#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ADAMTS16	170690	hgsc.bcm.edu	37	5	5239978	5239978	+	Silent	SNP	C	C	G			TCGA-24-1553-01	TCGA-24-1553-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr5:5239978C>G	ENST00000274181.7	+	16	2601	c.2463C>G	c.(2461-2463)tcC>tcG	p.S821S		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	821	Spacer.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S821S(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						ACAGACGGTCCTATAATGAGC	0.522																																																2	Substitution - coding silent(2)	ovary(2)	5											98.0	96.0	97.0					5																	5239978		1866	4109	5975	5292978	SO:0001819	synonymous_variant	170690			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2463C>G	5.37:g.5239978C>G			5292978	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1	SNP	24	Baylor																																																																																				0.522	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		Silent
ARF3	377	hgsc.bcm.edu	37	12	49334780	49334780	+	Silent	SNP	G	G	T			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr12:49334780G>T	ENST00000256682.4	-	2	433	c.99C>A	c.(97-99)atC>atA	p.I33I	ARF3_ENST00000447318.2_Silent_p.I33I|RP11-302B13.5_ENST00000398092.4_Silent_p.I33I|ARF3_ENST00000541959.1_Silent_p.I33I|ARF3_ENST00000541967.1_5'Flank|AC073610.5_ENST00000537495.1_5'Flank	NM_001659.2	NP_001650.1	P61204	ARF3_HUMAN	ADP-ribosylation factor 3	33					GTP catabolic process (GO:0006184)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|lung(2)|skin(1)	4						GCTTGTATAGGATGGTGGTCT	0.547																																					Pancreas(189;1862 2134 4419 30933 49364)											0			12											252.0	210.0	224.0					12																	49334780		2203	4300	6503	47621047	SO:0001819	synonymous_variant	377			M74491	CCDS8774.1	12q13.12	2013-01-22			ENSG00000134287	ENSG00000134287		"""ADP-ribosylation factors"""	654	protein-coding gene	gene with protein product	"""small GTP binding protein"""	103190				8661066	Standard	NM_001659		Approved		uc001rsr.2	P61204	OTTHUMG00000168080	ENST00000256682.4:c.99C>A	12.37:g.49334780G>T			47621047	A8K6G8|B7ZB63|P16587	Silent	SNP	ENST00000256682.4	37	CCDS8774.1	SNP	41	Baylor																																																																																				0.547	ARF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258242.2	NM_001659		Silent
ATP5B	506	hgsc.bcm.edu	37	12	57033004	57033004	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1553-01	TCGA-24-1553-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr12:57033004T>G	ENST00000262030.3	-	9	1425	c.1375A>C	c.(1375-1377)Aaa>Caa	p.K459Q	ATP5B_ENST00000550162.1_5'Flank|BAZ2A_ENST00000379441.3_5'Flank|BAZ2A_ENST00000179765.5_5'Flank|BAZ2A_ENST00000551812.1_5'Flank|ATP5B_ENST00000552919.1_Missense_Mutation_p.K448Q	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	459					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CGCTGTATTTTCCGTGCACGG	0.478																																																0			12											144.0	132.0	136.0					12																	57033004		2203	4300	6503	55319271	SO:0001583	missense	506			M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1375A>C	12.37:g.57033004T>G	ENSP00000262030:p.Lys459Gln		55319271	A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	37	CCDS8924.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	29.9	5.043560	0.93685	.	.	ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000552104;ENST00000551020	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	5.92	5.92	0.95590	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (2);ATPase, F1 complex beta subunit/V1 complex, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90021	0.6884	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.91921	0.5547	10	0.87932	D	0	-19.0085	15.3986	0.74818	0.0:0.0:0.0:1.0	.	459	P06576	ATPB_HUMAN	Q	459;448;162;274	ENSP00000262030:K459Q;ENSP00000450297:K448Q;ENSP00000450233:K162Q;ENSP00000446677:K274Q	ENSP00000262030:K459Q	K	-	1	0	ATP5B	55319271	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.872000	0.87187	2.278000	0.76064	0.524000	0.50904	AAA		0.478	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686		Missense_Mutation
BACE2	25825	hgsc.bcm.edu	37	21	42622778	42622778	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1553-01	TCGA-24-1553-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr21:42622778C>G	ENST00000330333.6	+	7	1547	c.1084C>G	c.(1084-1086)Ctg>Gtg	p.L362V	BACE2_ENST00000347667.5_Intron|BACE2_ENST00000466122.1_3'UTR|BACE2_ENST00000328735.6_Missense_Mutation_p.L362V	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	362					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)	p.L362V(1)		endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				CTCCATCTACCTGAGAGACGA	0.463																																																1	Substitution - Missense(1)	ovary(1)	21											114.0	96.0	102.0					21																	42622778		2203	4300	6503	41544648	SO:0001583	missense	25825			AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.1084C>G	21.37:g.42622778C>G	ENSP00000332979:p.Leu362Val		41544648	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Missense_Mutation	SNP	ENST00000330333.6	37	CCDS13668.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.72	3.683337	0.68157	.	.	ENSG00000182240	ENST00000330333;ENST00000328735;ENST00000544566	T;T	0.47528	0.84;0.84	5.48	3.61	0.41365	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.157332	0.43110	D	0.000607	T	0.56587	0.1995	L	0.56340	1.77	0.46874	D	0.999239	D;P	0.63046	0.992;0.701	P;B	0.61800	0.894;0.266	T	0.58393	-0.7644	10	0.66056	D	0.02	.	8.8844	0.35394	0.257:0.6713:0.0:0.0717	.	362;362	Q9Y5Z0-3;Q9Y5Z0	.;BACE2_HUMAN	V	362;362;267	ENSP00000332979:L362V;ENSP00000333854:L362V	ENSP00000333854:L362V	L	+	1	2	BACE2	41544648	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	0.992000	0.29667	1.320000	0.45209	0.650000	0.86243	CTG		0.463	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1			Missense_Mutation
CCDC39	339829	hgsc.bcm.edu	37	3	180377277	180377277	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1553-01	TCGA-24-1553-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr3:180377277A>G	ENST00000442201.2	-	6	820	c.701T>C	c.(700-702)aTg>aCg	p.M234T	CCDC39_ENST00000273654.4_Missense_Mutation_p.M318T	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	234					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.M318T(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CCTCTTCTGCATCTGTTCTAT	0.353																																																1	Substitution - Missense(1)	ovary(1)	3											271.0	254.0	259.0					3																	180377277		1904	4126	6030	181859971	SO:0001583	missense	339829			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.701T>C	3.37:g.180377277A>G	ENSP00000405708:p.Met234Thr		181859971	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	19.06	3.754630	0.69648	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.24151	1.87;1.87	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.55000	0.1893	M	0.83012	2.62	0.54753	D	0.999987	D	0.89917	1.0	D	0.79108	0.992	T	0.61811	-0.6986	10	0.72032	D	0.01	-26.2267	15.5832	0.76462	1.0:0.0:0.0:0.0	.	234	Q9UFE4	CCD39_HUMAN	T	318;234	ENSP00000273654:M318T;ENSP00000405708:M234T	ENSP00000273654:M318T	M	-	2	0	CCDC39	181859971	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	6.626000	0.74253	2.087000	0.62958	0.377000	0.23210	ATG		0.353	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028		Missense_Mutation
CHD6	84181	hgsc.bcm.edu	37	20	40081431	40081431	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1553-01	TCGA-24-1553-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr20:40081431C>T	ENST00000373233.3	-	21	3449	c.3272G>A	c.(3271-3273)cGc>cAc	p.R1091H	CHD6_ENST00000309279.7_Intron	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1091					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.R1091H(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TCGGAGGTAGCGCCTGGCTTT	0.512																																																1	Substitution - Missense(1)	ovary(1)	20											140.0	122.0	128.0					20																	40081431		2203	4300	6503	39514845	SO:0001583	missense	84181			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.3272G>A	20.37:g.40081431C>T	ENSP00000362330:p.Arg1091His		39514845	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	33	5.256533	0.95336	.	.	ENSG00000124177	ENST00000373233	D	0.85258	-1.96	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000019	D	0.86003	0.5829	N	0.22421	0.69	0.80722	D	1	D	0.67145	0.996	P	0.58210	0.835	D	0.87684	0.2549	10	0.62326	D	0.03	-13.0405	19.2691	0.94002	0.0:1.0:0.0:0.0	.	1091	Q8TD26	CHD6_HUMAN	H	1091	ENSP00000362330:R1091H	ENSP00000362330:R1091H	R	-	2	0	CHD6	39514845	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.630000	0.89119	0.591000	0.81541	CGC		0.512	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1			Missense_Mutation
DCHS2	54798	hgsc.bcm.edu	37	4	155305580	155305580	+	Silent	SNP	G	G	A			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr4:155305580G>A	ENST00000357232.4	-	2	173	c.174C>T	c.(172-174)ctC>ctT	p.L58L	DCHS2_ENST00000339452.1_Intron	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	58	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L58L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		tagcaccccagagctcagtct	0.507																																																1	Substitution - coding silent(1)	ovary(1)	4											160.0	121.0	134.0					4																	155305580		2203	4300	6503	155525030	SO:0001819	synonymous_variant	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.174C>T	4.37:g.155305580G>A			155525030	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	SNP	33	Baylor																																																																																				0.507	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		Missense_Mutation
DNAJA3	9093	hgsc.bcm.edu	37	16	4493083	4493083	+	Silent	SNP	C	C	G			TCGA-24-1553-01	TCGA-24-1553-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr16:4493083C>G	ENST00000262375.6	+	6	926	c.849C>G	c.(847-849)tcC>tcG	p.S283S	DNAJA3_ENST00000355296.4_Silent_p.S283S|DNAJA3_ENST00000431375.2_Silent_p.S130S	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	283					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						GCCGCGGCTCCATCATCATAT	0.537																																																0			16											103.0	84.0	90.0					16																	4493083		2197	4300	6497	4433084	SO:0001819	synonymous_variant	9093			AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.849C>G	16.37:g.4493083C>G			4433084	B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Silent	SNP	ENST00000262375.6	37	CCDS10515.1	SNP	21	Baylor																																																																																				0.537	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251633.1			Silent
DOCK2	1794	hgsc.bcm.edu	37	5	169483758	169483758	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr5:169483758G>C	ENST00000256935.8	+	43	4446	c.4366G>C	c.(4366-4368)Gag>Cag	p.E1456Q	DOCK2_ENST00000540750.1_Missense_Mutation_p.E517Q|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.E948Q	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1456	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.E1456Q(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGTAGACCCAGAGAATGAGTT	0.557																																																1	Substitution - Missense(1)	ovary(1)	5											115.0	89.0	98.0					5																	169483758		2203	4300	6503	169416336	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4366G>C	5.37:g.169483758G>C	ENSP00000256935:p.Glu1456Gln		169416336	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578449	0.46006	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.15256	2.44;2.44;2.44	5.27	5.27	0.74061	.	0.277859	0.38897	N	0.001526	T	0.14874	0.0359	L	0.33339	1.005	0.40041	D	0.975655	B;B	0.33748	0.423;0.423	B;B	0.25614	0.062;0.027	T	0.04203	-1.0969	10	0.41790	T	0.15	.	18.8867	0.92381	0.0:0.0:1.0:0.0	.	948;1456	E7ERW7;Q92608	.;DOCK2_HUMAN	Q	1456;948;517	ENSP00000256935:E1456Q;ENSP00000429283:E948Q;ENSP00000438827:E517Q	ENSP00000256935:E1456Q	E	+	1	0	DOCK2	169416336	1.000000	0.71417	0.941000	0.38009	0.435000	0.31806	5.310000	0.65780	2.449000	0.82847	0.650000	0.86243	GAG		0.557	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		Missense_Mutation
FBLN5	10516	hgsc.bcm.edu	37	14	92343944	92343944	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1553-01	TCGA-24-1553-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr14:92343944C>G	ENST00000342058.4	-	10	1665	c.1072G>C	c.(1072-1074)Gga>Cga	p.G358R	FBLN5_ENST00000556154.1_Missense_Mutation_p.G363R|FBLN5_ENST00000267620.10_Missense_Mutation_p.G399R|FBLN5_ENST00000556961.1_5'Flank	NM_006329.3	NP_006320.2	Q9UBX5	FBLN5_HUMAN	fibulin 5	358					cell-matrix adhesion (GO:0007160)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|protein localization to cell surface (GO:0034394)|regulation of cell growth (GO:0001558)|regulation of removal of superoxide radicals (GO:2000121)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein C-terminus binding (GO:0008022)	p.G358R(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	28		all_cancers(154;0.0722)				ACGGAGCGTCCTGACACCACG	0.547																																																1	Substitution - Missense(1)	ovary(1)	14											131.0	111.0	118.0					14																	92343944		2203	4300	6503	91413697	SO:0001583	missense	10516			AJ133490	CCDS9898.1	14q31	2014-09-17				ENSG00000140092		"""Fibulins"""	3602	protein-coding gene	gene with protein product		604580				10640802	Standard	NM_006329		Approved	EVEC, UP50, DANCE, ARMD3	uc001xzx.4	Q9UBX5		ENST00000342058.4:c.1072G>C	14.37:g.92343944C>G	ENSP00000345008:p.Gly358Arg		91413697	O75966|Q6IAL4|Q6UWA3	Missense_Mutation	SNP	ENST00000342058.4	37	CCDS9898.1	SNP	24	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.5|25.5	4.642931|4.642931	0.87859|0.87859	.|.	.|.	ENSG00000140092|ENSG00000140092	ENST00000267620;ENST00000342058;ENST00000556154|ENST00000554121	D;D;D|.	0.82344|.	-1.57;-1.6;-1.56|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.172636|.	0.50627|.	D|.	0.000119|.	T|T	0.54822|0.54822	0.1882|0.1882	L|L	0.29908|0.29908	0.895|0.895	0.53688|0.53688	D|D	0.999973|0.999973	D;P;P|.	0.55385|.	0.971;0.95;0.917|.	P;P;B|.	0.58454|.	0.839;0.667;0.367|.	T|T	0.47522|0.47522	-0.9111|-0.9111	10|5	0.66056|.	D|.	0.02|.	.|.	13.9957|13.9957	0.64397|0.64397	0.0:0.9315:0.0:0.0685|0.0:0.9315:0.0:0.0685	.|.	399;363;358|.	G3XA98;G3V4U0;Q9UBX5|.	.;.;FBLN5_HUMAN|.	R|H	399;358;363|66	ENSP00000267620:G399R;ENSP00000345008:G358R;ENSP00000451982:G363R|.	ENSP00000267620:G455R|.	G|Q	-|-	1|3	0|2	FBLN5|FBLN5	91413697|91413697	1.000000|1.000000	0.71417|0.71417	0.951000|0.951000	0.38953|0.38953	0.942000|0.942000	0.58702|0.58702	4.449000|4.449000	0.60034|0.60034	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GGA|CAG		0.547	FBLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411787.1			Missense_Mutation
GABRG1	2565	hgsc.bcm.edu	37	4	46043243	46043243	+	Missense_Mutation	SNP	G	G	A	rs575728108		TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr4:46043243G>A	ENST00000295452.4	-	9	1327	c.1160C>T	c.(1159-1161)aCt>aTt	p.T387I		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	387					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.T387I(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGGAATCAGAGTGGATCCAGG	0.383																																																1	Substitution - Missense(1)	ovary(1)	4											60.0	63.0	62.0					4																	46043243		2203	4299	6502	45738000	SO:0001583	missense	2565			BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.1160C>T	4.37:g.46043243G>A	ENSP00000295452:p.Thr387Ile		45738000	Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	37	CCDS3470.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.35	3.605754	0.66445	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	D	0.83992	-1.79	4.7	4.7	0.59300	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.055890	0.64402	D	0.000001	D	0.84862	0.5566	L	0.54323	1.7	0.46356	D	0.999001	P	0.41848	0.763	P	0.48770	0.589	D	0.84877	0.0828	10	0.42905	T	0.14	.	16.7998	0.85611	0.0:0.0:1.0:0.0	.	387	Q8N1C3	GBRG1_HUMAN	I	387	ENSP00000295452:T387I	ENSP00000295452:T387I	T	-	2	0	GABRG1	45738000	0.981000	0.34729	1.000000	0.80357	0.640000	0.38277	5.399000	0.66314	2.436000	0.82500	0.585000	0.79938	ACT		0.383	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536		Missense_Mutation
GLRA3	8001	hgsc.bcm.edu	37	4	175598272	175598272	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr4:175598272G>A	ENST00000274093.3	-	7	1386	c.884C>T	c.(883-885)aCg>aTg	p.T295M	GLRA3_ENST00000340217.5_Missense_Mutation_p.T295M	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	295					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.T295M(1)		endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	TGTAGTCATCGTTAGCACAGT	0.458																																																1	Substitution - Missense(1)	ovary(1)	4											109.0	87.0	95.0					4																	175598272		2203	4300	6503	175834847	SO:0001583	missense	8001			AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.884C>T	4.37:g.175598272G>A	ENSP00000274093:p.Thr295Met		175834847	D3DP44|O75816|Q5D0E3	Missense_Mutation	SNP	ENST00000274093.3	37	CCDS3822.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281191	0.59758	.	.	ENSG00000145451	ENST00000274093;ENST00000340217	D;D	0.87887	-2.31;-2.31	5.17	5.17	0.71159	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.94493	0.8227	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.95283	0.8388	10	0.87932	D	0	.	18.7161	0.91677	0.0:0.0:1.0:0.0	.	295;295	O75311-2;O75311	.;GLRA3_HUMAN	M	295	ENSP00000274093:T295M;ENSP00000345284:T295M	ENSP00000274093:T295M	T	-	2	0	GLRA3	175834847	1.000000	0.71417	0.901000	0.35422	0.012000	0.07955	9.714000	0.98744	2.415000	0.81967	0.650000	0.86243	ACG		0.458	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313427.1			Missense_Mutation
GPR111	222611	hgsc.bcm.edu	37	6	47649693	47649693	+	Silent	SNP	C	C	T			TCGA-24-1553-01	TCGA-24-1553-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr6:47649693C>T	ENST00000296862.1	+	6	1398	c.1398C>T	c.(1396-1398)tcC>tcT	p.S466S	GPR111_ENST00000398742.2_Silent_p.S398S|GPR111_ENST00000507065.1_Silent_p.S398S			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	466					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S466S(1)|p.S398S(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						TTTGCTTGTCCATTGAGGTCC	0.443																																																2	Substitution - coding silent(2)	lung(2)	6											141.0	129.0	133.0					6																	47649693		1979	4163	6142	47757652	SO:0001819	synonymous_variant	222611			AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.1398C>T	6.37:g.47649693C>T			47757652	Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Silent	SNP	ENST00000296862.1	37		SNP	21	Baylor																																																																																				0.443	GPR111-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000106423.2	NM_153839		Silent
GPR148	344561	hgsc.bcm.edu	37	2	131487555	131487555	+	Silent	SNP	G	G	T			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr2:131487555G>T	ENST00000309926.4	+	1	913	c.831G>T	c.(829-831)ggG>ggT	p.G277G		NM_207364.2	NP_997247.2	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(15)|skin(3)|upper_aerodigestive_tract(1)	27	Colorectal(110;0.1)					TGAGCACAGGGGTGGTGTTCT	0.582																																																0			2											166.0	129.0	142.0					2																	131487555		2203	4300	6503	131204025	SO:0001819	synonymous_variant	344561			AY255532	CCDS2163.1	2q21.2	2012-08-21			ENSG00000173302	ENSG00000173302		"""GPCR / Class A : Orphans"""	23623	protein-coding gene	gene with protein product						12679517	Standard	NM_207364		Approved	PGR6	uc002trv.2	Q8TDV2	OTTHUMG00000131655	ENST00000309926.4:c.831G>T	2.37:g.131487555G>T			131204025	Q2M369|Q86SP7|Q86U87	Silent	SNP	ENST00000309926.4	37	CCDS2163.1	SNP	43	Baylor																																																																																				0.582	GPR148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254552.3	XM_293092		Silent
GRIA3	2892	hgsc.bcm.edu	37	X	122561910	122561910	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chrX:122561910G>A	ENST00000371251.1	+	12	2048	c.1996G>A	c.(1996-1998)Gag>Aag	p.E666K	GRIA3_ENST00000542149.1_Missense_Mutation_p.E666K|GRIA3_ENST00000264357.5_Missense_Mutation_p.E666K|GRIA3_ENST00000371256.5_Missense_Mutation_p.E666K			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	666					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)	p.E666K(2)		breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	TTCTCCCATAGAGAGTGCTGA	0.443																																																2	Substitution - Missense(2)	ovary(2)	X											144.0	122.0	129.0					X																	122561910		2203	4300	6503	122389591	SO:0001583	missense	2892			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.1996G>A	X.37:g.122561910G>A	ENSP00000360297:p.Glu666Lys		122389591	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	CCDS14604.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	31	5.104864	0.94245	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	5.45	5.45	0.79879	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.54078	0.1836	L	0.43554	1.36	0.80722	D	1	D;D	0.63046	0.992;0.99	D;D	0.76071	0.987;0.979	T	0.55848	-0.8076	10	0.87932	D	0	.	17.4594	0.87616	0.0:0.0:1.0:0.0	.	666;666	P42263;P42263-2	GRIA3_HUMAN;.	K	666	ENSP00000264357:E666K;ENSP00000446146:E666K;ENSP00000360302:E666K;ENSP00000360297:E666K	ENSP00000264357:E666K	E	+	1	0	GRIA3	122389591	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.813000	0.99286	2.423000	0.82170	0.600000	0.82982	GAG		0.443	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828		Missense_Mutation
JUP	3728	hgsc.bcm.edu	37	17	39919488	39919488	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1553-01	TCGA-24-1553-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr17:39919488A>T	ENST00000393931.3	-	8	1362	c.1244T>A	c.(1243-1245)cTc>cAc	p.L415H	JUP_ENST00000393930.1_Missense_Mutation_p.L415H|JUP_ENST00000540235.1_Intron|JUP_ENST00000310706.5_Missense_Mutation_p.L415H	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	415					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)	p.L415H(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		CAGGTTGGAGAGTGTGCCCGT	0.562																																					Colon(16;42 520 6044 17852 28530)											1	Substitution - Missense(1)	ovary(1)	17											185.0	143.0	157.0					17																	39919488		2203	4300	6503	37173014	SO:0001583	missense	3728			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.1244T>A	17.37:g.39919488A>T	ENSP00000377508:p.Leu415His		37173014	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Missense_Mutation	SNP	ENST00000393931.3	37	CCDS11407.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.76	2.929187	0.52759	.	.	ENSG00000173801	ENST00000393930;ENST00000310706;ENST00000393931	T;T;T	0.78003	-1.14;-1.14;-1.14	4.9	4.9	0.64082	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88588	0.6477	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90449	0.4437	10	0.87932	D	0	-26.1868	13.8482	0.63481	1.0:0.0:0.0:0.0	.	415	P14923	PLAK_HUMAN	H	415	ENSP00000377507:L415H;ENSP00000311113:L415H;ENSP00000377508:L415H	ENSP00000311113:L415H	L	-	2	0	JUP	37173014	1.000000	0.71417	0.965000	0.40720	0.050000	0.14768	9.010000	0.93611	2.059000	0.61396	0.397000	0.26171	CTC		0.562	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257406.1			Missense_Mutation
KCNH8	131096	hgsc.bcm.edu	37	3	19554727	19554728	+	Frame_Shift_Ins	INS	-	-	C			TCGA-24-1553-01	TCGA-24-1553-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr3:19554727_19554728insC	ENST00000328405.2	+	13	2611_2612	c.2345_2346insC	c.(2344-2349)gaccccfs	p.DP782fs		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	782					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.N785fs*3(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CAGGAAATTGACCCCCCCAACC	0.47																																					NSCLC(124;1625 1765 8018 24930 42026)											1	Insertion - Frameshift(1)	ovary(1)	3																																								19529732	SO:0001589	frameshift_variant	131096			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2352dupC	3.37:g.19554734_19554734dupC	ENSP00000328813:p.Asp782fs		19529731	B7Z2I7|Q59GQ6	Frame_Shift_Ins	INS	ENST00000328405.2	37	CCDS2632.1	INS	10	Baylor																																																																																				0.470	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		Frame_Shift_Ins
FOCAD	54914	hgsc.bcm.edu	37	9	20907201	20907201	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr9:20907201G>T	ENST00000380249.1	+	24	3042	c.2678G>T	c.(2677-2679)tGg>tTg	p.W893L	FOCAD_ENST00000605086.1_Missense_Mutation_p.W329L|FOCAD_ENST00000338382.6_Missense_Mutation_p.W893L	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	893						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.W893L(1)									CCACAGGCCTGGCTTGCATAC	0.403																																																1	Substitution - Missense(1)	ovary(1)	9											151.0	144.0	146.0					9																	20907201		2203	4300	6503	20897201	SO:0001583	missense	54914			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.2678G>T	9.37:g.20907201G>T	ENSP00000369599:p.Trp893Leu		20897201	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214262	0.79352	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.39787	1.06;1.06	5.67	5.67	0.87782	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63663	0.2530	L	0.61218	1.895	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.64732	-0.6338	10	0.72032	D	0.01	-18.665	17.5376	0.87837	0.0:0.0:1.0:0.0	.	893	Q5VW36	K1797_HUMAN	L	893	ENSP00000369599:W893L;ENSP00000344307:W893L	ENSP00000344307:W893L	W	+	2	0	KIAA1797	20897201	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.333000	0.72939	2.671000	0.90904	0.585000	0.79938	TGG		0.403	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794		Missense_Mutation
LRRC59	55379	hgsc.bcm.edu	37	17	48462596	48462596	+	Silent	SNP	G	G	A			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr17:48462596G>A	ENST00000225972.7	-	6	794	c.559C>T	c.(559-561)Ctg>Ttg	p.L187L	Y_RNA_ENST00000384097.1_RNA	NM_018509.3	NP_060979.2	Q96AG4	LRC59_HUMAN	leucine rich repeat containing 59	187						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L187L(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			CGCTTCCGCAGTTCCCGCTCC	0.522																																																1	Substitution - coding silent(1)	central_nervous_system(1)	17											117.0	116.0	117.0					17																	48462596		2203	4300	6503	45817595	SO:0001819	synonymous_variant	55379			AK025328	CCDS11566.1	17q21.33	2014-02-12	2006-01-12		ENSG00000108829	ENSG00000108829			28817	protein-coding gene	gene with protein product		614854				12477932	Standard	NM_018509		Approved	PRO1855, FLJ21675	uc002iqt.3	Q96AG4	OTTHUMG00000162079	ENST00000225972.7:c.559C>T	17.37:g.48462596G>A			45817595	B2RE83|D3DTX8|Q9P189	Silent	SNP	ENST00000225972.7	37	CCDS11566.1	SNP	36	Baylor																																																																																				0.522	LRRC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367117.2	NM_018509		Silent
TAB3	257397	hgsc.bcm.edu	37	X	30873211	30873211	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1553-01	TCGA-24-1553-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chrX:30873211T>C	ENST00000378933.1	-	3	748	c.571A>G	c.(571-573)Agt>Ggt	p.S191G	TAB3_ENST00000378932.2_Missense_Mutation_p.S191G|TAB3-AS2_ENST00000445240.1_RNA|TAB3_ENST00000378930.3_Missense_Mutation_p.S191G|TAB3_ENST00000288422.2_Missense_Mutation_p.S191G|TAB3_ENST00000378928.1_5'Flank	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	191	Pro-rich.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						GGATTTGTACTATACCGAGGT	0.453																																					Pancreas(164;1598 1985 29022 43301 49529)											0			X											150.0	118.0	129.0					X																	30873211		2202	4300	6502	30783132	SO:0001583	missense	257397			AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.571A>G	X.37:g.30873211T>C	ENSP00000368215:p.Ser191Gly		30783132	A6NDD9|Q6VQR0	Missense_Mutation	SNP	ENST00000378933.1	37	CCDS14226.1	SNP	53	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.19	1.281925	0.23392	.	.	ENSG00000157625	ENST00000378933;ENST00000378930;ENST00000288422;ENST00000378932	T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71	5.31	4.16	0.48862	.	0.187623	0.56097	D	0.000024	T	0.50854	0.1640	N	0.14661	0.345	0.29027	N	0.885952	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.45600	-0.9250	10	0.35671	T	0.21	-4.2016	9.7721	0.40595	0.0:0.0819:0.0:0.9181	.	191;191	Q8N5C8-2;Q8N5C8	.;TAB3_HUMAN	G	191	ENSP00000368215:S191G;ENSP00000368212:S191G;ENSP00000288422:S191G;ENSP00000368214:S191G	ENSP00000288422:S191G	S	-	1	0	TAB3	30783132	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.567000	0.45956	1.777000	0.52277	0.486000	0.48141	AGT		0.453	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056173.1	NM_152787		Missense_Mutation
MAPK1	5594	hgsc.bcm.edu	37	22	22160202	22160202	+	Silent	SNP	A	A	T			TCGA-24-1553-01	TCGA-24-1553-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr22:22160202A>T	ENST00000215832.6	-	3	617	c.429T>A	c.(427-429)gcT>gcA	p.A143A	MAPK1_ENST00000544786.1_Silent_p.A143A|MAPK1_ENST00000398822.3_Silent_p.A143A	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	143	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.A143A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	GCAGAACGTTAGCTGAATGGA	0.423																																																1	Substitution - coding silent(1)	ovary(1)	22											204.0	184.0	191.0					22																	22160202		2203	4300	6503	20490202	SO:0001819	synonymous_variant	5594			M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.429T>A	22.37:g.22160202A>T			20490202	A8CZ64	Silent	SNP	ENST00000215832.6	37	CCDS13795.1	SNP	15	Baylor																																																																																				0.423	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075396.2			Silent
MGRN1	23295	hgsc.bcm.edu	37	16	4707254	4707254	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1553-01	TCGA-24-1553-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr16:4707254C>G	ENST00000399577.5	+	5	544	c.451C>G	c.(451-453)Ccc>Gcc	p.P151A	MGRN1_ENST00000262370.7_Missense_Mutation_p.P151A|MGRN1_ENST00000586183.1_Missense_Mutation_p.P151A|MGRN1_ENST00000415496.1_Missense_Mutation_p.P151A|MGRN1_ENST00000588994.1_Missense_Mutation_p.P151A	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	151					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						CAGATACAGCCCCAAGAGCCC	0.627																																																0			16											67.0	72.0	71.0					16																	4707254		2031	4198	6229	4647255	SO:0001583	missense	23295			AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.451C>G	16.37:g.4707254C>G	ENSP00000382487:p.Pro151Ala		4647255	A4URL3|A4URL4|Q86W76	Missense_Mutation	SNP	ENST00000399577.5	37	CCDS45402.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.957	0.546539	0.13312	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496;ENST00000536343	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	5.22	3.09	0.35607	.	0.274300	0.41938	D	0.000782	T	0.21468	0.0517	L	0.31926	0.97	0.46901	D	0.999245	B;B;B;B;B;B	0.11235	0.001;0.004;0.002;0.002;0.0;0.001	B;B;B;B;B;B	0.19391	0.007;0.025;0.004;0.011;0.005;0.005	T	0.05954	-1.0854	10	0.48119	T	0.1	-19.0058	7.0543	0.25091	0.2325:0.665:0.0:0.1025	.	151;151;151;151;151;151	O60291-4;O60291-3;B4DR12;E9PB19;O60291-2;O60291	.;.;.;.;.;MGRN1_HUMAN	A	151	ENSP00000262370:P151A;ENSP00000382487:P151A;ENSP00000393311:P151A;ENSP00000443810:P151A	ENSP00000262370:P151A	P	+	1	0	MGRN1	4647255	0.849000	0.29639	1.000000	0.80357	0.071000	0.16799	0.320000	0.19540	1.168000	0.42723	0.561000	0.74099	CCC		0.627	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2			Missense_Mutation
KMT2A	4297	hgsc.bcm.edu	37	11	118343378	118343378	+	Nonsense_Mutation	SNP	G	G	T	rs9332772	byFrequency	TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr11:118343378G>T	ENST00000389506.5	+	3	1504	c.1504G>T	c.(1504-1506)Gag>Tag	p.E502*	KMT2A_ENST00000534358.1_Nonsense_Mutation_p.E502*|KMT2A_ENST00000354520.4_Nonsense_Mutation_p.E502*			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	502			E -> K (in dbSNP:rs9332772). {ECO:0000269|Ref.3}.		anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.E502*(1)									ACTTCCTGAGGAGCGGAGCGA	0.502																																																1	Substitution - Nonsense(1)	ovary(1)	11											116.0	123.0	121.0					11																	118343378		2200	4296	6496	117848588	SO:0001587	stop_gained	4297			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.1504G>T	11.37:g.118343378G>T	ENSP00000374157:p.Glu502*		117848588	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Nonsense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.9	4.212995	0.79352	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520	.	.	.	5.32	5.32	0.75619	.	0.399973	0.27366	N	0.019682	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	14.9104	0.70752	0.0:0.1429:0.8571:0.0	.	.	.	.	X	502;535;502;502	.	ENSP00000346516:E502X	E	+	1	0	MLL	117848588	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.390000	0.52523	2.655000	0.90218	0.491000	0.48974	GAG		0.502	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933		Nonsense_Mutation
MYO3A	53904	hgsc.bcm.edu	37	10	26385321	26385321	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1553-01	TCGA-24-1553-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr10:26385321A>G	ENST00000265944.5	+	16	1740	c.1574A>G	c.(1573-1575)aAt>aGt	p.N525S	MYO3A_ENST00000543632.1_Missense_Mutation_p.N525S	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	525	Myosin motor.		N -> K (in an ovarian mucinous carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N525S(2)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GGAGAAAAAAATTTTCATATT	0.323																																																2	Substitution - Missense(2)	ovary(2)	10											30.0	34.0	33.0					10																	26385321		2194	4287	6481	26425327	SO:0001583	missense	53904			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1574A>G	10.37:g.26385321A>G	ENSP00000265944:p.Asn525Ser		26425327	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	19.86	3.904706	0.72868	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	T;D	0.88431	-0.92;-2.38	5.48	4.33	0.51752	Myosin head, motor domain (2);	0.042713	0.85682	D	0.000000	D	0.93006	0.7774	M	0.66439	2.03	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.97110	0.99;0.994;1.0	D	0.93010	0.6431	10	0.87932	D	0	.	12.136	0.53972	0.8716:0.0:0.0:0.1284	.	525;525;525	F5H0U9;Q0VD65;Q8NEV4	.;.;MYO3A_HUMAN	S	525	ENSP00000265944:N525S;ENSP00000445909:N525S	ENSP00000265944:N525S	N	+	2	0	MYO3A	26425327	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.910000	0.92685	0.993000	0.38866	0.533000	0.62120	AAT		0.323	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433		Missense_Mutation
Unknown	0	hgsc.bcm.edu	37	2	73928244	73928244	+	IGR	SNP	G	G	A			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr2:73928244G>A								ALMS1P (15541 upstream) : TPRKB (28712 downstream)																							TGAACACGAGGGCCAGAATCC	0.572																																																0			2											76.0	86.0	83.0					2																	73928244		2203	4300	6503	73781752	SO:0001628	intergenic_variant	51471																															2.37:g.73928244G>A			73781752		Silent	SNP		37		SNP	43	Baylor																																																																																			0	0.572									Silent
NES	10763	hgsc.bcm.edu	37	1	156640157	156640157	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr1:156640157G>A	ENST00000368223.3	-	4	3955	c.3823C>T	c.(3823-3825)Ccc>Tcc	p.P1275S		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1275	Tail.		P -> L (in dbSNP:rs3748570). {ECO:0000269|PubMed:1478958, ECO:0000269|PubMed:18669648, ECO:0000269|PubMed:21406692}.		brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCCTCCTGGGGGCCCTCGGGG	0.652																																																0			1											74.0	87.0	82.0					1																	156640157		2203	4300	6503	154906781	SO:0001583	missense	10763			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3823C>T	1.37:g.156640157G>A	ENSP00000357206:p.Pro1275Ser		154906781	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	CCDS1151.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.55	1.382819	0.25031	.	.	ENSG00000132688	ENST00000368223	D	0.85556	-2.0	4.95	3.81	0.43845	.	0.000000	0.29348	N	0.012416	T	0.56171	0.1967	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.56220	-0.8015	10	0.87932	D	0	.	11.0491	0.47876	0.1074:0.0:0.8926:0.0	.	1275	P48681	NEST_HUMAN	S	1275	ENSP00000357206:P1275S	ENSP00000357206:P1275S	P	-	1	0	NES	154906781	0.851000	0.29673	1.000000	0.80357	0.346000	0.29079	1.651000	0.37302	2.285000	0.76669	0.557000	0.71058	CCC		0.652	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		Missense_Mutation
NLRP8	126205	hgsc.bcm.edu	37	19	56490768	56490768	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1553-01	TCGA-24-1553-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr19:56490768A>T	ENST00000291971.3	+	9	2956	c.2885A>T	c.(2884-2886)aAc>aTc	p.N962I	NLRP8_ENST00000590542.1_Missense_Mutation_p.N943I	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	962					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.N962I(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		AGGCTGGAAAACTGCCTGTTC	0.512																																																1	Substitution - Missense(1)	ovary(1)	19											107.0	102.0	104.0					19																	56490768		2203	4300	6503	61182580	SO:0001583	missense	126205			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2885A>T	19.37:g.56490768A>T	ENSP00000291971:p.Asn962Ile		61182580	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.317	1.057144	0.19907	.	.	ENSG00000179709	ENST00000291971	T	0.55588	0.51	2.36	-4.45	0.03546	.	.	.	.	.	T	0.34513	0.0900	N	0.21448	0.665	0.09310	N	1	P;B	0.42735	0.788;0.332	P;B	0.44518	0.452;0.191	T	0.23332	-1.0191	9	0.39692	T	0.17	.	3.9846	0.09509	0.5893:0.0:0.2241:0.1866	.	943;962	Q86W28-2;Q86W28	.;NALP8_HUMAN	I	962	ENSP00000291971:N962I	ENSP00000291971:N962I	N	+	2	0	NLRP8	61182580	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.827000	0.01704	-1.064000	0.03172	-1.175000	0.01729	AAC		0.512	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811		Missense_Mutation
NPLOC4	55666	hgsc.bcm.edu	37	17	79573725	79573725	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1553-01	TCGA-24-1553-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr17:79573725T>A	ENST00000331134.6	-	7	861	c.646A>T	c.(646-648)Aac>Tac	p.N216Y	NPLOC4_ENST00000539314.1_Missense_Mutation_p.N55Y|NPLOC4_ENST00000374747.5_Missense_Mutation_p.N216Y|NPLOC4_ENST00000574344.1_5'UTR	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	216					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			ACCTGTCTGTTCAGCGTGATG	0.522																																																0			17											61.0	61.0	61.0					17																	79573725		2041	4196	6237	77184167	SO:0001583	missense	55666			AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.646A>T	17.37:g.79573725T>A	ENSP00000331487:p.Asn216Tyr		77184167	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Missense_Mutation	SNP	ENST00000331134.6	37	CCDS45812.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	27.3	4.816502	0.90790	.	.	ENSG00000182446	ENST00000331134;ENST00000374747;ENST00000539314	.	.	.	5.31	5.31	0.75309	NPL4, zinc-binding putative (1);	0.000000	0.85682	D	0.000000	T	0.81158	0.4764	M	0.84846	2.72	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.996;0.998	D	0.84547	0.0642	9	0.72032	D	0.01	-38.9381	15.2988	0.73931	0.0:0.0:0.0:1.0	.	55;216;216	B4DG89;Q8TAT6-2;Q8TAT6	.;.;NPL4_HUMAN	Y	216;215;55	.	ENSP00000331487:N216Y	N	-	1	0	NPLOC4	77184167	1.000000	0.71417	0.963000	0.40424	0.987000	0.75469	7.971000	0.88012	2.022000	0.59522	0.529000	0.55759	AAC		0.522	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440140.1			Missense_Mutation
NUP160	23279	hgsc.bcm.edu	37	11	47814456	47814456	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1553-01	TCGA-24-1553-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr11:47814456T>G	ENST00000378460.2	-	28	3378	c.3332A>C	c.(3331-3333)gAa>gCa	p.E1111A	NUP160_ENST00000528071.1_Missense_Mutation_p.E997A|NUP160_ENST00000530326.1_Missense_Mutation_p.E997A	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	1111					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.E1111A(1)		NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						AGTTCGAACTTCTCTGCCAAG	0.403																																																1	Substitution - Missense(1)	ovary(1)	11											101.0	97.0	99.0					11																	47814456		2201	4298	6499	47771032	SO:0001583	missense	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.3332A>C	11.37:g.47814456T>G	ENSP00000367721:p.Glu1111Ala		47771032	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	ENST00000378460.2	37	CCDS31484.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.8	4.043256	0.75732	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.56103	1.09;0.48;0.53	5.44	5.44	0.79542	.	0.120526	0.56097	D	0.000035	T	0.51618	0.1685	M	0.63843	1.955	0.80722	D	1	D	0.54397	0.966	B	0.43950	0.437	T	0.51132	-0.8744	10	0.16420	T	0.52	.	15.1779	0.72931	0.0:0.0:0.0:1.0	.	1111	Q12769	NU160_HUMAN	A	1111;997;997	ENSP00000367721:E1111A;ENSP00000433590:E997A;ENSP00000432367:E997A	ENSP00000367721:E1111A	E	-	2	0	NUP160	47771032	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.665000	0.83852	2.068000	0.61886	0.528000	0.53228	GAA		0.403	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2	NM_015231		Missense_Mutation
OR4C11	219429	hgsc.bcm.edu	37	11	55371459	55371459	+	Missense_Mutation	SNP	G	G	C	rs189261694		TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr11:55371459G>C	ENST00000302231.4	-	1	415	c.391C>G	c.(391-393)Cca>Gca	p.P131A		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P131A(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						ATGATGGTTGGGTAACGCAAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	11											91.0	75.0	80.0					11																	55371459		2177	4012	6189	55128035	SO:0001583	missense	219429			AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.391C>G	11.37:g.55371459G>C	ENSP00000306651:p.Pro131Ala		55128035	B9EIL4|Q8NGL8	Missense_Mutation	SNP	ENST00000302231.4	37	CCDS31503.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.088	-1.172178	0.01646	.	.	ENSG00000172188	ENST00000302231	T	0.00958	5.5	4.34	-8.11	0.01082	GPCR, rhodopsin-like superfamily (1);	0.466924	0.18113	N	0.151301	T	0.00552	0.0018	N	0.25647	0.755	0.09310	N	1	B	0.29481	0.245	B	0.23419	0.046	T	0.47249	-0.9132	10	0.16896	T	0.51	.	7.6149	0.28152	0.0738:0.0976:0.1456:0.6829	.	131	Q6IEV9	OR4CB_HUMAN	A	131	ENSP00000306651:P131A	ENSP00000306651:P131A	P	-	1	0	OR4C11	55128035	0.000000	0.05858	0.001000	0.08648	0.049000	0.14656	-7.185000	0.00042	-1.212000	0.02620	-0.534000	0.04291	CCA		0.453	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700		Missense_Mutation
OSBPL6	114880	hgsc.bcm.edu	37	2	179236957	179236957	+	Silent	SNP	T	T	C			TCGA-24-1553-01	TCGA-24-1553-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr2:179236957T>C	ENST00000190611.4	+	14	1768	c.1392T>C	c.(1390-1392)gaT>gaC	p.D464D	OSBPL6_ENST00000357080.4_Intron|OSBPL6_ENST00000315022.2_Silent_p.D468D|OSBPL6_ENST00000409045.3_Silent_p.D433D|OSBPL6_ENST00000409631.1_Intron|OSBPL6_ENST00000392505.2_Silent_p.D489D|OSBPL6_ENST00000359685.3_Intron	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	464					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			CTAGCCCTGATGAGGTAAGAC	0.323																																																0			2											120.0	121.0	120.0					2																	179236957		2203	4300	6503	178945203	SO:0001819	synonymous_variant	114880			AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.1392T>C	2.37:g.179236957T>C			178945203	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Silent	SNP	ENST00000190611.4	37	CCDS2277.1	SNP	51	Baylor																																																																																				0.323	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523		Silent
OXCT1	5019	hgsc.bcm.edu	37	5	41762295	41762295	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1553-01	TCGA-24-1553-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr5:41762295A>T	ENST00000196371.5	-	14	1416	c.1256T>A	c.(1255-1257)aTg>aAg	p.M419K	OXCT1_ENST00000510634.1_Missense_Mutation_p.M22K|OXCT1_ENST00000509987.1_Missense_Mutation_p.M233K|OXCT1_ENST00000513081.1_5'UTR|OXCT1_ENST00000512084.1_Missense_Mutation_p.M22K	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	419					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)	p.M419K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	TCCTTTCACCATCTTCCCCTG	0.388																																																1	Substitution - Missense(1)	ovary(1)	5											250.0	233.0	239.0					5																	41762295		2203	4300	6503	41798052	SO:0001583	missense	5019			U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.1256T>A	5.37:g.41762295A>T	ENSP00000196371:p.Met419Lys		41798052	B2R5V2|B7Z528	Missense_Mutation	SNP	ENST00000196371.5	37	CCDS3937.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.96	2.690376	0.48097	.	.	ENSG00000083720	ENST00000196371;ENST00000512084;ENST00000510634;ENST00000509987	D;D;D;D	0.86097	-1.69;-2.07;-2.07;-1.69	4.97	4.97	0.65823	3-oxoacid CoA-transferase, subunit B (1);	0.039657	0.85682	D	0.000000	T	0.80276	0.4593	L	0.45698	1.435	0.58432	D	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.75077	-0.3445	10	0.25751	T	0.34	-5.947	13.9433	0.64069	1.0:0.0:0.0:0.0	.	419	P55809	SCOT1_HUMAN	K	419;22;22;233	ENSP00000196371:M419K;ENSP00000421143:M22K;ENSP00000423144:M22K;ENSP00000425348:M233K	ENSP00000196371:M419K	M	-	2	0	OXCT1	41798052	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.434000	0.90294	1.973000	0.57446	0.533000	0.62120	ATG		0.388	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436		Missense_Mutation
PEX5L	51555	hgsc.bcm.edu	37	3	179592212	179592212	+	Splice_Site	SNP	C	C	G			TCGA-24-1553-01	TCGA-24-1553-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr3:179592212C>G	ENST00000467460.1	-	7	960		c.e7-1		PEX5L_ENST00000263962.8_Splice_Site|PEX5L_ENST00000472994.1_Splice_Site|PEX5L_ENST00000464614.1_Splice_Site|PEX5L_ENST00000392649.3_Splice_Site|PEX5L_ENST00000465751.1_Splice_Site|PEX5L_ENST00000476138.1_Splice_Site|PEX5L_ENST00000485199.1_Splice_Site|PEX5L-AS1_ENST00000466064.1_RNA|PEX5L_ENST00000467440.2_Splice_Site|PEX5L_ENST00000468741.1_Splice_Site	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like						maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)	p.?(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TTCTGAGGACCTATAAGGGAT	0.413																																																1	Unknown(1)	ovary(1)	3											107.0	101.0	103.0					3																	179592212		2203	4300	6503	181074906	SO:0001630	splice_region_variant	51555			AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.630-1G>C	3.37:g.179592212C>G			181074906	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Splice_Site_SNP	SNP	ENST00000467460.1	37	CCDS3236.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.24	3.067866	0.55539	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751;ENST00000496721;ENST00000491640	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7747	0.88503	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PEX5L	181074906	1.000000	0.71417	0.997000	0.53966	0.717000	0.41224	4.657000	0.61490	2.708000	0.92522	0.650000	0.86243	.		0.413	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559	Intron	Splice_Site_SNP
PKHD1L1	93035	hgsc.bcm.edu	37	8	110460547	110460547	+	Frame_Shift_Del	DEL	G	G	-			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr8:110460547delG	ENST00000378402.5	+	39	6056	c.5952delG	c.(5950-5952)aagfs	p.K1984fs		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1984	IPT/TIG 12.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.T1987fs*33(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGCATCATAAGACAAAAGGCT	0.418										HNSCC(38;0.096)																																						1	Deletion - Frameshift(1)	ovary(1)	8											94.0	93.0	94.0					8																	110460547		1988	4186	6174	110529723	SO:0001589	frameshift_variant	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5952delG	8.37:g.110460547delG	ENSP00000367655:p.Lys1984fs		110529723	Q567P2|Q9UF27	Frame_Shift_Del	DEL	ENST00000378402.5	37	CCDS47911.1	DEL	33	Baylor																																																																																				0.418	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		Frame_Shift_Del
PM20D1	148811	hgsc.bcm.edu	37	1	205819099	205819099	+	Missense_Mutation	SNP	T	T	A	rs139560425		TCGA-24-1553-01	TCGA-24-1553-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr1:205819099T>A	ENST00000367136.4	-	1	146	c.102A>T	c.(100-102)caA>caT	p.Q34H	PM20D1_ENST00000460624.1_5'UTR	NM_152491.4	NP_689704.4	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1	34					negative regulation of neuron death (GO:1901215)|regulation of defense response to virus by host (GO:0050691)|regulation of viral process (GO:0050792)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|peptidase activity (GO:0008233)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)	28	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GCGACGCCCTTTGATGCTCCC	0.607																																																0			1											86.0	88.0	87.0					1																	205819099		2203	4300	6503	204085722	SO:0001583	missense	148811				CCDS1460.1	1q32.1	2008-02-05			ENSG00000162877	ENSG00000162877			26518	protein-coding gene	gene with protein product							Standard	NM_152491		Approved	FLJ32569, Cps1	uc001hdj.3	Q6GTS8	OTTHUMG00000035999	ENST00000367136.4:c.102A>T	1.37:g.205819099T>A	ENSP00000356104:p.Gln34His		204085722	Q6P4E3|Q96DM4	Missense_Mutation	SNP	ENST00000367136.4	37	CCDS1460.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.91	2.377545	0.42105	.	.	ENSG00000162877	ENST00000367136	T	0.06933	3.24	5.17	-0.329	0.12686	.	0.983940	0.08343	N	0.960505	T	0.05686	0.0149	L	0.36672	1.1	0.09310	N	1	P	0.42337	0.776	B	0.34652	0.187	T	0.35549	-0.9784	10	0.45353	T	0.12	.	4.0934	0.09980	0.0:0.4289:0.172:0.3992	.	34	Q6GTS8	P20D1_HUMAN	H	34	ENSP00000356104:Q34H	ENSP00000356104:Q34H	Q	-	3	2	PM20D1	204085722	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.251000	0.08818	0.056000	0.16144	-0.763000	0.03452	CAA		0.607	PM20D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087736.1	NM_152491		Missense_Mutation
PTPRT	11122	hgsc.bcm.edu	37	20	41408909	41408909	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1553-01	TCGA-24-1553-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr20:41408909G>A	ENST00000373187.1	-	4	516	c.517C>T	c.(517-519)Cat>Tat	p.H173Y	PTPRT_ENST00000373201.1_Missense_Mutation_p.H173Y|PTPRT_ENST00000356100.2_Missense_Mutation_p.H173Y|PTPRT_ENST00000373184.1_Missense_Mutation_p.H173Y|PTPRT_ENST00000373190.1_Missense_Mutation_p.H173Y|PTPRT_ENST00000373198.4_Missense_Mutation_p.H173Y|PTPRT_ENST00000373193.3_Missense_Mutation_p.H173Y			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	173	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.H173Y(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TAGCCAGGATGACCCTTCAAT	0.532																																																1	Substitution - Missense(1)	ovary(1)	20											117.0	116.0	116.0					20																	41408909		2070	4206	6276	40842323	SO:0001583	missense	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.517C>T	20.37:g.41408909G>A	ENSP00000362283:p.His173Tyr		40842323	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	28.8	4.955668	0.92726	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.01871	4.59;4.59;4.59;4.59;4.59;4.59;4.59	5.75	5.75	0.90469	Concanavalin A-like lectin/glucanase (1);MAM domain (4);	0.000000	0.85682	D	0.000000	T	0.05593	0.0147	N	0.13198	0.31	0.80722	D	1	D;D	0.69078	0.996;0.997	P;P	0.61533	0.824;0.89	T	0.55373	-0.8151	10	0.56958	D	0.05	.	19.9564	0.97221	0.0:0.0:1.0:0.0	.	173;173	O14522-1;O14522	.;PTPRT_HUMAN	Y	173	ENSP00000362286:H173Y;ENSP00000362283:H173Y;ENSP00000362289:H173Y;ENSP00000348408:H173Y;ENSP00000362294:H173Y;ENSP00000362280:H173Y;ENSP00000362297:H173Y	ENSP00000348408:H173Y	H	-	1	0	PTPRT	40842323	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.269000	0.78482	2.708000	0.92522	0.650000	0.86243	CAT		0.532	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			Missense_Mutation
RTTN	25914	hgsc.bcm.edu	37	18	67855386	67855386	+	Silent	SNP	T	T	A			TCGA-24-1553-01	TCGA-24-1553-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr18:67855386T>A	ENST00000255674.6	-	10	1549	c.1263A>T	c.(1261-1263)tcA>tcT	p.S421S	RTTN_ENST00000437017.1_Silent_p.S421S|RTTN_ENST00000454359.1_Silent_p.S421S	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	421					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				AGATATCTGTTGAAATTGCTT	0.333																																																0			18											109.0	100.0	103.0					18																	67855386		1840	4086	5926	66006366	SO:0001819	synonymous_variant	25914			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.1263A>T	18.37:g.67855386T>A			66006366	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Silent	SNP	ENST00000255674.6	37	CCDS42443.1	SNP	63	Baylor																																																																																				0.333	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630		Silent
SELP	6403	hgsc.bcm.edu	37	1	169582923	169582924	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-24-1553-01	TCGA-24-1553-10	GG	GG	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr1:169582923_169582924delGG	ENST00000263686.6	-	4	526_527	c.489_490delCC	c.(487-492)tgccagfs	p.CQ163fs	SELP_ENST00000367788.2_Frame_Shift_Del_p.CQ163fs|SELP_ENST00000367792.2_Frame_Shift_Del_p.CQ163fs|SELP_ENST00000367793.2_Frame_Shift_Del_p.CQ163fs|SELP_ENST00000367786.2_Frame_Shift_Del_p.CQ163fs|SELP_ENST00000367791.2_Frame_Shift_Del_p.CQ163fs|SELP_ENST00000367794.2_Frame_Shift_Del_p.CQ163fs|SELP_ENST00000458599.2_Frame_Shift_Del_p.CQ163fs	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	163	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)	p.C163fs*1(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	GACATGTCCTGGCAGGAGGCTG	0.51																																																1	Deletion - Frameshift(1)	ovary(1)	1																																								167849548	SO:0001589	frameshift_variant	6403			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.489_490delCC	1.37:g.169582923_169582924delGG	ENSP00000263686:p.Cys163fs		167849547	Q5R344|Q8IVD1	Frame_Shift_Del	DEL	ENST00000263686.6	37	CCDS1282.1	DEL	47	Baylor																																																																																				0.510	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083916.4	NM_003005		Frame_Shift_Del
SEMA4G	57715	hgsc.bcm.edu	37	10	102743107	102743107	+	Missense_Mutation	SNP	A	A	T	rs570573396		TCGA-24-1553-01	TCGA-24-1553-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr10:102743107A>T	ENST00000370250.4	+	14	2109	c.1736A>T	c.(1735-1737)gAt>gTt	p.D579V	SEMA4G_ENST00000517724.1_Intron|MRPL43_ENST00000342071.1_Intron|MRPL43_ENST00000318325.2_Intron|SEMA4G_ENST00000210633.3_Missense_Mutation_p.D584V|MRPL43_ENST00000370241.3_Intron|RP11-108L7.4_ENST00000447344.1_RNA|MRPL43_ENST00000299179.5_Intron|MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000370242.4_Intron	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	579	Ig-like C2-type.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.D584V(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		CGGGGTGATGATGTCCTCCTG	0.637																																																1	Substitution - Missense(1)	ovary(1)	10											49.0	44.0	46.0					10																	102743107		2203	4299	6502	102733097	SO:0001583	missense	57715			AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.1736A>T	10.37:g.102743107A>T	ENSP00000359270:p.Asp579Val		102733097	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	ENST00000370250.4	37		SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	a	26.1	4.700946	0.88924	.	.	ENSG00000095539	ENST00000370250;ENST00000210633	T;T	0.10005	2.92;2.92	5.61	5.61	0.85477	.	0.093680	0.64402	D	0.000001	T	0.11750	0.0286	L	0.33339	1.005	0.80722	D	1	B	0.27316	0.175	B	0.33846	0.171	T	0.17048	-1.0382	10	0.29301	T	0.29	.	14.9957	0.71431	1.0:0.0:0.0:0.0	.	584	Q9NTN9-2	.	V	579;584	ENSP00000359270:D579V;ENSP00000210633:D584V	ENSP00000210633:D584V	D	+	2	0	SEMA4G	102733097	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	8.592000	0.90828	2.144000	0.66660	0.449000	0.29647	GAT		0.637	SEMA4G-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049920.2			Missense_Mutation
SLC17A1	6568	hgsc.bcm.edu	37	6	25819366	25819366	+	Silent	SNP	G	G	C			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr6:25819366G>C	ENST00000244527.4	-	6	661	c.546C>G	c.(544-546)ccC>ccG	p.P182P	SLC17A1_ENST00000468082.1_Silent_p.P182P|SLC17A1_ENST00000476801.1_Silent_p.P182P|SLC17A1_ENST00000427328.1_Silent_p.P182P	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	182					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.P182P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						GGACAATAAAGGGTCCCAGCA	0.413																																																1	Substitution - coding silent(1)	ovary(1)	6											48.0	48.0	48.0					6																	25819366		2203	4300	6503	25927345	SO:0001819	synonymous_variant	6568				CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.546C>G	6.37:g.25819366G>C			25927345	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Silent	SNP	ENST00000244527.4	37	CCDS4565.1	SNP	35	Baylor																																																																																				0.413	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2			Silent
TOX4	9878	hgsc.bcm.edu	37	14	21961324	21961324	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1553-01	TCGA-24-1553-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr14:21961324G>C	ENST00000405508.1	+	8	1825	c.1549G>C	c.(1549-1551)Gag>Cag	p.E517Q	TOX4_ENST00000448790.2_Missense_Mutation_p.E494Q|TOX4_ENST00000262709.3_Missense_Mutation_p.E517Q			O94842	TOX4_HUMAN	TOX high mobility group box family member 4	517	Gln/Pro-rich.					chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)	p.E517Q(1)		large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		AAGTAGTCCTGAGCGGCCTAT	0.507																																																1	Substitution - Missense(1)	ovary(1)	14											75.0	72.0	73.0					14																	21961324		2203	4300	6503	21031164	SO:0001583	missense	9878			AB018280	CCDS32043.1	14q11.2	2007-03-20	2007-03-20	2007-03-20	ENSG00000092203	ENSG00000092203			20161	protein-coding gene	gene with protein product		614032	"""chromosome 14 open reading frame 92"", ""KIAA0737"""	C14orf92, KIAA0737			Standard	NM_014828		Approved	LCP1	uc001waz.3	O94842	OTTHUMG00000150278	ENST00000405508.1:c.1549G>C	14.37:g.21961324G>C	ENSP00000385102:p.Glu517Gln		21031164	B4DPY8|B4DSM0|E7EV69	Missense_Mutation	SNP	ENST00000405508.1	37	CCDS32043.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.87	3.908124	0.72868	.	.	ENSG00000092203	ENST00000405508;ENST00000262709;ENST00000448790;ENST00000545559	T;T;T	0.11385	2.79;2.79;2.78	5.07	5.07	0.68467	.	0.478604	0.22087	N	0.064802	T	0.11836	0.0288	N	0.19112	0.55	0.40242	D	0.977973	P;P	0.47604	0.898;0.898	P;P	0.46825	0.528;0.528	T	0.12941	-1.0528	10	0.34782	T	0.22	.	17.7451	0.88418	0.0:0.0:1.0:0.0	.	494;517	B4DPY8;O94842	.;TOX4_HUMAN	Q	517;517;494;445	ENSP00000385102:E517Q;ENSP00000262709:E517Q;ENSP00000393080:E494Q	ENSP00000262709:E517Q	E	+	1	0	TOX4	21031164	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.643000	0.61390	2.800000	0.96347	0.455000	0.32223	GAG		0.507	TOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317287.2	NM_014828		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-24-1553-01	TCGA-24-1553-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C|TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000413465.2_Missense_Mutation_p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	17	GRCh37	CM015378|CM951227	TP53	M	rs121912666						102.0	94.0	97.0					17																	7578190		2203	4300	6503	7518915	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	17.37:g.7578190T>C	ENSP00000269305:p.Tyr220Cys		7518915	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TRIP13	9319	hgsc.bcm.edu	37	5	914604	914604	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1553-01	TCGA-24-1553-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr5:914604C>T	ENST00000166345.3	+	11	1401	c.1045C>T	c.(1045-1047)Cag>Tag	p.Q349*		NM_004237.3	NP_004228.1	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	349					double-strand break repair (GO:0006302)|female meiosis I (GO:0007144)|male meiosis I (GO:0007141)|oocyte maturation (GO:0001556)|oogenesis (GO:0048477)|reciprocal meiotic recombination (GO:0007131)|regulation of RNA biosynthetic process (GO:2001141)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transcription cofactor activity (GO:0003712)	p.Q349*(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	18			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			CCCTCGCCAGCAGCTGCTGAC	0.502																																																1	Substitution - Nonsense(1)	ovary(1)	5											177.0	183.0	181.0					5																	914604		2203	4300	6503	967604	SO:0001587	stop_gained	9319			L40384	CCDS3858.1	5p15	2010-04-21			ENSG00000071539	ENSG00000071539		"""ATPases / AAA-type"""	12307	protein-coding gene	gene with protein product	"""thyroid receptor interacting protein 13"""	604507				7776974	Standard	NM_004237		Approved	16E1BP	uc003jbr.3	Q15645	OTTHUMG00000090349	ENST00000166345.3:c.1045C>T	5.37:g.914604C>T	ENSP00000166345:p.Gln349*		967604	C9K0T3|D3DTC0|O15324	Nonsense_Mutation	SNP	ENST00000166345.3	37	CCDS3858.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	.	43	10.360373	0.99391	.	.	ENSG00000071539	ENST00000166345	.	.	.	5.8	5.8	0.92144	.	0.104412	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-3.5326	19.6559	0.95842	0.0:1.0:0.0:0.0	.	.	.	.	X	349	.	ENSP00000166345:Q349X	Q	+	1	0	TRIP13	967604	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.213000	0.77950	2.755000	0.94549	0.655000	0.94253	CAG		0.502	TRIP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206721.2	NM_004237		Nonsense_Mutation
UBP1	7342	hgsc.bcm.edu	37	3	33450220	33450220	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr3:33450220G>A	ENST00000283629.3	-	8	1418	c.889C>T	c.(889-891)Cca>Tca	p.P297S	UBP1_ENST00000486388.1_5'Flank|UBP1_ENST00000283628.5_Missense_Mutation_p.P297S|UBP1_ENST00000447368.2_Intron	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	297				SSKRTLP -> VQQADFA (in Ref. 1). {ECO:0000305}.	angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P297S(2)		breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						TAGTCTGCTGGCAAAGTCCGC	0.448																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	3											121.0	115.0	117.0					3																	33450220		2203	4300	6503	33425224	SO:0001583	missense	7342			AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.889C>T	3.37:g.33450220G>A	ENSP00000283629:p.Pro297Ser		33425224	Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	37	CCDS2659.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011871	0.75046	.	.	ENSG00000153560	ENST00000283629;ENST00000283628	T;T	0.16897	2.31;2.31	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.33933	0.0880	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00376	-1.1779	10	0.31617	T	0.26	-11.0023	18.833	0.92148	0.0:0.0:1.0:0.0	.	297	Q9NZI7	UBIP1_HUMAN	S	297	ENSP00000283629:P297S;ENSP00000283628:P297S	ENSP00000283628:P297S	P	-	1	0	UBP1	33425224	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.855000	0.92236	2.890000	0.99128	0.585000	0.79938	CCA		0.448	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	NM_014517		Missense_Mutation
USH2A	7399	hgsc.bcm.edu	37	1	216595383	216595383	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1553-01	TCGA-24-1553-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1553-01	TCGA-24-1553-10	g.chr1:216595383G>A	ENST00000307340.3	-	2	682	c.296C>T	c.(295-297)gCc>gTc	p.A99V	USH2A_ENST00000366943.2_Missense_Mutation_p.A99V|USH2A_ENST00000366942.3_Missense_Mutation_p.A99V	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	99					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.A99V(2)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGAGAAAAGGGCAGTGTAGGT	0.453										HNSCC(13;0.011)																																						2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	1											117.0	109.0	112.0					1																	216595383		2203	4300	6503	214662006	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.296C>T	1.37:g.216595383G>A	ENSP00000305941:p.Ala99Val		214662006	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276410	0.59649	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.19806	2.58;2.58;2.12	5.42	3.49	0.39957	.	1.106060	0.07114	U	0.842689	T	0.22589	0.0545	L	0.59436	1.845	0.23962	N	0.996335	P;B	0.34724	0.465;0.099	B;B	0.31101	0.124;0.082	T	0.22661	-1.0210	10	0.32370	T	0.25	.	10.1323	0.42687	0.0:0.1341:0.5879:0.278	.	99;99	O75445-2;O75445	.;USH2A_HUMAN	V	99	ENSP00000305941:A99V;ENSP00000355910:A99V;ENSP00000355909:A99V	ENSP00000305941:A99V	A	-	2	0	USH2A	214662006	0.015000	0.18098	0.323000	0.25347	0.797000	0.45037	0.422000	0.21296	0.619000	0.30197	0.591000	0.81541	GCC		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Missense_Mutation
