#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
TMEM234	56063	broad.mit.edu	37	1	32688148	32688148	+	5'Flank	SNP	C	C	G			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr1:32688148C>G	ENST00000344461.3	-	0	0				TMEM234_ENST00000309777.6_5'Flank|EIF3I_ENST00000373586.1_Missense_Mutation_p.L5V|TMEM234_ENST00000545122.1_5'Flank|TMEM234_ENST00000373593.1_5'Flank|EIF3I_ENST00000471486.1_3'UTR			Q8WY98	TM234_HUMAN	transmembrane protein 234							integral component of membrane (GO:0016021)		p.L5V(1)		kidney(2)|lung(3)	5						GAAGCCGATCCTACTGCAGGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											77.0	78.0	78.0					1																	32688148		2203	4300	6503	32460735	SO:0001631	upstream_gene_variant	8668			AY358586	CCDS356.2	1p36.11-p34.2	2011-02-14	2011-02-14	2011-02-14	ENSG00000160055	ENSG00000160055			28837	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 91"""	C1orf91		12477932	Standard	XM_005271045		Approved	RP4-622L5, dJ622L5.7, FLJ90779	uc001buq.4	Q8WY98	OTTHUMG00000005742		1.37:g.32688148C>G	Exception_encountered		32460735	B2R535|D3DPP7|Q6UWY9|Q8N2H6|Q9BSR2|Q9NU76	Missense_Mutation	SNP	ENST00000344461.3	37		SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	15.69	2.906706	0.52333	.	.	ENSG00000084623	ENST00000355082;ENST00000373586	T;T	0.80566	-1.39;-1.39	4.1	2.22	0.28083	.	0.157358	0.43919	D	0.000514	T	0.69160	0.3080	N	0.26162	0.8	0.58432	D	0.999996	B	0.25048	0.117	B	0.30716	0.119	T	0.62445	-0.6853	10	0.42905	T	0.14	-9.9483	10.2458	0.43341	0.0:0.8367:0.0:0.1633	.	5	Q13347	EIF3I_HUMAN	V	5	ENSP00000347194:L5V;ENSP00000362688:L5V	ENSP00000347194:L5V	L	+	1	2	EIF3I	32460735	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.869000	0.48444	0.504000	0.28082	0.557000	0.71058	CTA		0.562	TMEM234-009	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000092260.2	NM_019118		Missense_Mutation
ZNF518A	9849	broad.mit.edu	37	10	97916343	97916343	+	RNA	SNP	G	G	C			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr10:97916343G>C	ENST00000534948.1	+	0	1121							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K88N(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TCAGTATAAAGACTGTAAGCT	0.338																																																1	Substitution - Missense(1)	ovary(1)	10											89.0	88.0	89.0					10																	97916343		1830	4079	5909	97906333			9849			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97916343G>C			97906333	A0PJI5|O15044|Q32MP4	Missense_Mutation	SNP	ENST00000534948.1	37		SNP	33	Broad																																																																																				0.338	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803		Missense_Mutation
TLL2	7093	broad.mit.edu	37	10	98205874	98205874	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr10:98205874T>G	ENST00000357947.3	-	3	563	c.338A>C	c.(337-339)gAc>gCc	p.D113A	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	113					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D113A(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GGTGCCAGTGTCCATGGCTGT	0.502																																																1	Substitution - Missense(1)	ovary(1)	10											241.0	206.0	218.0					10																	98205874		2203	4300	6503	98195864	SO:0001583	missense	7093			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.338A>C	10.37:g.98205874T>G	ENSP00000350630:p.Asp113Ala		98195864	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.645190	0.00792	.	.	ENSG00000095587	ENST00000357947	T	0.12879	2.64	4.98	3.81	0.43845	.	1.012530	0.07951	N	0.980831	T	0.06872	0.0175	N	0.08118	0	0.09310	N	1	B	0.20368	0.044	B	0.15870	0.014	T	0.39563	-0.9608	10	0.08837	T	0.75	.	8.1255	0.30997	0.1792:0.0:0.0:0.8208	.	113	Q9Y6L7	TLL2_HUMAN	A	113	ENSP00000350630:D113A	ENSP00000350630:D113A	D	-	2	0	TLL2	98195864	0.019000	0.18553	0.003000	0.11579	0.013000	0.08279	0.873000	0.28052	0.812000	0.34326	0.454000	0.30748	GAC		0.502	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1			Missense_Mutation
EDRF1	26098	broad.mit.edu	37	10	127424457	127424457	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1551-01	TCGA-24-1551-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr10:127424457C>A	ENST00000356792.4	+	13	1974	c.1742C>A	c.(1741-1743)tCt>tAt	p.S581Y	C10orf137_ENST00000337623.3_Missense_Mutation_p.S547Y	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		581					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.S547Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				AAATACAAATCTATTCATCAA	0.313																																																1	Substitution - Missense(1)	ovary(1)	10											75.0	86.0	82.0					10																	127424457		2203	4299	6502	127414447	SO:0001583	missense	26098																														ENST00000356792.4:c.1742C>A	10.37:g.127424457C>A	ENSP00000349244:p.Ser581Tyr		127414447	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Missense_Mutation	SNP	ENST00000356792.4	37	CCDS55733.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	20.2	3.952466	0.73787	.	.	ENSG00000107938	ENST00000356792;ENST00000392732;ENST00000337623;ENST00000368813	T;T;T	0.62498	2.73;2.73;0.02	5.86	4.95	0.65309	.	0.164006	0.56097	D	0.000029	T	0.75459	0.3852	L	0.52573	1.65	0.58432	D	0.999997	D;D;D;D	0.89917	0.999;1.0;0.998;0.999	D;D;D;D	0.87578	0.964;0.998;0.914;0.996	T	0.78645	-0.2123	10	0.87932	D	0	.	17.2383	0.87006	0.0:0.8741:0.1259:0.0	.	581;581;547;581	F8W695;Q3B7T1;Q3B7T1-5;Q3B7T1-3	.;EDRF1_HUMAN;.;.	Y	581;581;547;1	ENSP00000349244:S581Y;ENSP00000336727:S547Y;ENSP00000357803:S1Y	ENSP00000336727:S547Y	S	+	2	0	C10orf137	127414447	1.000000	0.71417	0.995000	0.50966	0.999000	0.98932	5.657000	0.67996	1.589000	0.49982	0.650000	0.86243	TCT		0.313	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1			Missense_Mutation
USP35	57558	broad.mit.edu	37	11	77907406	77907406	+	Silent	SNP	C	C	T			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr11:77907406C>T	ENST00000529308.1	+	2	376	c.115C>T	c.(115-117)Ctg>Ttg	p.L39L	USP35_ENST00000530267.1_Intron|USP35_ENST00000530535.1_Intron|USP35_ENST00000526425.1_5'Flank|USP35_ENST00000441408.2_5'Flank	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	39					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.L39L(1)		endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			TGAGCAGTGCCTGGCGCTGCT	0.761																																																1	Substitution - coding silent(1)	ovary(1)	11											17.0	21.0	20.0					11																	77907406		2048	4179	6227	77585054	SO:0001819	synonymous_variant	57558			AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.115C>T	11.37:g.77907406C>T			77585054		Silent	SNP	ENST00000529308.1	37	CCDS41693.1	SNP	24	Broad																																																																																				0.761	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1	XM_290527		Silent
GAB2	9846	broad.mit.edu	37	11	77937726	77937726	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr11:77937726G>T	ENST00000361507.4	-	4	1077	c.992C>A	c.(991-993)aCt>aAt	p.T331N	GAB2_ENST00000526030.1_5'Flank|GAB2_ENST00000340149.2_Missense_Mutation_p.T293N	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	331					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.T331N(1)	INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			TTTGTCCAGAGTGAATGTCCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	11											65.0	63.0	63.0					11																	77937726		2200	4292	6492	77615374	SO:0001583	missense	9846			AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.992C>A	11.37:g.77937726G>T	ENSP00000354952:p.Thr331Asn		77615374	A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	ENST00000361507.4	37	CCDS8259.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	19.30	3.800786	0.70567	.	.	ENSG00000033327	ENST00000340149;ENST00000361507	T;T	0.16897	2.31;2.31	5.21	5.21	0.72293	.	0.106606	0.39274	U	0.001401	T	0.35595	0.0937	L	0.54323	1.7	0.47123	D	0.999323	D	0.69078	0.997	P	0.60789	0.879	T	0.01456	-1.1350	10	0.41790	T	0.15	-12.5974	19.1199	0.93358	0.0:0.0:1.0:0.0	.	331	Q9UQC2	GAB2_HUMAN	N	293;331	ENSP00000343959:T293N;ENSP00000354952:T331N	ENSP00000343959:T293N	T	-	2	0	GAB2	77615374	1.000000	0.71417	0.994000	0.49952	0.930000	0.56654	6.722000	0.74735	2.598000	0.87819	0.561000	0.74099	ACT		0.592	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491		Missense_Mutation
FAT3	120114	broad.mit.edu	37	11	92430605	92430606	+	Missense_Mutation	DNP	TC	TC	CA			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr11:92430605_92430606TC>CA	ENST00000298047.6	+	3	3680_3681	c.3663_3664TC>CA	c.(3661-3666)ttTCtg>ttCAtg	p.L1222M	FAT3_ENST00000409404.2_Missense_Mutation_p.L1222M|FAT3_ENST00000525166.1_Missense_Mutation_p.L1072M			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1222	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L1222M(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAGAACATTTTCTGGAGGTAAG	0.347										TCGA Ovarian(4;0.039)																																						2	Substitution - Missense(2)	ovary(2)	11																																								92070254	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	Exception_encountered	11.37:g.92430605_92430606delinsCA	ENSP00000298047:p.Leu1222Met		92070253	B5MDB0|Q96AU6	Missense_Mutation	DNP	ENST00000298047.6	37		DNP	62	Broad																																																																																				0.347	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		Missense_Mutation
AMOTL1	154810	broad.mit.edu	37	11	94533388	94533388	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr11:94533388G>C	ENST00000433060.2	+	3	1173	c.1032G>C	c.(1030-1032)gaG>gaC	p.E344D	AMOTL1_ENST00000317837.9_Missense_Mutation_p.E344D|AMOTL1_ENST00000317829.8_Missense_Mutation_p.E294D	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	344					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)	p.E344D(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				TGCTCCACGAGATGGTCAAGC	0.562																																																1	Substitution - Missense(1)	ovary(1)	11											116.0	117.0	117.0					11																	94533388		2009	4172	6181	94173036	SO:0001583	missense	154810			AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.1032G>C	11.37:g.94533388G>C	ENSP00000387739:p.Glu344Asp		94173036	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	CCDS44712.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	9.102	1.004461	0.19199	.	.	ENSG00000166025	ENST00000317829;ENST00000542840;ENST00000317837;ENST00000433060	T;T;T	0.14022	2.54;2.54;2.54	5.13	2.0	0.26442	.	0.171732	0.40064	N	0.001200	T	0.04452	0.0122	N	0.04043	-0.29	0.29278	N	0.870209	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.0	T	0.32134	-0.9918	9	.	.	.	-16.6905	3.1098	0.06355	0.0805:0.2401:0.2887:0.3907	.	294;344	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	D	294;350;344;344	ENSP00000320968:E294D;ENSP00000323474:E344D;ENSP00000387739:E344D	.	E	+	3	2	AMOTL1	94173036	0.965000	0.33210	0.998000	0.56505	0.931000	0.56810	-0.023000	0.12456	0.545000	0.28902	0.555000	0.69702	GAG		0.562	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847		Missense_Mutation
AASDHPPT	60496	broad.mit.edu	37	11	105948610	105948610	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr11:105948610A>G	ENST00000278618.4	+	1	395	c.173A>G	c.(172-174)aAg>aGg	p.K58R	KBTBD3_ENST00000526793.1_5'Flank|KBTBD3_ENST00000534815.1_5'Flank|KBTBD3_ENST00000531837.1_5'Flank	NM_015423.2	NP_056238.2	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase	58					macromolecule biosynthetic process (GO:0009059)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	holo-[acyl-carrier-protein] synthase activity (GO:0008897)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)	17		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		CGGGACGCTAAGGCAGCCATG	0.612																																																0			11											80.0	86.0	84.0					11																	105948610		2201	4299	6500	105453820	SO:0001583	missense	60496			AF302110	CCDS31664.1	11q22	2010-12-09			ENSG00000149313	ENSG00000149313	1.2.1.31		14235	protein-coding gene	gene with protein product		607756				12815048, 11286508	Standard	NM_015423		Approved	LYS5, CGI-80, AASD-PPT	uc001pjc.1	Q9NRN7	OTTHUMG00000166253	ENST00000278618.4:c.173A>G	11.37:g.105948610A>G	ENSP00000278618:p.Lys58Arg		105453820	B2R6D1|B4DDW7|Q9C068|Q9P0Q3|Q9UG80|Q9Y389	Missense_Mutation	SNP	ENST00000278618.4	37	CCDS31664.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	18.71	3.681733	0.68042	.	.	ENSG00000149313	ENST00000278618	.	.	.	5.35	5.35	0.76521	4&apos (1);-phosphopantetheinyl transferase (1);	0.112355	0.64402	D	0.000011	T	0.49660	0.1570	L	0.35341	1.055	0.53688	D	0.999978	B	0.16802	0.019	B	0.15870	0.014	T	0.44467	-0.9326	9	0.12103	T	0.63	.	14.991	0.71387	1.0:0.0:0.0:0.0	.	58	Q9NRN7	ADPPT_HUMAN	R	58	.	ENSP00000278618:K58R	K	+	2	0	AASDHPPT	105453820	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.783000	0.91813	2.022000	0.59522	0.460000	0.39030	AAG		0.612	AASDHPPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388734.1	NM_015423		Missense_Mutation
SIK3	23387	broad.mit.edu	37	11	116734491	116734491	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1551-01	TCGA-24-1551-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr11:116734491G>A	ENST00000292055.4	-	15	1713	c.1678C>T	c.(1678-1680)Cgt>Tgt	p.R560C	SIK3_ENST00000375288.1_5'UTR|SIK3_ENST00000375300.1_Missense_Mutation_p.R618C|SIK3_ENST00000542607.1_Missense_Mutation_p.R560C|SIK3_ENST00000446921.2_Missense_Mutation_p.R618C|SIK3_ENST00000434315.2_Missense_Mutation_p.R459C|SIK3_ENST00000488337.1_5'UTR	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	560					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.R666C(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GGGGAGAAACGCTCCGTAGGG	0.527																																																1	Substitution - Missense(1)	ovary(1)	11											137.0	137.0	137.0					11																	116734491		2201	4296	6497	116239701	SO:0001583	missense	23387			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.1678C>T	11.37:g.116734491G>A	ENSP00000292055:p.Arg560Cys		116239701	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	ENST00000292055.4	37	CCDS8379.1	SNP	38	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	29.5|29.5	5.013306|5.013306	0.93346|0.93346	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000445177;ENST00000446921|ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315	.|D;D;T;T	.|0.82984	.|-1.67;-1.67;-0.97;-1.14	5.53|5.53	5.53|5.53	0.82687|0.82687	.|Protein kinase-like domain (1);	.|0.000000	.|0.42294	.|U	.|0.000721	D|D	0.87740|0.87740	0.6253|0.6253	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.87578	.|0.998;0.998;0.997	D|D	0.88882|0.88882	0.3340|0.3340	5|10	.|0.87932	.|D	.|0	.|.	19.4611|19.4611	0.94918|0.94918	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|560;459;560	.|A1A5A8;A1A5A9;Q9Y2K2	.|.;.;SIK3_HUMAN	V|C	659;582|618;560;560;459	.|ENSP00000364449:R618C;ENSP00000292055:R560C;ENSP00000438108:R560C;ENSP00000415873:R459C	.|ENSP00000292055:R560C	A|R	-|-	2|1	0|0	SIK3|SIK3	116239701|116239701	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.509000|7.509000	0.81698|0.81698	2.592000|2.592000	0.87571|0.87571	0.561000|0.561000	0.74099|0.74099	GCG|CGT		0.527	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164		Missense_Mutation
AKAP11	11215	broad.mit.edu	37	13	42873737	42873737	+	Silent	SNP	T	T	C	rs147436453		TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr13:42873737T>C	ENST00000025301.2	+	8	1030	c.855T>C	c.(853-855)tcT>tcC	p.S285S		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	285	Ser-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)	p.S285S(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		ATAGGTCATCTAATGCTTCAG	0.378																																																1	Substitution - coding silent(1)	ovary(1)	13											76.0	76.0	76.0					13																	42873737		2203	4299	6502	41771737	SO:0001819	synonymous_variant	11215			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.855T>C	13.37:g.42873737T>C			41771737	O75124|Q9NUK7	Silent	SNP	ENST00000025301.2	37	CCDS9383.1	SNP	53	Broad																																																																																				0.378	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248		Silent
HCN4	10021	broad.mit.edu	37	15	73616093	73616093	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr15:73616093G>C	ENST00000261917.3	-	8	3334	c.2341C>G	c.(2341-2343)Cca>Gca	p.P781A		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	781					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.P781A(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GCCTGCAGTGGTGCCTGGATC	0.697																																																1	Substitution - Missense(1)	ovary(1)	15											26.0	31.0	29.0					15																	73616093		2196	4295	6491	71403146	SO:0001583	missense	10021			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.2341C>G	15.37:g.73616093G>C	ENSP00000261917:p.Pro781Ala		71403146	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	37	CCDS10248.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784395	0.49997	.	.	ENSG00000138622	ENST00000261917	T	0.78707	-1.2	3.45	3.45	0.39498	.	.	.	.	.	D	0.86016	0.5832	M	0.71581	2.175	0.58432	D	0.999998	D	0.89917	1.0	D	0.80764	0.994	D	0.86101	0.1556	9	0.39692	T	0.17	.	15.1054	0.72319	0.0:0.0:1.0:0.0	.	781	Q9Y3Q4	HCN4_HUMAN	A	781	ENSP00000261917:P781A	ENSP00000261917:P781A	P	-	1	0	HCN4	71403146	1.000000	0.71417	0.992000	0.48379	0.909000	0.53808	5.791000	0.69045	1.756000	0.51951	0.305000	0.20034	CCA		0.697	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477		Missense_Mutation
SNAI3	333929	broad.mit.edu	37	16	88747606	88747606	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr16:88747606A>G	ENST00000332281.5	-	2	679	c.593T>C	c.(592-594)cTc>cCc	p.L198P	SNAI3-AS1_ENST00000563261.1_RNA	NM_178310.3	NP_840101.1	Q3KNW1	SNAI3_HUMAN	snail family zinc finger 3	198					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	copper ion binding (GO:0005507)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L198P(1)		NS(1)|central_nervous_system(1)|kidney(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(80;0.048)		GTGCATCTTGAGGGCACCCAG	0.647																																					Colon(27;366 710 19748 23199 27567)											1	Substitution - Missense(1)	ovary(1)	16											116.0	104.0	108.0					16																	88747606		2198	4300	6498	87275107	SO:0001583	missense	333929			BC041461	CCDS32505.1	16q24.3	2013-05-23	2013-05-23			ENSG00000185669		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	18411	protein-coding gene	gene with protein product		612741	"""zinc finger protein 293"", ""snail homolog 3 (Drosophila)"""	ZNF293		12579345	Standard	NM_178310		Approved	SMUC, Zfp293	uc002flj.3	Q3KNW1		ENST00000332281.5:c.593T>C	16.37:g.88747606A>G	ENSP00000327968:p.Leu198Pro		87275107	Q86SU5	Missense_Mutation	SNP	ENST00000332281.5	37	CCDS32505.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	22.3	4.268769	0.80469	.	.	ENSG00000185669	ENST00000332281	T	0.75260	-0.92	4.64	4.64	0.57946	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	D	0.90844	0.7124	H	0.98178	4.165	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93743	0.7052	10	0.87932	D	0	-44.2166	13.3131	0.60390	1.0:0.0:0.0:0.0	.	198	Q3KNW1	SNAI3_HUMAN	P	198	ENSP00000327968:L198P	ENSP00000327968:L198P	L	-	2	0	SNAI3	87275107	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.205000	0.77881	1.855000	0.53841	0.402000	0.26972	CTC		0.647	SNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422582.1			Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	17	GRCh37	CM010465|CM900211	TP53	M	rs121912651						151.0	112.0	125.0					17																	7577539		2203	4300	6503	7518264	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp		7518264	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
KLHL14	57565	broad.mit.edu	37	18	30260462	30260462	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr18:30260462C>T	ENST00000359358.4	-	6	1777	c.1339G>A	c.(1339-1341)Gaa>Aaa	p.E447K		NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	447						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						TCATTCGTTTCTAGGTTATAG	0.463																																																0			18											120.0	116.0	117.0					18																	30260462		2203	4300	6503	28514460	SO:0001583	missense	57565			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1339G>A	18.37:g.30260462C>T	ENSP00000352314:p.Glu447Lys		28514460	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	ENST00000359358.4	37	CCDS32813.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	21.7	4.194851	0.78902	.	.	ENSG00000197705	ENST00000359358	T	0.78126	-1.15	5.58	5.58	0.84498	Galactose oxidase, beta-propeller (1);	0.044776	0.85682	D	0.000000	T	0.72590	0.3479	N	0.25060	0.705	0.80722	D	1	D	0.56287	0.975	P	0.51866	0.682	T	0.67150	-0.5743	10	0.02654	T	1	.	19.922	0.97089	0.0:1.0:0.0:0.0	.	447	Q9P2G3	KLH14_HUMAN	K	447	ENSP00000352314:E447K	ENSP00000352314:E447K	E	-	1	0	KLHL14	28514460	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	7.445000	0.80570	2.780000	0.95670	0.655000	0.94253	GAA		0.463	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1			Missense_Mutation
NETO1	81832	broad.mit.edu	37	18	70451060	70451060	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1551-01	TCGA-24-1551-10			T	A	T	T	Unknown	Valid	Somatic	x	x	454_PCR_WGA			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr18:70451060T>A	ENST00000327305.6	-	7	1378	c.721A>T	c.(721-723)Agt>Tgt	p.S241C	NETO1_ENST00000299430.2_Missense_Mutation_p.S240C|NETO1_ENST00000583169.1_Missense_Mutation_p.S241C	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	241	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.S241C(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		TCCACGGAACTGCTTCCATCA	0.428																																																1	Substitution - Missense(1)	ovary(1)	18											155.0	137.0	143.0					18																	70451060		2203	4300	6503	68602040	SO:0001583	missense	81832			AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.721A>T	18.37:g.70451060T>A	ENSP00000313088:p.Ser241Cys		68602040	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	37	CCDS12000.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	28.2	4.896648	0.91962	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.19532	2.14;2.14	5.27	5.27	0.74061	CUB (5);	0.000000	0.64402	D	0.000001	T	0.47469	0.1447	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.81914	0.995;0.99	T	0.51212	-0.8734	10	0.87932	D	0	-27.1659	15.5016	0.75703	0.0:0.0:0.0:1.0	.	240;241	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	C	241;240	ENSP00000313088:S241C;ENSP00000299430:S240C	ENSP00000299430:S240C	S	-	1	0	NETO1	68602040	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	7.841000	0.86834	2.102000	0.63906	0.528000	0.53228	AGT		0.428	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999		Missense_Mutation
EMR1	2015	broad.mit.edu	37	19	6937605	6937605	+	Silent	SNP	C	C	A			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr19:6937605C>A	ENST00000312053.4	+	20	2638	c.2601C>A	c.(2599-2601)tcC>tcA	p.S867S	EMR1_ENST00000381404.4_Silent_p.S848S|EMR1_ENST00000381407.5_Silent_p.S726S|EMR1_ENST00000450315.3_Silent_p.S690S|EMR1_ENST00000250572.8_Silent_p.S802S	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	867					cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.S867S(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					AGCCCAGCTCCCAGTCCCAGA	0.567																																																1	Substitution - coding silent(1)	ovary(1)	19											178.0	145.0	156.0					19																	6937605		2203	4300	6503	6888605	SO:0001819	synonymous_variant	2015			X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.2601C>A	19.37:g.6937605C>A			6888605	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Silent	SNP	ENST00000312053.4	37	CCDS12175.1	SNP	22	Broad																																																																																				0.567	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1			Silent
C19orf53	28974	broad.mit.edu	37	19	13885312	13885312	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr19:13885312G>C	ENST00000588234.1	+	1	331	c.21G>C	c.(19-21)aaG>aaC	p.K7N	C19orf53_ENST00000593274.1_5'Flank|CTB-5E10.3_ENST00000586894.1_RNA|CTB-5E10.3_ENST00000586297.1_RNA|CTB-5E10.3_ENST00000591826.1_RNA	NM_014047.2	NP_054766.1	Q9UNZ5	L10K_HUMAN	chromosome 19 open reading frame 53	7								p.K7N(1)		breast(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	6			OV - Ovarian serous cystadenocarcinoma(19;7.7e-24)|Epithelial(5;2.53e-19)			GGCAGCGCAAGTTTCAGGCGC	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											16.0	19.0	18.0					19																	13885312		2198	4294	6492	13746312	SO:0001583	missense	28974			AF078852	CCDS12298.1	19p13.2	2011-11-24			ENSG00000104979	ENSG00000104979			24991	protein-coding gene	gene with protein product	"""leydig cell tumor 10 kDa protein homolog"""					11042152	Standard	NM_014047		Approved	HSPC023, LYDG10	uc002mxg.3	Q9UNZ5		ENST00000588234.1:c.21G>C	19.37:g.13885312G>C	ENSP00000465432:p.Lys7Asn		13746312	B2R4J9	Missense_Mutation	SNP	ENST00000588234.1	37	CCDS12298.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365535	0.61513	.	.	ENSG00000104979	ENST00000221576	.	.	.	5.04	1.82	0.25136	.	0.000000	0.85682	D	0.000000	T	0.70824	0.3268	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.68953	-0.5273	8	0.87932	D	0	.	6.5531	0.22446	0.2921:0.0:0.7079:0.0	.	7	Q9UNZ5	L10K_HUMAN	N	7	.	ENSP00000221576:K7N	K	+	3	2	C19orf53	13746312	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	0.587000	0.23909	0.334000	0.23590	0.549000	0.68633	AAG		0.642	C19orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453621.1	NM_014047		Missense_Mutation
C19orf53	28974	broad.mit.edu	37	19	13888905	13888905	+	Missense_Mutation	SNP	G	G	A	rs183989129	byFrequency	TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr19:13888905G>A	ENST00000588234.1	+	3	503	c.193G>A	c.(193-195)Gtg>Atg	p.V65M	C19orf53_ENST00000593274.1_Missense_Mutation_p.V22M	NM_014047.2	NP_054766.1	Q9UNZ5	L10K_HUMAN	chromosome 19 open reading frame 53	65								p.V65M(1)		breast(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	6			OV - Ovarian serous cystadenocarcinoma(19;7.7e-24)|Epithelial(5;2.53e-19)			CGAACATGACGTGGTGATGAA	0.592													G|||	7	0.00139776	0.0053	0.0	5008	,	,		19240	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19											106.0	102.0	103.0					19																	13888905		2203	4300	6503	13749905	SO:0001583	missense	28974			AF078852	CCDS12298.1	19p13.2	2011-11-24			ENSG00000104979	ENSG00000104979			24991	protein-coding gene	gene with protein product	"""leydig cell tumor 10 kDa protein homolog"""					11042152	Standard	NM_014047		Approved	HSPC023, LYDG10	uc002mxg.3	Q9UNZ5		ENST00000588234.1:c.193G>A	19.37:g.13888905G>A	ENSP00000465432:p.Val65Met		13749905	B2R4J9	Missense_Mutation	SNP	ENST00000588234.1	37	CCDS12298.1	SNP	40	Broad	7	0.003205128205128205	7	0.014227642276422764	0	0.0	0	0.0	0	0.0	G	16.56	3.158704	0.57368	.	.	ENSG00000104979	ENST00000221576	.	.	.	4.98	2.71	0.32032	.	0.074103	0.53938	D	0.000055	T	0.45115	0.1326	.	.	.	0.26828	N	0.968644	D	0.69078	0.997	P	0.58210	0.835	T	0.44159	-0.9346	8	0.87932	D	0	.	9.3351	0.38045	0.0:0.1584:0.6774:0.1642	.	65	Q9UNZ5	L10K_HUMAN	M	65	.	ENSP00000221576:V65M	V	+	1	0	C19orf53	13749905	0.991000	0.36638	0.012000	0.15200	0.932000	0.56968	2.075000	0.41538	0.447000	0.26695	0.478000	0.44815	GTG		0.592	C19orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453621.1	NM_014047		Missense_Mutation
ZNF112	7771	broad.mit.edu	37	19	44831653	44831653	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1551-01	TCGA-24-1551-10			T	C	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr19:44831653T>C	ENST00000337401.4	-	5	2763	c.2675A>G	c.(2674-2676)gAa>gGa	p.E892G	ZNF112_ENST00000536500.1_Missense_Mutation_p.E909G|ZNF112_ENST00000354340.4_Missense_Mutation_p.E886G	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	892					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E886G(1)									ACCATAGTCTTCGCTTTTATA	0.383																																																1	Substitution - Missense(1)	ovary(1)	19											72.0	68.0	69.0					19																	44831653		2203	4299	6502	49523493	SO:0001583	missense	7771			AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.2675A>G	19.37:g.44831653T>C	ENSP00000337081:p.Glu892Gly		49523493	A4FU53|Q9HCA7	Missense_Mutation	SNP	ENST00000337401.4	37	CCDS54276.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	0.108	-1.142642	0.01728	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	T;T;T	0.52057	0.68;0.68;0.68	4.74	2.63	0.31362	.	0.000000	0.32655	N	0.005812	T	0.28167	0.0695	N	0.26162	0.8	0.09310	N	1	B;B;B	0.14805	0.006;0.011;0.006	B;B;B	0.15052	0.005;0.012;0.005	T	0.12708	-1.0537	10	0.25751	T	0.34	-10.4793	4.4537	0.11633	0.0:0.1843:0.1683:0.6475	.	891;909;892	B4DYT4;F5GWS7;Q9UJU3	.;.;ZF112_HUMAN	G	892;892;886;909;891	ENSP00000337081:E892G;ENSP00000346305:E886G;ENSP00000441990:E909G	ENSP00000253426:E891G	E	-	2	0	ZNF285	49523493	0.000000	0.05858	0.006000	0.13384	0.020000	0.10135	-0.098000	0.11024	0.421000	0.25980	0.460000	0.39030	GAA		0.383	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1	NM_013380		Missense_Mutation
FBXO46	23403	broad.mit.edu	37	19	46215218	46215218	+	Silent	SNP	C	C	T			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr19:46215218C>T	ENST00000317683.3	-	2	1669	c.1536G>A	c.(1534-1536)gtG>gtA	p.V512V		NM_001080469.1	NP_001073938.1	Q6PJ61	FBX46_HUMAN	F-box protein 46	512	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.							p.V512V(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	15		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)		CTGTGGCCCGCACGCCAAACG	0.642																																																1	Substitution - coding silent(1)	ovary(1)	19											29.0	32.0	31.0					19																	46215218		2121	4232	6353	50907058	SO:0001819	synonymous_variant	23403			BC021978	CCDS46116.1	19q13.3	2008-02-05	2004-06-15	2004-06-16		ENSG00000177051		"""F-boxes /  ""other"""""	25069	protein-coding gene	gene with protein product		609117	"""F-box only protein 34-like"""	FBXO34L		9585442	Standard	NM_001080469		Approved	20D7-FC4, Fbx46	uc002pcz.3	Q6PJ61		ENST00000317683.3:c.1536G>A	19.37:g.46215218C>T			50907058		Silent	SNP	ENST00000317683.3	37	CCDS46116.1	SNP	25	Broad																																																																																				0.642	FBXO46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459661.1	XM_371179		Silent
CYTH2	9266	broad.mit.edu	37	19	48975660	48975660	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr19:48975660G>T	ENST00000595676.1	+	4	415	c.265G>T	c.(265-267)Ggg>Tgg	p.G89W	CYTH2_ENST00000427476.1_Missense_Mutation_p.G105W|CTC-273B12.5_ENST00000593476.1_RNA|CYTH2_ENST00000452733.2_Missense_Mutation_p.G105W|CTC-273B12.5_ENST00000600650.1_RNA														p.G105W(1)									CAAGGGCGAGGGGCTGAACAA	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											58.0	53.0	55.0					19																	48975660		2203	4300	6503	53667472	SO:0001583	missense	9266																														ENST00000595676.1:c.265G>T	19.37:g.48975660G>T	ENSP00000470383:p.Gly89Trp		53667472		Missense_Mutation	SNP	ENST00000595676.1	37		SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	g	20.3	3.966889	0.74131	.	.	ENSG00000105443	ENST00000452733;ENST00000427476;ENST00000325139	T;T;T	0.37058	1.22;1.22;1.22	4.51	3.47	0.39725	.	0.000000	0.85682	D	0.000000	T	0.71400	0.3335	H	0.97962	4.115	0.58432	D	0.999993	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.988	T	0.79271	-0.1872	10	0.87932	D	0	.	10.6793	0.45804	0.0964:0.0:0.9035:0.0	.	105;105	B4DS60;Q99418-2	.;.	W	105;105;127	ENSP00000408236:G105W;ENSP00000391648:G105W;ENSP00000314566:G127W	ENSP00000314566:G127W	G	+	1	0	CYTH2	53667472	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.802000	0.99131	1.034000	0.39945	0.306000	0.20318	GGG		0.632	CTC-273B12.7-001	PUTATIVE	mRNA_end_NF|cds_end_NF|basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000466132.1			Missense_Mutation
PAX8	7849	broad.mit.edu	37	2	113999127	113999127	+	Splice_Site	SNP	C	C	A			TCGA-24-1551-01	TCGA-24-1551-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr2:113999127C>A	ENST00000429538.3	-	7	972		c.e7+1		AC016683.6_ENST00000456685.1_RNA|PAX8_ENST00000263335.7_Splice_Site|AC016683.6_ENST00000556070.1_RNA|AC016683.6_ENST00000553869.2_RNA|PAX8_ENST00000348715.5_Splice_Site|AC016683.6_ENST00000333145.5_RNA|AC016683.6_ENST00000451179.1_RNA|RP11-65I12.1_ENST00000553319.1_RNA|AC016683.6_ENST00000437551.1_RNA|AC016683.6_ENST00000436293.2_RNA|AC016683.6_ENST00000422956.2_RNA|PAX8_ENST00000397647.3_Splice_Site|PAX8_ENST00000263334.5_Splice_Site|AC016683.6_ENST00000445745.1_RNA	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8						anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)	p.?(1)	PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						CAGCTTCTCACCTGCTCGCCT	0.607			T	PPARG	follicular thyroid		Thyroid dysgenesis																														Ovarian(188;7 2067 9084 29802 29892)		Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	1	Unknown(1)	ovary(1)	2											16.0	19.0	18.0					2																	113999127		1992	4166	6158	113715597	SO:0001630	splice_region_variant	7849			X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.777+1G>T	2.37:g.113999127C>A			113715597	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Missense_Mutation	SNP	ENST00000429538.3	37	CCDS46398.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515319	0.64634	.	.	ENSG00000125618	ENST00000263335;ENST00000397647;ENST00000348715;ENST00000429538;ENST00000468980;ENST00000263334	.	.	.	4.7	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1782	0.54198	0.1723:0.8277:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PAX8	113715597	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.532000	0.73825	1.082000	0.41137	0.650000	0.86243	.		0.607	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250353.5		Intron	Missense_Mutation
CSF2RB	1439	broad.mit.edu	37	22	37334149	37334149	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1551-01	TCGA-24-1551-10			G	T	G	T	Unknown	Valid	Germline	x	x	Sequenom_PCR_WGA			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr22:37334149G>T	ENST00000403662.3	+	14	2521	c.2299G>T	c.(2299-2301)Gtg>Ttg	p.V767L	CSF2RB_ENST00000406230.1_Missense_Mutation_p.V773L|CSF2RB_ENST00000262825.5_Missense_Mutation_p.V773L|CSF2RB_ENST00000536485.1_Missense_Mutation_p.V714L			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	767					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.V767L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	TGAGGGCTATGTGGAGCTCCC	0.647																																																1	Substitution - Missense(1)	ovary(1)	22											43.0	42.0	42.0					22																	37334149		2203	4300	6503	35664095	SO:0001583	missense	1439			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2299G>T	22.37:g.37334149G>T	ENSP00000384053:p.Val767Leu		35664095	Q5JZI1|Q6ICE0	Missense_Mutation	SNP	ENST00000403662.3	37	CCDS13936.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	17.01	3.280180	0.59758	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.95622	-3.23;-3.76;-3.76;-3.76	5.5	4.49	0.54785	.	0.158580	0.29438	N	0.012159	D	0.96688	0.8919	M	0.71581	2.175	0.30761	N	0.744122	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	D	0.94108	0.7368	10	0.30078	T	0.28	-12.7559	10.1335	0.42693	0.0917:0.0:0.9083:0.0	.	773;767	P32927-2;P32927	.;IL3RB_HUMAN	L	767;767;773;773;714	ENSP00000384053:V767L;ENSP00000262825:V773L;ENSP00000385271:V773L;ENSP00000440003:V714L	ENSP00000262825:V773L	V	+	1	0	CSF2RB	35664095	0.998000	0.40836	0.978000	0.43139	0.411000	0.31082	1.579000	0.36536	1.325000	0.45301	0.555000	0.69702	GTG		0.647	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395		Missense_Mutation
LDOC1L	84247	broad.mit.edu	37	22	44893392	44893392	+	Silent	SNP	T	T	C			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr22:44893392T>C	ENST00000341255.3	-	2	554	c.45A>G	c.(43-45)gcA>gcG	p.A15A		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	15								p.A15A(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		TCGGAGACGCTGCCAAGGCTG	0.647																																																1	Substitution - coding silent(1)	ovary(1)	22											49.0	36.0	41.0					22																	44893392		2202	4300	6502	43272056	SO:0001819	synonymous_variant	84247			CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.45A>G	22.37:g.44893392T>C			43272056	Q6ZTR1	Silent	SNP	ENST00000341255.3	37	CCDS33662.1	SNP	55	Broad																																																																																				0.647	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287		Silent
ZCWPW2	152098	broad.mit.edu	37	3	28454757	28454757	+	Silent	SNP	A	A	G			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr3:28454757A>G	ENST00000383768.2	+	3	386	c.198A>G	c.(196-198)tcA>tcG	p.S66S	ZCWPW2_ENST00000421010.1_Silent_p.S66S			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	66							zinc ion binding (GO:0008270)	p.S66S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						ACACTGATTCAAGATATAATA	0.383																																																1	Substitution - coding silent(1)	ovary(1)	3											127.0	123.0	124.0					3																	28454757		2203	4300	6503	28429761	SO:0001819	synonymous_variant	152098			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.198A>G	3.37:g.28454757A>G			28429761		Silent	SNP	ENST00000383768.2	37	CCDS33723.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	8.679	0.904772	0.17760	.	.	ENSG00000206559	ENST00000428875	.	.	.	5.41	1.52	0.23074	.	.	.	.	.	T	0.36580	0.0972	.	.	.	0.31696	N	0.641263	.	.	.	.	.	.	T	0.39961	-0.9588	4	.	.	.	1.2678	4.6574	0.12624	0.6528:0.171:0.1761:0.0	.	.	.	.	E	50	.	.	K	+	1	0	ZCWPW2	28429761	0.871000	0.30034	0.476000	0.27291	0.925000	0.55904	1.250000	0.32850	0.016000	0.14998	0.533000	0.62120	AAG		0.383	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384		Silent
WDR82	80335	broad.mit.edu	37	3	52295435	52295435	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr3:52295435C>G	ENST00000296490.3	-	4	668	c.387G>C	c.(385-387)aaG>aaC	p.K129N		NM_025222.3	NP_079498.2	Q6UXN9	WDR82_HUMAN	WD repeat domain 82	129					histone H3-K4 methylation (GO:0051568)	chromatin (GO:0000785)|histone methyltransferase complex (GO:0035097)|PTW/PP1 phosphatase complex (GO:0072357)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)	p.K129N(1)							BRCA - Breast invasive adenocarcinoma(193;2.67e-05)|Kidney(197;0.00198)|KIRC - Kidney renal clear cell carcinoma(197;0.00223)|OV - Ovarian serous cystadenocarcinoma(275;0.246)		GTCGAATGGTCTTATCAAGAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	3											73.0	71.0	71.0					3																	52295435		1899	4111	6010	52270475	SO:0001583	missense	80335			AF132207	CCDS2851.2	3p21.2	2013-01-10	2007-07-04	2007-07-04	ENSG00000164091	ENSG00000164091		"""WD repeat domain containing"""	28826	protein-coding gene	gene with protein product		611059	"""transmembrane protein 113"""	TMEM113		17355966	Standard	NM_025222		Approved	PRO2730, MST107, MSTP107, PRO34047, WDR82A, SWD2	uc003ddl.2	Q6UXN9	OTTHUMG00000150391	ENST00000296490.3:c.387G>C	3.37:g.52295435C>G	ENSP00000296490:p.Lys129Asn		52270475	A8K5R5|Q8TEB2	Missense_Mutation	SNP	ENST00000296490.3	37	CCDS2851.2	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	11.83	1.757159	0.31137	.	.	ENSG00000164091	ENST00000296490;ENST00000469000;ENST00000463624	T;T;T	0.60171	0.21;0.21;0.21	5.23	0.87	0.19102	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.085212	0.85682	D	0.000000	T	0.35098	0.0920	N	0.13371	0.34	0.58432	D	0.999998	B;B	0.14438	0.003;0.01	B;B	0.22386	0.039;0.011	T	0.05305	-1.0893	10	0.29301	T	0.29	.	8.1765	0.31285	0.0:0.482:0.0:0.518	.	129;15	Q6UXN9;C9JBU3	WDR82_HUMAN;.	N	129;15;15	ENSP00000296490:K129N;ENSP00000420779:K15N;ENSP00000417313:K15N	ENSP00000296490:K129N	K	-	3	2	WDR82	52270475	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	0.450000	0.21762	0.317000	0.23160	-0.234000	0.12200	AAG		0.438	WDR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317919.1	NM_025222		Missense_Mutation
ADAMTS16	170690	broad.mit.edu	37	5	5318344	5318344	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr5:5318344C>T	ENST00000274181.7	+	22	3647	c.3509C>T	c.(3508-3510)tCg>tTg	p.S1170L		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1170	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S1170L(1)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CAGAAGCCTTCGGCCTCCCTG	0.657																																																1	Substitution - Missense(1)	ovary(1)	5											29.0	34.0	32.0					5																	5318344		1997	4158	6155	5371344	SO:0001583	missense	170690			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3509C>T	5.37:g.5318344C>T	ENSP00000274181:p.Ser1170Leu		5371344	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	1.513	-0.548858	0.04024	.	.	ENSG00000145536	ENST00000274181	T	0.16897	2.31	4.69	-4.57	0.03421	.	2.495180	0.01515	N	0.018086	T	0.09069	0.0224	N	0.13140	0.3	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.23368	-1.0190	10	0.23891	T	0.37	.	5.434	0.16469	0.3896:0.1426:0.0:0.4678	.	1170	Q8TE57	ATS16_HUMAN	L	1170	ENSP00000274181:S1170L	ENSP00000274181:S1170L	S	+	2	0	ADAMTS16	5371344	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.238000	0.02919	-0.798000	0.04444	-2.570000	0.00171	TCG		0.657	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		Missense_Mutation
FBXW11	23291	broad.mit.edu	37	5	171318554	171318554	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1551-01	TCGA-24-1551-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr5:171318554G>A	ENST00000265094.5	-	6	843	c.706C>T	c.(706-708)Cgc>Tgc	p.R236C	FBXW11_ENST00000393802.2_Missense_Mutation_p.R202C|FBXW11_ENST00000522891.1_5'UTR|FBXW11_ENST00000425623.2_Missense_Mutation_p.R204C|FBXW11_ENST00000296933.6_Missense_Mutation_p.R223C	NM_012300.2	NP_036432.2	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11	236					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.R236C(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	21	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTTTCAGAGCGGCACTGAATC	0.378																																																1	Substitution - Missense(1)	ovary(1)	5											81.0	76.0	78.0					5																	171318554		2203	4300	6503	171251159	SO:0001583	missense	23291			AB014596	CCDS34289.1, CCDS47340.1, CCDS47341.1	5q35.1	2013-01-09	2007-02-08	2004-06-16	ENSG00000072803	ENSG00000072803		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13607	protein-coding gene	gene with protein product		605651	"""F-box and WD-40 domain protein 1B"", ""F-box and WD-40 domain protein 11"""	FBXW1B		10531035, 10694485	Standard	NM_033644		Approved	KIAA0696, Fbw1b, BTRCP2, BTRC2, Hos, Fbw11	uc003mbm.1	Q9UKB1	OTTHUMG00000163267	ENST00000265094.5:c.706C>T	5.37:g.171318554G>A	ENSP00000265094:p.Arg236Cys		171251159	B2RC98|Q9P2S8|Q9P2S9|Q9Y4C6	Missense_Mutation	SNP	ENST00000265094.5	37	CCDS34289.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979682	0.74360	.	.	ENSG00000072803	ENST00000296933;ENST00000265094;ENST00000393802;ENST00000425623	T;T;T;T	0.35789	1.29;2.24;1.29;1.29	4.96	4.96	0.65561	WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.51007	0.1649	L	0.45581	1.43	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;P;D;P	0.68765	0.914;0.86;0.96;0.901	T	0.52185	-0.8609	10	0.87932	D	0	-9.2791	13.1763	0.59629	0.0:0.0:0.8402:0.1598	.	204;202;236;223	B4DH70;Q9UKB1-2;Q9UKB1;Q9UKB1-3	.;.;FBW1B_HUMAN;.	C	223;236;202;204	ENSP00000296933:R223C;ENSP00000265094:R236C;ENSP00000377391:R202C;ENSP00000444929:R204C	ENSP00000265094:R236C	R	-	1	0	FBXW11	171251159	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.189000	0.65098	2.465000	0.83290	0.591000	0.81541	CGC		0.378	FBXW11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372382.1	NM_012300		Missense_Mutation
CYP21A2	1589	broad.mit.edu	37	6	32006283	32006283	+	Silent	SNP	C	C	T			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr6:32006283C>T	ENST00000418967.2	+	1	242	c.84C>T	c.(82-84)ctC>ctT	p.L28L	CYP21A2_ENST00000435122.2_Silent_p.L28L|C4B-AS1_ENST00000415626.1_RNA	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	27					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)	p.L28L(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	TCCGGAGCCTCCACCTCCCGC	0.672																																					Melanoma(174;1669 1998 3915 34700 46447)											1	Substitution - coding silent(1)	ovary(1)	6											12.0	11.0	12.0					6																	32006283		1504	2702	4206	32114262	SO:0001819	synonymous_variant	1589			X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.84C>T	6.37:g.32006283C>T			32114262	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Silent	SNP	ENST00000418967.2	37	CCDS4735.1	SNP	30	Broad																																																																																				0.672	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268768.2	NM_000500		Silent
TRRAP	8295	broad.mit.edu	37	7	98553852	98553852	+	Silent	SNP	C	C	T			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr7:98553852C>T	ENST00000359863.4	+	41	6209	c.6000C>T	c.(5998-6000)atC>atT	p.I2000I	TRRAP_ENST00000446306.3_Silent_p.I1981I|TRRAP_ENST00000355540.3_Silent_p.I1982I	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2000					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.I1982I(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GTGTCACCATCGAGCAGAGGC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	7											49.0	43.0	45.0					7																	98553852		2203	4300	6503	98391788	SO:0001819	synonymous_variant	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.6000C>T	7.37:g.98553852C>T			98391788	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	37	CCDS59066.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	7.286	0.610073	0.14066	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.26	-8.34	0.00988	.	.	.	.	.	T	0.42743	0.1216	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46830	-0.9163	4	.	.	.	.	4.8123	0.13349	0.1718:0.1736:0.0799:0.5748	.	.	.	.	L	1722	.	.	S	+	2	0	TRRAP	98391788	0.000000	0.05858	0.789000	0.31954	0.833000	0.47200	-3.148000	0.00583	-1.466000	0.01897	-2.317000	0.00253	TCG		0.637	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496		Silent
MOGAT3	346606	broad.mit.edu	37	7	100842084	100842084	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr7:100842084C>A	ENST00000223114.4	-	4	482	c.316G>T	c.(316-318)Gat>Tat	p.D106Y	MOGAT3_ENST00000379423.3_Missense_Mutation_p.D106Y|MOGAT3_ENST00000440203.2_Missense_Mutation_p.D106Y	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	106					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)	p.D106Y(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					TAGTTCCGATCCGGGGGCAGC	0.592																																																1	Substitution - Missense(1)	ovary(1)	7											68.0	74.0	72.0					7																	100842084		2203	4300	6503	100628804	SO:0001583	missense	346606			AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.316G>T	7.37:g.100842084C>A	ENSP00000223114:p.Asp106Tyr		100628804	Q496A6|Q496A7|Q496A8|Q9UDW7	Missense_Mutation	SNP	ENST00000223114.4	37	CCDS5714.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	.	15.73	2.918482	0.52546	.	.	ENSG00000106384	ENST00000223114;ENST00000440203;ENST00000379423	D;T;T	0.94232	-3.38;2.37;2.37	5.33	-2.1	0.07210	.	0.377696	0.31660	N	0.007262	D	0.94742	0.8303	M	0.85197	2.74	0.09310	N	1	D;D	0.63880	0.993;0.975	P;P	0.61592	0.891;0.686	D	0.88906	0.3356	10	0.72032	D	0.01	-16.6988	6.4173	0.21723	0.0:0.463:0.122:0.415	.	106;106	Q86VF5-2;Q86VF5	.;MOGT3_HUMAN	Y	106	ENSP00000223114:D106Y;ENSP00000403756:D106Y;ENSP00000368734:D106Y	ENSP00000223114:D106Y	D	-	1	0	MOGAT3	100628804	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.165000	0.09968	-0.330000	0.08514	-0.150000	0.13652	GAT		0.592	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059649.3	NM_178176		Missense_Mutation
WDR91	29062	broad.mit.edu	37	7	134880941	134880941	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr7:134880941C>G	ENST00000354475.4	-	8	1230	c.1199G>C	c.(1198-1200)gGa>gCa	p.G400A	WDR91_ENST00000423565.1_Missense_Mutation_p.G365A|AC009542.2_ENST00000412549.2_RNA|WDR91_ENST00000344400.5_Missense_Mutation_p.G400A|WDR91_ENST00000485942.1_5'Flank	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	400								p.G400A(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						CTCCTCCTGTCCCAGCACAAT	0.622																																																1	Substitution - Missense(1)	ovary(1)	7											76.0	75.0	75.0					7																	134880941		2203	4300	6503	134531481	SO:0001583	missense	29062			AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.1199G>C	7.37:g.134880941C>G	ENSP00000346466:p.Gly400Ala		134531481	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	37	CCDS34758.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	11.16	1.555934	0.27827	.	.	ENSG00000105875	ENST00000344400;ENST00000354475;ENST00000423565	T;T;T	0.63417	1.58;-0.04;0.53	5.79	5.79	0.91817	.	0.124972	0.64402	D	0.000001	T	0.49762	0.1576	L	0.28274	0.84	0.39330	D	0.965408	B	0.02656	0.0	B	0.04013	0.001	T	0.48581	-0.9023	10	0.08599	T	0.76	-7.4019	19.6424	0.95763	0.0:1.0:0.0:0.0	.	400	A4D1P6	WDR91_HUMAN	A	400;400;365	ENSP00000340877:G400A;ENSP00000346466:G400A;ENSP00000392555:G365A	ENSP00000340877:G400A	G	-	2	0	WDR91	134531481	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.790000	0.85794	2.722000	0.93159	0.655000	0.94253	GGA		0.622	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149		Missense_Mutation
MFHAS1	9258	broad.mit.edu	37	8	8750063	8750063	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr8:8750063C>A	ENST00000276282.6	-	1	1092	c.506G>T	c.(505-507)cGg>cTg	p.R169L		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	169								p.R169L(1)		endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GTGCGCCAGCCGGTTAAAGCT	0.677																																					Melanoma(103;1201 2045 17515 28966)											1	Substitution - Missense(1)	ovary(1)	8											22.0	30.0	27.0					8																	8750063		2196	4294	6490	8787473	SO:0001583	missense	9258			AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.506G>T	8.37:g.8750063C>A	ENSP00000276282:p.Arg169Leu		8787473	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	5.909	0.351847	0.11182	.	.	ENSG00000147324	ENST00000276282	T	0.31247	1.5	5.29	3.49	0.39957	.	0.358670	0.26460	N	0.024252	T	0.21801	0.0525	L	0.37561	1.115	0.31478	N	0.667501	B	0.12630	0.006	B	0.13407	0.009	T	0.15723	-1.0427	10	0.27082	T	0.32	.	8.4264	0.32731	0.0:0.7612:0.0:0.2388	.	169	Q9Y4C4	MFHA1_HUMAN	L	169	ENSP00000276282:R169L	ENSP00000276282:R169L	R	-	2	0	MFHAS1	8787473	0.696000	0.27757	1.000000	0.80357	0.189000	0.23516	1.039000	0.30266	0.609000	0.30018	0.563000	0.77884	CGG		0.677	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225		Missense_Mutation
SPATC1	375686	broad.mit.edu	37	8	145095090	145095090	+	Silent	SNP	C	C	T			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr8:145095090C>T	ENST00000377470.3	+	2	594	c.492C>T	c.(490-492)acC>acT	p.T164T	SPATC1_ENST00000447830.2_Silent_p.T164T	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	164						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.T73T(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCACTGGCACCCTGACTCCCA	0.667																																																1	Substitution - coding silent(1)	ovary(1)	8											29.0	25.0	26.0					8																	145095090		2202	4299	6501	145167078	SO:0001819	synonymous_variant	375686			BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.492C>T	8.37:g.145095090C>T			145167078	B4DWW9|Q5U5I8|Q7Z6L7	Silent	SNP	ENST00000377470.3	37	CCDS6413.2	SNP	22	Broad																																																																																				0.667	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346926.1	NM_198572		Silent
ZNF7	7553	broad.mit.edu	37	8	146067488	146067488	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chr8:146067488G>T	ENST00000528372.1	+	5	1236	c.996G>T	c.(994-996)agG>agT	p.R332S	ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000544249.1_Missense_Mutation_p.R236S|ZNF7_ENST00000446747.2_Missense_Mutation_p.R343S|ZNF7_ENST00000325241.6_Missense_Mutation_p.R332S			P17097	ZNF7_HUMAN	zinc finger protein 7	332					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R332S(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		CAGGAGAGAGGCCCTATGGTT	0.547																																																1	Substitution - Missense(1)	ovary(1)	8											65.0	62.0	63.0					8																	146067488		2203	4300	6503	146038292	SO:0001583	missense	7553			AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.996G>T	8.37:g.146067488G>T	ENSP00000432724:p.Arg332Ser		146038292	B4DT08|D3DWN6|P17015|Q8N8Y4	Missense_Mutation	SNP	ENST00000528372.1	37	CCDS6435.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481912	0.63849	.	.	ENSG00000147789	ENST00000325241;ENST00000446747;ENST00000544249;ENST00000528372	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	4.91	1.92	0.25849	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49305	D	0.000160	T	0.16342	0.0393	L	0.56340	1.77	0.80722	D	1	P;P	0.49090	0.919;0.919	B;B	0.40256	0.324;0.324	T	0.03374	-1.1043	9	.	.	.	-30.1067	5.5907	0.17299	0.4793:0.0:0.5207:0.0	.	343;332	B4DT08;P17097	.;ZNF7_HUMAN	S	332;343;236;332	ENSP00000320627:R332S;ENSP00000393260:R343S;ENSP00000439424:R236S;ENSP00000432724:R332S	.	R	+	3	2	ZNF7	146038292	0.000000	0.05858	1.000000	0.80357	0.920000	0.55202	-0.362000	0.07602	0.681000	0.31386	0.455000	0.32223	AGG		0.547	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416		Missense_Mutation
FAM120C	54954	broad.mit.edu	37	X	54106713	54106713	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chrX:54106713T>A	ENST00000375180.2	-	15	3044	c.2988A>T	c.(2986-2988)aaA>aaT	p.K996N	FAM120C_ENST00000328235.4_Missense_Mutation_p.K859M	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	996							poly(A) RNA binding (GO:0044822)	p.K996N(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						CAGTCTGTTCTTTTCCATGCC	0.368																																																1	Substitution - Missense(1)	ovary(1)	X											163.0	137.0	146.0					X																	54106713		2203	4300	6503	54123438	SO:0001583	missense	54954			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.2988A>T	X.37:g.54106713T>A	ENSP00000364324:p.Lys996Asn		54123438	B2RMT7	Missense_Mutation	SNP	ENST00000375180.2	37	CCDS14356.1	SNP	56	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.13|14.13	2.443982|2.443982	0.43429|0.43429	.|.	.|.	ENSG00000184083|ENSG00000184083	ENST00000328235|ENST00000375180	T|T	0.34667|0.23552	1.35|1.9	4.89|4.89	3.72|3.72	0.42706|0.42706	.|.	0.503857|0.503857	0.20488|0.20488	N|N	0.091343|0.091343	T|T	0.13628|0.13628	0.0330|0.0330	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	P|P	0.49447|0.43885	0.924|0.82	P|B	0.53313|0.38500	0.723|0.275	T|T	0.03240|0.03240	-1.1057|-1.1057	10|10	0.56958|0.59425	D|D	0.05|0.04	-5.3281|-5.3281	7.4002|7.4002	0.26960|0.26960	0.0:0.1063:0.0:0.8937|0.0:0.1063:0.0:0.8937	.|.	859|996	F8W881|Q9NX05	.|F120C_HUMAN	M|N	859|996	ENSP00000329896:K859M|ENSP00000364324:K996N	ENSP00000329896:K859M|ENSP00000364324:K996N	K|K	-|-	2|3	0|2	FAM120C|FAM120C	54123438|54123438	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.667000|0.667000	0.39255|0.39255	1.309000|1.309000	0.33539|0.33539	1.733000|1.733000	0.51620|0.51620	0.412000|0.412000	0.27726|0.27726	AAG|AAA		0.368	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056795.2	NM_017848		Missense_Mutation
Unknown	0	broad.mit.edu	37	X	0	0	+	IGR	SNP	A	A	G			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Invalid:failed_liftOver	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chrX:0A>G								None (None upstream) : PLCXD1 (192988 downstream)																							NNNNNNNNNN	0.0																																																0			X																																								148576548	SO:0001628	intergenic_variant	4110																															X.37:g.0A>G			148576548		Silent	SNP		37		SNP	12	Broad																																																																																			0	0.000									Silent
ARMCX2	9823	broad.mit.edu	37	X	100911660	100911660	+	Silent	SNP	G	G	A			TCGA-24-1551-01	TCGA-24-1551-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chrX:100911660G>A	ENST00000328766.5	-	5	1368	c.915C>T	c.(913-915)gaC>gaT	p.D305D	ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000330154.2_Silent_p.D305D|ARMCX2_ENST00000356824.4_Silent_p.D305D	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	305						integral component of membrane (GO:0016021)		p.D305D(1)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						TCCCCAGTTCGTCTACTTCAA	0.592																																																1	Substitution - coding silent(1)	ovary(1)	X											128.0	139.0	135.0					X																	100911660		2203	4300	6503	100798316	SO:0001819	synonymous_variant	9823			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.915C>T	X.37:g.100911660G>A			100798316	O60267|Q5H9D9	Silent	SNP	ENST00000328766.5	37	CCDS14490.1	SNP	40	Broad																																																																																				0.592	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782		Silent
L1CAM	3897	broad.mit.edu	37	X	153136544	153136544	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-1551-01	TCGA-24-1551-10	g.chrX:153136544G>A	ENST00000370060.1	-	6	680	c.491C>T	c.(490-492)gCa>gTa	p.A164V	L1CAM_ENST00000370057.3_Missense_Mutation_p.A164V|L1CAM_ENST00000361981.3_Missense_Mutation_p.A159V|L1CAM_ENST00000361699.4_Missense_Mutation_p.A164V|L1CAM_ENST00000543994.1_Missense_Mutation_p.A166V|L1CAM_ENST00000370055.1_Missense_Mutation_p.A159V|L1CAM_ENST00000538883.1_Missense_Mutation_p.A166V	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	164	Ig-like C2-type 2.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.A164V(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GAGAGGCTCTGCACTTGGGGG	0.642																																																1	Substitution - Missense(1)	ovary(1)	X											47.0	43.0	44.0					X																	153136544		2203	4300	6503	152789738	SO:0001583	missense	3897			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.491C>T	X.37:g.153136544G>A	ENSP00000359077:p.Ala164Val		152789738	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	7.544	0.661204	0.14645	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000540065;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98	5.12	4.26	0.50523	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000008	T	0.64438	0.2598	L	0.41710	1.295	0.21933	N	0.999461	B;B;B	0.18013	0.02;0.02;0.025	B;B;B	0.22753	0.024;0.024;0.041	T	0.50701	-0.8797	10	0.22706	T	0.39	.	11.7574	0.51882	0.0886:0.0:0.9114:0.0	.	159;164;164	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	V	164;166;164;166;159;34;159;164	ENSP00000359077:A164V;ENSP00000438430:A166V;ENSP00000359074:A164V;ENSP00000439645:A166V;ENSP00000354712:A159V;ENSP00000359072:A159V;ENSP00000355380:A164V	ENSP00000355380:A164V	A	-	2	0	L1CAM	152789738	0.000000	0.05858	0.007000	0.13788	0.380000	0.30137	0.932000	0.28884	1.151000	0.42436	0.436000	0.28706	GCA		0.642	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		Missense_Mutation
UBL4B	164153	broad.mit.edu	37	1	110655663	110655663	+	Frame_Shift_Del	DEL	G	G	-			TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-1551-01	TCGA-24-1551-10	g.chr1:110655663delG	ENST00000334179.3	+	1	602	c.507delG	c.(505-507)gagfs	p.E169fs		NM_203412.1	NP_981957.1	Q8N7F7	UBL4B_HUMAN	ubiquitin-like 4B	169						cytoplasm (GO:0005737)		p.A170fs*>5(1)|p.E169E(1)		endometrium(1)|kidney(1)|large_intestine(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	7		all_cancers(81;1.14e-05)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0236)|all cancers(265;0.0823)|Epithelial(280;0.0917)|Colorectal(144;0.109)|LUSC - Lung squamous cell carcinoma(189;0.134)		AGAAGGAGGAGGCAGCAGCTG	0.567																																																2	Deletion - Frameshift(1)|Substitution - coding silent(1)	ovary(1)|endometrium(1)	1											19.0	21.0	20.0					1																	110655663		2201	4288	6489	110457186	SO:0001589	frameshift_variant	164153				CCDS820.1	1p13.3	2013-09-24			ENSG00000186150	ENSG00000186150			32309	protein-coding gene	gene with protein product		611127				16872915	Standard	NM_203412		Approved	FLJ25690	uc001dzc.3	Q8N7F7	OTTHUMG00000166989	ENST00000334179.3:c.507delG	1.37:g.110655663delG	ENSP00000334044:p.Glu169fs		110457186		Frame_Shift_Del	DEL	ENST00000334179.3	37	CCDS820.1	DEL	35	Broad																																																																																				0.567	UBL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392303.1	NM_203412		Frame_Shift_Del
NRXN2	9379	broad.mit.edu	37	11	64375285	64375286	+	Frame_Shift_Ins	INS	-	-	G	rs369377520		TCGA-24-1551-01	TCGA-24-1551-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-1551-01	TCGA-24-1551-10	g.chr11:64375285_64375286insG	ENST00000377551.1	-	22	4732_4733	c.4521_4522insC	c.(4519-4524)cccacgfs	p.T1508fs	NRXN2_ENST00000377559.3_Frame_Shift_Ins_p.T1438fs|NRXN2_ENST00000265459.6_Frame_Shift_Ins_p.T1508fs|NRXN2_ENST00000409571.1_Frame_Shift_Ins_p.T1501fs|NRXN2_ENST00000301894.2_Frame_Shift_Ins_p.T462fs			Q9P2S2	NRX2A_HUMAN	neurexin 2	1508					adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.T1508fs*82(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TCGTCGTCCGTGGGGGGGAGGC	0.693																																																1	Insertion - Frameshift(1)	ovary(1)	11																																								64131862	SO:0001589	frameshift_variant	9379				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.4522dupC	11.37:g.64375292_64375292dupG	ENSP00000366774:p.Thr1508fs		64131861	A7E2C1|Q9Y2D6	Frame_Shift_Ins	INS	ENST00000377551.1	37	CCDS8077.1	INS	59	Broad																																																																																				0.693	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080		Frame_Shift_Ins
