#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
IL32	9235	genome.wustl.edu	37	16	3119303	3119303	+	Missense_Mutation	SNP	G	G	C	rs141220342		TCGA-24-1549-01	TCGA-24-1549-10	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr16:3119303G>C	ENST00000534507.1	+	6	863	c.652G>C	c.(652-654)Gac>Cac	p.D218H	IL32_ENST00000529699.1_Missense_Mutation_p.D152H|IL32_ENST00000528163.2_Missense_Mutation_p.D172H|IL32_ENST00000548246.1_Missense_Mutation_p.D132H|IL32_ENST00000396890.2_Missense_Mutation_p.D218H|IL32_ENST00000552936.1_Missense_Mutation_p.D196H|RNU1-125P_ENST00000516752.1_RNA|IL32_ENST00000382213.3_Missense_Mutation_p.D163H|IL32_ENST00000551122.1_Missense_Mutation_p.D115H|IL32_ENST00000526464.2_Missense_Mutation_p.D172H|IL32_ENST00000529550.1_Missense_Mutation_p.D172H|IL32_ENST00000444393.3_Missense_Mutation_p.D172H|IL32_ENST00000325568.5_Missense_Mutation_p.D172H|IL32_ENST00000548652.1_Missense_Mutation_p.D163H|IL32_ENST00000551513.1_Missense_Mutation_p.D209H|IL32_ENST00000552664.1_Missense_Mutation_p.D172H|IL32_ENST00000525643.2_Missense_Mutation_p.D172H|IL32_ENST00000533097.2_Missense_Mutation_p.D172H|IL32_ENST00000440815.3_Missense_Mutation_p.D172H|IL32_ENST00000530538.2_Missense_Mutation_p.D172H|IL32_ENST00000530890.1_Missense_Mutation_p.D152H|IL32_ENST00000548476.1_Missense_Mutation_p.D218H|IL32_ENST00000549213.1_Missense_Mutation_p.D115H|IL32_ENST00000396887.3_Missense_Mutation_p.D115H|IL32_ENST00000531965.1_Missense_Mutation_p.D162H|IL32_ENST00000552356.1_Missense_Mutation_p.D152H|IL32_ENST00000008180.9_Missense_Mutation_p.D152H			P24001	IL32_HUMAN	interleukin 32	218					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)		p.D172H(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						CCCACGGGGGGACAAGGAGGA	0.577																																																1	Substitution - Missense(1)	ovary(1)	16											92.0	118.0	109.0					16																	3119303		2197	4300	6497	3059304	SO:0001583	missense	9235			M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	ENST00000534507.1:c.652G>C	16.37:g.3119303G>C	ENSP00000431775:p.Asp218His		3059304	A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Missense_Mutation	SNP	ENST00000534507.1	37		SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	7.185	0.590407	0.13812	.	.	ENSG00000008517	ENST00000325568;ENST00000534507;ENST00000531965;ENST00000396887;ENST00000529699;ENST00000526464;ENST00000440815;ENST00000529550;ENST00000551122;ENST00000525643;ENST00000548807;ENST00000528163;ENST00000530890;ENST00000444393;ENST00000533097;ENST00000008180;ENST00000396890;ENST00000548652;ENST00000530538;ENST00000549213;ENST00000552936;ENST00000548476;ENST00000552664;ENST00000552356;ENST00000551513;ENST00000382213;ENST00000548246	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57436	0.42;0.43;0.41;0.4;0.42;0.42;0.42;0.42;0.4;0.42;0.43;0.42;0.42;0.42;0.42;0.42;0.43;0.42;0.42;0.4;0.43;0.43;0.42;0.42;0.43;0.42;0.42	1.26	1.26	0.21427	.	.	.	.	.	T	0.34337	0.0894	N	0.14661	0.345	0.09310	N	1	B;P;P;P;D;P;P	0.60160	0.117;0.709;0.709;0.898;0.987;0.709;0.523	B;B;B;B;P;B;B	0.45195	0.003;0.102;0.181;0.27;0.473;0.181;0.077	T	0.14117	-1.0484	9	0.51188	T	0.08	.	6.0883	0.19980	0.0:0.0:1.0:0.0	.	132;152;163;152;218;172;115	B8Q191;C6GKH1;A6NNM0;A8MPX0;P24001;P24001-2;P24001-4	.;.;.;.;IL32_HUMAN;.;.	H	172;218;162;115;152;172;172;172;115;172;218;172;152;172;172;152;218;163;172;115;196;218;172;152;209;163;132	ENSP00000324742:D172H;ENSP00000431775:D218H;ENSP00000433177:D162H;ENSP00000380096:D115H;ENSP00000436937:D152H;ENSP00000450364:D172H;ENSP00000405063:D172H;ENSP00000437020:D172H;ENSP00000447496:D115H;ENSP00000432218:D172H;ENSP00000448354:D218H;ENSP00000432850:D172H;ENSP00000433747:D152H;ENSP00000411958:D172H;ENSP00000432917:D172H;ENSP00000008180:D152H;ENSP00000380099:D218H;ENSP00000446624:D163H;ENSP00000436929:D172H;ENSP00000447812:D115H;ENSP00000447033:D196H;ENSP00000449483:D218H;ENSP00000448683:D172H;ENSP00000446978:D152H;ENSP00000449147:D209H;ENSP00000371648:D163H;ENSP00000447979:D132H	ENSP00000008180:D152H	D	+	1	0	IL32	3059304	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.276000	0.08514	1.050000	0.40346	0.543000	0.68304	GAC		0.577	IL32-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000394812.2	NM_004221		Missense_Mutation
OR56B3P	401675	genome.wustl.edu	37	11	6150274	6150274	+	Silent	SNP	A	A	T			TCGA-24-1549-01	TCGA-24-1549-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr11:6150274A>T	ENST00000316517.2	+	1	435	c.435A>T	c.(433-435)acA>acT	p.T145T	RP11-290F24.3_ENST00000529961.1_RNA					olfactory receptor, family 56, subfamily B, member 3 pseudogene									p.T145T(1)									TCAAAGCCACACTGTCAGTAG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	11																																								6106850	SO:0001819	synonymous_variant						11p15.4	2013-09-24			ENSG00000180913	ENSG00000180913		"""GPCR / Class A : Olfactory receptors"""	15247	pseudogene	pseudogene							Standard	NG_004390		Approved					ENST00000316517.2:c.435A>T	11.37:g.6150274A>T			6106850		Silent	SNP	ENST00000316517.2	37		SNP	6	WashU																																																																																				0.488	OR56B3P-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				Silent
KIAA0232	9778	genome.wustl.edu	37	4	6862866	6862866	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1549-01	TCGA-24-1549-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr4:6862866A>T	ENST00000307659.5	+	7	1212	c.757A>T	c.(757-759)Aac>Tac	p.N253Y	KIAA0232_ENST00000425103.1_Missense_Mutation_p.N253Y	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	253							ATP binding (GO:0005524)	p.N253Y(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						CAAAAGCAAAAACGAGAAGGA	0.423																																																1	Substitution - Missense(1)	ovary(1)	4											90.0	88.0	88.0					4																	6862866		1898	4135	6033	6913767	SO:0001583	missense	9778			D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.757A>T	4.37:g.6862866A>T	ENSP00000303928:p.Asn253Tyr		6913767	A7E2D2	Missense_Mutation	SNP	ENST00000307659.5	37	CCDS43209.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	10.92	1.486828	0.26686	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.33	1.78	0.24846	.	0.484707	0.25344	N	0.031350	T	0.32585	0.0834	L	0.47716	1.5	0.09310	N	1	B	0.20671	0.047	B	0.20384	0.029	T	0.26780	-1.0093	9	0.62326	D	0.03	0.5686	6.8747	0.24141	0.4383:0.4067:0.155:0.0	.	253	Q92628	K0232_HUMAN	Y	253	.	ENSP00000303928:N253Y	N	+	1	0	KIAA0232	6913767	0.987000	0.35691	0.000000	0.03702	0.533000	0.34776	5.585000	0.67497	0.051000	0.15978	0.459000	0.35465	AAC		0.423	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743		Missense_Mutation
PTPRM	5797	genome.wustl.edu	37	18	7949198	7949198	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1549-01	TCGA-24-1549-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr18:7949198C>T	ENST00000332175.8	+	6	1720	c.683C>T	c.(682-684)gCt>gTt	p.A228V	PTPRM_ENST00000580170.1_Missense_Mutation_p.A228V|PTPRM_ENST00000400060.4_Missense_Mutation_p.A228V|PTPRM_ENST00000400053.4_Missense_Mutation_p.A166V|PTPRM_ENST00000444013.1_Missense_Mutation_p.A15V	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	228	Ig-like C2-type.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A228V(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GTGCGAGATGCTCCTCTGAAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	18											129.0	114.0	119.0					18																	7949198		2203	4300	6503	7939198	SO:0001583	missense	5797			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.683C>T	18.37:g.7949198C>T	ENSP00000331418:p.Ala228Val		7939198	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	13.75	2.329961	0.41297	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.77620	-1.11;-1.11;-1.11;0.86	5.86	5.0	0.66597	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.051084	0.85682	D	0.000000	T	0.60766	0.2294	N	0.24115	0.695	0.45403	D	0.998389	P;B;B	0.34757	0.467;0.002;0.002	B;B;B	0.19391	0.025;0.002;0.002	T	0.59968	-0.7354	10	0.17369	T	0.5	.	15.2825	0.73797	0.0:0.933:0.0:0.067	.	15;228;228	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	V	228;228;166;15	ENSP00000331418:A228V;ENSP00000382933:A228V;ENSP00000382927:A166V;ENSP00000387608:A15V	ENSP00000331418:A228V	A	+	2	0	PTPRM	7939198	1.000000	0.71417	0.975000	0.42487	0.935000	0.57460	4.727000	0.61993	1.631000	0.50456	0.650000	0.86243	GCT		0.463	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1			Missense_Mutation
FAM134B	54463	genome.wustl.edu	37	5	16478974	16478974	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1549-01	TCGA-24-1549-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr5:16478974T>C	ENST00000306320.9	-	6	879	c.793A>G	c.(793-795)Aaa>Gaa	p.K265E	FAM134B_ENST00000399793.2_Missense_Mutation_p.K124E	NM_001034850.2	NP_001030022.1	Q9H6L5	F134B_HUMAN	family with sequence similarity 134, member B	265					sensory perception of pain (GO:0019233)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.K265E(1)		breast(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(1)	16						CTCTCACGTTTCTTCTGATTA	0.289																																																1	Substitution - Missense(1)	ovary(1)	5											93.0	91.0	91.0					5																	16478974		1811	4067	5878	16531974	SO:0001583	missense	54463			BC053326	CCDS43304.1, CCDS43305.1	5p15.1	2014-09-17			ENSG00000154153	ENSG00000154153			25964	protein-coding gene	gene with protein product		613114				19838196, 24327336	Standard	NM_001034850		Approved	FLJ20152	uc003jfs.3	Q9H6L5	OTTHUMG00000161788	ENST00000306320.9:c.793A>G	5.37:g.16478974T>C	ENSP00000304642:p.Lys265Glu		16531974	Q69YN8|Q9H6K6|Q9H764|Q9NXM8	Missense_Mutation	SNP	ENST00000306320.9	37	CCDS43304.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	11.73	1.725244	0.30593	.	.	ENSG00000154153	ENST00000399793;ENST00000306320	T;T	0.41065	1.01;1.01	5.61	4.4	0.53042	.	0.260060	0.43747	D	0.000532	T	0.26231	0.0640	L	0.38175	1.15	0.28344	N	0.92123	P;B	0.38922	0.651;0.001	B;B	0.27887	0.084;0.002	T	0.26155	-1.0111	10	0.45353	T	0.12	-11.3829	8.6312	0.33919	0.1274:0.0:0.1332:0.7394	.	265;124	Q9H6L5;Q9H6L5-2	F134B_HUMAN;.	E	124;265	ENSP00000382691:K124E;ENSP00000304642:K265E	ENSP00000304642:K265E	K	-	1	0	FAM134B	16531974	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.251000	0.58778	2.147000	0.66899	0.477000	0.44152	AAA		0.289	FAM134B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366090.1	NM_001034850		Missense_Mutation
CFAP61	26074	genome.wustl.edu	37	20	20269566	20269566	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr20:20269566G>A	ENST00000245957.5	+	23	3186	c.3110G>A	c.(3109-3111)gGa>gAa	p.G1037E	C20orf26_ENST00000377309.2_Intron	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		1037								p.G1037E(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		ATGTACAAGGGAGCCAAGATT	0.512																																																1	Substitution - Missense(1)	ovary(1)	20											42.0	34.0	37.0					20																	20269566		2203	4300	6503	20217566	SO:0001583	missense	26074																														ENST00000245957.5:c.3110G>A	20.37:g.20269566G>A	ENSP00000245957:p.Gly1037Glu		20217566	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	CCDS33447.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	9.670	1.146494	0.21288	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	T	0.08282	3.11	5.48	4.52	0.55395	.	0.196102	0.45361	D	0.000366	T	0.15652	0.0377	L	0.42245	1.32	0.80722	D	1	D	0.69078	0.997	P	0.59357	0.856	T	0.04811	-1.0925	10	0.07030	T	0.85	.	16.2638	0.82563	0.0:0.1329:0.8671:0.0	.	1037	Q8NHU2	CT026_HUMAN	E	977;1003;1037	ENSP00000245957:G1037E	ENSP00000245957:G1037E	G	+	2	0	C20orf26	20217566	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	3.452000	0.52971	1.292000	0.44672	0.650000	0.86243	GGA		0.512	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3			Missense_Mutation
ZNF208	7757	genome.wustl.edu	37	19	22155079	22155079	+	Silent	SNP	A	A	G			TCGA-24-1549-01	TCGA-24-1549-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr19:22155079A>G	ENST00000397126.4	-	4	2905	c.2757T>C	c.(2755-2757)tgT>tgC	p.C919C	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	919					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.C819C(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CACATTCTTCACATTTGTAGG	0.383																																																1	Substitution - coding silent(1)	ovary(1)	19											51.0	54.0	53.0					19																	22155079		2094	4230	6324	21946919	SO:0001819	synonymous_variant	7757			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2757T>C	19.37:g.22155079A>G			21946919		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	SNP	6	WashU																																																																																				0.383	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		Missense_Mutation
SPATA6	54558	genome.wustl.edu	37	1	48821392	48821392	+	Missense_Mutation	SNP	G	G	A	rs148746931		TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr1:48821392G>A	ENST00000371847.3	-	11	1308	c.1144C>T	c.(1144-1146)Cgg>Tgg	p.R382W	SPATA6_ENST00000396199.3_Missense_Mutation_p.R310W|SPATA6_ENST00000371843.3_Missense_Mutation_p.R382W	NM_019073.2	NP_061946.1	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6	382					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)		p.R382W(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	21						TTTTTTACCCGGTCATGGATC	0.294																																																1	Substitution - Missense(1)	ovary(1)	1						G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	97.0	98.0	97.0		1144	4.7	1.0	1	dbSNP_134	97	0,8600		0,0,4300	no	missense	SPATA6	NM_019073.2	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	382/489	48821392	1,13005	2203	4300	6503	48593979	SO:0001583	missense	54558			AK000869	CCDS551.1, CCDS65535.1, CCDS72787.1	1p32.3	2012-03-15			ENSG00000132122	ENSG00000132122			18309	protein-coding gene	gene with protein product	"""spermatogenesis-related factor-1"""	613947					Standard	XM_005270948		Approved	SRF1, FLJ10007, SRF-1	uc001crr.2	Q9NWH7	OTTHUMG00000007794	ENST00000371847.3:c.1144C>T	1.37:g.48821392G>A	ENSP00000360913:p.Arg382Trp		48593979	Q5T3N7|Q8WUE6	Missense_Mutation	SNP	ENST00000371847.3	37	CCDS551.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	18.78	3.696546	0.68386	2.27E-4	0.0	ENSG00000132122	ENST00000371847;ENST00000371843;ENST00000396199;ENST00000371841	T;T;T;T	0.54071	1.69;2.0;1.9;0.59	4.71	4.71	0.59529	.	0.000000	0.64402	D	0.000001	T	0.67924	0.2945	M	0.66297	2.02	0.46416	D	0.999038	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.996;0.996	T	0.70178	-0.4943	10	0.87932	D	0	.	10.6085	0.45408	0.0:0.0:0.7104:0.2896	.	310;382;382	B4DX17;Q9NWH7-2;Q9NWH7	.;.;SPAT6_HUMAN	W	382;382;310;223	ENSP00000360913:R382W;ENSP00000360909:R382W;ENSP00000379502:R310W;ENSP00000360907:R223W	ENSP00000360907:R223W	R	-	1	2	SPATA6	48593979	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.304000	0.43655	2.613000	0.88420	0.591000	0.81541	CGG		0.294	SPATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021347.1	NM_019073		Missense_Mutation
KDM5C	8242	genome.wustl.edu	37	X	53230865	53230865	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chrX:53230865G>A	ENST00000375401.3	-	14	2460	c.1928C>T	c.(1927-1929)tCc>tTc	p.S643F	KDM5C_ENST00000404049.3_Missense_Mutation_p.S642F|KDM5C_ENST00000465402.1_5'UTR|KDM5C_ENST00000375379.3_Missense_Mutation_p.S643F|KDM5C_ENST00000452825.3_Missense_Mutation_p.S576F|KDM5C_ENST00000375383.3_Missense_Mutation_p.S602F	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	643					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.S643F(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CTCCTCATGGGAGAAGACGCA	0.567			"""N, F, S"""		clear cell renal carcinoma																																		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	1	Substitution - Missense(1)	ovary(1)	X											61.0	53.0	56.0					X																	53230865		2203	4300	6503	53247590	SO:0001583	missense	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1928C>T	X.37:g.53230865G>A	ENSP00000364550:p.Ser643Phe		53247590	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931431	0.92389	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.85961	0.5819	M	0.90309	3.105	0.80722	D	1	D;D;D	0.64830	0.994;0.99;0.99	D;P;P	0.64042	0.921;0.759;0.836	D	0.88958	0.3391	10	0.87932	D	0	-12.1331	15.8095	0.78547	0.0:0.0:1.0:0.0	.	576;642;643	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	F	576;643;642;643;602	ENSP00000445176:S576F;ENSP00000364550:S643F;ENSP00000385394:S642F;ENSP00000364528:S643F;ENSP00000364532:S602F	ENSP00000364528:S643F	S	-	2	0	KDM5C	53247590	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.869000	0.99810	2.331000	0.79229	0.600000	0.82982	TCC		0.567	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187		Missense_Mutation
DST	667	genome.wustl.edu	37	6	56329537	56329537	+	Nonsense_Mutation	SNP	T	T	A			TCGA-24-1549-01	TCGA-24-1549-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr6:56329537T>A	ENST00000361203.3	-	95	21752	c.21745A>T	c.(21745-21747)Aaa>Taa	p.K7249*	DST_ENST00000446842.2_Nonsense_Mutation_p.K7034*|DST_ENST00000370788.2_Nonsense_Mutation_p.K5163*|DST_ENST00000421834.2_Nonsense_Mutation_p.K5245*|DST_ENST00000370769.4_Nonsense_Mutation_p.K7360*|DST_ENST00000370754.5_Nonsense_Mutation_p.K7538*|DST_ENST00000312431.6_Intron|DST_ENST00000244364.6_Intron			Q03001	DYST_HUMAN	dystonin	7358	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.K7333*(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CGTAACATTTTACTCCCATGA	0.373																																																1	Substitution - Nonsense(1)	ovary(1)	6											21.0	20.0	20.0					6																	56329537		875	1991	2866	56437496	SO:0001587	stop_gained	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.21745A>T	6.37:g.56329537T>A	ENSP00000354508:p.Lys7249*		56437496	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	ENST00000361203.3	37		SNP	61	WashU	.	.	.	.	.	.	.	.	.	.	T	59	35.016866	0.99982	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	.	.	.	6.07	6.07	0.98685	.	0.000000	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.6407	0.85098	0.0:0.0:0.0:1.0	.	.	.	.	X	7538;7360;5245;7034;5163;7249	.	ENSP00000354508:K7249X	K	-	1	0	DST	56437496	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.326000	0.78906	0.533000	0.62120	AAA		0.373	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		Nonsense_Mutation
CDH26	60437	genome.wustl.edu	37	20	58569457	58569457	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1549-01	TCGA-24-1549-10	C	C	G	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr20:58569457C>G	ENST00000244047.5	+	11	1890	c.1579C>G	c.(1579-1581)Ctg>Gtg	p.L527V	CDH26_ENST00000244049.3_5'Flank|CDH26_ENST00000348616.4_Missense_Mutation_p.L527V|CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000350849.6_5'Flank			Q8IXH8	CAD26_HUMAN	cadherin 26	527					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L527V(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GGATCCGGACCTGGAGCCGTT	0.537																																																1	Substitution - Missense(1)	ovary(1)	20											66.0	62.0	63.0					20																	58569457		2203	4300	6503	58002852	SO:0001583	missense	60437			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1579C>G	20.37:g.58569457C>G	ENSP00000244047:p.Leu527Val		58002852	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	ENST00000244047.5	37		SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	15.00	2.702564	0.48307	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.61510	0.1;0.1	4.58	3.51	0.40186	Cadherin-like (1);	0.528138	0.17536	N	0.170701	T	0.53029	0.1771	M	0.78344	2.41	0.31566	N	0.656864	P;P	0.40602	0.604;0.723	B;B	0.40901	0.254;0.343	T	0.58289	-0.7662	10	0.27082	T	0.32	.	3.5747	0.07930	0.0:0.6148:0.0:0.3852	.	527;527	Q8IXH8;Q8IXH8-4	CAD26_HUMAN;.	V	527	ENSP00000244047:L527V;ENSP00000339390:L527V	ENSP00000244047:L527V	L	+	1	2	CDH26	58002852	0.403000	0.25319	0.590000	0.28732	0.479000	0.33129	0.730000	0.26043	2.071000	0.62044	0.655000	0.94253	CTG		0.537	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980		Missense_Mutation
PCDH20	64881	genome.wustl.edu	37	13	61986811	61986811	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1549-01	TCGA-24-1549-10	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr13:61986811G>A	ENST00000409186.1	-	5	3526	c.1421C>T	c.(1420-1422)cCg>cTg	p.P474L	PCDH20_ENST00000409204.4_Missense_Mutation_p.P474L			Q8N6Y1	PCD20_HUMAN	protocadherin 20	474	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.P447L(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TAACCTAAACGGCCCTTCACC	0.408																																																1	Substitution - Missense(1)	ovary(1)	13											114.0	112.0	112.0					13																	61986811		2203	4300	6503	60884812	SO:0001583	missense	64881			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.1421C>T	13.37:g.61986811G>A	ENSP00000386653:p.Pro474Leu		60884812	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	ENST00000409186.1	37	CCDS9442.2	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	16.37	3.104393	0.56291	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.61510	0.1;0.1	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000006	T	0.80544	0.4643	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82210	-0.0570	10	0.87932	D	0	.	20.2768	0.98488	0.0:0.0:1.0:0.0	.	474	A8K1K9	.	L	474;474;220	ENSP00000387250:P474L;ENSP00000386653:P474L	ENSP00000351500:P220L	P	-	2	0	PCDH20	60884812	1.000000	0.71417	0.948000	0.38648	0.462000	0.32619	9.807000	0.99171	2.808000	0.96608	0.650000	0.86243	CCG		0.408	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843		Missense_Mutation
OPHN1	4983	genome.wustl.edu	37	X	67283809	67283809	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1549-01	TCGA-24-1549-10	G	G	T	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chrX:67283809G>T	ENST00000355520.5	-	21	2686	c.2045C>A	c.(2044-2046)aCc>aAc	p.T682N	OPHN1_ENST00000484842.1_5'UTR|OPHN1_ENST00000540071.1_Intron	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	682	Pro-rich.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.T682N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						GGTGATCTTGGTCCCTCCATC	0.617																																																1	Substitution - Missense(1)	ovary(1)	X											78.0	59.0	66.0					X																	67283809		2203	4300	6503	67200534	SO:0001583	missense	4983			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.2045C>A	X.37:g.67283809G>T	ENSP00000347710:p.Thr682Asn		67200534	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	ENST00000355520.5	37	CCDS14388.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	3.819	-0.038092	0.07497	.	.	ENSG00000079482	ENST00000355520	T	0.42900	0.96	4.9	2.03	0.26663	.	0.909070	0.09418	N	0.804851	T	0.20861	0.0502	N	0.08118	0	0.54753	D	0.999988	B	0.22604	0.072	B	0.14023	0.01	T	0.06092	-1.0846	10	0.26408	T	0.33	.	6.1452	0.20280	0.1045:0.3579:0.5375:0.0	.	682	O60890	OPHN1_HUMAN	N	682	ENSP00000347710:T682N	ENSP00000347710:T682N	T	-	2	0	OPHN1	67200534	0.997000	0.39634	0.813000	0.32504	0.301000	0.27625	0.895000	0.28363	0.101000	0.17610	0.506000	0.49869	ACC		0.617	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057011.1	NM_002547		Missense_Mutation
PRDM14	63978	genome.wustl.edu	37	8	70978519	70978519	+	Silent	SNP	C	C	A			TCGA-24-1549-01	TCGA-24-1549-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr8:70978519C>A	ENST00000276594.2	-	5	1335	c.1134G>T	c.(1132-1134)gtG>gtT	p.V378V		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	378					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.V378V(1)		NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			CCTGAAGGCTCACAGGAATAT	0.512																																					NSCLC(129;99 1813 5906 40656 46114)											1	Substitution - coding silent(1)	ovary(1)	8											69.0	72.0	71.0					8																	70978519		2203	4300	6503	71141073	SO:0001819	synonymous_variant	63978			AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.1134G>T	8.37:g.70978519C>A			71141073	Q86UX9	Silent	SNP	ENST00000276594.2	37	CCDS6206.1	SNP	29	WashU																																																																																				0.512	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1			Silent
NEGR1	257194	genome.wustl.edu	37	1	72740691	72740691	+	Intron	SNP	G	G	T			TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr1:72740691G>T	ENST00000357731.5	-	1	416				NEGR1_ENST00000434200.1_Intron	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1						feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		GGAAACCAAGGAGCCTGAGAA	0.473																																																0			1																																								72513279	SO:0001627	intron_variant				AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.176+7310C>A	1.37:g.72740691G>T			72513279	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Nonsense_Mutation	SNP	ENST00000357731.5	37	CCDS661.1	SNP	41	WashU																																																																																				0.473	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808		Nonsense_Mutation
PRKRIR	5612	genome.wustl.edu	37	11	76062525	76062525	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr11:76062525G>A	ENST00000260045.3	-	5	1774	c.1669C>T	c.(1669-1671)Cgc>Tgc	p.R557C	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	557					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R557C(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						TGAGCTCTGCGGAATTTCCCA	0.398																																																1	Substitution - Missense(1)	ovary(1)	11											29.0	25.0	27.0					11																	76062525		2065	4162	6227	75740173	SO:0001583	missense	5612			AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.1669C>T	11.37:g.76062525G>A	ENSP00000260045:p.Arg557Cys		75740173	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	37	CCDS8243.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	10.35	1.324541	0.24080	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	.	.	.	5.13	3.12	0.35913	Ribonuclease H-like (1);	0.324194	0.38492	N	0.001675	T	0.36799	0.0980	N	0.16478	0.41	0.48288	D	0.999628	B	0.02656	0.0	B	0.01281	0.0	T	0.16778	-1.0391	9	0.37606	T	0.19	.	7.8485	0.29440	0.1485:0.1346:0.717:0.0	.	557	O43422	P52K_HUMAN	C	382;557	.	ENSP00000260045:R557C	R	-	1	0	PRKRIR	75740173	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.935000	0.40173	1.342000	0.45619	0.644000	0.83932	CGC		0.398	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705		Missense_Mutation
DNAAF1	123872	genome.wustl.edu	37	16	84188205	84188205	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr16:84188205G>C	ENST00000378553.5	+	4	500	c.376G>C	c.(376-378)Gaa>Caa	p.E126Q	DNAAF1_ENST00000334315.5_Missense_Mutation_p.E126Q	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	126					axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)	p.E126Q(1)		NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						TGAGAACCTGGAAGAGTACAC	0.507																																																1	Substitution - Missense(1)	ovary(1)	16											95.0	91.0	92.0					16																	84188205		2200	4300	6500	82745706	SO:0001583	missense	123872			BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.376G>C	16.37:g.84188205G>C	ENSP00000367815:p.Glu126Gln		82745706	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Missense_Mutation	SNP	ENST00000378553.5	37	CCDS10943.2	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437871	0.83885	.	.	ENSG00000154099	ENST00000334315;ENST00000378553	T;T	0.22539	1.95;1.95	4.99	4.99	0.66335	.	0.057447	0.64402	D	0.000002	T	0.41673	0.1169	L	0.49455	1.56	0.54753	D	0.999986	D	0.89917	1.0	D	0.80764	0.994	T	0.26360	-1.0105	10	0.66056	D	0.02	-11.6661	16.4493	0.83974	0.0:0.0:1.0:0.0	.	126	Q8NEP3	DAAF1_HUMAN	Q	126	ENSP00000334593:E126Q;ENSP00000367815:E126Q	ENSP00000334593:E126Q	E	+	1	0	DNAAF1	82745706	1.000000	0.71417	0.999000	0.59377	0.820000	0.46376	7.508000	0.81686	2.306000	0.77630	0.650000	0.86243	GAA		0.507	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250328.3	NM_178452		Missense_Mutation
DACH2	117154	genome.wustl.edu	37	X	85415494	85415494	+	Intron	SNP	T	T	G			TCGA-24-1549-01	TCGA-24-1549-10	T	T	G	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chrX:85415494T>G	ENST00000373125.4	+	1	488				DACH2_ENST00000373131.1_Intron	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2						development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						ATCAATCTTTTCCTTCAGTAC	0.473																																																0			X																																								85302150	SO:0001627	intron_variant				AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.488+11382T>G	X.37:g.85415494T>G			85302150	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	SNP	62	WashU																																																																																				0.473	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281		Missense_Mutation
GRID1	2894	genome.wustl.edu	37	10	87489325	87489325	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1549-01	TCGA-24-1549-10	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr10:87489325T>A	ENST00000327946.7	-	9	1365	c.1280A>T	c.(1279-1281)gAg>gTg	p.E427V	GRID1_ENST00000536331.1_5'UTR	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	427					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.E427V(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CATGGGCCTCTCTTGCAAGCT	0.537										Multiple Myeloma(13;0.14)																																						1	Substitution - Missense(1)	ovary(1)	10											82.0	78.0	79.0					10																	87489325		2203	4300	6503	87479305	SO:0001583	missense	2894			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1280A>T	10.37:g.87489325T>A	ENSP00000330148:p.Glu427Val		87479305	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	24.4	4.522366	0.85600	.	.	ENSG00000182771	ENST00000327946	T	0.12774	2.65	5.54	5.54	0.83059	.	0.043943	0.85682	D	0.000000	T	0.25457	0.0619	L	0.29908	0.895	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.01688	-1.1295	10	0.36615	T	0.2	.	14.8342	0.70169	0.0:0.0:0.0:1.0	.	427	Q9ULK0	GRID1_HUMAN	V	427	ENSP00000330148:E427V	ENSP00000330148:E427V	E	-	2	0	GRID1	87479305	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	2.094000	0.63399	0.533000	0.62120	GAG		0.537	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		Missense_Mutation
GAL3ST4	79690	genome.wustl.edu	37	7	99757959	99757959	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1549-01	TCGA-24-1549-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr7:99757959C>A	ENST00000360039.4	-	4	1445	c.1053G>T	c.(1051-1053)gaG>gaT	p.E351D	GAL3ST4_ENST00000423751.1_3'UTR|C7orf43_ENST00000316937.3_5'Flank|C7orf43_ENST00000457641.1_5'Flank|GAL3ST4_ENST00000413800.1_Missense_Mutation_p.E351D|GAL3ST4_ENST00000411994.1_3'UTR|C7orf43_ENST00000419841.1_5'Flank|GAL3ST4_ENST00000426974.2_Missense_Mutation_p.E289D	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	351					cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)	p.E351D(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCTGCCGGTCCTCCGCAGTCA	0.592																																																1	Substitution - Missense(1)	ovary(1)	7											53.0	55.0	54.0					7																	99757959		2203	4300	6503	99595895	SO:0001583	missense	79690			AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.1053G>T	7.37:g.99757959C>A	ENSP00000353142:p.Glu351Asp		99595895	A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Missense_Mutation	SNP	ENST00000360039.4	37	CCDS5688.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	11.24	1.580744	0.28180	.	.	ENSG00000197093	ENST00000413800;ENST00000360039;ENST00000426974	T;T;T	0.16073	2.37;2.37;2.37	5.12	2.31	0.28768	.	0.692716	0.10978	U	0.613041	T	0.15696	0.0378	L	0.36672	1.1	0.36769	D	0.883673	P;P	0.44521	0.801;0.837	B;B	0.44315	0.315;0.446	T	0.19192	-1.0313	10	0.21540	T	0.41	-11.9211	9.0872	0.36587	0.0:0.7575:0.0:0.2425	.	289;351	B4DWL8;Q96RP7	.;G3ST4_HUMAN	D	351;351;289	ENSP00000400451:E351D;ENSP00000353142:E351D;ENSP00000398304:E289D	ENSP00000353142:E351D	E	-	3	2	GAL3ST4	99595895	0.032000	0.19561	0.467000	0.27180	0.026000	0.11368	-0.114000	0.10757	0.318000	0.23185	0.511000	0.50034	GAG		0.592	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337495.2	NM_024637		Missense_Mutation
GRIN3A	116443	genome.wustl.edu	37	9	104432718	104432718	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr9:104432718G>T	ENST00000361820.3	-	3	2576	c.1976C>A	c.(1975-1977)aCc>aAc	p.T659N		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	659					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.T659N(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TGTATCTCGGGTCCTCACTAA	0.532																																																1	Substitution - Missense(1)	ovary(1)	9											73.0	78.0	77.0					9																	104432718		2203	4300	6503	103472539	SO:0001583	missense	116443				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1976C>A	9.37:g.104432718G>T	ENSP00000355155:p.Thr659Asn		103472539	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	19.05	3.752486	0.69533	.	.	ENSG00000198785	ENST00000361820	T	0.27256	1.68	5.63	5.63	0.86233	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.113322	0.64402	D	0.000016	T	0.40839	0.1133	L	0.36672	1.1	0.58432	D	0.999998	P	0.48764	0.915	P	0.57720	0.826	T	0.09907	-1.0653	10	0.72032	D	0.01	.	20.1163	0.97934	0.0:0.0:1.0:0.0	.	659	Q8TCU5	NMD3A_HUMAN	N	659	ENSP00000355155:T659N	ENSP00000355155:T659N	T	-	2	0	GRIN3A	103472539	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.445000	0.80570	2.829000	0.97493	0.580000	0.79431	ACC		0.532	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1			Missense_Mutation
RIMS2	9699	genome.wustl.edu	37	8	104709458	104709458	+	Silent	SNP	C	C	T			TCGA-24-1549-01	TCGA-24-1549-10	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr8:104709458C>T	ENST00000406091.3	+	2	321	c.321C>T	c.(319-321)aaC>aaT	p.N107N		NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	138	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.N143N(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GTGGCCATAACTGTTCATATT	0.433										HNSCC(12;0.0054)																																						1	Substitution - coding silent(1)	ovary(1)	8											194.0	193.0	193.0					8																	104709458		1986	4174	6160	104778634	SO:0001819	synonymous_variant	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.321C>T	8.37:g.104709458C>T			104778634	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000406091.3	37	CCDS55269.1	SNP	20	WashU																																																																																				0.433	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001100117		Silent
SNX19	399979	genome.wustl.edu	37	11	130785599	130785599	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1549-01	TCGA-24-1549-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr11:130785599A>G	ENST00000265909.4	-	1	805	c.236T>C	c.(235-237)cTg>cCg	p.L79P	SNX19_ENST00000533214.1_Missense_Mutation_p.L79P|SNX19_ENST00000539184.1_Intron|SNX19_ENST00000528555.1_Intron|SNX19_ENST00000530356.1_Intron|SNX19_ENST00000533318.1_Intron	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	79					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.L79P(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		GAAGCGTTCCAGATGCAGTCG	0.587																																																1	Substitution - Missense(1)	ovary(1)	11											71.0	57.0	62.0					11																	130785599		2201	4297	6498	130290809	SO:0001583	missense	399979			D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.236T>C	11.37:g.130785599A>G	ENSP00000265909:p.Leu79Pro		130290809	E9PKB9|Q8IV55	Missense_Mutation	SNP	ENST00000265909.4	37	CCDS31721.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	13.92	2.381427	0.42207	.	.	ENSG00000120451	ENST00000265909;ENST00000533214	T;T	0.29655	1.9;1.56	4.84	3.7	0.42460	.	0.160462	0.41605	D	0.000853	T	0.50171	0.1600	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.49351	-0.8949	10	0.62326	D	0.03	-9.6121	11.4421	0.50102	0.8485:0.1514:0.0:0.0	.	79;79	E9PKB9;Q92543	.;SNX19_HUMAN	P	79	ENSP00000265909:L79P;ENSP00000435390:L79P	ENSP00000265909:L79P	L	-	2	0	SNX19	130290809	1.000000	0.71417	0.998000	0.56505	0.084000	0.17831	6.732000	0.74790	0.842000	0.35045	0.374000	0.22700	CTG		0.587	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758		Missense_Mutation
NTM	50863	genome.wustl.edu	37	11	132016194	132016194	+	Silent	SNP	G	G	A	rs146934731		TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr11:132016194G>A	ENST00000374786.1	+	2	665	c.186G>A	c.(184-186)cgG>cgA	p.R62R	NTM_ENST00000374791.3_Silent_p.R62R|NTM_ENST00000427481.2_Silent_p.R53R|NTM_ENST00000374784.1_Silent_p.R62R|NTM_ENST00000539799.1_Silent_p.R62R|NTM_ENST00000425719.2_Silent_p.R62R	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	62	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R62R(1)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						TTGACAACCGGGTCACCCGGG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	11						G	,,,	1,4401	2.1+/-5.4	0,1,2200	117.0	94.0	102.0		186,186,186,186	0.8	1.0	11	dbSNP_134	102	0,8594		0,0,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NTM	NM_001048209.1,NM_001144058.1,NM_001144059.1,NM_016522.2	,,,	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	,,,	62/345,62/356,62/317,62/345	132016194	1,12995	2201	4297	6498	131521404	SO:0001819	synonymous_variant	50863			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.186G>A	11.37:g.132016194G>A			131521404	A0MTT2|Q6UXJ3|Q86VJ9	Silent	SNP	ENST00000374786.1	37	CCDS8491.1	SNP	43	WashU																																																																																				0.577	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522		Silent
MAP3K19	80122	genome.wustl.edu	37	2	135756432	135756432	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1549-01	TCGA-24-1549-10	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr2:135756432C>G	ENST00000375845.3	-	5	480	c.450G>C	c.(448-450)agG>agC	p.R150S	MAP3K19_ENST00000392918.3_Missense_Mutation_p.R150S|MAP3K19_ENST00000392915.1_Missense_Mutation_p.R167S|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000375844.3_Missense_Mutation_p.R150S|MAP3K19_ENST00000392917.3_Missense_Mutation_p.R150S|MAP3K19_ENST00000358371.4_Intron	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	150							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R150S(1)									TGCAGAGCTCCCTGGAACTTT	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											81.0	83.0	82.0					2																	135756432		2203	4300	6503	135472902	SO:0001583	missense	80122			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.450G>C	2.37:g.135756432C>G	ENSP00000365005:p.Arg150Ser		135472902	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	37	CCDS2176.2	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092218	0.36952	.	.	ENSG00000176601	ENST00000375845;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000392915	T;T;T;T;T	0.71222	-0.5;-0.48;-0.55;-0.45;1.87	5.19	3.33	0.38152	.	1.281410	0.05519	N	0.561682	T	0.53302	0.1788	N	0.22421	0.69	0.19775	N	0.999959	B;B;B;B;B;B	0.25667	0.005;0.131;0.02;0.131;0.02;0.081	B;B;B;B;B;B	0.21151	0.005;0.033;0.025;0.033;0.025;0.01	T	0.41251	-0.9519	10	0.09084	T	0.74	.	6.8559	0.24040	0.1728:0.7365:0.0:0.0907	.	150;150;150;167;150;150	B7ZMH9;Q56UN5-2;Q56UN5-4;A8MWG7;Q56UN5-5;Q56UN5	.;.;.;.;.;YSK4_HUMAN	S	150;150;150;150;167	ENSP00000365005:R150S;ENSP00000365004:R150S;ENSP00000376650:R150S;ENSP00000376649:R150S;ENSP00000376647:R167S	ENSP00000365004:R150S	R	-	3	2	YSK4	135472902	0.000000	0.05858	0.190000	0.23270	0.138000	0.21146	0.194000	0.17135	1.399000	0.46721	0.609000	0.83330	AGG		0.428	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052		Missense_Mutation
SLITRK2	84631	genome.wustl.edu	37	X	144905177	144905177	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chrX:144905177G>A	ENST00000370490.1	+	1	5489	c.1234G>A	c.(1234-1236)Gca>Aca	p.A412T	SLITRK2_ENST00000447897.2_Missense_Mutation_p.A412T|SLITRK2_ENST00000434188.2_Missense_Mutation_p.A412T|SLITRK2_ENST00000428560.2_Missense_Mutation_p.A412T|SLITRK2_ENST00000413937.2_Missense_Mutation_p.A412T			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	412					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.A412T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CAACAGGATTGCAGTCATTCA	0.403																																																1	Substitution - Missense(1)	ovary(1)	X											113.0	108.0	110.0					X																	144905177		2203	4300	6503	144712869	SO:0001583	missense	84631			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1234G>A	X.37:g.144905177G>A	ENSP00000359521:p.Ala412Thr		144712869	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	14.06	2.423288	0.43020	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57	5.49	5.49	0.81192	.	0.055575	0.64402	D	0.000001	T	0.29684	0.0741	N	0.01438	-0.865	0.54753	D	0.999985	P	0.38223	0.623	P	0.44772	0.46	T	0.39143	-0.9628	10	0.02654	T	1	-5.8855	15.6062	0.76672	0.0:0.0:1.0:0.0	.	412	Q9H156	SLIK2_HUMAN	T	412	ENSP00000334374:A412T;ENSP00000411681:A412T;ENSP00000359521:A412T;ENSP00000397015:A412T;ENSP00000407347:A412T;ENSP00000412010:A412T	ENSP00000334374:A412T	A	+	1	0	SLITRK2	144712869	1.000000	0.71417	0.878000	0.34440	0.896000	0.52359	4.709000	0.61867	2.280000	0.76307	0.594000	0.82650	GCA		0.403	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		Missense_Mutation
Unknown	0	genome.wustl.edu	37	1	148903435	148903435	+	IGR	SNP	G	G	A			TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr1:148903435G>A								RP11-763B22.6 (49718 upstream) : RNA5SP59 (9837 downstream)																							TGCCTTCAACGCCGACTTCCG	0.597																																																0			1																																								147170059	SO:0001628	intergenic_variant																																1.37:g.148903435G>A			147170059		Missense_Mutation	SNP		37		SNP	38	WashU																																																																																			0	0.597									Missense_Mutation
POGZ	23126	genome.wustl.edu	37	1	151378012	151378012	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1549-01	TCGA-24-1549-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr1:151378012C>A	ENST00000271715.2	-	19	3813	c.3499G>T	c.(3499-3501)Ggc>Tgc	p.G1167C	POGZ_ENST00000368863.2_Missense_Mutation_p.G1072C|POGZ_ENST00000409503.1_Missense_Mutation_p.G1158C|POGZ_ENST00000361398.3_Missense_Mutation_p.G1114C|POGZ_ENST00000491586.1_Missense_Mutation_p.G1123C|POGZ_ENST00000540984.1_Missense_Mutation_p.G529C|POGZ_ENST00000531094.1_Missense_Mutation_p.G1105C|POGZ_ENST00000392723.1_Missense_Mutation_p.G1114C	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	1167	DDE.				kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G1167C(1)		NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AGGACAGTGCCATCTGCCAGA	0.532																																																1	Substitution - Missense(1)	ovary(1)	1											114.0	97.0	103.0					1																	151378012		2203	4300	6503	149644636	SO:0001583	missense	23126			AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.3499G>T	1.37:g.151378012C>A	ENSP00000271715:p.Gly1167Cys		149644636	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	37	CCDS997.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	18.26	3.585792	0.66105	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000540984;ENST00000491586	T;T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000002	T	0.61248	0.2332	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;0.999;0.999;0.999;0.999	T	0.63328	-0.6662	10	0.87932	D	0	-15.9617	18.3087	0.90192	0.0:1.0:0.0:0.0	.	1105;1158;1072;1123;1114;1167	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	C	1114;1167;1114;1072;1158;1105;529;1123	ENSP00000376484:G1114C;ENSP00000271715:G1167C;ENSP00000354467:G1114C;ENSP00000357856:G1072C;ENSP00000386836:G1158C;ENSP00000431259:G1105C;ENSP00000443547:G529C;ENSP00000418408:G1123C	ENSP00000271715:G1167C	G	-	1	0	POGZ	149644636	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.106000	0.77039	2.665000	0.90641	0.591000	0.81541	GGC		0.532	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171		Missense_Mutation
YEATS2	55689	genome.wustl.edu	37	3	183493741	183493741	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr3:183493741G>A	ENST00000305135.5	+	18	2602	c.2407G>A	c.(2407-2409)Gcc>Acc	p.A803T		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	803	Gly-rich.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)	p.A803T(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TGGGAGTGGTGCCggaggagg	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											65.0	70.0	68.0					3																	183493741		2017	4186	6203	184976435	SO:0001583	missense	55689			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.2407G>A	3.37:g.183493741G>A	ENSP00000306983:p.Ala803Thr		184976435	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	ENST00000305135.5	37	CCDS43175.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	6.227	0.410103	0.11812	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.48201	0.82	5.04	-1.51	0.08664	.	0.807151	0.11286	N	0.579824	T	0.22437	0.0541	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27468	-1.0073	10	0.12103	T	0.63	11.1796	9.6154	0.39687	0.5051:0.0:0.4949:0.0	.	803	Q9ULM3	YETS2_HUMAN	T	803	ENSP00000306983:A803T	ENSP00000306983:A803T	A	+	1	0	YEATS2	184976435	0.771000	0.28555	0.000000	0.03702	0.067000	0.16453	0.903000	0.28475	-0.430000	0.07318	-1.000000	0.02509	GCC		0.537	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023		Missense_Mutation
FAT1	2195	genome.wustl.edu	37	4	187628556	187628556	+	Missense_Mutation	SNP	T	T	C	rs201850668	byFrequency	TCGA-24-1549-01	TCGA-24-1549-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr4:187628556T>C	ENST00000441802.2	-	2	2635	c.2426A>G	c.(2425-2427)cAt>cGt	p.H809R		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	809	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H809R(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AACCACGACATGTAGAAGACG	0.443										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)											1	Substitution - Missense(1)	ovary(1)	4						T	ARG/HIS	0,3948		0,0,1974	191.0	190.0	190.0		2426	3.6	0.0	4		190	9,8293		0,9,4142	yes	missense	FAT1	NM_005245.3	29	0,9,6116	CC,CT,TT		0.1084,0.0,0.0735	benign	809/4589	187628556	9,12241	1974	4151	6125	187865550	SO:0001583	missense	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.2426A>G	4.37:g.187628556T>C	ENSP00000406229:p.His809Arg		187865550		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	1.928	-0.446615	0.04572	0.0	0.001084	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.48522	0.81	4.81	3.61	0.41365	Cadherin (4);Cadherin-like (1);	0.275088	0.40144	N	0.001176	T	0.28234	0.0697	N	0.13003	0.285	0.09310	N	1	B	0.19445	0.036	B	0.23852	0.049	T	0.17745	-1.0359	10	0.15499	T	0.54	.	10.5956	0.45336	0.0:0.0766:0.0:0.9234	.	809	Q14517	FAT1_HUMAN	R	809	ENSP00000406229:H809R	ENSP00000260147:H809R	H	-	2	0	FAT1	187865550	0.973000	0.33851	0.002000	0.10522	0.006000	0.05464	2.627000	0.46469	0.847000	0.35167	0.402000	0.26972	CAT		0.443	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		Missense_Mutation
MASP1	5648	genome.wustl.edu	37	3	186953746	186953746	+	Intron	SNP	G	G	A			TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr3:186953746G>A	ENST00000337774.5	-	10	1693				MASP1_ENST00000495249.1_5'UTR|MASP1_ENST00000392472.2_Missense_Mutation_p.S525L|MASP1_ENST00000296280.6_Missense_Mutation_p.S638L	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)						complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		GTAATTGCCCGAGCGGGACTC	0.542																																																0			3											105.0	85.0	92.0					3																	186953746		2203	4300	6503	188436440	SO:0001627	intron_variant	5648			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1303+5522C>T	3.37:g.186953746G>A			188436440	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	37	CCDS33907.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	17.93	3.508467	0.64410	.	.	ENSG00000127241	ENST00000296280;ENST00000392472	D;D	0.83335	-1.69;-1.71	5.87	4.94	0.65067	.	0.439108	0.26963	N	0.021608	T	0.73458	0.3589	N	0.16098	0.37	0.80722	D	1	P;B	0.46912	0.886;0.286	P;B	0.45099	0.469;0.091	T	0.73975	-0.3813	10	0.35671	T	0.21	.	13.2154	0.59856	0.0824:0.0:0.9176:0.0	.	525;638	P48740-4;P48740-2	.;.	L	638;525	ENSP00000296280:S638L;ENSP00000376264:S525L	ENSP00000296280:S638L	S	-	2	0	MASP1	188436440	1.000000	0.71417	0.019000	0.16419	0.947000	0.59692	7.780000	0.85658	1.491000	0.48482	0.655000	0.94253	TCG		0.542	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879		Missense_Mutation
FMOD	2331	genome.wustl.edu	37	1	203317073	203317073	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1549-01	TCGA-24-1549-10	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr1:203317073T>C	ENST00000354955.4	-	2	789	c.326A>G	c.(325-327)tAt>tGt	p.Y109C	FMOD_ENST00000493296.1_Intron	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	109					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.Y109C(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			GAAGTACACATACTTCATGCG	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											102.0	85.0	91.0					1																	203317073		2203	4300	6503	201583696	SO:0001583	missense	2331			U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.326A>G	1.37:g.203317073T>C	ENSP00000347041:p.Tyr109Cys		201583696	Q15331|Q8IV47	Missense_Mutation	SNP	ENST00000354955.4	37	CCDS30976.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	16.92	3.254462	0.59212	.	.	ENSG00000122176	ENST00000435105;ENST00000354955;ENST00000539467	T	0.57752	0.38	5.16	5.16	0.70880	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.73953	0.3653	M	0.83312	2.635	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78718	-0.2095	10	0.87932	D	0	-20.2055	13.8362	0.63410	0.0:0.0:0.0:1.0	.	109	Q06828	FMOD_HUMAN	C	96;109;89	ENSP00000347041:Y109C	ENSP00000347041:Y109C	Y	-	2	0	FMOD	201583696	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	5.897000	0.69831	1.943000	0.56356	0.460000	0.39030	TAT		0.567	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087472.1	NM_002023		Missense_Mutation
GNPAT	8443	genome.wustl.edu	37	1	231398535	231398536	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-24-1549-01	TCGA-24-1549-10	CT	CT	CT	-	CT	CT	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr1:231398535_231398536delCT	ENST00000366647.4	+	4	674_675	c.505_506delCT	c.(505-507)ctcfs	p.L169fs	GNPAT_ENST00000366646.3_Frame_Shift_Del_p.L108fs	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	169					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				CATTGACTTCCTCATGTTGTCT	0.347																																																0			1																																								229465159	SO:0001589	frameshift_variant	8443			AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.505_506delCT	1.37:g.231398535_231398536delCT	ENSP00000355607:p.Leu169fs		229465158	B4DNM9|Q5TBH7|Q9BWC2	Frame_Shift_Del	DEL	ENST00000366647.4	37	CCDS1592.1	DEL	24	WashU																																																																																				0.347	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092871.1			Frame_Shift_Del
VAX1	11023	genome.wustl.edu	37	10	118895992	118895992	+	Silent	SNP	G	G	A			TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr10:118895992G>A	ENST00000369206.5	-	2	419	c.420C>T	c.(418-420)tcC>tcT	p.S140S	VAX1_ENST00000277905.2_Silent_p.S140S	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1	140					axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S140S(1)		endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		CCTGGGTCTCGGAGAGGTTAA	0.652																																																1	Substitution - coding silent(1)	ovary(1)	10											37.0	39.0	39.0					10																	118895992		2203	4300	6503	118885982	SO:0001819	synonymous_variant	11023			AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117	ENST00000369206.5:c.420C>T	10.37:g.118895992G>A			118885982	B1AVW5|Q6ZSX0	Silent	SNP	ENST00000369206.5	37	CCDS44483.1	SNP	39	WashU																																																																																				0.652	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050559.3	XM_301242		Silent
MUC5B	727897	genome.wustl.edu	37	11	1267258	1267258	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1549-01	TCGA-24-1549-10	A	A	A	G	A	A	Unknown	Valid	Somatic	PhaseIII	Capture	none	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr11:1267258A>G	ENST00000529681.1	+	31	9206	c.9148A>G	c.(9148-9150)Acc>Gcc	p.T3050A	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.T3053A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3050	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.T3029A(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GACTGCAACCACCCTTCCAGT	0.602																																																1	Substitution - Missense(1)	ovary(1)	11											130.0	158.0	149.0					11																	1267258		2093	4193	6286	1223834	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.9148A>G	11.37:g.1267258A>G	ENSP00000436812:p.Thr3050Ala		1223834	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	4.254	0.046127	0.08243	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.24151	1.87;2.05	3.08	-6.16	0.02098	.	.	.	.	.	T	0.21186	0.0510	L	0.61218	1.895	0.09310	N	1	B;B	0.16603	0.018;0.018	B;B	0.13407	0.009;0.009	T	0.21552	-1.0242	9	0.87932	D	0	.	5.4597	0.16610	0.266:0.0:0.3628:0.3712	.	3633;3053	A7Y9J9;E9PBJ0	.;.	A	3050;3053;3022;3010	ENSP00000436812:T3050A;ENSP00000415793:T3053A	ENSP00000343037:T3022A	T	+	1	0	MUC5B	1223834	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.479000	0.06567	-2.676000	0.00411	0.338000	0.21704	ACC		0.602	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		Missense_Mutation
OR51A7	119687	genome.wustl.edu	37	11	4928842	4928842	+	Missense_Mutation	SNP	G	G	A	rs141919327		TCGA-24-1549-01	TCGA-24-1549-10	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr11:4928842G>A	ENST00000359350.4	+	1	243	c.243G>A	c.(241-243)atG>atA	p.M81I	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	81			M -> T (in dbSNP:rs7108225).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M81I(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTCCTACCATGTTGAGGGTCT	0.463																																																1	Substitution - Missense(1)	ovary(1)	11						G	ILE/MET	1,4401	2.1+/-5.4	0,1,2200	153.0	132.0	139.0		243	4.1	1.0	11	dbSNP_134	139	0,8596		0,0,4298	no	missense	OR51A7	NM_001004749.1	10	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	benign	81/313	4928842	1,12997	2201	4298	6499	4885418	SO:0001583	missense	119687			AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.243G>A	11.37:g.4928842G>A	ENSP00000352305:p.Met81Ile		4885418	Q6IFH8	Missense_Mutation	SNP	ENST00000359350.4	37	CCDS31364.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284912	0.40394	2.27E-4	0.0	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.05513	3.43	5.02	4.09	0.47781	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000020	T	0.09423	0.0232	M	0.62266	1.93	0.24417	N	0.994635	B	0.18610	0.029	B	0.30782	0.12	T	0.08554	-1.0716	10	0.51188	T	0.08	.	8.4806	0.33040	0.0839:0.0:0.7625:0.1536	.	81	Q8NH64	O51A7_HUMAN	I	81;81;70	ENSP00000352305:M81I	ENSP00000352305:M81I	M	+	3	0	OR51A7	4885418	0.001000	0.12720	1.000000	0.80357	0.859000	0.49053	0.438000	0.21559	2.596000	0.87737	0.655000	0.94253	ATG		0.463	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749		Missense_Mutation
MYOD1	4654	genome.wustl.edu	37	11	17741443	17741443	+	Silent	SNP	G	G	T			TCGA-24-1549-01	TCGA-24-1549-10	G	G	T	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr11:17741443G>T	ENST00000250003.3	+	1	329	c.114G>T	c.(112-114)ccG>ccT	p.P38P		NM_002478.4	NP_002469.2	P15172	MYOD1_HUMAN	myogenic differentiation 1	38					cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to oxygen levels (GO:0071453)|cellular response to starvation (GO:0009267)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|myoblast fate determination (GO:0007518)|myotube cell development (GO:0014904)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|transcription from RNA polymerase II promoter (GO:0006366)	myofibril (GO:0030016)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription coactivator activity (GO:0003713)	p.P38P(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	17						TCGACTCCCCGGACCTGCGCT	0.672																																																1	Substitution - coding silent(1)	ovary(1)	11											49.0	52.0	51.0					11																	17741443		2200	4293	6493	17698019	SO:0001819	synonymous_variant	4654			AF027148	CCDS7826.1	11p15	2013-05-21	2005-09-12			ENSG00000129152		"""Basic helix-loop-helix proteins"""	7611	protein-coding gene	gene with protein product	"""myoblast determination protein 1"""	159970	"""myogenic factor 3"""	MYF3			Standard	NM_002478		Approved	PUM, MYOD, bHLHc1	uc001mni.3	P15172		ENST00000250003.3:c.114G>T	11.37:g.17741443G>T			17698019	O75321	Silent	SNP	ENST00000250003.3	37	CCDS7826.1	SNP	39	WashU																																																																																				0.672	MYOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389387.1	NM_002478		Silent
IGHE	3497	genome.wustl.edu	37	14	106067427	106067427	+	lincRNA	SNP	A	A	T			TCGA-24-1549-01	TCGA-24-1549-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr14:106067427A>T	ENST00000390540.2	-	0	1154				AL928742.12_ENST00000412518.1_lincRNA|IGHE_ENST00000577108.1_RNA|IGHE_ENST00000576077.1_RNA																							TGATGTTGATAGTCCCTGGGG	0.642																																																0			14											25.0	27.0	26.0					14																	106067427		2031	4163	6194	105138472																																		14.37:g.106067427A>T			105138472		Missense_Mutation	SNP	ENST00000390540.2	37		SNP	15	WashU																																																																																				0.642	RP11-731F5.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000380286.1			Missense_Mutation
TBX6	6911	genome.wustl.edu	37	16	30098101	30098101	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1549-01	TCGA-24-1549-10	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr16:30098101C>A	ENST00000395224.2	-	7	970	c.911G>T	c.(910-912)gGa>gTa	p.G304V	TBX6_ENST00000279386.2_Missense_Mutation_p.G304V	NM_004608.3	NP_004599.2	O95947	TBX6_HUMAN	T-box 6	304					anatomical structure morphogenesis (GO:0009653)|cell fate specification (GO:0001708)|mesoderm development (GO:0007498)|mesoderm formation (GO:0001707)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G304V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	9						ACACTCACCTCCGCTCCCATA	0.637																																																1	Substitution - Missense(1)	ovary(1)	16											64.0	52.0	56.0					16																	30098101		2197	4300	6497	30005602	SO:0001583	missense	6911			AJ007989	CCDS10670.1	16p11.2	2008-02-05			ENSG00000149922	ENSG00000149922		"""T-boxes"""	11605	protein-coding gene	gene with protein product		602427				9888994, 9933572	Standard	NM_004608		Approved		uc010veh.2	O95947	OTTHUMG00000132115	ENST00000395224.2:c.911G>T	16.37:g.30098101C>A	ENSP00000378650:p.Gly304Val		30005602	Q8TAS4|Q9HA44	Missense_Mutation	SNP	ENST00000395224.2	37	CCDS10670.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	12.08	1.830308	0.32329	.	.	ENSG00000149922	ENST00000395224;ENST00000279386	D;D	0.86769	-2.17;-2.17	5.36	3.37	0.38596	.	0.373975	0.26010	N	0.026897	T	0.74680	0.3748	N	0.24115	0.695	0.48341	D	0.999633	B	0.32338	0.365	B	0.30855	0.121	T	0.68202	-0.5471	10	0.27082	T	0.32	.	6.7694	0.23585	0.0:0.7257:0.1798:0.0945	.	304	O95947	TBX6_HUMAN	V	304	ENSP00000378650:G304V;ENSP00000279386:G304V	ENSP00000279386:G304V	G	-	2	0	TBX6	30005602	0.991000	0.36638	1.000000	0.80357	0.805000	0.45488	0.396000	0.20867	1.237000	0.43756	0.555000	0.69702	GGA		0.637	TBX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255157.2	NM_004608, NM_080758		Missense_Mutation
EMR4P	326342	genome.wustl.edu	37	19	6990796	6990796	+	RNA	SNP	A	A	G			TCGA-24-1549-01	TCGA-24-1549-10	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr19:6990796A>G	ENST00000600751.1	-	0	61					NR_024075.1		Q86SQ3	EMR4_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 4 pseudogene						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.F5S(1)									GACCAGGAGGAACCTGCTCCC	0.502																																																1	Substitution - Missense(1)	ovary(1)	19											96.0	103.0	101.0					19																	6990796		1964	4152	6116	6941796			326342			AY181245		19p13.2	2014-08-08	2008-06-06	2008-06-06	ENSG00000268758	ENSG00000268758		"""-"", ""GPCR / Class B : Orphans"""	19240	pseudogene	pseudogene		612305	"""G protein-coupled receptor 127"", ""egf-like module containing, mucin-like, hormone receptor-like 4"""	GPR127, EMR4		12565841	Standard	NR_024075		Approved	PGR16	uc010xjk.2	Q86SQ3	OTTHUMG00000177251		19.37:g.6990796A>G			6941796	Q86SP1	Missense_Mutation	SNP	ENST00000600751.1	37		SNP	9	WashU																																																																																				0.502	EMR4P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000436007.1	NR_024075		Missense_Mutation
ZAN	7455	genome.wustl.edu	37	7	100366320	100366320	+	RNA	SNP	A	A	T			TCGA-24-1549-01	TCGA-24-1549-10	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-24-1549-01	TCGA-24-1549-10	g.chr7:100366320A>T	ENST00000348028.3	+	0	5294				ZAN_ENST00000542585.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.K1710M(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCCGCCTGGAAGTTACCTGAA	0.627																																																1	Substitution - Missense(1)	ovary(1)	7											19.0	19.0	19.0					7																	100366320		1863	4088	5951	100204256			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100366320A>T			100204256	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	13.51	2.258867	0.39896	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.28255	2.17;2.17;2.14;1.62	4.62	0.246	0.15516	von Willebrand factor, type D domain (1);	0.657454	0.13404	N	0.390435	T	0.33933	0.0880	M	0.87328	2.875	0.09310	N	1	B;B	0.25272	0.122;0.075	B;B	0.24541	0.054;0.024	T	0.40515	-0.9559	10	0.66056	D	0.02	.	4.0425	0.09758	0.3681:0.0:0.1049:0.527	.	1710;1710	F5H0T8;Q9Y493	.;ZAN_HUMAN	M	1710;1710;1710;287	ENSP00000445943:K1710M;ENSP00000445091:K1710M;ENSP00000444427:K1710M;ENSP00000441117:K287M	ENSP00000423579:K1710M	K	+	2	0	ZAN	100204256	0.047000	0.20315	0.267000	0.24556	0.029000	0.11900	0.023000	0.13533	0.025000	0.15241	-0.301000	0.09380	AAG		0.627	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386		Missense_Mutation
