38016492		2197	4299	6496	37692887	SO:0001819	synonymous_variant	23216			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.780C>T	4.37:g.38016492C>T			37692887	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Silent	SNP	ENST00000261439.4	37	CCDS33972.1	SNP	32	Broad																																																																																				0.577	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173		Silent
TBCK	93627	broad.mit.edu	37	4	107133941	107133941	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr4:107133941C>G	ENST00000273980.5	-	21	2273	c.1826G>C	c.(1825-1827)aGt>aCt	p.S609T	TBCK_ENST00000361687.4_Missense_Mutation_p.S546T|TBCK_ENST00000394708.2_Missense_Mutation_p.S609T|TBCK_ENST00000394706.3_Missense_Mutation_p.S570T|TBCK_ENST00000514689.1_5'UTR|TBCK_ENST00000432496.2_Missense_Mutation_p.S609T					TBC1 domain containing kinase									p.S609T(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						GAGATGATTACTCAGCTCTGG	0.333																																																1	Substitution - Missense(1)	ovary(1)	4											147.0	155.0	152.0					4																	107133941		2203	4298	6501	107353390	SO:0001583	missense	93627				CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.1826G>C	4.37:g.107133941C>G	ENSP00000273980:p.Ser609Thr		107353390		Missense_Mutation	SNP	ENST00000273980.5	37	CCDS54788.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798489	0.70567	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94	5.04	5.04	0.67666	Rab-GAP/TBC domain (5);	0.000000	0.85682	D	0.000000	T	0.33556	0.0867	L	0.42744	1.35	0.58432	D	0.999999	B;D;B	0.58268	0.242;0.982;0.216	B;P;B	0.54889	0.166;0.763;0.108	T	0.02093	-1.1215	10	0.46703	T	0.11	.	18.7462	0.91794	0.0:1.0:0.0:0.0	.	609;570;546	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	T	609;609;546;570;609	ENSP00000273980:S609T;ENSP00000405847:S609T;ENSP00000355338:S546T;ENSP00000378196:S570T;ENSP00000378198:S609T	ENSP00000273980:S609T	S	-	2	0	TBCK	107353390	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.354000	0.79424	2.495000	0.84180	0.491000	0.48974	AGT		0.333	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115		Missense_Mutation
KIAA1109	84162	broad.mit.edu	37	4	123271114	123271114	+	Silent	SNP	A	A	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr4:123271114A>G	ENST00000264501.4	+	80	14107	c.13734A>G	c.(13732-13734)gaA>gaG	p.E4578E	KIAA1109_ENST00000388738.3_Silent_p.E4578E			Q2LD37	K1109_HUMAN	KIAA1109	4578					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.E4578E(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AGCTCCAGGAATTTTTCACAC	0.403																																																1	Substitution - coding silent(1)	ovary(1)	4											174.0	166.0	168.0					4																	123271114		1825	4090	5915	123490564	SO:0001819	synonymous_variant	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.13734A>G	4.37:g.123271114A>G			123490564	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	37	CCDS43267.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	7.354	0.623551	0.14193	.	.	ENSG00000138688	ENST00000306802	.	.	.	5.85	-0.426	0.12314	.	.	.	.	.	T	0.57858	0.2082	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54241	-0.8323	4	.	.	.	.	10.5644	0.45165	0.4989:0.0:0.5011:0.0	.	.	.	.	S	954	.	.	N	+	2	0	KIAA1109	123490564	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.222000	0.32515	0.144000	0.18951	0.460000	0.39030	AAT		0.403	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		Silent
RWDD4	201965	broad.mit.edu	37	4	184572200	184572200	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr4:184572200C>A	ENST00000326397.5	-	4	572	c.300G>T	c.(298-300)ttG>ttT	p.L100F	RNU6-479P_ENST00000516348.1_RNA|RWDD4_ENST00000327570.9_Missense_Mutation_p.L100F|RWDD4_ENST00000512740.1_Missense_Mutation_p.L37F|RWDD4_ENST00000510968.1_Missense_Mutation_p.L5F	NM_152682.2	NP_689895.2	Q6NW29	RWDD4_HUMAN	RWD domain containing 4	100	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.							p.L100F(1)		large_intestine(2)|lung(4)|ovary(1)|prostate(1)	8						CATATTCAAACAATGTATAGG	0.383																																																1	Substitution - Missense(1)	ovary(1)	4											92.0	90.0	91.0					4																	184572200		2203	4300	6503	184809194	SO:0001583	missense	201965			BC017472	CCDS34111.1	4q35.1	2012-12-07	2010-09-30	2010-09-30	ENSG00000182552	ENSG00000182552			23750	protein-coding gene	gene with protein product			"""family with sequence similarity 28, member A"", ""RWD domain containing 4A"""	FAM28A, RWDD4A			Standard	NM_152682		Approved	MGC10198	uc003ivt.1	Q6NW29	OTTHUMG00000160632	ENST00000326397.5:c.300G>T	4.37:g.184572200C>A	ENSP00000388920:p.Leu100Phe		184809194	B2RDE9|B4DDP2|Q75LA9|Q8WVW2	Missense_Mutation	SNP	ENST00000326397.5	37	CCDS34111.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	11.53	1.665165	0.29604	.	.	ENSG00000182552	ENST00000326397;ENST00000327570;ENST00000510968;ENST00000512740	T;T;T;T	0.62364	0.58;0.58;0.03;0.58	5.24	1.1	0.20463	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (3);	0.000000	0.64402	D	0.000001	T	0.80999	0.4732	M	0.93898	3.47	0.50171	D	0.999855	D	0.63880	0.993	D	0.69479	0.964	T	0.82690	-0.0332	10	0.87932	D	0	-10.4966	10.9421	0.47278	0.1612:0.4145:0.4243:0.0	.	100	Q6NW29	RWDD4_HUMAN	F	100;100;5;37	ENSP00000388920:L100F;ENSP00000332177:L100F;ENSP00000426329:L5F;ENSP00000423598:L37F	ENSP00000388920:L100F	L	-	3	2	RWDD4	184809194	0.977000	0.34250	0.106000	0.21319	0.024000	0.10985	0.164000	0.16542	0.176000	0.19873	-0.499000	0.04595	TTG		0.383	RWDD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361499.2	NM_152682		Missense_Mutation
CARD6	84674	broad.mit.edu	37	5	40843622	40843622	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr5:40843622G>T	ENST00000254691.5	+	2	851	c.652G>T	c.(652-654)Gtt>Ttt	p.V218F	CARD6_ENST00000381677.3_Missense_Mutation_p.V218F	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	218	Asp/Glu-rich.				apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)			p.V218F(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						TCTAGGATCTGTTGACACCCC	0.408																																																1	Substitution - Missense(1)	ovary(1)	5											64.0	67.0	66.0					5																	40843622		2203	4300	6503	40879379	SO:0001583	missense	84674			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.652G>T	5.37:g.40843622G>T	ENSP00000254691:p.Val218Phe		40879379	Q52LR2	Missense_Mutation	SNP	ENST00000254691.5	37	CCDS3935.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241711	0.58995	.	.	ENSG00000132357	ENST00000254691;ENST00000381677;ENST00000444789;ENST00000509771	T;T	0.35421	2.53;1.31	5.23	2.26	0.28386	.	1.646510	0.03575	N	0.229256	T	0.29817	0.0745	L	0.27053	0.805	0.09310	N	1	B	0.15141	0.012	B	0.14578	0.011	T	0.29458	-1.0011	10	0.59425	D	0.04	-0.824	8.044	0.30538	0.0:0.3485:0.4841:0.1674	.	218	Q9BX69	CARD6_HUMAN	F	218	ENSP00000254691:V218F;ENSP00000371093:V218F	ENSP00000254691:V218F	V	+	1	0	CARD6	40879379	0.000000	0.05858	0.000000	0.03702	0.324000	0.28378	-0.082000	0.11304	0.273000	0.22049	0.655000	0.94253	GTT		0.408	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211584.3			Missense_Mutation
STARD4	134429	broad.mit.edu	37	5	110837699	110837699	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr5:110837699G>T	ENST00000296632.3	-	4	377	c.243C>A	c.(241-243)agC>agA	p.S81R	STARD4_ENST00000512160.1_Intron|STARD4_ENST00000509887.1_Intron|STARD4_ENST00000502322.1_Missense_Mutation_p.S81R|STARD4_ENST00000511569.1_5'UTR	NM_139164.1	NP_631903.1	Q96DR4	STAR4_HUMAN	StAR-related lipid transfer (START) domain containing 4	81	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				lipid transport (GO:0006869)		lipid binding (GO:0008289)	p.S81R(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	12		all_cancers(142;0.00259)|all_epithelial(76;8.32e-05)|Prostate(80;0.0115)|Colorectal(10;0.0959)|Ovarian(225;0.156)|all_lung(232;0.18)|Lung NSC(167;0.248)		OV - Ovarian serous cystadenocarcinoma(64;4.91e-09)|Epithelial(69;1.39e-08)|all cancers(49;2.34e-06)|COAD - Colon adenocarcinoma(37;0.049)|Colorectal(14;0.138)		AAGTCATCAAGCTGTCCCAAT	0.408																																																1	Substitution - Missense(1)	ovary(1)	5											142.0	148.0	146.0					5																	110837699		2202	4300	6502	110865598	SO:0001583	missense	134429			AF480299	CCDS4104.1	5q22	2011-09-12	2007-08-16		ENSG00000164211	ENSG00000164211		"""StAR-related lipid transfer (START) domain containing"""	18058	protein-coding gene	gene with protein product		607049	"""START domain containing 4, sterol regulated"""			12011452	Standard	NM_139164		Approved		uc003kph.1	Q96DR4	OTTHUMG00000128793	ENST00000296632.3:c.243C>A	5.37:g.110837699G>T	ENSP00000296632:p.Ser81Arg		110865598	Q86TN9	Missense_Mutation	SNP	ENST00000296632.3	37	CCDS4104.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	11.59	1.683929	0.29872	.	.	ENSG00000164211	ENST00000296632;ENST00000505803;ENST00000502322	T;T;T	0.77489	-1.1;-1.1;-1.1	5.94	-0.291	0.12843	Lipid-binding START (2);START-like domain (1);	0.061993	0.64402	N	0.000003	T	0.62938	0.2469	L	0.43701	1.375	0.80722	D	1	B;B	0.15141	0.012;0.003	B;B	0.16722	0.016;0.011	T	0.42481	-0.9449	10	0.19147	T	0.46	0.1095	6.3937	0.21601	0.3466:0.12:0.5334:0.0	.	81;81	Q86TN9;Q96DR4	.;STAR4_HUMAN	R	81	ENSP00000296632:S81R;ENSP00000427478:S81R;ENSP00000427639:S81R	ENSP00000296632:S81R	S	-	3	2	STARD4	110865598	0.997000	0.39634	0.991000	0.47740	0.995000	0.86356	0.367000	0.20382	-0.121000	0.11787	0.655000	0.94253	AGC		0.408	STARD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250720.1	NM_139164		Missense_Mutation
ALDH7A1	501	broad.mit.edu	37	5	125887729	125887729	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr5:125887729T>C	ENST00000409134.3	-	14	1520	c.1301A>G	c.(1300-1302)tAt>tGt	p.Y434C	ALDH7A1_ENST00000553117.1_Missense_Mutation_p.Y370C|ALDH7A1_ENST00000447989.2_Missense_Mutation_p.Y397C|RNU6-963P_ENST00000363477.1_RNA	NM_001182.4|NM_001201377.1	NP_001173.2|NP_001188306.1	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1	434					cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|glycine betaine biosynthetic process from choline (GO:0019285)|lysine catabolic process (GO:0006554)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|betaine-aldehyde dehydrogenase activity (GO:0008802)|L-aminoadipate-semialdehyde dehydrogenase activity (GO:0004043)	p.Y406C(1)		endometrium(1)|kidney(4)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)		TTTAAAGACATAGAGAATCGG	0.398																																																1	Substitution - Missense(1)	ovary(1)	5											72.0	65.0	67.0					5																	125887729		2203	4300	6503	125915628	SO:0001583	missense	501			S74728	CCDS4137.2, CCDS56380.1	5q31	2013-06-03			ENSG00000164904	ENSG00000164904	1.2.1.31	"""Aldehyde dehydrogenases"""	877	protein-coding gene	gene with protein product	"""antiquitin 1"", ""26g turgor protein homolog"", ""alpha-aminoadipic semialdehyde dehydrogenase"", ""alpha-AASA dehydrogenase"", ""delta1-piperideine-6-carboxylate dehydrogenease"", ""P6c dehydrogenase"""	107323		ATQ1		9417906	Standard	NM_001182		Approved	EPD, PDE	uc003ktx.3	P49419	OTTHUMG00000128942	ENST00000409134.3:c.1301A>G	5.37:g.125887729T>C	ENSP00000387123:p.Tyr434Cys		125915628	B2R669|B4DIC7|B4DMA0|E7EPT3|O14619|Q6IPU8|Q9BUL4	Missense_Mutation	SNP	ENST00000409134.3	37	CCDS4137.2	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	19.99	3.929011	0.73327	.	.	ENSG00000164904	ENST00000409134;ENST00000553117;ENST00000447989;ENST00000437170	D;D;D	0.90732	-2.72;-2.72;-2.72	4.71	4.71	0.59529	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.94059	0.8096	M	0.64567	1.98	0.52501	D	0.999953	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94663	0.7850	10	0.87932	D	0	.	14.3021	0.66359	0.0:0.0:0.0:1.0	.	397;434	E7EPT3;P49419	.;AL7A1_HUMAN	C	434;370;397;242	ENSP00000387123:Y434C;ENSP00000448593:Y370C;ENSP00000414132:Y397C	ENSP00000387123:Y434C	Y	-	2	0	ALDH7A1	125915628	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.618000	0.83043	2.107000	0.64212	0.533000	0.62120	TAT		0.398	ALDH7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250921.2	NM_001182		Missense_Mutation
PCDHA2	56146	broad.mit.edu	37	5	140174981	140174981	+	Silent	SNP	A	A	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr5:140174981A>G	ENST00000526136.1	+	1	432	c.432A>G	c.(430-432)gaA>gaG	p.E144E	PCDHA2_ENST00000520672.2_Silent_p.E144E|PCDHA2_ENST00000378132.1_Silent_p.E144E|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	144					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E144E(1)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTTTCCCGAATCAAGGCTGC	0.473																																																1	Substitution - coding silent(1)	ovary(1)	5											95.0	99.0	98.0					5																	140174981		2203	4300	6503	140155165	SO:0001819	synonymous_variant	56146			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.432A>G	5.37:g.140174981A>G			140155165	O75287|Q9BTV3	Silent	SNP	ENST00000526136.1	37	CCDS54914.1	SNP	4	Broad																																																																																				0.473	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		Silent
PCDHB6	56130	broad.mit.edu	37	5	140531482	140531482	+	Silent	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr5:140531482G>A	ENST00000231136.1	+	1	1644	c.1644G>A	c.(1642-1644)ctG>ctA	p.L548L	PCDHB6_ENST00000543635.1_Silent_p.L412L	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	548	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L548L(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCGCTTGCTGGTGCTGGACG	0.711																																																1	Substitution - coding silent(1)	ovary(1)	5											43.0	51.0	49.0					5																	140531482		2201	4298	6499	140511666	SO:0001819	synonymous_variant	56130			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1644G>A	5.37:g.140531482G>A			140511666	B2R8R9	Silent	SNP	ENST00000231136.1	37	CCDS4248.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	3.988	-0.005022	0.07773	.	.	ENSG00000113211	ENST00000542861	.	.	.	4.19	2.31	0.28768	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8965	0.63775	0.0:0.4704:0.5296:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PCDHB6	140511666	0.000000	0.05858	0.111000	0.21465	0.853000	0.48598	-1.997000	0.01470	0.311000	0.23014	0.556000	0.70494	.		0.711	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939		Silent
PCDHB16	57717	broad.mit.edu	37	5	140562687	140562688	+	Missense_Mutation	DNP	TT	TT	GA			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr5:140562687_140562688TT>GA	ENST00000361016.2	+	1	1708_1709	c.553_554TT>GA	c.(553-555)TTc>GAc	p.F185D		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	185	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F185D(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AATCCATGAATTCAGAGATGGC	0.465																																																1	Substitution - Missense(1)	ovary(1)	5																																								140542872	SO:0001583	missense	57717			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	Exception_encountered	5.37:g.140562687_140562688delinsGA	ENSP00000354293:p.Phe185Asp		140542871	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	DNP	ENST00000361016.2	37	CCDS4251.1	DNP	52	Broad																																																																																				0.465	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		Missense_Mutation
NSD1	64324	broad.mit.edu	37	5	176721628	176721628	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1422-01	TCGA-24-1422-10			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr5:176721628C>G	ENST00000439151.2	+	23	7304	c.7259C>G	c.(7258-7260)cCt>cGt	p.P2420R	NSD1_ENST00000347982.4_Missense_Mutation_p.P2151R|NSD1_ENST00000354179.4_Missense_Mutation_p.P2151R|NSD1_ENST00000361032.4_Missense_Mutation_p.P2317R	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2420	Pro-rich.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.P2420R(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AGACTCCCACCTCCTGAGAAA	0.512			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																													Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	1	Substitution - Missense(1)	ovary(1)	5											73.0	83.0	80.0					5																	176721628		2203	4300	6503	176654234	SO:0001583	missense	64324	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.7259C>G	5.37:g.176721628C>G	ENSP00000395929:p.Pro2420Arg		176654234	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	14.80	2.644003	0.47258	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93659	-3.16;-3.16;-3.16;-3.26	5.69	5.69	0.88448	.	0.101803	0.44483	D	0.000454	D	0.93093	0.7801	N	0.24115	0.695	0.35189	D	0.773196	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.963	D	0.94810	0.7978	10	0.87932	D	0	.	10.8666	0.46858	0.0:0.8713:0.0:0.1287	.	2151;2420	Q96L73-2;Q96L73	.;NSD1_HUMAN	R	2151;2420;2151;2317	ENSP00000346111:P2151R;ENSP00000395929:P2420R;ENSP00000343209:P2151R;ENSP00000354310:P2317R	ENSP00000343209:P2151R	P	+	2	0	NSD1	176654234	0.113000	0.22115	0.999000	0.59377	0.778000	0.44026	0.968000	0.29357	2.687000	0.91594	0.563000	0.77884	CCT		0.512	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349		Missense_Mutation
CDKAL1	54901	broad.mit.edu	37	6	21065364	21065364	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr6:21065364G>C	ENST00000378610.1	+	10	1151	c.1141G>C	c.(1141-1143)Gtt>Ctt	p.V381L	CDKAL1_ENST00000378624.4_Missense_Mutation_p.V311L|CDKAL1_ENST00000274695.4_Missense_Mutation_p.V381L			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	381					maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)	p.V381L(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			AGTGAAACTTGTTGAAGAGTA	0.378																																																1	Substitution - Missense(1)	ovary(1)	6											103.0	102.0	102.0					6																	21065364		2203	4300	6503	21173343	SO:0001583	missense	54901			AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.1141G>C	6.37:g.21065364G>C	ENSP00000367873:p.Val381Leu		21173343	A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	ENST00000378610.1	37	CCDS4546.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610668	0.66558	.	.	ENSG00000145996	ENST00000274695;ENST00000378624;ENST00000378610	T;T;T	0.78246	-1.16;-1.16;-1.16	5.87	5.87	0.94306	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	T	0.62441	0.2428	L	0.33485	1.01	0.80722	D	1	P;B	0.35307	0.494;0.094	B;B	0.33254	0.16;0.123	T	0.63879	-0.6537	10	0.40728	T	0.16	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	311;381	Q5VV42-2;Q5VV42	.;CDKAL_HUMAN	L	381;311;381	ENSP00000274695:V381L;ENSP00000367889:V311L;ENSP00000367873:V381L	ENSP00000274695:V381L	V	+	1	0	CDKAL1	21173343	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.420000	0.97426	2.941000	0.99782	0.655000	0.94253	GTT		0.378	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039986.1	NM_017774		Missense_Mutation
HIST1H3G	8355	broad.mit.edu	37	6	26271472	26271472	+	Silent	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr6:26271472C>T	ENST00000305910.3	-	1	140	c.141G>A	c.(139-141)gtG>gtA	p.V47V	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	47					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.V47V(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						CGCGCAGAGCCACGGTGCCGG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	6											57.0	60.0	59.0					6																	26271472		2203	4300	6503	26379451	SO:0001819	synonymous_variant	8355			Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.141G>A	6.37:g.26271472C>T			26379451	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000305910.3	37	CCDS4602.1	SNP	21	Broad																																																																																				0.627	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040099.2	NM_003534		Silent
DHX16	8449	broad.mit.edu	37	6	30632946	30632946	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr6:30632946C>T	ENST00000376442.3	-	6	1222	c.1027G>A	c.(1027-1029)Gcc>Acc	p.A343T		NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	343					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.A343T(1)		kidney(2)|ovary(2)	4						GCATCTCGGGCCCCAAACTTC	0.637																																																1	Substitution - Missense(1)	ovary(1)	6											21.0	23.0	22.0					6																	30632946		2203	4300	6503	30740925	SO:0001583	missense	8449			AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.1027G>A	6.37:g.30632946C>T	ENSP00000365625:p.Ala343Thr		30740925	O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	ENST00000376442.3	37	CCDS4685.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	31	5.092870	0.94149	.	.	ENSG00000204560	ENST00000376442;ENST00000415603	T;T	0.59906	4.1;0.23	5.09	5.09	0.68999	.	0.117593	0.56097	D	0.000027	T	0.57533	0.2060	M	0.67397	2.05	0.80722	D	1	P;B	0.52170	0.951;0.212	P;B	0.50490	0.642;0.058	T	0.59542	-0.7435	10	0.41790	T	0.15	.	17.2648	0.87083	0.0:1.0:0.0:0.0	.	283;343	B4DZ28;O60231	.;DHX16_HUMAN	T	343;283	ENSP00000365625:A343T;ENSP00000399101:A283T	ENSP00000365625:A343T	A	-	1	0	DHX16	30740925	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.807000	0.55591	2.366000	0.80165	0.491000	0.48974	GCC		0.637	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587		Missense_Mutation
CLIC1	1192	broad.mit.edu	37	6	31704066	31704066	+	Silent	SNP	T	T	C	rs147567766	byFrequency	TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr6:31704066T>C	ENST00000375780.2	-	2	584	c.12A>G	c.(10-12)gaA>gaG	p.E4E	CLIC1_ENST00000375784.3_Silent_p.E4E|CLIC1_ENST00000395892.1_Silent_p.E4E|CLIC1_ENST00000375779.2_Silent_p.E4E			O00299	CLIC1_HUMAN	chloride intracellular channel 1	4	Required for insertion into the membrane.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|platelet aggregation (GO:0070527)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of mitochondrial membrane potential (GO:0051881)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|brush border (GO:0005903)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.E4E(1)		central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)|skin(1)	7						CCTGCGGTTGTTCTTCAGCCA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	6											137.0	106.0	117.0					6																	31704066		1511	2709	4220	31812045	SO:0001819	synonymous_variant	1192			U93205	CCDS4719.1	6p21.3	2012-09-26			ENSG00000213719	ENSG00000213719		"""Ion channels / Chloride channels : Intracellular"""	2062	protein-coding gene	gene with protein product		602872				9139710	Standard	NM_001288		Approved	NCC27, p64CLCP	uc003nwr.3	O00299	OTTHUMG00000031103	ENST00000375780.2:c.12A>G	6.37:g.31704066T>C			31812045	Q15089|Q502X1	Silent	SNP	ENST00000375780.2	37	CCDS4719.1	SNP	60	Broad																																																																																				0.597	CLIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076167.3	NM_001288		Silent
FAM83B	222584	broad.mit.edu	37	6	54804999	54804999	+	Silent	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr6:54804999T>C	ENST00000306858.7	+	5	1346	c.1230T>C	c.(1228-1230)aaT>aaC	p.N410N	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	410			N -> S (in dbSNP:rs13211183).					p.N410N(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					ATAGAACCAATAATCCACCTG	0.458																																																1	Substitution - coding silent(1)	ovary(1)	6											77.0	80.0	79.0					6																	54804999		2203	4300	6503	54912958	SO:0001819	synonymous_variant	222584			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1230T>C	6.37:g.54804999T>C			54912958	Q2M1P3|Q96DQ2	Silent	SNP	ENST00000306858.7	37	CCDS34479.1	SNP	49	Broad																																																																																				0.458	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		Silent
FAM83B	222584	broad.mit.edu	37	6	54806238	54806238	+	Silent	SNP	A	A	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr6:54806238A>G	ENST00000306858.7	+	5	2585	c.2469A>G	c.(2467-2469)aaA>aaG	p.K823K	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	823								p.K823K(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					CAGACACAAAAGTTGATTCAT	0.383																																																1	Substitution - coding silent(1)	ovary(1)	6											42.0	41.0	41.0					6																	54806238		2203	4300	6503	54914197	SO:0001819	synonymous_variant	222584			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.2469A>G	6.37:g.54806238A>G			54914197	Q2M1P3|Q96DQ2	Silent	SNP	ENST00000306858.7	37	CCDS34479.1	SNP	3	Broad																																																																																				0.383	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		Silent
IBTK	25998	broad.mit.edu	37	6	82924291	82924291	+	Silent	SNP	C	C	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr6:82924291C>A	ENST00000306270.7	-	12	2406	c.1857G>T	c.(1855-1857)gtG>gtT	p.V619V	IBTK_ENST00000503631.1_Intron|IBTK_ENST00000510291.1_Silent_p.V619V	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	619	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)	p.V619V(1)		central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		CCTTCTCTACCACAAAGAGAT	0.333																																																1	Substitution - coding silent(1)	ovary(1)	6											47.0	47.0	47.0					6																	82924291		2203	4300	6503	82981010	SO:0001819	synonymous_variant	25998			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.1857G>T	6.37:g.82924291C>A			82981010	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Silent	SNP	ENST00000306270.7	37	CCDS34490.1	SNP	21	Broad																																																																																				0.333	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525		Silent
TPBG	7162	broad.mit.edu	37	6	83075023	83075023	+	Silent	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr6:83075023G>C	ENST00000369750.3	+	2	962	c.345G>C	c.(343-345)ccG>ccC	p.P115P	TPBG_ENST00000543496.1_Silent_p.P115P|TPBG_ENST00000535040.1_Silent_p.P115P			Q13641	TPBG_HUMAN	trophoblast glycoprotein	115					cell adhesion (GO:0007155)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)		p.P115P(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)		CCCGCCGGCCGCCGCTGGCGG	0.746																																																1	Substitution - coding silent(1)	ovary(1)	6											9.0	11.0	10.0					6																	83075023		1366	3054	4420	83131742	SO:0001819	synonymous_variant	7162			AJ012159	CCDS4995.1	6q14-q15	2008-07-29			ENSG00000146242	ENSG00000146242			12004	protein-coding gene	gene with protein product		190920				8132670	Standard	NM_006670		Approved	5T4-AG, 5T4	uc003pjo.3	Q13641	OTTHUMG00000015103	ENST00000369750.3:c.345G>C	6.37:g.83075023G>C			83131742	A8K555	Silent	SNP	ENST00000369750.3	37	CCDS4995.1	SNP	38	Broad																																																																																				0.746	TPBG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041340.1			Silent
ZNF292	23036	broad.mit.edu	37	6	87965018	87965018	+	Silent	SNP	A	A	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr6:87965018A>G	ENST00000369577.3	+	8	1714	c.1671A>G	c.(1669-1671)gtA>gtG	p.V557V	ZNF292_ENST00000339907.4_Silent_p.V552V	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	557						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.V412V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		ACAGAATAGTACGACATGCTC	0.388																																																1	Substitution - coding silent(1)	ovary(1)	6											97.0	89.0	92.0					6																	87965018		1871	4107	5978	88021737	SO:0001819	synonymous_variant	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.1671A>G	6.37:g.87965018A>G			88021737	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Silent	SNP	ENST00000369577.3	37	CCDS47457.1	SNP	14	Broad																																																																																				0.388	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021		Silent
CYCS	54205	broad.mit.edu	37	7	25163377	25163377	+	Silent	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr7:25163377C>T	ENST00000305786.2	-	3	430	c.261G>A	c.(259-261)aaG>aaA	p.K87K	CYCS_ENST00000409764.1_Silent_p.K87K|CYCS_ENST00000409409.1_Silent_p.K87K	NM_018947.5	NP_061820.1	P99999	CYC_HUMAN	cytochrome c, somatic	87					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|dephosphorylation (GO:0016311)|intrinsic apoptotic signaling pathway (GO:0097193)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)|respiratory chain (GO:0070469)	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity (GO:0045155)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.K87K(1)		endometrium(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	4					Minocycline(DB01017)	CTTCCTTCTTCTTAATGCCGA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	7											73.0	77.0	75.0					7																	25163377		2203	4300	6503	25129902	SO:0001819	synonymous_variant	54205			M22877	CCDS5393.1	7p21.2	2014-09-17			ENSG00000172115	ENSG00000172115			19986	protein-coding gene	gene with protein product		123970				11790791	Standard	NM_018947		Approved	HCS, CYC	uc003sxl.3	P99999	OTTHUMG00000128495	ENST00000305786.2:c.261G>A	7.37:g.25163377C>T			25129902	A4D166|B2R4I1|P00001|Q6NUR2|Q6NX69|Q96BV4	Silent	SNP	ENST00000305786.2	37	CCDS5393.1	SNP	32	Broad																																																																																				0.378	CYCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250299.2			Silent
EPDR1	54749	broad.mit.edu	37	7	37960520	37960520	+	5'UTR	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr7:37960520G>C	ENST00000199448.4	+	0	358				EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000476620.1_Intron|EPDR1_ENST00000559325.1_Silent_p.S113S|EPDR1_ENST00000423717.1_5'UTR	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1						cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)	p.S113S(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						GCTTGCCCTCGGGCCGGGGAA	0.736																																																1	Substitution - coding silent(1)	ovary(1)	7											11.0	16.0	14.0					7																	37960520		2174	4272	6446	37927045	SO:0001623	5_prime_UTR_variant	54749			BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.-22G>C	7.37:g.37960520G>C			37927045	A8K4C0|C9JYS3|Q06BL0|Q99M77	Silent	SNP	ENST00000199448.4	37	CCDS5454.2	SNP	39	Broad																																																																																				0.736	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220037.3	NM_017549		Silent
URGCP	55665	broad.mit.edu	37	7	43918650	43918650	+	Missense_Mutation	SNP	C	C	T	rs201075158		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr7:43918650C>T	ENST00000453200.1	-	6	905	c.412G>A	c.(412-414)Gtg>Atg	p.V138M	URGCP_ENST00000402306.3_Missense_Mutation_p.V129M|URGCP_ENST00000447717.3_Missense_Mutation_p.V95M|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000223341.7_Missense_Mutation_p.V95M|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.V95M|URGCP_ENST00000443736.1_Missense_Mutation_p.V95M			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	138					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.V95M(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TCTGGGAGCACGTCCAGCACC	0.552																																																1	Substitution - Missense(1)	ovary(1)	7											87.0	93.0	91.0					7																	43918650		2004	4171	6175	43885175	SO:0001583	missense	55665				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.412G>A	7.37:g.43918650C>T	ENSP00000396918:p.Val138Met		43885175	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	ENST00000453200.1	37	CCDS47578.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	5.521	0.281010	0.10458	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717;ENST00000426198;ENST00000455877	T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.6	-11.2	0.00127	.	2.629040	0.01113	N	0.005629	T	0.21468	0.0517	N	0.12961	0.28	0.09310	N	1	B;B	0.23058	0.033;0.079	B;B	0.09377	0.004;0.004	T	0.15407	-1.0438	10	0.46703	T	0.11	-1.3133	1.2827	0.02044	0.4263:0.1057:0.2165:0.2515	.	129;138	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	M	95;95;129;95;138;95;95;95	ENSP00000223341:V95M;ENSP00000336872:V95M;ENSP00000384955:V129M;ENSP00000392136:V95M;ENSP00000396918:V138M;ENSP00000402803:V95M;ENSP00000389990:V95M	ENSP00000223341:V95M	V	-	1	0	URGCP	43885175	0.000000	0.05858	0.000000	0.03702	0.668000	0.39293	-3.184000	0.00567	-2.685000	0.00406	-0.274000	0.10170	GTG		0.552	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664		Missense_Mutation
TRIM50	135892	broad.mit.edu	37	7	72727211	72727211	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr7:72727211C>G	ENST00000333149.2	-	7	1370	c.1170G>C	c.(1168-1170)aaG>aaC	p.K390N	TRIM50_ENST00000453152.1_Missense_Mutation_p.K390N	NM_178125.2	NP_835226.2	Q86XT4	TRI50_HUMAN	tripartite motif containing 50	390	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.K390N(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)	20						CCCGGCCCTCCTTCAGGCCGA	0.692																																																1	Substitution - Missense(1)	ovary(1)	7											18.0	18.0	18.0					7																	72727211		2194	4292	6486	72365147	SO:0001583	missense	135892			AY081948	CCDS34654.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000146755	ENSG00000146755		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19017	protein-coding gene	gene with protein product		612548	"""tripartite motif-containing 50A"", ""tripartite motif-containing 50"""	TRIM50A			Standard	NM_001281450		Approved	FLJ32804	uc003txy.1	Q86XT4	OTTHUMG00000156805	ENST00000333149.2:c.1170G>C	7.37:g.72727211C>G	ENSP00000327994:p.Lys390Asn		72365147	Q86XT3	Missense_Mutation	SNP	ENST00000333149.2	37	CCDS34654.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217691	0.58560	.	.	ENSG00000146755	ENST00000333149;ENST00000453152	T;T	0.68624	-0.34;-0.34	4.62	1.68	0.24146	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000009	T	0.66934	0.2840	L	0.37897	1.145	0.36874	D	0.889065	D;D	0.76494	0.999;0.999	D;D	0.72338	0.961;0.977	T	0.64922	-0.6293	10	0.22706	T	0.39	.	7.2874	0.26346	0.0:0.5941:0.0:0.4059	.	389;390	Q86XT4-2;Q86XT4	.;TRI50_HUMAN	N	390	ENSP00000327994:K390N;ENSP00000413875:K390N	ENSP00000327994:K390N	K	-	3	2	TRIM50	72365147	0.998000	0.40836	1.000000	0.80357	0.821000	0.46438	1.134000	0.31442	0.613000	0.30089	0.561000	0.74099	AAG		0.692	TRIM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345925.1	NM_178125		Missense_Mutation
PMPCB	9512	broad.mit.edu	37	7	102937979	102937979	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr7:102937979C>G	ENST00000249269.4	+	1	111	c.73C>G	c.(73-75)Ctt>Gtt	p.L25V	PMPCB_ENST00000428154.1_Missense_Mutation_p.L25V|PMPCB_ENST00000420236.2_5'UTR	NM_004279.2	NP_004270.2	O75439	MPPB_HUMAN	peptidase (mitochondrial processing) beta	25					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.L25V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(9)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CAGCGAGAGTCTTCTAATCCG	0.662											OREG0018240	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	7											36.0	41.0	39.0					7																	102937979		2203	4299	6502	102725215	SO:0001583	missense	9512			AF054182	CCDS5730.1	7q22.1	2007-07-30			ENSG00000105819	ENSG00000105819			9119	protein-coding gene	gene with protein product		603131				9653160	Standard	XM_005250717		Approved	MPPB, MPPP52	uc003vbl.3	O75439	OTTHUMG00000157205	ENST00000249269.4:c.73C>G	7.37:g.102937979C>G	ENSP00000249269:p.Leu25Val	1370	102725215	O60416|Q96FV4	Missense_Mutation	SNP	ENST00000249269.4	37	CCDS5730.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	.	11.89	1.772707	0.31411	.	.	ENSG00000105819	ENST00000249269;ENST00000428154	T;T	0.11712	2.76;2.75	5.31	-3.57	0.04612	.	1.003380	0.08026	N	0.992751	T	0.04815	0.0130	N	0.08118	0	0.20307	N	0.999915	B;B;B	0.17038	0.0;0.02;0.004	B;B;B	0.16722	0.001;0.016;0.015	T	0.43972	-0.9358	10	0.31617	T	0.26	.	6.7436	0.23449	0.1344:0.2736:0.0:0.5921	.	25;25;25	B3KM34;O75439;G3V0E4	.;MPPB_HUMAN;.	V	25	ENSP00000249269:L25V;ENSP00000390035:L25V	ENSP00000249269:L25V	L	+	1	0	PMPCB	102725215	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-0.444000	0.06854	-0.580000	0.05944	-0.738000	0.03535	CTT		0.662	PMPCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347913.1	NM_004279		Missense_Mutation
NRCAM	4897	broad.mit.edu	37	7	107818499	107818499	+	Silent	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr7:107818499C>T	ENST00000425651.2	-	23	2909	c.2910G>A	c.(2908-2910)ttG>ttA	p.L970L	NRCAM_ENST00000351718.4_Silent_p.L954L|NRCAM_ENST00000413765.2_Silent_p.L951L|NRCAM_ENST00000379024.4_Silent_p.L951L|NRCAM_ENST00000379022.4_Silent_p.L970L|NRCAM_ENST00000379028.3_Silent_p.L970L	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	970	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)	p.L954L(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						GATCCCATTCCAAAGTGAGAG	0.453																																																1	Substitution - coding silent(1)	ovary(1)	7											85.0	74.0	78.0					7																	107818499		2203	4300	6503	107605735	SO:0001819	synonymous_variant	4897				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2910G>A	7.37:g.107818499C>T			107605735	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	ENST00000425651.2	37	CCDS47686.1	SNP	21	Broad																																																																																				0.453	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132		Silent
PTPRZ1	5803	broad.mit.edu	37	7	121650503	121650503	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr7:121650503A>T	ENST00000393386.2	+	12	1814	c.1403A>T	c.(1402-1404)aAt>aTt	p.N468I	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.N468I	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	468					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.N468I(2)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ACACACTACAATCGCATAGGG	0.418																																																2	Substitution - Missense(2)	ovary(2)	7											152.0	136.0	141.0					7																	121650503		2203	4300	6503	121437739	SO:0001583	missense	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1403A>T	7.37:g.121650503A>T	ENSP00000377047:p.Asn468Ile		121437739	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	7.171	0.587565	0.13812	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.46451	0.92;0.87	5.91	3.57	0.40892	.	0.691832	0.14613	N	0.308886	T	0.37652	0.1011	M	0.63428	1.95	0.09310	N	1	B;P	0.43169	0.309;0.8	B;B	0.36030	0.075;0.216	T	0.24835	-1.0149	10	0.87932	D	0	.	9.2999	0.37838	0.7935:0.0:0.2065:0.0	.	468;468	C9JFM0;P23471	.;PTPRZ_HUMAN	I	468	ENSP00000377047:N468I;ENSP00000410000:N468I	ENSP00000377047:N468I	N	+	2	0	PTPRZ1	121437739	0.377000	0.25106	0.018000	0.16275	0.065000	0.16274	1.620000	0.36976	0.518000	0.28383	0.533000	0.62120	AAT		0.418	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		Missense_Mutation
PARP12	64761	broad.mit.edu	37	7	139726033	139726033	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr7:139726033G>A	ENST00000263549.3	-	11	2617	c.1744C>T	c.(1744-1746)Cgg>Tgg	p.R582W		NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	582	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.R582W(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					CCACAGACCCGCCAGTCAAAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	7											81.0	76.0	77.0					7																	139726033		2203	4300	6503	139372502	SO:0001583	missense	64761			AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.1744C>T	7.37:g.139726033G>A	ENSP00000263549:p.Arg582Trp		139372502	Q9H610|Q9NP36|Q9NTI3	Missense_Mutation	SNP	ENST00000263549.3	37	CCDS5857.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889667	0.72524	.	.	ENSG00000059378	ENST00000263549	T	0.15017	2.46	5.07	1.8	0.24995	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.53753	0.1816	H	0.95982	3.75	0.54753	D	0.999988	D	0.89917	1.0	D	0.97110	1.0	T	0.71507	-0.4572	10	0.87932	D	0	.	14.9338	0.70938	0.0:0.0:0.5221:0.4779	.	582	Q9H0J9	PAR12_HUMAN	W	582	ENSP00000263549:R582W	ENSP00000263549:R582W	R	-	1	2	PARP12	139372502	0.999000	0.42202	1.000000	0.80357	0.943000	0.58893	0.499000	0.22546	0.490000	0.27771	0.467000	0.42956	CGG		0.582	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750		Missense_Mutation
OR2A5	393046	broad.mit.edu	37	7	143748037	143748037	+	Silent	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr7:143748037C>T	ENST00000408906.2	+	1	577	c.543C>T	c.(541-543)atC>atT	p.I181I		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I181I(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					TCTGTGAAATCCTGTCTGTCC	0.567																																																1	Substitution - coding silent(1)	ovary(1)	7											183.0	185.0	185.0					7																	143748037		2032	4205	6237	143378970	SO:0001819	synonymous_variant	393046			U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.543C>T	7.37:g.143748037C>T			143378970	B9EGX2|O43885|O43888	Silent	SNP	ENST00000408906.2	37	CCDS43668.1	SNP	30	Broad																																																																																				0.567	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349986.1			Silent
RP1	6101	broad.mit.edu	37	8	55540233	55540233	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr8:55540233T>A	ENST00000220676.1	+	4	3939	c.3791T>A	c.(3790-3792)gTa>gAa	p.V1264E		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1264					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.V1264E(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			ATGTGCACTGTAAATAAGGCT	0.448																																					Colon(91;1014 1389 7634 14542 40420)											1	Substitution - Missense(1)	ovary(1)	8											155.0	149.0	151.0					8																	55540233		2203	4300	6503	55702786	SO:0001583	missense	6101			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3791T>A	8.37:g.55540233T>A	ENSP00000220676:p.Val1264Glu		55702786		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	9.720	1.159311	0.21454	.	.	ENSG00000104237	ENST00000220676	T	0.27557	1.66	4.85	-1.77	0.07982	.	0.812859	0.10623	N	0.653167	T	0.17662	0.0424	L	0.34521	1.04	0.09310	N	1	B	0.17465	0.022	B	0.15052	0.012	T	0.32161	-0.9917	10	0.87932	D	0	.	0.756	0.00999	0.1701:0.2926:0.1758:0.3615	.	1264	P56715	RP1_HUMAN	E	1264	ENSP00000220676:V1264E	ENSP00000220676:V1264E	V	+	2	0	RP1	55702786	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.015000	0.13355	-0.168000	0.10853	-0.256000	0.11100	GTA		0.448	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269		Missense_Mutation
CPA6	57094	broad.mit.edu	37	8	68421759	68421759	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr8:68421759A>C	ENST00000297770.4	-	5	742	c.527T>G	c.(526-528)aTt>aGt	p.I176S	CPA6_ENST00000518549.1_Missense_Mutation_p.I176S|CPA6_ENST00000297769.4_Missense_Mutation_p.I28S	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	176						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.I176S(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			TACCTTTAAAATAAAAAGAGA	0.303																																																1	Substitution - Missense(1)	ovary(1)	8											52.0	53.0	52.0					8																	68421759		2203	4294	6497	68584313	SO:0001583	missense	57094			AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.527T>G	8.37:g.68421759A>C	ENSP00000297770:p.Ile176Ser		68584313	Q8NEX8|Q8TDE8|Q9NRI9	Missense_Mutation	SNP	ENST00000297770.4	37	CCDS6200.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	17.79	3.475382	0.63737	.	.	ENSG00000165078	ENST00000297769;ENST00000297770;ENST00000518549	T;T;T	0.10668	2.85;2.85;2.85	5.49	5.49	0.81192	Peptidase M14, carboxypeptidase A (3);	0.176634	0.49305	D	0.000151	T	0.09423	0.0232	N	0.05124	-0.11	0.35961	D	0.834617	P;P;B	0.45827	0.817;0.867;0.009	B;P;B	0.47346	0.347;0.544;0.051	T	0.33266	-0.9875	10	0.87932	D	0	.	15.2505	0.73542	1.0:0.0:0.0:0.0	.	176;28;176	Q8N4T0-2;Q8N4T0-3;Q8N4T0	.;.;CBPA6_HUMAN	S	28;176;176	ENSP00000297769:I28S;ENSP00000297770:I176S;ENSP00000431112:I176S	ENSP00000297769:I28S	I	-	2	0	CPA6	68584313	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.755000	0.85180	2.088000	0.63022	0.528000	0.53228	ATT		0.303	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361		Missense_Mutation
VPS13B	157680	broad.mit.edu	37	8	100866130	100866130	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr8:100866130C>T	ENST00000358544.2	+	56	10699	c.10588C>T	c.(10588-10590)Cgg>Tgg	p.R3530W	VPS13B_ENST00000357162.2_Missense_Mutation_p.R3505W|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3530					protein transport (GO:0015031)			p.R3530W(1)|p.R3505R(1)|p.R3530R(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAAACCTGCTCGGTTATACGT	0.403																																					Colon(161;2205 2542 7338 31318)											3	Substitution - coding silent(2)|Substitution - Missense(1)	lung(2)|ovary(1)	8											115.0	119.0	118.0					8																	100866130		2203	4300	6503	100935306	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.10588C>T	8.37:g.100866130C>T	ENSP00000351346:p.Arg3530Trp		100935306	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524735	0.64747	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.71222	-0.54;-0.55	5.67	3.66	0.41972	.	0.000000	0.85682	D	0.000000	T	0.78735	0.4330	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.967;0.998	T	0.79801	-0.1650	10	0.72032	D	0.01	.	14.7758	0.69732	0.2626:0.7374:0.0:0.0	.	3505;3530	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	W	3505;3530	ENSP00000349685:R3505W;ENSP00000351346:R3530W	ENSP00000349685:R3505W	R	+	1	2	VPS13B	100935306	1.000000	0.71417	0.990000	0.47175	0.986000	0.74619	2.242000	0.43106	0.668000	0.31126	0.650000	0.86243	CGG		0.403	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		Missense_Mutation
TG	7038	broad.mit.edu	37	8	133900728	133900728	+	Silent	SNP	T	T	C			TCGA-24-1422-01	TCGA-24-1422-10			T	C	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr8:133900728T>C	ENST00000220616.4	+	10	2716	c.2676T>C	c.(2674-2676)caT>caC	p.H892H	TG_ENST00000377869.1_Silent_p.H892H	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	892	Thyroglobulin type-1 7. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.H892H(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CTTTGGCACATTTTGATCTTC	0.517																																																1	Substitution - coding silent(1)	ovary(1)	8											38.0	37.0	37.0					8																	133900728		2203	4300	6503	133969910	SO:0001819	synonymous_variant	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.2676T>C	8.37:g.133900728T>C			133969910	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Silent	SNP	ENST00000220616.4	37	CCDS34944.1	SNP	52	Broad																																																																																				0.517	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235		Silent
FAM135B	51059	broad.mit.edu	37	8	139380193	139380193	+	Missense_Mutation	SNP	C	C	A	rs371759322		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr8:139380193C>A	ENST00000395297.1	-	2	204	c.34G>T	c.(34-36)Gta>Tta	p.V12L		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	12								p.V12I(2)|p.V12L(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TGTAGCTCTACCGAAAACTCA	0.368										HNSCC(54;0.14)																																						4	Substitution - Missense(4)	ovary(2)|lung(2)	8											153.0	146.0	148.0					8																	139380193		1866	4103	5969	139449375	SO:0001583	missense	51059			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.34G>T	8.37:g.139380193C>A	ENSP00000378710:p.Val12Leu		139449375	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403709	0.62288	.	.	ENSG00000147724	ENST00000395297;ENST00000160713;ENST00000520380	T	0.21191	2.02	5.54	4.66	0.58398	.	0.122706	0.31134	U	0.008184	T	0.17619	0.0423	L	0.43152	1.355	0.35971	D	0.835297	B	0.32653	0.379	B	0.23716	0.048	T	0.15378	-1.0439	10	0.44086	T	0.13	-8.2035	13.1697	0.59591	0.0:0.9222:0.0:0.0778	.	12	Q49AJ0	F135B_HUMAN	L	12	ENSP00000378710:V12L	ENSP00000160713:V12L	V	-	1	0	FAM135B	139449375	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.193000	0.42658	1.471000	0.48121	0.561000	0.74099	GTA		0.368	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		Missense_Mutation
SLC45A4	57210	broad.mit.edu	37	8	142228775	142228775	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr8:142228775G>C	ENST00000024061.3	-	4	1118	c.811C>G	c.(811-813)Ccc>Gcc	p.P271A	SLC45A4_ENST00000519067.1_Missense_Mutation_p.P271A|SLC45A4_ENST00000433583.2_Missense_Mutation_p.P264A|SLC45A4_ENST00000517878.1_Missense_Mutation_p.P322A	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)		p.P271A(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			AGCAGCTCGGGCTCCAGGTCC	0.667																																																1	Substitution - Missense(1)	ovary(1)	8											59.0	62.0	61.0					8																	142228775		2203	4299	6502	142297957	SO:0001583	missense	57210			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.811C>G	8.37:g.142228775G>C	ENSP00000024061:p.Pro271Ala		142297957	Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	ENST00000024061.3	37	CCDS34948.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	14.39	2.522533	0.44866	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061	T;T;T;T	0.15372	2.48;2.45;2.46;2.43	5.75	1.93	0.25924	.	0.670164	0.16216	N	0.224262	T	0.14657	0.0354	L	0.56769	1.78	0.29437	N	0.859441	B;B;B	0.24618	0.065;0.107;0.059	B;B;B	0.22753	0.015;0.041;0.021	T	0.14200	-1.0481	10	0.41790	T	0.15	-41.1095	3.9675	0.09437	0.3936:0.1732:0.4332:0.0	.	322;271;271	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	A	271;322;264;271	ENSP00000429059:P271A;ENSP00000428137:P322A;ENSP00000400799:P264A;ENSP00000024061:P271A	ENSP00000024061:P271A	P	-	1	0	SLC45A4	142297957	0.961000	0.32948	0.997000	0.53966	0.976000	0.68499	1.219000	0.32479	0.353000	0.24079	0.555000	0.69702	CCC		0.667	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325		Missense_Mutation
ZNF250	58500	broad.mit.edu	37	8	146107277	146107277	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr8:146107277A>C	ENST00000292579.7	-	6	1422	c.1306T>G	c.(1306-1308)Tca>Gca	p.S436A	ZNF250_ENST00000342660.6_Intron|ZNF250_ENST00000417550.2_Missense_Mutation_p.S431A|ZNF250_ENST00000543949.1_Intron	NM_001109689.3|NM_021061.4	NP_001103159.1|NP_066405.1	P15622	ZN250_HUMAN	zinc finger protein 250	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(2)|lung(8)|skin(1)	15	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		ATCAGGTGTGAGTGCTGAACG	0.572																																					NSCLC(16;520 556 24096 40084 43446)											0			8											157.0	145.0	149.0					8																	146107277		2203	4300	6503	146078081	SO:0001583	missense	58500			AK095705	CCDS34972.1, CCDS55282.1	8q24.3	2013-01-08	2004-11-08			ENSG00000196150		"""Zinc fingers, C2H2-type"", ""-"""	13044	protein-coding gene	gene with protein product			"""zinc finger protein 647"""	ZNF647		12477932	Standard	NM_021061		Approved	MGC9718, ZFP647	uc003zer.4	P15622		ENST00000292579.7:c.1306T>G	8.37:g.146107277A>C	ENSP00000292579:p.Ser436Ala		146078081	D3DWP1|Q59HE9|Q8N942|Q96AH9	Missense_Mutation	SNP	ENST00000292579.7	37	CCDS34972.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	10.39	1.338054	0.24253	.	.	ENSG00000196150	ENST00000292579;ENST00000417550	T;T	0.07327	3.2;3.2	4.11	4.11	0.48088	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41097	D	0.000955	T	0.16385	0.0394	M	0.73217	2.22	0.22253	N	0.999256	D;P	0.55172	0.97;0.512	P;B	0.49140	0.601;0.18	T	0.06092	-1.0846	10	0.44086	T	0.13	-17.0142	13.0284	0.58829	1.0:0.0:0.0:0.0	.	431;436	D3DWP1;P15622	.;ZN250_HUMAN	A	436;431	ENSP00000292579:S436A;ENSP00000393442:S431A	ENSP00000292579:S436A	S	-	1	0	ZNF250	146078081	0.000000	0.05858	1.000000	0.80357	0.967000	0.64934	0.084000	0.14891	2.098000	0.63641	0.402000	0.26972	TCA		0.572	ZNF250-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382968.1	NM_021061		Missense_Mutation
RUSC2	9853	broad.mit.edu	37	9	35560620	35560620	+	Missense_Mutation	SNP	G	G	C	rs372907491		TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr9:35560620G>C	ENST00000455600.1	+	10	4552	c.3983G>C	c.(3982-3984)tGc>tCc	p.C1328S	FAM166B_ENST00000492890.1_5'Flank	NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1328						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)	p.C1328S(1)		NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			GCTGAGGCCTGCCCTGCCTCT	0.687																																																1	Substitution - Missense(1)	ovary(1)	9											9.0	12.0	11.0					9																	35560620		2167	4255	6422	35550620	SO:0001583	missense	9853			AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.3983G>C	9.37:g.35560620G>C	ENSP00000393922:p.Cys1328Ser		35550620	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	ENST00000455600.1	37	CCDS35008.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	10.37	1.332700	0.24167	.	.	ENSG00000198853	ENST00000361226;ENST00000455600	T;T	0.23147	1.92;1.92	5.16	5.16	0.70880	.	0.192835	0.53938	D	0.000044	T	0.22437	0.0541	L	0.29908	0.895	0.41422	D	0.987809	B	0.22683	0.073	B	0.20767	0.031	T	0.02966	-1.1088	10	0.41790	T	0.15	-13.4318	17.6253	0.88092	0.0:0.0:1.0:0.0	.	1328	Q8N2Y8	RUSC2_HUMAN	S	1328	ENSP00000355177:C1328S;ENSP00000393922:C1328S	ENSP00000355177:C1328S	C	+	2	0	RUSC2	35550620	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	3.841000	0.55850	2.409000	0.81822	0.561000	0.74099	TGC		0.687	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462		Missense_Mutation
SMC2	10592	broad.mit.edu	37	9	106896802	106896802	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chr9:106896802T>A	ENST00000286398.7	+	23	3503	c.3215T>A	c.(3214-3216)gTt>gAt	p.V1072D	SMC2_ENST00000374793.3_Missense_Mutation_p.V1072D|SMC2_ENST00000303219.8_Missense_Mutation_p.V1072D|SMC2_ENST00000374787.3_Missense_Mutation_p.V1072D	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	1072					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.V1072D(1)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						GAGTTCAAGGTTGCCTTGGGA	0.403																																																1	Substitution - Missense(1)	ovary(1)	9											116.0	119.0	118.0					9																	106896802		2203	4300	6503	105936623	SO:0001583	missense	10592			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.3215T>A	9.37:g.106896802T>A	ENSP00000286398:p.Val1072Asp		105936623	Q6IEE0|Q9P1P2	Missense_Mutation	SNP	ENST00000286398.7	37	CCDS35086.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	26.6	4.750540	0.89753	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000303219;ENST00000374787	T;T;T;T	0.10005	2.92;2.92;2.92;2.92	5.92	5.92	0.95590	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.46678	0.1405	H	0.95224	3.64	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62343	-0.6874	10	0.87932	D	0	-20.2287	15.206	0.73180	0.0:0.0:0.0:1.0	.	1072	O95347	SMC2_HUMAN	D	1072	ENSP00000286398:V1072D;ENSP00000363925:V1072D;ENSP00000306152:V1072D;ENSP00000363919:V1072D	ENSP00000286398:V1072D	V	+	2	0	SMC2	105936623	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.040000	0.89188	2.267000	0.75376	0.477000	0.44152	GTT		0.403	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1			Missense_Mutation
FRMPD4	9758	broad.mit.edu	37	X	12734761	12734761	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1422-01	TCGA-24-1422-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chrX:12734761C>T	ENST00000380682.1	+	15	2689	c.2183C>T	c.(2182-2184)gCg>gTg	p.A728V		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	728					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.A728V(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						TTCCAGGCCGCGGAGGGGATC	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											106.0	108.0	107.0					X																	12734761		2203	4300	6503	12644682	SO:0001583	missense	9758			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2183C>T	X.37:g.12734761C>T	ENSP00000370057:p.Ala728Val		12644682	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	13.29	2.192817	0.38707	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.27104	1.69	5.71	5.71	0.89125	.	0.304412	0.35870	N	0.002934	T	0.28234	0.0697	M	0.63428	1.95	0.09310	N	1	B;B	0.31459	0.324;0.324	B;B	0.23852	0.049;0.049	T	0.16394	-1.0404	10	0.22706	T	0.39	.	18.8648	0.92287	0.0:1.0:0.0:0.0	.	720;728	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	V	728;719;717	ENSP00000370057:A728V	ENSP00000304583:A717V	A	+	2	0	FRMPD4	12644682	0.519000	0.26242	0.005000	0.12908	0.097000	0.18754	5.634000	0.67833	2.402000	0.81655	0.600000	0.82982	GCG		0.547	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		Missense_Mutation
ATP11C	286410	broad.mit.edu	37	X	138813816	138813816	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1422-01	TCGA-24-1422-10	g.chrX:138813816C>A	ENST00000327569.3	-	29	3494	c.3396G>T	c.(3394-3396)ttG>ttT	p.L1132F	ATP11C_ENST00000361648.2_Intron|ATP11C_ENST00000370557.1_Intron|ATP11C_ENST00000460773.1_5'UTR	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	1132					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.L1132F(1)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					GTACCTGTTACAATACATTAG	0.363																																																1	Substitution - Missense(1)	ovary(1)	X											109.0	100.0	103.0					X																	138813816		2203	4299	6502	138641482	SO:0001583	missense	286410			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.3396G>T	X.37:g.138813816C>A	ENSP00000332756:p.Leu1132Phe		138641482	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	CCDS14668.1	SNP	17	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.497|9.497	1.102112|1.102112	0.20632|0.20632	.|.	.|.	ENSG00000101974|ENSG00000101974	ENST00000327569|ENST00000433868	T|.	0.07021|.	3.23|.	5.76|5.76	2.88|2.88	0.33553|0.33553	.|.	0.143104|.	0.32372|.	N|.	0.006194|.	T|T	0.24699|0.24699	0.0599|0.0599	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.03453|0.03453	-1.1035|-1.1035	10|5	0.56958|.	D|.	0.05|.	.|.	4.8416|4.8416	0.13492|0.13492	0.304:0.5366:0.0:0.1594|0.304:0.5366:0.0:0.1594	.|.	1132|.	Q8NB49|.	AT11C_HUMAN|.	F|L	1132|165	ENSP00000332756:L1132F|.	ENSP00000332756:L1132F|.	L|V	-|-	3|1	2|0	ATP11C|ATP11C	138641482|138641482	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	1.453000|1.453000	0.35167|0.35167	0.588000|0.588000	0.29660|0.29660	0.600000|0.600000	0.82982|0.82982	TTG|GTA		0.363	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694		Missense_Mutation
RERE	473	broad.mit.edu	37	1	8419868	8419869	+	In_Frame_Ins	INS	-	-	CTCCTT	rs147985313|rs557606465	byFrequency	TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-1422-01	TCGA-24-1422-10	g.chr1:8419868_8419869insCTCCTT	ENST00000337907.3	-	20	4207_4208	c.3573_3574insAAGGAG	c.(3571-3576)gagcgg>gagAAGGAGcgg	p.1190_1191insEK	RERE_ENST00000377464.1_In_Frame_Ins_p.922_923insEK|RERE_ENST00000400908.2_In_Frame_Ins_p.1190_1191insEK|RERE_ENST00000400907.2_Intron|RERE_ENST00000476556.1_In_Frame_Ins_p.636_637insEK	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	1190	Arg/Glu-rich (mixed charge).				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E1191_R1192insKE(1)		central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		tcccgctcccgctccttctcct	0.683																																																1	Insertion - In frame(1)	ovary(1)	1																																								8342456	SO:0001652	inframe_insertion	473			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.3568_3573dupAAGGAG	1.37:g.8419869_8419874dupCTCCTT	ENSP00000338629:p.Glu1189_Lys1190dup		8342455	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	In_Frame_Ins	INS	ENST00000337907.3	37	CCDS95.1	INS	38	Broad																																																																																				0.683	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1			In_Frame_Ins
TRA2B	6434	broad.mit.edu	37	3	185641608	185641608	+	Frame_Shift_Del	DEL	A	A	-			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-1422-01	TCGA-24-1422-10	g.chr3:185641608delA	ENST00000453386.2	-	4	773	c.498delT	c.(496-498)tttfs	p.F166fs	TRA2B_ENST00000471134.1_5'Flank|TRA2B_ENST00000382191.4_Frame_Shift_Del_p.F66fs	NM_004593.2	NP_004584.1	P62995	TRA2B_HUMAN	transformer 2 beta homolog (Drosophila)	166	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.F166fs*4(1)		breast(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	18						CTACATTTTCAAAATATACAA	0.388																																																1	Deletion - Frameshift(1)	ovary(1)	3											84.0	81.0	82.0					3																	185641608		2203	4300	6503	187124302	SO:0001589	frameshift_variant	6434			AF057159	CCDS33905.1, CCDS58872.1	3q26.2-q27	2014-06-13	2009-02-27	2009-02-27	ENSG00000136527	ENSG00000136527		"""RNA binding motif (RRM) containing"""	10781	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 156"""	602719	"""splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)"""	SFRS10		9790768	Standard	NM_004593		Approved	Htra2-beta, PPP1R156	uc003fpv.3	P62995	OTTHUMG00000156641	ENST00000453386.2:c.498delT	3.37:g.185641608delA	ENSP00000416959:p.Phe166fs		187124302	B4DVK2|D3DNU3|O15449|Q15815|Q64283	Frame_Shift_Del	DEL	ENST00000453386.2	37	CCDS33905.1	DEL	5	Broad																																																																																				0.388	TRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344984.1	NM_004593		Frame_Shift_Del
PDE6B	5158	broad.mit.edu	37	4	660316	660322	+	Splice_Site	DEL	CCAGCCT	CCAGCCT	-			TCGA-24-1422-01	TCGA-24-1422-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-1422-01	TCGA-24-1422-10	g.chr4:660316_660322delCCAGCCT	ENST00000496514.1	+	20	2289_2292	c.2268_2271delCCAGCCT	c.(2266-2271)atccag>at	p.IQ756fs	PDE6B_ENST00000255622.6_Splice_Site_p.IQ756fs|PDE6B_ENST00000429163.2_Splice_Site_p.IQ477fs			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	756					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.?(1)		NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	GTTCCTCCCACCAGCCTATGATGGACC	0.633																																					GBM(71;463 1194 9848 25922 46834)											1	Unknown(1)	ovary(1)	4																																								650322	SO:0001630	splice_region_variant	5158			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.2269-1CCAGCCT>-	4.37:g.660316_660322delCCAGCCT			650316	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Splice_Site_Del	DEL	ENST00000496514.1	37	CCDS33932.1	DEL	18	Broad																																																																																				0.633	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	Frame_Shift_Del	Splice_Site_Del
