#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
C17orf107	100130311	genome.wustl.edu	37	17	4799859	4799860	+	5'Flank	INS	-	-	G			TCGA-24-1464-01	TCGA-24-1464-10	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr17:4799859_4799860insG	ENST00000381365.3	+	0	0				MINK1_ENST00000453408.3_Frame_Shift_Ins_p.W1231fs|C17orf107_ENST00000521575.1_5'Flank|MINK1_ENST00000355280.6_Frame_Shift_Ins_p.W1251fs|MINK1_ENST00000347992.7_Frame_Shift_Ins_p.W1222fs	NM_001145536.1	NP_001139008.1	Q6ZR85	CQ107_HUMAN	chromosome 17 open reading frame 107									p.E1253fs*19(1)		endometrium(2)	2						GGTGCTGCAGTGGGGGGAGATG	0.639																																																1	Insertion - Frameshift(1)	ovary(1)	17																																								4740636	SO:0001631	upstream_gene_variant	50488			AK128415	CCDS45591.1	17p13.2	2009-09-30			ENSG00000205710	ENSG00000205710			37238	protein-coding gene	gene with protein product							Standard	NM_001145536		Approved		uc002fzl.3	Q6ZR85	OTTHUMG00000164838		17.37:g.4799865_4799865dupG	Exception_encountered		4740635		Frame_Shift_Ins	INS	ENST00000381365.3	37	CCDS45591.1	INS	59	WashU																																																																																				0.639	C17orf107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380556.1	NM_001145536		Frame_Shift_Ins
CHD5	26038	genome.wustl.edu	37	1	6206923	6206924	+	Frame_Shift_Ins	INS	-	-	G			TCGA-24-1464-01	TCGA-24-1464-10	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr1:6206923_6206924insG	ENST00000262450.3	-	10	1490_1491	c.1391_1392insC	c.(1390-1392)ccafs	p.P464fs	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.L465fs*28(1)		breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TGCCCTTCAGTGGGGGGCACTG	0.683																																																1	Insertion - Frameshift(1)	ovary(1)	1																																								6129511	SO:0001589	frameshift_variant	26038			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.1392dupC	1.37:g.6206929_6206929dupG	ENSP00000262450:p.Pro464fs		6129510	A8KAP8|A8MQ44|D3DSH9|O60740	Frame_Shift_Ins	INS	ENST00000262450.3	37	CCDS57.1	INS	59	WashU																																																																																				0.683	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557		Frame_Shift_Ins
MYH13	8735	genome.wustl.edu	37	17	10216067	10216068	+	Frame_Shift_Ins	INS	-	-	T			TCGA-24-1464-01	TCGA-24-1464-10	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr17:10216067_10216068insT	ENST00000418404.3	-	30	4351_4352	c.4188_4189insA	c.(4186-4191)aaactgfs	p.L1397fs	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Frame_Shift_Ins_p.L1397fs			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1397					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.L1397fs*74(2)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTCTGGGCCAGTTTTTTCCTAC	0.495																																																2	Insertion - Frameshift(2)	ovary(2)	17																																								10156793	SO:0001589	frameshift_variant	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4189dupA	17.37:g.10216073_10216073dupT	ENSP00000404570:p.Leu1397fs		10156792	O95252|Q9P0U8	Frame_Shift_Ins	INS	ENST00000418404.3	37	CCDS45613.1	INS	36	WashU																																																																																				0.495	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		Frame_Shift_Ins
GALNT15	117248	genome.wustl.edu	37	3	16217061	16217062	+	Frame_Shift_Ins	INS	-	-	G			TCGA-24-1464-01	TCGA-24-1464-10	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr3:16217061_16217062insG	ENST00000339732.5	+	1	906_907	c.403_404insG	c.(403-405)tggfs	p.W135fs	GALNT15_ENST00000437509.1_Frame_Shift_Ins_p.W135fs|GALNT15_ENST00000470031.1_3'UTR	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	135					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.A137fs*2(1)									AAAGAGGGACTGGGGGGCTGAT	0.639																																																1	Insertion - Frameshift(1)	ovary(1)	3																																								16192066	SO:0001589	frameshift_variant	117248			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.409dupG	3.37:g.16217067_16217067dupG	ENSP00000344260:p.Trp135fs		16192065	A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Frame_Shift_Ins	INS	ENST00000339732.5	37	CCDS33711.1	INS	55	WashU																																																																																				0.639	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110		Frame_Shift_Ins
ZNF736	728927	genome.wustl.edu	37	7	63808785	63808786	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-24-1464-01	TCGA-24-1464-10	TG	TG					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr7:63808785_63808786delTG	ENST00000423484.2	+	4	666_667	c.544_545delTG	c.(544-546)tgtfs	p.C182fs	ZNF736_ENST00000355095.4_Frame_Shift_Del_p.C182fs			B4DX44	ZN736_HUMAN	zinc finger protein 736	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						TGGCAAAGACTGTAGGTTGTTC	0.351																																																0			7																																								63446221	SO:0001589	frameshift_variant	728927				CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.544_545delTG	7.37:g.63808785_63808786delTG	ENSP00000400852:p.Cys182fs		63446220		Frame_Shift_Del	DEL	ENST00000423484.2	37	CCDS55114.1	DEL	55	WashU																																																																																				0.351	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000344559.2	NM_001170905		Frame_Shift_Del
PSD	5662	genome.wustl.edu	37	10	104176573	104176574	+	Frame_Shift_Ins	INS	-	-	G			TCGA-24-1464-01	TCGA-24-1464-10	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr10:104176573_104176574insG	ENST00000020673.5	-	2	748_749	c.222_223insC	c.(220-225)ccctcafs	p.S75fs	PSD_ENST00000492902.2_5'UTR|FBXL15_ENST00000224862.3_5'Flank|PSD_ENST00000406432.1_Frame_Shift_Ins_p.S75fs	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	75	Pro-rich.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)	p.S75fs*127(1)		breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		ACACGGGGTGAGGGGGGGCCAC	0.668																																																1	Insertion - Frameshift(1)	ovary(1)	10																																								104166564	SO:0001589	frameshift_variant	5662			X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.223dupC	10.37:g.104176580_104176580dupG	ENSP00000020673:p.Ser75fs		104166563	B1AKX7|D3DR87|Q15673|Q8IVG0	Frame_Shift_Ins	INS	ENST00000020673.5	37	CCDS31272.1	INS	11	WashU																																																																																				0.668	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2			Frame_Shift_Ins
LINC00443	100874173	genome.wustl.edu	37	13	107316292	107316293	+	lincRNA	INS	-	-	A			TCGA-24-1464-01	TCGA-24-1464-10	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr13:107316292_107316293insA	ENST00000421601.2	+	0	239					NR_047026.1				long intergenic non-protein coding RNA 443																		CACGTTTCTCTAAAAAACGAAA	0.515																																																0			13																																								106114294			390424					13q33.3	2012-10-12			ENSG00000230156	ENSG00000230156		"""Long non-coding RNAs"""	42780	non-coding RNA	RNA, long non-coding							Standard	NR_047026		Approved		uc031qnf.1		OTTHUMG00000017323		13.37:g.107316298_107316298dupA			106114293		Frame_Shift_Ins	INS	ENST00000421601.2	37		INS	53	WashU																																																																																				0.515	LINC00443-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000045732.2			Frame_Shift_Ins
CEP164	22897	genome.wustl.edu	37	11	117222685	117222686	+	Frame_Shift_Ins	INS	-	-	C			TCGA-24-1464-01	TCGA-24-1464-10	-	-					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr11:117222685_117222686insC	ENST00000278935.3	+	5	521_522	c.374_375insC	c.(373-378)gaccccfs	p.DP125fs		NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	125	Interaction with ATRIP.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.K128fs*77(1)		breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		aaggaCAGAGACCCCCCCAAAA	0.51																																																1	Insertion - Frameshift(1)	ovary(1)	11								10,4230		0,10,2110						5.8	1.0		dbSNP_130	25	6,8192		0,6,4093	no	frameshift	CEP164	NM_014956.4		0,16,6203	A1A1,A1R,RR		0.0732,0.2358,0.1286				16,12422				116727896	SO:0001589	frameshift_variant	22897			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.381dupC	11.37:g.117222692_117222692dupC	ENSP00000278935:p.Asp125fs		116727895	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Frame_Shift_Ins	INS	ENST00000278935.3	37	CCDS31683.1	INS	10	WashU																																																																																				0.510	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956		Frame_Shift_Ins
ACTL8	81569	genome.wustl.edu	37	1	18153008	18153008	+	Silent	SNP	G	G	A			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr1:18153008G>A	ENST00000375406.1	+	3	1311	c.1095G>A	c.(1093-1095)agG>agA	p.R365R		NM_030812.2	NP_110439.2	Q9H568	ACTL8_HUMAN	actin-like 8	365					epithelial cell differentiation (GO:0030855)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R365R(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	28		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		AGCATATGAGGATGTGACCCT	0.512											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	1											44.0	47.0	46.0					1																	18153008		2157	4256	6413	18025595	SO:0001819	synonymous_variant	81569			AK057339	CCDS183.1	1p36.2-p35	2009-03-25			ENSG00000117148	ENSG00000117148			24018	protein-coding gene	gene with protein product	"""cancer/testis antigen 57"""						Standard	NM_030812		Approved	CT57	uc001bat.3	Q9H568	OTTHUMG00000002512	ENST00000375406.1:c.1095G>A	1.37:g.18153008G>A		723	18025595	Q13104|Q96M75	Silent	SNP	ENST00000375406.1	37	CCDS183.1	SNP	41	WashU																																																																																				0.512	ACTL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007143.1	NM_030812		Silent
IVNS1ABP	10625	genome.wustl.edu	37	1	185267296	185267296	+	Silent	SNP	C	C	G			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr1:185267296C>G	ENST00000367498.3	-	15	2422	c.1800G>C	c.(1798-1800)ggG>ggC	p.G600G	IVNS1ABP_ENST00000459929.1_5'UTR|IVNS1ABP_ENST00000392007.3_Silent_p.G382G	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	600					negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)		p.G600G(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						CAGTTGCAATCCCAGCATTGC	0.413																																																1	Substitution - coding silent(1)	ovary(1)	1											305.0	269.0	281.0					1																	185267296		2203	4300	6503	183533919	SO:0001819	synonymous_variant	10625			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.1800G>C	1.37:g.185267296C>G			183533919	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Silent	SNP	ENST00000367498.3	37	CCDS1368.1	SNP	30	WashU																																																																																				0.413	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085774.1	NM_006469		Silent
ARID4B	51742	genome.wustl.edu	37	1	235344929	235344929	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1464-01	TCGA-24-1464-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr1:235344929T>C	ENST00000264183.3	-	20	3802	c.3305A>G	c.(3304-3306)aAt>aGt	p.N1102S	ARID4B_ENST00000366603.2_Missense_Mutation_p.N1102S|ARID4B_ENST00000349213.3_Missense_Mutation_p.N1016S|ARID4B_ENST00000494543.1_5'UTR	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	1102					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.N1102S(2)		NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TTCTGGCTGATTACTACTGCT	0.443																																																2	Substitution - Missense(2)	ovary(2)	1											126.0	125.0	125.0					1																	235344929		2203	4300	6503	233411552	SO:0001583	missense	51742			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.3305A>G	1.37:g.235344929T>C	ENSP00000264183:p.Asn1102Ser		233411552	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	ENST00000264183.3	37	CCDS31061.1	SNP	52	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	1.381|1.381	-0.583494|-0.583494	0.03827|0.03827	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000444620|ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183	.|T;T;T	.|0.18657	.|2.21;2.2;2.2	5.17|5.17	2.66|2.66	0.31614|0.31614	.|.	.|0.362723	.|0.30704	.|N	.|0.009048	T|T	0.09335|0.09335	0.0230|0.0230	N|N	0.11427|0.11427	0.14|0.14	0.37998|0.37998	D|D	0.93414|0.93414	.|B;B;B;B	.|0.17268	.|0.016;0.021;0.01;0.012	.|B;B;B;B	.|0.21151	.|0.021;0.033;0.033;0.018	T|T	0.21348|0.21348	-1.0248|-1.0248	5|10	.|0.02654	.|T	.|1	-10.81|-10.81	11.5909|11.5909	0.50945|0.50945	0.0:0.0:0.2828:0.7172|0.0:0.0:0.2828:0.7172	.|.	.|783;1102;1016;1102	.|Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39	.|.;.;.;ARI4B_HUMAN	V|S	502|1102;1016;1102;1102	.|ENSP00000264184:N1016S;ENSP00000355562:N1102S;ENSP00000264183:N1102S	.|ENSP00000264183:N1102S	I|N	-|-	1|2	0|0	ARID4B|ARID4B	233411552|233411552	0.987000|0.987000	0.35691|0.35691	0.977000|0.977000	0.42913|0.42913	0.986000|0.986000	0.74619|0.74619	0.559000|0.559000	0.23485|0.23485	0.789000|0.789000	0.33779|0.33779	0.477000|0.477000	0.44152|0.44152	ATC|AAT		0.443	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374		Missense_Mutation
KMO	8564	genome.wustl.edu	37	1	241753389	241753389	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1464-01	TCGA-24-1464-10	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr1:241753389T>G	ENST00000366559.4	+	13	1485	c.1174T>G	c.(1174-1176)Tcg>Gcg	p.S392A	KMO_ENST00000366558.3_Missense_Mutation_p.S379A|KMO_ENST00000366557.4_Intron	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)									p.S392A(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			GATTATGCCATCGACCTTTAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	1											147.0	141.0	143.0					1																	241753389		2203	4300	6503	239820012	SO:0001583	missense	8564			AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.1174T>G	1.37:g.241753389T>G	ENSP00000355517:p.Ser392Ala		239820012		Missense_Mutation	SNP	ENST00000366559.4	37	CCDS1618.1	SNP	50	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.631|8.631	0.893784|0.893784	0.17613|0.17613	.|.	.|.	ENSG00000117009|ENSG00000117009	ENST00000366555|ENST00000366559;ENST00000366558	.|T;T	.|0.46063	.|0.88;0.97	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	.|0.231036	.|0.42294	.|D	.|0.000723	T|T	0.40015|0.40015	0.1100|0.1100	M|M	0.69185|0.69185	2.1|2.1	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.44241	.|0.737;0.731;0.829	.|B;B;B	.|0.38264	.|0.138;0.184;0.269	T|T	0.30621|0.30621	-0.9972|-0.9972	5|10	.|0.25751	.|T	.|0.34	.|.	12.6339|12.6339	0.56673|0.56673	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|392;392;379	.|O15229;A8K693;O15229-2	.|KMO_HUMAN;.;.	S|A	77|392;379	.|ENSP00000355517:S392A;ENSP00000355516:S379A	.|ENSP00000355516:S379A	I|S	+|+	2|1	0|0	KMO|KMO	239820012|239820012	0.926000|0.926000	0.31397|0.31397	0.869000|0.869000	0.34112|0.34112	0.008000|0.008000	0.06430|0.06430	3.132000|3.132000	0.50523|0.50523	2.234000|2.234000	0.73211|0.73211	0.533000|0.533000	0.62120|0.62120	ATC|TCG		0.368	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095612.1	NM_003679		Missense_Mutation
KIAA1462	57608	genome.wustl.edu	37	10	30317348	30317348	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr10:30317348C>A	ENST00000375377.1	-	3	1830	c.1729G>T	c.(1729-1731)Gag>Tag	p.E577*		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	577					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)		p.E577*(1)		breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						AATATAGTCTCGTTCATTTTT	0.418																																																1	Substitution - Nonsense(1)	ovary(1)	10											98.0	98.0	98.0					10																	30317348		1832	4086	5918	30357354	SO:0001587	stop_gained	57608			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.1729G>T	10.37:g.30317348C>A	ENSP00000364526:p.Glu577*		30357354	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Nonsense_Mutation	SNP	ENST00000375377.1	37	CCDS41500.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	36	5.654942	0.96724	.	.	ENSG00000165757	ENST00000375377	.	.	.	5.62	4.71	0.59529	.	0.159020	0.53938	D	0.000053	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-29.8284	14.685	0.69042	0.0:0.9299:0.0:0.07	.	.	.	.	X	577	.	ENSP00000364526:E577X	E	-	1	0	KIAA1462	30357354	1.000000	0.71417	0.260000	0.24451	0.003000	0.03518	7.115000	0.77110	1.380000	0.46344	-0.291000	0.09656	GAG		0.418	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848		Nonsense_Mutation
KIF5B	3799	genome.wustl.edu	37	10	32329377	32329377	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr10:32329377C>T	ENST00000302418.4	-	3	680	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K		NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	75	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.E75K(1)	KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				TTATATCCTTCAAGTACATCT	0.343			T	"""RET, ALK"""	NSCLC																																		Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	1	Substitution - Missense(1)	ovary(1)	10											159.0	146.0	150.0					10																	32329377		2202	4296	6498	32369383	SO:0001583	missense	3799			X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.223G>A	10.37:g.32329377C>T	ENSP00000307078:p.Glu75Lys		32369383	A0AVB2|Q5VZ85	Missense_Mutation	SNP	ENST00000302418.4	37	CCDS7171.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	13.29	2.192525	0.38707	.	.	ENSG00000170759	ENST00000302418	T	0.73363	-0.74	5.8	5.8	0.92144	Kinesin, motor domain (4);	0.208574	0.49305	D	0.000145	T	0.57784	0.2077	N	0.10664	0.02	0.43936	D	0.996595	B	0.02656	0.0	B	0.10450	0.005	T	0.54077	-0.8347	10	0.13470	T	0.59	.	20.1011	0.97876	0.0:1.0:0.0:0.0	.	75	P33176	KINH_HUMAN	K	75	ENSP00000307078:E75K	ENSP00000307078:E75K	E	-	1	0	KIF5B	32369383	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.766000	0.62279	2.754000	0.94517	0.650000	0.86243	GAA		0.343	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047467.1	NM_004521		Missense_Mutation
RASSF4	83937	genome.wustl.edu	37	10	45467201	45467201	+	Intron	SNP	G	G	A			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr10:45467201G>A	ENST00000340258.5	+	3	175				RASSF4_ENST00000334940.6_Intron|RASSF4_ENST00000374417.2_Intron|C10orf10_ENST00000496638.1_Intron	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4						endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						AGGAGTACATGTGTGTCTTTC	0.542																																																0			10											184.0	151.0	162.0					10																	45467201		2203	4300	6503	44787207	SO:0001627	intron_variant	83937			BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.63-20G>A	10.37:g.45467201G>A			44787207	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	ENST00000340258.5	37	CCDS7208.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	5.466	0.270983	0.10349	.	.	ENSG00000107551	ENST00000374411	.	.	.	5.12	-1.81	0.07882	.	2.760440	0.02035	N	0.048831	T	0.28333	0.0700	.	.	.	0.09310	N	0.999997	B	0.16802	0.019	B	0.12156	0.007	T	0.22034	-1.0228	8	0.51188	T	0.08	2.4718	2.6628	0.05031	0.1739:0.4103:0.2761:0.1396	.	106	Q59FL4	.	M	106	.	ENSP00000363532:V106M	V	+	1	0	RASSF4	44787207	0.008000	0.16893	0.000000	0.03702	0.007000	0.05969	-0.275000	0.08525	0.006000	0.14734	-0.175000	0.13238	GTG		0.542	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047745.2	NM_032023		Missense_Mutation
NHLRC2	374354	genome.wustl.edu	37	10	115668208	115668208	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr10:115668208G>A	ENST00000369301.3	+	11	2306	c.2094G>A	c.(2092-2094)atG>atA	p.M698I		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	698								p.M698I(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		CTTGTATGATGAAGGCAATTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	10											147.0	131.0	136.0					10																	115668208		2203	4300	6503	115658198	SO:0001583	missense	374354			AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.2094G>A	10.37:g.115668208G>A	ENSP00000358307:p.Met698Ile		115658198	Q8N1H1|Q8N5A6	Missense_Mutation	SNP	ENST00000369301.3	37	CCDS7585.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	26.8	4.776129	0.90195	.	.	ENSG00000196865	ENST00000369301	T	0.43294	0.95	5.68	5.68	0.88126	.	0.045134	0.85682	D	0.000000	T	0.47248	0.1435	L	0.34521	1.04	0.58432	D	0.999996	D	0.65815	0.995	P	0.55455	0.776	T	0.15752	-1.0426	10	0.21540	T	0.41	-25.9136	17.9619	0.89087	0.0:0.0:1.0:0.0	.	698	Q8NBF2	NHLC2_HUMAN	I	698	ENSP00000358307:M698I	ENSP00000358307:M698I	M	+	3	0	NHLRC2	115658198	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.993000	0.93524	2.688000	0.91661	0.591000	0.81541	ATG		0.408	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050446.1	NM_198514		Missense_Mutation
C11orf40	143501	genome.wustl.edu	37	11	4594688	4594688	+	Silent	SNP	A	A	G			TCGA-24-1464-01	TCGA-24-1464-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr11:4594688A>G	ENST00000307616.1	-	2	155	c.156T>C	c.(154-156)aaT>aaC	p.N52N		NM_144663.1	NP_653264.1	Q8WZ69	CK040_HUMAN	chromosome 11 open reading frame 40	52								p.N52N(1)		large_intestine(3)|lung(1)|ovary(2)|stomach(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;4.28e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		TTATAAGGATATTTTTGGATG	0.423																																																1	Substitution - coding silent(1)	ovary(1)	11											100.0	96.0	97.0					11																	4594688		2201	4298	6499	4551264	SO:0001819	synonymous_variant	143501				CCDS31354.1	11p15.5	2005-10-03			ENSG00000171987	ENSG00000171987			23986	protein-coding gene	gene with protein product							Standard	NM_144663		Approved	NOV1	uc010qyg.2	Q8WZ69	OTTHUMG00000165345	ENST00000307616.1:c.156T>C	11.37:g.4594688A>G			4551264		Silent	SNP	ENST00000307616.1	37	CCDS31354.1	SNP	16	WashU																																																																																				0.423	C11orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383529.1	NM_144663		Silent
OR4C16	219428	genome.wustl.edu	37	11	55339859	55339859	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-1464-01	TCGA-24-1464-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr11:55339859A>T	ENST00000314634.3	+	1	256	c.256A>T	c.(256-258)Aag>Tag	p.K86*		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K86*(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				TGCCCTTTTGAAGAAGACAAC	0.433																																																1	Substitution - Nonsense(1)	ovary(1)	11											262.0	245.0	251.0					11																	55339859		2201	4296	6497	55096435	SO:0001587	stop_gained	219428			AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.256A>T	11.37:g.55339859A>T	ENSP00000324913:p.Lys86*		55096435	Q6IEV8	Nonsense_Mutation	SNP	ENST00000314634.3	37	CCDS31502.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	6.319	0.427032	0.11987	.	.	ENSG00000181935	ENST00000314634	.	.	.	4.98	-0.543	0.11851	.	0.573496	0.17835	N	0.160387	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	4.8008	0.13296	0.4874:0.0:0.369:0.1436	.	.	.	.	X	86	.	ENSP00000324913:K86X	K	+	1	0	OR4C16	55096435	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.282000	0.08445	0.015000	0.14971	0.448000	0.29417	AAG		0.433	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701		Nonsense_Mutation
OR10Q1	219960	genome.wustl.edu	37	11	57995922	57995922	+	Silent	SNP	G	G	A			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr11:57995922G>A	ENST00000316770.2	-	1	468	c.426C>T	c.(424-426)cgC>cgT	p.R142R		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R142R(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				TGCACAGCTCGCGGGTCATGA	0.632																																																1	Substitution - coding silent(1)	ovary(1)	11											61.0	53.0	56.0					11																	57995922		2201	4295	6496	57752498	SO:0001819	synonymous_variant	219960			AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.426C>T	11.37:g.57995922G>A			57752498	Q6IFG4	Silent	SNP	ENST00000316770.2	37	CCDS31547.1	SNP	38	WashU																																																																																				0.632	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394706.1	NM_001004471		Silent
FERMT3	83706	genome.wustl.edu	37	11	63988554	63988554	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr11:63988554C>T	ENST00000279227.5	+	13	1719	c.1624C>T	c.(1624-1626)Cgc>Tgc	p.R542C	FERMT3_ENST00000345728.5_Missense_Mutation_p.R538C	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	542	FERM.				integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)	p.R538C(1)|p.R542C(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						GGCCCAGCTGCGCTTCATCCA	0.662																																																2	Substitution - Missense(2)	ovary(2)	11											100.0	86.0	91.0					11																	63988554		2201	4297	6498	63745130	SO:0001583	missense	83706			L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.1624C>T	11.37:g.63988554C>T	ENSP00000279227:p.Arg542Cys		63745130	Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	ENST00000279227.5	37	CCDS8060.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	19.39	3.819062	0.71028	.	.	ENSG00000149781	ENST00000345728;ENST00000279227	T;T	0.79454	-1.27;-1.27	4.29	4.29	0.51040	Band 4.1 domain (1);FERM central domain (2);	0.068219	0.56097	D	0.000029	D	0.82944	0.5147	L	0.52905	1.665	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	P;D	0.65773	0.855;0.938	D	0.83431	0.0038	10	0.54805	T	0.06	-26.3612	11.8234	0.52252	0.176:0.824:0.0:0.0	.	538;542	Q86UX7-2;Q86UX7	.;URP2_HUMAN	C	538;542	ENSP00000339950:R538C;ENSP00000279227:R542C	ENSP00000279227:R542C	R	+	1	0	FERMT3	63745130	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.471000	0.35365	2.386000	0.81285	0.462000	0.41574	CGC		0.662	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1	NM_031471		Missense_Mutation
MAML2	84441	genome.wustl.edu	37	11	95825655	95825655	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1464-01	TCGA-24-1464-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr11:95825655T>C	ENST00000524717.1	-	2	2824	c.1540A>G	c.(1540-1542)Atg>Gtg	p.M514V		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	514					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.M514V(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				GCCTTGTACATGTAGTTAGCC	0.577			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	1	Substitution - Missense(1)	ovary(1)	11											38.0	41.0	40.0					11																	95825655		1948	4136	6084	95465303	SO:0001583	missense	84441			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1540A>G	11.37:g.95825655T>C	ENSP00000434552:p.Met514Val		95465303	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation	SNP	ENST00000524717.1	37	CCDS44714.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	4.097	0.016108	0.07959	.	.	ENSG00000184384	ENST00000524717;ENST00000440572	T;T	0.60299	0.2;0.2	5.5	1.78	0.24846	.	0.525558	0.19954	N	0.102348	T	0.31918	0.0812	N	0.12182	0.205	0.21553	N	0.999649	B	0.02656	0.0	B	0.01281	0.0	T	0.15037	-1.0451	10	0.19590	T	0.45	-2.9423	6.1144	0.20117	0.0:0.1523:0.4025:0.4453	.	514	Q8IZL2	MAML2_HUMAN	V	514	ENSP00000434552:M514V;ENSP00000412394:M514V	ENSP00000412394:M514V	M	-	1	0	MAML2	95465303	1.000000	0.71417	0.991000	0.47740	0.392000	0.30506	0.887000	0.28254	0.042000	0.15717	0.454000	0.30748	ATG		0.577	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1			Missense_Mutation
CNTN5	53942	genome.wustl.edu	37	11	100061892	100061892	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr11:100061892C>G	ENST00000524871.1	+	14	1905	c.1615C>G	c.(1615-1617)Cta>Gta	p.L539V	CNTN5_ENST00000418526.2_Missense_Mutation_p.L465V|CNTN5_ENST00000527185.1_Missense_Mutation_p.L539V|CNTN5_ENST00000528682.1_Missense_Mutation_p.L539V|CNTN5_ENST00000279463.3_Missense_Mutation_p.L539V	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	539	Ig-like C2-type 5.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.L539V(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TCTACGGATCCTAAATGCTTC	0.373																																																1	Substitution - Missense(1)	ovary(1)	11											69.0	69.0	69.0					11																	100061892		1823	4077	5900	99567102	SO:0001583	missense	53942			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1615C>G	11.37:g.100061892C>G	ENSP00000435637:p.Leu539Val		99567102	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	7.191	0.591610	0.13812	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26	5.52	3.66	0.41972	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.125920	0.56097	D	0.000038	T	0.49490	0.1560	N	0.21282	0.65	0.38377	D	0.945032	B;B;B	0.23854	0.034;0.075;0.092	B;B;B	0.28916	0.017;0.01;0.096	T	0.38023	-0.9680	10	0.18276	T	0.48	.	9.1724	0.37091	0.0:0.7772:0.0:0.2228	.	539;465;539	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	V	539;539;539;465;539	ENSP00000433575:L539V;ENSP00000436185:L539V;ENSP00000435637:L539V;ENSP00000393229:L465V;ENSP00000279463:L539V	ENSP00000279463:L539V	L	+	1	2	CNTN5	99567102	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	0.512000	0.22755	0.823000	0.34589	0.650000	0.86243	CTA		0.373	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		Missense_Mutation
WBP11	51729	genome.wustl.edu	37	12	14946790	14946790	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1464-01	TCGA-24-1464-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr12:14946790T>C	ENST00000261167.2	-	8	1021	c.788A>G	c.(787-789)gAt>gGt	p.D263G		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	263	Asp-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)	p.D263G(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						CTTATCTTGATCCATGTCCTC	0.458																																																1	Substitution - Missense(1)	ovary(1)	12											254.0	210.0	225.0					12																	14946790		2203	4300	6503	14838057	SO:0001583	missense	51729			AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.788A>G	12.37:g.14946790T>C	ENSP00000261167:p.Asp263Gly		14838057	Q96AY8	Missense_Mutation	SNP	ENST00000261167.2	37	CCDS8666.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	10.84	1.464727	0.26335	.	.	ENSG00000084463	ENST00000261167;ENST00000537574	D	0.90069	-2.61	5.38	5.38	0.77491	.	0.106321	0.64402	D	0.000006	T	0.81069	0.4746	N	0.17082	0.46	0.41950	D	0.990659	B	0.02656	0.0	B	0.04013	0.001	T	0.77316	-0.2633	10	0.52906	T	0.07	-9.5792	13.332	0.60492	0.0:0.0:0.0:1.0	.	263	Q9Y2W2	WBP11_HUMAN	G	263	ENSP00000442868:D263G	ENSP00000261167:D263G	D	-	2	0	WBP11	14838057	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.212000	0.65225	2.051000	0.60960	0.533000	0.62120	GAT		0.458	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400850.1	NM_016312		Missense_Mutation
HOXC4	3221	genome.wustl.edu	37	12	54447926	54447926	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr12:54447926G>C	ENST00000430889.2	+	1	266	c.220G>C	c.(220-222)Ggg>Cgg	p.G74R	HOXC4_ENST00000303406.4_Missense_Mutation_p.G74R|HOXC4_ENST00000609810.1_Missense_Mutation_p.G74R	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	74					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G74R(1)		cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						CAGTCTCCAGGGGCCCGGCAA	0.687																																																1	Substitution - Missense(1)	ovary(1)	12											46.0	55.0	52.0					12																	54447926		2203	4300	6503	52734193	SO:0001583	missense	3221				CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.220G>C	12.37:g.54447926G>C	ENSP00000399808:p.Gly74Arg		52734193		Missense_Mutation	SNP	ENST00000430889.2	37	CCDS8873.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014101	0.35511	.	.	ENSG00000198353	ENST00000303406;ENST00000430889	D;D	0.81821	-1.54;-1.54	3.95	3.95	0.45737	.	0.131624	0.49916	D	0.000131	T	0.74635	0.3742	L	0.50333	1.59	0.37164	D	0.902748	B	0.14438	0.01	B	0.10450	0.005	T	0.72918	-0.4146	10	0.20519	T	0.43	.	15.2809	0.73784	0.0:0.0:1.0:0.0	.	74	P09017	HXC4_HUMAN	R	74	ENSP00000305973:G74R;ENSP00000399808:G74R	ENSP00000305973:G74R	G	+	1	0	HOXC4	52734193	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.912000	0.69948	2.187000	0.69744	0.462000	0.41574	GGG		0.687	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1			Missense_Mutation
TMTC2	160335	genome.wustl.edu	37	12	83081385	83081385	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr12:83081385G>T	ENST00000321196.3	+	1	727	c.20G>T	c.(19-21)aGc>aTc	p.S7I	TMTC2_ENST00000548305.1_Missense_Mutation_p.S7I	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	7					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.S7I(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						GAGTTGGTGAGCAGCGCTCTG	0.612											OREG0022010	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	12											93.0	76.0	82.0					12																	83081385		2203	4297	6500	81605516	SO:0001583	missense	160335			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.20G>T	12.37:g.83081385G>T	ENSP00000322300:p.Ser7Ile	1218	81605516	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	15.20	2.762115	0.49468	.	.	ENSG00000179104	ENST00000321196;ENST00000548305	T;T	0.58940	0.96;0.3	4.85	4.85	0.62838	.	0.185701	0.38326	N	0.001738	T	0.30039	0.0752	N	0.03983	-0.305	0.80722	D	1	B;B	0.33694	0.421;0.013	B;B	0.29267	0.1;0.015	T	0.36768	-0.9734	10	0.05721	T	0.95	-4.5647	16.8876	0.86079	0.0:0.0:1.0:0.0	.	7;7	Q8N394;F8VSH2	TMTC2_HUMAN;.	I	7	ENSP00000322300:S7I;ENSP00000448292:S7I	ENSP00000322300:S7I	S	+	2	0	TMTC2	81605516	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.807000	0.86032	2.536000	0.85505	0.462000	0.41574	AGC		0.612	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588		Missense_Mutation
GCN1L1	10985	genome.wustl.edu	37	12	120595680	120595680	+	Silent	SNP	G	G	A			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr12:120595680G>A	ENST00000300648.6	-	26	3072	c.3060C>T	c.(3058-3060)ccC>ccT	p.P1020P	MIR4498_ENST00000577599.1_RNA	NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1020					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)	p.P1020P(1)		NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTGGGGTGTTGGGGGAGGCCC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	12											37.0	43.0	41.0					12																	120595680		1939	4123	6062	119080063	SO:0001819	synonymous_variant	10985			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.3060C>T	12.37:g.120595680G>A			119080063	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	ENST00000300648.6	37	CCDS41847.1	SNP	47	WashU																																																																																				0.617	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1			Silent
PDS5B	23047	genome.wustl.edu	37	13	33330035	33330035	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr13:33330035G>T	ENST00000315596.10	+	26	3183	c.2997G>T	c.(2995-2997)ttG>ttT	p.L999F		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	999					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.L999F(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TTCACCTTTTGGCACATGACC	0.289																																																1	Substitution - Missense(1)	ovary(1)	13											128.0	118.0	121.0					13																	33330035		1816	4067	5883	32228035	SO:0001583	missense	23047			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.2997G>T	13.37:g.33330035G>T	ENSP00000313851:p.Leu999Phe		32228035	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	37	CCDS41878.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706692	0.68615	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	T	0.73897	-0.79	5.65	3.82	0.43975	Armadillo-type fold (1);	0.066425	0.64402	D	0.000014	T	0.81828	0.4905	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81731	-0.0799	10	0.87932	D	0	-11.6203	5.3408	0.15982	0.1608:0.0:0.5642:0.275	.	999	Q9NTI5	PDS5B_HUMAN	F	999	ENSP00000313851:L999F	ENSP00000313851:L999F	L	+	3	2	PDS5B	32228035	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.547000	0.45786	1.389000	0.46526	0.491000	0.48974	TTG		0.289	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032		Missense_Mutation
GAN	8139	genome.wustl.edu	37	16	81385238	81385238	+	Missense_Mutation	SNP	T	T	C	rs377294873		TCGA-24-1464-01	TCGA-24-1464-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr16:81385238T>C	ENST00000568107.2	+	2	380	c.218T>C	c.(217-219)aTt>aCt	p.I73T		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	73	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.I73T(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				ACTTATAAGATTGAACTTGAA	0.348																																					GBM(106;1239 1507 7582 9741 33976)											1	Substitution - Missense(1)	ovary(1)	16						T	THR/ILE	0,4404		0,0,2202	121.0	113.0	116.0		218	5.9	1.0	16		116	2,8598	2.2+/-6.3	0,2,4298	no	missense	GAN	NM_022041.3	89	0,2,6500	CC,CT,TT		0.0233,0.0,0.0154	probably-damaging	73/598	81385238	2,13002	2202	4300	6502	79942739	SO:0001583	missense	8139			AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.218T>C	16.37:g.81385238T>C	ENSP00000476795:p.Ile73Thr		79942739		Missense_Mutation	SNP	ENST00000568107.2	37	CCDS10935.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	22.9	4.351618	0.82132	0.0	2.33E-4	ENSG00000127688	ENST00000248272	T	0.72167	-0.63	5.88	5.88	0.94601	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.85013	0.5600	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.87015	0.2125	10	0.87932	D	0	.	16.3009	0.82811	0.0:0.0:0.0:1.0	.	73	Q9H2C0	GAN_HUMAN	T	73	ENSP00000248272:I73T	ENSP00000248272:I73T	I	+	2	0	GAN	79942739	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.246000	0.74042	0.533000	0.62120	ATT		0.348	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3			Missense_Mutation
HSD17B2	3294	genome.wustl.edu	37	16	82131895	82131895	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1464-01	TCGA-24-1464-10	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr16:82131895C>T	ENST00000199936.4	+	5	1211	c.1018C>T	c.(1018-1020)Cca>Tca	p.P340S	RP11-510J16.5_ENST00000567021.1_RNA	NM_002153.2	NP_002144.1	P37059	DHB2_HUMAN	hydroxysteroid (17-beta) dehydrogenase 2	340					in utero embryonic development (GO:0001701)|placenta development (GO:0001890)|response to retinoic acid (GO:0032526)|steroid biosynthetic process (GO:0006694)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone dehydrogenase (NAD+) activity (GO:0047035)	p.P340S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	10						CTATTACACGCCAGGGAAAGG	0.483																																																1	Substitution - Missense(1)	ovary(1)	16											161.0	141.0	148.0					16																	82131895		2201	4300	6501	80689396	SO:0001583	missense	3294				CCDS10936.1	16q24.1-q24.2	2011-09-14			ENSG00000086696	ENSG00000086696	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5211	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 2"""	109685				7759109, 19027726	Standard	NM_002153		Approved	HSD17, SDR9C2	uc002fgv.3	P37059	OTTHUMG00000137631	ENST00000199936.4:c.1018C>T	16.37:g.82131895C>T	ENSP00000199936:p.Pro340Ser		80689396	B2R7T4	Missense_Mutation	SNP	ENST00000199936.4	37	CCDS10936.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	c	12.98	2.099452	0.37048	.	.	ENSG00000086696	ENST00000199936	T	0.42131	0.98	5.57	3.47	0.39725	NAD(P)-binding domain (1);	0.115666	0.64402	N	0.000017	T	0.44329	0.1288	M	0.69358	2.11	0.23425	N	0.997704	P	0.39964	0.697	B	0.43194	0.411	T	0.38735	-0.9647	10	0.49607	T	0.09	.	10.4238	0.44365	0.0:0.7859:0.1351:0.079	.	340	P37059	DHB2_HUMAN	S	340	ENSP00000199936:P340S	ENSP00000199936:P340S	P	+	1	0	HSD17B2	80689396	0.649000	0.27322	0.068000	0.19968	0.003000	0.03518	1.888000	0.39708	1.460000	0.47911	0.655000	0.94253	CCA		0.483	HSD17B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269057.2	NM_002153		Missense_Mutation
BECN1	8678	genome.wustl.edu	37	17	40962917	40962917	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1464-01	TCGA-24-1464-10	T	T	C	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr17:40962917T>C	ENST00000361523.4	-	12	1346	c.1214A>G	c.(1213-1215)gAc>gGc	p.D405G	BECN1_ENST00000590099.1_Missense_Mutation_p.D405G|BECN1_ENST00000438274.3_3'UTR|CNTD1_ENST00000315066.5_3'UTR	NM_003766.3	NP_003757.1	Q14457	BECN1_HUMAN	beclin 1, autophagy related	405					autophagic vacuole assembly (GO:0000045)|beta-amyloid metabolic process (GO:0050435)|cellular defense response (GO:0006968)|cellular response to aluminum ion (GO:0071275)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokinesis (GO:0000910)|defense response to virus (GO:0051607)|lysosome organization (GO:0007040)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|neuron development (GO:0048666)|positive regulation of macroautophagy (GO:0016239)|regulation of catalytic activity (GO:0050790)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to vitamin E (GO:0033197)|viral process (GO:0016032)	dendrite (GO:0030425)|membrane (GO:0016020)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)		p.D405G(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		GCCTCCTGTGTCTTCAATCTT	0.468																																																1	Substitution - Missense(1)	ovary(1)	17											76.0	69.0	72.0					17																	40962917		2203	4300	6503	38216443	SO:0001583	missense	8678			AF077301	CCDS11441.1	17q21	2014-02-12	2008-01-14		ENSG00000126581	ENSG00000126581			1034	protein-coding gene	gene with protein product	"""ATG6 autophagy related 6 homolog (S. cerevisiae)"""	604378	"""beclin 1 (coiled-coil, moesin-like BCL2 interacting protein)"""			9765397	Standard	NM_003766		Approved	ATG6, VPS30	uc002ibn.2	Q14457		ENST00000361523.4:c.1214A>G	17.37:g.40962917T>C	ENSP00000355231:p.Asp405Gly		38216443	B2R6N7|O75595|Q9UNA8	Missense_Mutation	SNP	ENST00000361523.4	37	CCDS11441.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	19.94	3.920374	0.73098	.	.	ENSG00000126581	ENST00000361523;ENST00000543382	T	0.44881	0.91	5.88	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.60741	0.2292	M	0.66378	2.025	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60687	-0.7214	10	0.48119	T	0.1	.	11.9132	0.52751	0.0:0.0678:0.0:0.9322	.	405	Q14457	BECN1_HUMAN	G	405;318	ENSP00000355231:D405G	ENSP00000355231:D405G	D	-	2	0	BECN1	38216443	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.008000	0.88588	1.052000	0.40392	0.533000	0.62120	GAC		0.468	BECN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452405.1	NM_003766		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7577565	7577565	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1464-01	TCGA-24-1464-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr17:7577565T>C	ENST00000269305.4	-	7	905	c.716A>G	c.(715-717)aAc>aGc	p.N239S	TP53_ENST00000413465.2_Missense_Mutation_p.N239S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.N239S|TP53_ENST00000420246.2_Missense_Mutation_p.N239S|TP53_ENST00000445888.2_Missense_Mutation_p.N239S|TP53_ENST00000359597.4_Missense_Mutation_p.N239S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	239	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> D (in sporadic cancers; somatic mutation).|N -> H (in a sporadic cancer; somatic mutation).|N -> I (in a sporadic cancer; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.N239S(28)|p.0?(8)|p.?(5)|p.N239T(4)|p.M237_N239delMCN(4)|p.N146S(3)|p.N239_C242delNSSC(3)|p.N239fs*25(2)|p.N239_S240delNS(2)|p.Y236_M243delYMCNSSCM(1)|p.N239fs*1(1)|p.N239_S240insN(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.M144_N146delMCN(1)|p.C238fs*21(1)|p.N239I(1)|p.H233fs*6(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.N239fs*>48(1)|p.N146fs*>10(1)|p.N239_C242del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGAACTGTTACACATGTA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	76	Substitution - Missense(36)|Deletion - In frame(14)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Insertion - Frameshift(4)|Substitution - Nonsense(1)|Insertion - In frame(1)|Complex - frameshift(1)|Complex - deletion inframe(1)	biliary_tract(10)|urinary_tract(6)|lung(6)|ovary(6)|upper_aerodigestive_tract(5)|haematopoietic_and_lymphoid_tissue(5)|oesophagus(5)|breast(5)|bone(5)|central_nervous_system(4)|large_intestine(4)|endometrium(4)|kidney(4)|stomach(3)|thyroid(1)|soft_tissue(1)|liver(1)|pancreas(1)	17											135.0	105.0	115.0					17																	7577565		2203	4300	6503	7518290	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.716A>G	17.37:g.7577565T>C	ENSP00000269305:p.Asn239Ser		7518290	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	24.7	4.565663	0.86439	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99760	-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99736	0.9896	M	0.87381	2.88	0.58432	D	0.999991	D;B;D;D;D;D	0.89917	0.988;0.31;0.999;0.98;0.99;1.0	P;B;D;P;P;D	0.87578	0.826;0.104;0.981;0.815;0.891;0.998	D	0.97237	0.9888	10	0.87932	D	0	-35.9081	12.3101	0.54924	0.0:0.0:0.0:1.0	.	239;239;146;239;239;239	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	239;239;239;239;239;239;228;146;107;146	ENSP00000410739:N239S;ENSP00000352610:N239S;ENSP00000269305:N239S;ENSP00000398846:N239S;ENSP00000391127:N239S;ENSP00000391478:N239S;ENSP00000425104:N107S;ENSP00000423862:N146S	ENSP00000269305:N239S	N	-	2	0	TP53	7518290	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.770000	0.85390	2.074000	0.62210	0.379000	0.24179	AAC		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
BCAS3	54828	genome.wustl.edu	37	17	59161887	59161887	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1464-01	TCGA-24-1464-10	A	A	T	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr17:59161887A>T	ENST00000390652.5	+	23	2463	c.2432A>T	c.(2431-2433)gAt>gTt	p.D811V	BCAS3_ENST00000589222.1_Missense_Mutation_p.D796V|BCAS3_ENST00000585744.1_Missense_Mutation_p.D582V|BCAS3_ENST00000407086.3_Missense_Mutation_p.D796V|BCAS3_ENST00000588874.1_Missense_Mutation_p.D567V|BCAS3_ENST00000408905.3_Missense_Mutation_p.D796V|BCAS3_ENST00000588462.1_Missense_Mutation_p.D811V	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3									p.D811V(1)		NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			CCAGTCTCTGATCGAAGGGGA	0.458																																																1	Substitution - Missense(1)	ovary(1)	17											67.0	69.0	69.0					17																	59161887		1957	4163	6120	56516669	SO:0001583	missense	54828			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.2432A>T	17.37:g.59161887A>T	ENSP00000375067:p.Asp811Val		56516669		Missense_Mutation	SNP	ENST00000390652.5	37	CCDS45749.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	16.23	3.064672	0.55432	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000408905	T;T;T	0.32753	1.46;1.45;1.44	5.92	5.92	0.95590	.	0.047612	0.85682	D	0.000000	T	0.35653	0.0939	N	0.24115	0.695	0.80722	D	1	B;B;D;P;D	0.55385	0.004;0.004;0.971;0.952;0.971	B;B;P;P;P	0.55455	0.005;0.002;0.776;0.601;0.776	T	0.05699	-1.0869	10	0.32370	T	0.25	.	16.3631	0.83280	1.0:0.0:0.0:0.0	.	796;811;796;811;796	Q9H6U6-3;Q9H6U6-8;Q9H6U6-7;Q9H6U6;Q9H6U6-2	.;.;.;BCAS3_HUMAN;.	V	811;796;796	ENSP00000375067:D811V;ENSP00000385323:D796V;ENSP00000386173:D796V	ENSP00000375067:D811V	D	+	2	0	BCAS3	56516669	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.691000	0.91279	2.266000	0.75297	0.533000	0.62120	GAT		0.458	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449578.1	NM_017679		Missense_Mutation
THOP1	7064	genome.wustl.edu	37	19	2794857	2794857	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr19:2794857G>A	ENST00000307741.6	+	3	528	c.325G>A	c.(325-327)Gac>Aac	p.D109N	THOP1_ENST00000586677.1_5'Flank	NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	109					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)	p.D109N(1)		NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTGAGTTCGACGTGGAGAT	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											134.0	114.0	120.0					19																	2794857		2203	4300	6503	2745857	SO:0001583	missense	7064				CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.325G>A	19.37:g.2794857G>A	ENSP00000304467:p.Asp109Asn		2745857	B3KSE2|Q9UCB3	Missense_Mutation	SNP	ENST00000307741.6	37	CCDS12095.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	18.29	3.591562	0.66219	.	.	ENSG00000172009	ENST00000307741	T	0.07688	3.17	5.25	5.25	0.73442	Neurolysin/Thimet oligopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.08492	0.0211	L	0.46157	1.445	0.80722	D	1	P	0.42584	0.784	B	0.29353	0.101	T	0.14811	-1.0459	10	0.46703	T	0.11	-59.3907	17.405	0.87471	0.0:0.0:1.0:0.0	.	109	P52888	THOP1_HUMAN	N	109	ENSP00000304467:D109N	ENSP00000304467:D109N	D	+	1	0	THOP1	2745857	1.000000	0.71417	0.971000	0.41717	0.774000	0.43823	9.003000	0.93577	2.451000	0.82905	0.561000	0.74099	GAC		0.567	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451587.2			Missense_Mutation
RPL36AP51	649299	genome.wustl.edu	37	19	21416235	21416235	+	IGR	SNP	G	G	C			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr19:21416235G>C								ZNF431 (43201 upstream) : ZNF708 (57726 downstream)																							AGGATTCTCTGTATGCCCAGG	0.453																																																0			19																																								21208075	SO:0001628	intergenic_variant	649299																															19.37:g.21416235G>C			21208075		Silent	SNP		37		SNP	48	WashU																																																																																			0	0.453									Silent
C19orf48	84798	genome.wustl.edu	37	19	51301634	51301634	+	Silent	SNP	C	C	T			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr19:51301634C>T	ENST00000598463.1	-	5	1170	c.72G>A	c.(70-72)ggG>ggA	p.G24G	C19orf48_ENST00000595794.1_5'Flank|C19orf48_ENST00000596655.1_Silent_p.G24G|SNORD88B_ENST00000408454.1_RNA|C19orf48_ENST00000391812.1_Silent_p.G24G|SNORD88A_ENST00000408314.1_RNA|C19orf48_ENST00000345523.4_Silent_p.G24G			Q6RUI8	CS048_HUMAN	chromosome 19 open reading frame 48	24								p.G24G(1)		endometrium(1)|kidney(1)|lung(1)|ovary(1)	4		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00531)|GBM - Glioblastoma multiforme(134;0.0145)		GCCTGGCGGGCCCTGGCACCA	0.617																																																1	Substitution - coding silent(1)	ovary(1)	19											89.0	87.0	88.0					19																	51301634		2203	4300	6503	55993446	SO:0001819	synonymous_variant	84798			BC037227	CCDS12803.1	19q13.33	2012-10-26			ENSG00000167747	ENSG00000167747			29667	protein-coding gene	gene with protein product	"""multidrug resistance-related protein"""					12452007	Standard	NM_001290154		Approved	MGC13170	uc002ptg.3	Q6RUI8		ENST00000598463.1:c.72G>A	19.37:g.51301634C>T			55993446		Silent	SNP	ENST00000598463.1	37	CCDS12803.1	SNP	26	WashU																																																																																				0.617	C19orf48-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464107.1	NM_032712		Silent
FHL2	2274	genome.wustl.edu	37	2	105990124	105990124	+	Silent	SNP	G	G	A			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr2:105990124G>A	ENST00000409807.1	-	3	557	c.223C>T	c.(223-225)Ctg>Ttg	p.L75L	FHL2_ENST00000336660.5_Intron|FHL2_ENST00000408995.1_Silent_p.L75L|AC012360.6_ENST00000415627.1_RNA|AC012360.6_ENST00000457290.2_RNA|FHL2_ENST00000393353.3_Silent_p.L75L|FHL2_ENST00000322142.8_Silent_p.L75L|FHL2_ENST00000409177.1_Silent_p.L191L|FHL2_ENST00000344213.4_Silent_p.L185L|FHL2_ENST00000358129.4_Silent_p.L75L|FHL2_ENST00000393352.3_Silent_p.L75L			Q14192	FHL2_HUMAN	four and a half LIM domains 2	75	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				androgen receptor signaling pathway (GO:0030521)|atrial cardiac muscle cell development (GO:0055014)|cellular lipid metabolic process (GO:0044255)|heart trabecula formation (GO:0060347)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle cell development (GO:0055015)	actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|M band (GO:0031430)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Z disc (GO:0030018)	androgen receptor binding (GO:0050681)|identical protein binding (GO:0042802)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.L75L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9						TTGTCCACCAGTGAGTTTCTG	0.542																																																1	Substitution - coding silent(1)	ovary(1)	2											165.0	132.0	143.0					2																	105990124		2203	4300	6503	105356556	SO:0001819	synonymous_variant	2274				CCDS2070.1	2q12.2	2014-09-17			ENSG00000115641	ENSG00000115641			3703	protein-coding gene	gene with protein product		602633				8753811	Standard	NM_201557		Approved	SLIM3, DRAL	uc002tcy.3	Q14192	OTTHUMG00000153120	ENST00000409807.1:c.223C>T	2.37:g.105990124G>A			105356556	Q13229|Q13644|Q2I5I4|Q5TM15|Q9P294	Silent	SNP	ENST00000409807.1	37	CCDS2070.1	SNP	36	WashU																																																																																				0.542	FHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329654.1			Silent
NEB	4703	genome.wustl.edu	37	2	152409234	152409234	+	Silent	SNP	A	A	G			TCGA-24-1464-01	TCGA-24-1464-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr2:152409234A>G	ENST00000172853.10	-	100	14832	c.14685T>C	c.(14683-14685)gaT>gaC	p.D4895D	NEB_ENST00000604864.1_Silent_p.D6596D|NEB_ENST00000409198.1_Silent_p.D4895D|NEB_ENST00000397345.3_Silent_p.D6596D|NEB_ENST00000603639.1_Silent_p.D6596D|NEB_ENST00000427231.2_Silent_p.D6596D			P20929	NEBU_HUMAN	nebulin	4895					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.D4895D(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGACTGGTGTATCTGTGACAA	0.448																																																1	Substitution - coding silent(1)	ovary(1)	2											205.0	180.0	188.0					2																	152409234		1959	4165	6124	152117480	SO:0001819	synonymous_variant	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.14685T>C	2.37:g.152409234A>G			152117480	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37		SNP	16	WashU																																																																																				0.448	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		Silent
TTN	7273	genome.wustl.edu	37	2	179579191	179579191	+	Silent	SNP	G	G	A			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr2:179579191G>A	ENST00000591111.1	-	89	25583	c.25359C>T	c.(25357-25359)ttC>ttT	p.F8453F	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Silent_p.F7526F|TTN_ENST00000589042.1_Silent_p.F8770F|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12622	Ig-like 67.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.F7526F(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTATCTTTGAACCACACCA	0.408																																																1	Substitution - coding silent(1)	ovary(1)	2											73.0	68.0	69.0					2																	179579191		1860	4088	5948	179287436	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.25359C>T	2.37:g.179579191G>A			179287436	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37		SNP	45	WashU																																																																																				0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Silent
CCDC141	285025	genome.wustl.edu	37	2	179718332	179718332	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1464-01	TCGA-24-1464-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr2:179718332T>A	ENST00000420890.2	-	20	3197	c.3080A>T	c.(3079-3081)gAt>gTt	p.D1027V	CCDC141_ENST00000295723.5_Missense_Mutation_p.D452V	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1027								p.D452V(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			GGCACTTGCATCTTCGTACCA	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											91.0	91.0	91.0					2																	179718332		2203	4300	6503	179426577	SO:0001583	missense	285025			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3080A>T	2.37:g.179718332T>A	ENSP00000395995:p.Asp1027Val		179426577	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37		SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	22.7	4.328751	0.81690	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.37411	1.2;1.2;1.2	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000014	T	0.50154	0.1599	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	T	0.49744	-0.8907	10	0.59425	D	0.04	-16.5772	16.6407	0.85098	0.0:0.0:0.0:1.0	.	452	Q6ZP82	CC141_HUMAN	V	1027;471;452	ENSP00000395995:D1027V;ENSP00000344627:D471V;ENSP00000295723:D452V	ENSP00000295723:D452V	D	-	2	0	CCDC141	179426577	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.850000	0.75420	2.326000	0.78906	0.533000	0.62120	GAT		0.348	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648		Missense_Mutation
MSH6	2956	genome.wustl.edu	37	2	48028254	48028254	+	Nonsense_Mutation	SNP	C	C	G			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr2:48028254C>G	ENST00000234420.5	+	4	3284	c.3132C>G	c.(3130-3132)taC>taG	p.Y1044*	MSH6_ENST00000538136.1_Nonsense_Mutation_p.Y742*|MSH6_ENST00000540021.1_Nonsense_Mutation_p.Y914*|FBXO11_ENST00000405808.1_Intron	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	1044					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)|p.Y1044*(1)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			ATAAAAATTACAAGGACTGGC	0.418			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	3	Whole gene deletion(2)|Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(2)|ovary(1)	2											66.0	67.0	67.0					2																	48028254		2203	4298	6501	47881758	SO:0001587	stop_gained	2956	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.3132C>G	2.37:g.48028254C>G	ENSP00000234420:p.Tyr1044*		47881758	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Nonsense_Mutation	SNP	ENST00000234420.5	37	CCDS1836.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	44	11.208920	0.99531	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000543270;ENST00000540021;ENST00000538136	.	.	.	5.08	2.26	0.28386	.	0.186574	0.48286	D	0.000181	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5792	10.1943	0.43045	0.0:0.781:0.0:0.219	.	.	.	.	X	1044;1042;12;914;742	.	ENSP00000234420:Y1044X	Y	+	3	2	MSH6	47881758	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.604000	0.46274	0.729000	0.32403	0.462000	0.41574	TAC		0.418	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179		Nonsense_Mutation
TUBA4A	7277	genome.wustl.edu	37	2	220116426	220116426	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr2:220116426C>T	ENST00000248437.4	-	3	409	c.236G>A	c.(235-237)cGa>cAa	p.R79Q	TUBA4A_ENST00000392088.2_Missense_Mutation_p.R64Q|TUBA4B_ENST00000490341.1_RNA|TUBA4A_ENST00000498660.1_5'UTR	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a	79					'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R79Q(2)|p.R64Q(2)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	TGGGCCATTTCGGATCTCATC	0.547																																																4	Substitution - Missense(4)	ovary(2)|large_intestine(2)	2											81.0	74.0	76.0					2																	220116426		2203	4300	6503	219824670	SO:0001583	missense	7277			AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.236G>A	2.37:g.220116426C>T	ENSP00000248437:p.Arg79Gln		219824670	A8MUB1|B3KNQ6|P05215	Missense_Mutation	SNP	ENST00000248437.4	37	CCDS2438.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349294	0.61183	.	.	ENSG00000127824	ENST00000248437;ENST00000392088;ENST00000427737;ENST00000456818;ENST00000447205;ENST00000425551	T;T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	5.06	5.06	0.68205	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.64402	D	0.000002	T	0.72574	0.3477	M	0.88310	2.945	0.80722	D	1	B	0.34181	0.44	B	0.29267	0.1	T	0.78550	-0.2161	10	0.87932	D	0	.	18.6248	0.91333	0.0:1.0:0.0:0.0	.	79	P68366	TBA4A_HUMAN	Q	79;64;64;102;64;81	ENSP00000248437:R79Q;ENSP00000375938:R64Q;ENSP00000408194:R64Q;ENSP00000416992:R102Q;ENSP00000396061:R64Q;ENSP00000404740:R81Q	ENSP00000248437:R79Q	R	-	2	0	TUBA4A	219824670	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.564000	0.82326	2.639000	0.89480	0.655000	0.94253	CGA		0.547	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256816.3	NM_006000		Missense_Mutation
EPB41L1	2036	genome.wustl.edu	37	20	34761810	34761810	+	Silent	SNP	C	C	T	rs140731421		TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr20:34761810C>T	ENST00000338074.2	+	2	272	c.111C>T	c.(109-111)caC>caT	p.H37H	EPB41L1_ENST00000373950.2_Intron|EPB41L1_ENST00000202028.5_Intron|EPB41L1_ENST00000441639.1_Intron|EPB41L1_ENST00000373941.1_Silent_p.H37H|EPB41L1_ENST00000373946.3_Intron	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	37					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.H37H(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CTGCAGGCCACGGCCACCCAG	0.652													C|||	1	0.000199681	0.0	0.0	5008	,	,		15924	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	20						C	,	2,4404	6.2+/-15.9	0,2,2201	35.0	32.0	33.0		111,	4.8	1.0	20	dbSNP_134	33	20,8580	14.0+/-48.4	0,20,4280	no	coding-synonymous,intron	EPB41L1	NM_012156.2,NM_177996.1	,	0,22,6481	TT,TC,CC		0.2326,0.0454,0.1692	,	37/882,	34761810	22,12984	2203	4300	6503	34225224	SO:0001819	synonymous_variant	2036			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.111C>T	20.37:g.34761810C>T			34225224	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	ENST00000338074.2	37	CCDS13271.1	SNP	19	WashU																																																																																				0.652	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156		Silent
SNX25	83891	genome.wustl.edu	37	4	186267690	186267690	+	Splice_Site	SNP	G	G	A			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr4:186267690G>A	ENST00000504273.1	+	13	1989		c.e13-1		SNX25_ENST00000264694.8_Splice_Site|SNX25_ENST00000512853.1_Splice_Site			Q9H3E2	SNX25_HUMAN	sorting nexin 25						negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.?(1)		NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TCCCCCCACAGTGCGTCCCTT	0.308																																																1	Unknown(1)	ovary(1)	4											48.0	50.0	49.0					4																	186267690		2203	4300	6503	186504684	SO:0001630	splice_region_variant	83891			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.1696-1G>A	4.37:g.186267690G>A			186504684	Q3ZT30|Q8N6K3	Splice_Site_SNP	SNP	ENST00000504273.1	37	CCDS34116.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139445	0.77775	.	.	ENSG00000109762	ENST00000504273;ENST00000264694;ENST00000264693	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6017	0.95566	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SNX25	186504684	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	9.076000	0.94009	2.713000	0.92767	0.655000	0.94253	.		0.308	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953	Intron	Splice_Site_SNP
CAMK4	814	genome.wustl.edu	37	5	110730457	110730457	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1464-01	TCGA-24-1464-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr5:110730457A>G	ENST00000282356.4	+	5	834	c.436A>G	c.(436-438)Aaa>Gaa	p.K146E	CAMK4_ENST00000512453.1_Missense_Mutation_p.K146E	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.K146E(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		AGATGCCGTTAAACAAATCCT	0.398																																																1	Substitution - Missense(1)	ovary(1)	5											135.0	134.0	134.0					5																	110730457		2202	4300	6502	110758356	SO:0001583	missense	814			D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.436A>G	5.37:g.110730457A>G	ENSP00000282356:p.Lys146Glu		110758356	D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	CCDS4103.1	SNP	13	WashU	.	.	.	.	.	.	.	.	.	.	A	25.0	4.587309	0.86851	.	.	ENSG00000152495	ENST00000512453;ENST00000282356	T;T	0.51071	0.72;0.72	5.65	5.65	0.86999	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.63129	0.2485	M	0.68728	2.09	0.53688	D	0.999974	D	0.59767	0.986	P	0.60236	0.871	T	0.63743	-0.6568	9	.	.	.	.	14.8633	0.70397	1.0:0.0:0.0:0.0	.	146	Q16566	KCC4_HUMAN	E	146	ENSP00000422634:K146E;ENSP00000282356:K146E	.	K	+	1	0	CAMK4	110758356	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	7.227000	0.78070	2.165000	0.68154	0.383000	0.25322	AAA		0.398	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744		Missense_Mutation
COMMD10	51397	genome.wustl.edu	37	5	115428328	115428328	+	Silent	SNP	C	C	T			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr5:115428328C>T	ENST00000274458.4	+	4	392	c.330C>T	c.(328-330)gtC>gtT	p.V110V	COMMD10_ENST00000515539.1_Silent_p.V96V	NM_016144.2	NP_057228.1	Q9Y6G5	COMDA_HUMAN	COMM domain containing 10	110								p.V110V(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(2)	9		all_cancers(142;0.0834)|all_epithelial(76;0.00314)|Prostate(80;0.0102)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;4.3e-07)|Epithelial(69;8.06e-07)|all cancers(49;4.06e-05)		AAGCATTTGTCAATACGTGGT	0.383																																																1	Substitution - coding silent(1)	ovary(1)	5											99.0	89.0	93.0					5																	115428328		2202	4300	6502	115456227	SO:0001819	synonymous_variant	51397			AY542165	CCDS34215.1	5q23.1	2008-02-05				ENSG00000145781			30201	protein-coding gene	gene with protein product						15799966	Standard	NM_016144		Approved	PTD002	uc003krt.1	Q9Y6G5		ENST00000274458.4:c.330C>T	5.37:g.115428328C>T			115456227	D3DT07|Q9P077	Silent	SNP	ENST00000274458.4	37	CCDS34215.1	SNP	29	WashU																																																																																				0.383	COMMD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371033.1	NM_016144		Silent
IRX1	79192	genome.wustl.edu	37	5	3599809	3599809	+	Silent	SNP	C	C	T			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr5:3599809C>T	ENST00000302006.3	+	2	799	c.747C>T	c.(745-747)gcC>gcT	p.A249A	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	249					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A249A(1)		biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						AGGACAAGGCCGAGGCTCCGC	0.652																																																1	Substitution - coding silent(1)	ovary(1)	5											44.0	43.0	44.0					5																	3599809		2201	4299	6500	3652809	SO:0001819	synonymous_variant	79192			U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.747C>T	5.37:g.3599809C>T			3652809	Q7Z2F8|Q8N312	Silent	SNP	ENST00000302006.3	37	CCDS34132.1	SNP	23	WashU																																																																																				0.652	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337		Silent
CDX1	1044	genome.wustl.edu	37	5	149562371	149562371	+	Silent	SNP	C	C	T			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr5:149562371C>T	ENST00000231656.8	+	2	568	c.486C>T	c.(484-486)acC>acT	p.T162T		NM_001804.2	NP_001795.2	P47902	CDX1_HUMAN	caudal type homeobox 1	162					anterior/posterior pattern specification (GO:0009952)|bone morphogenesis (GO:0060349)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)	p.T162T(2)		central_nervous_system(1)|kidney(2)|lung(1)|ovary(1)	5		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGTCTACACCGACCACCAAC	0.547																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	5											157.0	159.0	158.0					5																	149562371		2203	4300	6503	149542564	SO:0001819	synonymous_variant	1044			U51095	CCDS4304.1	5q32	2012-03-09	2007-07-09		ENSG00000113722	ENSG00000113722		"""Homeoboxes / ANTP class : HOXL subclass"""	1805	protein-coding gene	gene with protein product		600746	"""caudal type homeo box transcription factor 1"""			8530027	Standard	NM_001804		Approved		uc003lrq.3	P47902	OTTHUMG00000169772	ENST00000231656.8:c.486C>T	5.37:g.149562371C>T			149542564	Q4VAU4|Q9NYK8	Silent	SNP	ENST00000231656.8	37	CCDS4304.1	SNP	23	WashU																																																																																				0.547	CDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252328.7	NM_001804		Silent
VARS2	57176	genome.wustl.edu	37	6	30892146	30892146	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr6:30892146G>A	ENST00000321897.5	+	25	3114	c.2482G>A	c.(2482-2484)Gtg>Atg	p.V828M	VARS2_ENST00000541562.1_Missense_Mutation_p.V858M|VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000542001.1_Missense_Mutation_p.V688M|VARS2_ENST00000416670.2_Missense_Mutation_p.V828M			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	828					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)	p.V828M(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						TGTGAAGCCCGTGCTGTGGCA	0.697																																																1	Substitution - Missense(1)	ovary(1)	6											29.0	37.0	34.0					6																	30892146		1503	2691	4194	31000125	SO:0001583	missense	57176			AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.2482G>A	6.37:g.30892146G>A	ENSP00000316092:p.Val828Met		31000125	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	37	CCDS34387.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	13.14	2.147198	0.37923	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000541562	T;T;T;T	0.12255	2.7;2.7;2.7;2.7	5.47	2.69	0.31865	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (1);Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.879091	0.10016	N	0.726569	T	0.08802	0.0218	L	0.51914	1.62	0.09310	N	1	D;P;P;P	0.53462	0.96;0.842;0.81;0.733	P;B;B;B	0.51833	0.681;0.443;0.316;0.166	T	0.21861	-1.0233	10	0.52906	T	0.07	-0.55	6.0083	0.19559	0.1667:0.3296:0.5037:0.0	.	266;826;858;828	Q5ST30-2;B7ZL25;F5GXJ0;Q5ST30	.;.;.;SYVM_HUMAN	M	828;828;688;858	ENSP00000316092:V828M;ENSP00000394802:V828M;ENSP00000438200:V688M;ENSP00000441000:V858M	ENSP00000316092:V828M	V	+	1	0	VARS2	31000125	0.957000	0.32711	0.001000	0.08648	0.001000	0.01503	1.662000	0.37418	0.261000	0.21753	-0.886000	0.02939	GTG		0.697	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442		Missense_Mutation
MSH5	4439	genome.wustl.edu	37	6	31715210	31715210	+	Splice_Site	SNP	G	G	T			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr6:31715210G>T	ENST00000375755.3	+	10	1098		c.e10+1		MSH5_ENST00000431848.2_Splice_Site|MSH5-SAPCD1_ENST00000493662.2_Splice_Site|MSH5_ENST00000375742.3_Splice_Site|MSH5_ENST00000534153.4_Splice_Site|MSH5_ENST00000375740.3_Splice_Site|MSH5_ENST00000375750.3_Splice_Site|MSH5_ENST00000375703.3_Splice_Site	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5						ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.?(1)		breast(1)|ovary(2)|skin(2)	5						AGCTGCTCAGGTGAGTGGGTC	0.473								Direct reversal of damage;Mismatch excision repair (MMR)																																								1	Unknown(1)	ovary(1)	6											143.0	100.0	115.0					6																	31715210		1511	2709	4220	31823189	SO:0001630	splice_region_variant	4439			AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.812+1G>T	6.37:g.31715210G>T			31823189	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Splice_Site_SNP	SNP	ENST00000375755.3	37	CCDS4720.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668719	0.67814	.	.	ENSG00000204410	ENST00000375755;ENST00000375742;ENST00000375750;ENST00000534153;ENST00000375703;ENST00000375740;ENST00000450148	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7925	0.69854	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MSH5	31823189	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	5.089000	0.64492	2.546000	0.85860	0.643000	0.83706	.		0.473	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076243.4		Intron	Splice_Site_SNP
RIOK1	83732	genome.wustl.edu	37	6	7414604	7414604	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1464-01	TCGA-24-1464-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr6:7414604A>G	ENST00000379834.2	+	16	2084	c.1577A>G	c.(1576-1578)gAc>gGc	p.D526G		NM_031480.2|NM_153005.1	NP_113668.2|NP_694550.1	Q9BRS2	RIOK1_HUMAN	RIO kinase 1	526							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.D519G(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19	Ovarian(93;0.0418)					CACACCACGGACCCTGACATT	0.463																																																1	Substitution - Missense(1)	ovary(1)	6											113.0	117.0	116.0					6																	7414604		2203	4300	6503	7359603	SO:0001583	missense	83732			BC006104	CCDS4500.1	6p24.3	2012-12-10	2012-12-10		ENSG00000124784	ENSG00000124784			18656	protein-coding gene	gene with protein product			"""RIO kinase 1 (yeast)"""				Standard	NM_031480		Approved	AD034, FLJ30006, bA288G3.1, RRP10	uc003mxn.3	Q9BRS2	OTTHUMG00000014207	ENST00000379834.2:c.1577A>G	6.37:g.7414604A>G	ENSP00000369162:p.Asp526Gly		7359603	B2RB28|Q8NDC8|Q96NV9	Missense_Mutation	SNP	ENST00000379834.2	37	CCDS4500.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	8.831	0.939901	0.18281	.	.	ENSG00000124784	ENST00000379834	T	0.06768	3.26	5.58	1.8	0.24995	.	0.529846	0.21524	N	0.073172	T	0.02342	0.0072	L	0.52759	1.655	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43327	-0.9398	10	0.48119	T	0.1	-6.0633	5.3377	0.15967	0.7061:0.0:0.1606:0.1334	.	526	Q9BRS2	RIOK1_HUMAN	G	526	ENSP00000369162:D526G	ENSP00000369162:D526G	D	+	2	0	RIOK1	7359603	0.078000	0.21339	0.000000	0.03702	0.039000	0.13416	1.956000	0.40382	-0.158000	0.11040	-1.450000	0.01041	GAC		0.463	RIOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039780.2	NM_031480		Missense_Mutation
VPS52	6293	genome.wustl.edu	37	6	33231265	33231265	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr6:33231265G>C	ENST00000445902.2	-	17	2008	c.1790C>G	c.(1789-1791)aCa>aGa	p.T597R	VPS52_ENST00000436044.2_Missense_Mutation_p.T472R|VPS52_ENST00000482399.1_3'UTR|VPS52_ENST00000478934.1_5'UTR	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	597					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.T597R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						CCCTACCTGTGTCCGAGCATT	0.522																																																1	Substitution - Missense(1)	ovary(1)	6											132.0	111.0	118.0					6																	33231265		2203	4300	6503	33339243	SO:0001583	missense	6293			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1790C>G	6.37:g.33231265G>C	ENSP00000409952:p.Thr597Arg		33339243	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Missense_Mutation	SNP	ENST00000445902.2	37	CCDS4770.2	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	28.0	4.884157	0.91814	.	.	ENSG00000223501	ENST00000445902;ENST00000418054;ENST00000436044	.	.	.	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.56601	0.1996	L	0.47190	1.495	0.80722	D	1	D;D	0.61697	0.99;0.983	P;P	0.62491	0.903;0.848	T	0.46428	-0.9192	9	0.17369	T	0.5	-12.4932	16.237	0.82381	0.0:0.0:1.0:0.0	.	408;597	B3KMF7;Q8N1B4	.;VPS52_HUMAN	R	597;575;472	.	ENSP00000414785:T575R	T	-	2	0	VPS52	33339243	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.660000	0.83776	2.779000	0.95612	0.573000	0.79308	ACA		0.522	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2	NM_022553		Missense_Mutation
LRRC17	10234	genome.wustl.edu	37	7	102579998	102579998	+	Silent	SNP	C	C	T			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr7:102579998C>T	ENST00000339431.4	+	3	1189	c.894C>T	c.(892-894)aaC>aaT	p.N298N	FBXL13_ENST00000456695.1_Intron|FBXL13_ENST00000393772.2_Intron|FBXL13_ENST00000455112.2_Intron|FBXL13_ENST00000436908.1_Intron|FBXL13_ENST00000379306.3_Intron|LRRC17_ENST00000485478.1_3'UTR|FBXL13_ENST00000379308.3_Intron|FBXL13_ENST00000379305.3_Intron|FBXL13_ENST00000313221.4_Intron|LRRC17_ENST00000249377.4_Silent_p.N298N	NM_001031692.2	NP_001026862.1	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17	298					bone marrow development (GO:0048539)|negative regulation of osteoclast differentiation (GO:0045671)|ossification (GO:0001503)	extracellular space (GO:0005615)		p.N298N(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	17						AGAAATTAAACCTCAGCAGCA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	7											118.0	119.0	118.0					7																	102579998		2203	4300	6503	102367234	SO:0001819	synonymous_variant	10234			U32907	CCDS5727.1, CCDS34721.1	7q22.1	2009-05-26			ENSG00000128606	ENSG00000128606			16895	protein-coding gene	gene with protein product						8982252, 19336404	Standard	NM_005824		Approved	P37NB, H_RG318M05.3	uc003vau.3	Q8N6Y2	OTTHUMG00000157210	ENST00000339431.4:c.894C>T	7.37:g.102579998C>T			102367234	Q13288|Q6UWA7|Q75MG5	Silent	SNP	ENST00000339431.4	37	CCDS34721.1	SNP	18	WashU																																																																																				0.398	LRRC17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347930.1	NM_005824		Silent
ZNF706	51123	genome.wustl.edu	37	8	102213847	102213847	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr8:102213847G>T	ENST00000520347.1	-	2	3079	c.123C>A	c.(121-123)tgC>tgA	p.C41*	ZNF706_ENST00000311212.4_Nonsense_Mutation_p.C41*|ZNF706_ENST00000519744.1_Nonsense_Mutation_p.C41*|ZNF706_ENST00000519882.1_Nonsense_Mutation_p.C41*|ZNF706_ENST00000518336.1_Nonsense_Mutation_p.C41*|ZNF706_ENST00000517844.1_Nonsense_Mutation_p.C41*|ZNF706_ENST00000520984.1_Nonsense_Mutation_p.C41*|ZNF706_ENST00000521272.1_Nonsense_Mutation_p.C41*			Q9Y5V0	ZN706_HUMAN	zinc finger protein 706	41							metal ion binding (GO:0046872)	p.C41*(2)		large_intestine(1)|ovary(2)	3	all_cancers(14;3.3e-07)|all_epithelial(15;3.47e-09)|Lung NSC(17;3.44e-05)|all_lung(17;0.000117)		Epithelial(11;8.57e-11)|all cancers(13;1.43e-08)|OV - Ovarian serous cystadenocarcinoma(57;1.43e-05)			TACAGACAGTGCAGGTATATA	0.408																																																2	Substitution - Nonsense(2)	ovary(2)	8											145.0	135.0	138.0					8																	102213847		2203	4300	6503	102283023	SO:0001587	stop_gained	51123			AF125099	CCDS6291.1	8q22.3	2005-09-22				ENSG00000120963			24992	protein-coding gene	gene with protein product						11042152	Standard	NM_001042510		Approved	HSPC038	uc031tbv.1	Q9Y5V0		ENST00000520347.1:c.123C>A	8.37:g.102213847G>T	ENSP00000430823:p.Cys41*		102283023	A8K362	Nonsense_Mutation	SNP	ENST00000520347.1	37	CCDS6291.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	33	5.258145	0.95368	.	.	ENSG00000120963	ENST00000520984;ENST00000311212;ENST00000519744;ENST00000517844;ENST00000519103;ENST00000520347;ENST00000519882;ENST00000521272;ENST00000518336;ENST00000523922	.	.	.	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.0113	0.53289	0.0796:0.0:0.9204:0.0	.	.	.	.	X	41;41;41;41;13;41;41;41;41;41	.	ENSP00000311768:C41X	C	-	3	2	ZNF706	102283023	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.924000	0.63418	2.446000	0.82766	0.563000	0.77884	TGC		0.408	ZNF706-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380477.1	NM_016096		Nonsense_Mutation
CSMD3	114788	genome.wustl.edu	37	8	113563048	113563048	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr8:113563048C>G	ENST00000297405.5	-	27	4660	c.4416G>C	c.(4414-4416)tgG>tgC	p.W1472C	CSMD3_ENST00000455883.2_Missense_Mutation_p.W1368C|CSMD3_ENST00000343508.3_Missense_Mutation_p.W1432C|CSMD3_ENST00000352409.3_Missense_Mutation_p.W1472C	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1472	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.W1472C(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTGGACCGTCCCAGACTCGGA	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - Missense(1)	ovary(1)	8											75.0	73.0	74.0					8																	113563048		2203	4300	6503	113632224	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4416G>C	8.37:g.113563048C>G	ENSP00000297405:p.Trp1472Cys		113632224	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	19.21	3.782819	0.70222	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23	4.36	4.36	0.52297	CUB (5);	0.000000	0.64402	D	0.000002	T	0.79488	0.4454	M	0.89904	3.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.91635	0.999;0.986;0.951	T	0.80032	-0.1552	10	0.26408	T	0.33	.	17.4138	0.87494	0.0:1.0:0.0:0.0	.	1368;1472;1432	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	C	1432;1472;812;1368;1472	ENSP00000345799:W1432C;ENSP00000297405:W1472C;ENSP00000341558:W812C;ENSP00000412263:W1368C;ENSP00000343124:W1472C	ENSP00000297405:W1472C	W	-	3	0	CSMD3	113632224	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	7.609000	0.82925	2.412000	0.81896	0.591000	0.81541	TGG		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		Missense_Mutation
PHF20L1	51105	genome.wustl.edu	37	8	133816277	133816277	+	Splice_Site	SNP	G	G	T			TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr8:133816277G>T	ENST00000395386.2	+	7	1020	c.721G>T	c.(721-723)Gga>Tga	p.G241*	PHF20L1_ENST00000395379.1_Splice_Site_p.G241*|PHF20L1_ENST00000395390.2_Splice_Site_p.V215L|PHF20L1_ENST00000395376.1_Splice_Site_p.V245L|PHF20L1_ENST00000220847.7_5'UTR|PHF20L1_ENST00000337920.4_Splice_Site_p.G215*	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	241							zinc ion binding (GO:0008270)	p.G215*(2)		breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TGAAACATTTGGTACAAAATA	0.353																																																2	Substitution - Nonsense(2)	ovary(2)	8											81.0	67.0	72.0					8																	133816277		2203	4299	6502	133885459	SO:0001630	splice_region_variant	51105			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.721+1G>T	8.37:g.133816277G>T			133885459	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Nonsense_Mutation	SNP	ENST00000395386.2	37	CCDS6367.2	SNP	47	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.863376|7.863376	0.98531|0.98531	.|.	.|.	ENSG00000129292|ENSG00000129292	ENST00000395383;ENST00000395379;ENST00000395386;ENST00000315808;ENST00000337920;ENST00000395382;ENST00000395374|ENST00000361997;ENST00000395376;ENST00000395390	.|T;T;T	.|0.48836	.|0.89;0.8;1.5	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.000000	.|0.37715	.|U	.|0.001971	.|T	.|0.58163	.|0.2103	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.50363	.|-0.8837	.|7	0.19147|0.27785	T|T	0.46|0.31	.|.	18.2561|18.2561	0.90020|0.90020	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	245;241;241;241;215;111;80|215;245;215	.|ENSP00000355301:V215L;ENSP00000378775:V245L;ENSP00000378788:V215L	ENSP00000324519:G241X|ENSP00000355301:V215L	G|V	+|+	1|1	0|0	PHF20L1|PHF20L1	133885459|133885459	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.159000|7.159000	0.77483|0.77483	2.563000|2.563000	0.86464|0.86464	0.585000|0.585000	0.79938|0.79938	GGA|GTA		0.353	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018	Nonsense_Mutation	Nonsense_Mutation
KCNU1	157855	genome.wustl.edu	37	8	36661448	36661448	+	Intron	SNP	G	G	A	rs117228362	byFrequency	TCGA-24-1464-01	TCGA-24-1464-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr8:36661448G>A	ENST00000399881.3	+	3	352					NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1						multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		atgGCTACACGTACACAGGCA	0.333													G|||	46	0.0091853	0.0008	0.0101	5008	,	,		19350	0.0		0.0189	False		,,,				2504	0.0194															0			8																																								36780606	SO:0001627	intron_variant				BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.316-97G>A	8.37:g.36661448G>A			36780606		Silent	SNP	ENST00000399881.3	37	CCDS55220.1	SNP	40	WashU																																																																																				0.333	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836		Silent
MROH6	642475	genome.wustl.edu	37	8	144654356	144654356	+	Splice_Site	SNP	C	C	G			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr8:144654356C>G	ENST00000398882.3	-	2	551		c.e2-1		RP11-661A12.9_ENST00000531730.1_RNA|NAPRT1_ENST00000460623.1_5'Flank|MROH6_ENST00000533679.1_5'Flank	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6									p.?(1)									TCTGGGGAACCTAGGGCAGGA	0.632																																																1	Unknown(1)	ovary(1)	8											34.0	37.0	36.0					8																	144654356		2049	4174	6223	144725499	SO:0001630	splice_region_variant	642475			AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.295-1G>C	8.37:g.144654356C>G			144725499	A8MWB1	Splice_Site_SNP	SNP	ENST00000398882.3	37	CCDS47928.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	.	10.07	1.250558	0.22880	.	.	ENSG00000204839	ENST00000398882;ENST00000529971	.	.	.	3.88	1.94	0.25998	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.3642	0.16105	0.0:0.6736:0.2078:0.1186	.	.	.	.	.	-1	.	.	.	-	.	.	C8orf73	144725499	0.757000	0.28394	0.014000	0.15608	0.152000	0.21847	3.518000	0.53451	0.801000	0.34066	0.455000	0.32223	.		0.632	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878	Intron	Splice_Site_SNP
Unknown	0	genome.wustl.edu	37	9	90559231	90559231	+	IGR	SNP	G	G	A			TCGA-24-1464-01	TCGA-24-1464-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr9:90559231G>A								SPATA31C1 (23208 upstream) : CDK20 (22129 downstream)																							GGAAGTCGTCGTCCCGGGCAG	0.662																																																0			9																																								89749051	SO:0001628	intergenic_variant	645937																															9.37:g.90559231G>A			89749051		Silent	SNP		37		SNP	40	WashU																																																																																			0	0.662									Silent
AKNA	80709	genome.wustl.edu	37	9	117138616	117138616	+	Intron	SNP	C	C	G			TCGA-24-1464-01	TCGA-24-1464-10	C	C	G	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chr9:117138616C>G	ENST00000307564.4	-	3	1503				AKNA_ENST00000374088.3_Intron|AKNA_ENST00000223791.3_Intron|AKNA_ENST00000312033.3_Intron|AKNA_ENST00000374075.5_Intron	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GCTTCCCACCCCAGCCAGGCT	0.692																																																0			9																																								116178437	SO:0001627	intron_variant	80709			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.1341+129G>C	9.37:g.117138616C>G			116178437	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	CCDS6805.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	5.211	0.224433	0.09863	.	.	ENSG00000106948	ENST00000394574	.	.	.	0.475	0.475	0.16774	.	.	.	.	.	T	0.37758	0.1015	.	.	.	0.53005	D	0.999962	P	0.38922	0.651	B	0.32342	0.144	T	0.32745	-0.9895	7	0.87932	D	0	.	8.3347	0.32208	0.0:1.0:0.0:0.0	.	491	Q7Z591-6	.	R	491	.	ENSP00000378075:G491R	G	-	1	0	AKNA	116178437	0.000000	0.05858	0.016000	0.15963	0.048000	0.14542	-1.511000	0.02260	0.473000	0.27368	0.205000	0.17691	GGG		0.692	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767		Missense_Mutation
DMD	1756	genome.wustl.edu	37	X	32583978	32583978	+	Silent	SNP	T	T	C			TCGA-24-1464-01	TCGA-24-1464-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chrX:32583978T>C	ENST00000357033.4	-	16	2039	c.1833A>G	c.(1831-1833)gaA>gaG	p.E611E	DMD_ENST00000378677.2_Silent_p.E607E|DMD_ENST00000288447.4_Silent_p.E603E	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	611					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.E606E(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GCTTTTTCTTTTCTAGATCCG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	X											136.0	109.0	118.0					X																	32583978		2202	4300	6502	32493899	SO:0001819	synonymous_variant	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1833A>G	X.37:g.32583978T>C			32493899	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1	SNP	64	WashU																																																																																				0.398	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		Silent
SMC1A	8243	genome.wustl.edu	37	X	53423416	53423416	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chrX:53423416C>T	ENST00000322213.4	-	17	2811	c.2684G>A	c.(2683-2685)cGt>cAt	p.R895H		NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	895					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.R895H(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						GAGTTTCTTACGAATCTCCTC	0.527																																																1	Substitution - Missense(1)	ovary(1)	X											174.0	132.0	147.0					X																	53423416		2203	4300	6503	53440141	SO:0001583	missense	8243			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.2684G>A	X.37:g.53423416C>T	ENSP00000323421:p.Arg895His		53440141	O14995|Q16351|Q2M228	Missense_Mutation	SNP	ENST00000322213.4	37	CCDS14352.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	26.7	4.762857	0.89932	.	.	ENSG00000072501	ENST00000322213	T	0.78707	-1.2	5.01	5.01	0.66863	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.89378	0.6698	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.91447	0.5178	10	0.87932	D	0	.	16.4457	0.83928	0.0:1.0:0.0:0.0	.	895	Q14683	SMC1A_HUMAN	H	895	ENSP00000323421:R895H	ENSP00000323421:R895H	R	-	2	0	SMC1A	53440141	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	5.578000	0.67450	2.225000	0.72522	0.529000	0.55759	CGT		0.527	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306		Missense_Mutation
KIAA2022	340533	genome.wustl.edu	37	X	73965420	73965420	+	Silent	SNP	C	C	T			TCGA-24-1464-01	TCGA-24-1464-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1464-01	TCGA-24-1464-10	g.chrX:73965420C>T	ENST00000055682.6	-	2	677	c.66G>A	c.(64-66)ggG>ggA	p.G22G		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	22					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.G22G(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TTTCTTTGACCCCATTAATCA	0.358																																																1	Substitution - coding silent(1)	ovary(1)	X											102.0	86.0	92.0					X																	73965420		2202	4299	6501	73882145	SO:0001819	synonymous_variant	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.66G>A	X.37:g.73965420C>T			73882145	A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	ENST00000055682.6	37	CCDS35337.1	SNP	22	WashU																																																																																				0.358	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		Silent
