#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
FBXO44	93611	broad.mit.edu	37	1	11718362	11718362	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr1:11718362G>A	ENST00000251547.5	+	3	386	c.304G>A	c.(304-306)Gat>Aat	p.D102N	FBXO44_ENST00000376770.1_Missense_Mutation_p.D102N|FBXO44_ENST00000251546.4_Missense_Mutation_p.D102N|FBXO44_ENST00000376768.1_Missense_Mutation_p.D102N|FBXO44_ENST00000376760.1_Missense_Mutation_p.D102N|FBXO44_ENST00000376762.4_Missense_Mutation_p.D102N	NM_033182.5	NP_149438.2	Q9H4M3	FBX44_HUMAN	F-box protein 44	102	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)		p.D102N(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	8	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.41e-06)|COAD - Colon adenocarcinoma(227;0.000255)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000758)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		GAATGGAGGCGATGAGTGGAA	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											124.0	129.0	127.0					1																	11718362		2203	4300	6503	11640949	SO:0001583	missense	93611			AY040878	CCDS131.1, CCDS132.1	1p36.21	2008-03-26			ENSG00000132879	ENSG00000132879		"""F-boxes /  ""other"""""	24847	protein-coding gene	gene with protein product		609111				12383498	Standard	XM_005263535		Approved	FBX30, FBG3, MGC14140, Fbxo6a, Fbx44	uc001asm.3	Q9H4M3	OTTHUMG00000002071	ENST00000251547.5:c.304G>A	1.37:g.11718362G>A	ENSP00000251547:p.Asp102Asn		11640949	B3KNZ2|B7Z743|Q5TGX2|Q5TGX4|Q5TGX5|Q68DJ9|Q8WWY2	Missense_Mutation	SNP	ENST00000251547.5	37	CCDS132.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429765	0.62844	.	.	ENSG00000132879	ENST00000251546;ENST00000425796;ENST00000376770;ENST00000376768;ENST00000251547;ENST00000376762;ENST00000376760	T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.11	5.11	0.69529	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.000000	0.85682	D	0.000000	T	0.49115	0.1538	L	0.61036	1.89	0.40104	D	0.976405	P;B;P	0.46457	0.878;0.106;0.851	P;B;B	0.46026	0.501;0.033;0.281	T	0.53063	-0.8491	10	0.45353	T	0.12	-0.2591	17.5308	0.87814	0.0:0.0:1.0:0.0	.	102;102;102	B7Z1P2;Q9H4M3;Q9H4M3-2	.;FBX44_HUMAN;.	N	102	ENSP00000251546:D102N;ENSP00000389820:D102N;ENSP00000365961:D102N;ENSP00000365959:D102N;ENSP00000251547:D102N;ENSP00000365953:D102N;ENSP00000365951:D102N	ENSP00000251546:D102N	D	+	1	0	FBXO44	11640949	1.000000	0.71417	0.818000	0.32626	0.920000	0.55202	6.285000	0.72658	2.384000	0.81235	0.511000	0.50034	GAT		0.512	FBXO44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005761.1	NM_183412		Missense_Mutation
VPS13D	55187	broad.mit.edu	37	1	12333152	12333152	+	Silent	SNP	T	T	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr1:12333152T>A	ENST00000358136.3	+	18	2326	c.2196T>A	c.(2194-2196)gtT>gtA	p.V732V	VPS13D_ENST00000356315.4_Silent_p.V732V	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)									p.V732V(1)		NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CTGTGTTAGTTGTCGTGGATC	0.428																																																1	Substitution - coding silent(1)	ovary(1)	1											159.0	153.0	155.0					1																	12333152		2203	4300	6503	12255739	SO:0001819	synonymous_variant	55187			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.2196T>A	1.37:g.12333152T>A			12255739		Silent	SNP	ENST00000358136.3	37	CCDS30588.1	SNP	63	Broad																																																																																				0.428	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378		Silent
CACHD1	57685	broad.mit.edu	37	1	65146957	65146957	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr1:65146957G>A	ENST00000371073.2	+	25	3423	c.3423G>A	c.(3421-3423)atG>atA	p.M1141I	CACHD1_ENST00000495994.1_3'UTR|CACHD1_ENST00000290039.5_Missense_Mutation_p.M1090I			Q5VU97	CAHD1_HUMAN	cache domain containing 1	1141					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)		p.M1090I(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CAGTGCGTATGTCCAACCTGG	0.443																																																1	Substitution - Missense(1)	ovary(1)	1											175.0	164.0	168.0					1																	65146957		2203	4300	6503	64919545	SO:0001583	missense	57685			AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.3423G>A	1.37:g.65146957G>A	ENSP00000360113:p.Met1141Ile		64919545	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	ENST00000371073.2	37		SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	29.2	4.981930	0.93044	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.27256	1.68;1.7	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.25865	0.0630	L	0.42245	1.32	0.80722	D	1	P	0.35872	0.525	P	0.45428	0.48	T	0.03981	-1.0987	10	0.72032	D	0.01	-33.6985	19.7173	0.96127	0.0:0.0:1.0:0.0	.	1141	Q5VU97	CAHD1_HUMAN	I	1141;1090	ENSP00000360113:M1141I;ENSP00000290039:M1090I	ENSP00000290039:M1090I	M	+	3	0	CACHD1	64919545	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.388000	0.97237	2.724000	0.93272	0.563000	0.77884	ATG		0.443	CACHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_020925		Missense_Mutation
OR10J3	441911	broad.mit.edu	37	1	159284385	159284385	+	Missense_Mutation	SNP	C	C	T	rs188688506	byFrequency	TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr1:159284385C>T	ENST00000332217.5	-	1	64	c.65G>A	c.(64-66)cGg>cAg	p.R22Q		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R22Q(1)|p.R22L(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					TTTGTGCTGCCGCCTGAAGCT	0.453													C|||	2	0.000399361	0.0	0.0	5008	,	,		22168	0.0		0.002	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|lung(1)	1						C	GLN/ARG	0,4406		0,0,2203	178.0	186.0	183.0		65	5.1	1.0	1		183	1,8599	1.2+/-3.3	0,1,4299	yes	missense	OR10J3	NM_001004467.1	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	22/330	159284385	1,13005	2203	4300	6503	157551009	SO:0001583	missense	441911				CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.65G>A	1.37:g.159284385C>T	ENSP00000331789:p.Arg22Gln		157551009		Missense_Mutation	SNP	ENST00000332217.5	37	CCDS30909.1	SNP	23	Broad	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	4.379	0.069897	0.08436	0.0	1.16E-4	ENSG00000196266	ENST00000332217	T	0.02974	4.09	5.13	5.13	0.70059	.	0.000000	0.29609	U	0.011678	T	0.00440	0.0014	N	0.11364	0.135	0.25944	N	0.982837	P	0.51351	0.944	B	0.28916	0.096	T	0.46303	-0.9201	10	0.10636	T	0.68	.	9.4856	0.38928	0.0:0.9069:0.0:0.0931	.	22	Q5JRS4	O10J3_HUMAN	Q	22	ENSP00000331789:R22Q	ENSP00000331789:R22Q	R	-	2	0	OR10J3	157551009	0.524000	0.26282	0.969000	0.41365	0.020000	0.10135	1.293000	0.33353	2.653000	0.90120	0.561000	0.74099	CGG		0.453	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1			Missense_Mutation
TAF3	83860	broad.mit.edu	37	10	8007590	8007590	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr10:8007590A>G	ENST00000344293.5	+	3	2323	c.2117A>G	c.(2116-2118)aAg>aGg	p.K706R		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	706	Lys-rich.				maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)	p.K706R(1)		NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						aaggacaaaaaggagaagaag	0.423																																																1	Substitution - Missense(1)	ovary(1)	10											21.0	21.0	21.0					10																	8007590		1852	4080	5932	8047596	SO:0001583	missense	83860			AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.2117A>G	10.37:g.8007590A>G	ENSP00000340271:p.Lys706Arg		8047596	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	37	CCDS41487.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	17.04	3.286381	0.59867	.	.	ENSG00000165632	ENST00000344293	T	0.14516	2.5	5.83	5.83	0.93111	.	0.162448	0.41294	D	0.000912	T	0.41096	0.1144	M	0.83223	2.63	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.26360	-1.0105	10	0.38643	T	0.18	-27.1468	15.8744	0.79151	1.0:0.0:0.0:0.0	.	706	Q5VWG9	TAF3_HUMAN	R	706	ENSP00000340271:K706R	ENSP00000340271:K706R	K	+	2	0	TAF3	8047596	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.730000	0.91510	2.235000	0.73313	0.533000	0.62120	AAG		0.423	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923		Missense_Mutation
STAMBPL1	57559	broad.mit.edu	37	10	90676486	90676486	+	Missense_Mutation	SNP	C	C	A	rs140820995	byFrequency	TCGA-24-1474-01	TCGA-24-1474-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr10:90676486C>A	ENST00000371926.3	+	8	1911	c.953C>A	c.(952-954)gCg>gAg	p.A318E	STAMBPL1_ENST00000371927.3_Missense_Mutation_p.A318E|STAMBPL1_ENST00000371924.1_Missense_Mutation_p.A318E|STAMBPL1_ENST00000371922.1_Missense_Mutation_p.A152E	NM_020799.3	NP_065850.1	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	318	MPN.					membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.A318E(1)		breast(2)|endometrium(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(1)	11		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		AAGCAGTCTGCGGGACCAGAC	0.373																																																1	Substitution - Missense(1)	ovary(1)	10											163.0	151.0	155.0					10																	90676486		2203	4300	6503	90666466	SO:0001583	missense	57559			AB037794	CCDS7391.1	10q23.32	2006-11-08			ENSG00000138134	ENSG00000138134			24105	protein-coding gene	gene with protein product	"""associated molecule with the SH3 domain of STAM (AMSH) like protein"", ""associated molecule with the SH3 domain of STAM (AMSH) - Family Protein"""	612352				12810066, 12943674	Standard	NM_020799		Approved	AMSH-LP, KIAA1373, AMSH-FP, FLJ31524, ALMalpha, bA399O19.2	uc001kfk.4	Q96FJ0	OTTHUMG00000018702	ENST00000371926.3:c.953C>A	10.37:g.90676486C>A	ENSP00000360994:p.Ala318Glu		90666466	B3KPA7|Q5T9N4|Q5T9N9|Q7Z420|Q9P2H4	Missense_Mutation	SNP	ENST00000371926.3	37	CCDS7391.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165309	0.78339	.	.	ENSG00000138134	ENST00000371926;ENST00000371927;ENST00000371924;ENST00000371922	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	6.07	6.07	0.98685	.	0.065128	0.64402	D	0.000014	T	0.54695	0.1874	M	0.77313	2.365	0.39981	D	0.974912	D;D	0.57257	0.969;0.979	P;B	0.44732	0.459;0.44	T	0.64381	-0.6421	10	0.87932	D	0	-3.199	14.7776	0.69740	0.0:0.8559:0.1441:0.0	.	318;318	Q96FJ0-2;Q96FJ0	.;STALP_HUMAN	E	318;318;318;152	ENSP00000360994:A318E;ENSP00000360995:A318E;ENSP00000360992:A318E;ENSP00000360990:A152E	ENSP00000360990:A152E	A	+	2	0	STAMBPL1	90666466	0.999000	0.42202	0.973000	0.42090	0.988000	0.76386	3.946000	0.56644	2.885000	0.99019	0.650000	0.86243	GCG		0.373	STAMBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049283.1	NM_020799		Missense_Mutation
LOXL4	84171	broad.mit.edu	37	10	100011329	100011329	+	Silent	SNP	G	G	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr10:100011329G>A	ENST00000260702.3	-	13	2232	c.2082C>T	c.(2080-2082)atC>atT	p.I694I	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	694	Lysyl-oxidase like.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)	p.I694I(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		TTACCTGGAAGATATAATTCC	0.527																																																1	Substitution - coding silent(1)	ovary(1)	10											59.0	62.0	61.0					10																	100011329		2203	4300	6503	100001319	SO:0001819	synonymous_variant	84171			AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.2082C>T	10.37:g.100011329G>A			100001319	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Silent	SNP	ENST00000260702.3	37	CCDS7473.1	SNP	33	Broad																																																																																				0.527	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049766.1	NM_032211		Silent
LZTS2	84445	broad.mit.edu	37	10	102763916	102763916	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr10:102763916T>A	ENST00000370220.1	+	2	4124	c.1061T>A	c.(1060-1062)aTg>aAg	p.M354K	LZTS2_ENST00000370223.3_Missense_Mutation_p.M354K					leucine zipper, putative tumor suppressor 2									p.M217K(1)|p.M354K(1)		breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		GAGGCTACCATGTGCCAGGTG	0.607																																					Esophageal Squamous(8;38 437 13604 19902 37640)											2	Substitution - Missense(2)	ovary(2)	10											28.0	31.0	30.0					10																	102763916		2179	4252	6431	102753906	SO:0001583	missense	84445			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.1061T>A	10.37:g.102763916T>A	ENSP00000359240:p.Met354Lys		102753906		Missense_Mutation	SNP	ENST00000370220.1	37	CCDS7507.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	21.4	4.148578	0.78001	.	.	ENSG00000107816	ENST00000370223;ENST00000315797;ENST00000370220	T;T	0.42131	0.98;0.98	5.12	-1.82	0.07857	.	0.799269	0.11933	N	0.515484	T	0.15782	0.0380	N	0.08118	0	0.19300	N	0.999979	B	0.09022	0.002	B	0.04013	0.001	T	0.19386	-1.0307	9	.	.	.	0.9554	1.9245	0.03314	0.1209:0.1395:0.2508:0.4888	.	354	Q9BRK4	LZTS2_HUMAN	K	354	ENSP00000359243:M354K;ENSP00000359240:M354K	.	M	+	2	0	LZTS2	102753906	0.980000	0.34600	0.016000	0.15963	0.807000	0.45602	1.894000	0.39768	-0.244000	0.09639	0.459000	0.35465	ATG		0.607	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743		Missense_Mutation
EBF3	253738	broad.mit.edu	37	10	131757199	131757199	+	Splice_Site	SNP	T	T	C			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr10:131757199T>C	ENST00000355311.5	-	5	556	c.484A>G	c.(484-486)Agc>Ggc	p.S162G	EBF3_ENST00000368648.3_Splice_Site_p.S162G			Q9H4W6	COE3_HUMAN	early B-cell factor 3	162					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S162G(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		gccgcTCACCTGCACATGATC	0.726																																																1	Substitution - Missense(1)	ovary(1)	10											23.0	27.0	25.0					10																	131757199		2201	4298	6499	131647189	SO:0001630	splice_region_variant	253738				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.485+1A>G	10.37:g.131757199T>C			131647189	A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37		SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	19.66	3.869120	0.72065	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.55588	0.51;0.56	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.65933	0.2739	M	0.88031	2.925	0.80722	D	1	P	0.46912	0.886	P	0.47528	0.549	T	0.74737	-0.3564	10	0.72032	D	0.01	-18.8606	13.5309	0.61621	0.0:0.0:0.0:1.0	.	162	Q9H4W6-2	.	G	162	ENSP00000347463:S162G;ENSP00000357637:S162G	ENSP00000347463:S162G	S	-	1	0	EBF3	131647189	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.651000	0.83577	1.665000	0.50811	0.459000	0.35465	AGC		0.726	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	Missense_Mutation	Missense_Mutation
OR51B2	79345	broad.mit.edu	37	11	5344732	5344732	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr11:5344732C>T	ENST00000328813.2	-	1	850	c.796G>A	c.(796-798)Gtg>Atg	p.V266M	HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V266M(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCTCTGGCACATTCTTCCCA	0.388																																																1	Substitution - Missense(1)	ovary(1)	11											122.0	112.0	115.0					11																	5344732		2201	4297	6498	5301308	SO:0001583	missense	79345			AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.796G>A	11.37:g.5344732C>T	ENSP00000327540:p.Val266Met		5301308	Q96RD4	Missense_Mutation	SNP	ENST00000328813.2	37	CCDS31377.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	4.635	0.117978	0.08881	.	.	ENSG00000184881	ENST00000328813	T	0.00164	8.64	4.38	3.47	0.39725	GPCR, rhodopsin-like superfamily (1);	0.625268	0.12210	U	0.489394	T	0.00300	0.0009	L	0.51853	1.615	0.09310	N	1	D	0.61697	0.99	D	0.67382	0.951	T	0.55939	-0.8061	10	0.56958	D	0.05	.	7.3329	0.26592	0.1671:0.7418:0.0:0.0911	.	266	Q9Y5P1	O51B2_HUMAN	M	266	ENSP00000327540:V266M	ENSP00000327540:V266M	V	-	1	0	OR51B2	5301308	0.000000	0.05858	0.014000	0.15608	0.004000	0.04260	-1.021000	0.03615	1.095000	0.41419	-0.158000	0.13435	GTG		0.388	OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142983.1	NM_033180		Missense_Mutation
C11orf94	143678	broad.mit.edu	37	11	45928420	45928420	+	Splice_Site	SNP	C	C	A	rs551758515	byFrequency	TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr11:45928420C>A	ENST00000449465.1	-	2	211	c.175G>T	c.(175-177)Gac>Tac	p.D59Y	RP11-618K13.2_ENST00000533218.1_RNA	NM_001080446.2	NP_001073915.2	C9JXX5	CK094_HUMAN	chromosome 11 open reading frame 94	59						extracellular region (GO:0005576)		p.D59Y(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|ovary(1)|pancreas(1)|prostate(1)	7						GAGATACTACCATCCACCAGG	0.607																																																1	Substitution - Missense(1)	ovary(1)	11											69.0	80.0	77.0					11																	45928420		2011	4161	6172	45884996	SO:0001630	splice_region_variant	143678				CCDS44577.1	11p11.2	2012-08-10			ENSG00000234776	ENSG00000234776			37213	protein-coding gene	gene with protein product							Standard	NM_001080446		Approved		uc001nbs.4	C9JXX5	OTTHUMG00000167004	ENST00000449465.1:c.175+1G>T	11.37:g.45928420C>A			45884996		Missense_Mutation	SNP	ENST00000449465.1	37	CCDS44577.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	19.01	3.743402	0.69418	.	.	ENSG00000234776	ENST00000449465	T	0.57107	0.42	4.82	4.82	0.62117	.	.	.	.	.	T	0.71986	0.3405	.	.	.	0.42704	D	0.993629	D	0.89917	1.0	D	0.87578	0.998	T	0.74575	-0.3620	7	.	.	.	-0.7597	16.0883	0.81073	0.0:1.0:0.0:0.0	.	59	C9JXX5	CK094_HUMAN	Y	59	ENSP00000401498:D59Y	.	D	-	1	0	C11orf94	45884996	0.998000	0.40836	1.000000	0.80357	0.695000	0.40330	2.370000	0.44240	2.219000	0.72066	0.655000	0.94253	GAC		0.607	C11orf94-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392395.1	NM_001080446	Missense_Mutation	Missense_Mutation
OR5AP2	338675	broad.mit.edu	37	11	56409376	56409376	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr11:56409376G>C	ENST00000302981.1	-	1	539	c.540C>G	c.(538-540)atC>atG	p.I180M	OR5AP2_ENST00000544374.1_Missense_Mutation_p.I181M	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I180M(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						AGAAATGGTTGATCCTATTAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	11											179.0	175.0	177.0					11																	56409376		2201	4296	6497	56165952	SO:0001583	missense	338675			AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.540C>G	11.37:g.56409376G>C	ENSP00000303111:p.Ile180Met		56165952	B2RNM8	Missense_Mutation	SNP	ENST00000302981.1	37	CCDS31534.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	15.01	2.707551	0.48412	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.00220	8.52;8.52	5.09	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	D	0.000236	T	0.00666	0.0022	M	0.93241	3.395	0.33916	D	0.640225	D	0.64830	0.994	D	0.65233	0.933	T	0.25433	-1.0132	10	0.87932	D	0	.	10.5778	0.45238	0.0761:0.1335:0.7904:0.0	.	180	Q8NGF4	O5AP2_HUMAN	M	181;180	ENSP00000442701:I181M;ENSP00000303111:I180M	ENSP00000303111:I180M	I	-	3	3	OR5AP2	56165952	0.237000	0.23815	1.000000	0.80357	0.966000	0.64601	-0.047000	0.11963	2.665000	0.90641	0.637000	0.83480	ATC		0.428	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391613.1	NM_001002925		Missense_Mutation
MMP3	4314	broad.mit.edu	37	11	102710943	102710943	+	Silent	SNP	C	C	G	rs536932547		TCGA-24-1474-01	TCGA-24-1474-10			C	G	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr11:102710943C>G	ENST00000299855.5	-	6	1087	c.831G>C	c.(829-831)acG>acC	p.T277T		NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	277					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T277T(1)		endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	GGACAGGTTCCGTGGGTACCA	0.512																																																1	Substitution - coding silent(1)	ovary(1)	11											58.0	62.0	61.0					11																	102710943		2203	4299	6502	102216153	SO:0001819	synonymous_variant	4314			X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.831G>C	11.37:g.102710943C>G			102216153	B2R8B8|Q3B7S0|Q6GRF8	Silent	SNP	ENST00000299855.5	37	CCDS8323.1	SNP	23	Broad																																																																																				0.512	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109758.2	NM_002422		Silent
STAB2	55576	broad.mit.edu	37	12	104134438	104134438	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr12:104134438C>A	ENST00000388887.2	+	55	5989	c.5785C>A	c.(5785-5787)Ccc>Acc	p.P1929T		NM_017564.9	NP_060034.9			stabilin 2									p.P1929T(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CTACAACCTGCCCTTCAAGAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	12											88.0	84.0	85.0					12																	104134438		2203	4300	6503	102658568	SO:0001583	missense	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.5785C>A	12.37:g.104134438C>A	ENSP00000373539:p.Pro1929Thr		102658568		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	7.680	0.688860	0.14973	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	D	0.88509	-2.39	5.46	-1.57	0.08506	.	1.106200	0.06822	N	0.792466	D	0.82806	0.5117	L	0.49640	1.575	0.09310	N	1	B	0.13145	0.007	B	0.13407	0.009	T	0.62562	-0.6828	10	0.27082	T	0.32	.	4.653	0.12605	0.249:0.2686:0.0:0.4823	.	1929	Q8WWQ8	STAB2_HUMAN	T	1929;616	ENSP00000373539:P1929T	ENSP00000258495:P616T	P	+	1	0	STAB2	102658568	0.000000	0.05858	0.000000	0.03702	0.487000	0.33371	-1.792000	0.01756	-0.711000	0.04995	-0.824000	0.03097	CCC		0.582	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			Missense_Mutation
C12orf76	400073	broad.mit.edu	37	12	110480186	110480186	+	Silent	SNP	C	C	T	rs371803112	byFrequency	TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr12:110480186C>T	ENST00000309050.5	-	5	742	c.378G>A	c.(376-378)gcG>gcA	p.A126A	C12orf76_ENST00000548936.1_5'UTR|C12orf76_ENST00000546651.2_Intron|C12orf76_ENST00000551185.2_3'UTR|C12orf76_ENST00000546627.1_3'UTR|C12orf76_ENST00000549724.1_Missense_Mutation_p.R71H	NM_207435.1	NP_997318.1	Q8N812	CL076_HUMAN	chromosome 12 open reading frame 76	126								p.A126A(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6						CTGTCACCGACGCCGAATGGG	0.458													C|||	2	0.000399361	0.0015	0.0	5008	,	,		21502	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	12						C		2,4404	4.2+/-10.8	0,2,2201	97.0	75.0	83.0		378	4.8	0.9	12		83	0,8600		0,0,4300	no	coding-synonymous	C12orf76	NM_207435.1		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		126/136	110480186	2,13004	2203	4300	6503	108964569	SO:0001819	synonymous_variant	400073			BC041968	CCDS9141.1	12q24.11	2012-08-16			ENSG00000174456	ENSG00000174456			33790	protein-coding gene	gene with protein product							Standard	NM_207435		Approved	FLJ40142	uc001tqe.2	Q8N812	OTTHUMG00000169315	ENST00000309050.5:c.378G>A	12.37:g.110480186C>T			108964569		Silent	SNP	ENST00000309050.5	37	CCDS9141.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599994	0.87055	4.54E-4	0.0	ENSG00000174456	ENST00000549724	.	.	.	5.72	4.83	0.62350	.	.	.	.	.	T	0.72748	0.3499	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75915	-0.3149	5	0.87932	D	0	.	12.3726	0.55263	0.0:0.919:0.0:0.081	.	.	.	.	H	71	.	ENSP00000450232:R71H	R	-	2	0	C12orf76	108964569	0.997000	0.39634	0.923000	0.36655	0.989000	0.77384	4.685000	0.61693	1.414000	0.47017	0.655000	0.94253	CGT		0.458	C12orf76-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403439.2	NM_207435		Silent
POP5	51367	broad.mit.edu	37	12	121019028	121019028	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr12:121019028G>A	ENST00000357500.4	-	2	88	c.53C>T	c.(52-54)cCc>cTc	p.P18L	POP5_ENST00000341039.2_Missense_Mutation_p.P18L|POP5_ENST00000542776.1_5'UTR	NM_015918.3	NP_057002.2	Q969H6	POP5_HUMAN	processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)	18					tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)	ribonuclease P activity (GO:0004526)	p.P18L(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	all_neural(191;0.077)|Medulloblastoma(191;0.0922)					GCGGCAGCGGGGGTCGTCAGA	0.667																																																1	Substitution - Missense(1)	ovary(1)	12											44.0	44.0	44.0					12																	121019028		2203	4300	6503	119503411	SO:0001583	missense	51367			AJ306296	CCDS9202.1, CCDS9203.1	12q24.31	2012-05-21			ENSG00000167272	ENSG00000167272			17689	protein-coding gene	gene with protein product		609992				11413139	Standard	NM_198202		Approved		uc001tys.3	Q969H6	OTTHUMG00000169023	ENST00000357500.4:c.53C>T	12.37:g.121019028G>A	ENSP00000350098:p.Pro18Leu		119503411	A6NL80|Q53FS5|Q9Y2Q6	Missense_Mutation	SNP	ENST00000357500.4	37	CCDS9202.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	27.6	4.845541	0.91197	.	.	ENSG00000167272	ENST00000341039;ENST00000357500	.	.	.	5.65	5.65	0.86999	.	0.183339	0.46442	D	0.000299	T	0.63165	0.2488	L	0.52266	1.64	0.80722	D	1	B;B	0.26602	0.124;0.154	B;B	0.35655	0.207;0.124	T	0.56854	-0.7910	9	0.32370	T	0.25	-10.2343	18.0832	0.89449	0.0:0.0:1.0:0.0	.	18;18	A6NL80;Q969H6	.;POP5_HUMAN	L	18	.	ENSP00000341791:P18L	P	-	2	0	POP5	119503411	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.206000	0.65192	2.941000	0.99782	0.655000	0.94253	CCC		0.667	POP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401993.1	NM_015918		Missense_Mutation
WDR66	144406	broad.mit.edu	37	12	122369783	122369783	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr12:122369783C>A	ENST00000288912.4	+	4	1733	c.879C>A	c.(877-879)taC>taA	p.Y293*	WDR66_ENST00000397454.2_Nonsense_Mutation_p.Y293*	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	293							calcium ion binding (GO:0005509)	p.Y293*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		ACAATCAATACCACCTTCAGG	0.438																																					Esophageal Squamous(85;849 1794 49757 52143)											1	Substitution - Nonsense(1)	ovary(1)	12											150.0	137.0	141.0					12																	122369783		1988	4166	6154	120854166	SO:0001587	stop_gained	144406			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.879C>A	12.37:g.122369783C>A	ENSP00000288912:p.Tyr293*		120854166	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Nonsense_Mutation	SNP	ENST00000288912.4	37	CCDS41853.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195630	0.58126	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	.	.	.	4.72	0.78	0.18556	.	0.452872	0.24398	N	0.038866	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2177	0.37358	0.0:0.6816:0.0:0.3184	.	.	.	.	X	293	.	ENSP00000288912:Y293X	Y	+	3	2	WDR66	120854166	0.981000	0.34729	0.255000	0.24374	0.090000	0.18270	0.338000	0.19858	0.093000	0.17368	-0.424000	0.05967	TAC		0.438	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401700.1	NM_144668		Nonsense_Mutation
MLXIP	22877	broad.mit.edu	37	12	122612462	122612462	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr12:122612462T>C	ENST00000319080.7	+	3	685	c.553T>C	c.(553-555)Ttt>Ctt	p.F185L						MLX interacting protein									p.F185L(1)		NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		TGTGTGCCACTTTGTGACACC	0.597																																					Esophageal Squamous(105;787 1493 16200 18566 52466)											1	Substitution - Missense(1)	ovary(1)	12											133.0	139.0	137.0					12																	122612462		2030	4203	6233	121178416	SO:0001583	missense	22877			AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.553T>C	12.37:g.122612462T>C	ENSP00000312834:p.Phe185Leu		121178416		Missense_Mutation	SNP	ENST00000319080.7	37		SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	34	5.301085	0.95601	.	.	ENSG00000175727	ENST00000319080	T	0.34472	1.36	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.61999	0.2392	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.67177	-0.5736	9	0.87932	D	0	-14.8124	15.657	0.77144	0.0:0.0:0.0:1.0	.	185	Q9HAP2	MLXIP_HUMAN	L	185	ENSP00000312834:F185L	ENSP00000312834:F185L	F	+	1	0	MLXIP	121178416	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.755000	0.85180	2.094000	0.63399	0.533000	0.62120	TTT		0.597	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938		Missense_Mutation
CYB5D2	124936	broad.mit.edu	37	17	4060287	4060287	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr17:4060287C>A	ENST00000301391.3	+	4	1206	c.706C>A	c.(706-708)Cac>Aac	p.H236N	CYB5D2_ENST00000573984.1_Intron|CYB5D2_ENST00000575251.1_Missense_Mutation_p.H124N|CYB5D2_ENST00000575411.2_3'UTR	NM_144611.3	NP_653212.1	Q8WUJ1	NEUFC_HUMAN	cytochrome b5 domain containing 2	236					nervous system development (GO:0007399)	extracellular region (GO:0005576)	heme binding (GO:0020037)	p.H236N(1)		breast(1)|large_intestine(3)|liver(2)|ovary(1)	7						CAACCCTCCACACAGAAATCG	0.607											OREG0024097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	17											69.0	59.0	62.0					17																	4060287		2203	4300	6503	4007036	SO:0001583	missense	124936			AK172844	CCDS11044.1, CCDS58501.1	17p13.2	2006-03-10							28471	protein-coding gene	gene with protein product							Standard	NM_144611		Approved	MGC32124	uc002fxm.4	Q8WUJ1		ENST00000301391.3:c.706C>A	17.37:g.4060287C>A	ENSP00000301391:p.His236Asn	615	4007036	B2R7R6|D3DTJ9|I3L1K2	Missense_Mutation	SNP	ENST00000301391.3	37	CCDS11044.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	11.96	1.794624	0.31777	.	.	ENSG00000167740	ENST00000301391	T	0.76448	-1.02	5.09	5.09	0.68999	.	0.123452	0.53938	D	0.000059	T	0.74831	0.3768	L	0.58925	1.835	0.42176	D	0.991668	B	0.22346	0.068	B	0.18561	0.022	T	0.70934	-0.4737	10	0.33940	T	0.23	-18.0435	17.2209	0.86957	0.0:1.0:0.0:0.0	.	236	Q8WUJ1	NEUFC_HUMAN	N	236	ENSP00000301391:H236N	ENSP00000301391:H236N	H	+	1	0	CYB5D2	4007036	0.643000	0.27269	0.738000	0.30950	0.129000	0.20672	2.393000	0.44442	2.650000	0.89964	0.561000	0.74099	CAC		0.607	CYB5D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438698.1	NM_144611		Missense_Mutation
MYH2	4620	broad.mit.edu	37	17	10429940	10429940	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr17:10429940C>T	ENST00000245503.5	-	30	4547	c.4163G>A	c.(4162-4164)cGc>cAc	p.R1388H	MYH2_ENST00000397183.2_Missense_Mutation_p.R1388H|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Intron|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1388					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R1388H(2)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CTCCTCTGTGCGCTGGATGGC	0.512																																																2	Substitution - Missense(2)	ovary(1)|kidney(1)	17											175.0	162.0	166.0					17																	10429940		2203	4300	6503	10370665	SO:0001583	missense	4620				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.4163G>A	17.37:g.10429940C>T	ENSP00000245503:p.Arg1388His		10370665	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	CCDS11156.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.504663	0.96371	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.80480	-1.38;-1.38	5.2	5.2	0.72013	Myosin tail (1);	0.000000	0.40144	U	0.001162	D	0.91402	0.7287	M	0.89030	3	0.58432	D	0.999997	D	0.89917	1.0	D	0.74023	0.982	D	0.92664	0.6144	10	0.87932	D	0	.	18.9148	0.92501	0.0:1.0:0.0:0.0	.	1388	Q9UKX2	MYH2_HUMAN	H	1388	ENSP00000245503:R1388H;ENSP00000380367:R1388H	ENSP00000245503:R1388H	R	-	2	0	MYH2	10370665	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.651000	0.83577	2.703000	0.92315	0.655000	0.94253	CGC		0.512	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		Missense_Mutation
LRRC75A	388341	broad.mit.edu	37	17	16347318	16347318	+	Missense_Mutation	SNP	C	C	G	rs574897855		TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr17:16347318C>G	ENST00000409083.3	-	3	665	c.503G>C	c.(502-504)cGt>cCt	p.R168P	C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|FAM211A_ENST00000470794.1_Missense_Mutation_p.V207L|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000391079.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000477249.2_RNA|C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000492250.1_RNA	NM_207387.3	NP_997270.2												p.R121P(1)		lung(1)	1						CCCAGCTCCACGCTGTCTACC	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											65.0	53.0	57.0					17																	16347318		2203	4300	6503	16288043	SO:0001583	missense	388341																														ENST00000409083.3:c.503G>C	17.37:g.16347318C>G	ENSP00000386504:p.Arg168Pro		16288043		Missense_Mutation	SNP	ENST00000409083.3	37	CCDS11178.2	SNP	19	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.842|7.842	0.722060|0.722060	0.15372|0.15372	.|.	.|.	ENSG00000181350|ENSG00000181350	ENST00000409083|ENST00000470794	.|T	.|0.20598	.|2.06	5.34|5.34	4.29|4.29	0.51040|0.51040	.|.	1.118960|.	0.06409|.	N|.	0.720278|.	T|T	0.09992|0.09992	0.0245|0.0245	.|.	.|.	.|.	0.32560|0.32560	N|N	0.531249|0.531249	B|B	0.02656|0.20164	0.0|0.042	B|B	0.04013|0.21360	0.001|0.034	T|T	0.03739|0.03739	-1.1008|-1.1008	8|8	0.87932|0.02654	D|T	0|1	.|.	13.5836|13.5836	0.61917|0.61917	0.0:0.8044:0.1956:0.0|0.0:0.8044:0.1956:0.0	.|.	168|207	Q8NAA5-2|Q8NAA5	.|CQ076_HUMAN	P|L	168|207	.|ENSP00000419502:V207L	ENSP00000386504:R168P|ENSP00000419502:V207L	R|V	-|-	2|1	0|0	C17orf76|C17orf76	16288043|16288043	0.999000|0.999000	0.42202|0.42202	0.992000|0.992000	0.48379|0.48379	0.988000|0.988000	0.76386|0.76386	1.718000|1.718000	0.38001|0.38001	2.680000|2.680000	0.91292|0.91292	0.561000|0.561000	0.74099|0.74099	CGT|GTG		0.637	FAM211A-001	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000130461.2			Missense_Mutation
UTP6	55813	broad.mit.edu	37	17	30202395	30202395	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr17:30202395G>C	ENST00000261708.4	-	14	1300	c.1163C>G	c.(1162-1164)gCt>gGt	p.A388G	CTC-542B22.2_ENST00000583236.1_lincRNA	NM_018428.2	NP_060898.2	Q9NYH9	UTP6_HUMAN	UTP6, small subunit (SSU) processome component, homolog (yeast)	388					rRNA processing (GO:0006364)	nucleolus (GO:0005730)		p.A388G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)	21		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				CACTTCCAGAGCTTCCCTCAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	17											84.0	81.0	82.0					17																	30202395		2203	4300	6503	27226508	SO:0001583	missense	55813			AF116631	CCDS11269.1	17q11.2	2010-06-24	2006-05-16	2006-05-16	ENSG00000108651	ENSG00000108651			18279	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated antigen 66"""		"""chromosome 17 open reading frame 40"""	C17orf40		10843809, 16138909	Standard	NM_018428		Approved	HCA66	uc002hgr.3	Q9NYH9	OTTHUMG00000132815	ENST00000261708.4:c.1163C>G	17.37:g.30202395G>C	ENSP00000261708:p.Ala388Gly		27226508	Q8IX96|Q96BL2|Q9NQ91	Missense_Mutation	SNP	ENST00000261708.4	37	CCDS11269.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252001	0.80135	.	.	ENSG00000108651	ENST00000261708	T	0.39592	1.07	5.42	5.42	0.78866	.	0.146722	0.64402	D	0.000008	T	0.53658	0.1810	M	0.64997	1.995	0.58432	D	0.999996	D;D	0.61697	0.99;0.99	P;P	0.54140	0.743;0.743	T	0.47182	-0.9137	10	0.27082	T	0.32	-6.1776	16.9846	0.86337	0.0:0.0:1.0:0.0	.	388;388	B3KQ21;Q9NYH9	.;UTP6_HUMAN	G	388	ENSP00000261708:A388G	ENSP00000261708:A388G	A	-	2	0	UTP6	27226508	0.999000	0.42202	0.716000	0.30569	0.778000	0.44026	5.813000	0.69201	2.565000	0.86533	0.462000	0.41574	GCT		0.433	UTP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256265.2	NM_018428		Missense_Mutation
USP36	57602	broad.mit.edu	37	17	76799798	76799798	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr17:76799798T>C	ENST00000542802.3	-	16	2922	c.2479A>G	c.(2479-2481)Acg>Gcg	p.T827A	USP36_ENST00000449938.2_Intron|USP36_ENST00000312010.6_Missense_Mutation_p.T827A			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	827					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)	p.T827A(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			GGGAGGCGCGTCTCTGAGCCC	0.637																																																2	Substitution - Missense(2)	ovary(2)	17											20.0	25.0	23.0					17																	76799798		2188	4287	6475	74311393	SO:0001583	missense	57602			AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.2479A>G	17.37:g.76799798T>C	ENSP00000441214:p.Thr827Ala		74311393	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Missense_Mutation	SNP	ENST00000542802.3	37	CCDS32755.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	7.295	0.611919	0.14066	.	.	ENSG00000055483	ENST00000312010;ENST00000542802	T;T	0.06068	3.35;3.35	5.39	-6.37	0.01963	.	1.625640	0.03083	N	0.158752	T	0.07098	0.0180	M	0.62723	1.935	0.09310	N	0.999999	B;B	0.14438	0.01;0.004	B;B	0.08055	0.002;0.003	T	0.42666	-0.9438	10	0.09843	T	0.71	0.082	9.5426	0.39262	0.0:0.5775:0.1038:0.3188	.	827;827	Q9P275;Q9P275-2	UBP36_HUMAN;.	A	827	ENSP00000310590:T827A;ENSP00000441214:T827A	ENSP00000310590:T827A	T	-	1	0	USP36	74311393	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-0.984000	0.03755	-1.026000	0.03330	0.533000	0.62120	ACG		0.637	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3	NM_025090		Missense_Mutation
KEAP1	9817	broad.mit.edu	37	19	10610143	10610143	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr19:10610143G>C	ENST00000171111.5	-	2	1114	c.567C>G	c.(565-567)aaC>aaG	p.N189K	KEAP1_ENST00000588024.1_5'UTR|KEAP1_ENST00000393623.2_Missense_Mutation_p.N189K	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	189	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.N189K(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GCTCAGCGAAGTTGGCGATGC	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											97.0	77.0	84.0					19																	10610143		2203	4300	6503	10471143	SO:0001583	missense	9817			AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.567C>G	19.37:g.10610143G>C	ENSP00000171111:p.Asn189Lys		10471143	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	CCDS12239.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	10.92	1.487529	0.26686	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.67865	-0.29;-0.29	4.81	4.81	0.61882	BTB/Kelch-associated (2);	0.198017	0.53938	D	0.000051	T	0.49729	0.1574	N	0.11892	0.195	0.52099	D	0.999945	B	0.30146	0.27	B	0.31812	0.136	T	0.49011	-0.8983	10	0.26408	T	0.33	.	15.3825	0.74669	0.0:0.0:1.0:0.0	.	189	Q14145	KEAP1_HUMAN	K	189	ENSP00000171111:N189K;ENSP00000377245:N189K	ENSP00000171111:N189K	N	-	3	2	KEAP1	10471143	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	3.931000	0.56529	2.232000	0.73038	0.561000	0.74099	AAC		0.602	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		Missense_Mutation
SMARCA4	6597	broad.mit.edu	37	19	11138568	11138568	+	Silent	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr19:11138568C>T	ENST00000429416.3	+	25	3605	c.3324C>T	c.(3322-3324)ctC>ctT	p.L1108L	SMARCA4_ENST00000444061.3_Silent_p.L1108L|SMARCA4_ENST00000358026.2_Silent_p.L1108L|SMARCA4_ENST00000344626.4_Silent_p.L1108L|SMARCA4_ENST00000590574.1_Silent_p.L1108L|SMARCA4_ENST00000589677.1_Silent_p.L1108L|SMARCA4_ENST00000541122.2_Silent_p.L1108L|SMARCA4_ENST00000413806.3_Silent_p.L1108L|SMARCA4_ENST00000450717.3_Silent_p.L1108L	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1108	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(2)|p.L1108L(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TGACCTCCCTCATGACCATCA	0.468			"""F, N, Mis"""		NSCLC																																		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	3	Unknown(2)|Substitution - coding silent(1)	lung(2)|ovary(1)	19											180.0	174.0	176.0					19																	11138568		2203	4300	6503	10999568	SO:0001819	synonymous_variant	6597			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3324C>T	19.37:g.11138568C>T			10999568	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Silent	SNP	ENST00000429416.3	37	CCDS12253.1	SNP	29	Broad																																																																																				0.468	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		Silent
NOTCH3	4854	broad.mit.edu	37	19	15278118	15278118	+	Silent	SNP	C	C	A			TCGA-24-1474-01	TCGA-24-1474-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr19:15278118C>A	ENST00000263388.2	-	29	5379	c.5304G>T	c.(5302-5304)ctG>ctT	p.L1768L		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1768					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.L1768L(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GTGGTGGTGTCAGTGCCATGG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	19											159.0	124.0	136.0					19																	15278118		2203	4300	6503	15139118	SO:0001819	synonymous_variant	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5304G>T	19.37:g.15278118C>A			15139118	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	ENST00000263388.2	37	CCDS12326.1	SNP	29	Broad																																																																																				0.612	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435		Silent
CPAMD8	27151	broad.mit.edu	37	19	17025585	17025585	+	Missense_Mutation	SNP	C	C	T	rs202014738		TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr19:17025585C>T	ENST00000443236.1	-	28	3840	c.3809G>A	c.(3808-3810)cGc>cAc	p.R1270H		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1223						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R1270H(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GATAAAGCTGCGAGCCTGTGC	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											34.0	38.0	37.0					19																	17025585		2008	4179	6187	16886585	SO:0001583	missense	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3809G>A	19.37:g.17025585C>T	ENSP00000402505:p.Arg1270His		16886585	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	SNP	27	Broad	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0017482517482517483|0.0017482517482517483	0|0	0.0|0.0	C|C	17.76|17.76	3.468558|3.468558	0.63625|0.63625	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	T|.	0.32988|.	1.43|.	3.04|3.04	3.04|3.04	0.35103|0.35103	.|Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	.|0.000000	.|0.64402	.|U	.|0.000003	T|T	0.78629|0.78629	0.4313|0.4313	M|M	0.81179|0.81179	2.53|2.53	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.82267|0.82267	-0.0542|-0.0542	6|9	.|0.66056	.|D	.|0.02	.|.	14.0348|14.0348	0.64638|0.64638	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1223	.|Q8IZJ3	.|CPMD8_HUMAN	T|H	1281|1270	ENSP00000402505:A1281T|.	.|ENSP00000291440:R1270H	A|R	-|-	1|2	0|0	CPAMD8|CPAMD8	16886585|16886585	0.995000|0.995000	0.38212|0.38212	0.826000|0.826000	0.32828|0.32828	0.330000|0.330000	0.28571|0.28571	3.543000|3.543000	0.53633|0.53633	1.265000|1.265000	0.44215|0.44215	0.555000|0.555000	0.69702|0.69702	GCA|CGC		0.627	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692		Missense_Mutation
KCNN4	3783	broad.mit.edu	37	19	44284881	44284881	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr19:44284881C>T	ENST00000262888.3	-	1	528	c.133G>A	c.(133-135)Gag>Aag	p.E45K		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	45					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)	p.E45K(1)		biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	CACAGCATCTCTGCATGCAGC	0.637																																																1	Substitution - Missense(1)	ovary(1)	19											148.0	128.0	135.0					19																	44284881		2203	4300	6503	48976721	SO:0001583	missense	3783			AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.133G>A	19.37:g.44284881C>T	ENSP00000262888:p.Glu45Lys		48976721	Q53XR4	Missense_Mutation	SNP	ENST00000262888.3	37	CCDS12630.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	c	29.0	4.966972	0.92855	.	.	ENSG00000104783	ENST00000262888	D	0.99933	-8.27	4.11	4.11	0.48088	Potassium channel, calcium-activated, SK, conserved region (1);	0.300322	0.24725	U	0.036120	D	0.99906	0.9955	M	0.75085	2.285	0.45733	D	0.998636	D	0.71674	0.998	D	0.67725	0.953	D	0.95294	0.8397	10	0.87932	D	0	-22.1744	11.8999	0.52678	0.0:1.0:0.0:0.0	.	45	O15554	KCNN4_HUMAN	K	45	ENSP00000262888:E45K	ENSP00000262888:E45K	E	-	1	0	KCNN4	48976721	0.993000	0.37304	0.991000	0.47740	0.988000	0.76386	3.370000	0.52372	1.862000	0.54008	0.537000	0.68136	GAG		0.637	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463598.1	NM_002250		Missense_Mutation
NCR1	9437	broad.mit.edu	37	19	55420747	55420747	+	Missense_Mutation	SNP	G	G	A	rs369920502		TCGA-24-1474-01	TCGA-24-1474-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr19:55420747G>A	ENST00000291890.4	+	4	537	c.499G>A	c.(499-501)Gga>Aga	p.G167R	NCR1_ENST00000594765.1_Missense_Mutation_p.G167R|NCR1_ENST00000447255.1_Missense_Mutation_p.G167R|NCR1_ENST00000357397.5_Missense_Mutation_p.G60R|NCR1_ENST00000338835.5_Missense_Mutation_p.G167R|NCR1_ENST00000350790.5_Missense_Mutation_p.G72R|NCR1_ENST00000598576.1_Missense_Mutation_p.G155R	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	167	Ig-like 2.				cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)	p.G167R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		CGTACAGCGCGGATACGGGAA	0.567																																																1	Substitution - Missense(1)	ovary(1)	19						G	ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	110.0	93.0	98.0		499,499,214,214,499	-4.0	0.0	19		98	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	NCR1	NM_001145457.1,NM_001145458.1,NM_001242356.1,NM_001242357.1,NM_004829.5	125,125,125,125,125	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign,benign	167/304,167/288,72/210,72/193,167/305	55420747	1,13005	2203	4300	6503	60112559	SO:0001583	missense	9437			AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.499G>A	19.37:g.55420747G>A	ENSP00000291890:p.Gly167Arg		60112559	B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Missense_Mutation	SNP	ENST00000291890.4	37	CCDS12911.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	0.154	-1.088098	0.01873	2.27E-4	0.0	ENSG00000189430	ENST00000291890;ENST00000447255;ENST00000338835;ENST00000350790;ENST00000357397	T;T;T;T;T	0.03301	3.98;3.98;3.98;3.98;3.98	3.53	-3.97	0.04094	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.546232	0.16721	N	0.202255	T	0.01287	0.0042	N	0.02539	-0.55	0.09310	N	1	B;B;B;B;B;B	0.15930	0.015;0.012;0.013;0.012;0.003;0.004	B;B;B;B;B;B	0.23018	0.021;0.005;0.022;0.005;0.011;0.043	T	0.44636	-0.9315	10	0.14252	T	0.57	.	6.9196	0.24380	0.3148:0.1645:0.5208:0.0	.	60;72;167;72;167;167	O76036-5;B0V3L4;B0V3L5;B0V3L2;O76036-6;O76036	.;.;.;.;.;NCTR1_HUMAN	R	167;167;167;72;60	ENSP00000291890:G167R;ENSP00000404434:G167R;ENSP00000339515:G167R;ENSP00000344358:G72R;ENSP00000349972:G60R	ENSP00000291890:G167R	G	+	1	0	NCR1	60112559	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.600000	0.05693	-1.122000	0.02945	-2.156000	0.00330	GGA		0.567	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465680.1			Missense_Mutation
BRSK1	84446	broad.mit.edu	37	19	55815055	55815055	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr19:55815055G>T	ENST00000309383.1	+	12	1424	c.1147G>T	c.(1147-1149)Gat>Tat	p.D383Y	BRSK1_ENST00000326848.7_Missense_Mutation_p.D78Y|BRSK1_ENST00000590333.1_Missense_Mutation_p.D399Y	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	383					axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.D383Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		GAAGCGTGTGGATTCTCCCAT	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											61.0	71.0	68.0					19																	55815055		2203	4300	6503	60506867	SO:0001583	missense	84446			AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.1147G>T	19.37:g.55815055G>T	ENSP00000310649:p.Asp383Tyr		60506867	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Missense_Mutation	SNP	ENST00000309383.1	37	CCDS12921.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	.	23.5	4.425721	0.83667	.	.	ENSG00000160469	ENST00000309383;ENST00000543410;ENST00000326848	T;T	0.74106	-0.81;0.42	3.96	3.96	0.45880	.	0.000000	0.64402	D	0.000001	D	0.86920	0.6049	M	0.86178	2.8	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89516	0.3775	10	0.87932	D	0	.	15.3305	0.74203	0.0:0.0:1.0:0.0	.	383;399	Q8TDC3;Q8TDC3-2	BRSK1_HUMAN;.	Y	383;78;78	ENSP00000310649:D383Y;ENSP00000320853:D78Y	ENSP00000310649:D383Y	D	+	1	0	BRSK1	60506867	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.157000	0.94714	2.233000	0.73108	0.561000	0.74099	GAT		0.592	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430		Missense_Mutation
SESTD1	91404	broad.mit.edu	37	2	180008450	180008450	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr2:180008450C>T	ENST00000428443.3	-	9	1034	c.718G>A	c.(718-720)Gaa>Aaa	p.E240K		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	240							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.E240K(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			GCAAGAAGTTCATCATCCATA	0.438																																																1	Substitution - Missense(1)	ovary(1)	2											139.0	137.0	138.0					2																	180008450		2203	4300	6503	179716695	SO:0001583	missense	91404			AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.718G>A	2.37:g.180008450C>T	ENSP00000415332:p.Glu240Lys		179716695	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	37	CCDS33338.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887116	0.91814	.	.	ENSG00000187231	ENST00000428443	T	0.05025	3.51	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.13030	0.0316	N	0.14661	0.345	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.34650	-0.9820	9	.	.	.	-26.5967	20.6593	0.99626	0.0:1.0:0.0:0.0	.	240	Q86VW0	SESD1_HUMAN	K	240	ENSP00000415332:E240K	.	E	-	1	0	SESTD1	179716695	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.487000	0.81328	2.885000	0.99019	0.655000	0.94253	GAA		0.438	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123		Missense_Mutation
MAP2	4133	broad.mit.edu	37	2	210574938	210574938	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1474-01	TCGA-24-1474-10			G	C	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr2:210574938G>C	ENST00000360351.4	+	12	5539	c.5033G>C	c.(5032-5034)gGa>gCa	p.G1678A	MAP2_ENST00000361559.4_Missense_Mutation_p.G322A|MAP2_ENST00000392194.1_Missense_Mutation_p.G322A|MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000199940.6_Missense_Mutation_p.G379A|MAP2_ENST00000447185.1_Missense_Mutation_p.G1674A	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1678					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.G1678A(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TCCAAAATCGGATCAACAGAC	0.433																																					Pancreas(27;423 979 28787 29963)											1	Substitution - Missense(1)	ovary(1)	2											61.0	52.0	55.0					2																	210574938		2202	4300	6502	210283183	SO:0001583	missense	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.5033G>C	2.37:g.210574938G>C	ENSP00000353508:p.Gly1678Ala		210283183	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	22.3	4.270566	0.80469	.	.	ENSG00000078018	ENST00000199940;ENST00000360351;ENST00000361559;ENST00000392194;ENST00000447185	D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55	5.6	5.6	0.85130	.	0.229146	0.30732	N	0.008982	D	0.99889	0.9947	M	0.83774	2.66	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;0.999	D;D;D;D;D	0.97110	0.999;0.96;0.998;1.0;1.0	D	0.96605	0.9448	10	0.62326	D	0.03	-22.0739	19.6088	0.95594	0.0:0.0:1.0:0.0	.	1674;322;323;1678;379	P11137-3;P11137-2;Q59FX9;P11137;Q8IUX2	.;.;.;MAP2_HUMAN;.	A	379;1678;322;322;1674	ENSP00000199940:G379A;ENSP00000353508:G1678A;ENSP00000355290:G322A;ENSP00000376032:G322A;ENSP00000392164:G1674A	ENSP00000199940:G379A	G	+	2	0	MAP2	210283183	1.000000	0.71417	0.936000	0.37596	0.528000	0.34623	9.813000	0.99286	2.636000	0.89361	0.467000	0.42956	GGA		0.433	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		Missense_Mutation
SLC16A14	151473	broad.mit.edu	37	2	230923879	230923879	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr2:230923879C>A	ENST00000295190.4	-	2	648	c.190G>T	c.(190-192)Gaa>Taa	p.E64*	RNY4P19_ENST00000362530.1_RNA	NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.E64*(1)		NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		TGGTGGAATTCTTCCAGCCAT	0.562																																																1	Substitution - Nonsense(1)	ovary(1)	2											80.0	77.0	78.0					2																	230923879		2203	4300	6503	230632123	SO:0001587	stop_gained	151473			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.190G>T	2.37:g.230923879C>A	ENSP00000295190:p.Glu64*		230632123	A8KA08|Q53R92|Q96NI7	Nonsense_Mutation	SNP	ENST00000295190.4	37	CCDS2473.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	37	6.415131	0.97550	.	.	ENSG00000163053	ENST00000295190;ENST00000457406;ENST00000412034	.	.	.	5.39	4.52	0.55395	.	0.098289	0.44097	D	0.000485	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	14.1591	0.65434	0.0:0.9284:0.0:0.0716	.	.	.	.	X	64	.	ENSP00000295190:E64X	E	-	1	0	SLC16A14	230632123	1.000000	0.71417	0.956000	0.39512	0.993000	0.82548	4.681000	0.61663	1.503000	0.48686	0.655000	0.94253	GAA		0.562	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527		Nonsense_Mutation
BPIFB6	128859	broad.mit.edu	37	20	31626752	31626752	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr20:31626752C>T	ENST00000349552.1	+	9	884	c.884C>T	c.(883-885)gCt>gTt	p.A295V		NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6	295						extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.A295V(1)									AAGACCCTGGCTCGCTTCATT	0.557																																																1	Substitution - Missense(1)	ovary(1)	20											187.0	183.0	185.0					20																	31626752		2203	4300	6503	31090413	SO:0001583	missense	128859			AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.884C>T	20.37:g.31626752C>T	ENSP00000344929:p.Ala295Val		31090413		Missense_Mutation	SNP	ENST00000349552.1	37	CCDS13211.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	c	16.38	3.106522	0.56291	.	.	ENSG00000167104	ENST00000349552	T	0.07800	3.16	4.48	4.48	0.54585	.	0.453031	0.17668	N	0.166088	T	0.20455	0.0492	M	0.68317	2.08	0.24989	N	0.991549	D	0.53312	0.959	P	0.55749	0.783	T	0.02053	-1.1222	10	0.54805	T	0.06	.	12.5573	0.56261	0.0:1.0:0.0:0.0	.	295	Q8NFQ5	BPIB6_HUMAN	V	295	ENSP00000344929:A295V	ENSP00000344929:A295V	A	+	2	0	BPIFB6	31090413	0.984000	0.35163	0.961000	0.40146	0.282000	0.26991	2.135000	0.42112	2.333000	0.79357	0.556000	0.70494	GCT		0.557	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078658.2	NM_174897		Missense_Mutation
MATN4	8785	broad.mit.edu	37	20	43932967	43932967	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr20:43932967G>A	ENST00000372754.1	-	2	552	c.544C>T	c.(544-546)Cgc>Tgc	p.R182C	MATN4_ENST00000360607.6_Missense_Mutation_p.R182C|MATN4_ENST00000372751.4_Intron|MATN4_ENST00000372756.1_Missense_Mutation_p.R182C|MATN4_ENST00000342716.4_Missense_Mutation_p.R182C|RBPJL_ENST00000372741.3_5'Flank|MATN4_ENST00000537548.1_Missense_Mutation_p.R182C|MATN4_ENST00000353917.5_Missense_Mutation_p.R182C|RBPJL_ENST00000372743.1_5'Flank|RBPJL_ENST00000343694.3_5'Flank			O95460	MATN4_HUMAN	matrilin 4	182	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)		p.R182C(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				GCCATGGCGCGCAGGGAGCCC	0.701																																																1	Substitution - Missense(1)	ovary(1)	20											28.0	27.0	28.0					20																	43932967		2199	4293	6492	43366381	SO:0001583	missense	8785			AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.544C>T	20.37:g.43932967G>A	ENSP00000361840:p.Arg182Cys		43366381	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Missense_Mutation	SNP	ENST00000372754.1	37		SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901843	0.72754	.	.	ENSG00000124159	ENST00000372754;ENST00000372756;ENST00000353917;ENST00000360607;ENST00000342716;ENST00000537548;ENST00000255132	D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	4.6	4.6	0.57074	.	0.000000	0.44902	D	0.000411	D	0.92404	0.7589	M	0.87456	2.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.996	D	0.93169	0.6564	10	0.87932	D	0	.	11.8345	0.52316	0.0:0.0:0.8251:0.1749	.	182;182;182	A6NNA4;O95460-4;O95460-2	.;.;.	C	182	ENSP00000361840:R182C;ENSP00000361842:R182C;ENSP00000243983:R182C;ENSP00000353819:R182C;ENSP00000343164:R182C;ENSP00000440328:R182C	ENSP00000255132:R182C	R	-	1	0	MATN4	43366381	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.806000	0.47947	2.419000	0.82065	0.456000	0.33151	CGC		0.701	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1			Missense_Mutation
KRTAP27-1	643812	broad.mit.edu	37	21	31709535	31709535	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr21:31709535A>G	ENST00000382835.2	-	1	477	c.452T>C	c.(451-453)tTc>tCc	p.F151S		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	151						intermediate filament (GO:0005882)		p.F151S(1)		endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						CAGAGTTTCGAAATTTTTAGA	0.488																																																1	Substitution - Missense(1)	ovary(1)	21											144.0	147.0	146.0					21																	31709535		2203	4300	6503	30631406	SO:0001583	missense	643812			AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.452T>C	21.37:g.31709535A>G	ENSP00000372286:p.Phe151Ser		30631406		Missense_Mutation	SNP	ENST00000382835.2	37	CCDS33532.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	10.16	1.274417	0.23307	.	.	ENSG00000206107	ENST00000382835	T	0.03982	3.74	4.44	-1.16	0.09678	.	0.963760	0.08533	N	0.931777	T	0.02047	0.0064	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.16722	0.016	T	0.49123	-0.8972	10	0.17369	T	0.5	0.516	0.7135	0.00928	0.1671:0.3333:0.1604:0.3391	.	151	Q3LI81	KR271_HUMAN	S	151	ENSP00000372286:F151S	ENSP00000372286:F151S	F	-	2	0	KRTAP27-1	30631406	0.019000	0.18553	0.007000	0.13788	0.008000	0.06430	-0.232000	0.09055	-0.221000	0.09973	-0.223000	0.12442	TTC		0.488	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711		Missense_Mutation
TFF1	7031	broad.mit.edu	37	21	43786532	43786532	+	Missense_Mutation	SNP	C	C	G	rs117389225	byFrequency	TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr21:43786532C>G	ENST00000291527.2	-	1	171	c.73G>C	c.(73-75)Gag>Cag	p.E25Q		NM_003225.2	NP_003216.1	P04155	TFF1_HUMAN	trefoil factor 1	25					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|digestion (GO:0007586)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of cell proliferation (GO:0008285)|response to estradiol (GO:0032355)|response to iron ion (GO:0010039)|response to peptide hormone (GO:0043434)	extracellular space (GO:0005615)				cervix(1)|lung(1)	2						GTCTGGGCCTCGGCCAGGGTG	0.607																																																0			21											40.0	38.0	38.0					21																	43786532		2203	4300	6503	42659601	SO:0001583	missense	7031			BC032811	CCDS13685.1	21q22.3	2012-10-02	2007-01-29		ENSG00000160182	ENSG00000160182			11755	protein-coding gene	gene with protein product		113710	"""breast cancer, estrogen-inducible sequence expressed in"""	BCEI		9043862	Standard	NM_003225		Approved	D21S21, HPS2, pS2, pNR-2, HP1.A	uc002zax.1	P04155	OTTHUMG00000086799	ENST00000291527.2:c.73G>C	21.37:g.43786532C>G	ENSP00000291527:p.Glu25Gln		42659601		Missense_Mutation	SNP	ENST00000291527.2	37	CCDS13685.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.674203	0.00758	.	.	ENSG00000160182	ENST00000291527	T	0.44482	0.92	4.42	-3.18	0.05186	P-type trefoil (1);	0.468738	0.17835	N	0.160399	T	0.28134	0.0694	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.14476	-1.0471	8	.	.	.	-2.6737	18.6138	0.91295	0.0:0.7731:0.2269:0.0	.	25	P04155	TFF1_HUMAN	Q	25	ENSP00000291527:E25Q	.	E	-	1	0	TFF1	42659601	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.315000	0.08081	-0.494000	0.06669	-2.708000	0.00134	GAG		0.607	TFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195361.1	NM_003225		Missense_Mutation
MORC2	22880	broad.mit.edu	37	22	31330166	31330166	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr22:31330166G>A	ENST00000397641.3	-	20	2614	c.2206C>T	c.(2206-2208)Cgg>Tgg	p.R736W	MORC2_ENST00000215862.4_Missense_Mutation_p.R674W|MORC2-AS1_ENST00000441558.1_RNA|MORC2_ENST00000469915.1_5'Flank			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	736						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.R674W(1)		breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CTCCGCTTCCGACTAGGGGTA	0.542																																																1	Substitution - Missense(1)	ovary(1)	22											104.0	80.0	88.0					22																	31330166		2203	4300	6503	29660166	SO:0001583	missense	22880			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.2206C>T	22.37:g.31330166G>A	ENSP00000380763:p.Arg736Trp		29660166	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	ENST00000397641.3	37		SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412892	0.83340	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.14144	2.53;2.53	5.95	4.91	0.64330	.	0.511565	0.22246	N	0.062603	T	0.28699	0.0711	L	0.40543	1.245	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.01791	-1.1273	10	0.87932	D	0	.	13.7426	0.62857	0.0:0.0:0.8463:0.1537	.	736	Q9Y6X9	MORC2_HUMAN	W	736;674	ENSP00000380763:R736W;ENSP00000215862:R674W	ENSP00000215862:R674W	R	-	1	2	MORC2	29660166	0.967000	0.33354	0.808000	0.32385	0.206000	0.24218	2.943000	0.49026	1.461000	0.47929	0.655000	0.94253	CGG		0.542	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2	NM_014941		Missense_Mutation
IQSEC1	9922	broad.mit.edu	37	3	12963738	12963738	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr3:12963738C>T	ENST00000273221.4	-	5	1993	c.1777G>A	c.(1777-1779)Gtc>Atc	p.V593I		NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	593	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.V593I(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCGTCCACGACGCAGCTGGAA	0.617																																																1	Substitution - Missense(1)	ovary(1)	3											60.0	55.0	57.0					3																	12963738		2203	4300	6503	12938738	SO:0001583	missense	9922			BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.1777G>A	3.37:g.12963738C>T	ENSP00000273221:p.Val593Ile		12938738	O94863|Q96D85	Missense_Mutation	SNP	ENST00000273221.4	37	CCDS33703.1	SNP	19	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.1|22.1	4.249561|4.249561	0.80024|0.80024	.|.	.|.	ENSG00000144711|ENSG00000144711	ENST00000450726|ENST00000273221;ENST00000435445;ENST00000429247	.|T;T	.|0.54675	.|0.56;0.56	4.84|4.84	4.84|4.84	0.62591|0.62591	.|SEC7-like (4);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73916|0.73916	0.3648|0.3648	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.999;1.0;0.999	.|D;D;D	.|0.87578	.|0.967;0.998;0.967	T|T	0.77627|0.77627	-0.2517|-0.2517	4|9	.|0.59425	.|D	.|0.04	.|.	17.942|17.942	0.89028|0.89028	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|579;579;593	.|E9PG60;C9JMG9;Q6DN90	.|.;.;IQEC1_HUMAN	H|I	593|593;579;579	.|ENSP00000273221:V593I;ENSP00000402299:V579I	.|ENSP00000273221:V593I	R|V	-|-	2|1	0|0	IQSEC1|IQSEC1	12938738|12938738	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.269000|0.269000	0.26545|0.26545	7.778000|7.778000	0.85637|0.85637	2.229000|2.229000	0.72834|0.72834	0.655000|0.655000	0.94253|0.94253	CGT|GTC		0.617	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869		Missense_Mutation
SLC4A7	9497	broad.mit.edu	37	3	27472842	27472842	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr3:27472842G>T	ENST00000295736.5	-	7	1140	c.1070C>A	c.(1069-1071)gCa>gAa	p.A357E	SLC4A7_ENST00000440156.1_Missense_Mutation_p.A353E|SLC4A7_ENST00000445684.1_Missense_Mutation_p.A353E|SLC4A7_ENST00000425128.2_Missense_Mutation_p.A349E|SLC4A7_ENST00000455077.1_Intron|SLC4A7_ENST00000435667.2_Intron|SLC4A7_ENST00000454389.1_Missense_Mutation_p.A366E|SLC4A7_ENST00000428386.1_Intron|SLC4A7_ENST00000437179.1_Intron|SLC4A7_ENST00000446700.1_Missense_Mutation_p.A349E|SLC4A7_ENST00000388777.4_5'UTR	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	357					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.A357E(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	TTTCAGCGCTGCTTCTAAGTC	0.493																																																1	Substitution - Missense(1)	ovary(1)	3											120.0	124.0	123.0					3																	27472842		2203	4300	6503	27447846	SO:0001583	missense	9497			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.1070C>A	3.37:g.27472842G>T	ENSP00000295736:p.Ala357Glu		27447846	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	37	CCDS33721.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	12.59	1.984439	0.35036	.	.	ENSG00000033867	ENST00000295736;ENST00000454389;ENST00000440156;ENST00000446700;ENST00000445684;ENST00000425128	T;T;T;T;T;T	0.78003	-1.07;-1.06;-1.13;-1.14;-1.14;0.38	5.83	4.0	0.46444	Bicarbonate transporter, cytoplasmic (1);	0.565200	0.17690	N	0.165283	T	0.50616	0.1626	N	0.00337	-1.62	0.25983	N	0.98235	P;P;D;B;P	0.59767	0.956;0.956;0.986;0.213;0.956	P;P;P;B;P	0.58970	0.849;0.849;0.449;0.18;0.849	T	0.57130	-0.7864	10	0.02654	T	1	.	5.4972	0.16809	0.2227:0.0:0.6318:0.1455	.	353;349;353;366;357	E9PFN4;E9PGC1;B5M453;E9PDL9;Q9Y6M7	.;.;.;.;S4A7_HUMAN	E	357;366;353;349;353;349	ENSP00000295736:A357E;ENSP00000390394:A366E;ENSP00000414797:A353E;ENSP00000406605:A349E;ENSP00000406804:A353E;ENSP00000401949:A349E	ENSP00000295736:A357E	A	-	2	0	SLC4A7	27447846	0.988000	0.35896	0.653000	0.29593	0.988000	0.76386	2.162000	0.42367	0.774000	0.33427	0.591000	0.81541	GCA		0.493	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615		Missense_Mutation
SLC9C1	285335	broad.mit.edu	37	3	111997686	111997686	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr3:111997686C>T	ENST00000305815.5	-	4	460	c.208G>A	c.(208-210)Gcc>Acc	p.A70T	SLC9C1_ENST00000467397.1_5'UTR|SLC9C1_ENST00000487372.1_Missense_Mutation_p.A70T	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	70					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.A70T(1)									CATTGTATGGCGTTTGCGTAT	0.323																																																1	Substitution - Missense(1)	ovary(1)	3											107.0	116.0	113.0					3																	111997686		2202	4299	6501	113480376	SO:0001583	missense	285335			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.208G>A	3.37:g.111997686C>T	ENSP00000306627:p.Ala70Thr		113480376	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	2.211	-0.380802	0.05000	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.14144	2.53;2.53	5.14	0.675	0.17952	Cation/H+ exchanger (1);	0.543878	0.16979	N	0.191781	T	0.06188	0.0160	L	0.38531	1.155	0.09310	N	1	B;P	0.43578	0.265;0.811	B;B	0.31614	0.041;0.133	T	0.33085	-0.9882	10	0.15499	T	0.54	-18.7727	3.6891	0.08339	0.0:0.4683:0.1849:0.3469	.	70;70	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	T	70	ENSP00000306627:A70T;ENSP00000420688:A70T	ENSP00000306627:A70T	A	-	1	0	SLC9A10	113480376	0.000000	0.05858	0.188000	0.23233	0.000000	0.00434	-1.012000	0.03649	0.266000	0.21894	-0.892000	0.02923	GCC		0.323	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061		Missense_Mutation
RTP1	132112	broad.mit.edu	37	3	186917725	186917725	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr3:186917725C>T	ENST00000312295.4	+	2	689	c.659C>T	c.(658-660)gCg>gTg	p.A220V	RP11-208N14.4_ENST00000356133.3_RNA	NM_153708.2	NP_714919.2	P59025	RTP1_HUMAN	receptor (chemosensory) transporter protein 1	220					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)	p.A220V(2)		breast(2)|endometrium(4)|large_intestine(5)|lung(6)|ovary(3)|skin(2)	22	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		TTCTCCCGGGCGCCCAGCCCC	0.647																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	3											49.0	47.0	48.0					3																	186917725		2203	4300	6503	188400419	SO:0001583	missense	132112			BC034744	CCDS3287.2	3q27.3	2014-02-20	2006-11-21		ENSG00000175077	ENSG00000175077		"""Receptor transporter proteins"""	28580	protein-coding gene	gene with protein product	"""receptor transporting protein 1"", ""zinc finger, 3CxxC-type 1"""	609137	"""receptor transporter protein 1"""			16271481, 15550249, 16720576	Standard	NM_153708		Approved	MGC35450, Z3CXXC1	uc003frg.3	P59025	OTTHUMG00000149886	ENST00000312295.4:c.659C>T	3.37:g.186917725C>T	ENSP00000311712:p.Ala220Val		188400419		Missense_Mutation	SNP	ENST00000312295.4	37	CCDS3287.2	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	15.45	2.838673	0.51057	.	.	ENSG00000175077	ENST00000312295	T	0.16743	2.32	5.74	4.87	0.63330	.	0.160521	0.41823	D	0.000813	T	0.10809	0.0264	L	0.29908	0.895	0.24462	N	0.994432	P	0.45078	0.85	B	0.33392	0.163	T	0.16188	-1.0411	10	0.54805	T	0.06	.	10.5722	0.45206	0.0:0.9117:0.0:0.0883	.	220	P59025	RTP1_HUMAN	V	220	ENSP00000311712:A220V	ENSP00000311712:A220V	A	+	2	0	RTP1	188400419	0.742000	0.28228	0.914000	0.36105	0.847000	0.48162	1.078000	0.30754	1.440000	0.47531	0.655000	0.94253	GCG		0.647	RTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313731.2	NM_153708		Missense_Mutation
CPZ	8532	broad.mit.edu	37	4	8605814	8605814	+	Missense_Mutation	SNP	G	G	A	rs376200702		TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr4:8605814G>A	ENST00000360986.4	+	4	782	c.608G>A	c.(607-609)cGc>cAc	p.R203H	CPZ_ENST00000429646.2_De_novo_Start_InFrame|CPZ_ENST00000382480.2_Missense_Mutation_p.R66H|CPZ_ENST00000315782.6_Missense_Mutation_p.R192H	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	203					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R203H(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						ACGGCCTCCCGCTGCGCCCAC	0.697																																																1	Substitution - Missense(1)	ovary(1)	4											20.0	16.0	17.0					4																	8605814		2179	4270	6449	8656714	SO:0001583	missense	8532			U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.608G>A	4.37:g.8605814G>A	ENSP00000354255:p.Arg203His		8656714	O00520|Q96MX2	Missense_Mutation	SNP	ENST00000360986.4	37	CCDS33953.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	14.03	2.414450	0.42817	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	T;T;T	0.12039	2.72;2.72;2.72	3.86	3.86	0.44501	Peptidase M14, carboxypeptidase A (1);	0.302031	0.30676	N	0.009112	T	0.12263	0.0298	L	0.48218	1.51	0.80722	D	1	P;B	0.34546	0.456;0.208	B;B	0.28553	0.081;0.091	T	0.06409	-1.0828	10	0.72032	D	0.01	-35.9354	11.6588	0.51334	0.0921:0.0:0.9079:0.0	.	192;203	Q66K79-2;Q66K79	.;CBPZ_HUMAN	H	203;66;192	ENSP00000354255:R203H;ENSP00000371920:R66H;ENSP00000315074:R192H	ENSP00000315074:R192H	R	+	2	0	CPZ	8656714	0.008000	0.16893	1.000000	0.80357	0.628000	0.37860	0.636000	0.24644	1.973000	0.57446	0.555000	0.69702	CGC		0.697	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652		Missense_Mutation
ADH1B	125	broad.mit.edu	37	4	100235225	100235225	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1474-01	TCGA-24-1474-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr4:100235225G>A	ENST00000305046.8	-	6	648	c.581C>T	c.(580-582)tCt>tTt	p.S194F	ADH1B_ENST00000394887.3_Missense_Mutation_p.S154F			P00325	ADH1B_HUMAN	alcohol dehydrogenase 1B (class I), beta polypeptide	194					ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)	p.S194F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	33				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	AGCACAGGTAGAGCCTGGGGT	0.473																																																1	Substitution - Missense(1)	ovary(1)	4											110.0	118.0	115.0					4																	100235225		2203	4300	6503	100454248	SO:0001583	missense	125			AF153821	CCDS34033.1, CCDS68761.1	4q23	2008-02-05	2007-11-06		ENSG00000196616	ENSG00000196616	1.1.1.1	"""Alcohol dehydrogenases"""	250	protein-coding gene	gene with protein product		103720		ADH2		3006456	Standard	NM_000668		Approved		uc003hus.4	P00325	OTTHUMG00000161413	ENST00000305046.8:c.581C>T	4.37:g.100235225G>A	ENSP00000306606:p.Ser194Phe		100454248	A8MYN5|B4DRS9|B4DVC3|Q13711|Q4ZGI9|Q96KI7	Missense_Mutation	SNP	ENST00000305046.8	37	CCDS34033.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	15.02	2.708184	0.48412	.	.	ENSG00000196616	ENST00000305046;ENST00000394887;ENST00000412614	T;T	0.33654	1.4;1.4	3.81	3.81	0.43845	GroES-like (1);	0.000000	0.85682	D	0.000000	T	0.75317	0.3833	H	0.98996	4.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86944	0.2081	10	0.87932	D	0	-12.0051	15.683	0.77388	0.0:0.0:1.0:0.0	.	181;154;194	F5HB16;A8MYN5;P00325	.;.;ADH1B_HUMAN	F	194;154;181	ENSP00000306606:S194F;ENSP00000378351:S154F	ENSP00000306606:S194F	S	-	2	0	ADH1B	100454248	1.000000	0.71417	0.977000	0.42913	0.041000	0.13682	8.934000	0.92915	1.641000	0.50575	0.561000	0.74099	TCT		0.473	ADH1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364853.1	NM_000668		Missense_Mutation
TENM2	57451	broad.mit.edu	37	5	167517659	167517659	+	Silent	SNP	C	C	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr5:167517659C>A	ENST00000518659.1	+	8	1635	c.1596C>A	c.(1594-1596)acC>acA	p.T532T	CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000519204.1_Silent_p.T411T|TENM2_ENST00000545108.1_Silent_p.T532T|TENM2_ENST00000520394.1_Silent_p.T300T|TENM2_ENST00000403607.2_Silent_p.T365T	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	532					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.T365T(1)									GCATACAGACCTTGGTTCAGA	0.507																																																1	Substitution - coding silent(1)	ovary(1)	5											230.0	233.0	232.0					5																	167517659		2079	4213	6292	167450237	SO:0001819	synonymous_variant	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.1596C>A	5.37:g.167517659C>A			167450237	Q9ULU2	Silent	SNP	ENST00000518659.1	37		SNP	24	Broad																																																																																				0.507	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		Silent
SLC17A2	10246	broad.mit.edu	37	6	25916965	25916965	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr6:25916965A>C	ENST00000265425.3	-	7	898	c.878T>G	c.(877-879)cTa>cGa	p.L293R	SLC17A2_ENST00000377850.3_Missense_Mutation_p.L293R|SLC17A2_ENST00000360488.3_Missense_Mutation_p.L293R			O00624	NPT3_HUMAN	solute carrier family 17, member 2	293					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.L293R(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						TAGGTATGTTAGGATGATGGT	0.433																																																1	Substitution - Missense(1)	ovary(1)	6											135.0	118.0	124.0					6																	25916965		2203	4300	6503	26024944	SO:0001583	missense	10246			U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.878T>G	6.37:g.25916965A>C	ENSP00000265425:p.Leu293Arg		26024944	A6NK81|A6NLD6|Q5TB84|Q76P85	Missense_Mutation	SNP	ENST00000265425.3	37		SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	17.60	3.430450	0.62844	.	.	ENSG00000112337	ENST00000360488;ENST00000377850;ENST00000265425	T;T;T	0.60299	0.2;0.2;0.2	4.65	3.51	0.40186	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.466016	0.20348	N	0.094120	T	0.53932	0.1827	M	0.79805	2.47	0.26713	N	0.970927	P;P;P	0.40360	0.708;0.708;0.714	P;P;B	0.50162	0.633;0.633;0.273	T	0.53194	-0.8473	10	0.87932	D	0	.	6.4099	0.21686	0.8924:0.0:0.1076:0.0	.	293;293;293	O00624;A6NK81;O00624-2	NPT3_HUMAN;.;.	R	293	ENSP00000353677:L293R;ENSP00000367081:L293R;ENSP00000265425:L293R	ENSP00000265425:L293R	L	-	2	0	SLC17A2	26024944	0.832000	0.29368	0.996000	0.52242	0.828000	0.46876	3.516000	0.53436	2.067000	0.61834	0.460000	0.39030	CTA		0.433	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040075.1			Missense_Mutation
USP45	85015	broad.mit.edu	37	6	99894075	99894075	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr6:99894075C>A	ENST00000327681.6	-	14	2105	c.1573G>T	c.(1573-1575)Gga>Tga	p.G525*	USP45_ENST00000369233.2_Nonsense_Mutation_p.G477*|USP45_ENST00000392738.2_Nonsense_Mutation_p.G205*|USP45_ENST00000500704.2_Nonsense_Mutation_p.G525*|USP45_ENST00000539675.1_Intron	NM_001080481.1	NP_001073950.1	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	525	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.G525*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(2)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	22		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		ACACCGGATCCACTACTGGAT	0.493																																																1	Substitution - Nonsense(1)	ovary(1)	6											81.0	68.0	72.0					6																	99894075		2203	4300	6503	100000796	SO:0001587	stop_gained	85015			AL832030	CCDS34501.1	6q16.2	2008-02-05	2005-08-08		ENSG00000123552	ENSG00000123552		"""Ubiquitin-specific peptidases"""	20080	protein-coding gene	gene with protein product			"""ubiquitin specific protease 45"""			12838346	Standard	NM_001080481		Approved	MGC14793	uc003ppx.2	Q70EL2	OTTHUMG00000015267	ENST00000327681.6:c.1573G>T	6.37:g.99894075C>A	ENSP00000333376:p.Gly525*		100000796	B2RXG0|Q5T062|Q86T44|Q86TC0|Q9BRU1	Nonsense_Mutation	SNP	ENST00000327681.6	37	CCDS34501.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	43	10.517373	0.99420	.	.	ENSG00000123552	ENST00000392738;ENST00000500704;ENST00000327681;ENST00000369233	.	.	.	5.19	-0.29	0.12847	.	2.008580	0.01849	N	0.035831	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	6.0066	0.19549	0.1327:0.3886:0.0:0.4787	.	.	.	.	X	205;525;525;477	.	ENSP00000333376:G525X	G	-	1	0	USP45	100000796	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-0.714000	0.05002	0.051000	0.15978	0.655000	0.94253	GGA		0.493	USP45-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041609.2	NM_032929		Nonsense_Mutation
SERINC1	57515	broad.mit.edu	37	6	122777762	122777762	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr6:122777762C>G	ENST00000339697.4	-	3	319	c.235G>C	c.(235-237)Gtc>Ctc	p.V79L		NM_020755.2	NP_065806.1	Q9NRX5	SERC1_HUMAN	serine incorporator 1	79					L-serine transport (GO:0015825)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)	p.V79L(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(1)	13				GBM - Glioblastoma multiforme(226;0.126)		TTACAAGGGACAACACCTTTC	0.303																																																1	Substitution - Missense(1)	ovary(1)	6											117.0	103.0	108.0					6																	122777762		2203	4300	6503	122819461	SO:0001583	missense	57515			AF087902	CCDS5125.1	6q22.32	2006-02-09	2005-10-14	2005-10-14	ENSG00000111897	ENSG00000111897			13464	protein-coding gene	gene with protein product		614548	"""tumor differentially expressed 2"""	TDE2		10637174	Standard	NM_020755		Approved	TMS-2, TDE1L, KIAA1253	uc003pyy.1	Q9NRX5	OTTHUMG00000015487	ENST00000339697.4:c.235G>C	6.37:g.122777762C>G	ENSP00000342962:p.Val79Leu		122819461	B3KY69|E1P565|O75655|Q7Z2F5|Q8TAG1|Q9NTH8|Q9ULG7	Missense_Mutation	SNP	ENST00000339697.4	37	CCDS5125.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109432	0.56398	.	.	ENSG00000111897	ENST00000339697;ENST00000368454	T;T	0.14144	2.53;2.53	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.08044	0.0201	L	0.39245	1.2	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.11348	-1.0591	10	0.34782	T	0.22	-18.9332	19.9351	0.97137	0.0:1.0:0.0:0.0	.	79	Q9NRX5	SERC1_HUMAN	L	79	ENSP00000342962:V79L;ENSP00000357439:V79L	ENSP00000342962:V79L	V	-	1	0	SERINC1	122819461	0.999000	0.42202	0.998000	0.56505	0.925000	0.55904	4.056000	0.57448	2.703000	0.92315	0.655000	0.94253	GTC		0.303	SERINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042031.2	NM_020755		Missense_Mutation
PHACTR2	9749	broad.mit.edu	37	6	144095220	144095220	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr6:144095220G>A	ENST00000427704.2	+	8	1554	c.1424G>A	c.(1423-1425)cGg>cAg	p.R475Q	PHACTR2_ENST00000305766.6_Missense_Mutation_p.R395Q|PHACTR2_ENST00000440869.2_Missense_Mutation_p.R486Q|PHACTR2_ENST00000367582.3_Missense_Mutation_p.R406Q|PHACTR2_ENST00000367584.4_Missense_Mutation_p.R463Q	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2	475							protein phosphatase inhibitor activity (GO:0004864)	p.R395Q(1)		NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		AAAATACGCCGGAGGGATACT	0.453																																					Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)											1	Substitution - Missense(1)	ovary(1)	6											87.0	80.0	83.0					6																	144095220		1871	4097	5968	144136913	SO:0001583	missense	9749			AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.1424G>A	6.37:g.144095220G>A	ENSP00000391763:p.Arg475Gln		144136913	A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Missense_Mutation	SNP	ENST00000427704.2	37	CCDS47492.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.660303	0.96734	.	.	ENSG00000112419	ENST00000367584;ENST00000427704;ENST00000305766;ENST00000440869;ENST00000367582	T;T;T;T;T	0.57107	0.42;0.79;0.5;0.79;0.49	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.74023	0.3662	M	0.83774	2.66	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.85130	0.994;0.997;0.997;0.984	T	0.75235	-0.3389	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	486;395;406;475	O75167-4;O75167-5;O75167-2;O75167	.;.;.;PHAR2_HUMAN	Q	463;475;395;486;406	ENSP00000356556:R463Q;ENSP00000391763:R475Q;ENSP00000305530:R395Q;ENSP00000417038:R486Q;ENSP00000356554:R406Q	ENSP00000305530:R395Q	R	+	2	0	PHACTR2	144136913	1.000000	0.71417	0.955000	0.39395	0.770000	0.43624	9.330000	0.96422	2.941000	0.99782	0.655000	0.94253	CGG		0.453	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042528.2	NM_014721		Missense_Mutation
TTLL2	83887	broad.mit.edu	37	6	167754356	167754356	+	Missense_Mutation	SNP	C	C	T	rs200878719		TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr6:167754356C>T	ENST00000239587.5	+	3	1056	c.968C>T	c.(967-969)aCg>aTg	p.T323M		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	323	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)	p.T323M(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TGTAAATGGACGCTCAGCAGA	0.433													C|||	1	0.000199681	0.0	0.0	5008	,	,		20194	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	6						C	MET/THR	0,4406		0,0,2203	158.0	167.0	164.0		968	2.8	0.8	6		164	1,8599	1.2+/-3.3	0,1,4299	no	missense	TTLL2	NM_031949.4	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	323/593	167754356	1,13005	2203	4300	6503	167674346	SO:0001583	missense	83887			AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.968C>T	6.37:g.167754356C>T	ENSP00000239587:p.Thr323Met		167674346	B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	ENST00000239587.5	37	CCDS5301.1	SNP	19	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.72	2.619248	0.46736	0.0	1.16E-4	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.06687	3.27	3.65	2.77	0.32553	.	0.165964	0.36972	N	0.002315	T	0.17874	0.0429	M	0.83483	2.645	0.37917	D	0.931574	D	0.89917	1.0	D	0.87578	0.998	T	0.01643	-1.1305	10	0.62326	D	0.03	.	9.8142	0.40842	0.0:0.8953:0.0:0.1047	.	323	Q9BWV7	TTLL2_HUMAN	M	323;250	ENSP00000239587:T323M	ENSP00000239587:T323M	T	+	2	0	TTLL2	167674346	0.992000	0.36948	0.780000	0.31762	0.509000	0.34042	3.056000	0.49923	0.859000	0.35456	0.491000	0.48974	ACG		0.433	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949		Missense_Mutation
FAM200A	221786	broad.mit.edu	37	7	99145297	99145297	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr7:99145297C>T	ENST00000449309.1	-	2	1113	c.734G>A	c.(733-735)cGa>cAa	p.R245Q		NM_145111.3	NP_659802.1	Q8TCP9	F200A_HUMAN	family with sequence similarity 200, member A	245						integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)	p.R245Q(1)		endometrium(1)|kidney(5)|large_intestine(2)|ovary(2)|skin(1)	11						caaagcttctcgatgaataaa	0.358																																																1	Substitution - Missense(1)	ovary(1)	7											76.0	79.0	78.0					7																	99145297		1544	2704	4248	98983233	SO:0001583	missense	221786				CCDS5668.1	7q22.1	2010-02-22	2010-02-22	2010-02-22	ENSG00000221909	ENSG00000221909			25401	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 38"""	C7orf38		10607616	Standard	NM_145111		Approved	FLJ36794, DKFZp727G131	uc003ura.3	Q8TCP9	OTTHUMG00000156723	ENST00000449309.1:c.734G>A	7.37:g.99145297C>T	ENSP00000411372:p.Arg245Gln		98983233	A4D293|A8K3V9|B2RD92|C9J6A8|D6W5T2|Q8N9P3	Missense_Mutation	SNP	ENST00000449309.1	37	CCDS5668.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	13.12	2.141332	0.37825	.	.	ENSG00000221909	ENST00000449309;ENST00000408938	D;D	0.82081	-1.57;-1.57	2.28	0.435	0.16544	Ribonuclease H-like (1);	1.029300	0.07780	N	0.953273	T	0.79713	0.4493	L	0.31578	0.945	0.19775	N	0.999957	D	0.65815	0.995	P	0.60886	0.88	T	0.66077	-0.6013	10	0.10377	T	0.69	.	4.6054	0.12374	0.0:0.668:0.0:0.332	.	245	Q8TCP9	F200A_HUMAN	Q	245	ENSP00000411372:R245Q;ENSP00000386191:R245Q	ENSP00000386191:R245Q	R	-	2	0	FAM200A	98983233	0.391000	0.25221	0.792000	0.32020	0.650000	0.38633	-1.582000	0.02117	0.090000	0.17273	-0.931000	0.02705	CGA		0.358	FAM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345467.1	NM_145111		Missense_Mutation
SRRT	51593	broad.mit.edu	37	7	100482600	100482600	+	Silent	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr7:100482600C>T	ENST00000347433.4	+	9	1256	c.1098C>T	c.(1096-1098)agC>agT	p.S366S	SRRT_ENST00000388793.4_Silent_p.S366S|SRRT_ENST00000457580.2_Silent_p.S366S|SRRT_ENST00000432932.1_Silent_p.S366S			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	366	Glu-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.S366S(1)		breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						ACGAGGGCAGCGTGTCAGAGT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	7											161.0	180.0	174.0					7																	100482600		2203	4300	6503	100320536	SO:0001819	synonymous_variant	51593				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.1098C>T	7.37:g.100482600C>T			100320536	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Silent	SNP	ENST00000347433.4	37	CCDS34709.1	SNP	27	Broad																																																																																				0.567	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908		Silent
MET	4233	broad.mit.edu	37	7	116339852	116339852	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr7:116339852A>T	ENST00000318493.6	+	2	901	c.714A>T	c.(712-714)ttA>ttT	p.L238F	MET_ENST00000436117.2_Missense_Mutation_p.L238F|MET_ENST00000397752.3_Missense_Mutation_p.L238F			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L238F(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTGATGTTTTACCTGAGTTCA	0.388			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	1	Substitution - Missense(1)	ovary(1)	7											206.0	203.0	204.0					7																	116339852		1887	4106	5993	116127088	SO:0001583	missense	4233	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.714A>T	7.37:g.116339852A>T	ENSP00000317272:p.Leu238Phe		116127088	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	15.75	2.926240	0.52759	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.11930	2.73;2.73;2.73	6.17	-3.54	0.04653	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.199295	0.44483	D	0.000459	T	0.28333	0.0700	M	0.82823	2.61	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.998;0.999;0.999;0.999;0.999;1.0;0.998;0.999;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.994;0.995;1.0;0.992;0.995;0.995;0.995;0.995;0.996;0.986;0.995;1.0;1.0	T	0.13926	-1.0491	10	0.66056	D	0.02	.	3.1414	0.06457	0.313:0.299:0.2976:0.0904	.	238;238;238;238;238;238;238;238;238;238;238;238;238	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;B5A940;P08581-2;B5A942;P08581;A1L467	.;.;.;.;.;.;.;.;.;.;.;MET_HUMAN;.	F	238	ENSP00000380860:L238F;ENSP00000317272:L238F;ENSP00000410980:L238F	ENSP00000317272:L238F	L	+	3	2	MET	116127088	0.025000	0.19082	0.522000	0.27862	0.998000	0.95712	-0.731000	0.04909	-0.602000	0.05775	0.533000	0.62120	TTA		0.388	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			Missense_Mutation
DOLK	22845	broad.mit.edu	37	9	131708478	131708478	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1474-01	TCGA-24-1474-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr9:131708478C>A	ENST00000372586.3	-	1	1420	c.1105G>T	c.(1105-1107)Gtc>Ttc	p.V369F	RP11-101E3.5_ENST00000482796.1_Intron|NUP188_ENST00000372577.2_5'Flank	NM_014908.3	NP_055723.1	Q9UPQ8	DOLK_HUMAN	dolichol kinase	369					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|dolichyl monophosphate biosynthetic process (GO:0043048)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichol kinase activity (GO:0004168)	p.V369F(1)		breast(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	11						AAGATGAAGACCGCCAGGCAT	0.532																																																1	Substitution - Missense(1)	ovary(1)	9											120.0	126.0	124.0					9																	131708478		2203	4300	6503	130748299	SO:0001583	missense	22845			AB029017	CCDS6915.1	9q34.13	2014-09-17	2007-02-09	2007-02-09	ENSG00000175283	ENSG00000175283			23406	protein-coding gene	gene with protein product	"""dolichol kinase 1"""	610746	"""transmembrane protein 15"""	TMEM15		12975309, 16923818	Standard	NM_014908		Approved	KIAA1094, DK1	uc004bwr.3	Q9UPQ8	OTTHUMG00000020765	ENST00000372586.3:c.1105G>T	9.37:g.131708478C>A	ENSP00000361667:p.Val369Phe		130748299	Q5SRE6	Missense_Mutation	SNP	ENST00000372586.3	37	CCDS6915.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	15.19	2.759197	0.49468	.	.	ENSG00000175283	ENST00000372586	T	0.62364	0.03	5.23	5.23	0.72850	.	0.078723	0.49305	D	0.000141	T	0.66046	0.2750	M	0.72576	2.205	0.58432	D	0.999997	B	0.25955	0.138	B	0.29785	0.107	T	0.67632	-0.5621	10	0.72032	D	0.01	-28.164	17.7792	0.88518	0.0:1.0:0.0:0.0	.	369	Q9UPQ8	DOLK_HUMAN	F	369	ENSP00000361667:V369F	ENSP00000361667:V369F	V	-	1	0	DOLK	130748299	1.000000	0.71417	0.945000	0.38365	0.801000	0.45260	5.663000	0.68038	2.422000	0.82143	0.462000	0.41574	GTC		0.532	DOLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054515.1	NM_014908		Missense_Mutation
FUBP3	8939	broad.mit.edu	37	9	133511477	133511477	+	Silent	SNP	C	C	T	rs368255279		TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chr9:133511477C>T	ENST00000319725.9	+	18	1749	c.1674C>T	c.(1672-1674)taC>taT	p.Y558Y		NM_003934.1	NP_003925.1	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	558					positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.Y558Y(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|urinary_tract(2)	21				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		TCGCTTTCTACGGACAGACGT	0.637													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15403	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	9						C		5,4231		0,5,2113	58.0	65.0	63.0		1674	-3.4	1.0	9		63	0,8454		0,0,4227	no	coding-synonymous	FUBP3	NM_003934.1		0,5,6340	TT,TC,CC		0.0,0.118,0.0394		558/573	133511477	5,12685	2118	4227	6345	132501298	SO:0001819	synonymous_variant	8939			U69127	CCDS43893.1	9q34.11	2008-02-05			ENSG00000107164	ENSG00000107164			4005	protein-coding gene	gene with protein product		603536		FBP3		8940189	Standard	NM_003934		Approved		uc004bzr.1	Q96I24	OTTHUMG00000020809	ENST00000319725.9:c.1674C>T	9.37:g.133511477C>T			132501298	A3KFK8|A3KFL0|Q92946|Q9BVB6	Silent	SNP	ENST00000319725.9	37	CCDS43893.1	SNP	19	Broad																																																																																				0.637	FUBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054666.1			Silent
ZXDA	7789	broad.mit.edu	37	X	57935896	57935896	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chrX:57935896T>G	ENST00000358697.4	-	1	1171	c.959A>C	c.(958-960)cAc>cCc	p.H320P		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	320	Required for interaction with ZXDC.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H320P(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						CGACTGCAGGTGCCTCTTGAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	X											29.0	28.0	28.0					X																	57935896		2203	4300	6503	57952621	SO:0001583	missense	7789			L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.959A>C	X.37:g.57935896T>G	ENSP00000351530:p.His320Pro		57952621	Q9UJP7	Missense_Mutation	SNP	ENST00000358697.4	37	CCDS14376.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	.	16.55	3.155320	0.57259	.	.	ENSG00000198205	ENST00000358697	D	0.99974	-10.2	3.23	3.23	0.37069	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.99977	0.9993	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95709	0.8756	9	.	.	.	.	9.1236	0.36801	0.0:0.0:0.0:1.0	.	320	P98168	ZXDA_HUMAN	P	320	ENSP00000351530:H320P	.	H	-	2	0	ZXDA	57952621	1.000000	0.71417	0.993000	0.49108	0.910000	0.53928	3.340000	0.52143	1.505000	0.48720	0.339000	0.21740	CAC		0.632	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056925.1	NM_007156		Missense_Mutation
SMARCA1	6594	broad.mit.edu	37	X	128645834	128645834	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chrX:128645834G>A	ENST00000371122.4	-	6	886	c.757C>T	c.(757-759)Cga>Tga	p.R253*	SMARCA1_ENST00000478420.1_5'UTR|SMARCA1_ENST00000371123.1_Nonsense_Mutation_p.R253*|SMARCA1_ENST00000371121.3_Nonsense_Mutation_p.R253*	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	253	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R253*(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						GGGACCCATCGTTTAAATTCA	0.388																																																1	Substitution - Nonsense(1)	ovary(1)	X																																								128473515	SO:0001587	stop_gained	6594			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.757C>T	X.37:g.128645834G>A	ENSP00000360163:p.Arg253*		128473515	Q5JV41|Q5JV42	Nonsense_Mutation	SNP	ENST00000371122.4	37	CCDS14612.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	38	6.908317	0.97928	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	.	.	.	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.2544	13.3533	0.60613	0.0:0.0:0.8425:0.1575	.	.	.	.	X	253;253;253;232	.	ENSP00000360162:R253X	R	-	1	2	SMARCA1	128473515	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.628000	0.67791	2.279000	0.76181	0.600000	0.82982	CGA		0.388	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069		Nonsense_Mutation
ATP11C	286410	broad.mit.edu	37	X	138865393	138865393	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chrX:138865393G>C	ENST00000327569.3	-	17	1807	c.1709C>G	c.(1708-1710)tCg>tGg	p.S570W	ATP11C_ENST00000359686.2_Missense_Mutation_p.S570W|ATP11C_ENST00000370557.1_Missense_Mutation_p.S567W|ATP11C_ENST00000370543.1_Missense_Mutation_p.S570W|ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000361648.2_Missense_Mutation_p.S570W	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	570					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.S570W(1)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					AAAAACTGCCGAGTCTGCTCC	0.378																																																1	Substitution - Missense(1)	ovary(1)	X											172.0	165.0	168.0					X																	138865393		2203	4300	6503	138693059	SO:0001583	missense	286410			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.1709C>G	X.37:g.138865393G>C	ENSP00000332756:p.Ser570Trp		138693059	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	CCDS14668.1	SNP	37	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.53|18.53	3.643624|3.643624	0.67244|0.67244	.|.	.|.	ENSG00000101974|ENSG00000101974	ENST00000422228|ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	.|T;T;T;T;T	.|0.70399	.|-0.48;-0.48;-0.48;-0.48;-0.48	5.03|5.03	5.03|5.03	0.67393|0.67393	.|ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	.|0.142445	.|0.48767	.|D	.|0.000174	D|D	0.89553|0.89553	0.6748|0.6748	H|H	0.98682|0.98682	4.3|4.3	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.79784	.|0.993;0.993	D|D	0.92706|0.92706	0.6179|0.6179	5|10	.|0.87932	.|D	.|0	.|.	12.2538|12.2538	0.54613|0.54613	0.0:0.1665:0.8335:0.0|0.0:0.1665:0.8335:0.0	.|.	.|570;570	.|Q8NB49-3;Q8NB49	.|.;AT11C_HUMAN	G|W	122|567;570;570;570;570	.|ENSP00000359588:S567W;ENSP00000355165:S570W;ENSP00000332756:S570W;ENSP00000359574:S570W;ENSP00000352715:S570W	.|ENSP00000332756:S570W	R|S	-|-	1|2	2|0	ATP11C|ATP11C	138693059|138693059	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.906000|0.906000	0.53458|0.53458	7.444000|7.444000	0.80532|0.80532	2.064000|2.064000	0.61679|0.61679	0.594000|0.594000	0.82650|0.82650	CGG|TCG		0.378	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694		Missense_Mutation
SLITRK4	139065	broad.mit.edu	37	X	142716427	142716427	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1474-01	TCGA-24-1474-10			G	T	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chrX:142716427G>T	ENST00000381779.4	-	2	2723	c.2498C>A	c.(2497-2499)gCt>gAt	p.A833D	SLITRK4_ENST00000338017.4_Missense_Mutation_p.A833D|SLITRK4_ENST00000356928.1_Missense_Mutation_p.A833D	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	833						integral component of membrane (GO:0016021)		p.A833D(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					CTTGTTCAAAGCTGTTTGCTC	0.373																																																1	Substitution - Missense(1)	ovary(1)	X											99.0	87.0	91.0					X																	142716427		2203	4300	6503	142544093	SO:0001583	missense	139065			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.2498C>A	X.37:g.142716427G>T	ENSP00000371198:p.Ala833Asp		142544093	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	CCDS14679.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246717	0.80024	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.59224	0.28;0.28;0.28	5.36	5.36	0.76844	.	0.000000	0.64402	U	0.000001	T	0.71617	0.3361	L	0.55481	1.735	0.80722	D	1	D	0.71674	0.998	D	0.68621	0.959	T	0.74472	-0.3654	10	0.72032	D	0.01	-4.8503	16.6088	0.84838	0.0:0.0:1.0:0.0	.	833	Q8IW52	SLIK4_HUMAN	D	833	ENSP00000371198:A833D;ENSP00000349400:A833D;ENSP00000336627:A833D	ENSP00000336627:A833D	A	-	2	0	SLITRK4	142544093	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.776000	0.75023	2.236000	0.73375	0.529000	0.55759	GCT		0.373	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078		Missense_Mutation
GABRE	2564	broad.mit.edu	37	X	151123994	151123994	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1474-01	TCGA-24-1474-10	g.chrX:151123994C>T	ENST00000370328.3	-	8	1036	c.983G>A	c.(982-984)cGt>cAt	p.R328H	GABRE_ENST00000370325.1_Missense_Mutation_p.R328H|GABRE_ENST00000483564.1_5'UTR|AF274855.1_ENST00000582865.1_RNA	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	328					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.R215H(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GAAATTCTTACGAGAAAAGGT	0.507																																																1	Substitution - Missense(1)	ovary(1)	X											124.0	106.0	112.0					X																	151123994		2203	4300	6503	150874650	SO:0001583	missense	2564			Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.983G>A	X.37:g.151123994C>T	ENSP00000359353:p.Arg328His		150874650	E7ET93|O15345|O15346|Q6PCD2|Q99520	Missense_Mutation	SNP	ENST00000370328.3	37	CCDS14703.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306326	0.60305	.	.	ENSG00000102287	ENST00000370328;ENST00000370325	D;D	0.86694	-2.16;-2.16	5.93	4.18	0.49190	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.56097	D	0.000036	D	0.91147	0.7212	M	0.72353	2.195	0.80722	D	1	D	0.76494	0.999	D	0.64595	0.927	D	0.90311	0.4337	10	0.87932	D	0	.	9.6403	0.39835	0.0:0.828:0.0:0.172	.	328	P78334	GBRE_HUMAN	H	328	ENSP00000359353:R328H;ENSP00000359350:R328H	ENSP00000359350:R328H	R	-	2	0	GABRE	150874650	1.000000	0.71417	0.006000	0.13384	0.179000	0.23085	4.857000	0.62939	0.641000	0.30601	0.600000	0.82982	CGT		0.507	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060903.1	NM_004961, NM_021990, NM_021984		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578275	7578275	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1474-01	TCGA-24-1474-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-1474-01	TCGA-24-1474-10	g.chr17:7578275G>A	ENST00000269305.4	-	6	763	c.574C>T	c.(574-576)Cag>Tag	p.Q192*	TP53_ENST00000445888.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q192*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q192*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	192	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).|Q -> L (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q192*(83)|p.0?(8)|p.Q99*(6)|p.?(6)|p.Q60*(6)|p.P191del(4)|p.P191delP(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.G187fs*16(2)|p.P59delP(2)|p.P98delP(2)|p.P191fs*6(1)|p.A189_Q192>E(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P191_Q192delPQ(1)|p.Q192K(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.Q192del(1)|p.Q192fs*16(1)|p.L188_P191del(1)|p.Q192fs*30(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATAAGATGCTGAGGAGGGGCC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	144	Substitution - Nonsense(95)|Deletion - In frame(19)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(6)|Unknown(6)|Insertion - Frameshift(1)|Complex - frameshift(1)|Substitution - Missense(1)	breast(26)|ovary(20)|urinary_tract(15)|lung(12)|upper_aerodigestive_tract(10)|skin(8)|biliary_tract(7)|oesophagus(7)|large_intestine(6)|kidney(6)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|liver(5)|bone(4)|central_nervous_system(3)|pancreas(2)|cervix(1)|endometrium(1)|eye(1)	17											89.0	80.0	83.0					17																	7578275		2203	4300	6503	7519000	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.574C>T	17.37:g.7578275G>A	ENSP00000269305:p.Gln192*		7519000	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	13.54	2.269040	0.40095	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	3.36	0.38483	.	0.242461	0.43260	D	0.000594	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-22.6404	8.6971	0.34303	0.0:0.1484:0.545:0.3066	.	.	.	.	X	192;192;192;192;192;192;181;99;60;99;60	.	ENSP00000269305:Q192X	Q	-	1	0	TP53	7519000	1.000000	0.71417	0.987000	0.45799	0.035000	0.12851	2.163000	0.42377	0.732000	0.32470	0.655000	0.94253	CAG		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
