#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
DNAJC6	9829	broad.mit.edu	37	1	65858546	65858546	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr1:65858546A>G	ENST00000395325.3	+	12	1887	c.1730A>G	c.(1729-1731)gAa>gGa	p.E577G	DNAJC6_ENST00000263441.7_Missense_Mutation_p.E564G|DNAJC6_ENST00000371069.4_Missense_Mutation_p.E634G	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	577	Pro-rich.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						AGAGTGGGAGAAGGTAATTTT	0.468																																																0			1											35.0	33.0	34.0					1																	65858546		2203	4300	6503	65631134	SO:0001583	missense	9829			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.1730A>G	1.37:g.65858546A>G	ENSP00000378735:p.Glu577Gly		65631134	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	ENST00000395325.3	37	CCDS30739.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	14.31	2.496680	0.44352	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	D;D;D	0.93307	-3.19;-3.19;-3.2	5.5	5.5	0.81552	.	0.107337	0.40469	N	0.001088	D	0.84101	0.5398	L	0.34521	1.04	0.42704	D	0.993629	B;B;B	0.24768	0.111;0.008;0.021	B;B;B	0.19391	0.025;0.001;0.003	T	0.81439	-0.0932	10	0.25751	T	0.34	.	15.7759	0.78214	1.0:0.0:0.0:0.0	.	634;577;564	O75061-2;O75061;D3DQ66	.;AUXI_HUMAN;.	G	564;577;634	ENSP00000263441:E564G;ENSP00000378735:E577G;ENSP00000360108:E634G	ENSP00000263441:E564G	E	+	2	0	DNAJC6	65631134	1.000000	0.71417	1.000000	0.80357	0.506000	0.33950	6.160000	0.71862	2.308000	0.77769	0.533000	0.62120	GAA		0.468	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025134.1			Missense_Mutation
HMGCS2	3158	broad.mit.edu	37	1	120306817	120306817	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr1:120306817C>T	ENST00000369406.3	-	2	586	c.537G>A	c.(535-537)tgG>tgA	p.W179*	HMGCS2_ENST00000544913.2_Nonsense_Mutation_p.W179*|HMGCS2_ENST00000476640.1_5'UTR	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	179					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)	p.W179*(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		TGGACTCCATCCAGTTGGCAG	0.478																																																1	Substitution - Nonsense(1)	ovary(1)	1											105.0	89.0	94.0					1																	120306817		2203	4300	6503	120108340	SO:0001587	stop_gained	3158			BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.537G>A	1.37:g.120306817C>T	ENSP00000358414:p.Trp179*		120108340	B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Nonsense_Mutation	SNP	ENST00000369406.3	37	CCDS905.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	37	6.554293	0.97658	.	.	ENSG00000134240	ENST00000369406;ENST00000544913	.	.	.	5.04	5.04	0.67666	.	0.000000	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.4887	17.3277	0.87253	0.0:1.0:0.0:0.0	.	.	.	.	X	179	.	ENSP00000358414:W179X	W	-	3	0	HMGCS2	120108340	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.332000	0.79203	2.497000	0.84241	0.650000	0.86243	TGG		0.478	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033469.2	NM_005518		Nonsense_Mutation
PDE4DIP	9659	broad.mit.edu	37	1	144879283	144879283	+	Silent	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr1:144879283C>A	ENST00000369354.3	-	27	4356	c.4167G>T	c.(4165-4167)tcG>tcT	p.S1389S	PDE4DIP_ENST00000530740.1_Silent_p.S1525S|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369356.4_Silent_p.S1389S|PDE4DIP_ENST00000313382.9_Silent_p.S1345S|PDE4DIP_ENST00000369359.4_Silent_p.S1525S|RP4-791M13.5_ENST00000531288.1_RNA|AL138796.1_ENST00000582173.1_RNA			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1389					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.S1389S(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCAGACTAGACGAATAATCAC	0.522			T	PDGFRB	MPD																																		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	1	Substitution - coding silent(1)	ovary(1)	1											101.0	111.0	108.0					1																	144879283		2203	4300	6503	143590640	SO:0001819	synonymous_variant	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.4167G>T	1.37:g.144879283C>A			143590640	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	ENST00000369354.3	37	CCDS30824.1	SNP	19	Broad																																																																																				0.522	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359		Silent
NBPF15	284565	broad.mit.edu	37	1	148754895	148754895	+	Silent	SNP	A	A	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr1:148754895A>G	ENST00000417839.1	+	14	1741	c.1551A>G	c.(1549-1551)agA>agG	p.R517R		NM_001102663.1	NP_001096133	Q5SXJ2	NBPFG_HUMAN		517	NBPF 5. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4	all_hematologic(923;0.032)					CACTGGATAGATATTATTCAA	0.463																																																0			1											1.0	1.0	1.0					1																	148754895		225	492	717	147021519	SO:0001819	synonymous_variant	728936																														ENST00000417839.1:c.1551A>G	1.37:g.148754895A>G			147021519	A8MPT6	Silent	SNP	ENST00000417839.1	37	CCDS41384.1	SNP	12	Broad																																																																																				0.463	NBPF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097693.1			Silent
FCGR1A	2209	broad.mit.edu	37	1	149761787	149761788	+	Missense_Mutation	DNP	AA	AA	CG			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr1:149761787_149761788AA>CG	ENST00000369168.4	+	5	791_792	c.737_738AA>CG	c.(736-738)cAA>cCG	p.Q246P	HIST2H2BF_ENST00000545683.1_Intron|RP11-196G18.21_ENST00000420462.1_RNA|RP11-196G18.3_ENST00000428289.1_RNA	NM_000566.3	NP_000557.1	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor (CD64)	246	Ig-like C2-type 3.				antibody-dependent cellular cytotoxicity (GO:0001788)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intracellular signal transduction (GO:0035556)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of phagocytosis (GO:0050766)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG receptor activity (GO:0019770)|receptor signaling protein activity (GO:0005057)	p.Q246P(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	10	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TCTGAATACCAAATACTAACTG	0.5																																																1	Substitution - Missense(1)	ovary(1)	1																																								148028412	SO:0001583	missense	2209			BC032634	CCDS933.1	1q21.2-q21.3	2014-09-17	2005-02-02		ENSG00000150337	ENSG00000150337		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3613	protein-coding gene	gene with protein product		146760	"""Fc fragment of IgG, high affinity Ia, receptor for (CD64)"""			8697799, 9763663	Standard	NM_000566		Approved	CD64, CD64A	uc001esp.4	P12314	OTTHUMG00000012089	Exception_encountered	1.37:g.149761787_149761788delinsCG	ENSP00000358165:p.Gln246Pro		148028411	P12315|Q5QNW7|Q92495|Q92663	Missense_Mutation	DNP	ENST00000369168.4	37	CCDS933.1	DNP	5	Broad																																																																																				0.500	FCGR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033446.1	NM_000566		Missense_Mutation
SELE	6401	broad.mit.edu	37	1	169696594	169696594	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr1:169696594G>C	ENST00000333360.7	-	10	1680	c.1541C>G	c.(1540-1542)aCt>aGt	p.T514S	SELE_ENST00000367782.4_Missense_Mutation_p.T451S|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367774.1_Missense_Mutation_p.T388S|SELE_ENST00000367776.1_Missense_Mutation_p.T451S|SELE_ENST00000367777.1_Missense_Mutation_p.T451S|SELE_ENST00000367775.1_Missense_Mutation_p.T389S|SELE_ENST00000367781.4_Missense_Mutation_p.T451S|SELE_ENST00000367779.4_Missense_Mutation_p.T388S|SELE_ENST00000367780.4_Missense_Mutation_p.T389S	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	514	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)	p.T514S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	CTTGCACACAGTGCCAAACAC	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											100.0	90.0	93.0					1																	169696594		2203	4300	6503	167963218	SO:0001583	missense	6401			M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.1541C>G	1.37:g.169696594G>C	ENSP00000331736:p.Thr514Ser		167963218	A2RRD6|P16111	Missense_Mutation	SNP	ENST00000333360.7	37	CCDS1283.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	3.598	-0.082122	0.07141	.	.	ENSG00000007908	ENST00000367781;ENST00000367782;ENST00000367780;ENST00000367779;ENST00000333360;ENST00000367777;ENST00000367775;ENST00000367776;ENST00000367774	T;T;T;T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	5.83	5.83	0.93111	Complement control module (2);Sushi/SCR/CCP (3);	0.338426	0.21718	N	0.070169	T	0.19366	0.0465	N	0.02412	-0.56	0.09310	N	1	B	0.32876	0.388	B	0.37422	0.249	T	0.20207	-1.0282	10	0.02654	T	1	-3.9251	17.6276	0.88097	0.0:0.0:1.0:0.0	.	514	P16581	LYAM2_HUMAN	S	451;451;389;388;514;451;389;451;388	ENSP00000356755:T451S;ENSP00000356756:T451S;ENSP00000356754:T389S;ENSP00000356753:T388S;ENSP00000331736:T514S;ENSP00000356751:T451S;ENSP00000356749:T389S;ENSP00000356750:T451S;ENSP00000356748:T388S	ENSP00000331736:T514S	T	-	2	0	SELE	167963218	0.476000	0.25901	0.010000	0.14722	0.823000	0.46562	3.908000	0.56355	2.753000	0.94483	0.650000	0.86243	ACT		0.547	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1	NM_000450		Missense_Mutation
BTG2	7832	broad.mit.edu	37	1	203274737	203274737	+	Start_Codon_SNP	SNP	G	G	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr1:203274737G>A	ENST00000290551.4	+	1	74	c.3G>A	c.(1-3)atG>atA	p.M1I	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	1					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.M1I(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			CGCGCGACATGAGCCACGGGA	0.697																																																1	Substitution - Missense(1)	ovary(1)	1											18.0	14.0	16.0					1																	203274737		2181	4284	6465	201541360	SO:0001582	initiator_codon_variant	7832				CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.3G>A	1.37:g.203274737G>A	ENSP00000290551:p.Met1Ile		201541360	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	24.5	4.536784	0.85812	.	.	ENSG00000159388	ENST00000290551	T	0.21191	2.02	4.66	4.66	0.58398	.	1.001540	0.08052	N	0.996811	T	0.22282	0.0537	.	.	.	0.36681	D	0.879047	B	0.10296	0.003	B	0.04013	0.001	T	0.07578	-1.0765	9	0.87932	D	0	-3.8598	14.3791	0.66900	0.0:0.0:1.0:0.0	.	1	P78543	BTG2_HUMAN	I	1	ENSP00000290551:M1I	ENSP00000290551:M1I	M	+	3	0	BTG2	201541360	1.000000	0.71417	0.988000	0.46212	0.926000	0.56050	4.629000	0.61290	2.425000	0.82216	0.478000	0.44815	ATG		0.697	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	Missense_Mutation	Missense_Mutation
NFASC	23114	broad.mit.edu	37	1	204953226	204953226	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr1:204953226C>T	ENST00000404076.1	+	20	2901	c.2479C>T	c.(2479-2481)Cgc>Tgc	p.R827C	NFASC_ENST00000367172.4_Missense_Mutation_p.R848C|NFASC_ENST00000360049.4_Missense_Mutation_p.R844C|NFASC_ENST00000513543.1_Missense_Mutation_p.R844C|NFASC_ENST00000339876.6_Intron|NFASC_ENST00000367170.4_Missense_Mutation_p.R848C|NFASC_ENST00000367169.4_Intron|NFASC_ENST00000367171.4_Missense_Mutation_p.R833C|NFASC_ENST00000338515.6_Missense_Mutation_p.R848C|NFASC_ENST00000539706.1_Missense_Mutation_p.R844C|NFASC_ENST00000404907.1_Missense_Mutation_p.R844C|NFASC_ENST00000338586.6_Missense_Mutation_p.R848C|NFASC_ENST00000401399.1_Intron			O94856	NFASC_HUMAN	neurofascin	848					axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.R844C(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TCAGTGGAACCGCGTCTACTC	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											102.0	90.0	94.0					1																	204953226		2203	4300	6503	203219849	SO:0001583	missense	23114			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000404076.1:c.2479C>T	1.37:g.204953226C>T	ENSP00000385676:p.Arg827Cys		203219849	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000404076.1	37		SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	21.9	4.217300	0.79352	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000404076;ENST00000404907;ENST00000513543;ENST00000430393	T;T;T;T;T;T;T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37	5.41	5.41	0.78517	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000096	T	0.68201	0.2975	L	0.58101	1.795	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.994;0.995;1.0;0.998	D;P;P;D;P	0.74023	0.982;0.781;0.905;0.944;0.905	T	0.70353	-0.4895	10	0.72032	D	0.01	.	14.5272	0.67897	0.1472:0.8528:0.0:0.0	.	848;859;844;833;844	O94856;O94856-11;O94856-8;F8W791;O94856-3	NFASC_HUMAN;.;.;.;.	C	848;833;848;848;848;859;844;844;827;844;844;835	ENSP00000356140:R848C;ENSP00000356139:R833C;ENSP00000356138:R848C;ENSP00000342128:R848C;ENSP00000343509:R848C;ENSP00000438614:R844C;ENSP00000353154:R844C;ENSP00000385676:R827C;ENSP00000384061:R844C;ENSP00000425908:R844C;ENSP00000415031:R835C	ENSP00000295776:R859C	R	+	1	0	NFASC	203219849	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.808000	0.47963	2.537000	0.85549	0.563000	0.77884	CGC		0.582	NFASC-012	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000131243.1	NM_001005388		Missense_Mutation
GPATCH2	55105	broad.mit.edu	37	1	217688226	217688226	+	Silent	SNP	G	G	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr1:217688226G>T	ENST00000366935.3	-	6	1214	c.1104C>A	c.(1102-1104)ccC>ccA	p.P368P		NM_018040.2	NP_060510.1	Q9NW75	GPTC2_HUMAN	G patch domain containing 2	368					negative regulation of phosphatase activity (GO:0010923)		nucleic acid binding (GO:0003676)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)	35				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		GGCCAGGAATGGGTACCTACA	0.353																																																0			1											41.0	41.0	41.0					1																	217688226		2203	4300	6503	215754849	SO:0001819	synonymous_variant	55105			AK001114	CCDS1518.1, CCDS73031.1	1q41	2013-01-28		2006-12-13	ENSG00000092978	ENSG00000092978		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""G patch domain containing"""	25499	protein-coding gene	gene with protein product	"""cancer/testis antigen 110"", ""protein phosphatase 1, regulatory subunit 30"""			GPATC2		19432882, 15375528	Standard	XM_005273174		Approved	FLJ10252, CT110, PPP1R30	uc001hlf.1	Q9NW75	OTTHUMG00000000527	ENST00000366935.3:c.1104C>A	1.37:g.217688226G>T			215754849	Q5VYK7|Q5VYK8|Q86YE7	Silent	SNP	ENST00000366935.3	37	CCDS1518.1	SNP	47	Broad																																																																																				0.353	GPATCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001272.1	NM_018040		Silent
PARP1	142	broad.mit.edu	37	1	226566920	226566920	+	Silent	SNP	G	G	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr1:226566920G>A	ENST00000366794.5	-	12	1811	c.1668C>T	c.(1666-1668)acC>acT	p.T556T		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	556					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.T556T(1)		breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		CCAGGCCAAGGGTGGCACTGA	0.532								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																								1	Substitution - coding silent(1)	ovary(1)	1											202.0	178.0	186.0					1																	226566920		2203	4300	6503	224633543	SO:0001819	synonymous_variant	142			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.1668C>T	1.37:g.226566920G>A			224633543	B1ANJ4|Q8IUZ9	Silent	SNP	ENST00000366794.5	37	CCDS1554.1	SNP	43	Broad																																																																																				0.532	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618		Silent
HK1	3098	broad.mit.edu	37	10	71119673	71119673	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr10:71119673C>G	ENST00000359426.6	+	3	351	c.247C>G	c.(247-249)Ctg>Gtg	p.L83V	HK1_ENST00000448642.2_Missense_Mutation_p.L118V|HK1_ENST00000404387.2_Missense_Mutation_p.L87V|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000298649.3_Missense_Mutation_p.L82V|HK1_ENST00000360289.2_Missense_Mutation_p.L71V	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	83	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)	p.L87V(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						TTTCATTGCCCTGGATCTTGG	0.478																																																1	Substitution - Missense(1)	ovary(1)	10											156.0	138.0	144.0					10																	71119673		2203	4300	6503	70789679	SO:0001583	missense	3098			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.247C>G	10.37:g.71119673C>G	ENSP00000352398:p.Leu83Val		70789679	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	37	CCDS7292.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	14.13	2.442426	0.43326	.	.	ENSG00000156515	ENST00000450646;ENST00000360289;ENST00000448642;ENST00000421088;ENST00000404387;ENST00000436817;ENST00000298649;ENST00000359426;ENST00000405407	T;T;T;T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21	5.51	1.35	0.21983	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.67306	0.2879	L	0.54323	1.7	0.58432	D	0.999999	D;B;B;B;B	0.89917	1.0;0.197;0.235;0.197;0.355	D;B;B;B;B	0.91635	0.999;0.159;0.246;0.159;0.214	T	0.64984	-0.6278	10	0.72032	D	0.01	-17.3959	9.6815	0.40072	0.0:0.6982:0.0:0.3018	.	83;82;118;87;71	P19367;P19367-2;E7ENR4;P19367-3;P19367-4	HXK1_HUMAN;.;.;.;.	V	87;71;118;71;87;82;82;83;83	ENSP00000409761:L87V;ENSP00000353433:L71V;ENSP00000402103:L118V;ENSP00000398316:L71V;ENSP00000384774:L87V;ENSP00000415949:L82V;ENSP00000298649:L82V;ENSP00000352398:L83V	ENSP00000298649:L82V	L	+	1	2	HK1	70789679	0.017000	0.18338	0.983000	0.44433	0.979000	0.70002	0.264000	0.18497	-0.013000	0.14199	-1.051000	0.02340	CTG		0.478	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188		Missense_Mutation
ODF3	113746	broad.mit.edu	37	11	197577	197577	+	Silent	SNP	G	G	A	rs374039790		TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr11:197577G>A	ENST00000325113.4	+	3	443	c.126G>A	c.(124-126)acG>acA	p.T42T	ODF3_ENST00000525282.1_Silent_p.T42T|BET1L_ENST00000410108.1_Intron|ODF3_ENST00000342593.5_Silent_p.T42T	NM_053280.3	NP_444510.2	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3	42					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	outer dense fiber (GO:0001520)		p.T42T(1)		biliary_tract(1)|breast(1)|kidney(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)	9		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		TGAAGCACACGCCCACCAAGC	0.652																																																1	Substitution - coding silent(1)	ovary(1)	11						G		0,4406		0,0,2203	39.0	38.0	38.0		126	-10.0	0.6	11		38	1,8599		0,1,4299	no	coding-synonymous	ODF3	NM_053280.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		42/255	197577	1,13005	2203	4300	6503	187577	SO:0001819	synonymous_variant	113746			AB067774	CCDS7688.1, CCDS65981.1	11p15.5	2010-04-23			ENSG00000177947	ENSG00000177947			19905	protein-coding gene	gene with protein product	"""cancer/testis antigen 135"""	608356				11870087	Standard	NM_001286136		Approved	SHIPPO1, hSHIPPO, CT135	uc001lob.3	Q96PU9	OTTHUMG00000119073	ENST00000325113.4:c.126G>A	11.37:g.197577G>A			187577	B7ZLT0|Q69YX0	Silent	SNP	ENST00000325113.4	37	CCDS7688.1	SNP	38	Broad																																																																																				0.652	ODF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239287.1			Silent
NELL1	4745	broad.mit.edu	37	11	21135138	21135138	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr11:21135138T>A	ENST00000357134.5	+	13	1456	c.1304T>A	c.(1303-1305)aTt>aAt	p.I435N	NELL1_ENST00000532434.1_Missense_Mutation_p.I435N|NELL1_ENST00000325319.5_Missense_Mutation_p.I378N|NELL1_ENST00000298925.5_Missense_Mutation_p.I463N	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	435	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.I435N(1)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						CCTTCAGATATTGATGAGTGT	0.358																																																1	Substitution - Missense(1)	ovary(1)	11											239.0	216.0	224.0					11																	21135138		2203	4300	6503	21091714	SO:0001583	missense	4745			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1304T>A	11.37:g.21135138T>A	ENSP00000349654:p.Ile435Asn		21091714	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	CCDS7855.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	20.5	4.001673	0.74932	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26	5.29	5.29	0.74685	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.95912	0.8669	M	0.65677	2.01	0.58432	D	0.999996	D;D;D;D	0.76494	0.997;0.999;0.996;0.996	D;D;D;D	0.87578	0.994;0.998;0.945;0.941	D	0.96325	0.9239	10	0.87932	D	0	-3.7774	13.7975	0.63180	0.0:0.0:0.0:1.0	.	378;463;435;435	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	N	463;435;378;435	ENSP00000298925:I463N;ENSP00000349654:I435N;ENSP00000317837:I378N;ENSP00000437170:I435N	ENSP00000298925:I463N	I	+	2	0	NELL1	21091714	1.000000	0.71417	0.996000	0.52242	0.973000	0.67179	7.447000	0.80620	1.998000	0.58463	0.482000	0.46254	ATT		0.358	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		Missense_Mutation
MYBPC3	4607	broad.mit.edu	37	11	47354410	47354410	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr11:47354410C>T	ENST00000545968.1	-	31	3499	c.3445G>A	c.(3445-3447)Gac>Aac	p.D1149N	MYBPC3_ENST00000256993.4_Missense_Mutation_p.D1148N|MYBPC3_ENST00000399249.2_Missense_Mutation_p.D1149N	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	1149	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.D1149N(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		GCCGCTCTGTCACTAAAGCCA	0.582																																																1	Substitution - Missense(1)	ovary(1)	11											40.0	43.0	42.0					11																	47354410		1982	4140	6122	47310986	SO:0001583	missense	4607			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.3445G>A	11.37:g.47354410C>T	ENSP00000442795:p.Asp1149Asn		47310986	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	ENST00000545968.1	37	CCDS53621.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	15.41	2.826022	0.50739	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	D;D;D	0.86562	-2.14;-2.14;-2.14	5.17	4.24	0.50183	Fibronectin, type III (2);Immunoglobulin-like fold (1);	.	.	.	.	D	0.91556	0.7333	M	0.79258	2.445	0.29925	N	0.822416	B	0.33777	0.425	P	0.48488	0.579	D	0.89546	0.3796	9	0.87932	D	0	.	13.9295	0.63986	0.1536:0.8464:0.0:0.0	.	1148	Q14896	MYPC3_HUMAN	N	1149;1149;1148	ENSP00000442795:D1149N;ENSP00000382193:D1149N;ENSP00000256993:D1148N	ENSP00000256993:D1148N	D	-	1	0	MYBPC3	47310986	0.651000	0.27340	0.732000	0.30844	0.108000	0.19459	2.474000	0.45154	1.164000	0.42652	-0.188000	0.12872	GAC		0.582	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3			Missense_Mutation
SLC29A2	3177	broad.mit.edu	37	11	66130950	66130950	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr11:66130950G>T	ENST00000357440.2	-	12	1556	c.1328C>A	c.(1327-1329)tCc>tAc	p.S443Y	RP11-867G23.8_ENST00000531602.1_Nonsense_Mutation_p.E67*|SLC29A2_ENST00000311161.7_3'UTR|SLC29A2_ENST00000546034.1_Missense_Mutation_p.S443Y|SLC29A2_ENST00000544554.1_Missense_Mutation_p.S443Y|RP11-867G23.8_ENST00000580881.1_Intron	NM_001532.2	NP_001523.2	Q14542	S29A2_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 2	443					cell proliferation (GO:0008283)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)	p.S443Y(1)		breast(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10					Didanosine(DB00900)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Zalcitabine(DB00943)|Zidovudine(DB00495)	GGCTCCACAGGAAAGTCCCAG	0.617																																																1	Substitution - Missense(1)	ovary(1)	11											70.0	64.0	66.0					11																	66130950		2199	4295	6494	65887526	SO:0001583	missense	3177			X86681	CCDS8137.1, CCDS73326.1	11q13	2013-07-17	2013-07-17		ENSG00000174669	ENSG00000174669		"""Solute carriers"""	11004	protein-coding gene	gene with protein product		602110	"""solute carrier family 29 (nucleoside transporters), member 2"""	ENT2, HNP36		9192854, 9478986	Standard	NM_001532		Approved	DER12	uc001oht.3	Q14542	OTTHUMG00000169056	ENST00000357440.2:c.1328C>A	11.37:g.66130950G>T	ENSP00000350024:p.Ser443Tyr		65887526	B3KPY7|O43530|Q52M84|Q96R00|Q9UPE0	Missense_Mutation	SNP	ENST00000357440.2	37	CCDS8137.1	SNP	41	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.298423|4.298423	0.81025|0.81025	.|.	.|.	ENSG00000255468|ENSG00000174669	ENST00000531602|ENST00000357440;ENST00000544554;ENST00000546034	.|T;T;T	.|0.81415	.|-1.49;-1.49;-1.49	4.57|4.57	4.57|4.57	0.56435|0.56435	.|.	.|0.057001	.|0.64402	.|D	.|0.000001	.|D	.|0.86772	.|0.6013	M|M	0.66939|0.66939	2.045|2.045	0.51233|0.51233	D|D	0.999919|0.999919	.|D	.|0.63046	.|0.992	.|D	.|0.66847	.|0.947	.|D	.|0.84479	.|0.0604	.|10	0.87932|0.25751	D|T	0|0.34	-35.7251|-35.7251	14.9343|14.9343	0.70941|0.70941	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|443	.|Q14542	.|S29A2_HUMAN	X|Y	67|443	.|ENSP00000350024:S443Y;ENSP00000439456:S443Y;ENSP00000440329:S443Y	ENSP00000435142:E67X|ENSP00000350024:S443Y	E|S	+|-	1|2	0|0	RP11-867G23.8|SLC29A2	65887526|65887526	1.000000|1.000000	0.71417|0.71417	0.939000|0.939000	0.37840|0.37840	0.814000|0.814000	0.46013|0.46013	8.988000|8.988000	0.93501|0.93501	2.395000|2.395000	0.81488|0.81488	0.585000|0.585000	0.79938|0.79938	GAA|TCC		0.617	SLC29A2-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402093.1	NM_001532		Missense_Mutation
BBS1	582	broad.mit.edu	37	11	66299139	66299139	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr11:66299139G>C	ENST00000318312.7	+	16	1672	c.1621G>C	c.(1621-1623)Gtg>Ctg	p.V541L	BBS1_ENST00000455748.2_Missense_Mutation_p.V444L|ZDHHC24_ENST00000526986.1_Intron|BBS1_ENST00000393994.2_Missense_Mutation_p.V412L|CTD-3074O7.11_ENST00000419755.3_Missense_Mutation_p.V578L	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	541					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)	p.V541L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						ACCCTTGCTGGTGCCAGGGCT	0.547									Bardet-Biedl syndrome																												GBM(152;173 2612 9770 10137)											1	Substitution - Missense(1)	ovary(1)	11											187.0	178.0	181.0					11																	66299139		2200	4295	6495	66055715	SO:0001583	missense	582	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.1621G>C	11.37:g.66299139G>C	ENSP00000317469:p.Val541Leu		66055715	Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	ENST00000318312.7	37	CCDS8142.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	26.9	4.780491	0.90195	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000455748;ENST00000393994	D;D;D;D	0.96774	-4.05;-4.12;-3.93;-3.8	5.79	5.79	0.91817	.	.	.	.	.	D	0.96790	0.8952	L	0.49778	1.585	0.80722	D	1	D;D;B;D;D;D	0.61697	0.957;0.99;0.067;0.981;0.976;0.976	P;P;B;P;P;P	0.60173	0.514;0.87;0.12;0.845;0.698;0.741	D	0.95656	0.8711	9	0.31617	T	0.26	.	17.5338	0.87822	0.0:0.0:1.0:0.0	.	216;444;412;429;541;578	B4DH75;E7EQH1;Q32MM9;Q4G0L2;Q8NFJ9;Q8NFJ9-2	.;.;.;.;BBS1_HUMAN;.	L	578;541;444;412	ENSP00000398526:V578L;ENSP00000317469:V541L;ENSP00000405764:V444L;ENSP00000377563:V412L	ENSP00000317469:V541L	V	+	1	0	BBS1;CTD-3074O7.11	66055715	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.534000	0.90620	2.733000	0.93635	0.655000	0.94253	GTG		0.547	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393235.2			Missense_Mutation
SORL1	6653	broad.mit.edu	37	11	121414435	121414435	+	Splice_Site	SNP	G	G	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr11:121414435G>T	ENST00000260197.7	+	13	1993	c.1864G>T	c.(1864-1866)Gga>Tga	p.G622*	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	622					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.G622*(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GGATGCCTTGGGTAAGCTGCT	0.507																																																1	Substitution - Nonsense(1)	ovary(1)	11											133.0	112.0	119.0					11																	121414435		2203	4299	6502	120919645	SO:0001630	splice_region_variant	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.1864+1G>T	11.37:g.121414435G>T			120919645	B2RNX7|Q92856	Nonsense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	40	8.387335	0.98789	.	.	ENSG00000137642	ENST00000260197	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.8045	0.96525	0.0:0.0:1.0:0.0	.	.	.	.	X	622	.	ENSP00000260197:G622X	G	+	1	0	SORL1	120919645	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.722000	0.84778	2.676000	0.91093	0.655000	0.94253	GGA		0.507	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	Nonsense_Mutation	Nonsense_Mutation
OR10G4	390264	broad.mit.edu	37	11	123887171	123887171	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr11:123887171C>T	ENST00000320891.4	+	1	890	c.890C>T	c.(889-891)gCt>gTt	p.A297V		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A297V(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GTGAAGAAAGCTGTGTTGAAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	11											75.0	71.0	72.0					11																	123887171		2201	4299	6500	123392381	SO:0001583	missense	390264			AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.890C>T	11.37:g.123887171C>T	ENSP00000325076:p.Ala297Val		123392381	Q6IEW0	Missense_Mutation	SNP	ENST00000320891.4	37	CCDS31702.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	c	10.88	1.474551	0.26511	.	.	ENSG00000254737	ENST00000320891	T	0.44881	0.91	3.38	3.38	0.38709	.	0.000000	0.41396	D	0.000895	T	0.38612	0.1047	L	0.46567	1.45	0.09310	N	1	B	0.19331	0.035	B	0.27170	0.077	T	0.44862	-0.9300	10	0.66056	D	0.02	.	13.0881	0.59153	0.0:1.0:0.0:0.0	.	297	Q8NGN3	O10G4_HUMAN	V	297	ENSP00000325076:A297V	ENSP00000325076:A297V	A	+	2	0	OR10G4	123392381	0.672000	0.27530	0.446000	0.26920	0.878000	0.50629	4.423000	0.59861	1.900000	0.55004	0.580000	0.79431	GCT		0.393	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462		Missense_Mutation
SLC2A3	6515	broad.mit.edu	37	12	8084025	8084025	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr12:8084025C>A	ENST00000075120.7	-	4	566	c.326G>T	c.(325-327)gGa>gTa	p.G109V		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	109					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)	p.G109V(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		TTTACACAGTCCCATAAAGCA	0.458																																					Colon(96;424 1461 14416 20933 23688)											1	Substitution - Missense(1)	ovary(1)	12											101.0	95.0	97.0					12																	8084025		2203	4300	6503	7975292	SO:0001583	missense	6515			M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.326G>T	12.37:g.8084025C>A	ENSP00000075120:p.Gly109Val		7975292	B2R606|D3DUU6|Q6I9U2|Q9UG15	Missense_Mutation	SNP	ENST00000075120.7	37	CCDS8586.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	15.15	2.749042	0.49257	.	.	ENSG00000059804	ENST00000075120;ENST00000540978;ENST00000544291	D;D	0.82344	-1.6;-1.6	4.37	4.37	0.52481	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.049515	0.85682	D	0.000000	D	0.88647	0.6493	L	0.58669	1.825	0.80722	D	1	D;D	0.63880	0.992;0.993	D;D	0.73380	0.954;0.98	D	0.89107	0.3493	10	0.56958	D	0.05	.	14.8038	0.69935	0.0:1.0:0.0:0.0	.	35;109	F5H2H8;P11169	.;GTR3_HUMAN	V	109;35;78	ENSP00000075120:G109V;ENSP00000440750:G78V	ENSP00000075120:G109V	G	-	2	0	SLC2A3	7975292	0.990000	0.36364	0.963000	0.40424	0.014000	0.08584	2.746000	0.47467	2.426000	0.82243	0.555000	0.69702	GGA		0.458	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257914.1	NM_006931		Missense_Mutation
ST8SIA1	6489	broad.mit.edu	37	12	22487101	22487101	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr12:22487101C>G	ENST00000396037.4	-	1	547	c.66G>C	c.(64-66)aaG>aaC	p.K22N	ST8SIA1_ENST00000404299.3_Missense_Mutation_p.K22N|ST8SIA1_ENST00000536558.1_Intron|ST8SIA1_ENST00000539510.1_5'UTR|ST8SIA1_ENST00000381424.3_Missense_Mutation_p.K22N	NM_003034.3	NP_003025.1	Q92185	SIA8A_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1	22					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|glycosphingolipid biosynthetic process (GO:0006688)|positive regulation of cell proliferation (GO:0008284)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)	p.K22N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25						TCCGCGGGAACTTCCACGCCA	0.706																																																1	Substitution - Missense(1)	ovary(1)	12											68.0	68.0	68.0					12																	22487101		2203	4300	6503	22378368	SO:0001583	missense	6489			L32867	CCDS8697.1	12p12.1-p11.2	2013-03-01	2003-01-14	2005-02-07	ENSG00000111728	ENSG00000111728	2.4.99.8	"""Sialyltransferases"""	10869	protein-coding gene	gene with protein product	"""ST8Sia I"""	601123	"""sialyltransferase 8 (alpha-N-acetylneuraminate: alpha-2,8-sialytransferase, GD3 synthase) A"""	SIAT8, SIAT8A		7901202	Standard	NM_003034		Approved		uc001rfo.4	Q92185	OTTHUMG00000169098	ENST00000396037.4:c.66G>C	12.37:g.22487101C>G	ENSP00000379353:p.Lys22Asn		22378368	A8K4H6|Q17RL0|Q6PZN5|Q93064	Missense_Mutation	SNP	ENST00000396037.4	37	CCDS8697.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	15.11	2.737015	0.49045	.	.	ENSG00000111728	ENST00000396037;ENST00000404299;ENST00000381424	T	0.26810	1.71	4.58	2.73	0.32206	.	0.217303	0.47093	D	0.000250	T	0.18045	0.0433	L	0.47716	1.5	0.80722	D	1	P	0.43826	0.818	B	0.34536	0.185	T	0.02713	-1.1120	10	0.59425	D	0.04	-16.8217	8.095	0.30822	0.0:0.8096:0.0:0.1904	.	22	Q92185	SIA8A_HUMAN	N	22	ENSP00000379353:K22N	ENSP00000261197:K22N	K	-	3	2	ST8SIA1	22378368	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.371000	0.34250	0.619000	0.30197	0.655000	0.94253	AAG		0.706	ST8SIA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402245.2	NM_003034		Missense_Mutation
MAP3K12	7786	broad.mit.edu	37	12	53875792	53875792	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr12:53875792G>A	ENST00000267079.2	-	14	2639	c.2414C>T	c.(2413-2415)tCa>tTa	p.S805L	MAP3K12_ENST00000547035.1_Missense_Mutation_p.S838L|MAP3K12_ENST00000547488.1_Missense_Mutation_p.S838L	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	805					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.S805L(1)		NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GATGACCTCTGAAGGAGGTGG	0.562											OREG0021873	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	12											102.0	95.0	97.0					12																	53875792		2203	4300	6503	52162059	SO:0001583	missense	7786			U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.2414C>T	12.37:g.53875792G>A	ENSP00000267079:p.Ser805Leu	996	52162059	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	37	CCDS8860.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904930	0.33628	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	T;T;T	0.56275	0.47;0.47;0.47	4.37	3.48	0.39840	.	0.000000	0.39020	N	0.001484	T	0.27313	0.0670	N	0.03608	-0.345	0.37328	D	0.909837	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.18335	-1.0340	10	0.87932	D	0	.	8.3043	0.32034	0.1061:0.0:0.8939:0.0	.	838;805	G3V1Y2;Q12852	.;M3K12_HUMAN	L	805;838;838	ENSP00000267079:S805L;ENSP00000449038:S838L;ENSP00000448689:S838L	ENSP00000267079:S805L	S	-	2	0	MAP3K12	52162059	1.000000	0.71417	0.600000	0.28864	0.579000	0.36224	2.151000	0.42263	1.445000	0.47624	-0.339000	0.08088	TCA		0.562	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301		Missense_Mutation
XPOT	11260	broad.mit.edu	37	12	64827256	64827256	+	Silent	SNP	G	G	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr12:64827256G>C	ENST00000332707.5	+	19	2854	c.2325G>C	c.(2323-2325)gtG>gtC	p.V775V		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	775	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.V775V(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		TTTTTGAAGTGCTGCTCCGGC	0.433																																																1	Substitution - coding silent(1)	ovary(1)	12											133.0	131.0	132.0					12																	64827256		2203	4300	6503	63113523	SO:0001819	synonymous_variant	11260			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.2325G>C	12.37:g.64827256G>C			63113523	A6NLH1|O43784|Q8WUG2|Q9BVS7	Silent	SNP	ENST00000332707.5	37	CCDS31852.1	SNP	46	Broad																																																																																				0.433	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235		Silent
SERPINE3	647174	broad.mit.edu	37	13	51921272	51921272	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr13:51921272G>T	ENST00000521255.1	+	3	662	c.602G>T	c.(601-603)aGa>aTa	p.R201I	SERPINE3_ENST00000400389.4_Missense_Mutation_p.R201I|SERPINE3_ENST00000524365.1_Missense_Mutation_p.R201I|MIR5693_ENST00000577722.1_RNA	NM_001101320.1	NP_001094790.1	A8MV23	SERP3_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 3	201					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R201I(1)		ovary(2)	2						TGGCGAAAGAGATTCTCCTCC	0.567																																																1	Substitution - Missense(1)	ovary(1)	13											122.0	120.0	121.0					13																	51921272		2095	4227	6322	50819273	SO:0001583	missense	647174			AX772926	CCDS53870.1	13q14.3	2014-02-18			ENSG00000253309	ENSG00000253309		"""Serine (or cysteine) peptidase inhibitors"""	24774	protein-coding gene	gene with protein product						24172014	Standard	NM_001101320		Approved		uc001vfh.2	A8MV23	OTTHUMG00000016943	ENST00000521255.1:c.602G>T	13.37:g.51921272G>T	ENSP00000428316:p.Arg201Ile		50819273	B1V8P3	Missense_Mutation	SNP	ENST00000521255.1	37	CCDS53870.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978336	0.34942	.	.	ENSG00000253309	ENST00000524365;ENST00000521255;ENST00000400389	D;D;D	0.84589	-1.87;-1.87;-1.87	4.56	1.77	0.24775	Serpin domain (3);	0.360994	0.21675	U	0.070801	D	0.84570	0.5501	M	0.72894	2.215	0.09310	N	0.999997	P;P	0.50272	0.933;0.889	B;P	0.49752	0.407;0.621	T	0.76350	-0.2991	10	0.87932	D	0	.	4.3993	0.11379	0.271:0.3839:0.3452:0.0	.	201;201	A8MV23-2;A8MV23	.;SERP3_HUMAN	I	201	ENSP00000430755:R201I;ENSP00000428316:R201I;ENSP00000441468:R201I	ENSP00000441468:R201I	R	+	2	0	SERPINE3	50819273	1.000000	0.71417	0.000000	0.03702	0.387000	0.30353	2.216000	0.42871	0.148000	0.19059	0.655000	0.94253	AGA		0.567	SERPINE3-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045021.2	NM_001101320		Missense_Mutation
NEK3	4752	broad.mit.edu	37	13	52709937	52709937	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr13:52709937C>A	ENST00000400357.2	-	12	2479	c.1186G>T	c.(1186-1188)Gac>Tac	p.D396Y	NEK3_ENST00000339406.3_Missense_Mutation_p.D413Y|NEK3_ENST00000378101.2_Missense_Mutation_p.D413Y|NEK3_ENST00000452082.2_Missense_Mutation_p.D417Y			P51956	NEK3_HUMAN	NIMA-related kinase 3	413					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.D413Y(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|stomach(2)	18		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		AACAAAGTGTCAGGGGTCTCT	0.368																																																1	Substitution - Missense(1)	ovary(1)	13											130.0	118.0	122.0					13																	52709937		1849	4085	5934	51607938	SO:0001583	missense	4752			AK290259, BC019916	CCDS73576.1	13q14.2-q21.1	2014-07-17	2012-11-15		ENSG00000136098	ENSG00000136098	2.7.11.1		7746	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase NEK3"", ""phosphorylase B kinase kinase"", ""glycogen synthase A kinase"", ""hydroxyalkyl-protein kinase"""	604044	"""NIMA (never in mitosis gene a)-related kinase 3"""			8274451, 7522034	Standard	NM_002498		Approved	HSPK36, MGC29949	uc010tgy.2	P51956	OTTHUMG00000016958	ENST00000400357.2:c.1186G>T	13.37:g.52709937C>A	ENSP00000383210:p.Asp396Tyr		51607938	A8K2J4|Q5TAP2|Q8J023|Q8WUN5	Missense_Mutation	SNP	ENST00000400357.2	37	CCDS53871.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	12.37	1.916525	0.33815	.	.	ENSG00000136098	ENST00000339406;ENST00000378101;ENST00000400357;ENST00000452082;ENST00000547422	T;T;T;T;T	0.71934	-0.46;-0.46;-0.61;-0.47;-0.45	5.21	5.21	0.72293	.	0.337359	0.33110	N	0.005278	T	0.61198	0.2328	N	0.14661	0.345	0.09310	N	1	P;P;D	0.53885	0.938;0.938;0.963	B;B;P	0.46825	0.328;0.445;0.528	T	0.61247	-0.7101	10	0.66056	D	0.02	.	15.7148	0.77658	0.0:0.8537:0.1463:0.0	.	413;417;390	P51956;Q6ZN64;F8VS47	NEK3_HUMAN;.;.	Y	413;413;396;417;390	ENSP00000339429:D413Y;ENSP00000367341:D413Y;ENSP00000383210:D396Y;ENSP00000404197:D417Y;ENSP00000448716:D390Y	ENSP00000339429:D413Y	D	-	1	0	NEK3	51607938	0.996000	0.38824	0.015000	0.15790	0.117000	0.20001	4.063000	0.57499	2.570000	0.86706	0.655000	0.94253	GAC		0.368	NEK3-002	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045047.3			Missense_Mutation
OR4K13	390433	broad.mit.edu	37	14	20502054	20502054	+	Silent	SNP	T	T	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr14:20502054T>C	ENST00000315693.2	-	1	865	c.864A>G	c.(862-864)acA>acG	p.T288T	AL359218.1_ENST00000580563.1_RNA	NM_001004714.1	NP_001004714.1	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K, member 13	288						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T288T(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)	24	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		GATTTCTTAATGTATAAATAA	0.318																																																1	Substitution - coding silent(1)	ovary(1)	14											18.0	20.0	19.0					14																	20502054		2200	4293	6493	19571894	SO:0001819	synonymous_variant	390433				CCDS32028.1	14q11.2	2013-09-23			ENSG00000176253	ENSG00000176253		"""GPCR / Class A : Olfactory receptors"""	15351	protein-coding gene	gene with protein product							Standard	NM_001004714		Approved		uc010tkz.2	Q8NH42	OTTHUMG00000170781	ENST00000315693.2:c.864A>G	14.37:g.20502054T>C			19571894	Q6IF13	Silent	SNP	ENST00000315693.2	37	CCDS32028.1	SNP	51	Broad																																																																																				0.318	OR4K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410344.1			Silent
FANCM	57697	broad.mit.edu	37	14	45658222	45658222	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr14:45658222G>T	ENST00000267430.5	+	20	5082	c.4997G>T	c.(4996-4998)aGa>aTa	p.R1666I	FANCM_ENST00000542564.2_Missense_Mutation_p.R1640I	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1666					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)	p.R1666I(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						AAATTATCCAGAATTATTTTA	0.313								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																							1	Substitution - Missense(1)	ovary(1)	14											58.0	64.0	62.0					14																	45658222		2203	4300	6503	44727972	SO:0001583	missense	57697	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4997G>T	14.37:g.45658222G>T	ENSP00000267430:p.Arg1666Ile		44727972	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	SNP	33	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.2|25.2	4.616750|4.616750	0.87359|0.87359	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000554809|ENST00000267430;ENST00000542564;ENST00000556250	.|T;T;T	.|0.30981	.|2.11;2.11;1.51	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|1.241660	.|0.05381	.|N	.|0.537218	T|T	0.62048|0.62048	0.2396|0.2396	M|M	0.70275|0.70275	2.135|2.135	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.87578	.|0.998;0.997	T|T	0.42120|0.42120	-0.9470|-0.9470	5|10	.|0.87932	.|D	.|0	.|.	16.8444|16.8444	0.85976|0.85976	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1640;1666	.|B2RTQ9;Q8IYD8	.|.;FANCM_HUMAN	H|I	598|1666;1640;1182	.|ENSP00000267430:R1666I;ENSP00000442493:R1640I;ENSP00000452033:R1182I	.|ENSP00000267430:R1666I	Q|R	+|+	3|2	2|0	FANCM|FANCM	44727972|44727972	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.959000|0.959000	0.62525|0.62525	6.849000|6.849000	0.75414|0.75414	2.834000|2.834000	0.97654|0.97654	0.650000|0.650000	0.86243|0.86243	CAG|AGA		0.313	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128		Missense_Mutation
MKL2	57496	broad.mit.edu	37	16	14340851	14340851	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr16:14340851G>C	ENST00000341243.5	+	10	1701	c.1701G>C	c.(1699-1701)gaG>gaC	p.E567D	MKL2_ENST00000571589.1_Missense_Mutation_p.E578D|MKL2_ENST00000574045.1_Missense_Mutation_p.E578D|MKL2_ENST00000318282.5_Missense_Mutation_p.E578D			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	567	Required for interaction with itself and with MKL1.				blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.E578D(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						AGGAGAAAGAGAAGCAAATCG	0.483																																																1	Substitution - Missense(1)	ovary(1)	16											39.0	40.0	39.0					16																	14340851		2197	4300	6497	14248352	SO:0001583	missense	57496			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.1701G>C	16.37:g.14340851G>C	ENSP00000345841:p.Glu567Asp		14248352	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	ENST00000341243.5	37		SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	10.79	1.449079	0.26074	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	5.83	3.54	0.40534	.	0.000000	0.85682	D	0.000000	T	0.50616	0.1626	L	0.28054	0.825	0.43246	D	0.995167	D;D	0.76494	0.999;0.996	D;D	0.76071	0.939;0.987	T	0.51004	-0.8760	9	0.02654	T	1	-35.6622	10.0096	0.41979	0.2264:0.0:0.7736:0.0	.	578;578	B4DGT8;Q9ULH7-4	.;.	D	578;567	.	ENSP00000339086:E578D	E	+	3	2	MKL2	14248352	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.638000	0.74309	1.462000	0.47948	0.655000	0.94253	GAG		0.483	MKL2-202	KNOWN	basic	protein_coding	protein_coding		NM_014048		Missense_Mutation
DRC7	84229	broad.mit.edu	37	16	57762332	57762332	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr16:57762332C>A	ENST00000360716.3	+	17	2448	c.2227C>A	c.(2227-2229)Cag>Aag	p.Q743K	CCDC135_ENST00000394337.4_Missense_Mutation_p.Q743K|CCDC135_ENST00000336825.8_Missense_Mutation_p.Q678K			Q8IY82	CC135_HUMAN		743					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)		p.Q743K(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						GCACCTGCGGCAGGTGGAGAC	0.602																																																1	Substitution - Missense(1)	ovary(1)	16											72.0	83.0	79.0					16																	57762332		2198	4297	6495	56319833	SO:0001583	missense	84229																														ENST00000360716.3:c.2227C>A	16.37:g.57762332C>A	ENSP00000353942:p.Gln743Lys		56319833	A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	ENST00000360716.3	37	CCDS10787.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	c	12.78	2.040564	0.35989	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.08984	3.2;3.03;3.2	5.26	5.26	0.73747	.	0.315875	0.31092	N	0.008277	T	0.21347	0.0514	L	0.49126	1.545	0.50813	D	0.999897	D;B	0.69078	0.997;0.226	D;B	0.74674	0.984;0.122	T	0.04767	-1.0928	10	0.11485	T	0.65	-42.4925	17.433	0.87544	0.0:1.0:0.0:0.0	.	678;743	Q8IY82-2;Q8IY82	.;CC135_HUMAN	K	743;678;743	ENSP00000377869:Q743K;ENSP00000338938:Q678K;ENSP00000353942:Q743K	ENSP00000338938:Q678K	Q	+	1	0	CCDC135	56319833	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	3.977000	0.56874	2.470000	0.83445	0.491000	0.48974	CAG		0.602	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2			Missense_Mutation
OR1D5	8386	broad.mit.edu	37	17	2966074	2966074	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr17:2966074C>A	ENST00000575751.1	-	1	827	c.828G>T	c.(826-828)atG>atT	p.M276I		NM_014566.1	NP_055381.1	P58170	OR1D5_HUMAN	olfactory receptor, family 1, subfamily D, member 5	276					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|lung(10)	11						GCACAGCATACATCACTGTGG	0.517																																																0			17											25.0	29.0	27.0					17																	2966074		2181	4277	6458	2912824	SO:0001583	missense	8386			AF087923	CCDS58499.1	17p13.3	2012-10-09			ENSG00000262628	ENSG00000262628		"""GPCR / Class A : Olfactory receptors"""	8186	protein-coding gene	gene with protein product						10673334	Standard	NM_014566		Approved	OR17-31	uc021tns.1	P58170	OTTHUMG00000177676	ENST00000575751.1:c.828G>T	17.37:g.2966074C>A	ENSP00000459028:p.Met276Ile		2912824	Q96RA6	Missense_Mutation	SNP	ENST00000575751.1	37	CCDS58499.1	SNP	17	Broad																																																																																				0.517	OR1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438410.2	NM_014566		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577124	7577124	+	Missense_Mutation	SNP	C	C	T	rs121912657		TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr17:7577124C>T	ENST00000269305.4	-	8	1003	c.814G>A	c.(814-816)Gtg>Atg	p.V272M	TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.V272M|TP53_ENST00000359597.4_Missense_Mutation_p.V272M|TP53_ENST00000445888.2_Missense_Mutation_p.V272M|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.V272M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	272	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1737852}.|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V272M(82)|p.V272L(26)|p.0?(8)|p.V272fs*73(4)|p.?(2)|p.F270fs*72(1)|p.E271fs*73(1)|p.V272fs*34(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.G266_E271delGRNSFE(1)|p.V272fs*74(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAACACGCACCTCAAAGCTG	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	133	Substitution - Missense(108)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)	large_intestine(23)|ovary(16)|lung(14)|breast(14)|oesophagus(11)|upper_aerodigestive_tract(9)|haematopoietic_and_lymphoid_tissue(9)|central_nervous_system(7)|bone(5)|stomach(4)|pancreas(4)|liver(4)|kidney(3)|urinary_tract(3)|endometrium(2)|thyroid(1)|vulva(1)|soft_tissue(1)|testis(1)|skin(1)	17	GRCh37	CM920676	TP53	M	rs121912657						62.0	54.0	57.0					17																	7577124		2203	4300	6503	7517849	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.814G>A	17.37:g.7577124C>T	ENSP00000269305:p.Val272Met		7517849	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318455	0.81469	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99833	-7.03;-7.03;-7.03;-7.03;-7.03;-7.03	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057604	0.64402	D	0.000002	D	0.99843	0.9928	M	0.90309	3.105	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.96721	0.9532	10	0.87932	D	0	-27.8222	16.1198	0.81342	0.0:1.0:0.0:0.0	.	272;272;272;272	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	M	272;272;272;272;272;261;140	ENSP00000352610:V272M;ENSP00000269305:V272M;ENSP00000398846:V272M;ENSP00000391127:V272M;ENSP00000391478:V272M;ENSP00000425104:V140M	ENSP00000269305:V272M	V	-	1	0	TP53	7517849	1.000000	0.71417	0.986000	0.45419	0.849000	0.48306	5.871000	0.69628	2.667000	0.90743	0.462000	0.41574	GTG		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
GRB2	2885	broad.mit.edu	37	17	73317818	73317818	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr17:73317818C>G	ENST00000392562.1	-	5	1172	c.390G>C	c.(388-390)gaG>gaC	p.E130D	GRB2_ENST00000578961.1_Intron|GRB2_ENST00000392564.1_Missense_Mutation_p.E130D|GRB2_ENST00000392563.1_Missense_Mutation_p.E89D|GRB2_ENST00000316804.5_Missense_Mutation_p.E130D|GRB2_ENST00000316615.5_Missense_Mutation_p.E89D|GRB2_ENST00000462266.1_5'UTR			P62993	GRB2_HUMAN	growth factor receptor-bound protein 2	130	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				aging (GO:0007568)|anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to ionizing radiation (GO:0071479)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of MAPK cascade (GO:0043408)|signal transduction in response to DNA damage (GO:0042770)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Grb2-EGFR complex (GO:0070436)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|identical protein binding (GO:0042802)|insulin receptor substrate binding (GO:0043560)|neurotrophin TRKA receptor binding (GO:0005168)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.E130D(1)		breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	17	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	AATCCACCAGCTCATTCAAAG	0.502																																																1	Substitution - Missense(1)	ovary(1)	17											102.0	94.0	97.0					17																	73317818		2203	4300	6503	70829413	SO:0001583	missense	2885				CCDS11721.1, CCDS11722.1	17q24-q25	2013-02-14			ENSG00000177885	ENSG00000177885		"""SH2 domain containing"""	4566	protein-coding gene	gene with protein product		108355					Standard	NM_002086		Approved	NCKAP2	uc002jnx.4	P62993	OTTHUMG00000134332	ENST00000392562.1:c.390G>C	17.37:g.73317818C>G	ENSP00000376345:p.Glu130Asp		70829413	P29354|Q14450|Q63057|Q63059	Missense_Mutation	SNP	ENST00000392562.1	37	CCDS11721.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	17.55	3.416661	0.62511	.	.	ENSG00000177885	ENST00000316804;ENST00000392562;ENST00000392564;ENST00000392563;ENST00000316615	T;T;T;D;D	0.83335	1.69;1.69;1.69;-1.71;-1.71	5.95	3.91	0.45181	SH2 motif (5);	0.100153	0.64402	D	0.000002	T	0.75838	0.3904	L	0.45744	1.44	0.58432	D	0.999999	B;B	0.13145	0.007;0.0	B;B	0.21546	0.035;0.004	T	0.69899	-0.5020	10	0.30078	T	0.28	-43.3633	9.051	0.36376	0.0:0.7448:0.1225:0.1327	.	89;130	P62993-2;P62993	.;GRB2_HUMAN	D	130;130;130;89;89	ENSP00000339007:E130D;ENSP00000376345:E130D;ENSP00000376347:E130D;ENSP00000376346:E89D;ENSP00000317360:E89D	ENSP00000317360:E89D	E	-	3	2	GRB2	70829413	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.591000	0.36665	1.534000	0.49203	0.655000	0.94253	GAG		0.502	GRB2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259476.1			Missense_Mutation
GAA	2548	broad.mit.edu	37	17	78092558	78092558	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr17:78092558C>A	ENST00000302262.3	+	19	2972	c.2753C>A	c.(2752-2754)tCc>tAc	p.S918Y	GAA_ENST00000390015.3_Missense_Mutation_p.S918Y	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	918					cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)	p.S918Y(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	CAGGTCCTCTCCAACGGTGTC	0.652																																																1	Substitution - Missense(1)	ovary(1)	17											100.0	93.0	95.0					17																	78092558		2203	4300	6503	75707153	SO:0001583	missense	2548				CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.2753C>A	17.37:g.78092558C>A	ENSP00000305692:p.Ser918Tyr		75707153	Q09GN4|Q14351|Q16302|Q8IWE7	Missense_Mutation	SNP	ENST00000302262.3	37	CCDS32760.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	7.365	0.625649	0.14257	.	.	ENSG00000171298	ENST00000302262;ENST00000390015	D;D	0.89939	-2.59;-2.59	5.31	-0.625	0.11548	.	0.630950	0.16530	N	0.210398	T	0.78253	0.4254	L	0.36672	1.1	0.19575	N	0.999965	B	0.24426	0.103	B	0.20955	0.032	T	0.60362	-0.7278	10	0.06757	T	0.87	-35.7583	9.2051	0.37285	0.0:0.347:0.5193:0.1337	.	918	P10253	LYAG_HUMAN	Y	918	ENSP00000305692:S918Y;ENSP00000374665:S918Y	ENSP00000305692:S918Y	S	+	2	0	GAA	75707153	0.024000	0.19004	0.060000	0.19600	0.536000	0.34869	0.493000	0.22451	0.011000	0.14865	0.655000	0.94253	TCC		0.652	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1			Missense_Mutation
OGFOD3	79701	broad.mit.edu	37	17	80373329	80373329	+	Silent	SNP	C	C	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr17:80373329C>T	ENST00000313056.5	-	2	400	c.249G>A	c.(247-249)ggG>ggA	p.G83G	HEXDC_ENST00000337014.6_5'Flank|OGFOD3_ENST00000329197.5_Silent_p.G83G|Y_RNA_ENST00000364369.1_RNA	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	83						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)	p.G83G(1)									CGATGAATCTCCCTGCCACGA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	17											103.0	99.0	101.0					17																	80373329		2203	4300	6503	77966618	SO:0001819	synonymous_variant	79701			BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.249G>A	17.37:g.80373329C>T			77966618	C9JDC8|Q8IZ37|Q9H6J2	Silent	SNP	ENST00000313056.5	37	CCDS11811.1	SNP	30	Broad																																																																																				0.602	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442895.1	NM_175902		Silent
MUC16	94025	broad.mit.edu	37	19	9087663	9087663	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr19:9087663C>A	ENST00000397910.4	-	1	4355	c.4152G>T	c.(4150-4152)tgG>tgT	p.W1384C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1384	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.W1384C(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGTGATGGTCCATGCTTTTG	0.463																																																1	Substitution - Missense(1)	ovary(1)	19											163.0	164.0	163.0					19																	9087663		2186	4286	6472	8948663	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4152G>T	19.37:g.9087663C>A	ENSP00000381008:p.Trp1384Cys		8948663	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	c	0.337	-0.952593	0.02285	.	.	ENSG00000181143	ENST00000397910	T	0.03152	4.03	1.62	0.558	0.17266	.	.	.	.	.	T	0.04272	0.0118	N	0.08118	0	.	.	.	D	0.71674	0.998	P	0.61132	0.884	T	0.41342	-0.9514	8	0.87932	D	0	.	4.0026	0.09587	0.0:0.7704:0.0:0.2296	.	1384	B5ME49	.	C	1384	ENSP00000381008:W1384C	ENSP00000381008:W1384C	W	-	3	0	MUC16	8948663	0.014000	0.17966	0.011000	0.14972	0.061000	0.15899	0.147000	0.16202	0.246000	0.21394	0.305000	0.20034	TGG		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Missense_Mutation
CCDC159	126075	broad.mit.edu	37	19	11462591	11462591	+	Silent	SNP	C	C	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr19:11462591C>T	ENST00000588790.1	+	8	879	c.432C>T	c.(430-432)ttC>ttT	p.F144F	CCDC159_ENST00000458408.1_Silent_p.F144F			P0C7I6	CC159_HUMAN	coiled-coil domain containing 159	259								p.F259F(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	5						GCAAGAAGTTCCTGTGGGAGG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	19											42.0	47.0	46.0					19																	11462591		2068	4183	6251	11323591	SO:0001819	synonymous_variant	126075			BC038439	CCDS45976.1	19p13.2	2010-02-17			ENSG00000183401	ENSG00000183401			26996	protein-coding gene	gene with protein product							Standard	NM_001080503		Approved		uc010xlt.2	P0C7I6		ENST00000588790.1:c.432C>T	19.37:g.11462591C>T			11323591	B4DEG3|B4DWR8|B4E133|B7ZAM4	Silent	SNP	ENST00000588790.1	37	CCDS45976.1	SNP	30	Broad																																																																																				0.632	CCDC159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458761.1	NM_001080503		Silent
CHST8	64377	broad.mit.edu	37	19	34180169	34180169	+	Start_Codon_SNP	SNP	T	T	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr19:34180169T>A	ENST00000262622.4	+	2	760	c.2T>A	c.(1-3)aTg>aAg	p.M1K	CHST8_ENST00000604556.1_3'UTR|CHST8_ENST00000438847.3_Start_Codon_SNP_p.M1K|CHST8_ENST00000434302.1_Start_Codon_SNP_p.M1K	NM_022467.3	NP_071912.2	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8	1					carbohydrate biosynthetic process (GO:0016051)|central nervous system development (GO:0007417)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)	p.M1K(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(5)	27	Esophageal squamous(110;0.162)					CAGCCCCGGATGACCCTGCGA	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											86.0	79.0	81.0					19																	34180169		2203	4300	6503	38872009	SO:0001582	initiator_codon_variant	64377			AB047801	CCDS12433.1	19q13.1	2008-02-05				ENSG00000124302		"""Sulfotransferases, membrane-bound"""	15993	protein-coding gene	gene with protein product		610190				10988300, 11001942	Standard	NM_001127895		Approved	GALNAC-4-ST1	uc002nut.4	Q9H2A9		ENST00000262622.4:c.2T>A	19.37:g.34180169T>A	ENSP00000262622:p.Met1Lys		38872009	Q9H3N2	Missense_Mutation	SNP	ENST00000262622.4	37	CCDS12433.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	12.92	2.082318	0.36758	.	.	ENSG00000124302	ENST00000434302;ENST00000438847;ENST00000262622	T;T;T	0.75050	-0.9;-0.9;-0.9	5.39	3.2	0.36748	.	0.238102	0.30142	N	0.010306	T	0.63721	0.2535	.	.	.	0.28790	N	0.899355	B	0.02656	0.0	B	0.04013	0.001	T	0.58696	-0.7591	9	0.87932	D	0	-3.5771	8.7692	0.34722	0.3022:0.0:0.0:0.6978	.	1	Q9H2A9	CHST8_HUMAN	K	1	ENSP00000392604:M1K;ENSP00000393879:M1K;ENSP00000262622:M1K	ENSP00000262622:M1K	M	+	2	0	CHST8	38872009	1.000000	0.71417	0.995000	0.50966	0.492000	0.33523	1.077000	0.30741	0.287000	0.22375	0.482000	0.46254	ATG		0.632	CHST8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451453.1	NM_022467	Missense_Mutation	Missense_Mutation
ARHGAP35	2909	broad.mit.edu	37	19	47424886	47424886	+	Nonsense_Mutation	SNP	C	C	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr19:47424886C>G	ENST00000404338.3	+	1	2954	c.2954C>G	c.(2953-2955)tCa>tGa	p.S985*		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	985					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.S985*(1)									CTGCAGGATTCAGAAGAAGAT	0.507																																																1	Substitution - Nonsense(1)	ovary(1)	19											55.0	54.0	54.0					19																	47424886		1942	4146	6088	52116726	SO:0001587	stop_gained	2909			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.2954C>G	19.37:g.47424886C>G	ENSP00000385720:p.Ser985*		52116726	A7E2A4|Q14452|Q9C0E1	Nonsense_Mutation	SNP	ENST00000404338.3	37	CCDS46127.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	41	8.731453	0.98933	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-16.542	18.9487	0.92632	0.0:1.0:0.0:0.0	.	.	.	.	X	985	.	ENSP00000324820:S985X	S	+	2	0	ARHGAP35	52116726	1.000000	0.71417	0.780000	0.31762	0.992000	0.81027	7.818000	0.86416	2.778000	0.95560	0.655000	0.94253	TCA		0.507	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491		Nonsense_Mutation
IRF3	3661	broad.mit.edu	37	19	50166630	50166630	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr19:50166630G>A	ENST00000597198.1	-	3	688	c.307C>T	c.(307-309)Cca>Tca	p.P103S	IRF3_ENST00000599144.1_Intron|IRF3_ENST00000600911.1_Missense_Mutation_p.P103S|BCL2L12_ENST00000246785.3_5'Flank|IRF3_ENST00000600022.1_5'UTR|BCL2L12_ENST00000246784.3_5'Flank|IRF3_ENST00000601291.1_Missense_Mutation_p.P103S|IRF3_ENST00000442265.2_Intron|IRF3_ENST00000377135.4_Missense_Mutation_p.P103S|IRF3_ENST00000599223.1_Missense_Mutation_p.P103S|IRF3_ENST00000593922.1_5'UTR|IRF3_ENST00000309877.7_Missense_Mutation_p.P103S|IRF3_ENST00000598808.1_5'UTR|IRF3_ENST00000599680.1_5'Flank|BCL2L12_ENST00000441864.2_5'Flank|IRF3_ENST00000377139.3_Missense_Mutation_p.P103S|IRF3_ENST00000596822.1_5'UTR|IRF3_ENST00000596765.1_Intron			Q14653	IRF3_HUMAN	interferon regulatory factor 3	103					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dsRNA (GO:0071359)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage apoptotic process (GO:0071888)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of interferon-beta biosynthetic process (GO:0045358)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|programmed necrotic cell death (GO:0097300)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)	p.P103S(1)		breast(1)|large_intestine(2)|lung(4)|ovary(2)|stomach(1)	10		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		ATTTTATGTGGGTCGTGAGGG	0.577																																																1	Substitution - Missense(1)	ovary(1)	19											79.0	74.0	76.0					19																	50166630		2203	4300	6503	54858442	SO:0001583	missense	3661				CCDS12775.1, CCDS56099.1, CCDS59407.1, CCDS59408.1, CCDS59409.1	19q13.3-q13.4	2008-07-16				ENSG00000126456			6118	protein-coding gene	gene with protein product		603734				8524823	Standard	NM_001571		Approved		uc002pow.3	Q14653		ENST00000597198.1:c.307C>T	19.37:g.50166630G>A	ENSP00000469113:p.Pro103Ser		54858442	A8K7L2|B2RAZ3|Q5FBY1|Q5FBY2|Q5FBY4|Q7Z5G6	Missense_Mutation	SNP	ENST00000597198.1	37	CCDS12775.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	18.05	3.536801	0.65085	.	.	ENSG00000126456	ENST00000377139;ENST00000309877;ENST00000377135	D;D;D	0.98280	-4.84;-4.84;-4.84	5.02	3.97	0.46021	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.99001	0.9659	M	0.90252	3.1	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.996;0.996;0.994;0.938	D	0.99593	1.0976	10	0.87932	D	0	-24.8414	13.4745	0.61301	0.0:0.1586:0.8414:0.0	.	103;103;103;103;103	B2RAZ3;Q96GL3;Q7Z5G6;Q14653;Q5FBY1	.;.;.;IRF3_HUMAN;.	S	103	ENSP00000366344:P103S;ENSP00000310127:P103S;ENSP00000366339:P103S	ENSP00000310127:P103S	P	-	1	0	IRF3	54858442	1.000000	0.71417	0.157000	0.22605	0.580000	0.36256	5.665000	0.68052	1.229000	0.43630	0.655000	0.94253	CCA		0.577	IRF3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465962.1	NM_001571		Missense_Mutation
AP2A1	160	broad.mit.edu	37	19	50285817	50285817	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr19:50285817C>G	ENST00000359032.5	+	4	309	c.309C>G	c.(307-309)aaC>aaG	p.N103K	AP2A1_ENST00000600199.1_3'UTR|AP2A1_ENST00000354293.5_Missense_Mutation_p.N103K	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	103					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)	p.N103K(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		TGCTGGTGAACTCGAACTCGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											55.0	58.0	57.0					19																	50285817		2158	4260	6418	54977629	SO:0001583	missense	160			AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.309C>G	19.37:g.50285817C>G	ENSP00000351926:p.Asn103Lys		54977629	Q96CI7|Q96PP6|Q96PP7|Q9H070	Missense_Mutation	SNP	ENST00000359032.5	37	CCDS46148.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	26.4	4.731337	0.89390	.	.	ENSG00000196961	ENST00000354293;ENST00000359032	T;T	0.34472	1.36;1.36	5.54	5.54	0.83059	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.61949	0.2388	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.989	T	0.60845	-0.7182	10	0.44086	T	0.13	.	18.2458	0.89985	0.0:1.0:0.0:0.0	.	103;103	O95782-2;O95782	.;AP2A1_HUMAN	K	103	ENSP00000346246:N103K;ENSP00000351926:N103K	ENSP00000346246:N103K	N	+	3	2	AP2A1	54977629	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	2.743000	0.47442	2.602000	0.87976	0.557000	0.71058	AAC		0.592	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465809.1			Missense_Mutation
SIGLEC12	89858	broad.mit.edu	37	19	52001419	52001419	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr19:52001419G>C	ENST00000291707.3	-	5	1313	c.1258C>G	c.(1258-1260)Ctg>Gtg	p.L420V	SIGLEC12_ENST00000598614.1_Missense_Mutation_p.L302V	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	420	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.L420V(1)		NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GAGGGGCTCAGGGTCAGGCTC	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											49.0	47.0	48.0					19																	52001419		2203	4300	6503	56693231	SO:0001583	missense	89858			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.1258C>G	19.37:g.52001419G>C	ENSP00000291707:p.Leu420Val		56693231	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	.	11.07	1.529778	0.27387	.	.	ENSG00000254521	ENST00000291707	T	0.15487	2.42	1.39	1.39	0.22231	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.30051	U	0.010533	T	0.29491	0.0735	L	0.60012	1.86	0.09310	N	1	D;P	0.65815	0.995;0.918	D;P	0.73380	0.98;0.775	T	0.01819	-1.1267	10	0.41790	T	0.15	.	6.2185	0.20667	0.0:0.0:1.0:0.0	.	420;302	Q96PQ1;Q96PQ1-2	SIG12_HUMAN;.	V	420	ENSP00000291707:L420V	ENSP00000291707:L420V	L	-	1	2	SIGLEC12	56693231	0.000000	0.05858	0.055000	0.19348	0.119000	0.20118	0.258000	0.18387	1.076000	0.40961	0.393000	0.25936	CTG		0.627	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003		Missense_Mutation
POLR1A	25885	broad.mit.edu	37	2	86255039	86255039	+	Silent	SNP	G	G	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr2:86255039G>A	ENST00000263857.6	-	33	5409	c.5031C>T	c.(5029-5031)agC>agT	p.S1677S	POLR1A_ENST00000409681.1_Silent_p.S1616S			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1677					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)	p.S1677S(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GAAACTGGAAGCTGGTTTCAA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	2											78.0	85.0	83.0					2																	86255039		1996	4171	6167	86108550	SO:0001819	synonymous_variant	25885			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.5031C>T	2.37:g.86255039G>A			86108550	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Silent	SNP	ENST00000263857.6	37	CCDS42706.1	SNP	34	Broad																																																																																				0.547	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425		Silent
DPP4	1803	broad.mit.edu	37	2	162881409	162881409	+	Missense_Mutation	SNP	T	T	C	rs375183248		TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr2:162881409T>C	ENST00000360534.3	-	11	1488	c.928A>G	c.(928-930)Aga>Gga	p.R310G		NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	310					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R310G(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	AAAGAAATTCTTTCTTGTGTT	0.438																																																1	Substitution - Missense(1)	ovary(1)	2						T	GLY/ARG	0,4406		0,0,2203	147.0	134.0	138.0		928	3.1	0.8	2		138	1,8599	1.2+/-3.3	0,1,4299	no	missense	DPP4	NM_001935.3	125	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	310/767	162881409	1,13005	2203	4300	6503	162589655	SO:0001583	missense	1803			M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.928A>G	2.37:g.162881409T>C	ENSP00000353731:p.Arg310Gly		162589655	Q53TN1	Missense_Mutation	SNP	ENST00000360534.3	37	CCDS2216.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	19.28	3.798044	0.70567	0.0	1.16E-4	ENSG00000197635	ENST00000360534	D	0.96232	-3.95	5.47	3.06	0.35304	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.199005	0.50627	D	0.000105	D	0.97445	0.9164	M	0.86740	2.835	0.49389	D	0.999786	D	0.59767	0.986	D	0.63703	0.917	D	0.96618	0.9457	10	0.87932	D	0	-29.0473	6.6409	0.22909	0.0:0.0783:0.1557:0.7661	.	310	P27487	DPP4_HUMAN	G	310	ENSP00000353731:R310G	ENSP00000353731:R310G	R	-	1	2	DPP4	162589655	1.000000	0.71417	0.845000	0.33349	0.969000	0.65631	1.568000	0.36418	0.873000	0.35799	0.533000	0.62120	AGA		0.438	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255079.2			Missense_Mutation
XIRP2	129446	broad.mit.edu	37	2	168101375	168101375	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr2:168101375A>T	ENST00000409195.1	+	9	3562	c.3473A>T	c.(3472-3474)cAa>cTa	p.Q1158L	XIRP2_ENST00000409273.1_Missense_Mutation_p.Q936L|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.Q1158L|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	983					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.Q1158L(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GAGGAGATCCAAGGTGGGGAT	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											86.0	77.0	80.0					2																	168101375		1860	4104	5964	167809621	SO:0001583	missense	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.3473A>T	2.37:g.168101375A>T	ENSP00000386840:p.Gln1158Leu		167809621	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	14.70	2.614522	0.46631	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.03386	3.95;3.95;3.95	5.91	4.73	0.59995	.	0.055308	0.64402	D	0.000001	T	0.06962	0.0177	L	0.50333	1.59	0.51482	D	0.99992	P;P;P	0.45474	0.779;0.859;0.859	B;P;P	0.45712	0.296;0.491;0.491	T	0.13415	-1.0510	10	0.59425	D	0.04	-5.0963	12.2267	0.54463	0.8574:0.1426:0.0:0.0	.	983;983;936	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	L	1158;1158;936	ENSP00000386840:Q1158L;ENSP00000295237:Q1158L;ENSP00000387255:Q936L	ENSP00000295237:Q1158L	Q	+	2	0	XIRP2	167809621	0.956000	0.32656	0.997000	0.53966	0.987000	0.75469	4.083000	0.57643	1.034000	0.39945	0.533000	0.62120	CAA		0.393	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		Missense_Mutation
MYO3B	140469	broad.mit.edu	37	2	171356174	171356174	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr2:171356174C>G	ENST00000408978.4	+	27	3288	c.3145C>G	c.(3145-3147)Cat>Gat	p.H1049D	MYO3B_ENST00000409044.3_Missense_Mutation_p.H1049D|MYO3B_ENST00000334231.6_Missense_Mutation_p.H1058D|MYO3B_ENST00000602629.1_Intron	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	1049	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)	p.H1049D(1)		breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						CAAATATTACCATGTTGAGCA	0.398																																																1	Substitution - Missense(1)	ovary(1)	2											82.0	77.0	78.0					2																	171356174		1871	4109	5980	171064420	SO:0001583	missense	140469				CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.3145C>G	2.37:g.171356174C>G	ENSP00000386213:p.His1049Asp		171064420	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	37	CCDS42773.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	24.8	4.570090	0.86542	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.71698	-0.59;1.57;-0.59;1.57	5.78	5.78	0.91487	Myosin head, motor domain (1);	0.044994	0.85682	D	0.000000	D	0.85388	0.5685	M	0.79475	2.455	0.58432	D	0.999999	D;P;D	0.89917	1.0;0.926;1.0	D;P;D	0.97110	1.0;0.882;0.999	D	0.85552	0.1222	10	0.59425	D	0.04	.	20.0278	0.97529	0.0:1.0:0.0:0.0	.	1049;1049;1049	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	D	1049;1049;1048;1058;1058	ENSP00000386497:H1049D;ENSP00000386213:H1049D;ENSP00000446237:H1058D;ENSP00000335100:H1058D	ENSP00000314213:H1048D	H	+	1	0	MYO3B	171064420	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.438000	0.80431	2.732000	0.93576	0.655000	0.94253	CAT		0.398	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1			Missense_Mutation
COL3A1	1281	broad.mit.edu	37	2	189875582	189875582	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr2:189875582A>G	ENST00000304636.3	+	50	4390	c.4220A>G	c.(4219-4221)aAa>aGa	p.K1407R	COL3A1_ENST00000317840.5_Missense_Mutation_p.K1104R	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1407	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.K1407R(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GGAAATAGCAAATTCACCTAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	2											100.0	92.0	95.0					2																	189875582		2203	4300	6503	189583827	SO:0001583	missense	1281			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.4220A>G	2.37:g.189875582A>G	ENSP00000304408:p.Lys1407Arg		189583827	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	CCDS2297.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	7.077	0.569452	0.13560	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	T;T	0.73575	-0.76;-0.76	5.53	5.53	0.82687	Fibrillar collagen, C-terminal (4);	0.000000	0.53938	D	0.000041	T	0.51381	0.1671	N	0.02916	-0.46	0.26243	N	0.978846	B	0.18863	0.031	B	0.27380	0.079	T	0.22977	-1.0201	10	0.07644	T	0.81	.	15.6613	0.77190	1.0:0.0:0.0:0.0	.	1407	P02461	CO3A1_HUMAN	R	1407;1104	ENSP00000304408:K1407R;ENSP00000315243:K1104R	ENSP00000304408:K1407R	K	+	2	0	COL3A1	189583827	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.309000	0.65774	2.100000	0.63781	0.533000	0.62120	AAA		0.398	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		Missense_Mutation
TMEM169	92691	broad.mit.edu	37	2	216960853	216960853	+	Missense_Mutation	SNP	G	G	A	rs143856543	byFrequency	TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr2:216960853G>A	ENST00000295658.4	+	2	374	c.167G>A	c.(166-168)cGc>cAc	p.R56H	TMEM169_ENST00000454545.1_Missense_Mutation_p.R56H|TMEM169_ENST00000437356.2_Missense_Mutation_p.R56H|TMEM169_ENST00000406027.2_Missense_Mutation_p.R56H	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	56						integral component of membrane (GO:0016021)		p.R56H(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATCATCTACCGCTCAGACAAT	0.517													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19692	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2											86.0	84.0	84.0					2																	216960853		2203	4300	6503	216669098	SO:0001583	missense	92691			AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.167G>A	2.37:g.216960853G>A	ENSP00000295658:p.Arg56His		216669098	B2R8W6	Missense_Mutation	SNP	ENST00000295658.4	37	CCDS2401.1	SNP	38	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	24.1	4.488262	0.84854	.	.	ENSG00000163449	ENST00000433112;ENST00000454545;ENST00000437356;ENST00000295658;ENST00000455479;ENST00000406027	.	.	.	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.75606	0.3872	M	0.61703	1.905	0.58432	D	0.999992	D	0.76494	0.999	D	0.66196	0.942	T	0.78758	-0.2079	9	0.72032	D	0.01	-20.6042	16.6847	0.85302	0.0:0.0:1.0:0.0	.	56	Q96HH4	TM169_HUMAN	H	56	.	ENSP00000295658:R56H	R	+	2	0	TMEM169	216669098	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	8.886000	0.92447	2.407000	0.81776	0.306000	0.20318	CGC		0.517	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256666.2	NM_138390		Missense_Mutation
WNT6	7475	broad.mit.edu	37	2	219736293	219736293	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr2:219736293C>A	ENST00000233948.3	+	3	605	c.388C>A	c.(388-390)Ctg>Atg	p.L130M	WNT6_ENST00000486233.1_3'UTR	NM_006522.3	NP_006513.1	Q9Y6F9	WNT6_HUMAN	wingless-type MMTV integration site family, member 6	130					axis specification (GO:0009798)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|epithelial-mesenchymal cell signaling (GO:0060684)|nephron tubule formation (GO:0072079)|neuron differentiation (GO:0030182)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of gene expression (GO:0010628)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription, DNA-templated (GO:0045893)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.L130M(1)		large_intestine(1)|ovary(2)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.53e-07)|all cancers(144;9.3e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGCGAGCTGCTGCAGTGCGG	0.756																																																1	Substitution - Missense(1)	ovary(1)	2											11.0	12.0	12.0					2																	219736293		1720	3541	5261	219444537	SO:0001583	missense	7475			AF079522	CCDS2425.1	2q35	2008-05-23			ENSG00000115596	ENSG00000115596		"""Wingless-type MMTV integration sites"""	12785	protein-coding gene	gene with protein product		604663				10343101, 11350055	Standard	NM_006522		Approved		uc002vjc.1	Q9Y6F9	OTTHUMG00000133082	ENST00000233948.3:c.388C>A	2.37:g.219736293C>A	ENSP00000233948:p.Leu130Met		219444537	Q9H1J6|Q9H238	Missense_Mutation	SNP	ENST00000233948.3	37	CCDS2425.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	c	13.89	2.370967	0.42003	.	.	ENSG00000115596	ENST00000233948	T	0.75704	-0.96	4.61	2.77	0.32553	.	0.172009	0.40818	N	0.001003	T	0.74321	0.3701	L	0.39514	1.22	0.40266	D	0.978233	D	0.61697	0.99	D	0.64410	0.925	T	0.71203	-0.4662	10	0.48119	T	0.1	.	4.2403	0.10645	0.1625:0.5944:0.1572:0.0858	.	130	Q9Y6F9	WNT6_HUMAN	M	130	ENSP00000233948:L130M	ENSP00000233948:L130M	L	+	1	2	WNT6	219444537	0.955000	0.32602	1.000000	0.80357	0.990000	0.78478	0.185000	0.16958	0.376000	0.24707	0.486000	0.48141	CTG		0.756	WNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256727.2	NM_006522		Missense_Mutation
CUL3	8452	broad.mit.edu	37	2	225400349	225400349	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr2:225400349C>G	ENST00000264414.4	-	3	612	c.274G>C	c.(274-276)Gat>Cat	p.D92H	CUL3_ENST00000344951.4_Missense_Mutation_p.D26H|CUL3_ENST00000409096.1_Missense_Mutation_p.D68H|CUL3_ENST00000432260.2_5'UTR|CUL3_ENST00000409777.1_Missense_Mutation_p.D68H	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	92					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)	p.D92H(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TTTAGTACATCTTCTCGCACC	0.343																																																1	Substitution - Missense(1)	ovary(1)	2											152.0	132.0	139.0					2																	225400349		2203	4298	6501	225108593	SO:0001583	missense	8452			U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.274G>C	2.37:g.225400349C>G	ENSP00000264414:p.Asp92His		225108593	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	ENST00000264414.4	37	CCDS2462.1	SNP	32	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.9|28.9	4.957586|4.957586	0.92726|0.92726	.|.	.|.	ENSG00000036257|ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777|ENST00000436172	T;T;T;T|.	0.32515|.	1.45;1.45;1.45;1.45|.	5.99|5.99	5.99|5.99	0.97316|0.97316	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70185|0.70185	0.3195|0.3195	L|L	0.45470|0.45470	1.425|1.425	0.80722|0.80722	D|D	1|1	D;D;D|.	0.71674|.	0.998;0.998;0.998|.	D;D;D|.	0.67900|.	0.922;0.954;0.954|.	T|T	0.63734|0.63734	-0.6570|-0.6570	10|5	0.45353|.	T|.	0.12|.	.|.	20.0728|20.0728	0.97731|0.97731	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	26;70;92|.	Q13618-3;Q53S54;Q13618|.	.;.;CUL3_HUMAN|.	H|T	92;26;68;68|112	ENSP00000264414:D92H;ENSP00000343601:D26H;ENSP00000387200:D68H;ENSP00000386525:D68H|.	ENSP00000264414:D92H|.	D|R	-|-	1|2	0|0	CUL3|CUL3	225108593|225108593	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.414000|7.414000	0.80117|0.80117	2.840000|2.840000	0.97914|0.97914	0.655000|0.655000	0.94253|0.94253	GAT|AGA		0.343	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2			Missense_Mutation
MC3R	4159	broad.mit.edu	37	20	54824097	54824097	+	Silent	SNP	C	C	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr20:54824097C>T	ENST00000243911.2	+	1	310	c.198C>T	c.(196-198)aaC>aaT	p.N66N		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	66					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.N103N(2)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			TGGTCAGGAACGGCAACCTGC	0.562																																																2	Substitution - coding silent(2)	ovary(1)|kidney(1)	20											90.0	72.0	79.0					20																	54824097		2203	4300	6503	54257504	SO:0001819	synonymous_variant	4159				CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.198C>T	20.37:g.54824097C>T			54257504	Q4KN27|Q9H517	Silent	SNP	ENST00000243911.2	37	CCDS13449.2	SNP	19	Broad																																																																																				0.562	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079786.2			Silent
DIDO1	11083	broad.mit.edu	37	20	61511133	61511133	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr20:61511133G>C	ENST00000266070.4	-	16	6500	c.6175C>G	c.(6175-6177)Ccc>Gcc	p.P2059A	DIDO1_ENST00000395343.1_Missense_Mutation_p.P2059A	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	2059					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P2059A(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TCGGCCTCGGGGCCCTGTCCG	0.687																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)											1	Substitution - Missense(1)	ovary(1)	20											61.0	70.0	67.0					20																	61511133		2008	3995	6003	60981578	SO:0001583	missense	11083			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.6175C>G	20.37:g.61511133G>C	ENSP00000266070:p.Pro2059Ala		60981578	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	9.793	1.178373	0.21787	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.08458	3.09;3.09	5.17	4.21	0.49690	.	0.362001	0.19929	N	0.102914	T	0.08492	0.0211	L	0.47716	1.5	0.47441	D	0.999421	B	0.11235	0.004	B	0.08055	0.003	T	0.12811	-1.0533	10	0.28530	T	0.3	-13.5474	10.3664	0.44026	0.0751:0.1337:0.7912:0.0	.	2059	Q9BTC0	DIDO1_HUMAN	A	2059	ENSP00000266070:P2059A;ENSP00000378752:P2059A	ENSP00000266070:P2059A	P	-	1	0	DIDO1	60981578	0.794000	0.28838	0.906000	0.35671	0.446000	0.32137	1.728000	0.38105	2.404000	0.81709	0.655000	0.94253	CCC		0.687	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		Missense_Mutation
NCAM2	4685	broad.mit.edu	37	21	22841054	22841054	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr21:22841054C>A	ENST00000400546.1	+	14	2095	c.1846C>A	c.(1846-1848)Cag>Aag	p.Q616K	NCAM2_ENST00000284894.7_Missense_Mutation_p.Q474K	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	616	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q616K(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		CATCACCAAACAGGACGATGG	0.373																																																1	Substitution - Missense(1)	ovary(1)	21											119.0	115.0	116.0					21																	22841054		1871	4092	5963	21762925	SO:0001583	missense	4685				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.1846C>A	21.37:g.22841054C>A	ENSP00000383392:p.Gln616Lys		21762925	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	17.84	3.486883	0.63962	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.53206	0.63;0.63	5.75	5.75	0.90469	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.051969	0.85682	D	0.000000	T	0.60894	0.2304	L	0.37630	1.12	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.69824	0.966;0.966	T	0.60352	-0.7280	10	0.56958	D	0.05	-11.128	18.5071	0.90901	0.0:1.0:0.0:0.0	.	474;616	B7Z5K2;O15394	.;NCAM2_HUMAN	K	616;474	ENSP00000383392:Q616K;ENSP00000284894:Q474K	ENSP00000284894:Q474K	Q	+	1	0	NCAM2	21762925	1.000000	0.71417	0.996000	0.52242	0.018000	0.09664	6.971000	0.76105	2.716000	0.92895	0.655000	0.94253	CAG		0.373	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540		Missense_Mutation
COL6A2	1292	broad.mit.edu	37	21	47545812	47545812	+	Missense_Mutation	SNP	G	G	C	rs377376395		TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr21:47545812G>C	ENST00000300527.4	+	26	2187	c.2083G>C	c.(2083-2085)Gag>Cag	p.E695Q	COL6A2_ENST00000357838.4_Missense_Mutation_p.E695Q|COL6A2_ENST00000397763.1_Missense_Mutation_p.E695Q|COL6A2_ENST00000409416.1_Missense_Mutation_p.E695Q|COL6A2_ENST00000310645.5_Missense_Mutation_p.E695Q	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	695	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)		p.E695Q(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CAAGAACCTCGAGTGGATTGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	21											74.0	67.0	70.0					21																	47545812		2203	4300	6503	46370240	SO:0001583	missense	1292			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2083G>C	21.37:g.47545812G>C	ENSP00000300527:p.Glu695Gln		46370240	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	CCDS13728.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	15.97	2.990794	0.54041	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06	4.21	4.21	0.49690	von Willebrand factor, type A (3);	0.052830	0.64402	D	0.000001	T	0.77685	0.4167	N	0.17838	0.53	0.80722	D	1	P;D;D	0.76494	0.932;0.999;0.997	P;D;D	0.75484	0.703;0.986;0.954	T	0.72394	-0.4307	10	0.09590	T	0.72	-24.9483	16.5536	0.84479	0.0:0.0:1.0:0.0	.	695;695;695	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	Q	695	ENSP00000300527:E695Q;ENSP00000350497:E695Q;ENSP00000312529:E695Q;ENSP00000387115:E695Q;ENSP00000380870:E695Q	ENSP00000300527:E695Q	E	+	1	0	COL6A2	46370240	1.000000	0.71417	0.994000	0.49952	0.776000	0.43924	7.742000	0.85008	1.889000	0.54706	0.491000	0.48974	GAG		0.607	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1			Missense_Mutation
SF3A1	10291	broad.mit.edu	37	22	30731718	30731718	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr22:30731718C>A	ENST00000215793.8	-	14	2285	c.2131G>T	c.(2131-2133)Gtg>Ttg	p.V711L	SF3A1_ENST00000439242.1_Missense_Mutation_p.V646L	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	711	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V711L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						ATGTTGGGCACCTGGACTTTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	22											214.0	156.0	175.0					22																	30731718		2203	4300	6503	29061718	SO:0001583	missense	10291			X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.2131G>T	22.37:g.30731718C>A	ENSP00000215793:p.Val711Leu		29061718	E9PAW1	Missense_Mutation	SNP	ENST00000215793.8	37	CCDS13875.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317246	0.81469	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049	T;T	0.35236	1.32;1.32	5.12	5.12	0.69794	Ubiquitin supergroup (1);	0.000000	0.85682	D	0.000000	T	0.50137	0.1598	L	0.46157	1.445	0.80722	D	1	B	0.28880	0.226	P	0.48114	0.567	T	0.42799	-0.9430	10	0.33141	T	0.24	-25.925	18.7515	0.91818	0.0:1.0:0.0:0.0	.	711	Q15459	SF3A1_HUMAN	L	646;711;608	ENSP00000390336:V646L;ENSP00000215793:V711L	ENSP00000215793:V711L	V	-	1	0	SF3A1	29061718	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.320000	0.79064	2.667000	0.90743	0.655000	0.94253	GTG		0.537	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877		Missense_Mutation
TUBGCP6	85378	broad.mit.edu	37	22	50659452	50659452	+	Silent	SNP	G	G	A	rs368660390	byFrequency	TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr22:50659452G>A	ENST00000248846.5	-	16	3440	c.3336C>T	c.(3334-3336)aaC>aaT	p.N1112N	TUBGCP6_ENST00000439308.2_Silent_p.N1112N|TUBGCP6_ENST00000491449.1_5'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1112	9 X 27 AA tandem repeats.				G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.N1112N(1)		breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TGATGCTGGCGTTGGACACAT	0.607													G|||	2	0.000399361	0.0	0.0	5008	,	,		23973	0.002		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	22						A		0,4406		0,0,2203	183.0	179.0	181.0		3336	-9.9	0.0	22		181	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	TUBGCP6	NM_020461.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		1112/1820	50659452	2,13004	2203	4300	6503	49001579	SO:0001819	synonymous_variant	85378			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.3336C>T	22.37:g.50659452G>A			49001579	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Silent	SNP	ENST00000248846.5	37	CCDS14087.1	SNP	40	Broad																																																																																				0.607	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461		Silent
BSN	8927	broad.mit.edu	37	3	49700363	49700363	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr3:49700363G>A	ENST00000296452.4	+	7	10886	c.10772G>A	c.(10771-10773)cGc>cAc	p.R3591H		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3591					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.R3591H(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CGGGATGCCCGCTCTGACCGG	0.612																																																1	Substitution - Missense(1)	ovary(1)	3											61.0	61.0	61.0					3																	49700363		2203	4300	6503	49675367	SO:0001583	missense	8927			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.10772G>A	3.37:g.49700363G>A	ENSP00000296452:p.Arg3591His		49675367	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	13.15	2.151041	0.38021	.	.	ENSG00000164061	ENST00000296452	T	0.28454	1.61	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.36276	0.0961	M	0.69358	2.11	0.58432	D	0.999999	P	0.52577	0.954	B	0.39706	0.307	T	0.43766	-0.9371	10	0.87932	D	0	-9.1184	18.932	0.92570	0.0:0.0:1.0:0.0	.	3591	Q9UPA5	BSN_HUMAN	H	3591	ENSP00000296452:R3591H	ENSP00000296452:R3591H	R	+	2	0	BSN	49675367	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.853000	0.86934	2.573000	0.86826	0.655000	0.94253	CGC		0.612	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458		Missense_Mutation
ITIH1	3697	broad.mit.edu	37	3	52812454	52812454	+	Silent	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr3:52812454C>A	ENST00000273283.2	+	3	261	c.237C>A	c.(235-237)gcC>gcA	p.A79A	ITIH1_ENST00000537050.1_5'Flank|ITIH1_ENST00000540715.1_5'Flank|ITIH1_ENST00000542827.1_Silent_p.A79A	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	79	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A79A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		TCAACACTGCCAATGAAGCCA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	3											151.0	143.0	146.0					3																	52812454		2203	4300	6503	52787494	SO:0001819	synonymous_variant	3697				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.237C>A	3.37:g.52812454C>A			52787494	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Silent	SNP	ENST00000273283.2	37	CCDS2864.1	SNP	21	Broad																																																																																				0.547	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215		Silent
ZNF654	55279	broad.mit.edu	37	3	88188630	88188630	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr3:88188630C>T	ENST00000309495.5	+	1	377	c.170C>T	c.(169-171)gCt>gTt	p.A57V	CGGBP1_ENST00000462901.1_Intron	NM_018293.2	NP_060763.2	Q8IZM8	ZN654_HUMAN	zinc finger protein 654	57					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A18V(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(3)	12		Lung NSC(201;0.0283)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		CAGCAAATTGCTGCAGCTCAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	3											87.0	87.0	87.0					3																	88188630		1894	4109	6003	88271320	SO:0001583	missense	55279			AF543494	CCDS46874.1	3p11.1	2005-01-10			ENSG00000175105	ENSG00000175105			25612	protein-coding gene	gene with protein product							Standard	NM_018293		Approved	FLJ10997, FLJ21142	uc003dqv.3	Q8IZM8	OTTHUMG00000159097	ENST00000309495.5:c.170C>T	3.37:g.88188630C>T	ENSP00000312141:p.Ala57Val		88271320	Q9H791|Q9NV14	Missense_Mutation	SNP	ENST00000309495.5	37	CCDS46874.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981286	0.53827	.	.	ENSG00000175105	ENST00000309495	T	0.11063	2.81	5.42	5.42	0.78866	.	1.116960	0.06558	N	0.746224	T	0.15609	0.0376	L	0.29908	0.895	0.40517	D	0.980791	P	0.48589	0.912	P	0.45310	0.476	T	0.33394	-0.9870	10	0.32370	T	0.25	.	18.2814	0.90099	0.0:1.0:0.0:0.0	.	57	Q8IZM8	ZN654_HUMAN	V	57	ENSP00000312141:A57V	ENSP00000312141:A57V	A	+	2	0	ZNF654	88271320	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.704000	0.74639	2.565000	0.86533	0.549000	0.68633	GCT		0.358	ZNF654-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353285.2	NM_018293		Missense_Mutation
KIAA1524	57650	broad.mit.edu	37	3	108282018	108282018	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr3:108282018C>G	ENST00000295746.8	-	13	1665	c.1589G>C	c.(1588-1590)aGa>aCa	p.R530T	KIAA1524_ENST00000487834.1_5'UTR|KIAA1524_ENST00000491772.1_Missense_Mutation_p.R371T	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	530					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R530T(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CAATAATATTCTCAGTCCAGA	0.393																																																1	Substitution - Missense(1)	ovary(1)	3											154.0	159.0	158.0					3																	108282018		2203	4300	6503	109764708	SO:0001583	missense	57650			AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.1589G>C	3.37:g.108282018C>G	ENSP00000295746:p.Arg530Thr		109764708	A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Missense_Mutation	SNP	ENST00000295746.8	37	CCDS33812.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	12.70	2.016313	0.35606	.	.	ENSG00000163507	ENST00000491772;ENST00000295746	T;T	0.34275	1.37;1.37	5.3	4.43	0.53597	.	0.494865	0.23127	N	0.051633	T	0.31295	0.0792	L	0.53249	1.67	0.37420	D	0.913588	P	0.35684	0.515	B	0.29267	0.1	T	0.32824	-0.9892	10	0.49607	T	0.09	-4.6479	11.7182	0.51666	0.0:0.8541:0.0:0.1459	.	530	Q8TCG1	CIP2A_HUMAN	T	371;530	ENSP00000419487:R371T;ENSP00000295746:R530T	ENSP00000295746:R530T	R	-	2	0	KIAA1524	109764708	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.617000	0.46385	1.237000	0.43756	0.563000	0.77884	AGA		0.393	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353975.2	NM_020890		Missense_Mutation
GOLGB1	2804	broad.mit.edu	37	3	121410361	121410361	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr3:121410361G>A	ENST00000340645.5	-	14	7960	c.7835C>T	c.(7834-7836)tCc>tTc	p.S2612F	GOLGB1_ENST00000393667.3_Missense_Mutation_p.S2617F	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2612					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.S2612F(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TGTTAGCTGGGATATAGATAC	0.388																																																1	Substitution - Missense(1)	ovary(1)	3											83.0	85.0	84.0					3																	121410361		2203	4300	6503	122893051	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.7835C>T	3.37:g.121410361G>A	ENSP00000341848:p.Ser2612Phe		122893051	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	5.232	0.228349	0.09916	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.16597	2.33;2.33	4.88	4.88	0.63580	.	0.218895	0.32640	N	0.005827	T	0.33904	0.0879	L	0.60455	1.87	0.26572	N	0.973545	P;P;P	0.51791	0.948;0.948;0.925	P;P;P	0.57720	0.826;0.826;0.568	T	0.06679	-1.0813	10	0.66056	D	0.02	.	15.5762	0.76387	0.0:0.0:1.0:0.0	.	2617;2617;2612	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	F	2612;2617	ENSP00000341848:S2612F;ENSP00000377275:S2617F	ENSP00000341848:S2612F	S	-	2	0	GOLGB1	122893051	0.903000	0.30736	0.339000	0.25562	0.181000	0.23173	5.158000	0.64917	2.520000	0.84964	0.655000	0.94253	TCC		0.388	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487		Missense_Mutation
FETUB	26998	broad.mit.edu	37	3	186358839	186358839	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr3:186358839C>G	ENST00000265029.3	+	2	347	c.246C>G	c.(244-246)ttC>ttG	p.F82L	FETUB_ENST00000382136.3_Intron|FETUB_ENST00000539949.1_Intron|RP11-134F2.2_ENST00000455926.1_RNA|FETUB_ENST00000450521.1_Missense_Mutation_p.F82L|FETUB_ENST00000488561.1_Intron|RP11-134F2.2_ENST00000428501.1_RNA|FETUB_ENST00000382134.3_Intron	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	82	Cystatin fetuin-B-type 1. {ECO:0000255|PROSITE-ProRule:PRU00862}.				binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)	p.F82L(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		GATCTCTGTTCTATCTTACAC	0.448																																																1	Substitution - Missense(1)	ovary(1)	3											94.0	86.0	88.0					3																	186358839		2203	4300	6503	187841533	SO:0001583	missense	26998			AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.246C>G	3.37:g.186358839C>G	ENSP00000265029:p.Phe82Leu		187841533	B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Missense_Mutation	SNP	ENST00000265029.3	37	CCDS3279.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243793	0.79912	.	.	ENSG00000090512	ENST00000450521;ENST00000265029	T;T	0.15603	2.41;2.41	5.64	4.77	0.60923	Proteinase inhibitor I25C, fetuin, conserved site (1);Proteinase inhibitor I25, cystatin (2);	0.296855	0.29838	N	0.011073	T	0.33962	0.0881	M	0.68952	2.095	0.80722	D	1	D	0.67145	0.996	P	0.60117	0.869	T	0.08472	-1.0720	10	0.72032	D	0.01	-19.3447	10.6138	0.45439	0.0:0.912:0.0:0.088	.	82	Q9UGM5	FETUB_HUMAN	L	82	ENSP00000404288:F82L;ENSP00000265029:F82L	ENSP00000265029:F82L	F	+	3	2	FETUB	187841533	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	0.984000	0.29565	1.537000	0.49254	0.655000	0.94253	TTC		0.448	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344679.1	NM_014375		Missense_Mutation
MAEA	10296	broad.mit.edu	37	4	1305928	1305928	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr4:1305928G>C	ENST00000303400.4	+	2	294	c.231G>C	c.(229-231)aaG>aaC	p.K77N	MAEA_ENST00000264750.6_Missense_Mutation_p.K77N|MAEA_ENST00000505839.1_Missense_Mutation_p.K29N|MAEA_ENST00000510794.1_Missense_Mutation_p.K76N|MAEA_ENST00000514708.1_Missense_Mutation_p.K77N|MAEA_ENST00000505177.2_Missense_Mutation_p.K77N|MAEA_ENST00000452175.2_Missense_Mutation_p.K66N	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	77	Extracellular and involved in cell to cell contact.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)	p.K77N(1)		NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	TGGTGGAGAAGCTCAGCGTCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	4											38.0	40.0	40.0					4																	1305928		2203	4300	6503	1295928	SO:0001583	missense	10296			AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.231G>C	4.37:g.1305928G>C	ENSP00000302830:p.Lys77Asn		1295928	O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	ENST00000303400.4	37	CCDS33936.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896969	0.72639	.	.	ENSG00000090316	ENST00000303400;ENST00000505177;ENST00000503653;ENST00000264750;ENST00000382947;ENST00000539495;ENST00000502558;ENST00000452175;ENST00000514708;ENST00000510794;ENST00000512842;ENST00000505839	T;T;T;T;T;T;T;T	0.56444	0.72;0.63;0.52;0.49;0.53;0.68;0.46;0.7	5.94	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.73305	0.3570	M	0.88640	2.97	0.29951	N	0.820206	D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.998;0.999;0.993	D;D;D;D;D;D	0.78314	0.974;0.98;0.991;0.968;0.989;0.943	T	0.72934	-0.4141	10	0.72032	D	0.01	-13.0273	8.894	0.35453	0.3009:0.0:0.6991:0.0	.	76;77;77;77;77;77	B4DVN3;E7ESC7;Q7L5Y9-2;D6RIB6;Q7L5Y9-3;Q7L5Y9	.;.;.;.;.;MAEA_HUMAN	N	77;77;77;77;77;56;77;66;77;76;29;29	ENSP00000302830:K77N;ENSP00000422215:K77N;ENSP00000421644:K77N;ENSP00000264750:K77N;ENSP00000426903:K77N;ENSP00000411415:K66N;ENSP00000427512:K77N;ENSP00000426807:K76N	ENSP00000264750:K77N	K	+	3	2	MAEA	1295928	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.349000	0.33998	0.788000	0.33755	-0.312000	0.09012	AAG		0.632	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	NM_005882		Missense_Mutation
PDGFRA	5156	broad.mit.edu	37	4	55138615	55138615	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr4:55138615A>G	ENST00000257290.5	+	9	1623	c.1292A>G	c.(1291-1293)cAg>cGg	p.Q431R	FIP1L1_ENST00000507166.1_Intron	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	431	Ig-like C2-type 5.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.Q431R(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	ACTGGGGGACAGACGGTGAGG	0.473			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	1	Substitution - Missense(1)	ovary(1)	4											158.0	144.0	148.0					4																	55138615		2203	4300	6503	54833372	SO:0001583	missense	5156	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.1292A>G	4.37:g.55138615A>G	ENSP00000257290:p.Gln431Arg		54833372	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	CCDS3495.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	18.85	3.710332	0.68730	.	.	ENSG00000134853	ENST00000257290	T	0.77358	-1.09	6.17	6.17	0.99709	.	0.000000	0.30781	U	0.008885	D	0.85353	0.5677	M	0.79258	2.445	0.80722	D	1	D;P	0.55605	0.972;0.749	P;B	0.58721	0.844;0.424	T	0.82577	-0.0388	10	0.15952	T	0.53	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	431;431	P16234-3;P16234	.;PGFRA_HUMAN	R	431	ENSP00000257290:Q431R	ENSP00000257290:Q431R	Q	+	2	0	PDGFRA	54833372	1.000000	0.71417	0.965000	0.40720	0.008000	0.06430	7.670000	0.83925	2.371000	0.80710	0.533000	0.62120	CAG		0.473	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206		Missense_Mutation
TACR3	6870	broad.mit.edu	37	4	104511133	104511133	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr4:104511133C>G	ENST00000304883.2	-	5	1244	c.1104G>C	c.(1102-1104)aaG>aaC	p.K368N	RP11-297P16.3_ENST00000502936.1_RNA|RP11-297P16.3_ENST00000512401.1_RNA	NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	368					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)	p.K368N(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		GAAATGCTCTCTTGAAGCCAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	4											67.0	67.0	67.0					4																	104511133		2203	4300	6503	104730582	SO:0001583	missense	6870			M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.1104G>C	4.37:g.104511133C>G	ENSP00000303325:p.Lys368Asn		104730582	Q0P510	Missense_Mutation	SNP	ENST00000304883.2	37	CCDS3664.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	19.55	3.847919	0.71603	.	.	ENSG00000169836	ENST00000304883	T	0.42900	0.96	5.81	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.64034	0.2562	M	0.85373	2.75	0.52099	D	0.999948	D	0.76494	0.999	D	0.68765	0.96	T	0.66775	-0.5838	10	0.45353	T	0.12	.	10.0621	0.42282	0.0:0.8489:0.0:0.1511	.	368	P29371	NK3R_HUMAN	N	368	ENSP00000303325:K368N	ENSP00000303325:K368N	K	-	3	2	TACR3	104730582	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.143000	0.31553	1.460000	0.47911	0.591000	0.81541	AAG		0.428	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059		Missense_Mutation
MFSD8	256471	broad.mit.edu	37	4	128863278	128863278	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr4:128863278C>T	ENST00000296468.3	-	6	602	c.475G>A	c.(475-477)Gct>Act	p.A159T	MFSD8_ENST00000541133.1_Missense_Mutation_p.A114T|MFSD8_ENST00000515130.1_5'UTR|MFSD8_ENST00000513559.1_Missense_Mutation_p.A114T	NM_152778.2	NP_689991.1	Q8NHS3	MFSD8_HUMAN	major facilitator superfamily domain containing 8	159					cell death (GO:0008219)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)		p.A159T(1)		cervix(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)	23						AGGGAAGTAGCACCAGCAGTA	0.358																																																1	Substitution - Missense(1)	ovary(1)	4											188.0	167.0	174.0					4																	128863278		2203	4300	6503	129082728	SO:0001583	missense	256471			AK074564	CCDS3736.1	4q28.2	2014-09-17			ENSG00000164073	ENSG00000164073			28486	protein-coding gene	gene with protein product		611124	"""ceroid-lipofuscinosis, neuronal 7, late infantile, variant"""	CLN7		17564970	Standard	NM_152778		Approved	MGC33302	uc003ifp.3	Q8NHS3	OTTHUMG00000133303	ENST00000296468.3:c.475G>A	4.37:g.128863278C>T	ENSP00000296468:p.Ala159Thr		129082728	B2RDM1|B7Z205|Q8N2P3	Missense_Mutation	SNP	ENST00000296468.3	37	CCDS3736.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	14.93	2.683278	0.47991	.	.	ENSG00000164073	ENST00000296468;ENST00000513559;ENST00000541133	T;T;T	0.58060	0.36;0.36;0.36	4.86	4.86	0.63082	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.69628	0.3132	M	0.74258	2.255	0.80722	D	1	B;D	0.71674	0.412;0.998	B;D	0.63957	0.25;0.92	T	0.66360	-0.5943	10	0.22706	T	0.39	-7.7445	18.1934	0.89813	0.0:1.0:0.0:0.0	.	114;159	B7Z2B2;Q8NHS3	.;MFSD8_HUMAN	T	159;114;114	ENSP00000296468:A159T;ENSP00000425000:A114T;ENSP00000439616:A114T	ENSP00000296468:A159T	A	-	1	0	MFSD8	129082728	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	6.693000	0.74582	2.518000	0.84900	0.563000	0.77884	GCT		0.358	MFSD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257097.1	NM_152778		Missense_Mutation
TBCA	6902	broad.mit.edu	37	5	76989143	76989143	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr5:76989143G>C	ENST00000380377.4	-	3	297	c.194C>G	c.(193-195)cCa>cGa	p.P65R	TBCA_ENST00000517881.1_5'UTR|TBCA_ENST00000518338.2_Missense_Mutation_p.P88R|TBCA_ENST00000520361.1_Intron|TBCA_ENST00000517679.1_Missense_Mutation_p.P76R|TBCA_ENST00000520039.1_3'UTR|TBCA_ENST00000306388.6_Missense_Mutation_p.P65R|TBCA_ENST00000522370.1_Missense_Mutation_p.P41R	NM_004607.2	NP_004598.1	O75347	TBCA_HUMAN	tubulin folding cofactor A	65					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tubulin complex assembly (GO:0007021)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	chaperone binding (GO:0051087)|poly(A) RNA binding (GO:0044822)	p.P65R(1)		kidney(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_lung(232;0.000511)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.02e-49)|Epithelial(54;1.05e-44)|all cancers(79;4.08e-40)		CTGGCAATCTGGGATCATCAT	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											74.0	71.0	72.0					5																	76989143		2203	4300	6503	77024899	SO:0001583	missense	6902			AF038952	CCDS4040.1, CCDS75263.1	5q14.1	2008-02-05	2006-11-21		ENSG00000171530	ENSG00000171530			11579	protein-coding gene	gene with protein product		610058	"""tubulin-specific chaperone a"""			9653160, 8706133	Standard	XM_005248586		Approved		uc003kfh.1	O75347	OTTHUMG00000102173	ENST00000380377.4:c.194C>G	5.37:g.76989143G>C	ENSP00000369736:p.Pro65Arg		77024899	B4DT30	Missense_Mutation	SNP	ENST00000380377.4	37	CCDS4040.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504376	0.85176	.	.	ENSG00000171530	ENST00000380377;ENST00000517679;ENST00000306388;ENST00000522370	.	.	.	5.46	5.46	0.80206	.	0.050633	0.85682	D	0.000000	D	0.84986	0.5594	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.985;0.996	D	0.86517	0.1813	9	0.62326	D	0.03	-12.7764	19.6694	0.95905	0.0:0.0:1.0:0.0	.	65;65	B4DT30;O75347	.;TBCA_HUMAN	R	65;76;65;41	.	ENSP00000306362:P65R	P	-	2	0	TBCA	77024899	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.531000	0.81973	2.719000	0.93026	0.650000	0.86243	CCA		0.403	TBCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220021.3	NM_004607		Missense_Mutation
APC	324	broad.mit.edu	37	5	112175577	112175577	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr5:112175577A>G	ENST00000457016.1	+	16	4666	c.4286A>G	c.(4285-4287)cAa>cGa	p.Q1429R	APC_ENST00000508376.2_Missense_Mutation_p.Q1429R|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.Q1429R			P25054	APC_HUMAN	adenomatous polyposis coli	1429	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1429fs*8(4)|p.Y1376fs*41(1)|p.T1430fs*43(1)|p.?(1)|p.P1424fs*19(1)|p.S1411fs*41(1)|p.K1192fs*3(1)|p.Q1429R(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGCCCTGGACAAACCATGCCA	0.473		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	11	Deletion - Frameshift(9)|Substitution - Missense(1)|Unknown(1)	large_intestine(8)|ovary(1)|soft_tissue(1)|skin(1)	5											108.0	98.0	101.0					5																	112175577		2202	4300	6502	112203476	SO:0001583	missense	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4286A>G	5.37:g.112175577A>G	ENSP00000413133:p.Gln1429Arg		112203476	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	22.2	4.262844	0.80358	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.93488	-3.23;-3.23;-3.23	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.95862	0.8653	M	0.64404	1.975	0.58432	D	0.999999	D;D	0.63880	0.993;0.993	D;D	0.70227	0.968;0.968	D	0.95380	0.8472	9	.	.	.	-14.8813	16.6288	0.85011	1.0:0.0:0.0:0.0	.	1431;1429	Q4LE70;P25054	.;APC_HUMAN	R	1429	ENSP00000413133:Q1429R;ENSP00000257430:Q1429R;ENSP00000427089:Q1429R	.	Q	+	2	0	APC	112203476	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.326000	0.78906	0.533000	0.62120	CAA		0.473	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		Missense_Mutation
MCC	4163	broad.mit.edu	37	5	112487091	112487091	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr5:112487091T>A	ENST00000302475.4	-	2	649	c.86A>T	c.(85-87)aAg>aTg	p.K29M	MCC_ENST00000515367.2_De_novo_Start_InFrame|MCC_ENST00000514701.3_5'UTR|MCC_ENST00000408903.3_Missense_Mutation_p.K219M	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	29					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.K29M(1)|p.K219M(1)		endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		TATATCTCCCTTTAGTGATGC	0.468																																																2	Substitution - Missense(2)	ovary(2)	5											90.0	81.0	84.0					5																	112487091		2202	4300	6502	112514990	SO:0001583	missense	4163				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.86A>T	5.37:g.112487091T>A	ENSP00000305617:p.Lys29Met		112514990	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000302475.4	37	CCDS4111.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	15.21	2.765087	0.49574	.	.	ENSG00000171444	ENST00000302475;ENST00000408903	T;T	0.79749	-1.3;0.89	5.25	4.1	0.47936	.	0.132653	0.52532	D	0.000067	T	0.76314	0.3970	N	0.19112	0.55	0.41867	D	0.990253	P;D;P	0.54964	0.799;0.969;0.799	B;P;B	0.55999	0.397;0.789;0.397	T	0.77405	-0.2600	10	0.72032	D	0.01	-38.5269	8.1987	0.31411	0.0:0.1523:0.0:0.8477	.	29;219;29	B7Z6G0;P23508-2;P23508	.;.;CRCM_HUMAN	M	29;219	ENSP00000305617:K29M;ENSP00000386227:K219M	ENSP00000305617:K29M	K	-	2	0	MCC	112514990	1.000000	0.71417	0.997000	0.53966	0.971000	0.66376	2.637000	0.46553	1.034000	0.39945	0.459000	0.35465	AAG		0.468	MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250736.3	NM_001085377		Missense_Mutation
SLC4A9	83697	broad.mit.edu	37	5	139743706	139743706	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr5:139743706C>G	ENST00000230993.6	+	10	1429	c.1394C>G	c.(1393-1395)cCc>cGc	p.P465R	SLC4A9_ENST00000507527.1_Missense_Mutation_p.P465R|SLC4A9_ENST00000506757.2_Missense_Mutation_p.P441R|SLC4A9_ENST00000506545.1_Missense_Mutation_p.P441R|SLC4A9_ENST00000432095.2_Missense_Mutation_p.P430R	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	465	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.P439R(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGGCCAGCCCCTCACCATT	0.622																																																1	Substitution - Missense(1)	ovary(1)	5											25.0	28.0	27.0					5																	139743706		1921	4124	6045	139723890	SO:0001583	missense	83697			AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.1394C>G	5.37:g.139743706C>G	ENSP00000230993:p.Pro465Arg		139723890	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Missense_Mutation	SNP	ENST00000230993.6	37	CCDS58973.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	17.04	3.286654	0.59867	.	.	ENSG00000113073	ENST00000230993;ENST00000506757;ENST00000432095;ENST00000506545;ENST00000507527	D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46	4.79	4.79	0.61399	Bicarbonate transporter, C-terminal (1);	0.087877	0.48767	D	0.000172	D	0.95990	0.8694	M	0.93978	3.48	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.994;0.995;0.991;0.991	D	0.96891	0.9653	10	0.87932	D	0	.	18.4108	0.90550	0.0:1.0:0.0:0.0	.	441;465;430;441	E9PDK1;Q96Q91;Q96Q91-2;Q96Q91-3	.;B3A4_HUMAN;.;.	R	465;441;430;441;465	ENSP00000230993:P465R;ENSP00000424424:P441R;ENSP00000410056:P430R;ENSP00000422855:P441R;ENSP00000427661:P465R	ENSP00000230993:P465R	P	+	2	0	SLC4A9	139723890	1.000000	0.71417	1.000000	0.80357	0.097000	0.18754	7.651000	0.83577	2.675000	0.91044	0.462000	0.41574	CCC		0.622	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372823.1	NM_031467		Missense_Mutation
APBB3	10307	broad.mit.edu	37	5	139941196	139941196	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr5:139941196A>T	ENST00000357560.4	-	8	1166	c.723T>A	c.(721-723)agT>agA	p.S241R	APBB3_ENST00000354402.5_Missense_Mutation_p.S248R|APBB3_ENST00000507279.1_5'Flank|APBB3_ENST00000356738.2_Missense_Mutation_p.S246R|SLC35A4_ENST00000323146.3_5'Flank|APBB3_ENST00000358580.5_Missense_Mutation_p.S241R|APBB3_ENST00000508496.2_Missense_Mutation_p.S18R|APBB3_ENST00000511201.2_Missense_Mutation_p.S239R|APBB3_ENST00000412920.3_Missense_Mutation_p.S239R	NM_006051.3|NM_133173.2	NP_006042.3|NP_573419.2	O95704	APBB3_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 3	241	PID 1. {ECO:0000255|PROSITE- ProRule:PRU00148}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S248R(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATGTAGGGCACTGGCAATGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	5											128.0	122.0	124.0					5																	139941196		2203	4300	6503	139921380	SO:0001583	missense	10307			AB018247	CCDS4227.1, CCDS4228.1, CCDS4229.1, CCDS47279.1	5q31	2008-02-05			ENSG00000113108	ENSG00000113108			20708	protein-coding gene	gene with protein product		602711				9407065	Standard	NM_133172		Approved	FE65L2	uc003lgd.1	O95704	OTTHUMG00000129504	ENST00000357560.4:c.723T>A	5.37:g.139941196A>T	ENSP00000350171:p.Ser241Arg		139921380	B3KQN9|Q08AG4|Q96Q18|Q9BYD4|Q9NYX6|Q9NYX7|Q9NYX8	Missense_Mutation	SNP	ENST00000357560.4	37	CCDS4229.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	15.89	2.966031	0.53507	.	.	ENSG00000113108	ENST00000358580;ENST00000356738;ENST00000354402;ENST00000357560;ENST00000508496;ENST00000412920;ENST00000511201	T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92	5.99	5.99	0.97316	.	0.325064	0.38272	N	0.001759	T	0.23727	0.0574	L	0.44542	1.39	0.51012	D	0.999902	P;P;P	0.49783	0.88;0.855;0.928	P;B;P	0.47402	0.468;0.359;0.546	T	0.11792	-1.0573	9	.	.	.	-14.8831	3.3031	0.06990	0.6421:0.1537:0.074:0.1302	.	239;239;246	D6RBA1;O95704-2;O95704-3	.;.;.	R	241;246;248;241;18;239;239	ENSP00000351389:S241R;ENSP00000349177:S246R;ENSP00000346378:S248R;ENSP00000350171:S241R;ENSP00000444013:S18R;ENSP00000402591:S239R;ENSP00000424317:S239R	.	S	-	3	2	APBB3	139921380	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	0.461000	0.21940	2.291000	0.77112	0.533000	0.62120	AGT		0.542	APBB3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251677.2	NM_006051		Missense_Mutation
PCDHB11	56125	broad.mit.edu	37	5	140579766	140579766	+	Missense_Mutation	SNP	T	T	C	rs553664559		TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr5:140579766T>C	ENST00000354757.3	+	1	419	c.419T>C	c.(418-420)cTa>cCa	p.L140P	PCDHB11_ENST00000536699.1_Intron	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	140	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L140P(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAAATGCTCCTAGAAATCCCA	0.413													T|||	1	0.000199681	0.0	0.0	5008	,	,		19361	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	5											124.0	138.0	133.0					5																	140579766		2203	4300	6503	140559950	SO:0001583	missense	56125			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.419T>C	5.37:g.140579766T>C	ENSP00000346802:p.Leu140Pro		140559950	B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	CCDS4253.1	SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	T	19.68	3.873711	0.72180	.	.	ENSG00000197479	ENST00000354757	T	0.21932	1.98	2.7	1.55	0.23275	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.60741	0.2292	H	0.99130	4.44	0.26550	N	0.973934	D	0.89917	1.0	D	0.91635	0.999	T	0.53114	-0.8484	9	0.87932	D	0	.	7.7183	0.28717	0.0:0.1175:0.0:0.8825	.	140	Q9Y5F2	PCDBB_HUMAN	P	140	ENSP00000346802:L140P	ENSP00000346802:L140P	L	+	2	0	PCDHB11	140559950	0.634000	0.27190	0.014000	0.15608	0.990000	0.78478	4.577000	0.60922	1.226000	0.43582	0.383000	0.25322	CTA		0.413	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		Missense_Mutation
PCDHGA10	56106	broad.mit.edu	37	5	140793949	140793949	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr5:140793949G>C	ENST00000398610.2	+	1	1207	c.1207G>C	c.(1207-1209)Gac>Cac	p.D403H	PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	403	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAGTCCATTGACAGTTATTA	0.428																																																0			5											82.0	83.0	83.0					5																	140793949		1902	4118	6020	140774133	SO:0001583	missense	56106				CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.1207G>C	5.37:g.140793949G>C	ENSP00000381611:p.Asp403His		140774133	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	37	CCDS47292.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	g	11.24	1.581803	0.28180	.	.	ENSG00000253846	ENST00000398610	T	0.52057	0.68	5.42	4.55	0.56014	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.68412	0.2998	M	0.85197	2.74	0.09310	N	1	D;D	0.63880	0.993;0.989	D;P	0.63877	0.919;0.897	T	0.61510	-0.7048	9	0.72032	D	0.01	.	10.8163	0.46578	0.1535:0.0:0.8465:0.0	.	403;403	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	H	403	ENSP00000381611:D403H	ENSP00000381611:D403H	D	+	1	0	PCDHGA10	140774133	0.000000	0.05858	0.048000	0.18961	0.805000	0.45488	0.656000	0.24948	1.271000	0.44313	0.650000	0.86243	GAC		0.428	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913		Missense_Mutation
CAGE1	285782	broad.mit.edu	37	6	7373686	7373686	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr6:7373686G>A	ENST00000512086.1	-	5	1568	c.1366C>T	c.(1366-1368)Caa>Taa	p.Q456*	CAGE1_ENST00000379918.4_Nonsense_Mutation_p.Q456*|CAGE1_ENST00000338150.4_Nonsense_Mutation_p.Q456*|CAGE1_ENST00000502583.1_Nonsense_Mutation_p.Q456*|CAGE1_ENST00000509324.1_5'Flank|CAGE1_ENST00000296742.7_Nonsense_Mutation_p.Q320*			Q8TC20	CAGE1_HUMAN	cancer antigen 1	456								p.Q456*(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|lung(11)|urinary_tract(1)	19	Ovarian(93;0.0418)					TTGAGTTGTTGTAGTCTCTCT	0.378																																																1	Substitution - Nonsense(1)	ovary(1)	6											131.0	113.0	118.0					6																	7373686		1827	4079	5906	7318685	SO:0001587	stop_gained	285782			BC026194	CCDS47367.1, CCDS54964.1, CCDS54965.1	6p24.3	2009-08-06	2005-01-26	2005-01-27	ENSG00000164304	ENSG00000164304			21622	protein-coding gene	gene with protein product	"""cancer/testis antigen 95"""	608304	"""cancer/testis antigen 3"""	CTAG3		12531476	Standard	NM_205864		Approved	bA69L16.7, CT95	uc003mxl.2	Q8TC20	OTTHUMG00000014200	ENST00000512086.1:c.1366C>T	6.37:g.7373686G>A	ENSP00000427583:p.Gln456*		7318685	D6RCT9|Q5TAM0|Q86TM4|Q8N7R5	Nonsense_Mutation	SNP	ENST00000512086.1	37		SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	18.50	3.638460	0.67130	.	.	ENSG00000164304	ENST00000541116;ENST00000379918;ENST00000502583;ENST00000296742;ENST00000512086;ENST00000338150;ENST00000542431;ENST00000512691	.	.	.	5.66	4.79	0.61399	.	0.205925	0.34386	N	0.004017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-4.4108	12.0709	0.53616	0.0:0.0:0.828:0.172	.	.	.	.	X	456;456;456;320;456;456;456;468	.	ENSP00000296742:Q320X	Q	-	1	0	CAGE1	7318685	0.922000	0.31269	0.249000	0.24280	0.009000	0.06853	1.910000	0.39927	1.377000	0.46286	0.591000	0.81541	CAA		0.378	CAGE1-008	PUTATIVE	non_canonical_conserved|basic	protein_coding	protein_coding	OTTHUMT00000367136.1	NM_175745		Nonsense_Mutation
NOTCH4	4855	broad.mit.edu	37	6	32163801	32163801	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr6:32163801G>T	ENST00000375023.3	-	30	5563	c.5425C>A	c.(5425-5427)Caa>Aaa	p.Q1809K	GPSM3_ENST00000375043.3_5'Flank|NOTCH4_ENST00000443903.2_Missense_Mutation_p.P185Q	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1809					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.Q1809K(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TGGTTACGTTGGTGAGCGACG	0.716																																																1	Substitution - Missense(1)	ovary(1)	6											9.0	12.0	11.0					6																	32163801		1401	2638	4039	32271779	SO:0001583	missense	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.5425C>A	6.37:g.32163801G>T	ENSP00000364163:p.Gln1809Lys		32271779	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	SNP	47	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.65|18.65	3.670545|3.670545	0.67814|0.67814	.|.	.|.	ENSG00000204301|ENSG00000204301	ENST00000443903|ENST00000375023	T|T	0.71461|0.70986	-0.57|-0.53	4.71|4.71	4.71|4.71	0.59529|0.59529	.|Ankyrin repeat-containing domain (3);	.|0.182554	.|0.26605	.|N	.|0.023447	T|T	0.51126|0.51126	0.1656|0.1656	L|L	0.52206|0.52206	1.635|1.635	0.28394|0.28394	N|N	0.918934|0.918934	P|B;B	0.37015|0.24483	0.578|0.034;0.104	B|B;B	0.33042|0.27076	0.157|0.076;0.039	T|T	0.53041|0.53041	-0.8494|-0.8494	9|10	0.30854|0.72032	T|D	0.27|0.01	.|.	11.2479|11.2479	0.49008|0.49008	0.0:0.1851:0.8149:0.0|0.0:0.1851:0.8149:0.0	.|.	185|1809;1808	B4DFM3|Q99466;B0S882	.|NOTC4_HUMAN;.	Q|K	185|1809	ENSP00000398123:P185Q|ENSP00000364163:Q1809K	ENSP00000398123:P185Q|ENSP00000364163:Q1809K	P|Q	-|-	2|1	0|0	NOTCH4|NOTCH4	32271779|32271779	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.066000|0.066000	0.16364|0.16364	3.760000|3.760000	0.55235|0.55235	2.598000|2.598000	0.87819|0.87819	0.563000|0.563000	0.77884|0.77884	CCA|CAA		0.716	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			Missense_Mutation
MDN1	23195	broad.mit.edu	37	6	90368337	90368337	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr6:90368337G>A	ENST00000369393.3	-	89	15128	c.15013C>T	c.(15013-15015)Cag>Tag	p.Q5005*	MDN1_ENST00000428876.1_Nonsense_Mutation_p.Q5005*			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	5005					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.Q5005*(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ACCTGGGGCTGGAAACCTTGG	0.458																																																1	Substitution - Nonsense(1)	ovary(1)	6											191.0	170.0	177.0					6																	90368337		2203	4300	6503	90425058	SO:0001587	stop_gained	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.15013C>T	6.37:g.90368337G>A	ENSP00000358400:p.Gln5005*		90425058	O15019|Q5T794	Nonsense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	55	25.090295	0.99963	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	.	.	.	5.37	4.44	0.53790	.	0.153390	0.43416	D	0.000579	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	7.4868	0.27439	0.0793:0.0:0.6494:0.2713	.	.	.	.	X	5005	.	ENSP00000358400:Q5005X	Q	-	1	0	MDN1	90425058	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	2.602000	0.46257	2.667000	0.90743	0.561000	0.74099	CAG		0.458	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			Nonsense_Mutation
ASL	435	broad.mit.edu	37	7	65557600	65557600	+	Silent	SNP	C	C	G	rs370291313		TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr7:65557600C>G	ENST00000304874.9	+	16	1302	c.1200C>G	c.(1198-1200)acC>acG	p.T400T	ASL_ENST00000380839.4_Silent_p.T374T|AC068533.7_ENST00000450043.1_Missense_Mutation_p.Q169E|ASL_ENST00000395331.3_Silent_p.T380T|ASL_ENST00000464970.1_3'UTR|ASL_ENST00000395332.3_Silent_p.T400T	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	400					arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)			breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	TGGCCGAGACCAAGGGGGTCG	0.632																																																0			7						C	,,,	0,4406		0,0,2203	69.0	69.0	69.0		1200,1200,1140,1122	1.4	0.9	7		69	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ASL	NM_000048.3,NM_001024943.1,NM_001024944.1,NM_001024946.1	,,,	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	,,,	400/465,400/465,380/445,374/439	65557600	1,13005	2203	4300	6503	65195035	SO:0001819	synonymous_variant	435				CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.1200C>G	7.37:g.65557600C>G			65195035	E7EMI0|E9PE48|Q6LDS5|Q96HS2	Silent	SNP	ENST00000304874.9	37	CCDS5531.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	c	8.640	0.895847	0.17686	0.0	1.16E-4	ENSG00000249319	ENST00000450043	.	.	.	5.28	1.37	0.22104	.	.	.	.	.	T	0.45135	0.1327	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21827	-1.0234	4	.	.	.	.	3.238	0.06771	0.1224:0.5511:0.1187:0.2078	.	.	.	.	E	169	.	.	Q	+	1	0	AC068533.7	65195035	0.874000	0.30092	0.921000	0.36526	0.872000	0.50106	-0.099000	0.11007	0.034000	0.15491	0.491000	0.48974	CAA		0.632	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251695.2	NM_000048		Silent
CPED1	79974	broad.mit.edu	37	7	120767266	120767266	+	Silent	SNP	A	A	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr7:120767266A>T	ENST00000310396.5	+	10	1724	c.1257A>T	c.(1255-1257)atA>atT	p.I419I	CPED1_ENST00000423795.1_Silent_p.I199I|CPED1_ENST00000450913.2_Silent_p.I419I	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	419						endoplasmic reticulum (GO:0005783)		p.I419I(1)									CACTTTCCATATTTTCTGAGA	0.289																																																1	Substitution - coding silent(1)	ovary(1)	7											88.0	94.0	92.0					7																	120767266		2200	4294	6494	120554502	SO:0001819	synonymous_variant	79974				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.1257A>T	7.37:g.120767266A>T			120554502	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Silent	SNP	ENST00000310396.5	37	CCDS34739.1	SNP	16	Broad																																																																																				0.289	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		Silent
TAS2R40	259286	broad.mit.edu	37	7	142919714	142919714	+	Silent	SNP	G	G	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr7:142919714G>A	ENST00000408947.3	+	1	585	c.543G>A	c.(541-543)acG>acA	p.T181T	AC073342.1_ENST00000595842.1_5'Flank	NM_176882.1	NP_795363.1	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	181					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.T181T(1)		kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8	Melanoma(164;0.059)					CCAACTCCACGGAGAAGAAGT	0.458																																																1	Substitution - coding silent(1)	ovary(1)	7											141.0	132.0	135.0					7																	142919714		1912	4129	6041	142629836	SO:0001819	synonymous_variant	259286			AF494229	CCDS43662.1	7q34	2012-08-22	2003-12-16		ENSG00000221937	ENSG00000221937		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18885	protein-coding gene	gene with protein product		613964	"""G protein-coupled receptor 60"""	GPR60		12379855	Standard	NM_176882		Approved		uc011ksx.2	P59535	OTTHUMG00000152638	ENST00000408947.3:c.543G>A	7.37:g.142919714G>A			142629836	A4D2I2|Q645W6	Silent	SNP	ENST00000408947.3	37	CCDS43662.1	SNP	39	Broad																																																																																				0.458	TAS2R40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327097.1			Silent
DCTN6	10671	broad.mit.edu	37	8	30032648	30032648	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr8:30032648G>A	ENST00000221114.3	+	3	223	c.136G>A	c.(136-138)Ggg>Agg	p.G46R	DCTN6_ENST00000520829.1_Missense_Mutation_p.G46R|RP11-51J9.4_ENST00000523733.1_RNA	NM_006571.3	NP_006562.1	O00399	DCTN6_HUMAN	dynactin 6	46					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|kinetochore (GO:0000776)		p.G46R(1)		endometrium(1)|lung(1)|ovary(1)|prostate(1)	4				KIRC - Kidney renal clear cell carcinoma(542;0.099)|Kidney(114;0.119)		TGCGGAAGCCGGGCCAATAGT	0.428																																																1	Substitution - Missense(1)	ovary(1)	8											54.0	51.0	52.0					8																	30032648		2203	4300	6503	30152190	SO:0001583	missense	10671			D84145	CCDS6076.1	8p12-p11	2003-03-20			ENSG00000104671	ENSG00000104671			16964	protein-coding gene	gene with protein product		612963				9168138	Standard	NM_006571		Approved	WS-3	uc003xhy.3	O00399	OTTHUMG00000163828	ENST00000221114.3:c.136G>A	8.37:g.30032648G>A	ENSP00000221114:p.Gly46Arg		30152190	B2RAC1	Missense_Mutation	SNP	ENST00000221114.3	37	CCDS6076.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953855	0.73902	.	.	ENSG00000104671	ENST00000221114;ENST00000520829	.	.	.	5.32	5.32	0.75619	Trimeric LpxA-like (1);	0.049868	0.85682	D	0.000000	D	0.84991	0.5595	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87723	0.2574	8	.	.	.	-15.2584	16.4948	0.84237	0.0:0.0:1.0:0.0	.	46	O00399	DCTN6_HUMAN	R	46	.	.	G	+	1	0	DCTN6	30152190	1.000000	0.71417	0.964000	0.40570	0.355000	0.29361	8.277000	0.89896	2.474000	0.83562	0.655000	0.94253	GGG		0.428	DCTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375815.2	NM_006571		Missense_Mutation
RB1CC1	9821	broad.mit.edu	37	8	53555017	53555017	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr8:53555017C>A	ENST00000025008.5	-	18	4754	c.4231G>T	c.(4231-4233)Gga>Tga	p.G1411*	RB1CC1_ENST00000435644.2_Nonsense_Mutation_p.G1411*|RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Nonsense_Mutation_p.G1411*	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1411					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.G1411*(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				GCACAAGCTCCATAAAGTTCT	0.443																																					GBM(180;1701 2102 13475 42023 52570)											1	Substitution - Nonsense(1)	ovary(1)	8											126.0	120.0	122.0					8																	53555017		2203	4300	6503	53717570	SO:0001587	stop_gained	9821			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4231G>T	8.37:g.53555017C>A	ENSP00000025008:p.Gly1411*		53717570	Q86YR4|Q8WVU9|Q92601	Nonsense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	48	14.502656	0.99798	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	.	.	.	5.55	5.55	0.83447	.	0.058105	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-27.5906	18.4711	0.90774	0.0:1.0:0.0:0.0	.	.	.	.	X	1411	.	ENSP00000025008:G1411X	G	-	1	0	RB1CC1	53717570	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.348000	0.59379	2.596000	0.87737	0.655000	0.94253	GGA		0.443	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781		Nonsense_Mutation
CSMD3	114788	broad.mit.edu	37	8	113277815	113277815	+	Silent	SNP	G	G	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr8:113277815G>T	ENST00000297405.5	-	60	9757	c.9513C>A	c.(9511-9513)atC>atA	p.I3171I	CSMD3_ENST00000352409.3_Silent_p.I3101I|CSMD3_ENST00000455883.2_Silent_p.I3002I|CSMD3_ENST00000343508.3_Silent_p.I3131I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3171	Sushi 24. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I3171I(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTCCACAACTGATTACTGTCA	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - coding silent(1)	ovary(1)	8											136.0	118.0	124.0					8																	113277815		2203	4300	6503	113346991	SO:0001819	synonymous_variant	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9513C>A	8.37:g.113277815G>T			113346991	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1	SNP	45	Broad																																																																																				0.408	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		Silent
DENND4C	55667	broad.mit.edu	37	9	19346478	19346478	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr9:19346478T>G	ENST00000380432.2	+	18	2889	c.2856T>G	c.(2854-2856)atT>atG	p.I952M	DENND4C_ENST00000602925.1_Missense_Mutation_p.I1188M|DENND4C_ENST00000434457.2_Missense_Mutation_p.I1237M			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	952					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.I952M(1)		breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TATATGGTATTGCTAAGGTGG	0.378																																																1	Substitution - Missense(1)	ovary(1)	9											77.0	77.0	77.0					9																	19346478		2203	4300	6503	19336478	SO:0001583	missense	55667			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.2856T>G	9.37:g.19346478T>G	ENSP00000369797:p.Ile952Met		19336478	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	ENST00000380432.2	37		SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	11.02	1.516501	0.27123	.	.	ENSG00000137145	ENST00000380437;ENST00000307015;ENST00000453857;ENST00000540671;ENST00000380432;ENST00000380427	T;T	0.23348	1.91;1.91	5.81	0.553	0.17235	.	1.023860	0.07795	N	0.955599	T	0.12178	0.0296	N	0.08118	0	0.09310	N	1	B;B;B;B	0.23806	0.007;0.091;0.071;0.055	B;B;B;B	0.25987	0.012;0.065;0.009;0.018	T	0.32981	-0.9886	10	0.59425	D	0.04	-5.6612	2.1049	0.03688	0.1211:0.1645:0.3935:0.3209	.	282;952;134;952	B7Z660;Q5VZ89-5;Q5VZ89-3;Q5VZ89	.;.;.;DEN4C_HUMAN	M	952;425;134;282;425;134	ENSP00000305795:I425M;ENSP00000443804:I282M	ENSP00000305795:I425M	I	+	3	3	DENND4C	19336478	0.004000	0.15560	0.816000	0.32577	0.829000	0.46940	0.072000	0.14617	0.436000	0.26393	0.528000	0.53228	ATT		0.378	DENND4C-201	KNOWN	basic	protein_coding	protein_coding		NM_017925		Missense_Mutation
UNC13B	10497	broad.mit.edu	37	9	35386219	35386219	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr9:35386219G>T	ENST00000378495.3	+	23	2998	c.2776G>T	c.(2776-2778)Gcc>Tcc	p.A926S	UNC13B_ENST00000378496.4_Missense_Mutation_p.A926S|UNC13B_ENST00000396787.1_Missense_Mutation_p.A938S	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	926					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.A926S(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TTGTGTGAAGGCCTGTTTGAA	0.493																																																1	Substitution - Missense(1)	ovary(1)	9											80.0	82.0	81.0					9																	35386219		2203	4300	6503	35376219	SO:0001583	missense	10497			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.2776G>T	9.37:g.35386219G>T	ENSP00000367756:p.Ala926Ser		35376219	Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	37	CCDS6579.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	29.7	5.032331	0.93575	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	D;D;D	0.85484	-1.87;-1.8;-1.99	4.86	4.86	0.63082	Calcium-dependent secretion activator (1);	0.047161	0.85682	D	0.000000	D	0.92528	0.7627	M	0.85373	2.75	0.80722	D	1	D;D	0.59767	0.972;0.986	P;D	0.63283	0.737;0.913	D	0.93261	0.6643	10	0.62326	D	0.03	-14.5671	18.5513	0.91066	0.0:0.0:1.0:0.0	.	926;926	F8W8M9;O14795	.;UN13B_HUMAN	S	938;926;926;513	ENSP00000380006:A938S;ENSP00000367756:A926S;ENSP00000367757:A926S	ENSP00000367756:A926S	A	+	1	0	UNC13B	35376219	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.492000	0.97957	2.683000	0.91414	0.655000	0.94253	GCC		0.493	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377		Missense_Mutation
OR1N2	138882	broad.mit.edu	37	9	125316167	125316167	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr9:125316167G>T	ENST00000373688.2	+	1	777	c.719G>T	c.(718-720)tGg>tTg	p.W240L		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W240L(1)		breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						CGCATTTTCTGGGCTGTGTTT	0.502																																																1	Substitution - Missense(1)	ovary(1)	9											248.0	237.0	241.0					9																	125316167		2203	4300	6503	124355988	SO:0001583	missense	138882				CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.719G>T	9.37:g.125316167G>T	ENSP00000362792:p.Trp240Leu		124355988	A3KFM2|B2RNY4|Q6IF17|Q96RA3	Missense_Mutation	SNP	ENST00000373688.2	37	CCDS35123.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	2.408	-0.336035	0.05278	.	.	ENSG00000171501	ENST00000373688	T	0.34472	1.36	4.56	0.172	0.15031	GPCR, rhodopsin-like superfamily (1);	1.787910	0.03970	N	0.291485	T	0.14743	0.0356	N	0.01019	-1.045	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.23440	-1.0188	10	0.62326	D	0.03	.	7.3249	0.26549	0.1839:0.529:0.2871:0.0	.	240	Q8NGR9	OR1N2_HUMAN	L	240	ENSP00000362792:W240L	ENSP00000362792:W240L	W	+	2	0	OR1N2	124355988	0.000000	0.05858	0.003000	0.11579	0.940000	0.58332	-2.749000	0.00793	0.162000	0.19483	0.644000	0.83932	TGG		0.502	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2			Missense_Mutation
PMPCA	23203	broad.mit.edu	37	9	139311576	139311576	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chr9:139311576G>C	ENST00000371717.3	+	7	816	c.807G>C	c.(805-807)aaG>aaC	p.K269N	PMPCA_ENST00000462616.1_3'UTR|PMPCA_ENST00000399219.3_Missense_Mutation_p.K138N	NM_001282946.1|NM_015160.1	NP_001269875.1|NP_055975.1	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	269					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.K269N(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	14		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		GTGCCCGGAAGTACCTCCTGG	0.632																																																1	Substitution - Missense(1)	ovary(1)	9											37.0	34.0	35.0					9																	139311576		2203	4299	6502	138431397	SO:0001583	missense	23203			D21064	CCDS35180.1, CCDS65192.1	9q34.3	2008-02-05	2003-06-13	2003-06-20	ENSG00000165688	ENSG00000165688			18667	protein-coding gene	gene with protein product		613036	"""inositol polyphosphate-5-phosphatase, 72 kD"""	INPP5E		8590280, 7788527	Standard	NM_015160		Approved	KIAA0123, Alpha-MPP	uc004chl.3	Q10713	OTTHUMG00000020926	ENST00000371717.3:c.807G>C	9.37:g.139311576G>C	ENSP00000360782:p.Lys269Asn		138431397	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	ENST00000371717.3	37	CCDS35180.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	15.67	2.902034	0.52227	.	.	ENSG00000165688	ENST00000371717;ENST00000399219	T;T	0.11385	2.78;2.78	5.81	2.35	0.29111	Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.147481	0.64402	D	0.000016	T	0.23330	0.0564	M	0.68317	2.08	0.38162	D	0.939062	P;D;D	0.54207	0.932;0.965;0.965	P;P;P	0.57371	0.599;0.819;0.819	T	0.05550	-1.0878	10	0.62326	D	0.03	.	11.2159	0.48825	0.2:0.0:0.8:0.0	.	138;269;269	B4DKL3;Q5SXM9;Q10713	.;.;MPPA_HUMAN	N	269;138	ENSP00000360782:K269N;ENSP00000416702:K138N	ENSP00000360782:K269N	K	+	3	2	PMPCA	138431397	0.648000	0.27313	0.233000	0.24025	0.382000	0.30200	0.832000	0.27490	0.725000	0.32318	0.609000	0.83330	AAG		0.632	PMPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055054.1	NM_015160		Missense_Mutation
GPR82	27197	broad.mit.edu	37	X	41586609	41586609	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chrX:41586609A>C	ENST00000302548.4	+	3	570	c.330A>C	c.(328-330)ttA>ttC	p.L110F	CASK_ENST00000378158.1_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000378163.1_Intron|CASK_ENST00000378154.1_Intron|CASK_ENST00000442742.2_Intron	NM_080817.4	NP_543007.1	Q96P67	GPR82_HUMAN	G protein-coupled receptor 82	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L110F(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	10						TCTTAATTTTAAGTTGGATTG	0.383																																																2	Substitution - Missense(2)	ovary(2)	X											62.0	58.0	59.0					X																	41586609		2203	4300	6503	41471553	SO:0001583	missense	27197			AF411111	CCDS14259.1	Xp11.4	2012-08-21			ENSG00000171657	ENSG00000171657		"""GPCR / Class A : Orphans"""	4533	protein-coding gene	gene with protein product		300748				11574155	Standard	NM_080817		Approved		uc004dft.3	Q96P67	OTTHUMG00000021373	ENST00000302548.4:c.330A>C	X.37:g.41586609A>C	ENSP00000303549:p.Leu110Phe		41471553	Q5VT13	Missense_Mutation	SNP	ENST00000302548.4	37	CCDS14259.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	15.28	2.787659	0.49997	.	.	ENSG00000171657	ENST00000302548	T	0.81415	-1.49	5.55	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45867	D	0.000337	D	0.86062	0.5843	M	0.68593	2.085	0.37142	D	0.901749	D	0.89917	1.0	D	0.91635	0.999	D	0.85660	0.1288	10	0.87932	D	0	-9.0894	7.1889	0.25814	0.7411:0.0:0.2589:0.0	.	110	Q96P67	GPR82_HUMAN	F	110	ENSP00000303549:L110F	ENSP00000303549:L110F	L	+	3	2	GPR82	41471553	0.985000	0.35326	0.992000	0.48379	0.966000	0.64601	0.919000	0.28692	0.254000	0.21573	0.486000	0.48141	TTA		0.383	GPR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056261.1	NM_080817		Missense_Mutation
GSPT2	23708	broad.mit.edu	37	X	51486770	51486770	+	Silent	SNP	C	C	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2024-01	TCGA-24-2024-11	g.chrX:51486770C>T	ENST00000340438.4	+	1	290	c.48C>T	c.(46-48)gaC>gaT	p.D16D		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	16					cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.D16D(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					ATTGCTGGGACCAGGTGGACA	0.682																																																1	Substitution - coding silent(1)	ovary(1)	X											23.0	26.0	25.0					X																	51486770		2202	4288	6490	51503510	SO:0001819	synonymous_variant	23708			AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	ENST00000340438.4:c.48C>T	X.37:g.51486770C>T			51503510	Q9H909|Q9NVY0|Q9NY44	Silent	SNP	ENST00000340438.4	37	CCDS14336.1	SNP	18	Broad																																																																																				0.682	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056587.1			Silent
TMOD2	29767	broad.mit.edu	37	15	52090499	52090499	+	Frame_Shift_Del	DEL	G	G	-			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-2024-01	TCGA-24-2024-11	g.chr15:52090499delG	ENST00000249700.4	+	8	1059	c.838delG	c.(838-840)gaafs	p.E280fs	TMOD2_ENST00000435126.2_Frame_Shift_Del_p.E244fs|TMOD2_ENST00000539962.2_Frame_Shift_Del_p.E236fs	NM_001142885.1|NM_014548.3	NP_001136357.1|NP_055363.1	Q9NZR1	TMOD2_HUMAN	tropomodulin 2 (neuronal)	280					learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuron-neuron synaptic transmission (GO:0007270)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)	tropomyosin binding (GO:0005523)	p.E280fs*5(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16				all cancers(107;0.00435)		GGCACTGAAAGAAAATGACAC	0.453																																																1	Deletion - Frameshift(1)	ovary(1)	15											76.0	68.0	71.0					15																	52090499		2195	4293	6488	49877791	SO:0001589	frameshift_variant	29767			AF177169	CCDS10144.1, CCDS45260.1	15q21.2	2008-05-14			ENSG00000128872	ENSG00000128872			11872	protein-coding gene	gene with protein product		602928				10662549	Standard	NM_014548		Approved	NTMOD	uc002abk.3	Q9NZR1	OTTHUMG00000131805	ENST00000249700.4:c.838delG	15.37:g.52090499delG	ENSP00000249700:p.Glu280fs		49877791	B4DEW6	Frame_Shift_Del	DEL	ENST00000249700.4	37	CCDS10144.1	DEL	33	Broad																																																																																				0.453	TMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254742.2			Frame_Shift_Del
MLLT6	4302	broad.mit.edu	37	17	36872810	36872812	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-2024-01	TCGA-24-2024-11	g.chr17:36872810_36872812delCTC	ENST00000325718.7	+	10	1318_1320	c.1227_1229delCTC	c.(1225-1230)ttctcc>ttc	p.S410del	CTB-58E17.9_ENST00000579499.1_RNA	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	410					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					TCATGCGCTTCTCCACCACCACC	0.66			T	MLL	AL																																		Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	0			17																																								34126338	SO:0001651	inframe_deletion	4302				CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.1227_1229delCTC	17.37:g.36872810_36872812delCTC	ENSP00000316426:p.Ser410del		34126336	Q59F28|Q96IU3|Q9H5F6|Q9UF49	In_Frame_Del	DEL	ENST00000325718.7	37	CCDS11327.1	DEL	32	Broad																																																																																				0.660	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937		In_Frame_Del
BAAT	570	broad.mit.edu	37	9	104130402	104130403	+	Splice_Site	INS	-	-	T			TCGA-24-2024-01	TCGA-24-2024-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-2024-01	TCGA-24-2024-11	g.chr9:104130402_104130403insT	ENST00000395051.3	-	2	738_739	c.668_669insA	c.(667-669)aag>aaAg	p.K223fs	BAAT_ENST00000259407.2_Splice_Site_p.K223fs			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	223					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)	p.V224fs*35(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	CAAAAATTACCTTTGGATGTCT	0.436																																																1	Insertion - Frameshift(1)	ovary(1)	9																																								103170224	SO:0001630	splice_region_variant	570			L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.669+1->A	9.37:g.104130405_104130405dupT			103170223	Q3B7W9|Q96L31	Frame_Shift_Ins	INS	ENST00000395051.3	37	CCDS6752.1	INS	24	Broad																																																																																				0.436	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053433.1		Frame_Shift_Ins	Frame_Shift_Ins
