#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
FAM193A	8603	genome.wustl.edu	37	4	2661684	2661684	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr4:2661684G>A	ENST00000324666.5	+	8	1126	c.775G>A	c.(775-777)Gtg>Atg	p.V259M	FAM193A_ENST00000545951.1_Missense_Mutation_p.V259M|FAM193A_ENST00000505311.1_Missense_Mutation_p.V259M|FAM193A_ENST00000382839.3_Missense_Mutation_p.V259M|FAM193A_ENST00000502458.1_Missense_Mutation_p.V283M	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	259								p.V259M(1)		NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						CCCGCCCAGTGTGTCATCTGC	0.572																																																1	Substitution - Missense(1)	ovary(1)	4											75.0	68.0	70.0					4																	2661684		2203	4300	6503	2631482	SO:0001583	missense	8603			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.775G>A	4.37:g.2661684G>A	ENSP00000324587:p.Val259Met		2631482	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	37	CCDS58875.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	9.584	1.124262	0.20959	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.29142	1.58;2.01;1.58;1.58;1.61	5.93	3.96	0.45880	.	0.103160	0.64402	D	0.000006	T	0.11281	0.0275	N	0.03608	-0.345	0.29519	N	0.853659	B;B;B;B;B	0.24823	0.112;0.112;0.112;0.063;0.063	B;B;B;B;B	0.17722	0.013;0.013;0.019;0.013;0.013	T	0.06427	-1.0827	10	0.32370	T	0.25	-25.9022	4.5068	0.11893	0.3962:0.0:0.6037:0.0	.	259;283;259;283;259	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	M	259;259;259;283;113	ENSP00000372290:V259M;ENSP00000324587:V259M;ENSP00000443617:V259M;ENSP00000427505:V283M;ENSP00000427260:V113M	ENSP00000324587:V259M	V	+	1	0	FAM193A	2631482	1.000000	0.71417	0.098000	0.21074	0.018000	0.09664	5.538000	0.67193	1.507000	0.48752	0.561000	0.74099	GTG		0.572	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704		Missense_Mutation
SFMBT2	57713	genome.wustl.edu	37	10	7239537	7239537	+	Silent	SNP	C	C	G	rs200717836		TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr10:7239537C>G	ENST00000361972.4	-	15	1761	c.1671G>C	c.(1669-1671)ccG>ccC	p.P557P	SFMBT2_ENST00000397167.1_Silent_p.P557P	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	557					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.P557P(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CGCATTTGCCCGGTCCCACCG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	10											114.0	108.0	110.0					10																	7239537		2203	4300	6503	7279543	SO:0001819	synonymous_variant	57713			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1671G>C	10.37:g.7239537C>G			7279543	A7MD09|Q9HCF5	Silent	SNP	ENST00000361972.4	37	CCDS31138.1	SNP	23	WashU																																																																																				0.473	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880		Silent
TP53	7157	genome.wustl.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1424-01	TCGA-24-1424-10	A	A	G	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr17:7578265A>G	ENST00000269305.4	-	6	773	c.584T>C	c.(583-585)aTc>aCc	p.I195T	TP53_ENST00000455263.2_Missense_Mutation_p.I195T|TP53_ENST00000413465.2_Missense_Mutation_p.I195T|TP53_ENST00000359597.4_Missense_Mutation_p.I195T|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.I195T|TP53_ENST00000420246.2_Missense_Mutation_p.I195T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)	17											100.0	89.0	93.0					17																	7578265		2203	4300	6503	7518990	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>C	17.37:g.7578265A>G	ENSP00000269305:p.Ile195Thr		7518990	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324656	0.41197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	N	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.52099	D	0.999943	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.991;0.989;0.998;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.995;0.953;0.979;0.995;0.993;0.996	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195T;ENSP00000352610:I195T;ENSP00000269305:I195T;ENSP00000398846:I195T;ENSP00000391127:I195T;ENSP00000391478:I195T;ENSP00000425104:I63T;ENSP00000423862:I102T	ENSP00000269305:I195T	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
KIN	22944	genome.wustl.edu	37	10	7822036	7822036	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1424-01	TCGA-24-1424-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr10:7822036T>C	ENST00000379562.4	-	4	406	c.359A>G	c.(358-360)aAg>aGg	p.K120R	KIN_ENST00000535925.1_Missense_Mutation_p.K120R|KIN_ENST00000543003.1_Missense_Mutation_p.K14R	NM_012311.3	NP_036443.1			Kin17 DNA and RNA binding protein									p.K120R(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(2)	19						GCCCAGCCACTTAGTAAAATC	0.403																																																1	Substitution - Missense(1)	ovary(1)	10											168.0	149.0	155.0					10																	7822036		2203	4300	6503	7862042	SO:0001583	missense	22944			AJ005273	CCDS7080.1	10p15-p14	2014-07-15	2014-07-15		ENSG00000151657	ENSG00000151657			6327	protein-coding gene	gene with protein product		601720	"""antigenic determinant of recA protein (mouse) homolog"", ""KIN, antigenic determinant of recA protein homolog (mouse)"""			1923796, 24140279	Standard	NM_012311		Approved	KIN17, Rts2	uc001ijt.3	O60870	OTTHUMG00000017634	ENST00000379562.4:c.359A>G	10.37:g.7822036T>C	ENSP00000368881:p.Lys120Arg		7862042		Missense_Mutation	SNP	ENST00000379562.4	37	CCDS7080.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	25.3	4.620479	0.87460	.	.	ENSG00000151657	ENST00000535925;ENST00000379562;ENST00000543003	.	.	.	5.74	5.74	0.90152	DNA/RNA-binding protein Kin17, conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.79741	0.4498	M	0.81682	2.555	0.80722	D	1	B;D;D	0.56035	0.412;0.974;0.974	B;D;D	0.75484	0.097;0.986;0.986	T	0.81197	-0.1042	9	0.51188	T	0.08	-27.9075	14.6061	0.68481	0.0:0.0:0.0:1.0	.	14;120;120	F5GXB3;B4DX32;O60870	.;.;KIN17_HUMAN	R	120;120;14	.	ENSP00000368881:K120R	K	-	2	0	KIN	7862042	1.000000	0.71417	0.994000	0.49952	0.818000	0.46254	7.649000	0.83500	2.186000	0.69663	0.533000	0.62120	AAG		0.403	KIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046683.2	NM_012311		Missense_Mutation
SLC7A2	6542	genome.wustl.edu	37	8	17407850	17407850	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr8:17407850G>C	ENST00000494857.1	+	6	957	c.739G>C	c.(739-741)Ggt>Cgt	p.G247R	SLC7A2_ENST00000398090.3_Missense_Mutation_p.G287R|SLC7A2_ENST00000004531.10_Missense_Mutation_p.G287R|SLC7A2_ENST00000470360.1_Missense_Mutation_p.G287R|SLC7A2_ENST00000522656.1_Missense_Mutation_p.G247R	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	247					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)	p.G247R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	CTATGGGGCTGGTGGCTTTAT	0.448																																																1	Substitution - Missense(1)	ovary(1)	8											205.0	166.0	179.0					8																	17407850		2203	4300	6503	17452228	SO:0001583	missense	6542			D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.739G>C	8.37:g.17407850G>C	ENSP00000419140:p.Gly247Arg		17452228	B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Missense_Mutation	SNP	ENST00000494857.1	37	CCDS34852.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	32	5.155020	0.94686	.	.	ENSG00000003989	ENST00000494857;ENST00000522656;ENST00000470360;ENST00000004531;ENST00000398090	D;D;D;D;D	0.91295	-2.68;-2.68;-2.82;-2.7;-2.82	5.62	5.62	0.85841	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.97498	0.9181	H	0.98068	4.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.96;0.998	D	0.98338	1.0537	10	0.87932	D	0	.	20.0425	0.97596	0.0:0.0:1.0:0.0	.	287;287;247	P52569-3;P52569-2;P52569	.;.;CTR2_HUMAN	R	247;247;287;287;287	ENSP00000419140:G247R;ENSP00000430464:G247R;ENSP00000419873:G287R;ENSP00000004531:G287R;ENSP00000381164:G287R	ENSP00000004531:G287R	G	+	1	0	SLC7A2	17452228	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.817000	0.96982	0.563000	0.77884	GGT		0.448	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253367.3	NM_003046		Missense_Mutation
MIB1	57534	genome.wustl.edu	37	18	19429212	19429212	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr18:19429212G>C	ENST00000261537.6	+	17	2713	c.2449G>C	c.(2449-2451)Gaa>Caa	p.E817Q	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	817					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E817Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			TGAAACCTTAGAAGAGTGTAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	18											202.0	201.0	201.0					18																	19429212		2203	4300	6503	17683210	SO:0001583	missense	57534			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.2449G>C	18.37:g.19429212G>C	ENSP00000261537:p.Glu817Gln		17683210	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Missense_Mutation	SNP	ENST00000261537.6	37	CCDS11871.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	14.00	2.406322	0.42715	.	.	ENSG00000101752	ENST00000261537	T	0.79033	-1.23	5.33	5.33	0.75918	.	0.049516	0.85682	D	0.000000	T	0.70228	0.3200	L	0.31804	0.96	0.80722	D	1	B	0.20887	0.049	B	0.29663	0.105	T	0.64202	-0.6463	10	0.14656	T	0.56	-21.8019	19.042	0.93004	0.0:0.0:1.0:0.0	.	817	Q86YT6	MIB1_HUMAN	Q	817	ENSP00000261537:E817Q	ENSP00000261537:E817Q	E	+	1	0	MIB1	17683210	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.494000	0.84150	0.585000	0.79938	GAA		0.363	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774		Missense_Mutation
CENPIP1	100419337	genome.wustl.edu	37	13	19703176	19703176	+	IGR	SNP	G	G	T			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr13:19703176G>T								RNA5SP24 (40455 upstream) : RNU6-52P (13945 downstream)																							AATGTATTTGGTACAAGGTGA	0.338																																																0			13																																								18601176	SO:0001628	intergenic_variant																																13.37:g.19703176G>T			18601176		Missense_Mutation	SNP		37		SNP	44	WashU																																																																																			0	0.338									Missense_Mutation
POTEB2	100287399	genome.wustl.edu	37	15	21071298	21071298	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1424-01	TCGA-24-1424-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr15:21071298T>G	ENST00000454856.4	-	1	345	c.313A>C	c.(313-315)Aag>Cag	p.K105Q		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	105																	CTGTGGAGCTTGTCCAGATCT	0.572																																																0			15											1.0	1.0	1.0					15																	21071298		42	299	341	19335877	SO:0001583	missense	339010				CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.313A>C	15.37:g.21071298T>G	ENSP00000456953:p.Lys105Gln		19335877		Missense_Mutation	SNP	ENST00000454856.4	37	CCDS59248.1	SNP	63	WashU																																																																																				0.572	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471435.1			Missense_Mutation
OR4M2	390538	genome.wustl.edu	37	15	22368759	22368759	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr15:22368759C>A	ENST00000332663.2	+	1	282	c.184C>A	c.(184-186)Ctg>Atg	p.L62M	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L62M(2)		NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TATGTATTTCCTGTTGGCTAA	0.388																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	15											494.0	428.0	450.0					15																	22368759		2203	4300	6503	19870123	SO:0001583	missense	390538			AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.184C>A	15.37:g.22368759C>A	ENSP00000329467:p.Leu62Met		19870123	B9EH16|Q6IEY2	Missense_Mutation	SNP	ENST00000332663.2	37	CCDS32172.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	.	14.73	2.622476	0.46840	.	.	ENSG00000182974	ENST00000332663	T	0.03152	4.03	2.5	2.5	0.30297	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36740	N	0.002434	T	0.12817	0.0311	M	0.86028	2.79	0.26793	N	0.969362	D	0.65815	0.995	P	0.59703	0.862	T	0.02484	-1.1152	10	0.72032	D	0.01	-6.7748	5.3487	0.16024	0.0:0.8342:0.0:0.1658	.	62	Q8NGB6	OR4M2_HUMAN	M	62	ENSP00000329467:L62M	ENSP00000329467:L62M	L	+	1	2	OR4M2	19870123	0.001000	0.12720	1.000000	0.80357	0.984000	0.73092	-0.131000	0.10482	1.422000	0.47177	0.448000	0.29417	CTG		0.388	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			Missense_Mutation
IGLV3-21	28796	genome.wustl.edu	37	22	23055635	23055635	+	RNA	SNP	G	G	C	rs568747731		TCGA-24-1424-01	TCGA-24-1424-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr22:23055635G>C	ENST00000390308.2	+	0	549									immunoglobulin lambda variable 3-21																		CGAAGCCGGGGATGAGGCCGA	0.567																																																0			22											46.0	48.0	47.0					22																	23055635		1954	4145	6099	21385635			0			X71966		22q11.2	2012-02-08			ENSG00000211662	ENSG00000211662		"""Immunoglobulins / IGL locus"""	5905	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151213		22.37:g.23055635G>C			21385635		Missense_Mutation	SNP	ENST00000390308.2	37		SNP	41	WashU																																																																																				0.567	IGLV3-21-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000321817.1	NG_000002		Missense_Mutation
CHRNA7	1139	genome.wustl.edu	37	15	32450703	32450703	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr15:32450703C>T	ENST00000306901.3	+	7	786	c.689C>T	c.(688-690)aCg>aTg	p.T230M	CHRNA7_ENST00000454250.3_Missense_Mutation_p.T259M|CHRNA7_ENST00000455693.2_Missense_Mutation_p.T49M	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	230					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)	p.T230M(1)		endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	CGCCGCAGGACGCTCTACTAT	0.582																																					Esophageal Squamous(193;529 2900 40232 43193)											1	Substitution - Missense(1)	ovary(1)	15											124.0	104.0	111.0					15																	32450703		2200	4297	6497	30237995	SO:0001583	missense	1139			Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.689C>T	15.37:g.32450703C>T	ENSP00000303727:p.Thr230Met		30237995	A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Missense_Mutation	SNP	ENST00000306901.3	37	CCDS10027.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	c	23.4	4.412940	0.83449	.	.	ENSG00000175344	ENST00000437966;ENST00000454250;ENST00000306901;ENST00000455693;ENST00000454016	D;D;D	0.85411	-1.98;-1.98;-1.98	4.51	4.51	0.55191	Neurotransmitter-gated ion-channel ligand-binding (2);Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.94833	0.8331	H	0.96943	3.91	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.96264	0.9193	10	0.87932	D	0	.	15.1122	0.72368	0.0:1.0:0.0:0.0	.	259;126;230	B4DFS0;B1N7G6;P36544	.;.;ACHA7_HUMAN	M	140;259;230;49;154	ENSP00000407546:T259M;ENSP00000303727:T230M;ENSP00000405989:T49M	ENSP00000303727:T230M	T	+	2	0	CHRNA7	30237995	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	7.303000	0.78871	2.502000	0.84385	0.484000	0.47621	ACG		0.582	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251410.2			Missense_Mutation
PCDH7	5099	genome.wustl.edu	37	4	30726071	30726071	+	Silent	SNP	C	C	T			TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr4:30726071C>T	ENST00000361762.2	+	1	4035	c.3027C>T	c.(3025-3027)ccC>ccT	p.P1009P	PCDH7_ENST00000543491.1_Silent_p.P1009P	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	1009					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P962P(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						AGCTTCATCCCCAGTCACCAA	0.512																																																1	Substitution - coding silent(1)	ovary(1)	4											96.0	97.0	97.0					4																	30726071		2203	4300	6503	30335169	SO:0001819	synonymous_variant	5099			AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.3027C>T	4.37:g.30726071C>T			30335169	O60246|O60247|Q4W5C4	Silent	SNP	ENST00000361762.2	37	CCDS33971.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	2.761	-0.257816	0.05791	.	.	ENSG00000169851	ENST00000511884	T	0.38722	1.12	5.08	3.34	0.38264	.	.	.	.	.	T	0.43010	0.1228	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44314	-0.9336	6	0.87932	D	0	.	1.6149	0.02701	0.2908:0.4092:0.1409:0.1591	.	.	.	.	S	699	ENSP00000427066:P699S	ENSP00000427066:P699S	P	+	1	0	PCDH7	30335169	0.000000	0.05858	1.000000	0.80357	0.976000	0.68499	-1.801000	0.01743	0.720000	0.32209	-0.258000	0.10820	CCA		0.512	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589		Silent
C16orf58	64755	genome.wustl.edu	37	16	31510846	31510846	+	Splice_Site	SNP	C	C	A			TCGA-24-1424-01	TCGA-24-1424-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr16:31510846C>A	ENST00000327237.2	-	4	501	c.462G>T	c.(460-462)ggG>ggT	p.G154G	C16orf58_ENST00000570164.1_Splice_Site_p.G154G|C16orf58_ENST00000567994.1_Splice_Site_p.G109G|C16orf58_ENST00000430477.2_Splice_Site_p.G12G			Q96GQ5	RUS1_HUMAN	chromosome 16 open reading frame 58	154						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)	14						CCAGTTTGCTCCTGTTGGGGA	0.527																																																0			16											48.0	47.0	47.0					16																	31510846		2197	4300	6497	31418347	SO:0001630	splice_region_variant	64755			AK023930	CCDS10715.1	16p11.2	2013-03-04			ENSG00000140688	ENSG00000140688			25848	protein-coding gene	gene with protein product							Standard	NM_022744		Approved	FLJ13868	uc002eci.3	Q96GQ5	OTTHUMG00000132466	ENST00000327237.2:c.462-1G>T	16.37:g.31510846C>A			31418347	Q53GL8|Q8NAJ4|Q9BVY3|Q9H887	Silent	SNP	ENST00000327237.2	37	CCDS10715.1	SNP	30	WashU																																																																																				0.527	C16orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255629.2	NM_022744	Silent	Silent
KIAA1551	55196	genome.wustl.edu	37	12	32145408	32145408	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1424-01	TCGA-24-1424-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr12:32145408C>A	ENST00000312561.4	+	6	5597	c.5183C>A	c.(5182-5184)aCc>aAc	p.T1728N	KIAA1551_ENST00000535596.1_3'UTR	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1728																	ATGTTTCAAACCTACAAACAG	0.368																																																0			12											142.0	157.0	152.0					12																	32145408		2203	4300	6503	32036675	SO:0001583	missense	55196			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.5183C>A	12.37:g.32145408C>A	ENSP00000310338:p.Thr1728Asn		32036675	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	15.72	2.916037	0.52546	.	.	ENSG00000174718	ENST00000312561	T	0.32515	1.45	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000017	T	0.56262	0.1973	M	0.67953	2.075	0.44927	D	0.997941	D	0.89917	1.0	D	0.97110	1.0	T	0.57406	-0.7817	10	0.87932	D	0	.	17.9462	0.89039	0.0:1.0:0.0:0.0	.	1728	Q9HCM1	CL035_HUMAN	N	1728	ENSP00000310338:T1728N	ENSP00000310338:T1728N	T	+	2	0	C12orf35	32036675	1.000000	0.71417	0.984000	0.44739	0.007000	0.05969	2.088000	0.41663	2.649000	0.89929	0.655000	0.94253	ACC		0.368	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169		Missense_Mutation
KRTAP9-7	100505724	genome.wustl.edu	37	17	39432035	39432035	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1424-01	TCGA-24-1424-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr17:39432035G>A	ENST00000391354.1	+	1	125	c.86G>A	c.(85-87)aGc>aAc	p.S29N		NM_001277332.1	NP_001264261.1	A8MTY7	KRA97_HUMAN	keratin associated protein 9-7	29	17 X 5 AA repeats of C-C-[VGSREQH]- [SQTPN]-[STPAI].					keratin filament (GO:0045095)		p.S29N(1)		ovary(1)	1						ACCTGCAGCAGCACACCCTGC	0.627																																																1	Substitution - Missense(1)	ovary(1)	17																																								36685561	SO:0001583	missense	728341			AC006070	CCDS59287.1	17q21.2	2013-06-25			ENSG00000180386	ENSG00000180386		"""Keratin associated proteins"""	18915	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 1"""	KRTAP9L1			Standard	NM_001277332		Approved	KAP9.7	uc031rah.1	A8MTY7	OTTHUMG00000133605	ENST00000391354.1:c.86G>A	17.37:g.39432035G>A	ENSP00000375149:p.Ser29Asn		36685561		Missense_Mutation	SNP	ENST00000391354.1	37	CCDS59287.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	.	11.14	1.550712	0.27739	.	.	ENSG00000180386	ENST00000391354	T	0.01369	4.97	3.13	-2.0	0.07433	.	.	.	.	.	T	0.00936	0.0031	N	0.19112	0.55	0.09310	N	1	.	.	.	.	.	.	T	0.47249	-0.9132	7	0.27082	T	0.32	.	0.8479	0.01166	0.2953:0.1683:0.367:0.1695	.	.	.	.	N	29	ENSP00000375149:S29N	ENSP00000375149:S29N	S	+	2	0	KRTAP9-7	36685561	0.028000	0.19301	0.013000	0.15412	0.279000	0.26890	0.616000	0.24344	-0.338000	0.08413	0.430000	0.28490	AGC		0.627	KRTAP9-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257713.1	XM_003118738		Missense_Mutation
HAP1	9001	genome.wustl.edu	37	17	39889011	39889011	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr17:39889011G>C	ENST00000310778.5	-	2	518	c.509C>G	c.(508-510)aCc>aGc	p.T170S	RN7SL399P_ENST00000471648.2_RNA|HAP1_ENST00000341193.5_Missense_Mutation_p.T170S|JUP_ENST00000540235.1_Intron|HAP1_ENST00000347901.4_Missense_Mutation_p.T170S|HAP1_ENST00000393939.2_Missense_Mutation_p.T170S			P54257	HAP1_HUMAN	huntingtin-associated protein 1	170	HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)	p.T170S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			GTCTTCCTGGGTGATCTTTTT	0.532																																																1	Substitution - Missense(1)	ovary(1)	17											146.0	127.0	134.0					17																	39889011		2203	4300	6503	37142537	SO:0001583	missense	9001			AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.509C>G	17.37:g.39889011G>C	ENSP00000309392:p.Thr170Ser		37142537	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	ENST00000310778.5	37		SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735869	0.30774	.	.	ENSG00000173805	ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	3.0	3.0	0.34707	.	0.000000	0.39341	N	0.001391	T	0.54271	0.1848	M	0.71581	2.175	0.25717	N	0.985417	D;D;D;D	0.69078	0.996;0.996;0.996;0.997	D;D;D;D	0.77004	0.98;0.971;0.98;0.989	T	0.38607	-0.9653	10	0.72032	D	0.01	-22.5336	9.7308	0.40359	0.0:0.0:1.0:0.0	.	170;170;170;170	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	S	170	ENSP00000377513:T170S;ENSP00000309392:T170S;ENSP00000334002:T170S;ENSP00000343170:T170S	ENSP00000309392:T170S	T	-	2	0	HAP1	37142537	0.971000	0.33674	0.987000	0.45799	0.006000	0.05464	0.735000	0.26115	1.985000	0.57927	0.455000	0.32223	ACC		0.532	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	NM_003949		Missense_Mutation
KNSTRN	90417	genome.wustl.edu	37	15	40684206	40684206	+	Silent	SNP	G	G	A			TCGA-24-1424-01	TCGA-24-1424-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr15:40684206G>A	ENST00000249776.8	+	8	919	c.804G>A	c.(802-804)aaG>aaA	p.K268K	KNSTRN_ENST00000416151.2_Silent_p.K268K|KNSTRN_ENST00000608100.1_Silent_p.K190K|KNSTRN_ENST00000448395.2_3'UTR	NM_033286.3	NP_150628.3			kinetochore-localized astrin/SPAG5 binding protein									p.K268K(1)									CAGCCAAAAAGCAGATGGAGG	0.378																																																1	Substitution - coding silent(1)	ovary(1)	15											141.0	136.0	137.0					15																	40684206		1900	4117	6017	38471498	SO:0001819	synonymous_variant	90417			AK027408	CCDS42021.1, CCDS45226.1, CCDS45227.1	15q15.1	2013-01-17	2012-12-04	2012-12-04	ENSG00000128944	ENSG00000128944			30767	protein-coding gene	gene with protein product	"""small kinetochore-associated protein"", ""kinetochore-localized astrin-binding protein"", ""TRAF4 associated factor 1"""	614718	"""chromosome 15 open reading frame 23"""	C15orf23		12477932	Standard	NM_033286		Approved	FLJ14502, SKAP, kinastrin, TRAF4AF1	uc001zll.3	Q9Y448	OTTHUMG00000172454	ENST00000249776.8:c.804G>A	15.37:g.40684206G>A			38471498		Silent	SNP	ENST00000249776.8	37	CCDS42021.1	SNP	34	WashU																																																																																				0.378	KNSTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418636.1	NM_001142761		Silent
KCNK16	83795	genome.wustl.edu	37	6	39285600	39285600	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr6:39285600C>T	ENST00000373229.5	-	3	470	c.457G>A	c.(457-459)Gcc>Acc	p.A153T	KCNK16_ENST00000437525.2_Missense_Mutation_p.A153T|KCNK16_ENST00000425054.2_Missense_Mutation_p.A153T|KCNK16_ENST00000373227.4_Missense_Mutation_p.A153T|KCNK16_ENST00000507712.1_Missense_Mutation_p.A88T	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	153					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.A153T(1)		large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						CTTTCAATGGCGGCCAGATGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	6											36.0	33.0	34.0					6																	39285600		2203	4300	6503	39393578	SO:0001583	missense	83795			AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.457G>A	6.37:g.39285600C>T	ENSP00000362326:p.Ala153Thr		39393578	B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Missense_Mutation	SNP	ENST00000373229.5	37	CCDS4843.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	T	3.135	-0.177590	0.06380	.	.	ENSG00000095981	ENST00000373229;ENST00000425054;ENST00000507712;ENST00000373227;ENST00000437525	T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9	5.35	-0.0725	0.13739	.	0.916437	0.09528	N	0.790004	T	0.02380	0.0073	N	0.04090	-0.28	0.09310	N	1	B;B;B;B	0.12013	0.0;0.005;0.0;0.0	B;B;B;B	0.13407	0.0;0.009;0.0;0.001	T	0.47471	-0.9115	10	0.08381	T	0.77	.	6.3315	0.21272	0.0:0.3631:0.1323:0.5046	.	153;153;153;153	B5TJL9;Q96T55-5;Q96T55-4;Q96T55	.;.;.;KCNKG_HUMAN	T	153;153;88;153;153	ENSP00000362326:A153T;ENSP00000391498:A153T;ENSP00000423842:A88T;ENSP00000362324:A153T;ENSP00000415375:A153T	ENSP00000362324:A153T	A	-	1	0	KCNK16	39393578	0.003000	0.15002	0.112000	0.21494	0.621000	0.37620	0.086000	0.14935	-0.184000	0.10567	-0.361000	0.07541	GCC		0.592	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115		Missense_Mutation
PTPRT	11122	genome.wustl.edu	37	20	40770604	40770604	+	Silent	SNP	G	G	A			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr20:40770604G>A	ENST00000373187.1	-	18	2720	c.2721C>T	c.(2719-2721)gcC>gcT	p.A907A	PTPRT_ENST00000373198.4_Silent_p.A926A|PTPRT_ENST00000373190.1_Silent_p.A906A|PTPRT_ENST00000356100.2_Silent_p.A916A|PTPRT_ENST00000373201.1_Silent_p.A897A|PTPRT_ENST00000373193.3_Silent_p.A910A|PTPRT_ENST00000373184.1_Silent_p.A897A			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	907	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.A929A(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CATCCTCCTTGGCTGTGTCCC	0.507																																																1	Substitution - coding silent(1)	ovary(1)	20											227.0	225.0	225.0					20																	40770604		1960	4153	6113	40204018	SO:0001819	synonymous_variant	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2721C>T	20.37:g.40770604G>A			40204018	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	CCDS42874.1	SNP	47	WashU																																																																																				0.507	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			Silent
NRXN1	9378	genome.wustl.edu	37	2	50149200	50149200	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr2:50149200C>A	ENST00000406316.2	-	22	5792	c.4316G>T	c.(4315-4317)cGa>cTa	p.R1439L	NRXN1_ENST00000401669.2_Missense_Mutation_p.R1469L|NRXN1_ENST00000404971.1_Missense_Mutation_p.R1509L|NRXN1_ENST00000342183.5_Missense_Mutation_p.R404L|NRXN1_ENST00000402717.3_Missense_Mutation_p.R1461L|NRXN1_ENST00000406859.3_Missense_Mutation_p.R1439L|NRXN1_ENST00000401710.1_Missense_Mutation_p.R457L|NRXN1_ENST00000405472.3_Missense_Mutation_p.R1461L	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1439					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.R404L(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GATGTAGTTTCGACTCTCGTC	0.478																																																1	Substitution - Missense(1)	ovary(1)	2											224.0	181.0	195.0					2																	50149200		2203	4300	6503	50002704	SO:0001583	missense	9378			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4316G>T	2.37:g.50149200C>A	ENSP00000384311:p.Arg1439Leu		50002704	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	SNP	31	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.9|22.9	4.351550|4.351550	0.82132|0.82132	.|.	.|.	ENSG00000179915|ENSG00000179915	ENST00000412315|ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	.|T;T;T;T;T;T;T;T	.|0.72942	.|0.82;2.02;0.0;-0.0;-0.7;-0.59;-0.3;-0.14	5.44|5.44	5.44|5.44	0.79542|0.79542	.|Neurexin/syndecan/glycophorin C (1);	.|0.000000	.|0.49305	.|U	.|0.000143	.|D	.|0.85057	.|0.5610	M|M	0.77313|0.77313	2.365|2.365	0.58432|0.58432	D|D	0.999992|0.999992	.|D;D;D;D;D;P	.|0.71674	.|0.978;0.974;0.998;0.998;0.996;0.917	.|D;P;D;D;D;P	.|0.80764	.|0.969;0.805;0.975;0.994;0.976;0.855	.|D	.|0.86086	.|0.1547	.|10	.|0.87932	.|D	.|0	.|.	19.4587|19.4587	0.94906|0.94906	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|104;1509;404;1439;1458;101	.|B4DIT5;Q9ULB1-3;P58400;F8WB18;A7E294;Q5HYI0	.|.;.;NRX1B_HUMAN;.;.;.	X|L	172|404;358;457;1509;1439;1461;1469;1510;1461;1439	.|ENSP00000341184:R404L;ENSP00000385580:R457L;ENSP00000385142:R1509L;ENSP00000384311:R1439L;ENSP00000434015:R1461L;ENSP00000385017:R1469L;ENSP00000385434:R1461L;ENSP00000385681:R1439L	.|ENSP00000341184:R404L	E|R	-|-	1|2	0|0	NRXN1|NRXN1	50002704|50002704	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.651000|7.651000	0.83577|0.83577	2.828000|2.828000	0.97474|0.97474	0.655000|0.655000	0.94253|0.94253	GAA|CGA		0.478	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			Missense_Mutation
DOCK3	1795	genome.wustl.edu	37	3	51274942	51274942	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr3:51274942C>T	ENST00000266037.9	+	21	2046	c.2023C>T	c.(2023-2025)Cga>Tga	p.R675*		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	675					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R675*(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CAACCTGCTCCGAGACATCAA	0.468																																																1	Substitution - Nonsense(1)	ovary(1)	3											87.0	80.0	83.0					3																	51274942		1946	4138	6084	51249982	SO:0001587	stop_gained	1795			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.2023C>T	3.37:g.51274942C>T	ENSP00000266037:p.Arg675*		51249982	O15017	Nonsense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	38	6.868622	0.97897	.	.	ENSG00000088538	ENST00000266037	.	.	.	5.19	3.35	0.38373	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	14.1129	0.65134	0.2676:0.7324:0.0:0.0	.	.	.	.	X	675	.	ENSP00000266037:R675X	R	+	1	2	DOCK3	51249982	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.327000	0.52045	0.522000	0.28464	0.655000	0.94253	CGA		0.468	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947		Nonsense_Mutation
GZMA	3001	genome.wustl.edu	37	5	54404085	54404085	+	Missense_Mutation	SNP	G	G	A	rs149445760	byFrequency	TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr5:54404085G>A	ENST00000274306.6	+	4	525	c.490G>A	c.(490-492)Gat>Aat	p.D164N		NM_006144.3	NP_006135	P12544	GRAA_HUMAN	granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)	164	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|immune response (GO:0006955)|negative regulation of DNA binding (GO:0043392)|negative regulation of endodeoxyribonuclease activity (GO:0032078)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of apoptotic process (GO:0043065)|proteolysis involved in cellular protein catabolic process (GO:0051603)	extracellular region (GO:0005576)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.D164N(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	25		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				ATCTTGGTCCGATACTCTGAG	0.428													G|||	11	0.00219649	0.0	0.0	5008	,	,		17985	0.0109		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5						G	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	83.0	79.0	81.0		490	1.8	0.0	5	dbSNP_134	81	0,8600		0,0,4300	yes	missense	GZMA	NM_006144.3	23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	164/263	54404085	1,13005	2203	4300	6503	54439842	SO:0001583	missense	3001				CCDS3965.1	5q11-q12	2008-07-18			ENSG00000145649	ENSG00000145649			4708	protein-coding gene	gene with protein product	"""CTL tryptase"", ""Granzyme A (Cytotoxic T-lymphocyte-associated serine esterase-3; Hanukah factor serine protease)"""	140050		HFSP, CTLA3		3262682, 3533635	Standard	NM_006144		Approved		uc003jpm.3	P12544	OTTHUMG00000097011	ENST00000274306.6:c.490G>A	5.37:g.54404085G>A	ENSP00000274306:p.Asp164Asn		54439842	A4PHN1|Q6IB36	Missense_Mutation	SNP	ENST00000274306.6	37	CCDS3965.1	SNP	37	WashU	10	0.004578754578754579	0	0.0	0	0.0	10	0.017482517482517484	0	0.0	G	14.79	2.640852	0.47153	2.27E-4	0.0	ENSG00000145649	ENST00000274306	D	0.89270	-2.49	5.93	1.83	0.25207	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.504313	0.23465	N	0.047890	T	0.69513	0.3119	L	0.43152	1.355	0.27265	N	0.95854	P	0.36378	0.55	B	0.29077	0.098	T	0.65138	-0.6241	10	0.42905	T	0.14	.	9.4054	0.38457	0.3169:0.0:0.6831:0.0	.	164	P12544	GRAA_HUMAN	N	164	ENSP00000274306:D164N	ENSP00000274306:D164N	D	+	1	0	GZMA	54439842	0.015000	0.18098	0.002000	0.10522	0.141000	0.21300	0.165000	0.16564	0.032000	0.15435	-0.136000	0.14681	GAT		0.428	GZMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214100.2	NM_006144		Missense_Mutation
Unknown	0	genome.wustl.edu	37	7	56804101	56804101	+	IGR	SNP	A	A	C	rs144059673		TCGA-24-1424-01	TCGA-24-1424-10	A	A	A	C	A	C	Unknown	Valid	Germline	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr7:56804101A>C								RP11-760D2.5 (198278 upstream) : RP13-580B18.1 (138976 downstream)																							ACTTTTTGGCAAATTTCTTAA	0.453																																																0			7																																								56771595	SO:0001628	intergenic_variant	728416																															7.37:g.56804101A>C			56771595		Missense_Mutation	SNP		37		SNP	5	WashU																																																																																			0	0.453									Missense_Mutation
CDH8	1006	genome.wustl.edu	37	16	61689507	61689507	+	Silent	SNP	G	G	T			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr16:61689507G>T	ENST00000577390.1	-	11	2727	c.1773C>A	c.(1771-1773)acC>acA	p.T591T	CDH8_ENST00000577730.1_Silent_p.T591T|CDH8_ENST00000299345.6_Silent_p.T591T	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	591	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.T591T(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TGATTGTCAAGGTGCTAGTGC	0.468																																																1	Substitution - coding silent(1)	ovary(1)	16											159.0	136.0	144.0					16																	61689507		2203	4300	6503	60247008	SO:0001819	synonymous_variant	1006			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1773C>A	16.37:g.61689507G>T			60247008	B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	ENST00000577390.1	37	CCDS10802.1	SNP	35	WashU																																																																																				0.468	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		Silent
VWCE	220001	genome.wustl.edu	37	11	61041992	61041992	+	Silent	SNP	C	C	T	rs540936887		TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr11:61041992C>T	ENST00000335613.5	-	12	1946	c.1560G>A	c.(1558-1560)gaG>gaA	p.E520E	VWCE_ENST00000535710.1_5'Flank	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	520	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.E520E(1)		biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						AGGTGGTACACTCGTCACCAC	0.552													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19383	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	11											222.0	134.0	164.0					11																	61041992		2203	4299	6502	60798568	SO:0001819	synonymous_variant	220001			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1560G>A	11.37:g.61041992C>T			60798568	A5PKV0|Q7Z7L6|Q86WK8	Silent	SNP	ENST00000335613.5	37	CCDS8002.1	SNP	20	WashU																																																																																				0.552	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718		Silent
KHDRBS2	202559	genome.wustl.edu	37	6	62611219	62611219	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1424-01	TCGA-24-1424-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr6:62611219A>T	ENST00000281156.4	-	5	819	c.541T>A	c.(541-543)Tca>Aca	p.S181T		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		GAGTCCTCTGAGCCATTTAAG	0.393																																																0			6											113.0	111.0	112.0					6																	62611219		2203	4300	6503	62669178	SO:0001583	missense	202559			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.541T>A	6.37:g.62611219A>T	ENSP00000281156:p.Ser181Thr		62669178	A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	ENST00000281156.4	37	CCDS4963.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	12.44	1.938054	0.34189	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.20069	2.1	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.08313	0.0207	L	0.38531	1.155	0.58432	D	0.999996	B	0.28128	0.201	B	0.30316	0.114	T	0.06058	-1.0848	10	0.07990	T	0.79	-2.9967	16.8222	0.85835	1.0:0.0:0.0:0.0	.	181	Q5VWX1	KHDR2_HUMAN	T	181	ENSP00000281156:S181T	ENSP00000281156:S181T	S	-	1	0	KHDRBS2	62669178	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.350000	0.79385	2.371000	0.80710	0.533000	0.62120	TCA		0.393	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041066.2	NM_152688		Missense_Mutation
ETAA1	54465	genome.wustl.edu	37	2	67637095	67637095	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1424-01	TCGA-24-1424-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr2:67637095A>T	ENST00000272342.5	+	6	2836	c.2706A>T	c.(2704-2706)agA>agT	p.R902S		NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	902						cytoplasm (GO:0005737)		p.R902S(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						AGAGAAAAAGACAAGAAGCAC	0.353																																																1	Substitution - Missense(1)	ovary(1)	2											93.0	111.0	105.0					2																	67637095		2203	4300	6503	67490599	SO:0001583	missense	54465			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.2706A>T	2.37:g.67637095A>T	ENSP00000272342:p.Arg902Ser		67490599	Q05BT7|Q53SC4	Missense_Mutation	SNP	ENST00000272342.5	37	CCDS1882.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	21.3	4.134552	0.77662	.	.	ENSG00000143971	ENST00000272342	T	0.34275	1.37	5.98	1.16	0.20824	.	0.053387	0.64402	D	0.000002	T	0.50599	0.1625	M	0.64997	1.995	0.27987	N	0.935822	D	0.89917	1.0	D	0.74348	0.983	T	0.42258	-0.9462	10	0.72032	D	0.01	-4.7801	8.6497	0.34027	0.6943:0.0:0.3057:0.0	.	902	Q9NY74	ETAA1_HUMAN	S	902	ENSP00000272342:R902S	ENSP00000272342:R902S	R	+	3	2	ETAA1	67490599	1.000000	0.71417	0.987000	0.45799	0.982000	0.71751	0.824000	0.27379	0.183000	0.20059	0.482000	0.46254	AGA		0.353	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002		Missense_Mutation
ACRC	93953	genome.wustl.edu	37	X	70812007	70812007	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1424-01	TCGA-24-1424-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chrX:70812007C>G	ENST00000373695.1	+	2	632	c.95C>G	c.(94-96)aCc>aGc	p.T32S	ACRC_ENST00000373696.3_Missense_Mutation_p.T32S			Q96QF7	ACRC_HUMAN	acidic repeat containing	32						nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					AGTGATGACACCAGTGGGTCT	0.403																																																0			X											195.0	154.0	168.0					X																	70812007		2203	4299	6502	70728732	SO:0001583	missense	93953			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.95C>G	X.37:g.70812007C>G	ENSP00000362799:p.Thr32Ser		70728732	B9EG62	Missense_Mutation	SNP	ENST00000373695.1	37	CCDS35326.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	7.133	0.580218	0.13686	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.35236	1.32;1.32	2.49	-0.188	0.13264	.	.	.	.	.	T	0.18341	0.0440	N	0.14661	0.345	0.09310	N	1	B	0.14438	0.01	B	0.15870	0.014	T	0.22417	-1.0217	9	0.87932	D	0	.	2.8294	0.05495	0.5417:0.2847:0.1736:0.0	.	32	Q96QF7	ACRC_HUMAN	S	32	ENSP00000362800:T32S;ENSP00000362799:T32S	ENSP00000362799:T32S	T	+	2	0	ACRC	70728732	0.012000	0.17670	0.001000	0.08648	0.011000	0.07611	1.072000	0.30678	-0.121000	0.11787	-0.568000	0.04159	ACC		0.403	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081856.1			Missense_Mutation
AMBN	258	genome.wustl.edu	37	4	71472119	71472119	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1424-01	TCGA-24-1424-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr4:71472119C>A	ENST00000322937.6	+	13	1119	c.1016C>A	c.(1015-1017)cCa>cAa	p.P339Q	AMBN_ENST00000449493.2_Missense_Mutation_p.P324Q	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	339					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)	p.P339Q(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			CTAGAAAACCCAGCTTTCCTT	0.577																																																1	Substitution - Missense(1)	ovary(1)	4											62.0	61.0	61.0					4																	71472119		2203	4300	6503	71506708	SO:0001583	missense	258			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.1016C>A	4.37:g.71472119C>A	ENSP00000313809:p.Pro339Gln		71506708	Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	ENST00000322937.6	37	CCDS3543.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	9.356	1.066836	0.20067	.	.	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.35048	1.33;1.33	5.7	2.93	0.34026	.	0.480210	0.21036	N	0.081252	T	0.30727	0.0774	L	0.39147	1.195	0.26062	N	0.981339	B	0.27700	0.186	B	0.34093	0.175	T	0.25082	-1.0142	10	0.56958	D	0.05	-0.8816	8.5452	0.33417	0.312:0.5374:0.1506:0.0	.	339	Q9NP70	AMBN_HUMAN	Q	339;338;324	ENSP00000313809:P339Q;ENSP00000391234:P324Q	ENSP00000313809:P339Q	P	+	2	0	AMBN	71506708	0.046000	0.20272	0.321000	0.25320	0.001000	0.01503	0.640000	0.24705	0.297000	0.22615	-0.282000	0.10007	CCA		0.577	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252165.1	NM_016519		Missense_Mutation
ALMS1	7840	genome.wustl.edu	37	2	73680484	73680484	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1424-01	TCGA-24-1424-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr2:73680484G>C	ENST00000264448.6	+	8	6938	c.6827G>C	c.(6826-6828)tGc>tCc	p.C2276S	ALMS1_ENST00000409009.1_Missense_Mutation_p.C2234S|ALMS1_ENST00000377715.1_Missense_Mutation_p.C2276S	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2276					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CTGAAACGATGCAATTTTCCT	0.408																																																0			2											76.0	74.0	75.0					2																	73680484		1845	4085	5930	73533992	SO:0001583	missense	7840			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.6827G>C	2.37:g.73680484G>C	ENSP00000264448:p.Cys2276Ser		73533992	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098439	0.56183	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.17370	3.21;3.2;2.28	5.82	1.69	0.24217	.	0.235104	0.30901	N	0.008643	T	0.24236	0.0587	L	0.46157	1.445	0.09310	N	1	D;D;D	0.76494	0.996;0.999;0.996	P;P;P	0.61658	0.884;0.892;0.892	T	0.02526	-1.1146	10	0.42905	T	0.14	.	5.9241	0.19099	0.1321:0.0:0.6531:0.2149	.	2276;2234;2276	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	S	2234;2276;2276	ENSP00000386627:C2234S;ENSP00000264448:C2276S;ENSP00000366944:C2276S	ENSP00000264448:C2276S	C	+	2	0	ALMS1	73533992	0.652000	0.27349	0.957000	0.39632	0.990000	0.78478	0.918000	0.28678	0.822000	0.34565	0.655000	0.94253	TGC		0.408	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		Missense_Mutation
ERICH3	127254	genome.wustl.edu	37	1	75086505	75086505	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr1:75086505G>T	ENST00000326665.5	-	8	1131	c.913C>A	c.(913-915)Cct>Act	p.P305T	C1orf173_ENST00000420661.2_Missense_Mutation_p.P108T|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		305								p.P305T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CGGAAGTCAGGATTATCAGAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	1											123.0	119.0	120.0					1																	75086505		2203	4300	6503	74859093	SO:0001583	missense	127254																														ENST00000326665.5:c.913C>A	1.37:g.75086505G>T	ENSP00000322609:p.Pro305Thr		74859093	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	8.917	0.960197	0.18507	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.16897	2.78;2.31	6.07	-2.93	0.05598	.	.	.	.	.	T	0.02418	0.0074	L	0.29908	0.895	0.09310	N	1	B;B	0.21147	0.019;0.052	B;B	0.21917	0.004;0.037	T	0.46020	-0.9221	9	0.15952	T	0.53	-0.029	2.0313	0.03529	0.4044:0.0901:0.1134:0.3922	.	108;305	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	T	305;108	ENSP00000322609:P305T;ENSP00000398581:P108T	ENSP00000322609:P305T	P	-	1	0	C1orf173	74859093	0.000000	0.05858	0.006000	0.13384	0.980000	0.70556	-0.637000	0.05459	-0.050000	0.13356	0.655000	0.94253	CCT		0.358	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			Missense_Mutation
GNA14	9630	genome.wustl.edu	37	9	80049381	80049381	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr9:80049381C>A	ENST00000341700.6	-	3	880	c.367G>T	c.(367-369)Gag>Tag	p.E123*	GNA14_ENST00000464095.1_5'Flank	NM_004297.3	NP_004288.1	O95837	GNA14_HUMAN	guanine nucleotide binding protein (G protein), alpha 14	123					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.E123*(1)		endometrium(3)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	24						TCCACCTGCTCCCTGGAGAGC	0.522											OREG0019263	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Nonsense(1)	ovary(1)	9											125.0	99.0	108.0					9																	80049381		2203	4300	6503	79239201	SO:0001587	stop_gained	9630			AF105201	CCDS6657.1	9q21	2008-05-23			ENSG00000156049	ENSG00000156049			4382	protein-coding gene	gene with protein product		604397				10191087, 17620339	Standard	NM_004297		Approved		uc004aku.3	O95837	OTTHUMG00000020058	ENST00000341700.6:c.367G>T	9.37:g.80049381C>A	ENSP00000365807:p.Glu123*	1195	79239201	B1ALW3	Nonsense_Mutation	SNP	ENST00000341700.6	37	CCDS6657.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	39	7.711779	0.98447	.	.	ENSG00000156049	ENST00000341700	.	.	.	5.19	3.21	0.36854	.	0.595446	0.18919	N	0.127533	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	4.6748	0.12706	0.0:0.6089:0.0:0.3911	.	.	.	.	X	123	.	ENSP00000365807:E123X	E	-	1	0	GNA14	79239201	0.046000	0.20272	1.000000	0.80357	0.910000	0.53928	0.841000	0.27613	1.435000	0.47434	0.655000	0.94253	GAG		0.522	GNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052759.1			Nonsense_Mutation
VCAN	1462	genome.wustl.edu	37	5	82836625	82836625	+	Silent	SNP	A	A	C			TCGA-24-1424-01	TCGA-24-1424-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr5:82836625A>C	ENST00000265077.3	+	8	8368	c.7803A>C	c.(7801-7803)gtA>gtC	p.V2601V	VCAN_ENST00000343200.5_Silent_p.V1614V|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2601	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.V2601V(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	ATACAGAGGTACCATCAGAAC	0.368																																																1	Substitution - coding silent(1)	ovary(1)	5											89.0	90.0	89.0					5																	82836625		2203	4300	6503	82872381	SO:0001819	synonymous_variant	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7803A>C	5.37:g.82836625A>C			82872381	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1	SNP	14	WashU																																																																																				0.368	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		Silent
IGKV1D-8	28904	genome.wustl.edu	37	2	90260042	90260042	+	RNA	SNP	C	C	G			TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr2:90260042C>G	ENST00000471857.1	+	0	326									immunoglobulin kappa variable 1D-8																		TCGGATGAGTCAGGGCATTAG	0.502																																																0			2											113.0	114.0	114.0					2																	90260042		1927	4139	6066	89897347						Z00008		2p11.2	2012-02-08			ENSG00000239819	ENSG00000239819		"""Immunoglobulins / IGK locus"""	5759	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151570		2.37:g.90260042C>G			89897347		Missense_Mutation	SNP	ENST00000471857.1	37		SNP	29	WashU																																																																																				0.502	IGKV1D-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000323145.2	NG_000833		Missense_Mutation
FAT3	120114	genome.wustl.edu	37	11	92085537	92085537	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr11:92085537G>A	ENST00000298047.6	+	1	276	c.259G>A	c.(259-261)Gac>Aac	p.D87N	FAT3_ENST00000541502.1_Missense_Mutation_p.D87N|FAT3_ENST00000409404.2_Missense_Mutation_p.D87N|FAT3_ENST00000525166.1_5'Flank			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	87	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D87N(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGTGTCCGGAGACGAGGAAGG	0.418										TCGA Ovarian(4;0.039)																																						1	Substitution - Missense(1)	ovary(1)	11											88.0	87.0	88.0					11																	92085537		1891	4117	6008	91725185	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.259G>A	11.37:g.92085537G>A	ENSP00000298047:p.Asp87Asn		91725185	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	23.4	4.416400	0.83449	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502	T;T;T	0.60424	0.19;0.19;0.19	5.53	5.53	0.82687	.	.	.	.	.	T	0.70806	0.3266	L	0.49126	1.545	0.54753	D	0.999987	D	0.89917	1.0	D	0.91635	0.999	T	0.63207	-0.6689	9	0.20519	T	0.43	.	18.8073	0.92043	0.0:0.0:1.0:0.0	.	87	Q8TDW7-3	.	N	87	ENSP00000298047:D87N;ENSP00000387040:D87N;ENSP00000443786:D87N	ENSP00000298047:D87N	D	+	1	0	FAT3	91725185	1.000000	0.71417	0.997000	0.53966	0.790000	0.44656	7.871000	0.87180	2.756000	0.94617	0.655000	0.94253	GAC		0.418	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		Missense_Mutation
TGFBR3	7049	genome.wustl.edu	37	1	92185570	92185570	+	Silent	SNP	G	G	A			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr1:92185570G>A	ENST00000525962.1	-	8	1354	c.1293C>T	c.(1291-1293)agC>agT	p.S431S	TGFBR3_ENST00000212355.4_Silent_p.S431S|TGFBR3_ENST00000370399.2_Silent_p.S430S			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	431					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.S431S(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		ACAGTTGTATGCTGGGAATGA	0.517																																																1	Substitution - coding silent(1)	ovary(1)	1											144.0	145.0	145.0					1																	92185570		2203	4300	6503	91958158	SO:0001819	synonymous_variant	7049			L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.1293C>T	1.37:g.92185570G>A			91958158	A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Silent	SNP	ENST00000525962.1	37	CCDS30770.1	SNP	46	WashU																																																																																				0.517	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382308.1	NM_003243		Silent
CCDC132	55610	genome.wustl.edu	37	7	92985338	92985338	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1424-01	TCGA-24-1424-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr7:92985338T>G	ENST00000305866.5	+	27	2849	c.2721T>G	c.(2719-2721)atT>atG	p.I907M	CCDC132_ENST00000535481.1_Missense_Mutation_p.I627M|CCDC132_ENST00000541136.1_3'UTR|CCDC132_ENST00000474412.1_3'UTR|CCDC132_ENST00000544910.1_Missense_Mutation_p.I877M	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	907						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.I907M(1)		endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			AAACTTATATTAAAGCTTATT	0.323																																																1	Substitution - Missense(1)	ovary(1)	7											45.0	45.0	45.0					7																	92985338		1825	4078	5903	92823274	SO:0001583	missense	55610			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.2721T>G	7.37:g.92985338T>G	ENSP00000307666:p.Ile907Met		92823274	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	CCDS43617.1	SNP	61	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.00|14.00	2.405557|2.405557	0.42715|0.42715	.|.	.|.	ENSG00000004766|ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000535481|ENST00000443443	.|.	.|.	.|.	5.77|5.77	-0.849|-0.849	0.10723|0.10723	Protein of unknown function DUF2451, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.71888|.	0.3393|.	M|M	0.81341|0.81341	2.54|2.54	0.80722|0.80722	D|D	1|1	D;D;D|.	0.69078|.	0.997;0.997;0.991|.	D;D;D|.	0.83275|.	0.996;0.994;0.986|.	T|.	0.72717|.	-0.4209|.	9|.	0.87932|.	D|.	0|.	-20.0147|-20.0147	12.118|12.118	0.53875|0.53875	0.0:0.5343:0.0:0.4657|0.0:0.5343:0.0:0.4657	.|.	627;877;907|.	B4DS55;F5H5U7;Q96JG6|.	.;.;CC132_HUMAN|.	M|E	907;877;627|132	.|.	ENSP00000307666:I907M|.	I|X	+|+	3|1	3|0	CCDC132|CCDC132	92823274|92823274	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.254000|0.254000	0.26022|0.26022	1.455000|1.455000	0.35190|0.35190	-0.005000|-0.005000	0.14395|0.14395	-1.007000|-1.007000	0.02485|0.02485	ATT|TAA		0.323	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667		Missense_Mutation
UNC79	57578	genome.wustl.edu	37	14	94079386	94079386	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr14:94079386G>A	ENST00000393151.2	+	27	3998	c.3998G>A	c.(3997-3999)cGc>cAc	p.R1333H	UNC79_ENST00000555664.1_Missense_Mutation_p.R1333H|UNC79_ENST00000553484.1_Missense_Mutation_p.R1355H|UNC79_ENST00000256339.4_Missense_Mutation_p.R1156H			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1333					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R1156H(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CAAAAAATGCGCCTGTCAACT	0.443																																																1	Substitution - Missense(1)	ovary(1)	14											128.0	108.0	114.0					14																	94079386		2203	4300	6503	93149139	SO:0001583	missense	57578			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.3998G>A	14.37:g.94079386G>A	ENSP00000376858:p.Arg1333His		93149139	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	32	5.173043	0.94807	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.35236	1.37;1.32;1.36;1.37	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.59335	0.2186	L	0.60455	1.87	0.58432	D	0.999993	D	0.89917	1.0	D	0.79784	0.993	T	0.60520	-0.7247	10	0.87932	D	0	-17.6195	19.5316	0.95231	0.0:0.0:1.0:0.0	.	1355	C9JQL1	.	H	1156;1333;1355;1333;1355	ENSP00000256339:R1156H;ENSP00000450868:R1333H;ENSP00000451360:R1355H;ENSP00000376858:R1333H	ENSP00000256339:R1156H	R	+	2	0	KIAA1409	93149139	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.853000	0.99521	2.617000	0.88574	0.650000	0.86243	CGC		0.443	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		Missense_Mutation
MBLAC1	255374	genome.wustl.edu	37	7	99725216	99725216	+	Silent	SNP	C	C	A	rs371728730	byFrequency	TCGA-24-1424-01	TCGA-24-1424-10	C	C	A	A	A	A	Unknown	Valid	Germline	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr7:99725216C>A	ENST00000398075.2	+	2	597	c.198C>A	c.(196-198)ggC>ggA	p.G66G	RP11-506M12.1_ENST00000494221.1_RNA	NM_203397.1	NP_981942.1	A4D2B0	MBLC1_HUMAN	metallo-beta-lactamase domain containing 1	66							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|skin(1)	7						GCGGGAGTGGCGGCGCAGAGG	0.796													C|||	8	0.00159744	0.0	0.0	5008	,	,		10183	0.0		0.008	False		,,,				2504	0.0															0			7						C		11,2983		0,11,1486	3.0	4.0	4.0		198	0.4	0.0	7		4	76,6814		0,76,3369	no	coding-synonymous	MBLAC1	NM_203397.1		0,87,4855	AA,AC,CC		1.103,0.3674,0.8802		66/267	99725216	87,9797	1497	3445	4942	99563152	SO:0001819	synonymous_variant	255374			BC031288	CCDS43620.1	7q22	2014-02-12	2009-04-08		ENSG00000214309	ENSG00000214309			22180	protein-coding gene	gene with protein product							Standard	XM_005250250		Approved	MGC49416	uc003utp.3	A4D2B0	OTTHUMG00000154846	ENST00000398075.2:c.198C>A	7.37:g.99725216C>A			99563152	Q8N5X8	Silent	SNP	ENST00000398075.2	37	CCDS43620.1	SNP	27	WashU																																																																																				0.796	MBLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337353.1	NM_203397		Silent
TRMT10C	54931	genome.wustl.edu	37	3	101284410	101284410	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1424-01	TCGA-24-1424-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr3:101284410A>G	ENST00000309922.6	+	2	939	c.785A>G	c.(784-786)tAt>tGt	p.Y262C		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	262	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.				mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)	p.Y262C(1)									GTTAAACGGTATCAAGAAAAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	3											83.0	82.0	83.0					3																	101284410		1820	4074	5894	102767100	SO:0001583	missense	54931			AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.785A>G	3.37:g.101284410A>G	ENSP00000312356:p.Tyr262Cys		102767100	Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	ENST00000309922.6	37	CCDS43122.1	SNP	16	WashU	.	.	.	.	.	.	.	.	.	.	A	14.26	2.483070	0.44147	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.22336	1.96;1.96	6.17	6.17	0.99709	.	0.326251	0.29745	N	0.011315	T	0.45836	0.1362	L	0.61387	1.9	0.58432	D	0.999992	D	0.89917	1.0	D	0.87578	0.998	T	0.26849	-1.0091	10	0.51188	T	0.08	-6.7102	16.8222	0.85835	1.0:0.0:0.0:0.0	.	262	Q7L0Y3	MRRP1_HUMAN	C	262	ENSP00000312356:Y262C;ENSP00000419389:Y262C	ENSP00000312356:Y262C	Y	+	2	0	RG9MTD1	102767100	1.000000	0.71417	0.890000	0.34922	0.104000	0.19210	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	TAT		0.333	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353400.2	NM_017819		Missense_Mutation
RINT1	60561	genome.wustl.edu	37	7	105187424	105187424	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1424-01	TCGA-24-1424-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr7:105187424G>T	ENST00000257700.2	+	5	814	c.583G>T	c.(583-585)Gca>Tca	p.A195S		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	195					G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.A195S(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						AGTGTCTATGGCAGAACTTGA	0.368																																																1	Substitution - Missense(1)	ovary(1)	7											117.0	100.0	106.0					7																	105187424		2203	4300	6503	104974660	SO:0001583	missense	60561			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.583G>T	7.37:g.105187424G>T	ENSP00000257700:p.Ala195Ser		104974660	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	ENST00000257700.2	37	CCDS34726.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	12.68	2.011486	0.35511	.	.	ENSG00000135249	ENST00000257700	T	0.23147	1.92	5.26	4.13	0.48395	.	0.115584	0.64402	D	0.000012	T	0.19366	0.0465	L	0.42245	1.32	0.50313	D	0.999867	B	0.27853	0.191	B	0.26770	0.073	T	0.02852	-1.1102	10	0.09084	T	0.74	-8.3789	11.3866	0.49789	0.1166:0.0:0.8834:0.0	.	195	Q6NUQ1	RINT1_HUMAN	S	195	ENSP00000257700:A195S	ENSP00000257700:A195S	A	+	1	0	RINT1	104974660	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.291000	0.72719	0.887000	0.36136	0.563000	0.77884	GCA		0.368	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930		Missense_Mutation
SLC26A4	5172	genome.wustl.edu	37	7	107342418	107342418	+	Silent	SNP	T	T	C			TCGA-24-1424-01	TCGA-24-1424-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr7:107342418T>C	ENST00000265715.3	+	17	2174	c.1950T>C	c.(1948-1950)gtT>gtC	p.V650V	SLC26A4_ENST00000543100.1_Silent_p.V219V|SLC26A4_ENST00000541474.1_Silent_p.V211V|SLC26A4_ENST00000544569.1_Silent_p.V237V	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	650	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.V650V(1)		central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						AAGTGAACGTTCCCAAAGTGC	0.453									Pendred syndrome																																							1	Substitution - coding silent(1)	ovary(1)	7											130.0	109.0	116.0					7																	107342418		2203	4300	6503	107129654	SO:0001819	synonymous_variant	5172	Familial Cancer Database	Goiter-Deafness syndrome	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1950T>C	7.37:g.107342418T>C			107129654	B7Z266|O43170	Silent	SNP	ENST00000265715.3	37	CCDS5746.1	SNP	62	WashU																																																																																				0.453	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441		Silent
COL4A5	1287	genome.wustl.edu	37	X	107683417	107683417	+	Missense_Mutation	SNP	G	G	A	rs281874760		TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chrX:107683417G>A	ENST00000361603.2	+	1	306	c.62G>A	c.(61-63)gGg>gAg	p.G21E	COL4A5_ENST00000477429.1_3'UTR|COL4A6_ENST00000372216.4_5'Flank|COL4A6_ENST00000545689.1_5'Flank|COL4A6_ENST00000394872.2_5'Flank|COL4A6_ENST00000461897.1_5'Flank|COL4A6_ENST00000334504.7_5'Flank|COL4A6_ENST00000538570.1_5'Flank|COL4A5_ENST00000328300.6_Missense_Mutation_p.G21E	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	21					axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.G21E(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						AGTCTTTGGGGGCAGCCTGCA	0.612									Alport syndrome with Diffuse Leiomyomatosis																																							1	Substitution - Missense(1)	ovary(1)	X											48.0	39.0	42.0					X																	107683417		2203	4300	6503	107570073	SO:0001583	missense	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.62G>A	X.37:g.107683417G>A	ENSP00000354505:p.Gly21Glu		107570073	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744654	0.49151	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.90504	-2.68;-2.51	4.68	4.68	0.58851	.	0.654740	0.14911	N	0.291232	D	0.83078	0.5176	N	0.08118	0	0.28952	N	0.890357	P;P	0.51240	0.943;0.943	P;P	0.45998	0.5;0.5	T	0.77892	-0.2418	10	0.38643	T	0.18	.	12.5058	0.55979	0.0:0.0:1.0:0.0	.	21;21	E7EVY4;P29400	.;CO4A5_HUMAN	E	21	ENSP00000331902:G21E;ENSP00000354505:G21E	ENSP00000331902:G21E	G	+	2	0	COL4A5	107570073	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.675000	0.46875	2.246000	0.74042	0.600000	0.82982	GGG		0.612	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			Missense_Mutation
ARHGAP20	57569	genome.wustl.edu	37	11	110450709	110450709	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr11:110450709G>T	ENST00000260283.4	-	16	3245	c.2961C>A	c.(2959-2961)gaC>gaA	p.D987E	ARHGAP20_ENST00000528829.1_Missense_Mutation_p.D951E|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.D530E|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.D964E|ARHGAP20_ENST00000533353.1_Missense_Mutation_p.D961E|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.D951E|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.D961E	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	987					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.D987E(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		CAGGAGAAAGGTCTTCCCGTT	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											58.0	56.0	57.0					11																	110450709		2201	4298	6499	109955919	SO:0001583	missense	57569			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.2961C>A	11.37:g.110450709G>T	ENSP00000260283:p.Asp987Glu		109955919	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	C	0.001	-4.157260	0.00001	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.06768	3.26;3.26;3.33;3.26;3.26;3.26;3.26	5.9	-1.62	0.08372	.	0.650450	0.15694	N	0.249276	T	0.01092	0.0036	N	0.00162	-1.95	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.40459	-0.9562	10	0.02654	T	1	.	2.6332	0.04950	0.1689:0.309:0.333:0.1892	.	961;987;964	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	E	987;961;530;964;951;961;951	ENSP00000260283:D987E;ENSP00000349660:D961E;ENSP00000437905:D530E;ENSP00000432076:D964E;ENSP00000436319:D951E;ENSP00000436522:D961E;ENSP00000431399:D951E	ENSP00000260283:D987E	D	-	3	2	ARHGAP20	109955919	0.005000	0.15991	0.001000	0.08648	0.001000	0.01503	-0.944000	0.03913	-0.394000	0.07727	-0.751000	0.03497	GAC		0.498	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809		Missense_Mutation
ING1	3621	genome.wustl.edu	37	13	111372144	111372144	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1424-01	TCGA-24-1424-10	G	G	T	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr13:111372144G>T	ENST00000375774.3	+	2	1596	c.1134G>T	c.(1132-1134)tgG>tgT	p.W378C	ING1_ENST00000333219.7_Missense_Mutation_p.W235C|ING1_ENST00000338450.7_Missense_Mutation_p.W191C|ING1_ENST00000375775.3_Missense_Mutation_p.W166C	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	378					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.W235C(1)		endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CCATCGAGTGGTTCCACTTCT	0.587																																																1	Substitution - Missense(1)	ovary(1)	13											80.0	71.0	74.0					13																	111372144		2203	4300	6503	110170145	SO:0001583	missense	3621				CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.1134G>T	13.37:g.111372144G>T	ENSP00000364929:p.Trp378Cys		110170145	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	ENST00000375774.3	37	CCDS9517.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253273	0.80135	.	.	ENSG00000153487	ENST00000338450;ENST00000333219;ENST00000375775;ENST00000375774	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	5.5	5.5	0.81552	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.87212	0.6121	H	0.99169	4.455	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.995	D	0.92550	0.6049	10	0.87932	D	0	-40.1282	19.3838	0.94548	0.0:0.0:1.0:0.0	.	378;235;191	Q9UK53;Q5T9H0;Q9UK53-4	ING1_HUMAN;.;.	C	191;235;166;378	ENSP00000345202:W191C;ENSP00000328436:W235C;ENSP00000364930:W166C;ENSP00000364929:W378C	ENSP00000328436:W235C	W	+	3	0	ING1	110170145	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.224000	0.95209	2.586000	0.87340	0.491000	0.48974	TGG		0.587	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537		Missense_Mutation
CASP6	839	genome.wustl.edu	37	4	110619483	110619483	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1424-01	TCGA-24-1424-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr4:110619483A>C	ENST00000265164.2	-	2	133	c.56T>G	c.(55-57)aTg>aGg	p.M19R	CASP6_ENST00000352981.3_Intron|CASP6_ENST00000505486.1_Missense_Mutation_p.M19R	NM_001226.3	NP_001217.2	P55212	CASP6_HUMAN	caspase 6, apoptosis-related cysteine peptidase	19					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|epithelial cell differentiation (GO:0030855)|proteolysis (GO:0006508)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|identical protein binding (GO:0042802)	p.M19R(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000171)		TGTTTCTGTCATGTTTTCTTC	0.353																																																1	Substitution - Missense(1)	ovary(1)	4											135.0	138.0	137.0					4																	110619483		2203	4300	6503	110838932	SO:0001583	missense	839			U20536	CCDS3684.1, CCDS3685.1	4q25	2008-02-05	2005-08-17		ENSG00000138794	ENSG00000138794		"""Caspases"""	1507	protein-coding gene	gene with protein product		601532	"""caspase 6, apoptosis-related cysteine protease"""			8780721, 7796396	Standard	XM_005263271		Approved	MCH2	uc003hzn.1	P55212	OTTHUMG00000131914	ENST00000265164.2:c.56T>G	4.37:g.110619483A>C	ENSP00000265164:p.Met19Arg		110838932	Q9BQE7	Missense_Mutation	SNP	ENST00000265164.2	37	CCDS3684.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	13.46	2.242475	0.39598	.	.	ENSG00000138794	ENST00000265164;ENST00000503684;ENST00000505486	T;T;T	0.50001	4.38;3.15;0.76	5.24	4.03	0.46877	.	0.973581	0.08535	N	0.931455	T	0.33469	0.0864	N	0.25647	0.755	0.37997	D	0.934108	B	0.25955	0.138	B	0.20955	0.032	T	0.11203	-1.0597	10	0.16420	T	0.52	.	9.9995	0.41920	0.9219:0.0:0.0781:0.0	.	19	P55212	CASP6_HUMAN	R	19;1;19	ENSP00000265164:M19R;ENSP00000427669:M1R;ENSP00000424080:M19R	ENSP00000265164:M19R	M	-	2	0	CASP6	110838932	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.054000	0.57434	2.196000	0.70406	0.528000	0.53228	ATG		0.353	CASP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254866.1	NM_001226		Missense_Mutation
LCT	3938	genome.wustl.edu	37	2	136594681	136594681	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr2:136594681G>T	ENST00000264162.2	-	1	69	c.59C>A	c.(58-60)tCa>tAa	p.S20*		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	20					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.S20*(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	CTCCCAGTCTGACCCCCAGCA	0.463																																																1	Substitution - Nonsense(1)	ovary(1)	2											55.0	58.0	57.0					2																	136594681		2203	4300	6503	136311151	SO:0001587	stop_gained	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.59C>A	2.37:g.136594681G>T	ENSP00000264162:p.Ser20*		136311151	Q4ZG58	Nonsense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	g	12.37	1.917956	0.33815	.	.	ENSG00000115850	ENST00000264162	.	.	.	5.16	0.652	0.17823	.	1.842650	0.02944	N	0.140810	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	2.9778	4.4097	0.11427	0.6018:0.0:0.2446:0.1536	.	.	.	.	X	20	.	ENSP00000264162:S20X	S	-	2	0	LCT	136311151	0.000000	0.05858	0.001000	0.08648	0.053000	0.15095	-0.173000	0.09854	-0.029000	0.13827	0.651000	0.88453	TCA		0.463	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		Nonsense_Mutation
PCDHB13	56123	genome.wustl.edu	37	5	140595880	140595880	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1424-01	TCGA-24-1424-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr5:140595880G>A	ENST00000341948.4	+	1	2372	c.2185G>A	c.(2185-2187)Gag>Aag	p.E729K		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	729					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E729K(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTTGGTGCCCGAGGGCCCCCT	0.637																																																1	Substitution - Missense(1)	ovary(1)	5											91.0	101.0	98.0					5																	140595880		2203	4300	6503	140576064	SO:0001583	missense	56123			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.2185G>A	5.37:g.140595880G>A	ENSP00000345491:p.Glu729Lys		140576064	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	-	12.37	1.918789	0.33908	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.49720	0.77	3.88	-0.157	0.13387	.	.	.	.	.	T	0.42359	0.1199	M	0.66939	2.045	0.21325	N	0.999727	B	0.11235	0.004	B	0.12837	0.008	T	0.36792	-0.9733	9	0.35671	T	0.21	.	7.9261	0.29876	0.1818:0.1332:0.685:0.0	.	729	Q9Y5F0	PCDBD_HUMAN	K	729;729;675	ENSP00000345491:E729K	ENSP00000345491:E729K	E	+	1	0	PCDHB13	140576064	0.015000	0.18098	0.021000	0.16686	0.009000	0.06853	0.741000	0.26202	-0.029000	0.13827	-2.347000	0.00243	GAG		0.637	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		Missense_Mutation
MAGEC2	51438	genome.wustl.edu	37	X	141291064	141291064	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1424-01	TCGA-24-1424-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chrX:141291064A>G	ENST00000247452.3	-	3	1057	c.710T>C	c.(709-711)aTc>aCc	p.I237T		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	237	Interaction with TRIM28.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)	p.I237T(1)		NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					CTTTATGAAGATCACACTCAG	0.512										HNSCC(46;0.14)																																						1	Substitution - Missense(1)	ovary(1)	X											121.0	113.0	116.0					X																	141291064		2203	4300	6503	141118730	SO:0001583	missense	51438			AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.710T>C	X.37:g.141291064A>G	ENSP00000354660:p.Ile237Thr		141118730	Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	37	CCDS14678.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	-	10.48	1.362120	0.24684	.	.	ENSG00000046774	ENST00000247452	T	0.12672	2.66	0.988	0.988	0.19796	.	0.065818	0.64402	U	0.000019	T	0.41511	0.1162	H	0.96015	3.755	0.09310	N	1	D	0.71674	0.998	D	0.80764	0.994	T	0.22277	-1.0221	10	0.87932	D	0	.	3.916	0.09224	1.0:0.0:0.0:0.0	.	237	Q9UBF1	MAGC2_HUMAN	T	237	ENSP00000354660:I237T	ENSP00000354660:I237T	I	-	2	0	MAGEC2	141118730	0.883000	0.30277	0.022000	0.16811	0.051000	0.14879	2.181000	0.42547	0.635000	0.30488	0.235000	0.17854	ATC		0.512	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249		Missense_Mutation
MARCH1	55016	genome.wustl.edu	37	4	165118803	165118803	+	Intron	SNP	C	C	T			TCGA-24-1424-01	TCGA-24-1424-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr4:165118803C>T	ENST00000503008.1	-	2	864				MARCH1_ENST00000508725.1_Intron|MARCH1_ENST00000514618.1_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E21K(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				AGGGCAAGTTCTTTCACATCA	0.527																																																1	Substitution - Missense(1)	ovary(1)	4											136.0	137.0	137.0					4																	165118803		2203	4300	6503	165338253	SO:0001627	intron_variant	23520			AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.113-85989G>A	4.37:g.165118803C>T			165338253	D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	CCDS54814.1	SNP	32	WashU																																																																																				0.527	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923		Missense_Mutation
STX6	10228	genome.wustl.edu	37	1	180959145	180959145	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1424-01	TCGA-24-1424-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr1:180959145A>G	ENST00000258301.5	-	5	701	c.464T>C	c.(463-465)aTt>aCt	p.I155T	STX6_ENST00000542060.1_Missense_Mutation_p.I54T|STX6_ENST00000469135.1_5'Flank	NM_005819.4	NP_005810.1	O43752	STX6_HUMAN	syntaxin 6	155					endosome organization (GO:0007032)|Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|trans-Golgi network membrane (GO:0032588)	SNAP receptor activity (GO:0005484)	p.I155T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	10						CTGCTCCTCAATGAAATGAGA	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											92.0	84.0	86.0					1																	180959145		2203	4300	6503	179225768	SO:0001583	missense	10228			AJ002078	CCDS1341.1, CCDS65738.1	1q25.3	2008-02-05			ENSG00000135823	ENSG00000135823			11441	protein-coding gene	gene with protein product		603944				10080545	Standard	XM_005244824		Approved		uc021pfr.1	O43752	OTTHUMG00000035179	ENST00000258301.5:c.464T>C	1.37:g.180959145A>G	ENSP00000258301:p.Ile155Thr		179225768	B2R652|B4DR17|Q5VY08|Q6FH83	Missense_Mutation	SNP	ENST00000258301.5	37	CCDS1341.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	24.3	4.519227	0.85495	.	.	ENSG00000135823	ENST00000258301;ENST00000542060	.	.	.	5.38	5.38	0.77491	.	0.047558	0.85682	D	0.000000	T	0.65637	0.2710	M	0.64404	1.975	0.39158	D	0.962357	P;D	0.52996	0.915;0.957	B;P	0.52823	0.3;0.71	T	0.75105	-0.3435	8	0.51188	T	0.08	-22.5575	13.6361	0.62223	1.0:0.0:0.0:0.0	.	54;155	B4DR17;O43752	.;STX6_HUMAN	T	155;54	.	ENSP00000258301:I155T	I	-	2	0	STX6	179225768	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.422000	0.90262	2.048000	0.60808	0.460000	0.39030	ATT		0.562	STX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085143.1	NM_005819		Missense_Mutation
OR2V2	285659	genome.wustl.edu	37	5	180582342	180582342	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr5:180582342C>A	ENST00000328275.1	+	1	400	c.400C>A	c.(400-402)Ccc>Acc	p.P134T		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P134T(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACTTCACTATCCCATCCTCAT	0.498																																																1	Substitution - Missense(1)	ovary(1)	5											98.0	95.0	96.0					5																	180582342		2203	4300	6503	180514948	SO:0001583	missense	285659			AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.400C>A	5.37:g.180582342C>A	ENSP00000332185:p.Pro134Thr		180514948	Q6IFL6|Q8NGV1	Missense_Mutation	SNP	ENST00000328275.1	37	CCDS4461.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	.	6.590	0.477255	0.12521	.	.	ENSG00000182613	ENST00000328275	T	0.01119	5.31	3.27	2.39	0.29439	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33938	N	0.004414	T	0.00724	0.0024	N	0.12831	0.26	0.24261	N	0.995284	P	0.41420	0.749	B	0.36186	0.219	T	0.54563	-0.8275	10	0.41790	T	0.15	.	5.3359	0.15957	0.0:0.7317:0.0:0.2683	.	134	Q96R30	OR2V2_HUMAN	T	134	ENSP00000332185:P134T	ENSP00000332185:P134T	P	+	1	0	OR2V2	180514948	0.000000	0.05858	0.886000	0.34754	0.684000	0.39900	-3.040000	0.00633	0.703000	0.31848	0.305000	0.20034	CCC		0.498	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253529.1			Missense_Mutation
RD3	343035	genome.wustl.edu	37	1	211654728	211654728	+	Silent	SNP	G	G	A			TCGA-24-1424-01	TCGA-24-1424-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr1:211654728G>A	ENST00000367002.4	-	2	1193	c.30C>T	c.(28-30)aaC>aaT	p.N10N	RD3_ENST00000484910.1_Intron	NM_001164688.1|NM_183059.2	NP_001158160.1|NP_898882.1	Q7Z3Z2	RD3_HUMAN	retinal degeneration 3	10					response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)			p.N10N(1)		central_nervous_system(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10				OV - Ovarian serous cystadenocarcinoma(81;0.00284)|all cancers(67;0.0279)|Epithelial(68;0.0689)		ATGGGGCCTCGTTCCACCGAA	0.607																																																1	Substitution - coding silent(1)	ovary(1)	1											44.0	44.0	44.0					1																	211654728		2203	4300	6503	209721351	SO:0001819	synonymous_variant	343035			AY191519	CCDS1498.1	1q32.3	2008-02-05	2006-11-13	2006-11-13	ENSG00000198570	ENSG00000198570			19689	protein-coding gene	gene with protein product		180040	"""chromosome 1 open reading frame 36"""	C1orf36		12914764	Standard	NM_183059		Approved	LCA12	uc001hin.2	Q7Z3Z2	OTTHUMG00000037002	ENST00000367002.4:c.30C>T	1.37:g.211654728G>A			209721351	A8K595	Silent	SNP	ENST00000367002.4	37	CCDS1498.1	SNP	40	WashU																																																																																				0.607	RD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089837.1	NM_183059		Silent
SI	6476	genome.wustl.edu	37	3	164777005	164777005	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1424-01	TCGA-24-1424-10	T	T	C	T	T	T	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr3:164777005T>C	ENST00000264382.3	-	11	1291	c.1229A>G	c.(1228-1230)cAa>cGa	p.Q410R		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	410	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.Q410R(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TTGCACAAATTGAGGGAGTCC	0.343										HNSCC(35;0.089)																																						1	Substitution - Missense(1)	ovary(1)	3											141.0	132.0	135.0					3																	164777005		2203	4300	6503	166259699	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1229A>G	3.37:g.164777005T>C	ENSP00000264382:p.Gln410Arg		166259699	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	13.50	2.255858	0.39896	.	.	ENSG00000090402	ENST00000264382	D	0.91631	-2.88	5.59	5.59	0.84812	Glycoside hydrolase, superfamily (1);	0.825071	0.11859	N	0.522587	D	0.86264	0.5891	N	0.16656	0.425	0.09310	N	1	B	0.14805	0.011	B	0.19391	0.025	T	0.77598	-0.2528	10	0.59425	D	0.04	.	11.7132	0.51637	0.0:0.0:0.1475:0.8525	.	410	P14410	SUIS_HUMAN	R	410	ENSP00000264382:Q410R	ENSP00000264382:Q410R	Q	-	2	0	SI	166259699	0.293000	0.24371	0.997000	0.53966	0.785000	0.44390	3.089000	0.50183	2.125000	0.65367	0.455000	0.32223	CAA		0.343	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		Missense_Mutation
EVI5	7813	genome.wustl.edu	37	1	93169005	93169006	+	Missense_Mutation	DNP	AG	AG	GA			TCGA-24-1424-01	TCGA-24-1424-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr1:93169005_93169006AG>GA	ENST00000370331.1	-	4	651_652	c.642_643CT>TC	c.(640-645)aaCTtt>aaTCtt	p.F215L	RNU4-59P_ENST00000364447.1_RNA|EVI5_ENST00000540033.1_Missense_Mutation_p.F215L|EVI5_ENST00000543509.1_Missense_Mutation_p.F215L	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	215	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		TCCTTAAAAAAGTTGTGTTCAG	0.342																																																0			1																																								92941594	SO:0001583	missense	7813			AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.642_643delinsGA	1.37:g.93169005_93169006delinsGA	ENSP00000359356:p.Phe215Leu		92941593	A6NKX8|B9A6J0|Q9H1Y9	Missense	DNP	ENST00000370331.1	37	CCDS30774.1	DNP	3	WashU																																																																																				0.342	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665		Missense
ZNF492	57615	genome.wustl.edu	37	19	22817278	22817278	+	Splice_Site	SNP	T	T	A	rs386807978|rs148713444|rs370410008|rs376564253	byFrequency	TCGA-24-1424-01	TCGA-24-1424-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr19:22817278T>A	ENST00000456783.2	+	1	151		c.e1+2			NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.?(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				CTAGAAACGGTGAGAGTGCCG	0.637																																																1	Unknown(1)	ovary(1)	19																																								22609118	SO:0001630	splice_region_variant	57615			AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.-94+2T>A	19.37:g.22817278T>A			22609118	Q08EI7|Q08EI8	Splice_Site_SNP	SNP	ENST00000456783.2	37	CCDS46032.1	SNP	59	WashU																																																																																				0.637	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464581.1	NM_020855	Intron	Splice_Site_SNP
CEP250	11190	genome.wustl.edu	37	20	34091857	34091857	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1424-01	TCGA-24-1424-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr20:34091857A>G	ENST00000397527.1	+	30	6380	c.5660A>G	c.(5659-5661)gAg>gGg	p.E1887G	CEP250_ENST00000342580.4_Missense_Mutation_p.E1831G	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1887	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.E1887G(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GCCCTGGAGGAGGTGCTGGGA	0.622																																																1	Substitution - Missense(1)	ovary(1)	20																																								33555271	SO:0001583	missense	11190			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.5660A>G	20.37:g.34091857A>G	ENSP00000380661:p.Glu1887Gly		33555271	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	37	CCDS13255.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	19.11	3.763305	0.69763	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.57273	2.47;2.41;0.41	4.94	4.94	0.65067	.	0.000000	0.64402	D	0.000007	T	0.70465	0.3227	M	0.73962	2.25	0.41958	D	0.990693	D	0.67145	0.996	D	0.75020	0.985	T	0.73452	-0.3978	10	0.51188	T	0.08	.	13.5691	0.61836	1.0:0.0:0.0:0.0	.	1887	Q9BV73	CP250_HUMAN	G	1887;1831;375	ENSP00000380661:E1887G;ENSP00000341541:E1831G;ENSP00000395992:E375G	ENSP00000341541:E1831G	E	+	2	0	CEP250	33555271	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.595000	0.54016	2.081000	0.62600	0.533000	0.62120	GAG		0.622	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186		Missense_Mutation
FAM47E-STBD1	100631383	genome.wustl.edu	37	4	77230934	77230934	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	A	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr4:77230934C>A	ENST00000237642.6	+	2	1602	c.858C>A	c.(856-858)gaC>gaA	p.D286E	FAM47E-STBD1_ENST00000539752.1_Missense_Mutation_p.D137E|FAM47E_ENST00000515604.1_3'UTR	NM_003943.4	NP_003934.1			FAM47E-STBD1 readthrough									p.D286E(1)									TAACTGGAGACCATGAGTGTC	0.488																																																1	Substitution - Missense(1)	ovary(1)	4											199.0	169.0	179.0					4																	77230934		2203	4300	6503	77449958	SO:0001583	missense	8987				CCDS58908.1	4q21.1	2013-04-23			ENSG00000118804	ENSG00000118804			44667	other	readthrough							Standard	NM_001242939		Approved				OTTHUMG00000160966	ENST00000237642.6:c.858C>A	4.37:g.77230934C>A	ENSP00000237642:p.Asp286Glu		77449958		Missense_Mutation	SNP	ENST00000237642.6	37	CCDS3578.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	13.71	2.318389	0.40996	.	.	ENSG00000118804	ENST00000539752;ENST00000237642	D;D	0.90197	-2.63;-2.63	5.26	3.55	0.40652	Carbohydrate-binding-like fold (1);Glycoside hydrolase, carbohydrate-binding (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000009	D	0.94814	0.8325	M	0.86651	2.83	0.33342	D	0.570014	D	0.76494	0.999	D	0.74348	0.983	D	0.95578	0.8644	10	0.72032	D	0.01	-21.8878	9.1534	0.36978	0.0:0.7791:0.0:0.2209	.	286	O95210	STBD1_HUMAN	E	137;286	ENSP00000442265:D137E;ENSP00000237642:D286E	ENSP00000237642:D286E	D	+	3	2	STBD1	77449958	1.000000	0.71417	0.998000	0.56505	0.016000	0.09150	3.261000	0.51530	0.789000	0.33779	0.655000	0.94253	GAC		0.488	FAM47E-STBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252415.2			Missense_Mutation
IL13	3596	genome.wustl.edu	37	5	131994030	131994030	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1424-01	TCGA-24-1424-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr5:131994030T>G	ENST00000304506.3	+	1	166	c.152T>G	c.(151-153)gTc>gGc	p.V51G	IL13_ENST00000468334.1_Intron|AC004041.2_ENST00000435042.1_RNA|AC004041.2_ENST00000417516.1_RNA|AC004041.2_ENST00000458509.1_RNA	NM_002188.2	NP_002179.2	P35225	IL13_HUMAN	interleukin 13	51				V -> S (in Ref. 9; no nucleotide entry). {ECO:0000305}.	cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|cellular response to cytokine stimulus (GO:0071345)|cellular response to mechanical stimulus (GO:0071260)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of lung ciliated cell differentiation (GO:1901247)|negative regulation of transforming growth factor beta production (GO:0071635)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of connective tissue growth factor production (GO:0032723)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of lung goblet cell differentiation (GO:1901251)|positive regulation of macrophage activation (GO:0043032)|positive regulation of pancreatic stellate cell proliferation (GO:2000231)|positive regulation of protein secretion (GO:0050714)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat6 protein (GO:0042526)|regulation of proton transport (GO:0010155)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)	p.V51G(1)		large_intestine(1)|lung(1)|ovary(1)|skin(3)	6		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GAGGAGCTGGTCAACATCACC	0.587																																																1	Substitution - Missense(1)	ovary(1)	5											54.0	47.0	49.0					5																	131994030		2203	4300	6503	132021929	SO:0001583	missense	3596			U31120	CCDS4157.1	5q31	2011-07-14			ENSG00000169194	ENSG00000169194		"""Interleukins and interleukin receptors"""	5973	protein-coding gene	gene with protein product	"""allergic rhinitis"", ""Bronchial hyperresponsiveness-1 (bronchial asthma)"""	147683					Standard	NM_002188		Approved	P600, IL-13, ALRH, BHR1, MGC116786, MGC116788, MGC116789	uc003kxj.1	P35225	OTTHUMG00000059723	ENST00000304506.3:c.152T>G	5.37:g.131994030T>G	ENSP00000304915:p.Val51Gly		132021929	O43644|Q4VB52|Q9UDC7	Missense_Mutation	SNP	ENST00000304506.3	37	CCDS4157.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	15.64	2.891876	0.52014	.	.	ENSG00000169194	ENST00000304506	T	0.48522	0.81	5.03	-10.1	0.00402	Four-helical cytokine-like, core (1);Interleukin-4/interleukin-13, conserved site (1);Four-helical cytokine, core (1);	2.143410	0.01804	N	0.033093	T	0.36608	0.0973	L	0.50333	1.59	0.09310	N	0.999996	B	0.12630	0.006	B	0.14023	0.01	T	0.22208	-1.0223	10	0.40728	T	0.16	-1.2533	7.9687	0.30115	0.5377:0.0:0.3142:0.1481	.	51	P35225	IL13_HUMAN	G	51	ENSP00000304915:V51G	ENSP00000304915:V51G	V	+	2	0	IL13	132021929	0.000000	0.05858	0.002000	0.10522	0.708000	0.40852	-3.479000	0.00457	-1.437000	0.01967	-0.336000	0.08194	GTC		0.587	IL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132782.1	NM_002188		Missense_Mutation
OR12D2	26529	genome.wustl.edu	37	6	29365185	29365185	+	Silent	SNP	C	C	T			TCGA-24-1424-01	TCGA-24-1424-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1424-01	TCGA-24-1424-10	g.chr6:29365185C>T	ENST00000383555.2	+	1	770	c.709C>T	c.(709-711)Ctg>Ttg	p.L237L	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L237L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						CTGTAAAGCACTGTCCACTTG	0.438																																																1	Substitution - coding silent(1)	ovary(1)	6											225.0	217.0	220.0					6																	29365185		1511	2708	4219	29473164	SO:0001819	synonymous_variant	26529				CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.709C>T	6.37:g.29365185C>T			29473164	B0S862|Q5SUN9|Q6IET9	Silent	SNP	ENST00000383555.2	37	CCDS4659.1	SNP	20	WashU																																																																																				0.438	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076054.2			Silent
