#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ARHGEF9	23229	hgsc.bcm.edu	37	X	62926239	62926239	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chrX:62926239C>A	ENST00000253401.6	-	3	1080	c.280G>T	c.(280-282)Ggg>Tgg	p.G94W	ARHGEF9_ENST00000437457.2_Missense_Mutation_p.G41W|ARHGEF9_ENST00000374878.1_Missense_Mutation_p.G92W|ARHGEF9_ENST00000495564.1_5'UTR|ARHGEF9_ENST00000374872.1_Missense_Mutation_p.G73W|ARHGEF9_ENST00000374870.4_5'UTR	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	94					apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G92W(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						AGTGGCCGCCCCAGACAGAGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	X											103.0	73.0	83.0					X																	62926239		2203	4300	6503	62842964	SO:0001583	missense	23229			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.280G>T	X.37:g.62926239C>A	ENSP00000253401:p.Gly94Trp		62842964	A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Missense_Mutation	SNP	ENST00000253401.6	37	CCDS35315.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345111	0.82022	.	.	ENSG00000131089	ENST00000253401;ENST00000374878;ENST00000437457;ENST00000374872	T;T;T;T	0.73258	0.86;0.86;-0.73;0.86	5.73	4.85	0.62838	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	T	0.77301	0.4110	L	0.44542	1.39	0.80722	D	1	D;D;D	0.76494	0.992;0.998;0.999	D;P;D	0.66497	0.922;0.9;0.944	T	0.77587	-0.2532	10	0.51188	T	0.08	.	13.7508	0.62906	0.1547:0.8453:0.0:0.0	.	41;92;94	B4DHC7;B1AMR4;O43307	.;.;ARHG9_HUMAN	W	94;92;41;73	ENSP00000253401:G94W;ENSP00000364012:G92W;ENSP00000399994:G41W;ENSP00000364006:G73W	ENSP00000253401:G94W	G	-	1	0	ARHGEF9	62842964	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.463000	0.66712	1.140000	0.42260	0.600000	0.82982	GGG		0.562	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056937.1			Missense_Mutation
ARMC4	55130	hgsc.bcm.edu	37	10	28283956	28283956	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1614-01	TCGA-24-1614-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr10:28283956T>G	ENST00000305242.5	-	2	208	c.116A>C	c.(115-117)gAg>gCg	p.E39A		NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	39					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.E39A(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						GATAAAACTCTCCACAAACAC	0.408																																																1	Substitution - Missense(1)	ovary(1)	10											79.0	75.0	77.0					10																	28283956		2203	4300	6503	28323962	SO:0001583	missense	55130			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.116A>C	10.37:g.28283956T>G	ENSP00000306410:p.Glu39Ala		28323962	A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	ENST00000305242.5	37	CCDS7157.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.42	3.619610	0.66787	.	.	ENSG00000169126	ENST00000305242	T	0.38887	1.11	4.98	3.81	0.43845	.	0.000000	0.85682	D	0.000000	T	0.56587	0.1995	M	0.78637	2.42	0.80722	D	1	D	0.63880	0.993	P	0.55923	0.787	T	0.59815	-0.7383	10	0.72032	D	0.01	-4.5595	10.5355	0.45002	0.1563:0.0:0.0:0.8437	.	39	Q5T2S8	ARMC4_HUMAN	A	39	ENSP00000306410:E39A	ENSP00000306410:E39A	E	-	2	0	ARMC4	28323962	0.991000	0.36638	0.772000	0.31596	0.716000	0.41182	2.264000	0.43302	0.691000	0.31592	0.477000	0.44152	GAG		0.408	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076		Missense_Mutation
B3GAT2	135152	hgsc.bcm.edu	37	6	71603934	71603934	+	Silent	SNP	C	C	G			TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr6:71603934C>G	ENST00000230053.6	-	2	1241	c.633G>C	c.(631-633)ctG>ctC	p.L211L		NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	211					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)	p.L211L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						GCCCACCAACCAGGCCCACAG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	6											78.0	74.0	76.0					6																	71603934		2203	4300	6503	71660655	SO:0001819	synonymous_variant	135152			AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.633G>C	6.37:g.71603934C>G			71660655	Q5JS09|Q8TF38|Q96NK4	Silent	SNP	ENST00000230053.6	37	CCDS4974.1	SNP	21	Baylor																																																																																				0.537	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041150.2	NM_080742		Silent
C11orf87	399947	hgsc.bcm.edu	37	11	109294535	109294535	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr11:109294535C>A	ENST00000327419.6	+	2	579	c.176C>A	c.(175-177)tCc>tAc	p.S59Y	RP11-708B6.2_ENST00000532992.1_RNA|RP11-708B6.2_ENST00000532929.1_RNA	NM_207645.3	NP_997528.2	Q6NUJ2	CK087_HUMAN	chromosome 11 open reading frame 87	59						integral component of membrane (GO:0016021)		p.S59Y(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17						CAGTCCTTCTCCTCCACGCTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	11											165.0	133.0	144.0					11																	109294535		2201	4298	6499	108799745	SO:0001583	missense	399947			AB096240, BC035798	CCDS31672.1	11q22.3	2013-12-13	2013-12-13	2013-12-13	ENSG00000185742	ENSG00000185742			33788	protein-coding gene	gene with protein product	"""neuronal integral membrane protein 1"""					12477932	Standard	NM_207645		Approved	LOH11CR1A, LOC399947, NEURIM1	uc010rwb.2	Q6NUJ2		ENST00000327419.6:c.176C>A	11.37:g.109294535C>A	ENSP00000331581:p.Ser59Tyr		108799745	B4E169	Missense_Mutation	SNP	ENST00000327419.6	37	CCDS31672.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808485	0.70797	.	.	ENSG00000185742	ENST00000327419	.	.	.	5.0	5.0	0.66597	.	0.000000	0.53938	U	0.000053	T	0.66436	0.2789	L	0.29908	0.895	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.70278	-0.4916	9	0.87932	D	0	.	16.1559	0.81666	0.0:1.0:0.0:0.0	.	59	Q6NUJ2	CK087_HUMAN	Y	59	.	ENSP00000331581:S59Y	S	+	2	0	C11orf87	108799745	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.868000	0.75516	2.487000	0.83934	0.561000	0.74099	TCC		0.622	C11orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390403.1	NM_207645		Missense_Mutation
CACNA1S	779	hgsc.bcm.edu	37	1	201052430	201052430	+	Frame_Shift_Del	DEL	T	T	-			TCGA-24-1614-01	TCGA-24-1614-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr1:201052430delT	ENST00000362061.3	-	10	1479	c.1253delA	c.(1252-1254)aacfs	p.N418fs	CACNA1S_ENST00000367338.3_Frame_Shift_Del_p.N418fs	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	418					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.N418fs*12(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AAAGATGCGGTTCCACTGCCT	0.542																																																1	Deletion - Frameshift(1)	ovary(1)	1											192.0	158.0	170.0					1																	201052430		2203	4300	6503	199319053	SO:0001589	frameshift_variant	779			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1253delA	1.37:g.201052430delT	ENSP00000355192:p.Asn418fs		199319053	A4IF51|B1ALM2|Q12896|Q13934	Frame_Shift_Del	DEL	ENST00000362061.3	37	CCDS1407.1	DEL	60	Baylor																																																																																				0.542	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069		Frame_Shift_Del
CORO2A	7464	hgsc.bcm.edu	37	9	100897216	100897216	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1614-01	TCGA-24-1614-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr9:100897216T>C	ENST00000343933.5	-	4	597	c.340A>G	c.(340-342)Aag>Gag	p.K114E	CORO2A_ENST00000375077.4_Missense_Mutation_p.K114E	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	114					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)			endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				AGCAGCTGCTTGGGGATGCTC	0.632																																																0			9											79.0	68.0	72.0					9																	100897216		2203	4300	6503	99937037	SO:0001583	missense	7464			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.340A>G	9.37:g.100897216T>C	ENSP00000343746:p.Lys114Glu		99937037	Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	ENST00000343933.5	37	CCDS6735.1	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	5.392	0.257478	0.10239	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	T;T	0.06294	3.32;3.32	5.37	5.37	0.77165	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.350050	0.33854	N	0.004491	T	0.02571	0.0078	N	0.03948	-0.315	0.30037	N	0.812959	B	0.02656	0.0	B	0.04013	0.001	T	0.30208	-0.9986	10	0.02654	T	1	-30.3549	10.9779	0.47478	0.0:0.0:0.1563:0.8437	.	114	Q92828	COR2A_HUMAN	E	114	ENSP00000343746:K114E;ENSP00000364218:K114E	ENSP00000343746:K114E	K	-	1	0	CORO2A	99937037	0.000000	0.05858	1.000000	0.80357	0.747000	0.42532	0.526000	0.22971	2.260000	0.74910	0.528000	0.53228	AAG		0.632	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053357.1	NM_003389		Missense_Mutation
DACH2	117154	hgsc.bcm.edu	37	X	85950112	85950112	+	Silent	SNP	A	A	C			TCGA-24-1614-01	TCGA-24-1614-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chrX:85950112A>C	ENST00000373125.4	+	5	861	c.861A>C	c.(859-861)ctA>ctC	p.L287L	DACH2_ENST00000373131.1_Silent_p.L274L|DACH2_ENST00000508860.1_Silent_p.L120L|DACH2_ENST00000510272.1_Silent_p.L68L	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	287					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						ATGCAGCCCTAGCTGGCCAGC	0.498																																																0			X											60.0	46.0	51.0					X																	85950112		2203	4300	6503	85836768	SO:0001819	synonymous_variant	117154			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.861A>C	X.37:g.85950112A>C			85836768	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Silent	SNP	ENST00000373125.4	37	CCDS14455.1	SNP	15	Baylor																																																																																				0.498	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281		Silent
DCC	1630	hgsc.bcm.edu	37	18	50705485	50705485	+	Splice_Site	SNP	G	G	C	rs148634700	byFrequency	TCGA-24-1614-01	TCGA-24-1614-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr18:50705485G>C	ENST00000442544.2	+	9	2188	c.1572G>C	c.(1570-1572)gaG>gaC	p.E524D	DCC_ENST00000412726.1_Splice_Site_p.E372D|DCC_ENST00000581580.1_Splice_Site_p.E179D	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	524	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.E524D(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CACAGCCTGAGTGTGAGTATG	0.453																																																1	Substitution - Missense(1)	ovary(1)	18											49.0	47.0	48.0					18																	50705485		2203	4300	6503	48959483	SO:0001630	splice_region_variant	1630			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1573+1G>C	18.37:g.50705485G>C			48959483		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.53	1.666602	0.29604	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.56103	0.58;0.48	5.62	-1.63	0.08345	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.066702	0.64402	D	0.000018	T	0.36853	0.0982	N	0.25201	0.72	0.41892	D	0.990373	B;B;B	0.19331	0.035;0.035;0.002	B;B;B	0.27715	0.082;0.082;0.021	T	0.18461	-1.0336	10	0.66056	D	0.02	.	12.0126	0.53297	0.5975:0.0:0.4025:0.0	.	372;372;524	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	D	524;457;372	ENSP00000389140:E524D;ENSP00000397322:E372D	ENSP00000304146:E457D	E	+	3	2	DCC	48959483	0.224000	0.23674	0.992000	0.48379	0.913000	0.54294	-0.141000	0.10327	-0.270000	0.09285	-0.302000	0.09304	GAG		0.453	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	Missense_Mutation	Missense_Mutation
EFEMP1	2202	hgsc.bcm.edu	37	2	56098226	56098226	+	Missense_Mutation	SNP	G	G	A	rs121434491		TCGA-24-1614-01	TCGA-24-1614-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr2:56098226G>A	ENST00000394555.2	-	9	1468	c.1033C>T	c.(1033-1035)Cgg>Tgg	p.R345W	EFEMP1_ENST00000424836.2_Missense_Mutation_p.R207W|EFEMP1_ENST00000355426.3_Missense_Mutation_p.R345W|EFEMP1_ENST00000394554.1_Missense_Mutation_p.R345W	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	345	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.|Mediates interaction with TIMP3.		R -> W (in DHRD; misfolded, accumulates in cells due to inefficient secretion; induces the formation of deposits between Bruch's membrane and the retinal pigment epithelium where it accumulates). {ECO:0000269|PubMed:10369267, ECO:0000269|PubMed:11384588}.		epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)	p.R345W(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TCATCCTCCCGGCATTCATTT	0.368																																					GBM(92;934 1319 7714 28760 40110)											1	Substitution - Missense(1)	ovary(1)	2	GRCh37	CM990504	EFEMP1	M	rs121434491						82.0	88.0	86.0					2																	56098226		2203	4300	6503	55951730	SO:0001583	missense	2202			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.1033C>T	2.37:g.56098226G>A	ENSP00000378058:p.Arg345Trp		55951730	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	ENST00000394555.2	37	CCDS1857.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952590	0.53293	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000405693;ENST00000424836;ENST00000355426	D;D;D;D	0.93859	-3.3;-3.3;-1.57;-3.3	5.5	5.5	0.81552	EGF-like calcium-binding, conserved site (1);	0.000000	0.56097	D	0.000021	D	0.95529	0.8547	M	0.67397	2.05	0.43271	A	0.995229	D;D	0.89917	1.0;0.987	D;B	0.74348	0.983;0.329	D	0.96705	0.9521	9	0.72032	D	0.01	.	11.2141	0.48817	0.0:0.1274:0.7244:0.1481	.	207;345	B4DW75;Q12805	.;FBLN3_HUMAN	W	345;345;201;207;345	ENSP00000378058:R345W;ENSP00000378057:R345W;ENSP00000399145:R207W;ENSP00000347596:R345W	ENSP00000347596:R345W	R	-	1	2	EFEMP1	55951730	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.926000	0.40084	2.744000	0.94065	0.655000	0.94253	CGG		0.368	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2			Missense_Mutation
EPHA3	2042	hgsc.bcm.edu	37	3	89259417	89259417	+	Silent	SNP	T	T	G			TCGA-24-1614-01	TCGA-24-1614-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr3:89259417T>G	ENST00000336596.2	+	3	786	c.561T>G	c.(559-561)ggT>ggG	p.G187G	EPHA3_ENST00000452448.2_Silent_p.G187G|EPHA3_ENST00000494014.1_Silent_p.G187G	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	187	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.G187G(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		AAGATGTTGGTGCTTGTGTTG	0.438										TSP Lung(6;0.00050)																																						1	Substitution - coding silent(1)	ovary(1)	3											165.0	141.0	149.0					3																	89259417		2203	4300	6503	89342107	SO:0001819	synonymous_variant	2042			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.561T>G	3.37:g.89259417T>G			89342107	Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	37	CCDS2922.1	SNP	59	Baylor																																																																																				0.438	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		Silent
ERCC5	2073	hgsc.bcm.edu	37	13	103524696	103524696	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1614-01	TCGA-24-1614-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr13:103524696G>T	ENST00000355739.4	+	13	4250	c.2827G>T	c.(2827-2829)Gac>Tac	p.D943Y	ERCC5_ENST00000375954.1_Missense_Mutation_p.D176Y|BIVM-ERCC5_ENST00000602836.1_Nonstop_Mutation_p.*1368L	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	943					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)	p.D943Y(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CGTGGTGGATGACTCGAAGGG	0.448			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	1	Substitution - Missense(1)	ovary(1)	13											83.0	79.0	80.0					13																	103524696		2203	4300	6503	102322697	SO:0001583	missense	2073	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2827G>T	13.37:g.103524696G>T	ENSP00000347978:p.Asp943Tyr		102322697	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.47	3.133068	0.56828	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	T;T	0.67345	-0.26;-0.26	5.54	5.54	0.83059	-3&apos (1); exonuclease, C-terminal domain (1);5&apos (1);	0.281155	0.40222	N	0.001143	T	0.77011	0.4068	L	0.54323	1.7	0.80722	D	1	D;B	0.62365	0.991;0.206	P;B	0.59056	0.851;0.118	T	0.77319	-0.2632	10	0.54805	T	0.06	-13.3192	19.4954	0.95070	0.0:0.0:1.0:0.0	.	943;1368	P28715;Q59FZ7	ERCC5_HUMAN;.	Y	1368;943;775;176	ENSP00000347978:D943Y;ENSP00000365121:D176Y	ENSP00000347978:D943Y	D	+	1	0	ERCC5	102322697	1.000000	0.71417	0.995000	0.50966	0.863000	0.49368	6.145000	0.71769	2.607000	0.88179	0.655000	0.94253	GAC		0.448	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1			Missense_Mutation
GALNT14	79623	hgsc.bcm.edu	37	2	31154991	31154991	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1614-01	TCGA-24-1614-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr2:31154991A>C	ENST00000349752.5	-	10	1640	c.1001T>G	c.(1000-1002)gTc>gGc	p.V334G	GALNT14_ENST00000324589.5_Missense_Mutation_p.V339G|GALNT14_ENST00000356174.3_Missense_Mutation_p.V301G|GALNT14_ENST00000420311.2_Missense_Mutation_p.V299G|GALNT14_ENST00000406653.1_Missense_Mutation_p.V314G|GALNT14_ENST00000486564.1_5'UTR	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	334	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CTTCCGGAAGACGTGCCCCAC	0.592																																																0			2											97.0	90.0	92.0					2																	31154991		2203	4300	6503	31008495	SO:0001583	missense	79623			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1001T>G	2.37:g.31154991A>C	ENSP00000288988:p.Val334Gly		31008495	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	26.5	4.740094	0.89573	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.84316	0.5445	H	0.94925	3.6	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.998;1.0;1.0;1.0	D	0.88980	0.3407	10	0.87932	D	0	.	14.6772	0.68989	1.0:0.0:0.0:0.0	.	299;301;339;334;314	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	G	334;339;314;301;299;301	ENSP00000288988:V334G;ENSP00000314500:V339G;ENSP00000385435:V314G;ENSP00000348497:V301G;ENSP00000415514:V299G;ENSP00000406399:V301G	ENSP00000314500:V339G	V	-	2	0	GALNT14	31008495	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	1.877000	0.54381	0.459000	0.35465	GTC		0.592	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		Missense_Mutation
GDF3	9573	hgsc.bcm.edu	37	12	7848219	7848219	+	Frame_Shift_Del	DEL	C	C	-			TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr12:7848219delC	ENST00000329913.3	-	1	153	c.106delG	c.(106-108)gatfs	p.D36fs		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	36					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)	p.D36fs*16(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						GGCGCCTTATCTAAGCCCAGA	0.483																																																1	Deletion - Frameshift(1)	ovary(1)	12											47.0	48.0	47.0					12																	7848219		2203	4300	6503	7739486	SO:0001589	frameshift_variant	9573			AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.106delG	12.37:g.7848219delC	ENSP00000331745:p.Asp36fs		7739486	Q8NEJ4	Frame_Shift_Del	DEL	ENST00000329913.3	37	CCDS8581.1	DEL	32	Baylor																																																																																				0.483	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399717.1			Frame_Shift_Del
H2AFY	9555	hgsc.bcm.edu	37	5	134679093	134679093	+	Silent	SNP	G	G	T			TCGA-24-1614-01	TCGA-24-1614-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr5:134679093G>T	ENST00000511689.1	-	8	1403	c.810C>A	c.(808-810)gcC>gcA	p.A270A	H2AFY_ENST00000510038.1_Silent_p.A270A|CTC-349C3.1_ENST00000432382.3_Missense_Mutation_p.L125F|H2AFY_ENST00000423969.2_Silent_p.A98A|H2AFY_ENST00000512507.1_5'UTR|H2AFY_ENST00000312469.4_Silent_p.A267A|H2AFY_ENST00000304332.4_Silent_p.A269A	NM_001040158.1|NM_138610.2	NP_001035248.1|NP_613258.2	O75367	H2AY_HUMAN	H2A histone family, member Y	270	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of cell cycle G2/M phase transition (GO:1902750)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|condensed chromosome (GO:0000793)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleosome (GO:0000786)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|sex chromatin (GO:0001739)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|rDNA binding (GO:0000182)|transcription regulatory region DNA binding (GO:0044212)	p.A270A(1)		endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCACAAACTTGGCAGGCAGGC	0.502																																																1	Substitution - coding silent(1)	ovary(1)	5											88.0	88.0	88.0					5																	134679093		2203	4300	6503	134706992	SO:0001819	synonymous_variant	9555			AF054174	CCDS4183.1, CCDS4184.1, CCDS4185.1	5q31.1	2011-01-27			ENSG00000113648	ENSG00000113648		"""Histones / Replication-independent"""	4740	protein-coding gene	gene with protein product		610054				9653160, 9714746	Standard	NM_004893		Approved	macroH2A1.2	uc003lam.1	O75367	OTTHUMG00000129141	ENST00000511689.1:c.810C>A	5.37:g.134679093G>T			134706992	O75377|Q503A8|Q7Z5E3|Q96D41|Q9H8P3|Q9UP96	Silent	SNP	ENST00000511689.1	37	CCDS4185.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825199	0.50739	.	.	ENSG00000224186	ENST00000432382	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	T	0.66733	0.2819	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69606	-0.5100	5	0.87932	D	0	.	9.5829	0.39499	0.0741:0.0:0.7735:0.1523	.	.	.	.	F	125	.	ENSP00000402151:L125F	L	+	3	2	CTC-203F4.1	134706992	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	0.706000	0.25690	2.714000	0.92807	0.561000	0.74099	TTG		0.502	H2AFY-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251196.3	NM_004893		Silent
HKDC1	80201	hgsc.bcm.edu	37	10	70992825	70992825	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1614-01	TCGA-24-1614-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr10:70992825A>C	ENST00000354624.5	+	4	564	c.431A>C	c.(430-432)aAg>aCg	p.K144T	RP11-227H15.4_ENST00000450995.1_RNA|HKDC1_ENST00000395086.2_Missense_Mutation_p.K144T	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	144	Hexokinase type-1 1.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)	p.K144T(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						AAAGATTTAAAGCATAAGAAA	0.458																																																1	Substitution - Missense(1)	ovary(1)	10											103.0	99.0	101.0					10																	70992825		2203	4300	6503	70662831	SO:0001583	missense	80201				CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.431A>C	10.37:g.70992825A>C	ENSP00000346643:p.Lys144Thr		70662831	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	37	CCDS7288.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.25	1.880397	0.33255	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.98381	-4.9;-4.9	4.3	-5.99	0.02213	Hexokinase, N-terminal (1);	0.686578	0.14881	N	0.292942	D	0.95648	0.8585	M	0.67625	2.065	0.09310	N	1	B	0.09022	0.002	B	0.20577	0.03	D	0.88563	0.3124	10	0.49607	T	0.09	-3.8623	8.2939	0.31973	0.3409:0.4435:0.0:0.2156	.	144	Q2TB90	HKDC1_HUMAN	T	144	ENSP00000346643:K144T;ENSP00000378521:K144T	ENSP00000346643:K144T	K	+	2	0	HKDC1	70662831	0.735000	0.28153	0.010000	0.14722	0.888000	0.51559	1.078000	0.30754	-0.763000	0.04658	0.459000	0.35465	AAG		0.458	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130		Missense_Mutation
HUWE1	10075	hgsc.bcm.edu	37	X	53602136	53602136	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1614-01	TCGA-24-1614-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chrX:53602136A>G	ENST00000342160.3	-	45	6533	c.6076T>C	c.(6076-6078)Tct>Cct	p.S2026P	HUWE1_ENST00000262854.6_Missense_Mutation_p.S2026P			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2026					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.S1889P(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GAGGTCCCAGATGCGGAAGTC	0.448																																																1	Substitution - Missense(1)	ovary(1)	X											52.0	45.0	47.0					X																	53602136		2203	4300	6503	53618861	SO:0001583	missense	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.6076T>C	X.37:g.53602136A>G	ENSP00000340648:p.Ser2026Pro		53618861	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	SNP	12	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.18|10.18	1.279188|1.279188	0.23307|0.23307	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854	.|T;T	.|0.43688	.|0.94;0.94	5.03|5.03	2.52|2.52	0.30459|0.30459	.|.	.|0.773882	.|0.11938	.|N	.|0.515064	T|T	0.29458|0.29458	0.0734|0.0734	N|N	0.24115|0.24115	0.695|0.695	0.39383|0.39383	D|D	0.96629|0.96629	.|D;B	.|0.53885	.|0.963;0.106	.|P;B	.|0.46685	.|0.524;0.068	T|T	0.07028|0.07028	-1.0794|-1.0794	5|10	.|0.27785	.|T	.|0.31	.|.	4.4731|4.4731	0.11722|0.11722	0.73:0.0:0.0964:0.1736|0.73:0.0:0.0964:0.1736	.|.	.|2026;2026	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	T|P	1059|2026	.|ENSP00000340648:S2026P;ENSP00000262854:S2026P	.|ENSP00000262854:S2026P	I|S	-|-	2|1	0|0	HUWE1|HUWE1	53618861|53618861	1.000000|1.000000	0.71417|0.71417	0.633000|0.633000	0.29310|0.29310	0.732000|0.732000	0.41865|0.41865	1.758000|1.758000	0.38410|0.38410	0.115000|0.115000	0.18071|0.18071	0.486000|0.486000	0.48141|0.48141	ATC|TCT		0.448	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		Missense_Mutation
IL7R	3575	hgsc.bcm.edu	37	5	35876310	35876310	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1614-01	TCGA-24-1614-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr5:35876310A>T	ENST00000303115.3	+	8	1231	c.1102A>T	c.(1102-1104)Aca>Tca	p.T368S	IL7R_ENST00000343305.4_3'UTR	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	368					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)	p.T368S(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TTCATCCCTCACATGCCTGGC	0.537			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	1	Substitution - Missense(1)	ovary(1)	5											94.0	88.0	90.0					5																	35876310		2203	4300	6503	35912067	SO:0001583	missense	3575			M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.1102A>T	5.37:g.35876310A>T	ENSP00000306157:p.Thr368Ser		35912067	B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	CCDS3911.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	3.307	-0.141671	0.06669	.	.	ENSG00000168685	ENST00000303115;ENST00000505875	T;T	0.31510	2.01;1.49	5.6	-1.06	0.10002	.	1.782080	0.02099	N	0.053785	T	0.16128	0.0388	N	0.14661	0.345	0.09310	N	0.999999	B	0.14438	0.01	B	0.11329	0.006	T	0.13764	-1.0497	10	0.09084	T	0.74	-11.9971	5.1402	0.14955	0.4546:0.1622:0.3833:0.0	.	368	P16871	IL7RA_HUMAN	S	368;134	ENSP00000306157:T368S;ENSP00000420923:T134S	ENSP00000306157:T368S	T	+	1	0	IL7R	35912067	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.785000	0.04628	0.034000	0.15491	-0.408000	0.06270	ACA		0.537	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			Missense_Mutation
KCNIP3	30818	hgsc.bcm.edu	37	2	96040047	96040047	+	Frame_Shift_Del	DEL	G	G	-			TCGA-24-1614-01	TCGA-24-1614-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr2:96040047delG	ENST00000295225.5	+	3	320	c.185delG	c.(184-186)agcfs	p.S63fs	KCNIP3_ENST00000360990.3_Frame_Shift_Del_p.S63fs|KCNIP3_ENST00000377181.2_3'UTR|KCNIP3_ENST00000468529.1_Frame_Shift_Del_p.S37fs	NM_013434.4	NP_038462.1	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3, calsenilin	63					apoptotic process (GO:0006915)|behavioral response to pain (GO:0048266)|intracellular protein transport (GO:0006886)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	axon terminus (GO:0043679)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|voltage-gated ion channel activity (GO:0005244)	p.S62fs*130(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	16				READ - Rectum adenocarcinoma(193;0.13)		ACTCCAGATAGCAGCGACAGT	0.607																																																1	Deletion - Frameshift(1)	ovary(1)	2											84.0	79.0	81.0					2																	96040047		2203	4300	6503	95403774	SO:0001589	frameshift_variant	30818			AF199599	CCDS2013.1, CCDS33245.1	2q21.1	2013-01-10	2006-02-11	2006-02-11	ENSG00000115041	ENSG00000115041		"""EF-hand domain containing"""	15523	protein-coding gene	gene with protein product		604662	"""calsenilin, presenilin-binding protein, EF hand transcription factor"""	CSEN		9771752, 10078534	Standard	NM_013434		Approved	DREAM, KCHIP3, calsenilin	uc002sup.3	Q9Y2W7	OTTHUMG00000130392	ENST00000295225.5:c.185delG	2.37:g.96040047delG	ENSP00000295225:p.Ser63fs		95403774	H7BY46|Q3YAC3|Q3YAC4|Q53TJ5|Q96T40|Q9UJ84|Q9UJ85	Frame_Shift_Del	DEL	ENST00000295225.5	37	CCDS2013.1	DEL	34	Baylor																																																																																				0.607	KCNIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252770.1	NM_013434		Frame_Shift_Del
KCNIP3	30818	hgsc.bcm.edu	37	2	96040111	96040111	+	Silent	SNP	G	G	A			TCGA-24-1614-01	TCGA-24-1614-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr2:96040111G>A	ENST00000295225.5	+	3	384	c.249G>A	c.(247-249)caG>caA	p.Q83Q	KCNIP3_ENST00000360990.3_Silent_p.Q83Q|KCNIP3_ENST00000377181.2_3'UTR|KCNIP3_ENST00000468529.1_Silent_p.Q57Q	NM_013434.4	NP_038462.1	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3, calsenilin	83	EF-hand 1; degenerate. {ECO:0000255|PROSITE-ProRule:PRU00448}.				apoptotic process (GO:0006915)|behavioral response to pain (GO:0048266)|intracellular protein transport (GO:0006886)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	axon terminus (GO:0043679)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|voltage-gated ion channel activity (GO:0005244)	p.Q83Q(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	16				READ - Rectum adenocarcinoma(193;0.13)		ACCAGCTGCAGGCCCAGACCA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	2											77.0	75.0	76.0					2																	96040111		2203	4300	6503	95403838	SO:0001819	synonymous_variant	30818			AF199599	CCDS2013.1, CCDS33245.1	2q21.1	2013-01-10	2006-02-11	2006-02-11	ENSG00000115041	ENSG00000115041		"""EF-hand domain containing"""	15523	protein-coding gene	gene with protein product		604662	"""calsenilin, presenilin-binding protein, EF hand transcription factor"""	CSEN		9771752, 10078534	Standard	NM_013434		Approved	DREAM, KCHIP3, calsenilin	uc002sup.3	Q9Y2W7	OTTHUMG00000130392	ENST00000295225.5:c.249G>A	2.37:g.96040111G>A			95403838	H7BY46|Q3YAC3|Q3YAC4|Q53TJ5|Q96T40|Q9UJ84|Q9UJ85	Silent	SNP	ENST00000295225.5	37	CCDS2013.1	SNP	35	Baylor																																																																																				0.602	KCNIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252770.1	NM_013434		Silent
NR2F1	7025	hgsc.bcm.edu	37	5	92921109	92921109	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1614-01	TCGA-24-1614-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr5:92921109A>G	ENST00000327111.3	+	1	2067	c.380A>G	c.(379-381)aAc>aGc	p.N127S	NR2F1-AS1_ENST00000513055.1_RNA	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	127					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.N127S(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		GCCAACAGGAACTGTCCCATC	0.542																																																1	Substitution - Missense(1)	ovary(1)	5											82.0	67.0	72.0					5																	92921109		2203	4300	6503	92946865	SO:0001583	missense	7025			BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.380A>G	5.37:g.92921109A>G	ENSP00000325819:p.Asn127Ser		92946865		Missense_Mutation	SNP	ENST00000327111.3	37	CCDS4068.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.72	3.202293	0.58234	.	.	ENSG00000175745	ENST00000327111	D	0.96427	-4.01	3.3	3.3	0.37823	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.045099	0.85682	D	0.000000	D	0.92512	0.7622	L	0.41124	1.26	0.80722	D	1	B	0.25667	0.131	B	0.22152	0.038	D	0.89881	0.4030	10	0.32370	T	0.25	.	11.7486	0.51835	1.0:0.0:0.0:0.0	.	127	P10589	COT1_HUMAN	S	127	ENSP00000325819:N127S	ENSP00000325819:N127S	N	+	2	0	NR2F1	92946865	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.819000	0.91997	1.508000	0.48769	0.254000	0.18369	AAC		0.542	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239293.2	NM_005654		Missense_Mutation
OR5M1	390168	hgsc.bcm.edu	37	11	56380663	56380663	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr11:56380663C>T	ENST00000526538.1	-	1	315	c.316G>A	c.(316-318)Gcc>Acc	p.A106T		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A106T(2)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						ATCACCAGGGCGATGAAGAGA	0.448																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	11											175.0	160.0	165.0					11																	56380663		1987	4163	6150	56137239	SO:0001583	missense	390168			AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.316G>A	11.37:g.56380663C>T	ENSP00000435416:p.Ala106Thr		56137239	Q6IF60|Q96RB6	Missense_Mutation	SNP	ENST00000526538.1	37	CCDS53631.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.124	0.391105	0.11581	.	.	ENSG00000255012	ENST00000526538	T	0.02140	4.43	3.71	0.674	0.17946	GPCR, rhodopsin-like superfamily (1);	0.403660	0.18179	N	0.149211	T	0.01592	0.0051	N	0.20530	0.585	0.09310	N	1	B	0.19073	0.033	B	0.15052	0.012	T	0.48068	-0.9067	10	0.25751	T	0.34	-20.489	7.8354	0.29368	0.0:0.6151:0.0:0.3849	.	106	Q8NGP8	OR5M1_HUMAN	T	106	ENSP00000435416:A106T	ENSP00000435416:A106T	A	-	1	0	OR5M1	56137239	0.000000	0.05858	0.994000	0.49952	0.854000	0.48673	-2.965000	0.00670	0.293000	0.22520	0.280000	0.19369	GCC		0.448	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391610.1	NM_001004740		Missense_Mutation
PHF20L1	51105	hgsc.bcm.edu	37	8	133807002	133807002	+	Silent	SNP	T	T	C			TCGA-24-1614-01	TCGA-24-1614-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr8:133807002T>C	ENST00000395386.2	+	4	578	c.279T>C	c.(277-279)gtT>gtC	p.V93V	PHF20L1_ENST00000395376.1_Silent_p.V93V|PHF20L1_ENST00000337920.4_Silent_p.V93V|PHF20L1_ENST00000220847.7_5'UTR|PHF20L1_ENST00000395379.1_Silent_p.V93V|PHF20L1_ENST00000395390.2_Silent_p.V93V	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	93	Tudor 2.						zinc ion binding (GO:0008270)	p.V93V(2)		breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GAGAAGAAGTTCTGGCTCGTT	0.313																																																2	Substitution - coding silent(2)	ovary(2)	8											53.0	56.0	55.0					8																	133807002		2203	4300	6503	133876184	SO:0001819	synonymous_variant	51105			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.279T>C	8.37:g.133807002T>C			133876184	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Silent	SNP	ENST00000395386.2	37	CCDS6367.2	SNP	62	Baylor																																																																																				0.313	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018		Silent
GSAP	54103	hgsc.bcm.edu	37	7	77004374	77004374	+	Splice_Site	SNP	C	C	T			TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr7:77004374C>T	ENST00000257626.7	-	11	864		c.e11+1			NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein						positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)	p.?(1)									GAATAACTTACTTAAATCCTG	0.289																																																1	Unknown(1)	ovary(1)	7											71.0	69.0	70.0					7																	77004374		2201	4299	6500	76842310	SO:0001630	splice_region_variant	54103				CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.785+1G>A	7.37:g.77004374C>T			76842310	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Splice_Site_SNP	SNP	ENST00000257626.7	37	CCDS34672.2	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.45	3.127239	0.56721	.	.	ENSG00000186088	ENST00000257626	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3927	0.74758	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PION	76842310	1.000000	0.71417	1.000000	0.80357	0.614000	0.37383	4.488000	0.60300	2.709000	0.92574	0.563000	0.77884	.		0.289	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439	Intron	Splice_Site_SNP
PPT1	5538	hgsc.bcm.edu	37	1	40546070	40546070	+	Splice_Site	SNP	C	C	T	rs201265025		TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr1:40546070C>T	ENST00000433473.3	-	6	1090	c.626G>A	c.(625-627)cGg>cAg	p.R209Q	PPT1_ENST00000372775.2_5'Flank|PPT1_ENST00000530076.1_5'UTR|PPT1_ENST00000449045.2_Splice_Site_p.R106Q	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1	209					adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)	p.R209L(1)|p.R209Q(1)		endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGTGCTTACCCGCTCCTGATT	0.478																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	1											235.0	228.0	230.0					1																	40546070		2203	4300	6503	40318657	SO:0001630	splice_region_variant	5538			U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495	ENST00000433473.3:c.627+1G>A	1.37:g.40546070C>T			40318657	B4DY24|Q6FGQ4	Missense_Mutation	SNP	ENST00000433473.3	37	CCDS447.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360338	0.61403	.	.	ENSG00000131238	ENST00000433473;ENST00000449045;ENST00000439754;ENST00000372779	D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41	5.43	5.43	0.79202	.	0.087834	0.64402	D	0.000001	D	0.96383	0.8820	M	0.80332	2.49	0.80722	D	1	B;B;B	0.29805	0.003;0.257;0.034	B;B;B	0.25291	0.003;0.059;0.017	D	0.95046	0.8182	10	0.33141	T	0.24	-9.283	18.608	0.91273	0.0:1.0:0.0:0.0	.	106;159;209	P50897-2;B4DWU3;P50897	.;.;PPT1_HUMAN	Q	209;106;104;238	ENSP00000394863:R209Q;ENSP00000392293:R106Q;ENSP00000403207:R104Q;ENSP00000361865:R238Q	ENSP00000361865:R238Q	R	-	2	0	PPT1	40318657	1.000000	0.71417	0.999000	0.59377	0.695000	0.40330	3.256000	0.51492	2.719000	0.93026	0.655000	0.94253	CGG		0.478	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013126.2	NM_000310	Missense_Mutation	Missense_Mutation
PRAF2	11230	hgsc.bcm.edu	37	X	48931554	48931554	+	Missense_Mutation	SNP	C	C	G	rs35035067	byFrequency	TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chrX:48931554C>G	ENST00000376390.4	-	1	176	c.93G>C	c.(91-93)caG>caC	p.Q31H	AF196779.12_ENST00000376358.3_Intron|PRAF2_ENST00000376386.3_Missense_Mutation_p.Q31H|PRAF2_ENST00000491199.1_5'Flank|WDR45_ENST00000553851.1_Intron	NM_007213.1	NP_009144.1	O60831	PRAF2_HUMAN	PRA1 domain family, member 2	31					L-glutamate transport (GO:0015813)|protein transport (GO:0015031)	endosome (GO:0005768)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	8						GGCACCATCGCTGCGGGTCGC	0.662																																																0			X											74.0	61.0	65.0					X																	48931554		2203	4300	6503	48818498	SO:0001583	missense	11230			BC021213	CCDS14317.1	Xp11.23	2008-02-05	2004-11-15		ENSG00000243279	ENSG00000243279			28911	protein-coding gene	gene with protein product		300840	"""PRA1 domain family 2"""			16481131	Standard	NM_007213		Approved	JM4		O60831	OTTHUMG00000034499	ENST00000376390.4:c.93G>C	X.37:g.48931554C>G	ENSP00000365570:p.Gln31His		48818498	B2RD20	Missense_Mutation	SNP	ENST00000376390.4	37	CCDS14317.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.65	3.443057	0.63067	.	.	ENSG00000243279	ENST00000376390;ENST00000376386	T;T	0.44083	0.93;0.93	4.38	2.56	0.30785	.	0.246292	0.33272	N	0.005083	T	0.43433	0.1247	L	0.34521	1.04	0.58432	D	0.999994	D	0.56746	0.977	P	0.59288	0.855	T	0.24835	-1.0149	10	0.51188	T	0.08	-21.7717	7.5607	0.27849	0.0:0.78:0.0:0.22	.	31	O60831	PRAF2_HUMAN	H	31	ENSP00000365570:Q31H;ENSP00000365566:Q31H	ENSP00000365566:Q31H	Q	-	3	2	PRAF2	48818498	0.571000	0.26659	0.995000	0.50966	0.994000	0.84299	-0.128000	0.10531	0.559000	0.29153	0.600000	0.82982	CAG		0.662	PRAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083415.2	NM_007213		Missense_Mutation
PXDNL	137902	hgsc.bcm.edu	37	8	52232509	52232509	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1614-01	TCGA-24-1614-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr8:52232509G>T	ENST00000356297.4	-	23	4434	c.4334C>A	c.(4333-4335)aCc>aAc	p.T1445N	PXDNL_ENST00000543296.1_3'UTR|RP11-401H2.1_ENST00000521294.1_RNA	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1445	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.T1445N(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TGGACAGCAGGTTCCTTTCAC	0.512																																																1	Substitution - Missense(1)	ovary(1)	8											52.0	53.0	53.0					8																	52232509		1901	4109	6010	52395062	SO:0001583	missense	137902				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.4334C>A	8.37:g.52232509G>T	ENSP00000348645:p.Thr1445Asn		52395062	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	SNP	44	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.672|7.672	0.687109|0.687109	0.14973|0.14973	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000522933|ENST00000356297	.|T	.|0.71579	.|-0.58	4.51|4.51	-9.03|-9.03	0.00737|0.00737	.|von Willebrand factor, type C (4);	.|.	.|.	.|.	.|.	T|T	0.37517|0.37517	0.1006|0.1006	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.10296	.|0.003	.|B	.|0.12837	.|0.008	T|T	0.18335|0.18335	-1.0340|-1.0340	5|9	.|0.31617	.|T	.|0.26	.|.	0.735|0.735	0.00963|0.00963	0.2582:0.2042:0.1258:0.4118|0.2582:0.2042:0.1258:0.4118	.|.	.|1445	.|A1KZ92	.|PXDNL_HUMAN	T|N	519|1445	.|ENSP00000348645:T1445N	.|ENSP00000348645:T1445N	P|T	-|-	1|2	0|0	PXDNL|PXDNL	52395062|52395062	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-1.363000|-1.363000	0.02592|0.02592	-1.763000|-1.763000	0.01307|0.01307	-2.045000|-2.045000	0.00415|0.00415	CCT|ACC		0.512	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		Missense_Mutation
RBM18	92400	hgsc.bcm.edu	37	9	125014155	125014155	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1614-01	TCGA-24-1614-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr9:125014155A>T	ENST00000417201.3	-	3	351	c.211T>A	c.(211-213)Tac>Aac	p.Y71N	RBM18_ENST00000483428.1_5'UTR	NM_033117.3	NP_149108.1	Q96H35	RBM18_HUMAN	RNA binding motif protein 18	71	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7						ACAAAACAGTAGCCTCGAGGC	0.418																																																0			9											77.0	80.0	79.0					9																	125014155		2203	4300	6503	124053976	SO:0001583	missense	92400			AK057676	CCDS6839.1	9q34.11	2013-02-12			ENSG00000119446	ENSG00000119446		"""RNA binding motif (RRM) containing"""	28413	protein-coding gene	gene with protein product						12477932	Standard	NM_033117		Approved	MGC2734	uc004bma.2	Q96H35	OTTHUMG00000020602	ENST00000417201.3:c.211T>A	9.37:g.125014155A>T	ENSP00000409315:p.Tyr71Asn		124053976	B3KQ89	Missense_Mutation	SNP	ENST00000417201.3	37	CCDS6839.1	SNP	15	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.47	3.630653	0.67015	.	.	ENSG00000119446	ENST00000417201	T	0.18960	2.18	5.97	4.82	0.62117	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.37598	0.1009	H	0.94222	3.51	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.38478	-0.9659	10	0.87932	D	0	-8.9645	11.8127	0.52192	0.8686:0.0:0.0:0.1314	.	71	Q96H35	RBM18_HUMAN	N	71	ENSP00000409315:Y71N	ENSP00000409315:Y71N	Y	-	1	0	RBM18	124053976	1.000000	0.71417	0.986000	0.45419	0.989000	0.77384	8.870000	0.92336	1.059000	0.40554	0.459000	0.35465	TAC		0.418	RBM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053928.2	NM_033117		Missense_Mutation
RENBP	5973	hgsc.bcm.edu	37	X	153207037	153207037	+	Missense_Mutation	SNP	G	G	T	rs78377269	byFrequency	TCGA-24-1614-01	TCGA-24-1614-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chrX:153207037G>T	ENST00000393700.3	-	8	919	c.839C>A	c.(838-840)gCc>gAc	p.A280D	RENBP_ENST00000412763.1_Missense_Mutation_p.P253T|RENBP_ENST00000369997.3_Missense_Mutation_p.A266D|RENBP_ENST00000462086.1_5'Flank	NM_002910.5	NP_002901.2	P51606	RENBP_HUMAN	renin binding protein	280					N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)|regulation of blood pressure (GO:0008217)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|endopeptidase inhibitor activity (GO:0004866)|N-acylglucosamine 2-epimerase activity (GO:0050121)	p.A280D(1)|p.A270D(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	AATCACGTGGGCTCGAAGTTC	0.592													G|||	81	0.021457	0.0325	0.0029	3775	,	,		8409	0.0079		0.0219	False		,,,				2504	0.0061															2	Substitution - Missense(2)	ovary(2)	X						G	ASP/ALA	197,3638		2,171,22,1459,549	108.0	91.0	97.0		839	3.3	0.0	X	dbSNP_131	97	216,6512		2,150,62,2276,1810	yes	missense	RENBP	NM_002910.5	126	4,321,84,3735,2359	TT,TG,T,GG,G		3.2105,5.1369,3.9099	benign	280/428	153207037	413,10150	2203	4300	6503	152860231	SO:0001583	missense	5973				CCDS14738.2	Xq28	2013-09-23	2001-11-28		ENSG00000102032	ENSG00000102032			9959	protein-coding gene	gene with protein product	"""N-acylglucosamine 2-epimerase"", ""GlcNAc 2-epimerase"", ""N-acetyl-D-glucosamine 2-epimerase"""	312420	"""renin-binding protein"""			1618798	Standard	NM_002910		Approved	RNBP, RBP	uc004fjo.2	P51606	OTTHUMG00000024224	ENST00000393700.3:c.839C>A	X.37:g.153207037G>T	ENSP00000377303:p.Ala280Asp		152860231	B4DNZ3|Q96BI6	Missense_Mutation	SNP	ENST00000393700.3	37	CCDS14738.2	SNP	42	Baylor	42|42	0.02531645569620253|0.02531645569620253	11|11	0.022916666666666665|0.022916666666666665	1|1	0.0027624309392265192|0.0027624309392265192	4|4	0.007042253521126761|0.007042253521126761	13|13	0.017379679144385027|0.017379679144385027	G|G	6.705|6.705	0.498797|0.498797	0.12762|0.12762	0.051369|0.051369	0.032105|0.032105	ENSG00000102032|ENSG00000102032	ENST00000393700;ENST00000369997|ENST00000412763	T;T|T	0.26660|0.51325	1.72;1.72|0.71	5.15|5.15	3.35|3.35	0.38373|0.38373	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);|.	0.612514|.	0.17353|.	N|.	0.177323|.	T|T	0.07908|0.07908	0.0198|0.0198	L|L	0.39692|0.39692	1.235|1.235	0.80722|0.80722	P|P	0.0|0.0	B|B	0.17268|0.30973	0.021|0.302	B|B	0.10450|0.29176	0.005|0.099	T|T	0.27088|0.27088	-1.0084|-1.0084	9|8	0.15066|0.87932	T|D	0.55|0	-4.5745|-4.5745	8.9147|8.9147	0.35574|0.35574	0.086:0.1469:0.7672:0.0|0.086:0.1469:0.7672:0.0	.|.	280|253	P51606|P51606-2	RENBP_HUMAN|.	D|T	280;266|253	ENSP00000377303:A280D;ENSP00000359014:A266D|ENSP00000387811:P253T	ENSP00000359014:A266D|ENSP00000387811:P253T	A|P	-|-	2|1	0|0	RENBP|RENBP	152860231|152860231	0.007000|0.007000	0.16637|0.16637	0.002000|0.002000	0.10522|0.10522	0.040000|0.040000	0.13550|0.13550	1.164000|1.164000	0.31810|0.31810	0.397000|0.397000	0.25310|0.25310	0.436000|0.436000	0.28706|0.28706	GCC|CCC		0.592	RENBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061103.3	NM_002910		Missense_Mutation
RNF146	81847	hgsc.bcm.edu	37	6	127608473	127608473	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1614-01	TCGA-24-1614-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr6:127608473G>A	ENST00000368314.1	+	3	1139	c.715G>A	c.(715-717)Gca>Aca	p.A239T	RNF146_ENST00000608991.1_Missense_Mutation_p.A238T|RNF146_ENST00000309649.3_Missense_Mutation_p.A238T|ECHDC1_ENST00000488087.1_5'Flank|RNF146_ENST00000356799.2_3'UTR|RNF146_ENST00000610153.1_Missense_Mutation_p.A239T	NM_001242850.1|NM_001242851.1	NP_001229779.1|NP_001229780.1	Q9NTX7	RN146_HUMAN	ring finger protein 146	239					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly-ADP-D-ribose binding (GO:0072572)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A238T(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(226;0.0407)|all cancers(137;0.2)		ATCCCCTGATGCAAGCACTTC	0.478																																																1	Substitution - Missense(1)	ovary(1)	6											109.0	106.0	107.0					6																	127608473		2203	4300	6503	127650166	SO:0001583	missense	81847			AK027558	CCDS5136.1, CCDS56449.1	6q22.1-q22.33	2008-02-05			ENSG00000118518	ENSG00000118518		"""RING-type (C3HC4) zinc fingers"""	21336	protein-coding gene	gene with protein product		612137					Standard	NM_001242844		Approved	DKFZp434O1427, dactylidin, dJ351K20.1	uc021zes.1	Q9NTX7	OTTHUMG00000015522	ENST00000368314.1:c.715G>A	6.37:g.127608473G>A	ENSP00000357297:p.Ala239Thr		127650166	E1P572|Q6FIB2|Q7L8H4|Q96K03|Q96T06|Q9NTX6	Missense_Mutation	SNP	ENST00000368314.1	37	CCDS56449.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.73	2.325012	0.41197	.	.	ENSG00000118518	ENST00000368314;ENST00000356799;ENST00000309649	T;T;T	0.22945	1.93;1.93;1.93	5.95	4.08	0.47627	.	0.403964	0.25885	N	0.027661	T	0.10165	0.0249	L	0.44542	1.39	0.37042	D	0.897186	B	0.31318	0.319	B	0.26614	0.071	T	0.06110	-1.0845	10	0.38643	T	0.18	-4.9218	11.5602	0.50772	0.067:0.125:0.808:0.0	.	239	Q9NTX7	RN146_HUMAN	T	239;238;238	ENSP00000357297:A239T;ENSP00000349253:A238T;ENSP00000309365:A238T	ENSP00000309365:A238T	A	+	1	0	RNF146	127650166	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.077000	0.50089	1.528000	0.49103	0.655000	0.94253	GCA		0.478	RNF146-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042112.1	NM_030963		Missense_Mutation
SLC1A6	6511	hgsc.bcm.edu	37	19	15079174	15079174	+	Silent	SNP	C	C	T			TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr19:15079174C>T	ENST00000221742.3	-	3	496	c.489G>A	c.(487-489)ctG>ctA	p.L163L	SLC1A6_ENST00000544886.2_Silent_p.L163L|SLC1A6_ENST00000600144.1_Silent_p.L163L|SLC1A6_ENST00000430939.2_Intron|SLC1A6_ENST00000598504.1_Silent_p.L163L	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	163					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.L163L(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						CCTCCCGGTGCAGCCCCTCCT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	19											76.0	56.0	63.0					19																	15079174		2203	4300	6503	14940174	SO:0001819	synonymous_variant	6511				CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.489G>A	19.37:g.15079174C>T			14940174	Q8N753	Silent	SNP	ENST00000221742.3	37	CCDS12321.1	SNP	25	Baylor																																																																																				0.547	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071		Silent
SIN3B	23309	hgsc.bcm.edu	37	19	16973182	16973182	+	Missense_Mutation	SNP	G	G	T	rs200523165		TCGA-24-1614-01	TCGA-24-1614-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr19:16973182G>T	ENST00000248054.5	+	9	1099	c.1078G>T	c.(1078-1080)Gca>Tca	p.A360S	SIN3B_ENST00000379803.1_Missense_Mutation_p.A360S|SIN3B_ENST00000595541.1_5'Flank					SIN3 transcription regulator family member B									p.A360S(1)		endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						AGAACTCTTTGCACAGTTCAA	0.493																																																1	Substitution - Missense(1)	ovary(1)	19											69.0	73.0	71.0					19																	16973182		2203	4300	6503	16834182	SO:0001583	missense	23309			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.1078G>T	19.37:g.16973182G>T	ENSP00000248054:p.Ala360Ser		16834182		Missense_Mutation	SNP	ENST00000248054.5	37		SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326736	0.60743	.	.	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.42513	0.97;0.98	4.63	3.59	0.41128	.	0.106801	0.64402	D	0.000005	T	0.18718	0.0449	N	0.04508	-0.205	0.38290	D	0.942689	B;B	0.31790	0.34;0.242	B;B	0.29862	0.108;0.105	T	0.09796	-1.0658	10	0.09084	T	0.74	-17.7932	12.5464	0.56201	0.0822:0.0:0.9178:0.0	.	360;360	O75182-2;O75182	.;SIN3B_HUMAN	S	360	ENSP00000369131:A360S;ENSP00000248054:A360S	ENSP00000248054:A360S	A	+	1	0	SIN3B	16834182	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	3.632000	0.54287	0.941000	0.37499	0.561000	0.74099	GCA		0.493	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260		Missense_Mutation
SPAG5	10615	hgsc.bcm.edu	37	17	26918782	26918782	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1614-01	TCGA-24-1614-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr17:26918782G>T	ENST00000321765.5	-	4	1703	c.1371C>A	c.(1369-1371)agC>agA	p.S457R		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	457					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)		p.S457R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					CAGCCAGCTGGCTCTTCCAGT	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											85.0	81.0	82.0					17																	26918782		2203	4300	6503	23942909	SO:0001583	missense	10615			AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.1371C>A	17.37:g.26918782G>T	ENSP00000323300:p.Ser457Arg		23942909	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.69	3.194212	0.58017	.	.	ENSG00000076382	ENST00000321765	.	.	.	5.73	-3.5	0.04710	.	0.619232	0.16399	N	0.216099	T	0.24314	0.0589	L	0.32530	0.975	0.09310	N	1	P	0.46512	0.879	P	0.45829	0.494	T	0.17471	-1.0368	9	0.44086	T	0.13	1.0E-4	5.3806	0.16189	0.4252:0.2548:0.32:0.0	.	457	Q96R06	SPAG5_HUMAN	R	457	.	ENSP00000323300:S457R	S	-	3	2	SPAG5	23942909	0.005000	0.15991	0.047000	0.18901	0.991000	0.79684	-0.047000	0.11963	-0.195000	0.10382	0.655000	0.94253	AGC		0.542	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	C	A	rs121912654		TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr17:7578461C>A	ENST00000269305.4	-	5	658	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.V157F|TP53_ENST00000445888.2_Missense_Mutation_p.V157F|TP53_ENST00000420246.2_Missense_Mutation_p.V157F|TP53_ENST00000359597.4_Missense_Mutation_p.V157F|TP53_ENST00000413465.2_Missense_Mutation_p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCGCGGACGCGGGTGCCG	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	231	Substitution - Missense(189)|Deletion - Frameshift(15)|Deletion - In frame(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	lung(69)|liver(30)|upper_aerodigestive_tract(26)|breast(19)|oesophagus(14)|ovary(13)|stomach(9)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|bone(5)|vulva(4)|urinary_tract(4)|skin(3)|pancreas(3)|endometrium(2)|kidney(2)|biliary_tract(2)|soft_tissue(2)|prostate(1)|adrenal_gland(1)|salivary_gland(1)|thymus(1)	17											50.0	52.0	51.0					17																	7578461		2202	4300	6502	7519186	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.469G>T	17.37:g.7578461C>A	ENSP00000269305:p.Val157Phe		7519186	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.19	1.865109	0.32977	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.47	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99718	0.9891	M	0.86420	2.815	0.33606	D	0.603	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.994;0.984;0.981;0.996;0.998;0.996	D	0.97998	1.0358	10	0.72032	D	0.01	-16.7152	5.3541	0.16051	0.0:0.6119:0.146:0.2421	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157F;ENSP00000352610:V157F;ENSP00000269305:V157F;ENSP00000398846:V157F;ENSP00000391127:V157F;ENSP00000391478:V157F;ENSP00000425104:V25F;ENSP00000423862:V64F;ENSP00000424104:V157F	ENSP00000269305:V157F	V	-	1	0	TP53	7519186	0.137000	0.22531	0.013000	0.15412	0.150000	0.21749	0.548000	0.23314	0.386000	0.24997	-0.253000	0.11424	GTC		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TEX2	55852	hgsc.bcm.edu	37	17	62265564	62265564	+	Silent	SNP	C	C	G			TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr17:62265564C>G	ENST00000583097.1	-	5	2560	c.2388G>C	c.(2386-2388)ctG>ctC	p.L796L	TEX2_ENST00000258991.3_Silent_p.L803L|TEX2_ENST00000584379.1_Silent_p.L796L			Q8IWB9	TEX2_HUMAN	testis expressed 2	796					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)		p.L803L(1)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CCGCACTCTGCAGGGGGCTCC	0.587																																																1	Substitution - coding silent(1)	ovary(1)	17											42.0	47.0	45.0					17																	62265564		2202	4299	6501	59619296	SO:0001819	synonymous_variant	55852			AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2388G>C	17.37:g.62265564C>G			59619296	Q6AHZ5|Q8N3L0|Q9C0C5	Silent	SNP	ENST00000583097.1	37		SNP	25	Baylor																																																																																				0.587	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469		Silent
TBCD	6904	hgsc.bcm.edu	37	17	80863815	80863815	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1614-01	TCGA-24-1614-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr17:80863815T>C	ENST00000355528.4	+	20	1938	c.1808T>C	c.(1807-1809)tTc>tCc	p.F603S	TBCD_ENST00000397466.2_Missense_Mutation_p.F217S|TBCD_ENST00000539345.2_Missense_Mutation_p.F603S	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	603					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)	p.F603S(1)				Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			CTTGCAGTCTTCCCGAGGCTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	17											72.0	76.0	74.0					17																	80863815		2128	4229	6357	78457104	SO:0001583	missense	6904			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.1808T>C	17.37:g.80863815T>C	ENSP00000347719:p.Phe603Ser		78457104	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	37	CCDS45818.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.16	3.045328	0.55110	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000397466;ENST00000536182	T;T	0.68331	-0.32;-0.32	5.35	5.35	0.76521	Armadillo-like helical (1);Armadillo-type fold (1);	0.601471	0.17313	N	0.178807	T	0.65801	0.2726	L	0.53249	1.67	0.22811	N	0.998701	P;P;B	0.43885	0.586;0.82;0.013	B;B;B	0.44224	0.191;0.444;0.026	T	0.60637	-0.7224	9	.	.	.	.	13.2697	0.60153	0.0:0.0:0.0:1.0	.	603;603;603	Q9BTW9;Q9BTW9-4;F5H8C7	TBCD_HUMAN;.;.	S	603;354;217;603	ENSP00000347719:F603S;ENSP00000380608:F217S	.	F	+	2	0	TBCD	78457104	1.000000	0.71417	0.014000	0.15608	0.013000	0.08279	5.570000	0.67398	2.019000	0.59389	0.533000	0.62120	TTC		0.602	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1	NM_005993		Missense_Mutation
TSPYL1	7259	hgsc.bcm.edu	37	6	116600465	116600466	+	In_Frame_Ins	INS	-	-	CAC	rs76746450|rs397735194|rs78371471|rs56100880	byFrequency	TCGA-24-1614-01	TCGA-24-1614-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr6:116600465_116600466insCAC	ENST00000368608.3	-	1	600_601	c.528_529insGTG	c.(526-531)gtgaag>gtgGTGaag	p.176_177insV	RP1-93H18.1_ENST00000449314.1_lincRNA|DSE_ENST00000540275.1_Intron|DSE_ENST00000452085.3_5'Flank	NM_003309.3	NP_003300.1	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	176					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.V176_K177insV(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(3)|urinary_tract(1)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		aggccttccttcaccacctcAG	0.614														4368	0.872204	0.9592	0.7839	5008	,	,		18686	0.9772		0.6521	False		,,,				2504	0.9356															1	Insertion - In frame(1)	ovary(1)	6								3880,384		1772,336,24						-8.3	0.0		dbSNP_131	62	5244,3010		1653,1938,536	no	coding	TSPYL1	NM_003309.3		3425,2274,560	A1A1,A1R,RR		36.4672,9.0056,27.113				9124,3394				116707159	SO:0001652	inframe_insertion	7259			AF042181	CCDS34518.1	6q22.1	2014-09-17	2004-04-05	2004-04-07	ENSG00000189241	ENSG00000189241			12382	protein-coding gene	gene with protein product		604714	"""TSPY-like"""	TSPYL		9730615	Standard	NM_003309		Approved		uc003pwp.4	Q9H0U9	OTTHUMG00000015427	ENST00000368608.3:c.526_528dupGTG	6.37:g.116600469_116600471dupCAC	ENSP00000357597:p.Val176_Val176dup		116707158	O75885|Q5TFE6	In_Frame_Ins	INS	ENST00000368608.3	37	CCDS34518.1	INS	62	Baylor																																																																																				0.614	TSPYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041929.1			In_Frame_Ins
TTC24	164118	hgsc.bcm.edu	37	1	156555516	156555516	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr1:156555516C>T	ENST00000368237.3	+	8	1468	c.1468C>T	c.(1468-1470)Cca>Tca	p.P490S	AL365181.1_ENST00000581084.1_RNA|TTC24_ENST00000368236.3_Missense_Mutation_p.P490S|TTC24_ENST00000478081.1_3'UTR			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	490										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTGTTTCCTTCCAGGCACAGT	0.502																																																0			1											121.0	118.0	119.0					1																	156555516		2068	4219	6287	154822140	SO:0001583	missense	164118				CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.1468C>T	1.37:g.156555516C>T	ENSP00000357220:p.Pro490Ser		154822140	Q5T3H7	Missense_Mutation	SNP	ENST00000368237.3	37	CCDS53379.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.64	3.179847	0.57800	.	.	ENSG00000187862	ENST00000368236;ENST00000368237	T;T	0.23552	1.9;1.9	3.29	3.29	0.37713	.	1.123640	0.07021	N	0.826838	T	0.05410	0.0143	N	0.24115	0.695	0.09310	N	1	P	0.37781	0.608	B	0.32465	0.146	T	0.04551	-1.0943	10	0.08599	T	0.76	.	10.3462	0.43907	0.0:1.0:0.0:0.0	.	490	A2A3L6	TTC24_HUMAN	S	490	ENSP00000357219:P490S;ENSP00000357220:P490S	ENSP00000357219:P490S	P	+	1	0	TTC24	154822140	0.001000	0.12720	0.027000	0.17364	0.833000	0.47200	1.163000	0.31798	2.173000	0.68751	0.462000	0.41574	CCA		0.502	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158547.1	XM_089384		Missense_Mutation
ZFHX4	79776	hgsc.bcm.edu	37	8	77766447	77766447	+	Silent	SNP	A	A	G			TCGA-24-1614-01	TCGA-24-1614-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr8:77766447A>G	ENST00000521891.2	+	10	7738	c.7290A>G	c.(7288-7290)ccA>ccG	p.P2430P	ZFHX4_ENST00000455469.2_Silent_p.P2385P|ZFHX4_ENST00000050961.6_Silent_p.P2385P|ZFHX4_ENST00000518282.1_Silent_p.P2404P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.P2414P(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAGCCCTGCCATTAGCATCGA	0.557										HNSCC(33;0.089)																																						1	Substitution - coding silent(1)	ovary(1)	8											51.0	85.0	74.0					8																	77766447		2050	4163	6213	77929002	SO:0001819	synonymous_variant	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7290A>G	8.37:g.77766447A>G			77929002	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2	SNP	8	Baylor																																																																																				0.557	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		Silent
ZNF804A	91752	hgsc.bcm.edu	37	2	185802211	185802211	+	Missense_Mutation	SNP	C	C	A	rs5836928|rs3046266	byFrequency	TCGA-24-1614-01	TCGA-24-1614-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-24-1614-01	TCGA-24-1614-10	g.chr2:185802211C>A	ENST00000302277.6	+	4	2682	c.2088C>A	c.(2086-2088)aaC>aaA	p.N696K		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	696							metal ion binding (GO:0046872)	p.N696K(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GTAAAAAGAACACAATACTTT	0.289																																																1	Substitution - Missense(1)	ovary(1)	2											73.0	68.0	70.0					2																	185802211		2194	4291	6485	185510456	SO:0001583	missense	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2088C>A	2.37:g.185802211C>A	ENSP00000303252:p.Asn696Lys		185510456	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.52	1.663251	0.29515	.	.	ENSG00000170396	ENST00000302277	T	0.06068	3.35	5.63	3.8	0.43715	.	0.582383	0.16465	N	0.213215	T	0.06325	0.0163	L	0.46157	1.445	0.09310	N	1	B	0.24258	0.1	B	0.24541	0.054	T	0.29243	-1.0018	10	0.42905	T	0.14	-1.8543	4.6402	0.12545	0.1573:0.6004:0.0:0.2423	.	696	Q7Z570	Z804A_HUMAN	K	696	ENSP00000303252:N696K	ENSP00000303252:N696K	N	+	3	2	ZNF804A	185510456	0.000000	0.05858	0.002000	0.10522	0.041000	0.13682	-0.003000	0.12901	1.353000	0.45828	0.655000	0.94253	AAC		0.289	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		Missense_Mutation
