#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
XG	7499	genome.wustl.edu	37	X	2729383	2729383	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1435-01	TCGA-24-1435-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chrX:2729383T>C	ENST00000381174.5	+	9	641	c.416T>C	c.(415-417)aTg>aCg	p.M139T	snoU13_ENST00000516039.1_RNA|XG_ENST00000419513.2_Missense_Mutation_p.M154T|XG_ENST00000426774.1_Missense_Mutation_p.M140T			P55808	XG_HUMAN	Xg blood group	139						integral component of plasma membrane (GO:0005887)		p.M139T(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				GCAGGCAATATGGTAGCAAAA	0.438																																																1	Substitution - Missense(1)	ovary(1)	X											51.0	48.0	49.0					X																	2729383		2203	4298	6501	2739383	SO:0001583	missense	7499			AF380356	CCDS14120.1, CCDS48073.1	Xp22.32	2014-07-19	2006-01-12		ENSG00000124343	ENSG00000124343		"""Blood group antigens"", ""Pseudoautosomal regions / PAR1"""	12806	protein-coding gene	gene with protein product		300879	"""Xg blood group (pseudoautosomal boundary-divided on the X chromosome)"""	PBDX		8054981	Standard	NM_175569		Approved		uc004cqp.3	P55808	OTTHUMG00000021075	ENST00000381174.5:c.416T>C	X.37:g.2729383T>C	ENSP00000370566:p.Met139Thr		2739383	E9PCH1|Q496N8|Q496N9|Q496P0|Q71BZ5	Missense_Mutation	SNP	ENST00000381174.5	37	CCDS14120.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	1.900	-0.453427	0.04540	.	.	ENSG00000124343	ENST00000381174;ENST00000419513;ENST00000426774;ENST00000509484;ENST00000533923	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	3.58	1.43	0.22495	.	2.178760	0.02607	N	0.101685	T	0.05914	0.0154	N	0.00707	-1.245	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.34576	-0.9823	10	0.07325	T	0.83	.	4.0654	0.09857	0.0:0.6032:0.2202:0.1766	.	139;154	P55808;P55808-3	XG_HUMAN;.	T	139;154;140;117;1	ENSP00000370566:M139T;ENSP00000411004:M154T;ENSP00000398503:M140T;ENSP00000430005:M117T	ENSP00000370566:M139T	M	+	2	0	XG	2739383	0.000000	0.05858	0.002000	0.10522	0.161000	0.22273	-1.013000	0.03645	-0.027000	0.13873	0.303000	0.19852	ATG		0.438	XG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055633.2	NM_175569		Missense_Mutation
CREB3L3	84699	genome.wustl.edu	37	19	4157240	4157240	+	Silent	SNP	A	A	G			TCGA-24-1435-01	TCGA-24-1435-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr19:4157240A>G	ENST00000078445.2	+	3	552	c.405A>G	c.(403-405)acA>acG	p.T135T	CREB3L3_ENST00000602257.1_Silent_p.T135T|CREB3L3_ENST00000252587.3_Silent_p.T125T|CREB3L3_ENST00000602147.1_Silent_p.T135T|CREB3L3_ENST00000595923.1_Silent_p.T134T	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	135					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.T135T(1)		breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCCACCACAACCCCAGGGC	0.647																																																1	Substitution - coding silent(1)	ovary(1)	19											90.0	94.0	93.0					19																	4157240		2203	4300	6503	4108240	SO:0001819	synonymous_variant	84699				CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.405A>G	19.37:g.4157240A>G			4108240	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Silent	SNP	ENST00000078445.2	37	CCDS12121.1	SNP	5	WashU																																																																																				0.647	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457922.1	NM_032607		Silent
C3	718	genome.wustl.edu	37	19	6697521	6697521	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1435-01	TCGA-24-1435-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr19:6697521G>T	ENST00000245907.6	-	21	2722	c.2630C>A	c.(2629-2631)aCc>aAc	p.T877N		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	877					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CCTCTTGGTGGTGGCCAGGCT	0.592																																																0			19											104.0	82.0	90.0					19																	6697521		2203	4300	6503	6648521	SO:0001583	missense	718			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.2630C>A	19.37:g.6697521G>T	ENSP00000245907:p.Thr877Asn		6648521	A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	CCDS32883.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	20.6	4.024656	0.75390	.	.	ENSG00000125730	ENST00000245907	T	0.35236	1.32	5.96	5.96	0.96718	.	1.525930	0.03600	N	0.233214	T	0.66416	0.2787	M	0.84326	2.69	0.26924	N	0.966604	D	0.65815	0.995	D	0.68353	0.957	T	0.53472	-0.8434	10	0.25106	T	0.35	.	14.0768	0.64895	0.0:0.0:0.8492:0.1508	.	877	P01024	CO3_HUMAN	N	877	ENSP00000245907:T877N	ENSP00000245907:T877N	T	-	2	0	C3	6648521	0.994000	0.37717	0.980000	0.43619	0.979000	0.70002	2.184000	0.42575	2.831000	0.97527	0.650000	0.86243	ACC		0.592	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7578203	7578203	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr17:7578203C>T	ENST00000269305.4	-	6	835	c.646G>A	c.(646-648)Gtg>Atg	p.V216M	TP53_ENST00000420246.2_Missense_Mutation_p.V216M|TP53_ENST00000445888.2_Missense_Mutation_p.V216M|TP53_ENST00000413465.2_Missense_Mutation_p.V216M|TP53_ENST00000359597.4_Missense_Mutation_p.V216M|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.V216M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	216	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V216M(61)|p.V216del(8)|p.0?(8)|p.V216L(7)|p.?(5)|p.V84M(3)|p.V123M(3)|p.V216fs*6(2)|p.H214fs*5(2)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V216fs*5(1)|p.V216_Y220delVVVPY(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.D207_V216del10(1)|p.S215_V218>R(1)|p.S215_V218>M(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACCACCACACTATGTCGA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	113	Substitution - Missense(74)|Deletion - In frame(11)|Deletion - Frameshift(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(4)|Complex - deletion inframe(2)|Insertion - In frame(1)	breast(17)|lung(14)|haematopoietic_and_lymphoid_tissue(12)|ovary(12)|upper_aerodigestive_tract(10)|large_intestine(9)|oesophagus(9)|biliary_tract(5)|central_nervous_system(5)|bone(5)|stomach(4)|liver(4)|pancreas(3)|soft_tissue(2)|urinary_tract(1)|skin(1)	17	GRCh37	CX952222	TP53	X							123.0	111.0	115.0					17																	7578203		2203	4300	6503	7518928	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.646G>A	17.37:g.7578203C>T	ENSP00000269305:p.Val216Met		7518928	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958421	0.92726	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99889	0.9947	M	0.92169	3.28	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.996;1.0;1.0;1.0;1.0	D	0.96411	0.9304	10	0.87932	D	0	-12.2832	16.7921	0.85592	0.0:1.0:0.0:0.0	.	177;216;216;123;216;216;216	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	216;216;216;216;216;216;205;123;84;123;84	ENSP00000410739:V216M;ENSP00000352610:V216M;ENSP00000269305:V216M;ENSP00000398846:V216M;ENSP00000391127:V216M;ENSP00000391478:V216M;ENSP00000425104:V84M;ENSP00000423862:V123M	ENSP00000269305:V216M	V	-	1	0	TP53	7518928	1.000000	0.71417	0.978000	0.43139	0.971000	0.66376	7.775000	0.85489	2.634000	0.89283	0.563000	0.77884	GTG		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
MUC16	94025	genome.wustl.edu	37	19	9068974	9068974	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr19:9068974G>T	ENST00000397910.4	-	3	18675	c.18472C>A	c.(18472-18474)Caa>Aaa	p.Q6158K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6160	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.Q6158K(1)|p.Q1791K(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGACCTGTTTGTGTGGCGATG	0.502																																																2	Substitution - Missense(2)	ovary(2)	19											71.0	75.0	73.0					19																	9068974		2121	4233	6354	8929974	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.18472C>A	19.37:g.9068974G>T	ENSP00000381008:p.Gln6158Lys		8929974	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	g	3.222	-0.159410	0.06544	.	.	ENSG00000181143	ENST00000397910	T	0.02258	4.37	1.35	-1.26	0.09376	.	.	.	.	.	T	0.01661	0.0053	N	0.24115	0.695	.	.	.	B	0.16603	0.018	B	0.06405	0.002	T	0.43343	-0.9397	8	0.87932	D	0	.	3.3894	0.07283	0.0:0.2848:0.4264:0.2887	.	6158	B5ME49	.	K	6158	ENSP00000381008:Q6158K	ENSP00000381008:Q6158K	Q	-	1	0	MUC16	8929974	0.000000	0.05858	0.000000	0.03702	0.078000	0.17371	-0.347000	0.07750	-0.266000	0.09339	0.163000	0.16589	CAA		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Missense_Mutation
MUC16	94025	genome.wustl.edu	37	19	9072137	9072137	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr19:9072137C>G	ENST00000397910.4	-	3	15512	c.15309G>C	c.(15307-15309)aaG>aaC	p.K5103N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5105	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.K736N(1)|p.K5103N(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGCCAGTATCTTATCTGAGG	0.418																																																2	Substitution - Missense(2)	ovary(2)	19											157.0	143.0	147.0					19																	9072137		1902	4136	6038	8933137	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.15309G>C	19.37:g.9072137C>G	ENSP00000381008:p.Lys5103Asn		8933137	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	c	2.414	-0.334766	0.05278	.	.	ENSG00000181143	ENST00000397910	T	0.23552	1.9	1.71	-3.42	0.04825	.	.	.	.	.	T	0.10423	0.0255	N	0.08118	0	.	.	.	B	0.17268	0.021	B	0.06405	0.002	T	0.24584	-1.0156	8	0.87932	D	0	.	3.8438	0.08926	0.4633:0.3066:0.2301:0.0	.	5103	B5ME49	.	N	5103	ENSP00000381008:K5103N	ENSP00000381008:K5103N	K	-	3	2	MUC16	8933137	0.000000	0.05858	0.000000	0.03702	0.509000	0.34042	-1.861000	0.01654	-0.648000	0.05437	0.109000	0.15622	AAG		0.418	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Missense_Mutation
SLC6A6	6533	genome.wustl.edu	37	3	14523332	14523332	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr3:14523332G>C	ENST00000454876.2	+	14	2034	c.1705G>C	c.(1705-1707)Gag>Cag	p.E569Q	SLC6A6_ENST00000360861.3_Missense_Mutation_p.E569Q			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	569					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)	p.E569Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						CTGCCAGACTGAGGGGCCGTT	0.617																																																1	Substitution - Missense(1)	ovary(1)	3											69.0	62.0	64.0					3																	14523332		2203	4300	6503	14498336	SO:0001583	missense	6533				CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.1705G>C	3.37:g.14523332G>C	ENSP00000398063:p.Glu569Gln		14498336	B2RNU7|Q9BRI2|Q9BXB0	Missense_Mutation	SNP	ENST00000454876.2	37	CCDS33705.1	SNP	45	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.728|7.728	0.698648|0.698648	0.15106|0.15106	.|.	.|.	ENSG00000131389|ENSG00000131389	ENST00000454876;ENST00000360861|ENST00000452151	T;T|.	0.72942|.	-0.7;-0.7|.	4.61|4.61	0.67|0.67	0.17923|0.17923	.|.	0.564948|.	0.18906|.	N|.	0.127881|.	T|.	0.24314|.	0.0589|.	N|N	0.14661|0.14661	0.345|0.345	0.30896|0.30896	N|N	0.729808|0.729808	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|.	0.32955|.	-0.9887|.	10|.	0.41790|.	T|.	0.15|.	.|.	7.2684|7.2684	0.26242|0.26242	0.2229:0.1393:0.6377:0.0|0.2229:0.1393:0.6377:0.0	.|.	569|.	P31641|.	SC6A6_HUMAN|.	Q|S	569|77	ENSP00000398063:E569Q;ENSP00000354107:E569Q|.	ENSP00000354107:E569Q|.	E|X	+|+	1|2	0|2	SLC6A6|SLC6A6	14498336|14498336	0.998000|0.998000	0.40836|0.40836	0.347000|0.347000	0.25668|0.25668	0.184000|0.184000	0.23303|0.23303	2.726000|2.726000	0.47302|0.47302	0.144000|0.144000	0.18951|0.18951	0.460000|0.460000	0.39030|0.39030	GAG|TGA		0.617	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340507.1	NM_003043		Missense_Mutation
OTOR	56914	genome.wustl.edu	37	20	16729556	16729556	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1435-01	TCGA-24-1435-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr20:16729556G>A	ENST00000246081.2	+	2	204	c.160G>A	c.(160-162)Gac>Aac	p.D54N		NM_020157.2	NP_064542.1	Q9NRC9	OTOR_HUMAN	otoraplin	54	SH3.				cartilage condensation (GO:0001502)|sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)		p.D54N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|liver(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	10						TAATGCCCCGGACTGTAGATT	0.363																																																1	Substitution - Missense(1)	ovary(1)	20											71.0	73.0	72.0					20																	16729556		2203	4300	6503	16677556	SO:0001583	missense	56914			AF233261	CCDS13124.1	20p12.1-p11.23	2005-11-14			ENSG00000125879	ENSG00000125879			8517	protein-coding gene	gene with protein product		606067				10873378	Standard	NM_020157		Approved	MIAL, MIAL1, FDP	uc002wpj.3	Q9NRC9	OTTHUMG00000031931	ENST00000246081.2:c.160G>A	20.37:g.16729556G>A	ENSP00000246081:p.Asp54Asn		16677556	D3DW22|Q3MIU6	Missense_Mutation	SNP	ENST00000246081.2	37	CCDS13124.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	31	5.088088	0.94100	.	.	ENSG00000125879	ENST00000246081	D	0.85171	-1.95	5.93	5.93	0.95920	Src homology-3 domain (2);Variant SH3 (1);	0.000000	0.85682	D	0.000000	D	0.94026	0.8086	M	0.90309	3.105	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.94419	0.7639	10	0.72032	D	0.01	-16.3856	18.5344	0.91004	0.0:0.0:1.0:0.0	.	54	Q9NRC9	OTOR_HUMAN	N	54	ENSP00000246081:D54N	ENSP00000246081:D54N	D	+	1	0	OTOR	16677556	1.000000	0.71417	0.973000	0.42090	0.977000	0.68977	8.069000	0.89491	2.826000	0.97356	0.655000	0.94253	GAC		0.363	OTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078108.2			Missense_Mutation
SLCO1C1	53919	genome.wustl.edu	37	12	20885980	20885980	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr12:20885980C>G	ENST00000266509.2	+	10	1692	c.1324C>G	c.(1324-1326)Ctg>Gtg	p.L442V	SLCO1C1_ENST00000381552.1_Missense_Mutation_p.L442V|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.L393V|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.L324V|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.L442V	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	442					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.L442V(1)		NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	ATTTCTTTCCCTGTTTGCACT	0.418																																																1	Substitution - Missense(1)	ovary(1)	12											195.0	175.0	182.0					12																	20885980		2203	4300	6503	20777247	SO:0001583	missense	53919			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1324C>G	12.37:g.20885980C>G	ENSP00000266509:p.Leu442Val		20777247	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	ENST00000266509.2	37	CCDS8683.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	10.38	1.334035	0.24253	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;D	0.83250	0.13;0.13;0.13;0.13;-1.7	5.11	3.28	0.37604	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.064945	0.64402	D	0.000006	T	0.72763	0.3501	N	0.20357	0.565	0.42698	D	0.993605	P;P;B;B	0.47253	0.845;0.892;0.153;0.295	P;P;B;B	0.48873	0.503;0.593;0.179;0.246	T	0.66292	-0.5960	10	0.23891	T	0.37	.	5.9588	0.19289	0.0:0.5782:0.0:0.4218	.	324;393;442;442	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	V	442;393;442;442;324	ENSP00000444149:L442V;ENSP00000438665:L393V;ENSP00000266509:L442V;ENSP00000370964:L442V;ENSP00000444527:L324V	ENSP00000266509:L442V	L	+	1	2	SLCO1C1	20777247	0.989000	0.36119	0.997000	0.53966	0.985000	0.73830	2.395000	0.44459	0.722000	0.32252	0.591000	0.81541	CTG		0.418	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435		Missense_Mutation
APOB	338	genome.wustl.edu	37	2	21235160	21235160	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1435-01	TCGA-24-1435-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr2:21235160A>T	ENST00000233242.1	-	26	4707	c.4580T>A	c.(4579-4581)cTc>cAc	p.L1527H		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1527					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.L1527H(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTGCCTTGGAGGTAGGAGGA	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											121.0	123.0	123.0					2																	21235160		2203	4300	6503	21088665	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4580T>A	2.37:g.21235160A>T	ENSP00000233242:p.Leu1527His		21088665	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	21.7	4.181585	0.78677	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01076	5.37	5.88	5.88	0.94601	.	1.077840	0.07220	N	0.860701	T	0.03520	0.0101	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	P	0.55667	0.781	T	0.59611	-0.7422	10	0.87932	D	0	.	16.3009	0.82811	1.0:0.0:0.0:0.0	.	1527	P04114	APOB_HUMAN	H	1527	ENSP00000233242:L1527H	ENSP00000233242:L1527H	L	-	2	0	APOB	21088665	1.000000	0.71417	0.908000	0.35775	0.994000	0.84299	8.842000	0.92136	2.246000	0.74042	0.533000	0.62120	CTC		0.488	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			Missense_Mutation
ZNF729	100287226	genome.wustl.edu	37	19	22498507	22498507	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1435-01	TCGA-24-1435-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr19:22498507C>G	ENST00000601693.1	+	4	2406	c.2288C>G	c.(2287-2289)aCt>aGt	p.T763S	ZNF729_ENST00000357491.6_Missense_Mutation_p.T763S			A6NN14	ZN729_HUMAN	zinc finger protein 729	763					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T763S(1)		breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						GTAATTCATACTAGGGAGAAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	19																																								22290347	SO:0001583	missense	0				CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.2288C>G	19.37:g.22498507C>G	ENSP00000469582:p.Thr763Ser		22290347	M0QY45	Missense_Mutation	SNP	ENST00000601693.1	37	CCDS59368.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	.	9.403	1.078555	0.20227	.	.	ENSG00000196350	ENST00000357491	T	0.35789	1.29	0.996	0.996	0.19844	.	.	.	.	.	T	0.38799	0.1054	L	0.49455	1.56	.	.	.	.	.	.	.	.	.	T	0.51826	-0.8656	6	0.52906	T	0.07	.	8.7778	0.34774	0.0:1.0:0.0:0.0	.	.	.	.	S	763	ENSP00000350085:T763S	ENSP00000350085:T763S	T	+	2	0	ZNF729	22290347	0.074000	0.21230	0.007000	0.13788	0.006000	0.05464	1.158000	0.31737	0.416000	0.25844	0.416000	0.27883	ACT		0.358	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301		Missense_Mutation
RPL23A	6147	genome.wustl.edu	37	17	27050601	27050601	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr17:27050601G>C	ENST00000422514.2	+	4	1012	c.399G>C	c.(397-399)gaG>gaC	p.E133D	SNORD42B_ENST00000458893.1_RNA|RPL23A_ENST00000472628.1_Missense_Mutation_p.E47D|SNORD4A_ENST00000459174.1_RNA|SNORD42A_ENST00000459584.1_RNA|RPL23A_ENST00000394938.4_Missense_Mutation_p.E171D|SNORD4B_ENST00000459083.1_RNA|AC010761.8_ENST00000582718.1_RNA|RPL23A_ENST00000496182.1_Missense_Mutation_p.E47D	NM_000984.5	NP_000975.2	P62750	RL23A_HUMAN	ribosomal protein L23a	133					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)	p.E133D(1)		endometrium(1)|lung(3)|ovary(1)	5	Lung NSC(42;0.00431)					CTGATGGAGAGAAGAAGGCAT	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											159.0	152.0	155.0					17																	27050601		2203	4300	6503	24074728	SO:0001583	missense	6147			U43701	CCDS11241.1	17q11.2	2011-04-06			ENSG00000198242	ENSG00000198242		"""L ribosomal proteins"""	10317	protein-coding gene	gene with protein product		602326				9417910	Standard	NM_000984		Approved	L23A	uc002hci.3	P62750	OTTHUMG00000132684	ENST00000422514.2:c.399G>C	17.37:g.27050601G>C	ENSP00000389103:p.Glu133Asp		24074728	B2R5B2|P29316|P39024|Q92774	Missense_Mutation	SNP	ENST00000422514.2	37	CCDS11241.1	SNP	33	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.50|16.50	3.140640|3.140640	0.56936|0.56936	.|.	.|.	ENSG00000198242|ENSG00000198242	ENST00000422514;ENST00000394938;ENST00000394935|ENST00000355731	T;T|.	0.46063|.	0.88;0.88|.	5.27|5.27	3.27|3.27	0.37495|0.37495	Ribosomal protein L23/L15e (1);Nucleotide-binding, alpha-beta plait (1);|.	0.000000|.	0.35838|.	U|.	0.002958|.	T|T	0.65048|0.65048	0.2654|0.2654	M|M	0.75447|0.75447	2.3|2.3	0.58432|0.58432	D|D	0.999996|0.999996	B|.	0.23990|.	0.095|.	B|.	0.35688|.	0.208|.	T|T	0.62081|0.62081	-0.6929|-0.6929	10|5	0.52906|.	T|.	0.07|.	-4.4278|-4.4278	8.4343|8.4343	0.32778|0.32778	0.2394:0.0:0.7606:0.0|0.2394:0.0:0.7606:0.0	.|.	133|.	P62750|.	RL23A_HUMAN|.	D|T	133;171;135|135	ENSP00000389103:E133D;ENSP00000378396:E171D|.	ENSP00000378393:E135D|.	E|R	+|+	3|2	2|0	RPL23A|RPL23A	24074728|24074728	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.916000|0.916000	0.54674|0.54674	1.856000|1.856000	0.39389|0.39389	0.601000|0.601000	0.29879|0.29879	0.462000|0.462000	0.41574|0.41574	GAG|AGA		0.542	RPL23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255975.1	NM_000984		Missense_Mutation
TNRC6A	27327	genome.wustl.edu	37	16	24804800	24804800	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr16:24804800G>T	ENST00000395799.3	+	7	3311	c.3182G>T	c.(3181-3183)gGt>gTt	p.G1061V	TNRC6A_ENST00000315183.7_Missense_Mutation_p.G1061V	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1061	Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G1061V(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		AAAGGCTGGGGTGAGCCCTGG	0.517																																																1	Substitution - Missense(1)	ovary(1)	16											58.0	64.0	62.0					16																	24804800		2197	4300	6497	24712301	SO:0001583	missense	27327			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.3182G>T	16.37:g.24804800G>T	ENSP00000379144:p.Gly1061Val		24712301	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541106	0.85917	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.19669	2.13;2.17	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.33498	0.0865	M	0.62723	1.935	0.80722	D	1	P;P	0.48162	0.773;0.906	B;P	0.47402	0.316;0.546	T	0.00717	-1.1596	10	0.26408	T	0.33	-10.4605	20.6397	0.99537	0.0:0.0:1.0:0.0	.	808;1061	Q8NDV7-2;Q8NDV7	.;TNR6A_HUMAN	V	1061	ENSP00000326900:G1061V;ENSP00000379144:G1061V	ENSP00000326900:G1061V	G	+	2	0	TNRC6A	24712301	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.498000	0.81546	2.880000	0.98712	0.650000	0.86243	GGT		0.517	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847		Missense_Mutation
PI4K2B	55300	genome.wustl.edu	37	4	25270129	25270129	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1435-01	TCGA-24-1435-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr4:25270129G>C	ENST00000264864.6	+	8	1332	c.1143G>C	c.(1141-1143)ttG>ttC	p.L381F	PI4K2B_ENST00000512921.1_Missense_Mutation_p.L285F	NM_018323.3	NP_060793.2	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	381	PI3K/PI4K.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.L381F(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|skin(3)	15		Breast(46;0.173)				TAAGAAATTTGATTCTACCAT	0.333																																																1	Substitution - Missense(1)	ovary(1)	4											63.0	62.0	62.0					4																	25270129		2203	4300	6503	24879227	SO:0001583	missense	55300			AK001967	CCDS3433.1	4p15.31	2009-05-07			ENSG00000038210	ENSG00000038210			18215	protein-coding gene	gene with protein product		612101				11923287	Standard	NM_018323		Approved	PI4KIIB, FLJ11105, PIK42B	uc003grk.2	Q8TCG2	OTTHUMG00000128564	ENST00000264864.6:c.1143G>C	4.37:g.25270129G>C	ENSP00000264864:p.Leu381Phe		24879227	Q9NUW2	Missense_Mutation	SNP	ENST00000264864.6	37	CCDS3433.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807757	0.50421	.	.	ENSG00000038210	ENST00000512921;ENST00000264864;ENST00000537420	T;T	0.77229	-1.08;-1.08	5.69	1.58	0.23477	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.82499	0.5050	M	0.75777	2.31	0.47374	D	0.999408	D	0.89917	1.0	D	0.97110	1.0	T	0.78221	-0.2288	10	0.17369	T	0.5	-13.567	5.9971	0.19499	0.3375:0.0:0.5347:0.1278	.	381	Q8TCG2	P4K2B_HUMAN	F	285;381;350	ENSP00000423373:L285F;ENSP00000264864:L381F	ENSP00000264864:L381F	L	+	3	2	PI4K2B	24879227	0.955000	0.32602	0.265000	0.24526	0.967000	0.64934	0.027000	0.13621	0.772000	0.33382	0.650000	0.86243	TTG		0.333	PI4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250415.1	NM_018323		Missense_Mutation
SEC14L3	266629	genome.wustl.edu	37	22	30858108	30858108	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1435-01	TCGA-24-1435-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr22:30858108T>C	ENST00000215812.4	-	9	826	c.736A>G	c.(736-738)Act>Gct	p.T246A	SEC14L3_ENST00000401751.1_Missense_Mutation_p.T187A|SEC14L3_ENST00000539629.1_Missense_Mutation_p.T187A|SEC14L3_ENST00000540910.1_Missense_Mutation_p.T169A|SEC14L3_ENST00000402286.1_Missense_Mutation_p.T169A|SEC14L3_ENST00000403066.1_Missense_Mutation_p.T187A|SEC14L3_ENST00000415957.2_Missense_Mutation_p.T187A	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	246	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.T246A(1)		NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	TCTGGGTCAGTCAGGGTGCCC	0.507																																					Esophageal Squamous(108;290 1516 3584 23771 37333)											1	Substitution - Missense(1)	ovary(1)	22											93.0	82.0	86.0					22																	30858108		2203	4300	6503	29188108	SO:0001583	missense	266629			AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.736A>G	22.37:g.30858108T>C	ENSP00000215812:p.Thr246Ala		29188108	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000215812.4	37	CCDS13877.1	SNP	58	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.91|16.91	3.252952|3.252952	0.59212|0.59212	.|.	.|.	ENSG00000100012|ENSG00000100012	ENST00000403066;ENST00000415957;ENST00000215812;ENST00000402286;ENST00000401751;ENST00000539629;ENST00000540910|ENST00000435069	T;T;T;T;T;T;T|.	0.60548|.	0.18;0.18;0.18;1.73;0.18;0.18;1.73|.	5.33|5.33	5.33|5.33	0.75918|0.75918	Cellular retinaldehyde-binding/triple function, C-terminal (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.77864|.	0.4194|.	M|M	0.83223|0.83223	2.63|2.63	0.80722|0.80722	D|D	1|1	B;B|.	0.25235|.	0.121;0.013|.	B;B|.	0.19148|.	0.024;0.012|.	T|.	0.80118|.	-0.1516|.	10|.	0.54805|.	T|.	0.06|.	-13.0553|-13.0553	15.2524|15.2524	0.73559|0.73559	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	169;246|.	E9PE57;Q9UDX4|.	.;S14L3_HUMAN|.	A|W	187;187;246;169;187;187;169|211	ENSP00000385941:T187A;ENSP00000401864:T187A;ENSP00000215812:T246A;ENSP00000385004:T169A;ENSP00000383896:T187A;ENSP00000444691:T187A;ENSP00000439752:T169A|.	ENSP00000215812:T246A|.	T|X	-|-	1|3	0|0	SEC14L3|SEC14L3	29188108|29188108	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.778000|4.778000	0.62368|0.62368	2.145000|2.145000	0.66743|0.66743	0.533000|0.533000	0.62120|0.62120	ACT|TGA		0.507	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975		Missense_Mutation
DOC2A	8448	genome.wustl.edu	37	16	30020582	30020582	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr16:30020582C>G	ENST00000350119.4	-	4	548	c.358G>C	c.(358-360)Gat>Cat	p.D120H	DOC2A_ENST00000564944.1_Missense_Mutation_p.D120H|DOC2A_ENST00000564979.1_Missense_Mutation_p.D120H	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	120	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)	p.D120H(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						CCATTGAAATCCATGGGCTTG	0.647																																																1	Substitution - Missense(1)	ovary(1)	16											19.0	16.0	17.0					16																	30020582		2178	4278	6456	29928083	SO:0001583	missense	8448			D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.358G>C	16.37:g.30020582C>G	ENSP00000340017:p.Asp120His		29928083	B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Missense_Mutation	SNP	ENST00000350119.4	37	CCDS10666.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	27.9	4.875095	0.91664	.	.	ENSG00000149927	ENST00000350119	T	0.56275	0.47	5.26	5.26	0.73747	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.56097	D	0.000030	D	0.83399	0.5246	H	0.98542	4.26	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89963	0.4088	10	0.87932	D	0	.	16.363	0.83280	0.0:1.0:0.0:0.0	.	120	Q14183	DOC2A_HUMAN	H	120	ENSP00000340017:D120H	ENSP00000340017:D120H	D	-	1	0	DOC2A	29928083	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.268000	0.78473	2.470000	0.83445	0.491000	0.48974	GAT		0.647	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255148.2	NM_003586		Missense_Mutation
ARHGAP5	394	genome.wustl.edu	37	14	32561295	32561295	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr14:32561295G>A	ENST00000345122.3	+	2	1735	c.1420G>A	c.(1420-1422)Gta>Ata	p.V474I	ARHGAP5_ENST00000539826.2_Missense_Mutation_p.V474I|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.V474I|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.V474I	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	474	FF 3.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.V474I(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TAGCAAAGAGGTATATGGTAG	0.368																																					NSCLC(9;77 350 3443 29227 41353)											1	Substitution - Missense(1)	ovary(1)	14											74.0	77.0	76.0					14																	32561295		2203	4297	6500	31631046	SO:0001583	missense	394			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1420G>A	14.37:g.32561295G>A	ENSP00000371897:p.Val474Ile		31631046	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	1.872	-0.460038	0.04508	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.07216	3.21;3.21;3.21;3.21	6.02	6.02	0.97574	FF domain (1);	0.000000	0.85682	D	0.000000	T	0.06050	0.0157	N	0.05487	-0.04	0.80722	D	1	B;B	0.18610	0.029;0.017	B;B	0.30105	0.111;0.052	T	0.20874	-1.0262	10	0.02654	T	1	.	20.547	0.99278	0.0:0.0:1.0:0.0	.	474;474	Q13017-2;Q13017	.;RHG05_HUMAN	I	474	ENSP00000452222:V474I;ENSP00000441692:V474I;ENSP00000371897:V474I;ENSP00000393307:V474I	ENSP00000371897:V474I	V	+	1	0	ARHGAP5	31631046	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.062000	0.89475	2.850000	0.98022	0.650000	0.86243	GTA		0.368	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055		Missense_Mutation
NLRC4	58484	genome.wustl.edu	37	2	32475438	32475438	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr2:32475438C>A	ENST00000404025.2	-	5	1983	c.1495G>T	c.(1495-1497)Gtg>Ttg	p.V499L	NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000402280.1_Missense_Mutation_p.V499L|NLRC4_ENST00000360906.5_Missense_Mutation_p.V499L			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	499					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.V499L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GTGGCTTCCACAGATGACCCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											66.0	64.0	65.0					2																	32475438		2203	4300	6503	32328942	SO:0001583	missense	58484			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.1495G>T	2.37:g.32475438C>A	ENSP00000385090:p.Val499Leu		32328942	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	ENST00000404025.2	37	CCDS33174.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	0.181	-1.062440	0.01950	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.10099	2.91;2.91;2.91	3.4	-4.83	0.03161	.	2.131760	0.02374	N	0.078168	T	0.05502	0.0145	N	0.08118	0	0.22213	N	0.999281	B	0.12013	0.005	B	0.08055	0.003	T	0.34900	-0.9810	9	0.25751	T	0.34	.	8.1166	0.30946	0.0:0.2521:0.1215:0.6264	.	499	Q9NPP4	NLRC4_HUMAN	L	499	ENSP00000354159:V499L;ENSP00000385428:V499L;ENSP00000385090:V499L	ENSP00000354159:V499L	V	-	1	0	NLRC4	32328942	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-1.269000	0.02834	-1.130000	0.02914	-0.300000	0.09419	GTG		0.532	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209		Missense_Mutation
GJB5	2709	genome.wustl.edu	37	1	35223670	35223670	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:35223670G>A	ENST00000338513.1	+	2	912	c.739G>A	c.(739-741)Gac>Aac	p.D247N	GJB4_ENST00000339480.1_5'Flank	NM_005268.3	NP_005259.1	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	247					cell communication (GO:0007154)|epidermis development (GO:0008544)|labyrinthine layer morphogenesis (GO:0060713)|spongiotrophoblast differentiation (GO:0060708)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)		p.D247N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)	10		Myeloproliferative disorder(586;0.0393)				CCTTTCGGGTGACCTCATCTT	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											128.0	109.0	116.0					1																	35223670		2203	4300	6503	34996257	SO:0001583	missense	2709			BC004379	CCDS382.1	1p34.3	2008-05-14	2007-11-06		ENSG00000189280	ENSG00000189280		"""Ion channels / Gap junction proteins (connexins)"""	4287	protein-coding gene	gene with protein product	"""connexin 31.1"""	604493	"""gap junction protein, beta 5 (connexin 31.1)"", ""gap junction protein, beta 5"""			9843209	Standard	NM_005268		Approved	CX31.1	uc001bxu.4	O95377	OTTHUMG00000004053	ENST00000338513.1:c.739G>A	1.37:g.35223670G>A	ENSP00000340811:p.Asp247Asn		34996257	Q9UPA3	Missense_Mutation	SNP	ENST00000338513.1	37	CCDS382.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	13.57	2.276440	0.40294	.	.	ENSG00000189280	ENST00000338513	D	0.97731	-4.51	5.71	3.86	0.44501	.	0.490245	0.17011	U	0.190481	D	0.95548	0.8553	M	0.71581	2.175	0.32471	N	0.542803	P	0.34462	0.454	B	0.24974	0.057	D	0.93971	0.7249	10	0.21540	T	0.41	.	12.0513	0.53507	0.0954:0.0:0.9046:0.0	.	247	O95377	CXB5_HUMAN	N	247	ENSP00000340811:D247N	ENSP00000340811:D247N	D	+	1	0	GJB5	34996257	0.014000	0.17966	0.674000	0.29902	0.279000	0.26890	0.658000	0.24979	0.777000	0.33496	0.563000	0.77884	GAC		0.572	GJB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011561.1	NM_005268		Missense_Mutation
TCP11	6954	genome.wustl.edu	37	6	35086096	35086096	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1435-01	TCGA-24-1435-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr6:35086096T>G	ENST00000512012.1	-	9	1618	c.1462A>C	c.(1462-1464)Acc>Ccc	p.T488P	TCP11_ENST00000373979.2_Missense_Mutation_p.T426P|TCP11_ENST00000311875.5_Missense_Mutation_p.T501P|TCP11_ENST00000444780.2_Missense_Mutation_p.T496P|TCP11_ENST00000412155.2_Missense_Mutation_p.T450P|TCP11_ENST00000244645.3_Missense_Mutation_p.T426P|TCP11_ENST00000418521.2_Missense_Mutation_p.T425P|TCP11_ENST00000373974.4_Missense_Mutation_p.T455P			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	488					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.T426P(1)		breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						GAAATGAGGGTTTTTAGGATC	0.502																																																1	Substitution - Missense(1)	ovary(1)	6											161.0	162.0	162.0					6																	35086096		2203	4300	6503	35194074	SO:0001583	missense	6954				CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.1462A>C	6.37:g.35086096T>G	ENSP00000425995:p.Thr488Pro		35194074	B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Missense_Mutation	SNP	ENST00000512012.1	37		SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	13.14	2.149722	0.37923	.	.	ENSG00000124678	ENST00000373979;ENST00000412155;ENST00000244645;ENST00000311875;ENST00000444780;ENST00000373974;ENST00000418521;ENST00000512012	T;T;T;T;T;T;T;T	0.11930	2.73;2.73;2.73;2.73;2.73;2.73;2.73;2.73	5.32	2.87	0.33458	.	0.549053	0.18469	N	0.140280	T	0.04998	0.0134	L	0.57536	1.79	0.09310	N	0.999998	B;B;B;B;B;B	0.12013	0.002;0.002;0.002;0.005;0.002;0.001	B;B;B;B;B;B	0.13407	0.006;0.006;0.006;0.009;0.006;0.008	T	0.34329	-0.9833	10	0.59425	D	0.04	-7.0261	6.5218	0.22279	0.1486:0.0761:0.0:0.7753	.	455;450;496;561;488;426	B7Z7G1;E7EP29;B7Z7B5;Q5TB88;Q8WWU5;Q8WWU5-2	.;.;.;.;TCP11_HUMAN;.	P	426;450;426;501;496;455;425;488	ENSP00000363091:T426P;ENSP00000402816:T450P;ENSP00000244645:T426P;ENSP00000308708:T501P;ENSP00000404479:T496P;ENSP00000363085:T455P;ENSP00000415320:T425P;ENSP00000425995:T488P	ENSP00000244645:T426P	T	-	1	0	TCP11	35194074	0.016000	0.18221	0.007000	0.13788	0.091000	0.18340	0.819000	0.27308	0.310000	0.22990	0.460000	0.39030	ACC		0.502	TCP11-014	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000370354.1	NM_001093728		Missense_Mutation
PAMR1	25891	genome.wustl.edu	37	11	35496225	35496225	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr11:35496225G>C	ENST00000378880.2	-	4	892	c.447C>G	c.(445-447)caC>caG	p.H149Q	PAMR1_ENST00000378878.3_Intron|PAMR1_ENST00000534803.1_5'UTR|PAMR1_ENST00000278360.3_Missense_Mutation_p.H149Q|PAMR1_ENST00000532848.1_Missense_Mutation_p.H109Q	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	149	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.H149Q(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						TCCATTCACAGTGAGCATTTA	0.443																																																1	Substitution - Missense(1)	ovary(1)	11											109.0	100.0	103.0					11																	35496225		2202	4298	6500	35452801	SO:0001583	missense	25891				CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.447C>G	11.37:g.35496225G>C	ENSP00000368158:p.His149Gln		35452801	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	ENST00000378880.2	37	CCDS31460.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	11.87	1.767182	0.31320	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000532848;ENST00000527605	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	5.2	1.26	0.21427	CUB (5);	0.124840	0.52532	D	0.000069	T	0.31263	0.0791	N	0.04994	-0.135	0.80722	D	1	B;B	0.30361	0.175;0.277	B;B	0.31390	0.129;0.079	T	0.08932	-1.0698	10	0.87932	D	0	.	5.5558	0.17115	0.2971:0.0:0.5668:0.1361	.	149;149	Q6UXH9;Q6UXH9-2	PAMR1_HUMAN;.	Q	149;149;109;109	ENSP00000278360:H149Q;ENSP00000368158:H149Q;ENSP00000433868:H109Q;ENSP00000432591:H109Q	ENSP00000278360:H149Q	H	-	3	2	PAMR1	35452801	0.999000	0.42202	0.984000	0.44739	0.835000	0.47333	0.429000	0.21412	0.215000	0.20761	0.462000	0.41574	CAC		0.443	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430		Missense_Mutation
GORASP1	64689	genome.wustl.edu	37	3	39144201	39144201	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr3:39144201G>A	ENST00000319283.3	-	3	1137	c.316C>T	c.(316-318)Cgc>Tgc	p.R106C	GORASP1_ENST00000422110.2_Intron|GORASP1_ENST00000479927.1_Intron	NM_031899.2	NP_114105.1	Q9BQQ3	GORS1_HUMAN	golgi reassembly stacking protein 1, 65kDa	106					Golgi organization (GO:0007030)|mitotic cell cycle (GO:0000278)|negative regulation of dendrite morphogenesis (GO:0050774)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)		p.R106C(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(1)|ovary(3)|urinary_tract(1)	14				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CTGGCCCTGCGGAAGCTGCAG	0.627																																																1	Substitution - Missense(1)	ovary(1)	3											101.0	94.0	96.0					3																	39144201		2203	4300	6503	39119205	SO:0001583	missense	64689			AJ409349	CCDS2681.1, CCDS63596.1, CCDS63597.1	3p22-p21.33	2008-04-23	2002-08-29	2002-05-24	ENSG00000114745	ENSG00000114745			16769	protein-coding gene	gene with protein product		606867	"""golgi phosphoprotein 5"""	GOLPH5			Standard	NM_001278789		Approved	GRASP65, P65, FLJ23443	uc003ciw.1	Q9BQQ3	OTTHUMG00000131292	ENST00000319283.3:c.316C>T	3.37:g.39144201G>A	ENSP00000313869:p.Arg106Cys		39119205	B3KWC8|Q3SYG7|Q8N272|Q96H42	Missense_Mutation	SNP	ENST00000319283.3	37	CCDS2681.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595927	0.66332	.	.	ENSG00000114745	ENST00000319283;ENST00000437458;ENST00000416741;ENST00000411813	T	0.30981	1.51	5.05	3.18	0.36537	PDZ/DHR/GLGF (1);	0.363545	0.29369	N	0.012347	T	0.40067	0.1102	L	0.36672	1.1	0.80722	D	1	D	0.57257	0.979	P	0.61658	0.892	T	0.15350	-1.0440	10	0.72032	D	0.01	-12.0833	11.3652	0.49668	0.0:0.1311:0.7161:0.1527	.	106	Q9BQQ3	GORS1_HUMAN	C	106;146;33;106	ENSP00000313869:R106C	ENSP00000313869:R106C	R	-	1	0	GORASP1	39119205	1.000000	0.71417	0.981000	0.43875	0.815000	0.46073	3.243000	0.51392	0.461000	0.27071	-0.410000	0.06199	CGC		0.627	GORASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254060.1			Missense_Mutation
MROH2B	133558	genome.wustl.edu	37	5	41033156	41033156	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1435-01	TCGA-24-1435-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr5:41033156A>G	ENST00000399564.4	-	23	2798	c.2348T>C	c.(2347-2349)aTt>aCt	p.I783T	MROH2B_ENST00000506092.2_Missense_Mutation_p.I338T	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	783								p.I783T(1)									CATGTAACCAATCAGCATCTC	0.433																																																1	Substitution - Missense(1)	ovary(1)	5											121.0	111.0	114.0					5																	41033156		2011	4173	6184	41068913	SO:0001583	missense	133558				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2348T>C	5.37:g.41033156A>G	ENSP00000382476:p.Ile783Thr		41068913	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	8.591	0.884613	0.17467	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.68479	-0.33;-0.33	5.55	5.55	0.83447	Armadillo-type fold (1);	0.419619	0.20374	N	0.093589	T	0.43033	0.1229	N	0.03324	-0.35	0.09310	N	0.999998	B	0.26195	0.144	B	0.24155	0.051	T	0.33266	-0.9875	10	0.33141	T	0.24	.	12.0724	0.53624	1.0:0.0:0.0:0.0	.	783	Q7Z745	HTRB2_HUMAN	T	338;488;783	ENSP00000441504:I338T;ENSP00000382476:I783T	ENSP00000296803:I488T	I	-	2	0	HEATR7B2	41068913	0.958000	0.32768	0.025000	0.17156	0.135000	0.20990	4.598000	0.61069	2.113000	0.64589	0.533000	0.62120	ATT		0.433	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		Missense_Mutation
DYNC2LI1	51626	genome.wustl.edu	37	2	44010664	44010664	+	Silent	SNP	G	G	A			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr2:44010664G>A	ENST00000260605.8	+	3	232	c.132G>A	c.(130-132)aaG>aaA	p.K44K	DYNC2LI1_ENST00000443170.3_5'UTR|DYNC2LI1_ENST00000398823.2_Silent_p.K44K|DYNC2LI1_ENST00000489222.2_3'UTR|DYNC2LI1_ENST00000406852.3_Silent_p.K44K|DYNC2LI1_ENST00000605786.1_Silent_p.K44K	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1	44					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)	p.K44K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TCCAGGGAAAGACTACTATTA	0.299																																																1	Substitution - coding silent(1)	ovary(1)	2											130.0	142.0	138.0					2																	44010664		2203	4293	6496	43864168	SO:0001819	synonymous_variant	51626				CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.132G>A	2.37:g.44010664G>A			43864168	A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Silent	SNP	ENST00000260605.8	37	CCDS1813.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	12.10	1.835930	0.32421	.	.	ENSG00000138036	ENST00000378587	.	.	.	5.85	4.07	0.47477	.	.	.	.	.	T	0.59459	0.2195	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55108	-0.8192	4	.	.	.	-15.7147	9.4488	0.38714	0.2162:0.0:0.7838:0.0	.	.	.	.	K	28	.	.	R	+	2	0	DYNC2LI1	43864168	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.808000	0.38912	0.824000	0.34613	0.561000	0.74099	AGA		0.299	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250536.2	NM_016008		Silent
ST3GAL3	6487	genome.wustl.edu	37	1	44290497	44290497	+	Intron	SNP	C	C	G			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:44290497C>G	ENST00000361392.4	+	4	386				ST3GAL3_ENST00000372375.2_Missense_Mutation_p.P102A|ST3GAL3_ENST00000361812.4_Intron|ST3GAL3_ENST00000372365.1_Intron|ST3GAL3_ENST00000528371.1_Intron|ST3GAL3_ENST00000372366.1_Intron|ST3GAL3_ENST00000531993.1_Intron|ST3GAL3_ENST00000351035.3_Missense_Mutation_p.P86A|ST3GAL3_ENST00000262915.3_Missense_Mutation_p.P117A|ST3GAL3_ENST00000545417.1_Intron|ST3GAL3_ENST00000347631.2_Intron|ST3GAL3_ENST00000361746.4_Missense_Mutation_p.P117A|ST3GAL3_ENST00000531451.1_Intron|ST3GAL3_ENST00000372362.2_Intron|ST3GAL3_ENST00000330208.2_Intron|ST3GAL3_ENST00000353126.3_Intron|ST3GAL3_ENST00000372372.2_Missense_Mutation_p.P86A|ST3GAL3_ENST00000372367.1_Intron|ST3GAL3_ENST00000533933.1_Intron|ST3GAL3_ENST00000372377.4_Intron|ST3GAL3_ENST00000372369.1_Intron|ST3GAL3_ENST00000372368.2_Missense_Mutation_p.P102A|ST3GAL3_ENST00000372374.2_Intron|ST3GAL3_ENST00000361400.4_Intron|ST3GAL3_ENST00000332628.6_Intron|ST3GAL3_ENST00000531816.1_Intron|ST3GAL3_ENST00000335430.6_Intron|ST3GAL3_ENST00000461375.1_Intron	NM_001270459.1|NM_006279.3|NM_174964.2	NP_001257388.1|NP_006270.1|NP_777624.1	Q11203	SIAT6_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 3						carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|N-acetyllactosaminide alpha-2,3-sialyltransferase activity (GO:0008118)	p.P117A(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(3)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				tgcatcccaccctctagagat	0.473																																																1	Substitution - Missense(1)	ovary(1)	1											71.0	71.0	71.0					1																	44290497		2203	4299	6502	44063084	SO:0001627	intron_variant	6487			L23768	CCDS492.1, CCDS493.1, CCDS494.1, CCDS495.1, CCDS496.1, CCDS497.1, CCDS498.1, CCDS499.1, CCDS500.1, CCDS53310.1, CCDS57988.1, CCDS57989.1, CCDS57990.1, CCDS57991.1, CCDS57992.1, CCDS57993.1, CCDS57994.1	1p34.1	2014-01-31	2005-02-07	2005-02-07	ENSG00000126091	ENSG00000126091	2.4.99.6	"""Sialyltransferases"""	10866	protein-coding gene	gene with protein product	"""ST3Gal III"""	606494	"""sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase)"", ""mental retardation, non-syndromic, autosomal recessive, 12"""	SIAT6, MRT12		8333853, 21907012	Standard	NM_174963		Approved		uc001cjz.4	Q11203	OTTHUMG00000007561	ENST00000361392.4:c.209+9892C>G	1.37:g.44290497C>G			44063084	A9Z1W2|D3DPX8|Q5T4W9|Q5T4X0|Q5T4X7|Q5T4X8|Q5T4X9|Q5T4Y0|Q5T4Y2|Q5T4Y3|Q5T4Y4|Q86UR6|Q86UR7|Q86UR8|Q86UR9|Q86US0|Q86US1|Q86US2|Q8IX41|Q8IX42|Q8IX43|Q8IX44|Q8IX45|Q8IX46|Q8IX47|Q8IX48|Q8IX49|Q8IX50|Q8IX51|Q8IX52|Q8IX53|Q8IX54|Q8IX55|Q8IX56|Q8IX57|Q8IX58	Missense_Mutation	SNP	ENST00000361392.4	37	CCDS492.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	7.703	0.693428	0.15039	.	.	ENSG00000126091	ENST00000262915;ENST00000372375;ENST00000351035;ENST00000361746;ENST00000372368;ENST00000372372	T;T;T;T;T;T	0.56103	0.53;0.53;0.48;0.53;0.53;0.48	2.47	0.482	0.16815	.	.	.	.	.	T	0.36663	0.0975	.	.	.	0.09310	N	1	B;B;B	0.19706	0.038;0.038;0.038	B;B;B	0.25140	0.012;0.012;0.058	T	0.32561	-0.9902	8	0.49607	T	0.09	.	2.7335	0.05234	0.2816:0.5558:0.0:0.1626	.	86;102;117	Q11203-19;Q11203-13;Q11203-4	.;.;.	A	117;102;86;117;102;86	ENSP00000262915:P117A;ENSP00000361450:P102A;ENSP00000316999:P86A;ENSP00000354657:P117A;ENSP00000361443:P102A;ENSP00000361447:P86A	ENSP00000262915:P117A	P	+	1	0	ST3GAL3	44063084	0.002000	0.14202	0.001000	0.08648	0.324000	0.28378	0.291000	0.18994	0.116000	0.18110	-0.293000	0.09583	CCT		0.473	ST3GAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019964.1	NM_174963		Missense_Mutation
CCR3	1232	genome.wustl.edu	37	3	46307596	46307596	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1435-01	TCGA-24-1435-10	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr3:46307596T>C	ENST00000357422.2	+	4	1490	c.947T>C	c.(946-948)tTc>tCc	p.F316S	CCR3_ENST00000395940.2_Missense_Mutation_p.F316S|CCR3_ENST00000545097.1_Missense_Mutation_p.F337S|CCR3_ENST00000395942.2_Missense_Mutation_p.F316S|CCR3_ENST00000541018.1_Missense_Mutation_p.F316S			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	316					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)	p.F316S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		CGCCACTTCTTCCACAGGCAC	0.552																																																1	Substitution - Missense(1)	ovary(1)	3											100.0	85.0	90.0					3																	46307596		2203	4300	6503	46282600	SO:0001583	missense	1232			AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.947T>C	3.37:g.46307596T>C	ENSP00000350003:p.Phe316Ser		46282600	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	37	CCDS2738.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	20.8	4.058355	0.76074	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	5.42	5.42	0.78866	.	1.401590	0.05162	N	0.497883	T	0.73822	0.3636	M	0.88310	2.945	0.43499	D	0.995742	D;D	0.69078	0.997;0.988	D;P	0.68483	0.958;0.852	T	0.61402	-0.7070	10	0.87932	D	0	.	15.4496	0.75262	0.0:0.0:0.0:1.0	.	337;316	F5GWL6;P51677	.;CCR3_HUMAN	S	316;337;316;316;316	ENSP00000350003:F316S;ENSP00000441600:F337S;ENSP00000440097:F316S;ENSP00000379271:F316S;ENSP00000379273:F316S	ENSP00000350003:F316S	F	+	2	0	CCR3	46282600	0.984000	0.35163	0.915000	0.36163	0.799000	0.45148	2.099000	0.41767	2.042000	0.60477	0.459000	0.35465	TTC		0.552	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2			Missense_Mutation
LHCGR	3973	genome.wustl.edu	37	2	48915723	48915723	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr2:48915723C>T	ENST00000294954.7	-	11	1234	c.1213G>A	c.(1213-1215)Gac>Aac	p.D405N	LHCGR_ENST00000344775.3_Missense_Mutation_p.D343N|LHCGR_ENST00000403273.1_Splice_Site|LHCGR_ENST00000405626.1_Missense_Mutation_p.D378N|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000401907.1_Intron	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	405					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)	p.D405N(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	ATGCAAAAGTCTGCAAAGGAG	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											68.0	67.0	67.0					2																	48915723		2203	4300	6503	48769227	SO:0001583	missense	3973				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1213G>A	2.37:g.48915723C>T	ENSP00000294954:p.Asp405Asn		48769227	Q14751|Q15996|Q9UEW9	Splice_Site_SNP	SNP	ENST00000294954.7	37	CCDS1842.1	SNP	32	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.1|21.1	4.099407|4.099407	0.76983|0.76983	.|.	.|.	ENSG00000138039|ENSG00000138039	ENST00000403273|ENST00000344775;ENST00000294954;ENST00000405626	.|D;D;D	.|0.88431	.|-2.38;-2.38;-2.38	5.91|5.91	5.91|5.91	0.95273|0.95273	.|GPCR, rhodopsin-like superfamily (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.96374	.|0.8817	H|H	0.94183|0.94183	3.505|3.505	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.91635	.|0.999	.|D	.|0.96883	.|0.9647	.|9	.|.	.|.	.|.	.|.	19.2939|19.2939	0.94114|0.94114	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|405	.|P22888	.|LSHR_HUMAN	.|N	-1|343;405;378	.|ENSP00000344301:D343N;ENSP00000294954:D405N;ENSP00000386033:D378N	.|.	.|D	-|-	.|1	.|0	LHCGR|LHCGR	48769227|48769227	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.086000|6.086000	0.71352|0.71352	2.791000|2.791000	0.96007|0.96007	0.655000|0.655000	0.94253|0.94253	.|GAC		0.468	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3		Splice_Site_SNP
TRAIP	10293	genome.wustl.edu	37	3	49885593	49885593	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1435-01	TCGA-24-1435-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr3:49885593G>C	ENST00000331456.2	-	2	252	c.139C>G	c.(139-141)Cca>Gca	p.P47A	TRAIP_ENST00000469027.1_Missense_Mutation_p.P47A|TRAIP_ENST00000473863.1_5'UTR	NM_005879.2	NP_005870.2	Q9BWF2	TRAIP_HUMAN	TRAF interacting protein	47					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|receptor signaling protein activity (GO:0005057)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P47A(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CGGCACTGTGGGCAGGTCCGA	0.502																																																1	Substitution - Missense(1)	ovary(1)	3											102.0	87.0	92.0					3																	49885593		2203	4300	6503	49860597	SO:0001583	missense	10293			BC019283	CCDS2806.1	3p21.31	2013-01-09			ENSG00000183763	ENSG00000183763		"""RING-type (C3HC4) zinc fingers"""	30764	protein-coding gene	gene with protein product	"""ring finger protein 206"""	605958				9104814	Standard	NM_005879		Approved	TRIP, RNF206	uc003cxs.1	Q9BWF2	OTTHUMG00000158269	ENST00000331456.2:c.139C>G	3.37:g.49885593G>C	ENSP00000328203:p.Pro47Ala		49860597	B5BU84|B5BUL3|O00467	Missense_Mutation	SNP	ENST00000331456.2	37	CCDS2806.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	16.89	3.246788	0.59103	.	.	ENSG00000183763	ENST00000331456;ENST00000469027;ENST00000482582;ENST00000482243	D;D;D;D	0.94497	-3.44;-3.44;-3.44;-3.44	5.65	4.75	0.60458	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.051323	0.85682	N	0.000000	D	0.97901	0.9310	M	0.93197	3.39	0.53005	D	0.999967	D;B;D	0.89917	1.0;0.235;1.0	D;B;D	0.97110	1.0;0.19;1.0	D	0.98844	1.0756	10	0.87932	D	0	-13.4357	15.3398	0.74287	0.0:0.1402:0.8598:0.0	.	47;47;47	B4DIU1;A8K807;Q9BWF2	.;.;TRAIP_HUMAN	A	47	ENSP00000328203:P47A;ENSP00000420085:P47A;ENSP00000418544:P47A;ENSP00000419350:P47A	ENSP00000328203:P47A	P	-	1	0	TRAIP	49860597	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.401000	0.90202	1.321000	0.45227	0.655000	0.94253	CCA		0.502	TRAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350518.1	NM_005879		Missense_Mutation
IQSEC2	23096	genome.wustl.edu	37	X	53283901	53283901	+	Silent	SNP	C	C	T	rs370611796		TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chrX:53283901C>T	ENST00000375368.5	-	3	1382	c.1182G>A	c.(1180-1182)gcG>gcA	p.A394A	IQSEC2_ENST00000396435.3_Silent_p.A404A|IQSEC2_ENST00000375365.2_Silent_p.A199A			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	394					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.A401A(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						CCTCGAAGTACGCGGGGTTCT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	X						C	,	1,3834		0,1,1631,571	41.0	26.0	31.0		1212,597	2.0	1.0	X		31	0,6728		0,0,2428,1872	no	coding-synonymous,coding-synonymous	IQSEC2	NM_001111125.2,NM_015075.1	,	0,1,4059,2443	TT,TC,CC,C		0.0,0.0261,0.0095	,	404/1489,199/950	53283901	1,10562	2203	4300	6503	53300626	SO:0001819	synonymous_variant	23096			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1182G>A	X.37:g.53283901C>T			53300626	B3KT97|C7SDG1|O60275|Q5JUX1	Silent	SNP	ENST00000375368.5	37		SNP	19	WashU																																																																																				0.627	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345		Silent
OR6C75	390323	genome.wustl.edu	37	12	55759292	55759292	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1435-01	TCGA-24-1435-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr12:55759292T>A	ENST00000343399.3	+	1	398	c.398T>A	c.(397-399)aTc>aAc	p.I133N		NM_001005497.1	NP_001005497.1	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C, member 75	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I133N(1)		endometrium(2)|large_intestine(5)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)	25						TACACAATCATCATGAGCACC	0.458																																																1	Substitution - Missense(1)	ovary(1)	12											168.0	141.0	150.0					12																	55759292		2203	4300	6503	54045559	SO:0001583	missense	390323				CCDS31820.1	12q13.2	2013-09-23			ENSG00000187857	ENSG00000187857		"""GPCR / Class A : Olfactory receptors"""	31304	protein-coding gene	gene with protein product							Standard	NM_001005497		Approved		uc010spk.2	A6NL08	OTTHUMG00000169886	ENST00000343399.3:c.398T>A	12.37:g.55759292T>A	ENSP00000368987:p.Ile133Asn		54045559		Missense_Mutation	SNP	ENST00000343399.3	37	CCDS31820.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	t	14.83	2.651246	0.47362	.	.	ENSG00000187857	ENST00000343399	T	0.00418	7.49	5.25	5.25	0.73442	GPCR, rhodopsin-like superfamily (1);	0.284658	0.24683	N	0.036444	T	0.01387	0.0045	M	0.90870	3.155	0.34838	D	0.740387	D	0.69078	0.997	D	0.64506	0.926	T	0.30149	-0.9988	10	0.87932	D	0	.	11.0501	0.47882	0.0:0.0:0.1554:0.8446	.	133	A6NL08	O6C75_HUMAN	N	133	ENSP00000368987:I133N	ENSP00000368987:I133N	I	+	2	0	OR6C75	54045559	0.475000	0.25894	0.999000	0.59377	0.300000	0.27592	3.640000	0.54350	2.202000	0.70862	0.519000	0.50382	ATC		0.458	OR6C75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406418.1			Missense_Mutation
OR5D16	390144	genome.wustl.edu	37	11	55607071	55607071	+	Missense_Mutation	SNP	G	G	A	rs375193534		TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr11:55607071G>A	ENST00000378396.1	+	1	844	c.844G>A	c.(844-846)Gtg>Atg	p.V282M		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V282M(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				GTTTTACACCGTGGTGATCCC	0.413																																																1	Substitution - Missense(1)	ovary(1)	11						G	MET/VAL	0,4402		0,0,2201	73.0	69.0	71.0		844	4.3	0.3	11		71	1,8591		0,1,4295	no	missense	OR5D16	NM_001005496.1	21	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	282/329	55607071	1,12993	2201	4296	6497	55363647	SO:0001583	missense	390144			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.844G>A	11.37:g.55607071G>A	ENSP00000367649:p.Val282Met		55363647	Q6IF65|Q96RB4	Missense_Mutation	SNP	ENST00000378396.1	37	CCDS31512.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	.	7.186	0.590545	0.13812	0.0	1.16E-4	ENSG00000205029	ENST00000378396	T	0.00307	8.17	4.27	4.27	0.50696	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00524	0.0017	M	0.78344	2.41	0.09310	N	1	P	0.52061	0.95	P	0.55824	0.785	T	0.59685	-0.7408	9	0.30854	T	0.27	-15.9636	14.5936	0.68389	0.0:0.0:1.0:0.0	.	282	Q8NGK9	OR5DG_HUMAN	M	282	ENSP00000367649:V282M	ENSP00000367649:V282M	V	+	1	0	OR5D16	55363647	0.000000	0.05858	0.313000	0.25210	0.047000	0.14425	-0.409000	0.07160	2.118000	0.64928	0.537000	0.68136	GTG		0.413	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496		Missense_Mutation
FLNB	2317	genome.wustl.edu	37	3	58111324	58111324	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr3:58111324G>C	ENST00000295956.4	+	23	4080	c.3915G>C	c.(3913-3915)gaG>gaC	p.E1305D	FLNB_ENST00000490882.1_Missense_Mutation_p.E1305D|FLNB_ENST00000493452.1_Missense_Mutation_p.E1136D|FLNB_ENST00000357272.4_Missense_Mutation_p.E1305D|FLNB_ENST00000348383.5_Missense_Mutation_p.E1305D|FLNB_ENST00000358537.3_Missense_Mutation_p.E1305D|FLNB_ENST00000429972.2_Missense_Mutation_p.E1305D|FLNB_ENST00000419752.2_Missense_Mutation_p.E1136D	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1305	Interaction with FBLP1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.E1305D(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		ATGTAGTGGAGGTGACATATG	0.458																																																1	Substitution - Missense(1)	ovary(1)	3											168.0	141.0	150.0					3																	58111324		2203	4300	6503	58086364	SO:0001583	missense	2317			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.3915G>C	3.37:g.58111324G>C	ENSP00000295956:p.Glu1305Asp		58086364	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	6.874	0.530739	0.13127	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91	6.06	2.89	0.33648	Immunoglobulin E-set (2);Immunoglobulin-like fold (1);	0.238346	0.49916	D	0.000127	T	0.80773	0.4687	N	0.16266	0.395	0.37723	D	0.925	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.09377	0.001;0.004;0.002;0.0;0.002;0.002	T	0.69599	-0.5102	10	0.14656	T	0.56	.	5.2111	0.15316	0.1366:0.2663:0.4953:0.1018	.	1305;1305;1136;1136;1305;1305	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	D	1305;1305;1305;1305;1305;1305;1136;1136	ENSP00000295956:E1305D;ENSP00000420213:E1305D;ENSP00000351339:E1305D;ENSP00000415599:E1305D;ENSP00000232447:E1305D;ENSP00000349819:E1305D;ENSP00000418510:E1136D;ENSP00000414532:E1136D	ENSP00000295956:E1305D	E	+	3	2	FLNB	58086364	0.995000	0.38212	1.000000	0.80357	0.508000	0.34012	0.270000	0.18607	0.895000	0.36342	-0.140000	0.14226	GAG		0.458	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457		Missense_Mutation
OR4D10	390197	genome.wustl.edu	37	11	59245129	59245129	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1435-01	TCGA-24-1435-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr11:59245129T>C	ENST00000530162.1	+	1	284	c.227T>C	c.(226-228)aTc>aCc	p.I76T		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I74T(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTCTCTTCCATCACAGTGCCC	0.443																																																1	Substitution - Missense(1)	ovary(1)	11											149.0	149.0	149.0					11																	59245129		2065	4233	6298	59001705	SO:0001583	missense	390197			AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.227T>C	11.37:g.59245129T>C	ENSP00000436424:p.Ile76Thr		59001705	B2RNH6	Missense_Mutation	SNP	ENST00000530162.1	37	CCDS53636.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	1.494	-0.553795	0.03996	.	.	ENSG00000254466	ENST00000530162	T	0.00512	6.89	4.4	4.4	0.53042	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00241	0.0007	N	0.02225	-0.63	0.26569	N	0.973598	B	0.02656	0.0	B	0.10450	0.005	T	0.21348	-1.0248	9	0.09843	T	0.71	.	8.3873	0.32508	0.1751:0.0:0.0:0.8249	.	76	Q8NGI6	OR4DA_HUMAN	T	76	ENSP00000436424:I76T	ENSP00000436424:I76T	I	+	2	0	OR4D10	59001705	0.000000	0.05858	0.361000	0.25849	0.031000	0.12232	0.204000	0.17335	1.733000	0.51620	0.533000	0.62120	ATC		0.443	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394235.1	NM_001004705		Missense_Mutation
C14orf39	317761	genome.wustl.edu	37	14	60903646	60903646	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr14:60903646G>C	ENST00000321731.3	-	18	1840	c.1681C>G	c.(1681-1683)Cag>Gag	p.Q561E		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	561					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)			p.Q561E(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TTTTGACCCTGTCCAAATGAA	0.323																																																1	Substitution - Missense(1)	ovary(1)	14											148.0	168.0	161.0					14																	60903646		2203	4295	6498	59973399	SO:0001583	missense	317761			AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.1681C>G	14.37:g.60903646G>C	ENSP00000324920:p.Gln561Glu		59973399	Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	37	CCDS9746.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	14.09	2.432439	0.43224	.	.	ENSG00000179008	ENST00000321731	T	0.28069	1.63	5.39	3.51	0.40186	.	0.393532	0.21928	N	0.067061	T	0.27559	0.0677	M	0.62723	1.935	0.33891	D	0.637325	P	0.35872	0.525	B	0.30572	0.117	T	0.47209	-0.9135	10	0.66056	D	0.02	-0.1639	8.9456	0.35756	0.0774:0.0:0.773:0.1496	.	561	Q8N1H7	S6OS1_HUMAN	E	561	ENSP00000324920:Q561E	ENSP00000324920:Q561E	Q	-	1	0	C14orf39	59973399	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	2.760000	0.47581	1.230000	0.43646	0.557000	0.71058	CAG		0.323	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978		Missense_Mutation
MS4A15	219995	genome.wustl.edu	37	11	60531386	60531386	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr11:60531386G>T	ENST00000405633.3	+	2	259	c.180G>T	c.(178-180)ttG>ttT	p.L60F	MS4A15_ENST00000337911.4_Intron|MS4A15_ENST00000528170.1_Missense_Mutation_p.L60F	NM_001098835.1	NP_001092305.1	Q8N5U1	M4A15_HUMAN	membrane-spanning 4-domains, subfamily A, member 15	60						integral component of membrane (GO:0016021)		p.L60F(1)		breast(1)|large_intestine(2)|lung(3)	6						CACCTGACTTGCGGCCCGTGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	11											30.0	33.0	32.0					11																	60531386		2019	4153	6172	60287962	SO:0001583	missense	219995			AY584608	CCDS7991.1, CCDS44617.1, CCDS60802.1	11q12.2	2008-03-25							28573	protein-coding gene	gene with protein product							Standard	NM_001098835		Approved		uc009ynf.1	Q8N5U1		ENST00000405633.3:c.180G>T	11.37:g.60531386G>T	ENSP00000386022:p.Leu60Phe		60287962	A9UJY6|A9UJY7|F2Z2J5	Missense_Mutation	SNP	ENST00000405633.3	37	CCDS44617.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	6.729	0.503185	0.12822	.	.	ENSG00000166961	ENST00000528170;ENST00000405633	T;T	0.21932	1.98;2.78	5.21	-9.2	0.00682	.	.	.	.	.	T	0.17577	0.0422	L	0.29908	0.895	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.24835	-1.0149	9	0.09084	T	0.74	-11.1259	0.4307	0.00471	0.231:0.1828:0.3059:0.2803	.	60;60	F2Z2J5;Q8N5U1	.;M4A15_HUMAN	F	60	ENSP00000434165:L60F;ENSP00000386022:L60F	ENSP00000386022:L60F	L	+	3	2	MS4A15	60287962	0.002000	0.14202	0.000000	0.03702	0.010000	0.07245	-0.530000	0.06179	-1.613000	0.01577	-1.587000	0.00848	TTG		0.587	MS4A15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395618.1			Missense_Mutation
ZNF609	23060	genome.wustl.edu	37	15	64791989	64791989	+	Missense_Mutation	SNP	G	G	A	rs369004534		TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr15:64791989G>A	ENST00000326648.3	+	1	499	c.371G>A	c.(370-372)cGc>cAc	p.R124H	ZNF609_ENST00000416172.1_Missense_Mutation_p.R124H	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	124						nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.R124H(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GTGCAGGGGCGCTCAGGAGAT	0.567																																																1	Substitution - Missense(1)	ovary(1)	15											45.0	48.0	47.0					15																	64791989		2203	4300	6503	62579042	SO:0001583	missense	23060			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.371G>A	15.37:g.64791989G>A	ENSP00000316527:p.Arg124His		62579042	Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	37	CCDS32270.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	.	20.3	3.958548	0.74016	.	.	ENSG00000180357	ENST00000416172;ENST00000326648	T	0.52526	0.66	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.70701	0.3254	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.951	T	0.72673	-0.4222	10	0.72032	D	0.01	-11.755	19.7614	0.96319	0.0:0.0:1.0:0.0	.	124;124	E7ERY8;O15014	.;ZN609_HUMAN	H	124	ENSP00000316527:R124H	ENSP00000316527:R124H	R	+	2	0	ZNF609	62579042	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.757000	0.98924	2.747000	0.94245	0.651000	0.88453	CGC		0.567	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833		Missense_Mutation
VWA9	81556	genome.wustl.edu	37	15	65899653	65899653	+	Silent	SNP	G	G	A	rs369672173		TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr15:65899653G>A	ENST00000395644.4	-	2	401	c.66C>T	c.(64-66)tcC>tcT	p.S22S	VWA9_ENST00000313182.2_Silent_p.S22S|VWA9_ENST00000569491.1_Silent_p.S22S|VWA9_ENST00000567744.1_Silent_p.S58S|VWA9_ENST00000442903.3_Silent_p.S22S|VWA9_ENST00000420799.2_Intron|VWA9_ENST00000431261.2_5'UTR			Q96SY0	VWA9_HUMAN	von Willebrand factor A domain containing 9	22	VWFA.							p.S22S(1)									GGTATTCCTCGGACCCCTCAA	0.473																																																1	Substitution - coding silent(1)	ovary(1)	15						G	,,,,	0,4402		0,0,2201	116.0	97.0	103.0		,174,162,,66	-9.4	0.6	15		103	1,8597	1.2+/-3.3	0,1,4298	no	utr-5,coding-synonymous,coding-synonymous,intron,coding-synonymous	C15orf44	NM_001136043.2,NM_001207057.1,NM_001207058.1,NM_001207059.1,NM_030800.2	,,,,	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,,,,	,58/555,54/501,,22/519	65899653	1,12999	2201	4299	6500	63686706	SO:0001819	synonymous_variant	81556			AL136662	CCDS55969.1, CCDS45283.1	15q22.31	2012-09-27	2012-09-27	2012-09-27	ENSG00000138614	ENSG00000138614			25372	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 44"""	C15orf44		11230166	Standard	NM_001136043		Approved	DKFZP564O1664	uc010uja.2	Q96SY0	OTTHUMG00000133159	ENST00000395644.4:c.66C>T	15.37:g.65899653G>A			63686706	B4DDI6|B4DVD5|Q49AH8|Q96HX5|Q9H0S5	Silent	SNP	ENST00000395644.4	37		SNP	39	WashU																																																																																				0.473	VWA9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420604.3	NM_030800		Silent
LAS1L	81887	genome.wustl.edu	37	X	64744051	64744051	+	Silent	SNP	C	C	G	rs373278066		TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chrX:64744051C>G	ENST00000374811.3	-	10	1225	c.1185G>C	c.(1183-1185)acG>acC	p.T395T	LAS1L_ENST00000312391.8_3'UTR|LAS1L_ENST00000374807.5_Silent_p.T378T|LAS1L_ENST00000374804.5_Silent_p.T336T	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	395					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.T395T(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						ATAGGGCCTGCGTGAAGTTCT	0.572																																																1	Substitution - coding silent(1)	ovary(1)	X											44.0	38.0	40.0					X																	64744051		2203	4300	6503	64660776	SO:0001819	synonymous_variant	81887			BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.1185G>C	X.37:g.64744051C>G			64660776	A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Silent	SNP	ENST00000374811.3	37	CCDS14381.1	SNP	27	WashU																																																																																				0.572	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056974.1	NM_031206		Silent
PJA1	64219	genome.wustl.edu	37	X	68382992	68382992	+	Silent	SNP	A	A	C			TCGA-24-1435-01	TCGA-24-1435-10	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chrX:68382992A>C	ENST00000361478.1	-	2	467	c.90T>G	c.(88-90)gcT>gcG	p.A30A	PJA1_ENST00000477231.1_Intron|PJA1_ENST00000374584.3_Silent_p.A30A|PJA1_ENST00000374571.4_Intron|PJA1_ENST00000374583.1_Silent_p.A30A	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	30					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						AACTGACATAAGCATGCCTTC	0.522																																																0			X											195.0	172.0	180.0					X																	68382992		2203	4300	6503	68299717	SO:0001819	synonymous_variant	64219			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.90T>G	X.37:g.68382992A>C			68299717	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Silent	SNP	ENST00000361478.1	37	CCDS14393.1	SNP	3	WashU																																																																																				0.522	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119		Silent
ARFGEF1	10565	genome.wustl.edu	37	8	68179365	68179365	+	Silent	SNP	T	T	C			TCGA-24-1435-01	TCGA-24-1435-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr8:68179365T>C	ENST00000262215.3	-	12	2162	c.1773A>G	c.(1771-1773)caA>caG	p.Q591Q	ARFGEF1_ENST00000520381.1_Silent_p.Q45Q	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	591					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)	p.Q591Q(1)		breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TGCCCCTTCCTTGAGCAATTT	0.328																																																1	Substitution - coding silent(1)	ovary(1)	8											84.0	85.0	85.0					8																	68179365		2202	4297	6499	68341919	SO:0001819	synonymous_variant	10565			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.1773A>G	8.37:g.68179365T>C			68341919	Q9NV46|Q9UFV2|Q9UNL0	Silent	SNP	ENST00000262215.3	37	CCDS6199.1	SNP	56	WashU																																																																																				0.328	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421		Silent
HCN4	10021	genome.wustl.edu	37	15	73617776	73617776	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr15:73617776C>T	ENST00000261917.3	-	5	2593	c.1600G>A	c.(1600-1602)Gtg>Atg	p.V534M		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	534					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.V534M(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TACTGCTCCACCTGCTTGTAC	0.657																																																1	Substitution - Missense(1)	ovary(1)	15											92.0	94.0	93.0					15																	73617776		2198	4297	6495	71404829	SO:0001583	missense	10021			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1600G>A	15.37:g.73617776C>T	ENSP00000261917:p.Val534Met		71404829	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	37	CCDS10248.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	18.34	3.602074	0.66445	.	.	ENSG00000138622	ENST00000261917	D	0.96913	-4.17	3.6	3.6	0.41247	Cyclic nucleotide-binding-like (1);	.	.	.	.	D	0.98055	0.9359	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99143	1.0856	9	0.87932	D	0	.	15.4365	0.75152	0.0:1.0:0.0:0.0	.	534	Q9Y3Q4	HCN4_HUMAN	M	534	ENSP00000261917:V534M	ENSP00000261917:V534M	V	-	1	0	HCN4	71404829	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.551000	0.82182	1.847000	0.53656	0.555000	0.69702	GTG		0.657	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477		Missense_Mutation
GTF2IRD2B	389524	genome.wustl.edu	37	7	74564621	74564621	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1435-01	TCGA-24-1435-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr7:74564621A>G	ENST00000312575.7	+	16	2543	c.2368A>G	c.(2368-2370)Aaa>Gaa	p.K790E	GTF2IRD2B_ENST00000418185.2_Missense_Mutation_p.K337E	NM_001003795.2	NP_001003795.1	Q6EKJ0	GTD2B_HUMAN	GTF2I repeat domain containing 2B	790					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K790E(1)		endometrium(1)|ovary(2)|prostate(1)	4						gttcctagcaaaactgtgcct	0.488																																																1	Substitution - Missense(1)	ovary(1)	7											19.0	20.0	20.0					7																	74564621		1472	3131	4603	74202557	SO:0001583	missense	389524			AY312850	CCDS34659.1	7q11.23	2014-05-06			ENSG00000174428	ENSG00000174428			33125	protein-coding gene	gene with protein product		608900				15100712	Standard	XM_005277580		Approved		uc003ubt.3	Q6EKJ0	OTTHUMG00000181534	ENST00000312575.7:c.2368A>G	7.37:g.74564621A>G	ENSP00000308080:p.Lys790Glu		74202557	B2RNE9|Q69GU6|Q8N979|Q9H739	Missense_Mutation	SNP	ENST00000312575.7	37	CCDS34659.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	12.00	1.805335	0.31961	.	.	ENSG00000174428	ENST00000312575;ENST00000418185;ENST00000412484	T;T	0.22945	1.93;1.93	1.53	1.53	0.23141	Ribonuclease H-like (1);	.	.	.	.	T	0.48714	0.1515	M	0.87827	2.91	0.29481	N	0.856353	P;D	0.63880	0.856;0.993	P;D	0.68192	0.769;0.956	T	0.41574	-0.9501	9	0.87932	D	0	-10.1214	5.1941	0.15227	1.0:0.0:0.0:0.0	.	285;790	Q86Y00;Q6EKJ0	.;GTD2B_HUMAN	E	790;337;205	ENSP00000308080:K790E;ENSP00000411454:K337E	ENSP00000308080:K790E	K	+	1	0	GTF2IRD2B	74202557	0.735000	0.28153	0.899000	0.35326	0.967000	0.64934	2.100000	0.41777	0.961000	0.38030	0.352000	0.21897	AAA		0.488	GTF2IRD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342728.1	NM_001003795		Missense_Mutation
MSS51	118490	genome.wustl.edu	37	10	75185963	75185963	+	Silent	SNP	C	C	T			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr10:75185963C>T	ENST00000372912.1	-	4	677	c.675G>A	c.(673-675)ccG>ccA	p.P225P	AL353731.1_ENST00000584907.1_RNA|MSS51_ENST00000299432.2_Silent_p.P225P			Q4VC12	MSS51_HUMAN	MSS51 mitochondrial translational activator	225					social behavior (GO:0035176)		metal ion binding (GO:0046872)	p.P225P(1)									GCAGGACATCCGGGTCTGGCC	0.542																																																1	Substitution - coding silent(1)	ovary(1)	10											65.0	61.0	62.0					10																	75185963		2203	4300	6503	74855969	SO:0001819	synonymous_variant	118490			AK096884	CCDS31221.1	10q22.3	2013-01-10	2013-01-10	2012-02-24	ENSG00000166343	ENSG00000166343		"""Zinc fingers, MYND-type"""	21000	protein-coding gene	gene with protein product		614773	"""zinc finger, MYND-type containing 17"", ""MSS51 mitochondrial translational activator homolog (S. cerevisiae)"""	ZMYND17		19710419	Standard	NM_001024593		Approved	FLJ39565	uc001jud.3	Q4VC12	OTTHUMG00000018464	ENST00000372912.1:c.675G>A	10.37:g.75185963C>T			74855969	A6NGH6|Q2VP95|Q5F2H5|Q7Z3M9|Q8N8G0	Silent	SNP	ENST00000372912.1	37	CCDS31221.1	SNP	23	WashU																																																																																				0.542	MSS51-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048652.3	NM_178451		Silent
CCDC146	57639	genome.wustl.edu	37	7	76903942	76903942	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1435-01	TCGA-24-1435-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr7:76903942A>C	ENST00000285871.4	+	11	1540	c.1413A>C	c.(1411-1413)caA>caC	p.Q471H	CCDC146_ENST00000431197.1_Missense_Mutation_p.Q185H|CCDC146_ENST00000415740.2_3'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	471								p.Q471H(1)		breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AAAAGGAACAAAAGTCCAAGG	0.373																																																1	Substitution - Missense(1)	ovary(1)	7											55.0	53.0	54.0					7																	76903942		2203	4300	6503	76741878	SO:0001583	missense	57639			BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.1413A>C	7.37:g.76903942A>C	ENSP00000285871:p.Gln471His		76741878	A8K8X6|Q9P223	Missense_Mutation	SNP	ENST00000285871.4	37	CCDS34671.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	12.01	1.810648	0.32053	.	.	ENSG00000135205	ENST00000285871;ENST00000431197	T;T	0.36520	1.25;1.25	5.71	-0.979	0.10276	.	0.061993	0.64402	D	0.000003	T	0.38348	0.1037	L	0.46157	1.445	0.48511	D	0.999661	D;P	0.54772	0.968;0.702	P;B	0.53062	0.717;0.36	T	0.15723	-1.0427	10	0.41790	T	0.15	-21.6799	11.171	0.48571	0.4253:0.0:0.5747:0.0	.	185;471	Q8IYE0-2;Q8IYE0	.;CC146_HUMAN	H	471;185	ENSP00000285871:Q471H;ENSP00000413885:Q185H	ENSP00000285871:Q471H	Q	+	3	2	AC007000.1	76741878	0.997000	0.39634	0.979000	0.43373	0.608000	0.37181	0.331000	0.19733	-0.112000	0.11979	-0.334000	0.08254	CAA		0.373	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341449.1	NM_020879		Missense_Mutation
GAB2	9846	genome.wustl.edu	37	11	77934467	77934467	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr11:77934467C>T	ENST00000361507.4	-	6	1643	c.1558G>A	c.(1558-1560)Gat>Aat	p.D520N	GAB2_ENST00000340149.2_Missense_Mutation_p.D482N	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	520					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.D520N(1)	INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			CCTTTCCGATCAGGTTTGAGG	0.537																																																1	Substitution - Missense(1)	ovary(1)	11											131.0	119.0	123.0					11																	77934467		2200	4292	6492	77612115	SO:0001583	missense	9846			AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.1558G>A	11.37:g.77934467C>T	ENSP00000354952:p.Asp520Asn		77612115	A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	ENST00000361507.4	37	CCDS8259.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	14.14	2.447467	0.43429	.	.	ENSG00000033327	ENST00000340149;ENST00000361507	T;T	0.16597	2.33;2.33	4.97	4.06	0.47325	.	0.123993	0.52532	U	0.000061	T	0.13200	0.0320	L	0.35288	1.05	0.39173	D	0.962626	B	0.09022	0.002	B	0.06405	0.002	T	0.07868	-1.0750	10	0.30854	T	0.27	-26.3339	11.5342	0.50628	0.0:0.8518:0.0:0.1482	.	520	Q9UQC2	GAB2_HUMAN	N	482;520	ENSP00000343959:D482N;ENSP00000354952:D520N	ENSP00000343959:D482N	D	-	1	0	GAB2	77612115	0.998000	0.40836	1.000000	0.80357	0.974000	0.67602	3.476000	0.53143	1.323000	0.45263	0.561000	0.74099	GAT		0.537	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491		Missense_Mutation
ZNF292	23036	genome.wustl.edu	37	6	87971465	87971465	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr6:87971465G>T	ENST00000369577.3	+	8	8161	c.8118G>T	c.(8116-8118)atG>atT	p.M2706I	ZNF292_ENST00000339907.4_Missense_Mutation_p.M2701I	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	2706						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.M2561I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		ATCCAGATATGTCTGTTATGA	0.318																																																1	Substitution - Missense(1)	ovary(1)	6											51.0	50.0	50.0					6																	87971465		1828	4077	5905	88028184	SO:0001583	missense	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.8118G>T	6.37:g.87971465G>T	ENSP00000358590:p.Met2706Ile		88028184	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	0.410	-0.913799	0.02415	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.05786	3.39;3.4	5.92	1.27	0.21489	.	0.719989	0.13400	N	0.390739	T	0.00580	0.0019	N	0.02011	-0.69	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.45352	-0.9267	10	0.13853	T	0.58	.	4.3131	0.10979	0.4076:0.0:0.3498:0.2426	.	2706	O60281	ZN292_HUMAN	I	2706;2701	ENSP00000358590:M2706I;ENSP00000342847:M2701I	ENSP00000342847:M2701I	M	+	3	0	ZNF292	88028184	0.000000	0.05858	0.948000	0.38648	0.941000	0.58515	0.413000	0.21148	0.269000	0.21961	0.555000	0.69702	ATG		0.318	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021		Missense_Mutation
TYR	7299	genome.wustl.edu	37	11	88924500	88924500	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1435-01	TCGA-24-1435-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr11:88924500A>C	ENST00000263321.5	+	2	1452	c.950A>C	c.(949-951)gAt>gCt	p.D317A	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	317					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.D317A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	TCTTCAGCTGATGTAGAATTT	0.448																																																1	Substitution - Missense(1)	ovary(1)	11											120.0	117.0	118.0					11																	88924500		2201	4299	6500	88564148	SO:0001583	missense	7299			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.950A>C	11.37:g.88924500A>C	ENSP00000263321:p.Asp317Ala		88564148	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	CCDS8284.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	27.7	4.854863	0.91355	.	.	ENSG00000077498	ENST00000263321	D	0.97279	-4.32	5.59	5.59	0.84812	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.197051	0.52532	D	0.000062	D	0.97564	0.9202	M	0.75264	2.295	0.58432	D	0.999999	D	0.56746	0.977	P	0.54889	0.763	D	0.97524	1.0075	9	.	.	.	.	15.7688	0.78149	1.0:0.0:0.0:0.0	.	317	P14679	TYRO_HUMAN	A	317	ENSP00000263321:D317A	.	D	+	2	0	TYR	88564148	1.000000	0.71417	0.969000	0.41365	0.970000	0.65996	8.771000	0.91751	2.134000	0.65973	0.533000	0.62120	GAT		0.448	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372		Missense_Mutation
FAM35A	54537	genome.wustl.edu	37	10	88930699	88930699	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr10:88930699C>G	ENST00000298784.1	+	6	2045	c.1931C>G	c.(1930-1932)gCa>gGa	p.A644G	FAM35A_ENST00000298786.4_Missense_Mutation_p.A644G	NM_019054.2	NP_061927.2	Q86V20	FA35A_HUMAN	family with sequence similarity 35, member A	644								p.A644G(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(1)|ovary(2)|prostate(2)|skin(2)	16						GGTCCTGGAGCAGCCTGGTAC	0.378																																					Ovarian(175;703 2004 25460 32514 43441)											1	Substitution - Missense(1)	ovary(1)	10											4.0	4.0	4.0					10																	88930699		1763	3630	5393	88920679	SO:0001583	missense	54537			BC051863	CCDS7383.1	10q23.2	2010-06-02			ENSG00000122376	ENSG00000122376			28773	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_019054		Approved	MGC5560, bA163M19.1, FAM35A1	uc001kei.4	Q86V20	OTTHUMG00000018669	ENST00000298784.1:c.1931C>G	10.37:g.88930699C>G	ENSP00000298784:p.Ala644Gly		88920679	O95885|Q9H991	Missense_Mutation	SNP	ENST00000298784.1	37	CCDS7383.1	SNP	25	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	17.54|17.54	3.414336|3.414336	0.62511|0.62511	.|.	.|.	ENSG00000122376|ENSG00000122376	ENST00000298786;ENST00000298784;ENST00000358313|ENST00000342900	T;T;T|.	0.66638|.	-0.22;-0.22;-0.22|.	4.05|4.05	2.14|2.14	0.27477|0.27477	.|.	0.512623|.	0.20963|.	N|.	0.082530|.	T|T	0.54498|0.54498	0.1862|0.1862	M|M	0.64997|0.64997	1.995|1.995	0.32628|0.32628	N|N	0.522351|0.522351	D;D|.	0.58268|.	0.965;0.982|.	P;P|.	0.57425|.	0.558;0.82|.	T|T	0.61744|0.61744	-0.7000|-0.7000	10|5	0.87932|.	D|.	0|.	-14.5696|-14.5696	7.3125|7.3125	0.26483|0.26483	0.1703:0.7359:0.0:0.0938|0.1703:0.7359:0.0:0.0938	.|.	298;644|.	Q5VSZ0;Q86V20|.	.;FA35A_HUMAN|.	G|R	644|298	ENSP00000298786:A644G;ENSP00000298784:A644G;ENSP00000351064:A644G|.	ENSP00000298784:A644G|.	A|S	+|+	2|3	0|2	FAM35A|FAM35A	88920679|88920679	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.949000|0.949000	0.60115|0.60115	1.471000|1.471000	0.35365|0.35365	1.026000|1.026000	0.39733|0.39733	0.603000|0.603000	0.83216|0.83216	GCA|AGC		0.378	FAM35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049196.2	NM_019054		Missense_Mutation
SAMD9L	219285	genome.wustl.edu	37	7	92761355	92761355	+	Silent	SNP	C	C	T			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr7:92761355C>T	ENST00000318238.4	-	5	5146	c.3930G>A	c.(3928-3930)ttG>ttA	p.L1310L	SAMD9L_ENST00000437805.1_Silent_p.L1310L|SAMD9L_ENST00000411955.1_Silent_p.L1310L	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1310					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.L1310L(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			GACATGGATCCAAATGACAGA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	7											76.0	79.0	78.0					7																	92761355		2203	4299	6502	92599291	SO:0001819	synonymous_variant	219285			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.3930G>A	7.37:g.92761355C>T			92599291	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Silent	SNP	ENST00000318238.4	37	CCDS34681.1	SNP	21	WashU																																																																																				0.378	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		Silent
ABCA4	24	genome.wustl.edu	37	1	94528774	94528774	+	Missense_Mutation	SNP	C	C	A	rs145525174	byFrequency	TCGA-24-1435-01	TCGA-24-1435-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:94528774C>A	ENST00000370225.3	-	12	1740	c.1654G>T	c.(1654-1656)Gta>Tta	p.V552L	ABCA4_ENST00000535735.1_Missense_Mutation_p.V552L	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	552			V -> I. {ECO:0000269|PubMed:10958763, ECO:0000269|PubMed:19028736}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.V552L(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCAGGGAATACCACTCCGGCC	0.478																																																1	Substitution - Missense(1)	ovary(1)	1	GRCh37	CM074660	ABCA4	M	rs145525174						180.0	165.0	170.0					1																	94528774		2203	4300	6503	94301362	SO:0001583	missense	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.1654G>T	1.37:g.94528774C>A	ENSP00000359245:p.Val552Leu		94301362	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	15.13	2.742101	0.49151	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.97888	-4.59;-4.59	4.91	4.0	0.46444	.	0.208109	0.41823	D	0.000804	D	0.98292	0.9434	M	0.86420	2.815	0.49483	D	0.999791	D;B	0.76494	0.999;0.368	D;B	0.70016	0.967;0.196	D	0.98905	1.0778	10	0.72032	D	0.01	.	10.6485	0.45634	0.0:0.8457:0.0:0.1543	.	552;552	F5H6E5;P78363	.;ABCA4_HUMAN	L	552	ENSP00000359245:V552L;ENSP00000437682:V552L	ENSP00000359245:V552L	V	-	1	0	ABCA4	94301362	0.991000	0.36638	0.904000	0.35570	0.170000	0.22686	2.932000	0.48940	1.292000	0.44672	0.455000	0.32223	GTA		0.478	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350		Missense_Mutation
CDH17	1015	genome.wustl.edu	37	8	95172299	95172299	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr8:95172299C>A	ENST00000027335.3	-	12	1575	c.1451G>T	c.(1450-1452)aGt>aTt	p.S484I	CDH17_ENST00000441892.2_Missense_Mutation_p.S270I|CDH17_ENST00000450165.2_Missense_Mutation_p.S484I	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	484	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.S484I(1)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			AATTTTAGAACTCCCAGTAAA	0.448																																																1	Substitution - Missense(1)	ovary(1)	8											123.0	125.0	124.0					8																	95172299		2203	4300	6503	95241475	SO:0001583	missense	1015			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1451G>T	8.37:g.95172299C>A	ENSP00000027335:p.Ser484Ile		95241475	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	CCDS6260.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141313	0.57044	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165	T;T;T	0.52295	0.67;0.67;0.67	5.27	5.27	0.74061	Cadherin (4);Cadherin-like (1);	0.000000	0.56097	D	0.000034	T	0.72922	0.3521	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.78329	-0.2246	10	0.87932	D	0	-22.056	15.8056	0.78506	0.0:1.0:0.0:0.0	.	270;484	E7EN24;Q12864	.;CAD17_HUMAN	I	484;270;484	ENSP00000027335:S484I;ENSP00000392811:S270I;ENSP00000401468:S484I	ENSP00000027335:S484I	S	-	2	0	CDH17	95241475	1.000000	0.71417	1.000000	0.80357	0.258000	0.26162	5.317000	0.65822	2.469000	0.83416	0.561000	0.74099	AGT		0.448	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063		Missense_Mutation
VWA3B	200403	genome.wustl.edu	37	2	98804464	98804464	+	Silent	SNP	A	A	C			TCGA-24-1435-01	TCGA-24-1435-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr2:98804464A>C	ENST00000477737.1	+	10	1542	c.1338A>C	c.(1336-1338)gcA>gcC	p.A446A	VWA3B_ENST00000451075.2_Silent_p.A296A|VWA3B_ENST00000435344.1_Silent_p.A446A	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	446								p.A446A(1)		NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CAGTCCATGCAAAATATTGCA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	2											82.0	81.0	81.0					2																	98804464		1934	4146	6080	98170896	SO:0001819	synonymous_variant	200403			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.1338A>C	2.37:g.98804464A>C			98170896	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Silent	SNP	ENST00000477737.1	37	CCDS42718.1	SNP	5	WashU																																																																																				0.483	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992		Silent
RGS22	26166	genome.wustl.edu	37	8	101117621	101117621	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr8:101117621G>A	ENST00000360863.6	-	2	229	c.35C>T	c.(34-36)aCt>aTt	p.T12I	RGS22_ENST00000523287.1_5'UTR|RGS22_ENST00000523437.1_Missense_Mutation_p.T12I	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	12					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.T12I(1)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TTCTGTAATAGTTGGTGGCTC	0.338																																																1	Substitution - Missense(1)	ovary(1)	8											96.0	101.0	100.0					8																	101117621		1836	4084	5920	101186797	SO:0001583	missense	26166			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.35C>T	8.37:g.101117621G>A	ENSP00000354109:p.Thr12Ile		101186797	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	CCDS43758.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	g	10.56	1.384734	0.25031	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523437	T;T	0.63580	-0.05;-0.05	4.96	-3.16	0.05217	.	2.268410	0.02201	N	0.062274	T	0.43322	0.1242	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20874	-1.0262	10	0.52906	T	0.07	.	1.2779	0.02034	0.1946:0.121:0.2104:0.474	.	12;12	A8K944;Q8NE09	.;RGS22_HUMAN	I	12	ENSP00000354109:T12I;ENSP00000428212:T12I	ENSP00000354109:T12I	T	-	2	0	RGS22	101186797	0.005000	0.15991	0.096000	0.21009	0.927000	0.56198	-0.381000	0.07417	-0.426000	0.07360	0.651000	0.88453	ACT		0.338	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668		Missense_Mutation
RELN	5649	genome.wustl.edu	37	7	103214613	103214613	+	Missense_Mutation	SNP	A	A	C	rs200920818		TCGA-24-1435-01	TCGA-24-1435-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr7:103214613A>C	ENST00000428762.1	-	30	4596	c.4437T>G	c.(4435-4437)gaT>gaG	p.D1479E	RELN_ENST00000343529.5_Missense_Mutation_p.D1479E|RELN_ENST00000424685.2_Missense_Mutation_p.D1479E	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1479					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.D1479E(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GAGATTTGCCATCGTTAAGTG	0.483																																					NSCLC(146;835 1944 15585 22231 52158)											1	Substitution - Missense(1)	ovary(1)	7											149.0	134.0	139.0					7																	103214613		2203	4300	6503	103001849	SO:0001583	missense	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4437T>G	7.37:g.103214613A>C	ENSP00000392423:p.Asp1479Glu		103001849	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	11.89	1.773232	0.31411	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.43294	1.99;0.95;1.99	5.62	-0.98	0.10272	.	0.049041	0.85682	D	0.000000	T	0.34250	0.0891	N	0.14661	0.345	0.37648	D	0.922296	B;D	0.54964	0.0;0.969	B;P	0.59056	0.002;0.851	T	0.17289	-1.0374	10	0.19147	T	0.46	.	10.2247	0.43218	0.6751:0.0:0.3249:0.0	.	1479;1479	P78509-2;P78509	.;RELN_HUMAN	E	1479	ENSP00000392423:D1479E;ENSP00000345694:D1479E;ENSP00000388446:D1479E	ENSP00000345694:D1479E	D	-	3	2	RELN	103001849	0.719000	0.27986	0.931000	0.37212	0.942000	0.58702	-0.005000	0.12855	-0.310000	0.08766	0.533000	0.62120	GAT		0.483	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		Missense_Mutation
SLC26A3	1811	genome.wustl.edu	37	7	107414533	107414533	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1435-01	TCGA-24-1435-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr7:107414533T>C	ENST00000340010.5	-	17	2023	c.1839A>G	c.(1837-1839)atA>atG	p.I613M	SLC26A3_ENST00000422236.2_Intron	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	613	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)	p.I613M(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						CCAGTACTTCTATCTGATTGT	0.428																																																1	Substitution - Missense(1)	ovary(1)	7											302.0	264.0	277.0					7																	107414533		2203	4300	6503	107201769	SO:0001583	missense	1811			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1839A>G	7.37:g.107414533T>C	ENSP00000345873:p.Ile613Met		107201769		Missense_Mutation	SNP	ENST00000340010.5	37	CCDS5748.1	SNP	53	WashU	.	.	.	.	.	.	.	.	.	.	T	1.325	-0.598274	0.03744	.	.	ENSG00000091138	ENST00000340010	D	0.93189	-3.18	6.16	-2.07	0.07276	Sulphate transporter/antisigma-factor antagonist STAS (3);	0.423101	0.32593	N	0.005898	D	0.82365	0.5021	N	0.22421	0.69	0.42862	D	0.994116	B	0.21821	0.061	B	0.22152	0.038	T	0.63883	-0.6536	10	0.41790	T	0.15	.	0.5309	0.00628	0.1946:0.2271:0.2003:0.378	.	613	P40879	S26A3_HUMAN	M	613	ENSP00000345873:I613M	ENSP00000345873:I613M	I	-	3	3	SLC26A3	107201769	0.016000	0.18221	0.315000	0.25238	0.010000	0.07245	-0.117000	0.10708	-0.312000	0.08741	-0.263000	0.10527	ATA		0.428	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111		Missense_Mutation
IFT81	28981	genome.wustl.edu	37	12	110581325	110581325	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr12:110581325C>G	ENST00000242591.5	+	9	1426	c.920C>G	c.(919-921)tCt>tGt	p.S307C	IFT81_ENST00000552912.1_Missense_Mutation_p.S307C|IFT81_ENST00000549009.1_3'UTR|IFT81_ENST00000361948.4_Missense_Mutation_p.S307C	NM_014055.3	NP_054774.2	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81	307					cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|spermatogenesis (GO:0007283)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	tubulin binding (GO:0015631)	p.S307C(1)		endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)	10						ATGGGCCATTCTGATCTTCTT	0.294																																																1	Substitution - Missense(1)	ovary(1)	12											71.0	83.0	79.0					12																	110581325		2188	4281	6469	109065708	SO:0001583	missense	28981			AF139540	CCDS9142.1, CCDS41831.1	12q24.13	2014-07-03	2014-07-03	2005-11-02		ENSG00000122970		"""Intraflagellar transport homologs"""	14313	protein-coding gene	gene with protein product		605489	"""carnitine deficiency-associated, expressed in ventricle 1"", ""intraflagellar transport 81 homolog (Chlamydomonas)"""	CDV1		11130971	Standard	NM_014055		Approved	CDV-1R, MGC4027	uc001tqi.3	Q8WYA0	OTTHUMG00000169326	ENST00000242591.5:c.920C>G	12.37:g.110581325C>G	ENSP00000242591:p.Ser307Cys		109065708	Q2YDY1|Q8NB51|Q9BSV2|Q9UNY8	Missense_Mutation	SNP	ENST00000242591.5	37	CCDS41831.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365332	0.82463	.	.	ENSG00000122970	ENST00000361948;ENST00000552912;ENST00000242591;ENST00000546374	T	0.33865	1.39	4.62	4.62	0.57501	.	0.110120	0.64402	D	0.000009	T	0.52419	0.1733	M	0.64997	1.995	0.80722	D	1	D;D	0.56521	0.976;0.958	P;P	0.55577	0.779;0.639	T	0.58634	-0.7602	10	0.72032	D	0.01	-4.3797	17.834	0.88691	0.0:1.0:0.0:0.0	.	307;307	Q8WYA0;Q8WYA0-3	IFT81_HUMAN;.	C	307;307;307;277	ENSP00000355372:S307C	ENSP00000242591:S307C	S	+	2	0	IFT81	109065708	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.972000	0.76110	2.274000	0.75844	0.557000	0.71058	TCT		0.294	IFT81-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403529.1	NM_014055		Missense_Mutation
SLC16A4	9122	genome.wustl.edu	37	1	110923659	110923659	+	Silent	SNP	C	C	T			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:110923659C>T	ENST00000369779.4	-	5	720	c.471G>A	c.(469-471)ctG>ctA	p.L157L	SLC16A4_ENST00000437429.2_Silent_p.L47L|LAMTOR5-AS1_ENST00000590413.1_RNA|SLC16A4_ENST00000472422.2_Silent_p.L109L|SLC16A4_ENST00000369781.4_Silent_p.L157L|SLC16A4_ENST00000497687.1_Intron|SLC16A4_ENST00000541986.1_Silent_p.L95L	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	157					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)	p.L157L(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	AAAGAAAAGTCAGTCCCATCC	0.398																																																1	Substitution - coding silent(1)	ovary(1)	1											117.0	113.0	114.0					1																	110923659		2203	4300	6503	110725182	SO:0001819	synonymous_variant	9122			U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.471G>A	1.37:g.110923659C>T			110725182	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Silent	SNP	ENST00000369779.4	37	CCDS823.1	SNP	29	WashU																																																																																				0.398	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031115.3	NM_004696		Silent
KCND3	3752	genome.wustl.edu	37	1	112329626	112329626	+	Silent	SNP	A	A	G			TCGA-24-1435-01	TCGA-24-1435-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:112329626A>G	ENST00000315987.2	-	3	1688	c.1209T>C	c.(1207-1209)gtT>gtC	p.V403V	KCND3_ENST00000302127.4_Silent_p.V403V|KCND3_ENST00000369697.1_Silent_p.V403V	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	403					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.V403V(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TAAAGTTGGAAACAATCACAG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	1											127.0	117.0	120.0					1																	112329626		2203	4300	6503	112131149	SO:0001819	synonymous_variant	3752			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.1209T>C	1.37:g.112329626A>G			112131149	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Silent	SNP	ENST00000315987.2	37	CCDS843.1	SNP	1	WashU																																																																																				0.537	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198		Silent
CADM1	23705	genome.wustl.edu	37	11	115088693	115088693	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1435-01	TCGA-24-1435-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr11:115088693A>T	ENST00000452722.3	-	6	760	c.740T>A	c.(739-741)aTt>aAt	p.I247N	CADM1_ENST00000331581.6_Missense_Mutation_p.I247N|CADM1_ENST00000537058.1_Missense_Mutation_p.I247N|CADM1_ENST00000542447.2_Missense_Mutation_p.I247N|CADM1_ENST00000536727.1_Missense_Mutation_p.I247N|CADM1_ENST00000537140.1_5'UTR	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.I247N(1)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		AGTCATCTGAATGTGCACTTG	0.443																																																1	Substitution - Missense(1)	ovary(1)	11											136.0	115.0	123.0					11																	115088693		2201	4296	6497	114593903	SO:0001583	missense	23705			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.740T>A	11.37:g.115088693A>T	ENSP00000395359:p.Ile247Asn		114593903		Missense_Mutation	SNP	ENST00000452722.3	37	CCDS8373.1	SNP	4	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.7|20.7	4.037266|4.037266	0.75617|0.75617	.|.	.|.	ENSG00000182985|ENSG00000182985	ENST00000545380|ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000542450	T|T;T;T;T;T;D	0.14893|0.87809	2.47|2.28;2.28;2.28;2.28;2.28;-2.3	5.84|5.84	5.84|5.84	0.93424|0.93424	.|Immunoglobulin-like (1);	.|0.108661	.|0.64402	.|D	.|0.000008	D|D	0.93530|0.93530	0.7935|0.7935	M|M	0.84219|0.84219	2.685|2.685	0.58432|0.58432	D|D	0.999992|0.999992	.|D;D;D;D;D	.|0.89917	.|0.995;0.995;0.996;1.0;0.971	.|P;P;D;D;P	.|0.80764	.|0.894;0.894;0.936;0.994;0.773	D|D	0.93942|0.93942	0.7224|0.7224	7|10	0.31617|0.56958	T|D	0.26|0.05	.|.	14.7818|14.7818	0.69772|0.69772	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|247;247;248;247;247	.|Q9BY67-2;F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.|.;.;.;CADM1_HUMAN;.	Q|N	245|247;247;247;247;206;247;100	ENSP00000442387:H245Q|ENSP00000439176:I247N;ENSP00000395359:I247N;ENSP00000439817:I247N;ENSP00000440322:I247N;ENSP00000329797:I247N;ENSP00000442001:I100N	ENSP00000442387:H245Q|ENSP00000329797:I247N	H|I	-|-	3|2	2|0	CADM1|CADM1	114593903|114593903	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.817000|7.817000	0.86213|0.86213	2.232000|2.232000	0.73038|0.73038	0.533000|0.533000	0.62120|0.62120	CAT|ATT		0.443	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333		Missense_Mutation
ENPP2	5168	genome.wustl.edu	37	8	120575156	120575156	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr8:120575156G>T	ENST00000075322.6	-	24	2420	c.2362C>A	c.(2362-2364)Cct>Act	p.P788T	ENPP2_ENST00000522167.1_Missense_Mutation_p.P423T|ENPP2_ENST00000522826.1_Missense_Mutation_p.P813T|ENPP2_ENST00000427067.2_Missense_Mutation_p.P809T|ENPP2_ENST00000259486.6_Missense_Mutation_p.P840T	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	788					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P840T(1)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ACAGAGAGAGGGCCGTCACAC	0.522																																					Melanoma(20;305 879 2501 4818 31020)											1	Substitution - Missense(1)	ovary(1)	8											142.0	119.0	127.0					8																	120575156		2203	4300	6503	120644337	SO:0001583	missense	5168			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.2362C>A	8.37:g.120575156G>T	ENSP00000075322:p.Pro788Thr		120644337	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	ENST00000075322.6	37	CCDS34936.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	14.53	2.562461	0.45694	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522167;ENST00000522826;ENST00000075322	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	5.8	4.91	0.64330	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.107284	0.64402	D	0.000003	T	0.71013	0.3290	L	0.59436	1.845	0.58432	D	0.999996	P;P;P;P;P	0.50617	0.937;0.775;0.575;0.734;0.575	P;P;P;P;P	0.59221	0.854;0.697;0.546;0.571;0.546	T	0.67086	-0.5759	10	0.15499	T	0.54	.	16.024	0.80528	0.0:0.0:0.8645:0.1355	.	326;813;788;840;423	B4DJD3;E9PHP7;Q13822;Q13822-2;E5RIA2	.;.;ENPP2_HUMAN;.;.	T	840;809;423;813;788	ENSP00000259486:P840T;ENSP00000403315:P809T;ENSP00000429476:P423T;ENSP00000428291:P813T;ENSP00000075322:P788T	ENSP00000075322:P788T	P	-	1	0	ENPP2	120644337	1.000000	0.71417	0.969000	0.41365	0.868000	0.49771	7.824000	0.86668	1.404000	0.46819	0.650000	0.86243	CCT		0.522	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1			Missense_Mutation
GRK5	2869	genome.wustl.edu	37	10	121093310	121093310	+	Intron	SNP	C	C	G			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr10:121093310C>G	ENST00000392870.2	+	2	477				RP11-79M19.2_ENST00000457948.3_RNA	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		TCTCCTGGAGCTCATCCACCA	0.502																																																0			10											66.0	56.0	59.0					10																	121093310		876	1991	2867	121083300	SO:0001627	intron_variant	2869			L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.148+7187C>G	10.37:g.121093310C>G			121083300	D3DRD0|Q5T059	Missense_Mutation	SNP	ENST00000392870.2	37	CCDS7612.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	c	8.245	0.807763	0.16467	.	.	ENSG00000198873	ENST00000369106	.	.	.	3.64	-2.94	0.05581	.	.	.	.	.	T	0.25827	0.0629	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33954	-0.9848	5	0.56958	D	0.05	.	0.9129	0.01298	0.1479:0.2768:0.2899:0.2854	.	.	.	.	R	60	.	ENSP00000358102:S60R	S	+	3	2	GRK5	121083300	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.028000	0.13644	-0.664000	0.05324	-1.732000	0.00693	AGC		0.502	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050652.2	NM_005308		Missense_Mutation
UBC	7316	genome.wustl.edu	37	12	125398164	125398164	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr12:125398164C>T	ENST00000538617.1	-	3	470	c.154G>A	c.(154-156)Gat>Aat	p.D52N	UBC_ENST00000546120.1_Missense_Mutation_p.D52N|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000339647.5_Missense_Mutation_p.D52N|UBC_ENST00000536661.1_5'UTR|UBC_ENST00000536769.1_Missense_Mutation_p.D52N			P0CG48	UBC_HUMAN	ubiquitin C	432	Ubiquitin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)	p.D52N(1)		breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		GTGCGCCCATCTTCCAGCTGT	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											217.0	201.0	206.0					12																	125398164		2203	4300	6503	123964117	SO:0001583	missense	7316				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.154G>A	12.37:g.125398164C>T	ENSP00000443053:p.Asp52Asn		123964117	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000538617.1	37		SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	-	18.57	3.653560	0.67472	.	.	ENSG00000150991	ENST00000536769;ENST00000535460;ENST00000538617;ENST00000541046;ENST00000339647;ENST00000546120;ENST00000544656;ENST00000541272;ENST00000540351;ENST00000541645;ENST00000535131;ENST00000546271;ENST00000540700;ENST00000535859;ENST00000542416	T;T;T;T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	4.51	4.51	0.55191	Ubiquitin supergroup (1);Ubiquitin conserved site (1);Ubiquitin (2);	0.000000	0.49305	U	0.000147	T	0.62938	0.2469	L	0.59436	1.845	0.51233	D	0.999918	P;P;P	0.43607	0.812;0.775;0.812	P;P;P	0.59487	0.772;0.778;0.858	T	0.66559	-0.5893	10	0.87932	D	0	.	15.1039	0.72306	0.0:1.0:0.0:0.0	.	141;52;52	Q66K58;F5H7K6;P0CG48	.;.;UBC_HUMAN	N	52	ENSP00000441543:D52N;ENSP00000443053:D52N;ENSP00000344818:D52N;ENSP00000438394:D52N;ENSP00000440205:D52N;ENSP00000442800:D52N;ENSP00000445337:D52N;ENSP00000439492:D52N;ENSP00000438289:D52N;ENSP00000441238:D52N;ENSP00000437452:D52N;ENSP00000441556:D52N	ENSP00000344818:D52N	D	-	1	0	UBC	123964117	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.792000	0.75125	2.212000	0.71576	0.650000	0.86243	GAT		0.532	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000400179.1	NM_021009		Missense_Mutation
KALRN	8997	genome.wustl.edu	37	3	124413265	124413265	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr3:124413265C>G	ENST00000291478.5	+	20	2564	c.2401C>G	c.(2401-2403)Cca>Gca	p.P801A	KALRN_ENST00000428018.2_Missense_Mutation_p.P769A|KALRN_ENST00000360013.3_Missense_Mutation_p.P2498A|AC080008.1_ENST00000584173.1_RNA	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2497					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P801A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CTGTGGGCGGCCAAAGCCCAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											156.0	139.0	145.0					3																	124413265		2203	4300	6503	125895955	SO:0001583	missense	8997			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.2401C>G	3.37:g.124413265C>G	ENSP00000291478:p.Pro801Ala		125895955	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000291478.5	37	CCDS3028.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498773	0.85069	.	.	ENSG00000160145	ENST00000360013;ENST00000291478;ENST00000428018	T;T;T	0.74106	-0.81;-0.81;-0.81	6.07	5.19	0.71726	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.133416	0.51477	N	0.000089	T	0.81819	0.4903	M	0.93763	3.455	0.34375	D	0.692442	B;B	0.16603	0.018;0.002	B;B	0.20184	0.028;0.013	D	0.84977	0.0886	10	0.56958	D	0.05	.	15.6595	0.77174	0.0:0.8637:0.1363:0.0	.	801;2497	C9JQ37;O60229	.;KALRN_HUMAN	A	2498;801;769	ENSP00000353109:P2498A;ENSP00000291478:P801A;ENSP00000402419:P769A	ENSP00000291478:P801A	P	+	1	0	KALRN	125895955	1.000000	0.71417	0.961000	0.40146	0.956000	0.61745	5.500000	0.66943	1.529000	0.49120	0.655000	0.94253	CCA		0.537	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947		Missense_Mutation
LCT	3938	genome.wustl.edu	37	2	136570088	136570088	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr2:136570088C>G	ENST00000264162.2	-	7	2156	c.2146G>C	c.(2146-2148)Gtg>Ctg	p.V716L	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	716	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.V716M(1)|p.V716L(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TGGGGCCACACATGGTTCACG	0.532																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	2											101.0	98.0	99.0					2																	136570088		2203	4300	6503	136286558	SO:0001583	missense	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2146G>C	2.37:g.136570088C>G	ENSP00000264162:p.Val716Leu		136286558	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	10.44	1.350174	0.24512	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.50001	0.76	5.66	-1.98	0.07480	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.804728	0.11825	N	0.525814	T	0.23014	0.0556	N	0.10685	0.025	0.09310	N	1	B	0.06786	0.001	B	0.18263	0.021	T	0.13098	-1.0522	10	0.38643	T	0.18	-0.0567	6.1383	0.20245	0.5152:0.2361:0.0:0.2487	.	716	P09848	LPH_HUMAN	L	716;148	ENSP00000264162:V716L	ENSP00000264162:V716L	V	-	1	0	LCT	136286558	0.014000	0.17966	0.000000	0.03702	0.823000	0.46562	0.003000	0.13083	-0.797000	0.04450	0.655000	0.94253	GTG		0.532	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		Missense_Mutation
PIK3CB	5291	genome.wustl.edu	37	3	138423330	138423330	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1435-01	TCGA-24-1435-10	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr3:138423330A>C	ENST00000477593.1	-	11	1609	c.1536T>G	c.(1534-1536)atT>atG	p.I512M	PIK3CB_ENST00000289153.2_Missense_Mutation_p.I512M|PIK3CB_ENST00000544716.1_De_novo_Start_InFrame			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	512					activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)	p.I512M(1)		NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	CTGCCTTTTCAATAATCTGTT	0.308																																																1	Substitution - Missense(1)	ovary(1)	3											131.0	131.0	131.0					3																	138423330		2203	4300	6503	139906020	SO:0001583	missense	5291				CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.1536T>G	3.37:g.138423330A>C	ENSP00000418143:p.Ile512Met		139906020	D3DNF0|Q24JU2	Missense_Mutation	SNP	ENST00000477593.1	37	CCDS3104.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	11.51	1.660479	0.29515	.	.	ENSG00000051382	ENST00000477593;ENST00000289153	T;T	0.69685	-0.42;-0.42	6.08	3.66	0.41972	Armadillo-type fold (1);	0.480329	0.23107	N	0.051846	T	0.57740	0.2074	L	0.47716	1.5	0.80722	D	1	B	0.13594	0.008	B	0.17098	0.017	T	0.50541	-0.8816	10	0.39692	T	0.17	-15.7566	10.0448	0.42180	0.8867:0.0:0.1133:0.0	.	512	P42338	PK3CB_HUMAN	M	512	ENSP00000418143:I512M;ENSP00000289153:I512M	ENSP00000289153:I512M	I	-	3	3	PIK3CB	139906020	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.266000	0.43320	0.531000	0.28639	0.482000	0.46254	ATT		0.308	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358019.1			Missense_Mutation
PCDHB12	56124	genome.wustl.edu	37	5	140590510	140590510	+	Silent	SNP	C	C	T	rs574218346	byFrequency	TCGA-24-1435-01	TCGA-24-1435-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr5:140590510C>T	ENST00000239450.2	+	1	2220	c.2031C>T	c.(2029-2031)gcC>gcT	p.A677A	PCDHB12_ENST00000541609.1_Silent_p.A340A|PCDHB13_ENST00000341948.4_5'Flank	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	677					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A677A(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGAGGCGGCCCCGGCCCAGG	0.692																																																1	Substitution - coding silent(1)	ovary(1)	5											51.0	57.0	55.0					5																	140590510		2184	4267	6451	140570694	SO:0001819	synonymous_variant	56124			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.2031C>T	5.37:g.140590510C>T			140570694	B4DDU1	Silent	SNP	ENST00000239450.2	37	CCDS4254.1	SNP	22	WashU																																																																																				0.692	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		Silent
LRP1B	53353	genome.wustl.edu	37	2	141458145	141458145	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr2:141458145C>T	ENST00000389484.3	-	41	7444	c.6473G>A	c.(6472-6474)tGt>tAt	p.C2158Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2158	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.C2158Y(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCGATAAAGACAGAGTTGCTT	0.408										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											1	Substitution - Missense(1)	ovary(1)	2											114.0	112.0	112.0					2																	141458145		2203	4300	6503	141174615	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6473G>A	2.37:g.141458145C>T	ENSP00000374135:p.Cys2158Tyr		141174615	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200071	0.79015	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.99955	-8.88	4.47	4.47	0.54385	Epidermal growth factor-like (1);	0.000000	0.85682	U	0.000000	D	0.99967	0.9988	H	0.99143	4.445	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	D	0.96534	0.9395	10	0.87932	D	0	.	17.4918	0.87705	0.0:1.0:0.0:0.0	.	2158	Q9NZR2	LRP1B_HUMAN	Y	2158;2096	ENSP00000374135:C2158Y	ENSP00000374135:C2158Y	C	-	2	0	LRP1B	141174615	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.710000	0.84655	2.176000	0.68965	0.585000	0.79938	TGT		0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		Missense_Mutation
SPANXN3	139067	genome.wustl.edu	37	X	142596669	142596669	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chrX:142596669G>C	ENST00000370503.2	-	2	484	c.401C>G	c.(400-402)tCt>tGt	p.S134C	GS1-256O22.5_ENST00000431432.1_RNA	NM_001009609.2	NP_001009609.1	Q5MJ09	SPXN3_HUMAN	SPANX family, member N3	134								p.S134C(1)		endometrium(1)|large_intestine(1)|lung(9)|ovary(2)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;6.56e-05)					GTCCTGTGAAGATCCTTCAGA	0.443																																																1	Substitution - Missense(1)	ovary(1)	X											136.0	111.0	119.0					X																	142596669		2203	4300	6503	142424335	SO:0001583	missense	139067				CCDS35418.1	Xq27.3	2012-06-12			ENSG00000189252	ENSG00000189252			33176	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 8"""	300666				14973187, 17012309	Standard	NM_001009609		Approved	SPANX-N3, CT11.8	uc004fbw.3	Q5MJ09	OTTHUMG00000022582	ENST00000370503.2:c.401C>G	X.37:g.142596669G>C	ENSP00000359534:p.Ser134Cys		142424335	Q0ZNK4	Missense_Mutation	SNP	ENST00000370503.2	37	CCDS35418.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	g	7.917	0.737768	0.15574	.	.	ENSG00000189252	ENST00000370503	T	0.11604	2.76	0.695	0.695	0.18070	.	.	.	.	.	T	0.17874	0.0429	L	0.38838	1.175	0.09310	N	1	D	0.67145	0.996	D	0.64506	0.926	T	0.14008	-1.0488	8	0.48119	T	0.1	.	.	.	.	.	134	Q5MJ09	SPXN3_HUMAN	C	134	ENSP00000359534:S134C	ENSP00000359534:S134C	S	-	2	0	SPANXN3	142424335	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	-0.261000	0.08694	0.633000	0.30452	0.368000	0.22195	TCT		0.443	SPANXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058620.2	NM_001009609		Missense_Mutation
ARHGAP30	257106	genome.wustl.edu	37	1	161022312	161022312	+	Silent	SNP	G	G	A			TCGA-24-1435-01	TCGA-24-1435-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:161022312G>A	ENST00000368013.3	-	8	1178	c.858C>T	c.(856-858)gtC>gtT	p.V286V	ARHGAP30_ENST00000368015.1_Silent_p.V109V|ARHGAP30_ENST00000368016.3_Silent_p.V286V	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	286					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)	p.V286V(2)		breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			TCCACTTCCTGACCTTCAAAG	0.547																																																2	Substitution - coding silent(2)	ovary(2)	1											170.0	184.0	179.0					1																	161022312		2203	4300	6503	159288936	SO:0001819	synonymous_variant	257106			AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.858C>T	1.37:g.161022312G>A			159288936	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Silent	SNP	ENST00000368013.3	37	CCDS30918.1	SNP	45	WashU																																																																																				0.547	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720		Silent
USP21	27005	genome.wustl.edu	37	1	161130804	161130804	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1435-01	TCGA-24-1435-10	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:161130804C>T	ENST00000289865.8	+	2	595	c.374C>T	c.(373-375)gCc>gTc	p.A125V	RP11-297K8.2_ENST00000420498.1_RNA|USP21_ENST00000368002.3_Missense_Mutation_p.A125V|USP21_ENST00000368001.1_Missense_Mutation_p.A125V	NM_012475.4	NP_036607.3	Q9UK80	UBP21_HUMAN	ubiquitin specific peptidase 21	125					histone deubiquitination (GO:0016578)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)|metal ion binding (GO:0046872)|NEDD8-specific protease activity (GO:0019784)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.A125V(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|prostate(3)	29	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			ATGGGGATTGCCTTGGGAGGG	0.632																																																1	Substitution - Missense(1)	ovary(1)	1											84.0	78.0	80.0					1																	161130804		2203	4300	6503	159397428	SO:0001583	missense	27005			AF177758	CCDS30920.1	1q22	2008-04-11	2005-08-08		ENSG00000143258	ENSG00000143258		"""Ubiquitin-specific peptidases"""	12620	protein-coding gene	gene with protein product		604729	"""ubiquitin specific protease 21"""	USP23		12838346, 10799498	Standard	XM_006711273		Approved	USP16	uc010pkd.2	Q9UK80	OTTHUMG00000033154	ENST00000289865.8:c.374C>T	1.37:g.161130804C>T	ENSP00000289865:p.Ala125Val		159397428	Q59H60|Q5BKT5|Q5VTW9|Q5VTX0|Q9BTV1|Q9HBS2|Q9NYN4	Missense_Mutation	SNP	ENST00000289865.8	37	CCDS30920.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324587	0.81580	.	.	ENSG00000143258	ENST00000368002;ENST00000289865;ENST00000368001	T;T;T	0.47177	0.85;0.85;0.85	5.14	5.14	0.70334	.	1.477390	0.03973	N	0.292028	T	0.24084	0.0583	N	0.14661	0.345	0.36502	D	0.869072	P	0.43024	0.798	B	0.36289	0.221	T	0.25467	-1.0131	10	0.54805	T	0.06	.	17.538	0.87839	0.0:1.0:0.0:0.0	.	125	Q9UK80	UBP21_HUMAN	V	125	ENSP00000356981:A125V;ENSP00000289865:A125V;ENSP00000356980:A125V	ENSP00000289865:A125V	A	+	2	0	USP21	159397428	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.934000	0.28910	2.666000	0.90696	0.561000	0.74099	GCC		0.632	USP21-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080801.1			Missense_Mutation
MPZ	4359	genome.wustl.edu	37	1	161275956	161275956	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:161275956G>C	ENST00000533357.1	-	5	653	c.587C>G	c.(586-588)gCt>gGt	p.A196G	MPZ_ENST00000336559.4_Missense_Mutation_p.A196G|MPZ_ENST00000491222.2_5'UTR|MPZ_ENST00000526189.1_5'UTR|MPZ_ENST00000360451.6_Missense_Mutation_p.A206G	NM_000530.6	NP_000521.2	P25189	MYP0_HUMAN	myelin protein zero	196					cell death (GO:0008219)|cell-cell junction maintenance (GO:0045217)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.A206G(1)		central_nervous_system(1)|large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	10	all_cancers(52;6.96e-17)|all_hematologic(112;0.093)	Breast(1374;0.181)	BRCA - Breast invasive adenocarcinoma(70;0.00376)			CTTCTCCATAGCACTGCAAGA	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											110.0	110.0	110.0					1																	161275956		2203	4300	6503	159542580	SO:0001583	missense	4359			BC006491	CCDS1229.1, CCDS1229.2	1q22	2014-09-17	2008-08-01		ENSG00000158887	ENSG00000158887		"""Immunoglobulin superfamily / V-set domain containing"""	7225	protein-coding gene	gene with protein product		159440	"""Charcot-Marie-Tooth neuropathy 1B"""	CMT1, CMT1B		7693129	Standard	NM_000530		Approved	HMSNIB	uc001gaf.4	P25189	OTTHUMG00000034341	ENST00000533357.1:c.587C>G	1.37:g.161275956G>C	ENSP00000432943:p.Ala196Gly		159542580	Q16072|Q5VTH4|Q92677|Q9BR67	Missense_Mutation	SNP	ENST00000533357.1	37	CCDS1229.2	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	16.88	3.245067	0.59103	.	.	ENSG00000158887	ENST00000533357;ENST00000360451;ENST00000336559	D;D;D	0.92099	-2.97;-2.97;-2.97	4.45	3.51	0.40186	Myelin-PO, C-terminal (1);	0.082794	0.47093	D	0.000249	D	0.84781	0.5548	L	0.27053	0.805	0.35452	D	0.795783	D	0.56287	0.975	P	0.56042	0.79	T	0.81497	-0.0906	9	0.19147	T	0.46	-20.2103	9.7758	0.40618	0.0:0.0:0.7946:0.2054	.	196	P25189	MYP0_HUMAN	G	196;206;196	ENSP00000432943:A196G;ENSP00000353634:A206G;ENSP00000337777:A196G	ENSP00000337777:A196G	A	-	2	0	MPZ	159542580	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.353000	0.66034	1.181000	0.42912	0.655000	0.94253	GCT		0.607	MPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082987.2	NM_000530		Missense_Mutation
ZNF354B	117608	genome.wustl.edu	37	5	178310100	178310100	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr5:178310100G>A	ENST00000322434.3	+	5	873	c.647G>A	c.(646-648)tGc>tAc	p.C216Y	RNU1-39P_ENST00000383897.1_RNA	NM_058230.2	NP_478137.1	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	216					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C216Y(1)		breast(2)|kidney(2)|large_intestine(7)|liver(2)|lung(2)|ovary(2)|stomach(3)|urinary_tract(1)	21	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCTATAAATGCAGTACATGT	0.289																																																1	Substitution - Missense(1)	ovary(1)	5											70.0	77.0	74.0					5																	178310100		2201	4296	6497	178242706	SO:0001583	missense	117608			AK057737	CCDS4439.1	5q35.3	2013-01-08			ENSG00000178338	ENSG00000178338		"""Zinc fingers, C2H2-type"", ""-"""	17197	protein-coding gene	gene with protein product							Standard	NM_058230		Approved	KID2, FLJ25008	uc003mjl.3	Q96LW1	OTTHUMG00000130896	ENST00000322434.3:c.647G>A	5.37:g.178310100G>A	ENSP00000327143:p.Cys216Tyr		178242706	A8K0V2|Q5U5Z4	Missense_Mutation	SNP	ENST00000322434.3	37	CCDS4439.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623348	0.46840	.	.	ENSG00000178338	ENST00000322434	T	0.58358	0.34	3.53	3.53	0.40419	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75474	0.3854	M	0.89840	3.065	0.40280	D	0.978385	D	0.89917	1.0	D	0.97110	1.0	T	0.81756	-0.0787	9	0.72032	D	0.01	.	12.6061	0.56525	0.0:0.0:1.0:0.0	.	216	Q96LW1	Z354B_HUMAN	Y	216	ENSP00000327143:C216Y	ENSP00000327143:C216Y	C	+	2	0	ZNF354B	178242706	1.000000	0.71417	0.980000	0.43619	0.780000	0.44128	6.382000	0.73167	1.805000	0.52779	0.561000	0.74099	TGC		0.289	ZNF354B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253482.1	NM_058230		Missense_Mutation
NCF2	4688	genome.wustl.edu	37	1	183529377	183529378	+	Missense_Mutation	DNP	TC	TC	GT			TCGA-24-1435-01	TCGA-24-1435-10	TC	TC	TC	GT	TC	TC	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:183529377_183529378TC>GT	ENST00000367535.3	-	14	1572_1573	c.1321_1322GA>AC	c.(1321-1323)GAa>ACa	p.E441T	NCF2_ENST00000367536.1_Missense_Mutation_p.E441T|NCF2_ENST00000413720.1_Missense_Mutation_p.E396T|NCF2_ENST00000469280.1_5'Flank|NCF2_ENST00000418089.1_Missense_Mutation_p.E360T	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	441					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	TTTTTCACTTTCCTTGGGTTCA	0.441																																																0			1																																								181796001	SO:0001583	missense	4688			BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.1321_1322delinsGT	1.37:g.183529377_183529378delinsGT	ENSP00000356505:p.Glu441Thr		181796000	B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense	DNP	ENST00000367535.3	37	CCDS1356.1	DNP	62	WashU																																																																																				0.441	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085483.1	NM_000433		Missense
PPFIA4	8497	genome.wustl.edu	37	1	203033069	203033069	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1435-01	TCGA-24-1435-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:203033069G>A	ENST00000447715.2	+	30	3363	c.2922G>A	c.(2920-2922)atG>atA	p.M974I	PPFIA4_ENST00000367240.2_Missense_Mutation_p.M975I|PPFIA4_ENST00000599966.1_Missense_Mutation_p.M481I|PPFIA4_ENST00000272198.6_Missense_Mutation_p.M490I|PPFIA4_ENST00000414050.2_Missense_Mutation_p.M703I|PPFIA4_ENST00000295706.4_Missense_Mutation_p.M481I			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	974	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)		p.M1120I(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						ACGCCCGCATGCTGGACCACC	0.632																																																1	Substitution - Missense(1)	ovary(1)	1											43.0	50.0	48.0					1																	203033069		2201	4300	6501	201299692	SO:0001583	missense	8497			AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.2922G>A	1.37:g.203033069G>A	ENSP00000402576:p.Met974Ile		201299692	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Missense_Mutation	SNP	ENST00000447715.2	37		SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	35	5.588079	0.96590	.	.	ENSG00000143847	ENST00000367240;ENST00000447715;ENST00000295706;ENST00000414050;ENST00000272198	T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74	5.14	5.14	0.70334	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.51477	U	0.000090	T	0.70474	0.3228	M	0.85710	2.77	0.80722	D	1	B;D;B;B;P	0.54772	0.415;0.968;0.276;0.451;0.507	B;P;B;B;B	0.60286	0.184;0.872;0.339;0.162;0.25	T	0.75130	-0.3426	10	0.62326	D	0.03	-25.44	18.7744	0.91904	0.0:0.0:1.0:0.0	.	703;974;176;481;490	B4DIS5;B1N949;B3KN22;O75335-2;O75335	.;.;.;.;LIPA4_HUMAN	I	975;974;481;703;490	ENSP00000356209:M975I;ENSP00000402576:M974I;ENSP00000295706:M481I;ENSP00000400379:M703I;ENSP00000272198:M490I	ENSP00000272198:M490I	M	+	3	0	PPFIA4	201299692	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.657000	0.98554	2.668000	0.90789	0.650000	0.86243	ATG		0.632	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1	NM_015053		Missense_Mutation
KMO	8564	genome.wustl.edu	37	1	241731804	241731804	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:241731804C>A	ENST00000366559.4	+	10	1125	c.814C>A	c.(814-816)Ctc>Atc	p.L272I	KMO_ENST00000366558.3_Missense_Mutation_p.L272I|KMO_ENST00000366557.4_Missense_Mutation_p.L272I	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)									p.L272I(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			TTGAAGGAAACTCCTAGTGCA	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											152.0	148.0	149.0					1																	241731804		2203	4300	6503	239798427	SO:0001583	missense	8564			AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.814C>A	1.37:g.241731804C>A	ENSP00000355517:p.Leu272Ile		239798427		Missense_Mutation	SNP	ENST00000366559.4	37	CCDS1618.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	7.194	0.592021	0.13812	.	.	ENSG00000117009	ENST00000366559;ENST00000366558;ENST00000366557	T;T;T	0.51574	0.7;0.7;0.7	5.8	2.94	0.34122	Monooxygenase, FAD-binding (1);	0.336766	0.34411	N	0.003985	T	0.32556	0.0833	N	0.24115	0.695	0.22305	N	0.999218	B;B;B	0.26258	0.145;0.087;0.12	B;B;B	0.33620	0.167;0.167;0.104	T	0.21690	-1.0238	10	0.37606	T	0.19	.	6.2508	0.20845	0.1669:0.1591:0.674:0.0	.	272;272;272	O15229;A8K693;O15229-2	KMO_HUMAN;.;.	I	272	ENSP00000355517:L272I;ENSP00000355516:L272I;ENSP00000355515:L272I	ENSP00000355515:L272I	L	+	1	0	KMO	239798427	1.000000	0.71417	0.805000	0.32314	0.011000	0.07611	2.039000	0.41193	0.383000	0.24910	-0.171000	0.13296	CTC		0.363	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095612.1	NM_003679		Missense_Mutation
AHCTF1	25909	genome.wustl.edu	37	1	247071042	247071042	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1435-01	TCGA-24-1435-10	C	C	G	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:247071042C>G	ENST00000391829.2	-	5	698	c.575G>C	c.(574-576)gGt>gCt	p.G192A	AHCTF1_ENST00000366508.1_Missense_Mutation_p.G227A|AHCTF1_ENST00000326225.3_Missense_Mutation_p.G201A			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	192	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G192A(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AGCTGGGATACCAGTTAGAAC	0.373																																					Colon(145;197 1800 4745 15099 26333)											1	Substitution - Missense(1)	ovary(1)	1											93.0	88.0	90.0					1																	247071042		2203	4300	6503	245137665	SO:0001583	missense	25909				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.575G>C	1.37:g.247071042C>G	ENSP00000375705:p.Gly192Ala		245137665	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37		SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715383	0.68844	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.49139	0.79;0.79;0.79	5.86	5.86	0.93980	.	0.098601	0.64402	D	0.000001	T	0.64046	0.2563	L	0.51422	1.61	0.46096	D	0.998868	D;D	0.65815	0.995;0.981	D;P	0.63957	0.92;0.76	T	0.58725	-0.7586	10	0.45353	T	0.12	-23.1527	20.5632	0.99335	0.0:1.0:0.0:0.0	.	227;192	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	A	227;201;192	ENSP00000355464:G227A;ENSP00000355465:G201A;ENSP00000375705:G192A	ENSP00000355465:G201A	G	-	2	0	AHCTF1	245137665	1.000000	0.71417	0.961000	0.40146	0.994000	0.84299	5.677000	0.68142	2.937000	0.99478	0.650000	0.86243	GGT		0.373	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446		Missense_Mutation
DNAH9	1770	genome.wustl.edu	37	17	11672606	11672606	+	Silent	SNP	C	C	T	rs199937308		TCGA-24-1435-01	TCGA-24-1435-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr17:11672606C>T	ENST00000262442.4	+	38	7580	c.7512C>T	c.(7510-7512)aaC>aaT	p.N2504N	DNAH9_ENST00000454412.2_Silent_p.N2504N	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2504	AAA 3. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.N2504N(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGGTGAAAAACGTGCCATTCA	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		18860	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	17											61.0	53.0	56.0					17																	11672606		2203	4300	6503	11613331	SO:0001819	synonymous_variant	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.7512C>T	17.37:g.11672606C>T			11613331	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1	SNP	19	WashU																																																																																				0.627	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		Silent
ZNF320	162967	genome.wustl.edu	37	19	53386928	53386928	+	Intron	SNP	G	G	A			TCGA-24-1435-01	TCGA-24-1435-10	G	G	A	G	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr19:53386928G>A	ENST00000595635.1	-	8	644				ZNF320_ENST00000391781.2_Intron|ZNF320_ENST00000600930.1_Intron|ZNF320_ENST00000597909.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		tgagtcgggtggatcatgagg	0.438																																																0			19																																								58078740	SO:0001627	intron_variant	162967			AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.143-1692C>T	19.37:g.53386928G>A			58078740	Q8NDR6	Missense_Mutation	SNP	ENST00000595635.1	37	CCDS33095.1	SNP	47	WashU																																																																																				0.438	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463771.1	NM_207333		Missense_Mutation
NRXN2	9379	genome.wustl.edu	37	11	64390411	64390411	+	Silent	SNP	G	G	T			TCGA-24-1435-01	TCGA-24-1435-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr11:64390411G>T	ENST00000377551.1	-	20	4198	c.3987C>A	c.(3985-3987)ccC>ccA	p.P1329P	NRXN2_ENST00000409571.1_Silent_p.P1322P|NRXN2_ENST00000265459.6_Silent_p.P1329P|NRXN2_ENST00000377559.3_Silent_p.P1259P|NRXN2_ENST00000301894.2_Silent_p.P283P			Q9P2S2	NRX2A_HUMAN	neurexin 2	1329	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.P1329P(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TCCGCACATTGGGGTCGCTCT	0.701																																																1	Substitution - coding silent(1)	ovary(1)	11											34.0	30.0	32.0					11																	64390411		2199	4295	6494	64146987	SO:0001819	synonymous_variant	9379				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.3987C>A	11.37:g.64390411G>T			64146987	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1	SNP	47	WashU																																																																																				0.701	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080		Silent
TRAF1	7185	genome.wustl.edu	37	9	123673632	123673632	+	Missense_Mutation	SNP	C	C	T	rs149705933		TCGA-24-1435-01	TCGA-24-1435-10	C	C	C	T	C	C	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr9:123673632C>T	ENST00000373887.3	-	6	3310	c.865G>A	c.(865-867)Gtc>Atc	p.V289I	TRAF1_ENST00000540010.1_Missense_Mutation_p.V289I|TRAF1_ENST00000546084.1_Missense_Mutation_p.V167I	NM_005658.4	NP_005649.1	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	289	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein complex assembly (GO:0006461)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V289I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(4)|pancreas(1)|skin(2)	22						AAGAGGCTGACGGTCCTGCCA	0.612													c|||	1	0.000199681	0.0008	0.0	5008	,	,		20798	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9						T	ILE/VAL,ILE/VAL,ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	37.0	33.0	35.0		865,499,865	-2.0	0.6	9	dbSNP_134	35	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	TRAF1	NM_001190945.1,NM_001190947.1,NM_005658.4	29,29,29	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	possibly-damaging,possibly-damaging,possibly-damaging	289/417,167/295,289/417	123673632	3,13003	2203	4300	6503	122713453	SO:0001583	missense	7185			AK090468	CCDS6825.1, CCDS55335.1	9q33-q34	2008-02-05			ENSG00000056558	ENSG00000056558			12031	protein-coding gene	gene with protein product		601711				8069916	Standard	NM_001190945		Approved	EBI6	uc010mvl.2	Q13077	OTTHUMG00000020578	ENST00000373887.3:c.865G>A	9.37:g.123673632C>T	ENSP00000362994:p.Val289Ile		122713453	B4DJ77|Q658U1|Q8NF13	Missense_Mutation	SNP	ENST00000373887.3	37	CCDS6825.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	c	7.976	0.750141	0.15778	4.54E-4	1.16E-4	ENSG00000056558	ENST00000373887;ENST00000540010;ENST00000546084	T;T;T	0.43688	0.94;0.94;0.94	4.64	-2.01	0.07410	TRAF-type (1);TRAF-like (1);MATH (3);	0.644298	0.15227	N	0.273622	T	0.19886	0.0478	N	0.11927	0.2	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.27739	-1.0065	10	0.14656	T	0.56	-16.2109	10.0395	0.42148	0.0:0.4697:0.0:0.5303	.	289	Q13077	TRAF1_HUMAN	I	289;289;167	ENSP00000362994:V289I;ENSP00000443183:V289I;ENSP00000438583:V167I	ENSP00000362994:V289I	V	-	1	0	TRAF1	122713453	0.000000	0.05858	0.623000	0.29173	0.905000	0.53344	-1.063000	0.03465	-0.333000	0.08476	-0.213000	0.12676	GTC		0.612	TRAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053843.1	NM_005658		Missense_Mutation
COL24A1	255631	genome.wustl.edu	37	1	86497578	86497585	+	Frame_Shift_Del	DEL	CCGGAGGA	CCGGAGGA	-	rs370899727|rs187962051	byFrequency	TCGA-24-1435-01	TCGA-24-1435-10	CCGGAGGA	CCGGAGGA	CCGGAGGA	-	CCGGAGGA	CCGGAGGA	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr1:86497578_86497585delCCGGAGGA	ENST00000370571.2	-	14	2391_2398	c.2025_2032delTCCTCCGG	c.(2023-2034)ggtcctccggggfs	p.GPPG675fs	COL24A1_ENST00000436319.1_Frame_Shift_Del_p.GPPG675fs	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	675	Collagen-like 3.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.P677T(1)|p.P676fs*5(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		CCAGGAAACCCCGGAGGACCAGTGCCAC	0.327																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|lung(1)	1																																								86270173	SO:0001589	frameshift_variant	255631			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.2025_2032delTCCTCCGG	1.37:g.86497578_86497585delCCGGAGGA	ENSP00000359603:p.Gly675fs		86270166	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Frame_Shift_Del	DEL	ENST00000370571.2	37	CCDS41353.1	DEL	22	WashU																																																																																				0.327	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890		Frame_Shift_Del
VSIG2	23584	genome.wustl.edu	37	11	124620707	124620710	+	Frame_Shift_Del	DEL	GTCA	GTCA	-			TCGA-24-1435-01	TCGA-24-1435-10	GTCA	GTCA	GTCA	-	GTCA	GTCA	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr11:124620707_124620710delGTCA	ENST00000326621.5	-	3	427_430	c.327_330delTGAC	c.(325-330)actgacfs	p.TD109fs	VSIG2_ENST00000403470.1_Frame_Shift_Del_p.TD109fs	NM_014312.3	NP_055127.2	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	109	Ig-like V-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.D110fs*26(1)		central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(5)	19	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		AGGGGTGGACGTCAGTCAGTTTCA	0.529																																																1	Deletion - Frameshift(1)	ovary(1)	11																																								124125920	SO:0001589	frameshift_variant	23584			AF061022	CCDS8452.1	11q24	2013-01-11			ENSG00000019102	ENSG00000019102		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	17149	protein-coding gene	gene with protein product		606011				9862345	Standard	NM_014312		Approved	CTXL, CTH	uc001qas.3	Q96IQ7	OTTHUMG00000150357	ENST00000326621.5:c.327_330delTGAC	11.37:g.124620711_124620714delGTCA	ENSP00000318684:p.Thr109fs		124125917	O95791|Q9NX42	Frame_Shift_Del	DEL	ENST00000326621.5	37	CCDS8452.1	DEL	40	WashU																																																																																				0.529	VSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317785.1	NM_014312		Frame_Shift_Del
AIM1	202	genome.wustl.edu	37	6	106969189	106969214	+	Frame_Shift_Del	DEL	AGGCTAATCATATTGAAAGTGTTATT	AGGCTAATCATATTGAAAGTGTTATT	-	rs140407254|rs375366785|rs201797268|rs575356547|rs149596949|rs144529082	byFrequency	TCGA-24-1435-01	TCGA-24-1435-10	AGGCTAATCATATTGAAAGTGTTATT	AGGCTAATCATATTGAAAGTGTTATT	AGGCTAATCATATTGAAAGTGTTATT	-	AGGCTAATCATATTGAAAGTGTTATT	AGGCTAATCATATTGAAAGTGTTATT	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr6:106969189_106969214delAGGCTAATCATATTGAAAGTGTTATT	ENST00000369066.3	+	2	3369_3394	c.2882_2907delAGGCTAATCATATTGAAAGTGTTATT	c.(2881-2907)aaggctaatcatattgaaagtgttattfs	p.KANHIESVI961fs		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.A962fs*10(1)		breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GATATGGAAAAGGCTAATCATATTGAAAGTGTTATTAAATCAAACT	0.363																																																1	Deletion - Frameshift(1)	ovary(1)	6																																								107075907	SO:0001589	frameshift_variant	202			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.2882_2907delAGGCTAATCATATTGAAAGTGTTATT	6.37:g.106969189_106969214delAGGCTAATCATATTGAAAGTGTTATT	ENSP00000358062:p.Lys961fs		107075882	Q6P2P0|Q9BTM3	Frame_Shift_Del	DEL	ENST00000369066.3	37	CCDS34506.1	DEL	3	WashU																																																																																				0.363	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			Frame_Shift_Del
RPS6	6194	genome.wustl.edu	37	9	19379608	19379610	+	In_Frame_Del	DEL	GAT	GAT	-			TCGA-24-1435-01	TCGA-24-1435-10	GAT	GAT	GAT	-	GAT	GAT	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1435-01	TCGA-24-1435-10	g.chr9:19379608_19379610delGAT	ENST00000380394.4	-	2	71_73	c.13_15delATC	c.(13-15)atcdel	p.I5del	RPS6_ENST00000380384.1_5'UTR|RPS6_ENST00000315377.4_5'UTR|RPS6_ENST00000380381.3_In_Frame_Del_p.I5del|RPS6_ENST00000498815.1_5'Flank	NM_001010.2	NP_001001.2	P62753	RS6_HUMAN	ribosomal protein S6	5					activation-induced cell death of T cells (GO:0006924)|cellular protein metabolic process (GO:0044267)|erythrocyte development (GO:0048821)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|oogenesis stage (GO:0022605)|placenta development (GO:0001890)|positive regulation of apoptotic process (GO:0043065)|ribosomal small subunit assembly (GO:0000028)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell differentiation in thymus (GO:0033077)|T cell proliferation involved in immune response (GO:0002309)|TOR signaling (GO:0031929)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|dendrite (GO:0030425)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)	p.I5del(1)		endometrium(3)|lung(2)|ovary(1)|urinary_tract(1)	7		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		CTGGGAAGGAGATGTTCAGCTAA	0.429																																																1	Deletion - In frame(1)	ovary(1)	9																																								19369610	SO:0001651	inframe_deletion	6194				CCDS6492.1	9p21	2011-04-05			ENSG00000137154	ENSG00000137154		"""S ribosomal proteins"""	10429	protein-coding gene	gene with protein product	"""40S ribosomal protein S6"", ""phosphoprotein NP33"""	180460				1577483	Standard	NM_001010		Approved	S6	uc003znv.1	P62753	OTTHUMG00000019642	ENST00000380394.4:c.13_15delATC	9.37:g.19379608_19379610delGAT	ENSP00000369757:p.Ile5del		19369608	P08227|P10660|Q4VBY7|Q8N6Z7	In_Frame_Del	DEL	ENST00000380394.4	37	CCDS6492.1	DEL	33	WashU																																																																																				0.429	RPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051858.1	NM_001010		In_Frame_Del
