#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
HRNR	388697	broad.mit.edu	37	1	152193357	152193357	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr1:152193357C>T	ENST00000368801.2	-	3	823	c.748G>A	c.(748-750)Ggc>Agc	p.G250S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	250					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.G250S(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGACCTGAGCCAGATCCATGC	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											310.0	292.0	298.0					1																	152193357		2203	4300	6503	150459981	SO:0001583	missense	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.748G>A	1.37:g.152193357C>T	ENSP00000357791:p.Gly250Ser		150459981	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	10.39	1.336881	0.24253	.	.	ENSG00000197915	ENST00000368801	T	0.05447	3.44	4.48	-8.08	0.01094	.	.	.	.	.	T	0.00724	0.0024	N	0.24115	0.695	0.09310	N	1	B	0.26081	0.141	B	0.23574	0.047	T	0.45440	-0.9261	9	0.06365	T	0.9	.	5.9622	0.19305	0.209:0.28:0.0:0.511	.	250	Q86YZ3	HORN_HUMAN	S	250	ENSP00000357791:G250S	ENSP00000357791:G250S	G	-	1	0	HRNR	150459981	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-2.643000	0.00862	-2.047000	0.00908	-0.151000	0.13558	GGC		0.537	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		Missense_Mutation
LHX9	56956	broad.mit.edu	37	1	197887048	197887048	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr1:197887048G>T	ENST00000367387.4	+	1	520	c.95G>T	c.(94-96)gGc>gTc	p.G32V	LHX9_ENST00000337020.2_Missense_Mutation_p.G32V|LHX9_ENST00000561173.1_Missense_Mutation_p.G38V|LHX9_ENST00000367391.1_Missense_Mutation_p.G23V|LHX9_ENST00000367390.3_Missense_Mutation_p.G23V|LHX9_ENST00000606127.1_3'UTR	NM_020204.2	NP_064589.2	Q9NQ69	LHX9_HUMAN	LIM homeobox 9	32					cell proliferation (GO:0008283)|female gonad development (GO:0008585)|gonad morphogenesis (GO:0035262)|male gonad development (GO:0008584)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.G32V(1)		endometrium(8)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|skin(1)|stomach(1)	35						CACATCCAAGGCATCATGGAG	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											100.0	99.0	99.0					1																	197887048		2203	4300	6503	196153671	SO:0001583	missense	56956			AJ277915	CCDS1393.1, CCDS30962.1	1q31.1	2011-06-20			ENSG00000143355	ENSG00000143355		"""Homeoboxes / LIM class"""	14222	protein-coding gene	gene with protein product		606066					Standard	NM_020204		Approved		uc001guk.1	Q9NQ69	OTTHUMG00000035656	ENST00000367387.4:c.95G>T	1.37:g.197887048G>T	ENSP00000356357:p.Gly32Val		196153671	Q5VUE2|Q5VUE3|Q5VUE6|Q86UH2|Q9BYU6|Q9NQ70	Missense_Mutation	SNP	ENST00000367387.4	37	CCDS1393.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	25.7	4.667791	0.88348	.	.	ENSG00000143355	ENST00000367391;ENST00000367390;ENST00000367388;ENST00000337020;ENST00000367387	T;D;T;D	0.89939	0.36;-2.58;0.24;-2.59	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.93354	0.7881	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.996;1.0	D	0.93969	0.7247	10	0.87932	D	0	.	17.7666	0.88480	0.0:0.0:1.0:0.0	.	32;23;23	Q9NQ69;Q9NQ69-3;Q9NQ69-2	LHX9_HUMAN;.;.	V	23;23;75;32;32	ENSP00000356361:G23V;ENSP00000356360:G23V;ENSP00000337969:G32V;ENSP00000356357:G32V	ENSP00000337969:G32V	G	+	2	0	LHX9	196153671	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.128000	0.94424	2.506000	0.84524	0.655000	0.94253	GGC		0.622	LHX9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086547.2	NM_020204		Missense_Mutation
PPP2R5A	5525	broad.mit.edu	37	1	212530010	212530010	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1471-01	TCGA-24-1471-10			C	A	C	C	Unknown	Valid	Somatic	x	x	454_PCR_WGA			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr1:212530010C>A	ENST00000261461.2	+	9	1544	c.970C>A	c.(970-972)Cag>Aag	p.Q324K	PPP2R5A_ENST00000537030.3_Missense_Mutation_p.Q267K|RP11-384C4.2_ENST00000447949.1_RNA	NM_006243.3	NP_006234.1	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B', alpha	324					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of lipid kinase activity (GO:0090219)|positive regulation of protein dephosphorylation (GO:0035307)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|M band (GO:0031430)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)|Z disc (GO:0030018)	kinase binding (GO:0019900)|protein phosphatase type 2A regulator activity (GO:0008601)	p.Q324K(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		AACCTGCAGTCAGAAAGAGGT	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											92.0	93.0	92.0					1																	212530010		2203	4300	6503	210596633	SO:0001583	missense	5525			BC022474	CCDS1503.1, CCDS55686.1	1q32.2-q32.3	2010-06-18	2010-04-14		ENSG00000066027	ENSG00000066027		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9309	protein-coding gene	gene with protein product		601643	"""protein phosphatase 2, regulatory subunit B (B56), alpha isoform"", ""protein phosphatase 2, regulatory subunit B', alpha isoform"""			7592815	Standard	NM_006243		Approved	PR61A, B56A	uc001hjb.3	Q15172	OTTHUMG00000036750	ENST00000261461.2:c.970C>A	1.37:g.212530010C>A	ENSP00000261461:p.Gln324Lys		210596633	B2R6D2|B7Z7L2|D3DT99|Q2NL72|Q5VVB2|Q8TBI9	Missense_Mutation	SNP	ENST00000261461.2	37	CCDS1503.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	21.7	4.192798	0.78902	.	.	ENSG00000066027	ENST00000542178;ENST00000261461;ENST00000537030	.	.	.	5.32	5.32	0.75619	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81894	0.4919	M	0.93638	3.44	0.80722	D	1	B;B	0.25719	0.132;0.132	B;B	0.32762	0.152;0.152	T	0.82928	-0.0214	9	0.72032	D	0.01	-12.3677	19.3719	0.94492	0.0:1.0:0.0:0.0	.	267;324	B7Z7L2;Q15172	.;2A5A_HUMAN	K	324;324;267	.	ENSP00000261461:Q324K	Q	+	1	0	PPP2R5A	210596633	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.621000	0.83083	2.639000	0.89480	0.655000	0.94253	CAG		0.403	PPP2R5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089302.1	NM_006243		Missense_Mutation
ZP4	57829	broad.mit.edu	37	1	238051678	238051678	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr1:238051678G>A	ENST00000366570.4	-	4	691	c.533C>T	c.(532-534)tCc>tTc	p.S178F	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	178	P-type. {ECO:0000255|PROSITE- ProRule:PRU00779}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)	p.S178F(1)|p.S178Y(1)		breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			ATAGTAGCAGGAATTCACCTC	0.507																																					NSCLC(166;160 2029 11600 18754 19936)											2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	1											129.0	109.0	116.0					1																	238051678		2203	4300	6503	236118301	SO:0001583	missense	57829			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.533C>T	1.37:g.238051678G>A	ENSP00000355529:p.Ser178Phe		236118301	B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	CCDS1615.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	5.488	0.274966	0.10403	.	.	ENSG00000116996	ENST00000366570	T	0.55052	0.54	4.98	3.1	0.35709	P-type trefoil (5);	0.445538	0.23993	N	0.042554	T	0.37812	0.1017	L	0.37561	1.115	0.24876	N	0.992257	B	0.14805	0.011	B	0.23716	0.048	T	0.25916	-1.0118	10	0.09843	T	0.71	-10.9002	9.1251	0.36810	0.1792:0.0:0.8208:0.0	.	178	Q12836	ZP4_HUMAN	F	178	ENSP00000355529:S178F	ENSP00000355529:S178F	S	-	2	0	ZP4	236118301	0.993000	0.37304	0.762000	0.31397	0.144000	0.21451	2.701000	0.47094	0.493000	0.27837	0.655000	0.94253	TCC		0.507	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			Missense_Mutation
NKX2-3	159296	broad.mit.edu	37	10	101292917	101292917	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr10:101292917C>T	ENST00000344586.7	+	1	228	c.29C>T	c.(28-30)aCc>aTc	p.T10I	RP11-129J12.2_ENST00000548010.1_RNA	NM_145285.2	NP_660328.2	Q8TAU0	NKX23_HUMAN	NK2 homeobox 3	10					CD4-positive, alpha-beta T cell differentiation (GO:0043367)|gland morphogenesis (GO:0022612)|leukocyte homeostasis (GO:0001776)|leukocyte migration (GO:0050900)|lymph node development (GO:0048535)|macrophage differentiation (GO:0030225)|odontogenesis of dentin-containing tooth (GO:0042475)|Peyer's patch development (GO:0048541)|plasma cell differentiation (GO:0002317)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic digestive tract morphogenesis (GO:0048621)|regulation of cell proliferation (GO:0042127)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)|triglyceride metabolic process (GO:0006641)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.T10I(1)		endometrium(1)|kidney(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.45e-08)		GTCACCTCCACCCCTTTCTCA	0.582																																					Pancreas(173;2021 2035 19403 19989 27291)											1	Substitution - Missense(1)	ovary(1)	10											65.0	75.0	72.0					10																	101292917		1986	4151	6137	101282907	SO:0001583	missense	159296				CCDS41558.1	10q24.2	2013-09-20	2011-06-01	2002-10-04	ENSG00000119919	ENSG00000119919		"""Homeoboxes / ANTP class : NKL subclass"""	7836	protein-coding gene	gene with protein product		606727	"""NK-2 (Drosophila) homolog C"", ""NK2 transcription factor related, locus 3 (Drosophila)"""	NKX2C		1346742, 9142493	Standard	NM_145285		Approved	NKX2.3, CSX3, NKX4-3	uc009xwj.3	Q8TAU0	OTTHUMG00000018887	ENST00000344586.7:c.29C>T	10.37:g.101292917C>T	ENSP00000342828:p.Thr10Ile		101282907	B4DUZ4|Q9NYS6	Missense_Mutation	SNP	ENST00000344586.7	37	CCDS41558.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	25.2	4.610389	0.87258	.	.	ENSG00000119919	ENST00000344586	T	0.52295	0.67	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.71592	0.3358	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.74665	-0.3589	10	0.87932	D	0	.	19.1782	0.93612	0.0:1.0:0.0:0.0	.	10	Q8TAU0	NKX23_HUMAN	I	10	ENSP00000342828:T10I	ENSP00000342828:T10I	T	+	2	0	NKX2-3	101282907	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.286000	0.78671	2.600000	0.87896	0.655000	0.94253	ACC		0.582	NKX2-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049808.2			Missense_Mutation
MUC5B	727897	broad.mit.edu	37	11	1270876	1270876	+	Missense_Mutation	SNP	A	A	C	rs373639590		TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr11:1270876A>C	ENST00000529681.1	+	31	12824	c.12766A>C	c.(12766-12768)Aca>Cca	p.T4256P	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.T4259P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4256	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.T4211P(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCTGACCACAACAGCCACTAC	0.672																																																1	Substitution - Missense(1)	ovary(1)	11											91.0	109.0	103.0					11																	1270876		2032	4167	6199	1227452	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.12766A>C	11.37:g.1270876A>C	ENSP00000436812:p.Thr4256Pro		1227452	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	a	7.085	0.571012	0.13623	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000535652	T;T	0.19938	2.11;2.3	2.82	-5.27	0.02763	.	.	.	.	.	T	0.13713	0.0332	L	0.58810	1.83	0.09310	N	1	B;B	0.30281	0.115;0.275	B;B	0.18263	0.021;0.021	T	0.38112	-0.9676	9	0.87932	D	0	.	1.2184	0.01918	0.411:0.2644:0.1942:0.1305	.	4729;4259	A7Y9J9;E9PBJ0	.;.	P	4256;4259;4200;4106;35	ENSP00000436812:T4256P;ENSP00000415793:T4259P	ENSP00000343037:T4200P	T	+	1	0	MUC5B	1227452	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.158000	0.10070	-0.316000	0.08690	0.155000	0.16302	ACA		0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		Missense_Mutation
OR51F1	256892	broad.mit.edu	37	11	4790481	4790481	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr11:4790481T>C	ENST00000380383.1	-	1	687	c.688A>G	c.(688-690)Att>Gtt	p.I230V	OR51F1_ENST00000343430.3_Missense_Mutation_p.I223V|MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I223V(1)		kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		GAGTGAATAATTAAGATATAT	0.443																																																1	Substitution - Missense(1)	ovary(1)	11											127.0	125.0	126.0					11																	4790481		2201	4298	6499	4747057	SO:0001583	missense	256892			BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.688A>G	11.37:g.4790481T>C	ENSP00000369744:p.Ile230Val		4747057		Missense_Mutation	SNP	ENST00000380383.1	37		SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	17.75	3.465182	0.63513	.	.	ENSG00000188069	ENST00000343430;ENST00000380383	T;T	0.00374	7.72;7.72	5.24	5.24	0.73138	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000023	T	0.01489	0.0048	M	0.93507	3.425	0.37886	D	0.930549	D	0.71674	0.998	D	0.87578	0.998	T	0.42413	-0.9453	10	0.87932	D	0	.	14.0937	0.65006	0.0:0.0:0.0:1.0	.	230	A6NGY5	O51F1_HUMAN	V	223;230	ENSP00000345163:I223V;ENSP00000369744:I230V	ENSP00000345163:I223V	I	-	1	0	OR51F1	4747057	1.000000	0.71417	0.112000	0.21494	0.781000	0.44180	7.215000	0.77966	2.202000	0.70862	0.533000	0.62120	ATT		0.443	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001004752		Missense_Mutation
OR8H3	390152	broad.mit.edu	37	11	55890337	55890337	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr11:55890337G>A	ENST00000313472.3	+	1	489	c.489G>A	c.(487-489)atG>atA	p.M163I		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	163						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M163I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					TGGTTTCCATGAGCAGATTGC	0.428																																																1	Substitution - Missense(1)	ovary(1)	11											239.0	213.0	222.0					11																	55890337		2201	4296	6497	55646913	SO:0001583	missense	390152			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.489G>A	11.37:g.55890337G>A	ENSP00000323928:p.Met163Ile		55646913	Q6IFB7	Missense_Mutation	SNP	ENST00000313472.3	37	CCDS31519.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.269145	0.00259	.	.	ENSG00000181761	ENST00000313472	T	0.00069	8.77	3.62	0.159	0.14968	GPCR, rhodopsin-like superfamily (1);	0.090906	0.49305	D	0.000150	T	0.00039	0.0001	N	0.02539	-0.55	0.09310	N	1	B	0.13594	0.008	B	0.20384	0.029	T	0.20605	-1.0270	10	0.30854	T	0.27	.	1.7478	0.02966	0.254:0.14:0.463:0.143	.	163	Q8N146	OR8H3_HUMAN	I	163	ENSP00000323928:M163I	ENSP00000323928:M163I	M	+	3	0	OR8H3	55646913	0.000000	0.05858	0.012000	0.15200	0.077000	0.17291	-3.932000	0.00331	0.153000	0.19213	-1.289000	0.01358	ATG		0.428	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391541.1	NM_001005201		Missense_Mutation
OR5AK2	390181	broad.mit.edu	37	11	56756787	56756787	+	Silent	SNP	T	T	C	rs373245457		TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr11:56756787T>C	ENST00000326855.2	+	1	441	c.399T>C	c.(397-399)acT>acC	p.T133T		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T133T(1)		breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						TTCACTATACTGTAATCATGT	0.423																																																1	Substitution - coding silent(1)	ovary(1)	11						T		0,4402		0,0,2201	171.0	142.0	152.0		399	-1.2	0.0	11		152	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous	OR5AK2	NM_001005323.1		0,1,6496	CC,CT,TT		0.0116,0.0,0.0077		133/310	56756787	1,12993	2201	4296	6497	56513363	SO:0001819	synonymous_variant	390181			AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.399T>C	11.37:g.56756787T>C			56513363	B2RNZ9	Silent	SNP	ENST00000326855.2	37	CCDS31538.1	SNP	55	Broad																																																																																				0.423	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392446.1	NM_001005323		Silent
ANO2	57101	broad.mit.edu	37	12	5685069	5685069	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr12:5685069T>C	ENST00000356134.5	-	25	2626	c.2555A>G	c.(2554-2556)aAc>aGc	p.N852S	ANO2_ENST00000546188.1_Missense_Mutation_p.N852S|ANO2_ENST00000327087.8_Missense_Mutation_p.N851S	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	856					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.N852S(1)		central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CTGGCTGACGTTGAAAAAGGA	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											67.0	69.0	68.0					12																	5685069		1944	4150	6094	5555330	SO:0001583	missense	57101			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2555A>G	12.37:g.5685069T>C	ENSP00000348453:p.Asn852Ser		5555330	C4N787|Q9H847	Missense_Mutation	SNP	ENST00000356134.5	37		SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	22.5	4.300791	0.81136	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	T;T;T	0.68624	-0.34;-0.33;-0.33	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.80934	0.4719	M	0.78049	2.395	0.58432	D	0.999999	D	0.69078	0.997	D	0.70935	0.971	T	0.82170	-0.0590	10	0.48119	T	0.1	.	14.6997	0.69147	0.0:0.0:0.0:1.0	.	851	Q9NQ90-3	.	S	851;852;852;856	ENSP00000314048:N851S;ENSP00000348453:N852S;ENSP00000440981:N852S	ENSP00000314048:N851S	N	-	2	0	ANO2	5555330	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.997000	0.88414	2.119000	0.64992	0.528000	0.53228	AAC		0.532	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373		Missense_Mutation
ESYT1	23344	broad.mit.edu	37	12	56532265	56532265	+	Silent	SNP	G	G	A			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr12:56532265G>A	ENST00000394048.5	+	22	2679	c.2415G>A	c.(2413-2415)gaG>gaA	p.E805E	ESYT1_ENST00000550878.1_3'UTR|ESYT1_ENST00000267113.4_Silent_p.E815E|ESYT1_ENST00000541590.1_Silent_p.E815E	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	805	C2 4. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.E805E(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						TCTATATGGAGCGGGCAGAGG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	12											29.0	31.0	30.0					12																	56532265		2203	4300	6503	54818532	SO:0001819	synonymous_variant	23344			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.2415G>A	12.37:g.56532265G>A			54818532	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Silent	SNP	ENST00000394048.5	37	CCDS8904.1	SNP	34	Broad																																																																																				0.592	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292		Silent
TBC1D4	9882	broad.mit.edu	37	13	75886898	75886898	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1471-01	TCGA-24-1471-10			A	C	A	A	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr13:75886898A>C	ENST00000377636.3	-	13	2705	c.2359T>G	c.(2359-2361)Tct>Gct	p.S787A	TBC1D4_ENST00000425511.1_Missense_Mutation_p.S4A|TBC1D4_ENST00000431480.2_Missense_Mutation_p.S779A|TBC1D4_ENST00000377625.2_Missense_Mutation_p.S724A	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	787					cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.S787A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		GCTGAGGGAGATTTGTTCATG	0.507																																																1	Substitution - Missense(1)	ovary(1)	13											84.0	86.0	85.0					13																	75886898		1947	4149	6096	74784899	SO:0001583	missense	9882			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.2359T>G	13.37:g.75886898A>C	ENSP00000366863:p.Ser787Ala		74784899	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	ENST00000377636.3	37	CCDS41901.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	18.97	3.735592	0.69189	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625;ENST00000425511;ENST00000413735	T;T;T;T;T	0.47528	0.84;0.84;0.84;3.61;0.84	5.53	5.53	0.82687	.	0.078542	0.53938	D	0.000044	T	0.40448	0.1117	L	0.38175	1.15	0.43793	D	0.996333	B;B;P	0.46578	0.203;0.203;0.88	B;B;B	0.42995	0.064;0.143;0.404	T	0.16217	-1.0410	10	0.15066	T	0.55	-13.7368	15.9669	0.79979	1.0:0.0:0.0:0.0	.	724;779;787	O60343-2;O60343-3;O60343	.;.;TBCD4_HUMAN	A	787;779;724;4;236	ENSP00000366863:S787A;ENSP00000395986:S779A;ENSP00000366852:S724A;ENSP00000390654:S4A;ENSP00000396932:S236A	ENSP00000366852:S724A	S	-	1	0	TBC1D4	74784899	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	4.203000	0.58453	2.236000	0.73375	0.533000	0.62120	TCT		0.507	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	NM_014832		Missense_Mutation
TRPM1	4308	broad.mit.edu	37	15	31330344	31330344	+	Missense_Mutation	SNP	G	G	A	rs566390005		TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr15:31330344G>A	ENST00000256552.6	-	19	2489	c.2342C>T	c.(2341-2343)cCc>cTc	p.P781L	TRPM1_ENST00000542188.1_Missense_Mutation_p.P798L|RP11-348B17.1_ENST00000558755.1_RNA|TRPM1_ENST00000397795.2_Missense_Mutation_p.P759L|RP11-348B17.1_ENST00000561299.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1									p.P759L(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CAAGATGGTGGGGGGTAGAAG	0.353																																																1	Substitution - Missense(1)	ovary(1)	15											74.0	68.0	70.0					15																	31330344		1829	4083	5912	29117636	SO:0001583	missense	4308			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.2342C>T	15.37:g.31330344G>A	ENSP00000256552:p.Pro781Leu		29117636		Missense_Mutation	SNP	ENST00000256552.6	37	CCDS58346.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665942	0.67700	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.75477	-0.94;-0.94;-0.94	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.82019	0.4946	L	0.56340	1.77	0.80722	D	1	D;D	0.64830	0.994;0.974	P;P	0.57846	0.828;0.78	D	0.83637	0.0148	10	0.87932	D	0	-27.2573	19.3842	0.94550	0.0:0.0:1.0:0.0	.	753;759	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	L	759;798;781;759	ENSP00000380897:P759L;ENSP00000437849:P798L;ENSP00000256552:P781L	ENSP00000256552:P781L	P	-	2	0	TRPM1	29117636	1.000000	0.71417	0.372000	0.25991	0.420000	0.31355	9.332000	0.96446	2.644000	0.89710	0.655000	0.94253	CCC		0.353	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420		Missense_Mutation
TMEM256-PLSCR3	100529211	broad.mit.edu	37	17	7296683	7296683	+	Splice_Site	SNP	G	G	A			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr17:7296683G>A	ENST00000576362.1	-	4	444	c.287C>T	c.(286-288)aCg>aTg	p.T96M	TMEM256-PLSCR3_ENST00000576201.1_Splice_Site_p.T96M|TMEM256-PLSCR3_ENST00000574401.1_Splice_Site_p.T96M|TMEM256-PLSCR3_ENST00000324822.11_Splice_Site_p.T96M|C17orf61-PLSCR3_ENST00000573331.1_3'UTR|TMEM256-PLSCR3_ENST00000535512.1_Splice_Site_p.T96M					TMEM256-PLSCR3 readthrough (NMD candidate)									p.T96M(1)									GCCTAGGAACGCTGCCCGAGG	0.662																																																1	Substitution - Missense(1)	ovary(1)	17											77.0	90.0	85.0					17																	7296683		2035	4181	6216	7237407	SO:0001630	splice_region_variant	57048					17p13.1	2013-09-25			ENSG00000187838	ENSG00000187838			49186	other	readthrough							Standard	NR_037719		Approved				OTTHUMG00000178150	ENST00000576362.1:c.287-1C>T	17.37:g.7296683G>A			7237407		Missense_Mutation	SNP	ENST00000576362.1	37		SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	14.45	2.538789	0.45176	.	.	ENSG00000187838	ENST00000535512;ENST00000324822;ENST00000380658	T;T	0.21543	2.0;2.0	4.75	2.72	0.32119	.	0.279626	0.38778	N	0.001573	T	0.13030	0.0316	N	0.03050	-0.425	0.37675	D	0.923274	D;D	0.71674	0.995;0.998	P;P	0.55545	0.778;0.778	T	0.20107	-1.0285	10	0.32370	T	0.25	.	6.3514	0.21377	0.1016:0.2027:0.6957:0.0	.	96;151	Q9NRY6;D3DTP7	PLS3_HUMAN;.	M	96	ENSP00000438547:T96M;ENSP00000316021:T96M	ENSP00000316021:T96M	T	-	2	0	PLSCR3	7237407	1.000000	0.71417	0.997000	0.53966	0.837000	0.47467	3.218000	0.51192	0.718000	0.32166	0.563000	0.77884	ACG		0.662	TMEM256-PLSCR3-008	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000440808.1		Missense_Mutation	Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577127	7577127	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr17:7577127C>A	ENST00000269305.4	-	8	1000	c.811G>T	c.(811-813)Gag>Tag	p.E271*	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.E271*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E271*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E271*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E271*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	271	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|E -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> Q (in sporadic cancers; somatic mutation).|E -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> V (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E271K(28)|p.E271*(18)|p.0?(8)|p.E271Q(5)|p.?(2)|p.G266_E271delGRNSFE(2)|p.F270fs*72(1)|p.L265_K305del41(1)|p.E271P(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.E271del(1)|p.S269fs*34(1)|p.F270_D281del12(1)|p.E271fs*34(1)|p.E271fs*35(1)|p.E271_R273delEVR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACGCACCTCAAAGCTGTTC	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	74	Substitution - Missense(34)|Substitution - Nonsense(18)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Unknown(2)|Insertion - Frameshift(1)	urinary_tract(16)|lung(10)|oesophagus(7)|breast(7)|large_intestine(6)|haematopoietic_and_lymphoid_tissue(5)|bone(4)|liver(4)|upper_aerodigestive_tract(3)|stomach(3)|central_nervous_system(3)|ovary(2)|cervix(1)|biliary_tract(1)|salivary_gland(1)|pancreas(1)	17											58.0	51.0	54.0					17																	7577127		2203	4300	6503	7517852	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.811G>T	17.37:g.7577127C>A	ENSP00000269305:p.Glu271*		7517852	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	37	6.547962	0.97654	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-38.0695	16.1198	0.81342	0.0:1.0:0.0:0.0	.	.	.	.	X	271;271;271;271;271;260;139	.	ENSP00000269305:E271X	E	-	1	0	TP53	7517852	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GAG		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
ICAM1	3383	broad.mit.edu	37	19	10395085	10395085	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1471-01	TCGA-24-1471-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr19:10395085C>T	ENST00000264832.3	+	5	1257	c.932C>T	c.(931-933)cCg>cTg	p.P311L	ICAM4_ENST00000393717.2_5'Flank|ICAM4_ENST00000340992.4_5'Flank|ICAM1_ENST00000423829.2_Missense_Mutation_p.P89L|ICAM4_ENST00000380770.3_5'Flank|CTD-2369P2.8_ENST00000589379.1_RNA|CTD-2369P2.5_ENST00000592893.1_RNA	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	311					adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)	p.P311L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	CCAGGCTTTCCGGCGCCCAAC	0.612																																																1	Substitution - Missense(1)	ovary(1)	19																																								10256085	SO:0001583	missense	3383				CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.932C>T	19.37:g.10395085C>T	ENSP00000264832:p.Pro311Leu		10256085	B2R6M3|Q5NKV7|Q96B50	Missense_Mutation	SNP	ENST00000264832.3	37	CCDS12231.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	11.46	1.645558	0.29246	.	.	ENSG00000090339	ENST00000264832;ENST00000423829	T;T	0.16743	2.32;2.32	4.1	0.43	0.16515	Immunoglobulin-like fold (1);	0.337248	0.21388	N	0.075359	T	0.27098	0.0664	L	0.58428	1.81	0.09310	N	0.999999	D;P	0.89917	1.0;0.777	D;B	0.77557	0.99;0.141	T	0.13683	-1.0500	10	0.21540	T	0.41	-13.2516	4.4224	0.11486	0.3955:0.4935:0.0:0.111	.	89;311	E7ESS4;P05362	.;ICAM1_HUMAN	L	311;89	ENSP00000264832:P311L;ENSP00000413124:P89L	ENSP00000264832:P311L	P	+	2	0	ICAM1	10256085	0.209000	0.23505	0.025000	0.17156	0.014000	0.08584	0.929000	0.28844	0.079000	0.16929	0.407000	0.27541	CCG		0.612	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451207.1			Missense_Mutation
CPS1	1373	broad.mit.edu	37	2	211466935	211466935	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1471-01	TCGA-24-1471-10			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr2:211466935G>T	ENST00000233072.5	+	16	1913	c.1717G>T	c.(1717-1719)Gca>Tca	p.A573S	CPS1_ENST00000451903.2_Missense_Mutation_p.A122S|CPS1_ENST00000430249.2_Missense_Mutation_p.A579S	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	573	ATP-grasp 1.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.A573S(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	GATTGAGGATGCACTGAAGGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											114.0	101.0	106.0					2																	211466935		2203	4300	6503	211175180	SO:0001583	missense	1373			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1717G>T	2.37:g.211466935G>T	ENSP00000233072:p.Ala573Ser		211175180	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	17.75	3.465686	0.63513	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.97924	-4.61;-4.61;-4.61	5.63	5.63	0.86233	ATP-grasp fold (1);ATP-grasp fold, subdomain 1 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);	0.000000	0.85682	D	0.000000	D	0.99158	0.9709	H	0.94385	3.53	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99097	1.0842	10	0.59425	D	0.04	-9.2259	19.6756	0.95930	0.0:0.0:1.0:0.0	.	583;573	Q59HF8;P31327	.;CPSM_HUMAN	S	579;581;573;122	ENSP00000402608:A579S;ENSP00000233072:A573S;ENSP00000406136:A122S	ENSP00000233072:A573S	A	+	1	0	CPS1	211175180	1.000000	0.71417	0.931000	0.37212	0.004000	0.04260	9.224000	0.95209	2.670000	0.90874	0.585000	0.79938	GCA		0.498	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			Missense_Mutation
ISX	91464	broad.mit.edu	37	22	35463246	35463246	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr22:35463246G>T	ENST00000308700.6	+	1	1118	c.166G>T	c.(166-168)Ggc>Tgc	p.G56C	ISX_ENST00000404699.2_Missense_Mutation_p.G56C|RP1-272J12.1_ENST00000448318.4_RNA	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	56					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.G56C(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						AGGTGAAGAGGGCCCCGGAGA	0.572																																																1	Substitution - Missense(1)	ovary(1)	22											32.0	35.0	34.0					22																	35463246		2202	4300	6502	33793246	SO:0001583	missense	91464			AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.166G>T	22.37:g.35463246G>T	ENSP00000311492:p.Gly56Cys		33793246	Q68DJ5	Missense_Mutation	SNP	ENST00000308700.6	37	CCDS33640.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744446	0.49151	.	.	ENSG00000175329	ENST00000308700;ENST00000404699	D;D	0.91237	-2.81;-2.81	5.13	1.9	0.25705	.	1.263520	0.05582	N	0.573147	D	0.88826	0.6542	L	0.27053	0.805	0.09310	N	1	D	0.58620	0.983	P	0.52710	0.707	T	0.77574	-0.2537	10	0.66056	D	0.02	.	7.0722	0.25185	0.2859:0.0:0.7141:0.0	.	56	Q2M1V0	ISX_HUMAN	C	56	ENSP00000311492:G56C;ENSP00000386037:G56C	ENSP00000311492:G56C	G	+	1	0	ISX	33793246	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.498000	0.22530	0.198000	0.20407	-0.140000	0.14226	GGC		0.572	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320662.1	NM_001008494		Missense_Mutation
EP300	2033	broad.mit.edu	37	22	41564512	41564512	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1471-01	TCGA-24-1471-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr22:41564512C>T	ENST00000263253.7	+	24	5153	c.3934C>T	c.(3934-3936)Cga>Tga	p.R1312*	RP1-85F18.6_ENST00000415054.1_RNA|RNU6-375P_ENST00000517050.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1312	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.R1312*(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CTTTCTGAGGCGACAGAATCA	0.428			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																														Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	1	Substitution - Nonsense(1)	ovary(1)	22											121.0	113.0	116.0					22																	41564512		2203	4300	6503	39894458	SO:0001587	stop_gained	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.3934C>T	22.37:g.41564512C>T	ENSP00000263253:p.Arg1312*		39894458	B1AKC2	Nonsense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	51	18.252331	0.99902	.	.	ENSG00000100393	ENST00000263253	.	.	.	5.75	3.52	0.40303	.	0.000000	0.40818	N	0.001006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.3062	13.8573	0.63537	0.4746:0.5254:0.0:0.0	.	.	.	.	X	1312	.	ENSP00000263253:R1312X	R	+	1	2	EP300	39894458	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.771000	0.26633	1.397000	0.46682	0.557000	0.71058	CGA		0.428	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429		Nonsense_Mutation
RAD18	56852	broad.mit.edu	37	3	9005025	9005025	+	Silent	SNP	G	G	A			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr3:9005025G>A	ENST00000264926.2	-	1	161	c.45C>T	c.(43-45)gtC>gtT	p.V15V	RAD18_ENST00000495087.1_5'UTR	NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase	15					DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)	p.V15V(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		TCACCTTCATGACTGCCAGGC	0.652								Rad6 pathway																																								1	Substitution - coding silent(1)	ovary(1)	3											23.0	23.0	23.0					3																	9005025		2202	4300	6502	8980025	SO:0001819	synonymous_variant	56852				CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.45C>T	3.37:g.9005025G>A			8980025	Q58F55|Q9NRT6	Silent	SNP	ENST00000264926.2	37	CCDS2571.1	SNP	45	Broad																																																																																				0.652	RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207071.2	NM_020165		Silent
ADCY5	111	broad.mit.edu	37	3	123166608	123166608	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr3:123166608G>A	ENST00000462833.1	-	1	1997	c.785C>T	c.(784-786)gCg>gTg	p.A262V		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	262					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.A262V(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CGGGGGCCGCGCCGCGTGGAA	0.672																																																1	Substitution - Missense(1)	ovary(1)	3											25.0	27.0	26.0					3																	123166608		2201	4299	6500	124649298	SO:0001583	missense	111			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.785C>T	3.37:g.123166608G>A	ENSP00000419361:p.Ala262Val		124649298	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	CCDS3022.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	11.08	1.532745	0.27387	.	.	ENSG00000173175	ENST00000462833	T	0.76968	-1.06	4.91	2.14	0.27477	.	0.999708	0.08090	N	0.999437	T	0.54983	0.1892	N	0.04203	-0.255	0.80722	D	1	B	0.12013	0.005	B	0.06405	0.002	T	0.28459	-1.0043	10	0.14656	T	0.56	.	8.8077	0.34948	0.4584:0.0:0.5416:0.0	.	262	O95622	ADCY5_HUMAN	V	262	ENSP00000419361:A262V	ENSP00000419361:A262V	A	-	2	0	ADCY5	124649298	0.002000	0.14202	0.993000	0.49108	0.923000	0.55619	0.180000	0.16860	0.153000	0.19213	-0.361000	0.07541	GCG		0.672	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048		Missense_Mutation
PCDHA4	56144	broad.mit.edu	37	5	140187629	140187629	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr5:140187629C>T	ENST00000530339.1	+	1	857	c.857C>T	c.(856-858)tCg>tTg	p.S286L	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.S286L|PCDHA4_ENST00000356878.4_Missense_Mutation_p.S286L	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	286	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S286L(1)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATGATATTTCGCCAAATGTG	0.313																																																1	Substitution - Missense(1)	ovary(1)	5											64.0	69.0	67.0					5																	140187629		2203	4300	6503	140167813	SO:0001583	missense	56144			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.857C>T	5.37:g.140187629C>T	ENSP00000435300:p.Ser286Leu		140167813	O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	CCDS54916.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	c	2.680	-0.275652	0.05679	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.64991	-0.13;-0.13;-0.13	4.34	2.27	0.28462	Cadherin (4);Cadherin-like (1);	1.146100	0.06905	N	0.806657	T	0.53674	0.1811	L	0.49513	1.565	0.09310	N	1	B;B;B	0.26318	0.012;0.04;0.146	B;B;B	0.23419	0.008;0.028;0.046	T	0.44267	-0.9339	10	0.40728	T	0.16	.	5.1496	0.15002	0.1626:0.6295:0.0:0.2079	.	286;286;286	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	L	286	ENSP00000423470:S286L;ENSP00000349344:S286L;ENSP00000435300:S286L	ENSP00000349344:S286L	S	+	2	0	PCDHA4	140167813	0.000000	0.05858	0.036000	0.18154	0.041000	0.13682	-0.105000	0.10907	0.748000	0.32831	0.467000	0.42956	TCG		0.313	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907		Missense_Mutation
HIST1H1E	3008	broad.mit.edu	37	6	26156790	26156790	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr6:26156790T>C	ENST00000304218.3	+	1	232	c.172T>C	c.(172-174)Tct>Cct	p.S58P	HIST1H2BD_ENST00000289316.2_5'Flank|HIST1H2BD_ENST00000377777.4_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	58	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.S58P(1)		NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						CAGCGGCGTATCTTTGGCCGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	6											29.0	33.0	31.0					6																	26156790		2203	4300	6503	26264769	SO:0001583	missense	3008			M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.172T>C	6.37:g.26156790T>C	ENSP00000307705:p.Ser58Pro		26264769	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	37	CCDS4586.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	.	20.2	3.943545	0.73672	.	.	ENSG00000168298	ENST00000304218	T	0.53423	0.62	5.11	5.11	0.69529	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.79476	0.4452	H	0.99525	4.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88464	0.3057	10	0.87932	D	0	-4.3875	14.3666	0.66810	0.0:0.0:0.0:1.0	.	58	P10412	H14_HUMAN	P	58	ENSP00000307705:S58P	ENSP00000307705:S58P	S	+	1	0	HIST1H1E	26264769	1.000000	0.71417	0.594000	0.28785	0.645000	0.38454	7.930000	0.87610	2.055000	0.61198	0.459000	0.35465	TCT		0.617	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321		Missense_Mutation
CTTNBP2	83992	broad.mit.edu	37	7	117432608	117432608	+	Silent	SNP	G	G	A	rs138336454		TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr7:117432608G>A	ENST00000160373.3	-	4	733	c.642C>T	c.(640-642)tcC>tcT	p.S214S	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	214					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)		p.S214S(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GTTTCTCAGCGGAGAGTTCCT	0.478													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20853	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	7						G		7,4399	12.9+/-30.5	0,7,2196	134.0	120.0	125.0		642	-11.5	0.0	7	dbSNP_134	125	0,8600		0,0,4300	no	coding-synonymous	CTTNBP2	NM_033427.2		0,7,6496	AA,AG,GG		0.0,0.1589,0.0538		214/1664	117432608	7,12999	2203	4300	6503	117219844	SO:0001819	synonymous_variant	83992				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.642C>T	7.37:g.117432608G>A			117219844	O43389|Q7LG11|Q9C0A5	Silent	SNP	ENST00000160373.3	37	CCDS5774.1	SNP	39	Broad																																																																																				0.478	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		Silent
PEBP4	157310	broad.mit.edu	37	8	22675215	22675215	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1471-01	TCGA-24-1471-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr8:22675215C>T	ENST00000256404.6	-	4	383	c.292G>A	c.(292-294)Gat>Aat	p.D98N	PEBP4_ENST00000521284.1_5'UTR	NM_144962.2	NP_659399.2	Q96S96	PEBP4_HUMAN	phosphatidylethanolamine-binding protein 4	98						extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)		p.D98N(1)		breast(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|stomach(2)	10		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)		CTAGGGGCATCTGGATCCACC	0.498																																																1	Substitution - Missense(1)	ovary(1)	8											133.0	131.0	132.0					8																	22675215		1964	4162	6126	22731160	SO:0001583	missense	157310			BC020779	CCDS43724.1	8p21.3	2009-08-13			ENSG00000134020	ENSG00000134020			28319	protein-coding gene	gene with protein product	"""cousin-of-RKIP 1 protein"""	612473				15302887, 16865237	Standard	NM_144962		Approved	MGC22776, CORK1, hPEBP4	uc003xcn.1	Q96S96	OTTHUMG00000163749	ENST00000256404.6:c.292G>A	8.37:g.22675215C>T	ENSP00000256404:p.Asp98Asn		22731160	Q5EVA1|Q8WW74	Missense_Mutation	SNP	ENST00000256404.6	37	CCDS43724.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369196	0.82463	.	.	ENSG00000134020	ENST00000256404	T	0.76578	-1.03	5.09	5.09	0.68999	Phosphatidylethanolamine-binding, conserved site (1);	0.148471	0.41938	N	0.000781	D	0.92437	0.7599	H	0.97896	4.1	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	D	0.95010	0.8151	10	0.87932	D	0	-29.9237	15.2431	0.73485	0.0:1.0:0.0:0.0	.	98	Q96S96	PEBP4_HUMAN	N	98	ENSP00000256404:D98N	ENSP00000256404:D98N	D	-	1	0	PEBP4	22731160	0.990000	0.36364	0.987000	0.45799	0.800000	0.45204	4.511000	0.60462	2.374000	0.81015	0.655000	0.94253	GAT		0.498	PEBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375141.2	NM_144962		Missense_Mutation
ABCA1	19	broad.mit.edu	37	9	107594970	107594970	+	Missense_Mutation	SNP	G	G	A	rs551313050		TCGA-24-1471-01	TCGA-24-1471-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr9:107594970G>A	ENST00000374736.3	-	12	1788	c.1394C>T	c.(1393-1395)gCg>gTg	p.A465V	ABCA1_ENST00000494467.1_5'Flank	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	465					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.A465V(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GGCCAAAAACGCCACGATGTC	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		19370	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9											208.0	169.0	182.0					9																	107594970		2203	4300	6503	106634791	SO:0001583	missense	19			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.1394C>T	9.37:g.107594970G>A	ENSP00000363868:p.Ala465Val		106634791	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	10.72	1.429258	0.25726	.	.	ENSG00000165029	ENST00000374736	D	0.85258	-1.96	5.82	3.97	0.46021	.	0.955747	0.08799	N	0.892034	T	0.77226	0.4099	L	0.29908	0.895	0.09310	N	1	B	0.20887	0.049	B	0.12156	0.007	T	0.64019	-0.6505	10	0.45353	T	0.12	.	7.6705	0.28455	0.1469:0.3916:0.4615:0.0	.	465	O95477	ABCA1_HUMAN	V	465	ENSP00000363868:A465V	ENSP00000363868:A465V	A	-	2	0	ABCA1	106634791	0.000000	0.05858	0.005000	0.12908	0.965000	0.64279	-0.136000	0.10405	0.783000	0.33636	0.563000	0.77884	GCG		0.507	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502		Missense_Mutation
TTC16	158248	broad.mit.edu	37	9	130492926	130492926	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1471-01	TCGA-24-1471-10	g.chr9:130492926G>A	ENST00000373289.3	+	14	1944	c.1864G>A	c.(1864-1866)Ggc>Agc	p.G622S	TOR2A_ENST00000472723.1_5'Flank|TTC16_ENST00000489226.1_3'UTR	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	622								p.G622S(1)		central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						CAGGACCACAGGCACCTCAGA	0.582																																																1	Substitution - Missense(1)	ovary(1)	9											49.0	40.0	43.0					9																	130492926		2203	4300	6503	129532747	SO:0001583	missense	158248			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.1864G>A	9.37:g.130492926G>A	ENSP00000362386:p.Gly622Ser		129532747	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	ENST00000373289.3	37	CCDS6875.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	A	0.131	-1.112983	0.01799	.	.	ENSG00000167094	ENST00000373289	T	0.10860	2.83	4.37	-8.74	0.00838	.	1.727810	0.03031	N	0.152087	T	0.02688	0.0081	N	0.02247	-0.625	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29731	-1.0002	10	0.05721	T	0.95	-0.7676	3.9076	0.09190	0.416:0.0727:0.3736:0.1377	.	609;622	B4DZ42;Q8NEE8	.;TTC16_HUMAN	S	622	ENSP00000362386:G622S	ENSP00000362386:G622S	G	+	1	0	TTC16	129532747	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.025000	0.03600	-2.480000	0.00523	-5.006000	0.00002	GGC		0.582	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054224.1	NM_144965		Missense_Mutation
SSPO	23145	broad.mit.edu	37	7	149503917	149503920	+	RNA	DEL	GATA	GATA	-	rs72359812|rs66470151	byFrequency	TCGA-24-1471-01	TCGA-24-1471-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-1471-01	TCGA-24-1471-10	g.chr7:149503917_149503920delGATA	ENST00000378016.2	+	0	8745							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGGCCCCGGGATAGATAGAGTGT	0.652														1379	0.275359	0.4803	0.2334	5008	,	,		17754	0.1895		0.1581	False		,,,				2504	0.2372															0			7								1437,2153		344,749,702						3.3	0.9		dbSNP_130	28	1265,6541		120,1025,2758	no	frameshift	SSPO	NM_198455.2		464,1774,3460	A1A1,A1R,RR		16.2055,40.0279,23.7101				2702,8694				149134853			23145			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149503921_149503924delGATA			149134850	Q76B61	Frame_Shift_Del	DEL	ENST00000378016.2	37		DEL	41	Broad																																																																																				0.652	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				Frame_Shift_Del
