#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CCNL2	81669	broad.mit.edu	37	1	1334552	1334552	+	Silent	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr1:1334552C>T	ENST00000400809.3	-	1	140	c.135G>A	c.(133-135)gtG>gtA	p.V45V	CCNL2_ENST00000408952.5_5'Flank|RP4-758J18.2_ENST00000444362.1_5'Flank|CCNL2_ENST00000408918.4_Silent_p.V45V|RP4-758J18.2_ENST00000576232.1_5'Flank|MRPL20_ENST00000493287.1_5'Flank|RP4-758J18.2_ENST00000448629.2_5'Flank	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	45					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.V45V(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		AGGTGATGAGCACCCCGGAGT	0.701																																																1	Substitution - coding silent(1)	ovary(1)	1											81.0	65.0	70.0					1																	1334552		2202	4300	6502	1324415	SO:0001819	synonymous_variant	81669			AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.135G>A	1.37:g.1334552C>T			1324415	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Silent	SNP	ENST00000400809.3	37	CCDS30557.1	SNP	25	Broad																																																																																				0.701	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008146.2	NM_030937		Silent
RWDD3	25950	broad.mit.edu	37	1	95709781	95709781	+	Missense_Mutation	SNP	G	G	C	rs369999943		TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr1:95709781G>C	ENST00000370202.4	+	2	176	c.100G>C	c.(100-102)Gtg>Ctg	p.V34L	RWDD3_ENST00000495272.1_3'UTR|RP11-57H12.6_ENST00000604534.1_Missense_Mutation_p.R194P|RWDD3_ENST00000429514.2_Missense_Mutation_p.V19L|RWDD3_ENST00000263893.6_Missense_Mutation_p.V34L|RP11-57H12.5_ENST00000444665.1_RNA	NM_001199682.1|NM_015485.4	NP_001186611.1|NP_056300	Q9Y3V2	RWDD3_HUMAN	RWD domain containing 3	34	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.				negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of hypoxia-inducible factor-1alpha signaling pathway (GO:1902073)|positive regulation of protein sumoylation (GO:0033235)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V34L(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)	10		all_epithelial(167;5.99e-05)|all_lung(203;0.00168)|Lung NSC(277;0.00769)		all cancers(265;0.112)|Epithelial(280;0.229)		AGATGGGACCGTGTTCAGAAT	0.388																																																1	Substitution - Missense(1)	ovary(1)	1											126.0	117.0	120.0					1																	95709781		1872	4104	5976	95482369	SO:0001583	missense	25950			BC010936	CCDS41357.1, CCDS44177.1	1p22.1	2012-12-07			ENSG00000122481	ENSG00000122481			21393	protein-coding gene	gene with protein product		615875				11230166	Standard	NM_015485		Approved	DKFZP566K023	uc009wdu.3	Q9Y3V2	OTTHUMG00000010910	ENST00000370202.4:c.100G>C	1.37:g.95709781G>C	ENSP00000359221:p.Val34Leu		95482369	A6NP44|A8K9F0|C9J9L7|C9JI45|Q08AJ7|Q6FID3|Q9BX35	Missense_Mutation	SNP	ENST00000370202.4	37	CCDS41357.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	11.84	1.757796	0.31137	.	.	ENSG00000122481	ENST00000370202;ENST00000429514;ENST00000263893	T;T;T	0.28895	1.95;1.59;1.95	5.27	1.12	0.20585	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (3);	0.395711	0.26665	N	0.023139	T	0.05868	0.0153	.	.	.	0.09310	N	1	B;B;B;B;B	0.32382	0.18;0.061;0.001;0.368;0.002	B;B;B;B;B	0.31495	0.088;0.066;0.009;0.131;0.005	T	0.25117	-1.0141	9	0.27785	T	0.31	-14.4099	3.738	0.08518	0.4068:0.0:0.3254:0.2678	.	19;34;34;19;34	E7ES73;Q9Y3V2;D3DT49;Q9Y3V2-3;Q9Y3V2-2	.;RWDD3_HUMAN;.;.;.	L	34;19;34	ENSP00000359221:V34L;ENSP00000397398:V19L;ENSP00000263893:V34L	ENSP00000263893:V34L	V	+	1	0	RWDD3	95482369	0.173000	0.23056	0.950000	0.38849	0.993000	0.82548	0.397000	0.20883	0.723000	0.32274	-0.143000	0.13931	GTG		0.388	RWDD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030078.1	NM_015485		Missense_Mutation
GJA8	2703	broad.mit.edu	37	1	147380369	147380369	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr1:147380369C>T	ENST00000369235.1	+	1	287	c.287C>T	c.(286-288)gCg>gTg	p.A96V	GJA8_ENST00000240986.4_Missense_Mutation_p.A96V			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	96					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)	p.A96V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					GTGGGGCACGCGGTGCACTAC	0.657																																					Melanoma(76;1255 1795 8195 52096)											1	Substitution - Missense(1)	ovary(1)	1											103.0	84.0	91.0					1																	147380369		2203	4300	6503	145846993	SO:0001583	missense	2703			U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.287C>T	1.37:g.147380369C>T	ENSP00000358238:p.Ala96Val		145846993	A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	ENST00000369235.1	37	CCDS30834.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	9.186	1.024704	0.19433	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.98958	-5.27;-5.27	5.2	5.2	0.72013	Connexin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96040	0.8710	N	0.10645	0.015	0.58432	D	0.999999	D	0.89917	1.0	D	0.66602	0.945	D	0.94268	0.7508	10	0.06236	T	0.91	.	18.721	0.91692	0.0:1.0:0.0:0.0	.	96	P48165	CXA8_HUMAN	V	96	ENSP00000240986:A96V;ENSP00000358238:A96V	ENSP00000240986:A96V	A	+	2	0	GJA8	145846993	1.000000	0.71417	0.666000	0.29783	0.648000	0.38561	6.020000	0.70826	2.409000	0.81822	0.491000	0.48974	GCG		0.657	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267		Missense_Mutation
CYB5R1	51706	broad.mit.edu	37	1	202932829	202932829	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr1:202932829G>A	ENST00000367249.4	-	7	660	c.586C>T	c.(586-588)Cgg>Tgg	p.R196W	CYB5R1_ENST00000497655.1_5'UTR	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	196					sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)	p.R196W(1)		breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	AGGATGGCCCGGATCAGCTGT	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											127.0	106.0	113.0					1																	202932829		2203	4300	6503	201199452	SO:0001583	missense	51706			AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.586C>T	1.37:g.202932829G>A	ENSP00000356218:p.Arg196Trp		201199452	A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	Missense_Mutation	SNP	ENST00000367249.4	37	CCDS1431.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284167	0.80803	.	.	ENSG00000159348	ENST00000367249	D	0.87571	-2.27	5.93	5.01	0.66863	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.351913	0.26026	N	0.026782	D	0.94450	0.8214	H	0.94698	3.57	0.50632	D	0.999884	D	0.76494	0.999	D	0.62955	0.909	D	0.95382	0.8474	10	0.87932	D	0	-5.8142	12.6473	0.56742	0.0795:0.0:0.9205:0.0	.	196	Q9UHQ9	NB5R1_HUMAN	W	196	ENSP00000356218:R196W	ENSP00000356218:R196W	R	-	1	2	CYB5R1	201199452	1.000000	0.71417	0.996000	0.52242	0.961000	0.63080	5.838000	0.69388	1.503000	0.48686	0.655000	0.94253	CGG		0.517	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099155.1	NM_016243		Missense_Mutation
FMN2	56776	broad.mit.edu	37	1	240371066	240371066	+	Missense_Mutation	SNP	G	G	C	rs141912031		TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr1:240371066G>C	ENST00000319653.9	+	5	3184	c.2954G>C	c.(2953-2955)gGc>gCc	p.G985A		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	985	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G1128A(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCCGGAGCGGGCATACCCCCT	0.716																																																1	Substitution - Missense(1)	ovary(1)	1											15.0	18.0	17.0					1																	240371066		2194	4276	6470	238437689	SO:0001583	missense	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2954G>C	1.37:g.240371066G>C	ENSP00000318884:p.Gly985Ala		238437689	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	7.211	0.595405	0.13875	.	.	ENSG00000155816	ENST00000319653	T	0.52526	0.66	3.42	2.45	0.29901	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (1);	.	.	.	.	T	0.34250	0.0891	L	0.28014	0.82	0.19775	N	0.999956	B	0.24920	0.114	B	0.23852	0.049	T	0.17379	-1.0371	8	.	.	.	.	12.728	0.57183	0.0:0.1673:0.8327:0.0	.	985	Q9NZ56	FMN2_HUMAN	A	985	ENSP00000318884:G985A	.	G	+	2	0	FMN2	238437689	0.358000	0.24947	0.002000	0.10522	0.026000	0.11368	1.720000	0.38022	0.756000	0.33013	0.472000	0.43445	GGC		0.716	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		Missense_Mutation
SKIDA1	387640	broad.mit.edu	37	10	21804259	21804259	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr10:21804259C>A	ENST00000449193.2	-	4	4745	c.2493G>T	c.(2491-2493)aaG>aaT	p.K831N	SKIDA1_ENST00000444772.3_Missense_Mutation_p.K752N	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	750						nucleus (GO:0005634)		p.K831N(1)									TGCTGGCTACCTTTTTGCGTC	0.403																																																1	Substitution - Missense(1)	ovary(1)	10											156.0	149.0	151.0					10																	21804259		1927	4131	6058	21844265	SO:0001583	missense	387640			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.2493G>T	10.37:g.21804259C>A	ENSP00000410041:p.Lys831Asn		21844265	B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	ENST00000449193.2	37	CCDS44363.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839661	0.51057	.	.	ENSG00000180592	ENST00000449193;ENST00000444772	.	.	.	5.64	5.64	0.86602	.	0.053060	0.64402	D	0.000001	T	0.45538	0.1347	N	0.14661	0.345	0.41018	D	0.985054	B	0.32245	0.361	B	0.30646	0.118	T	0.50101	-0.8867	9	0.72032	D	0.01	0.2383	20.0534	0.97636	0.0:1.0:0.0:0.0	.	831	E9PAX1	.	N	831;752	.	ENSP00000442432:K752N	K	-	3	2	C10orf140	21844265	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.916000	0.39986	2.821000	0.97095	0.655000	0.94253	AAG		0.403	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371		Missense_Mutation
LDB3	11155	broad.mit.edu	37	10	88459050	88459050	+	Silent	SNP	G	G	T	rs144445130	byFrequency	TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr10:88459050G>T	ENST00000372066.3	+	8	850	c.771G>T	c.(769-771)acG>acT	p.T257T	LDB3_ENST00000429277.2_Intron|LDB3_ENST00000458213.2_Intron|LDB3_ENST00000372056.4_Silent_p.T372T|LDB3_ENST00000542786.1_3'UTR|LDB3_ENST00000361373.4_Intron|LDB3_ENST00000263066.6_Intron|LDB3_ENST00000352360.5_Intron|LDB3_ENST00000310944.6_Silent_p.T304T	NM_001080116.1	NP_001073585.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						GGTTTGAAACGGAACGTAACA	0.483																																																0			10											159.0	169.0	166.0					10																	88459050		1923	4142	6065	88449030	SO:0001819	synonymous_variant	11155			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000372066.3:c.771G>T	10.37:g.88459050G>T			88449030		Silent	SNP	ENST00000372066.3	37	CCDS41545.1	SNP	39	Broad																																																																																				0.483	LDB3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049161.1			Silent
AGAP11	119385	broad.mit.edu	37	10	88769467	88769467	+	RNA	SNP	A	A	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr10:88769467A>T	ENST00000444431.1	+	0	4067				RP11-96C23.10_ENST00000451760.1_RNA|RP11-96C23.14_ENST00000444180.3_RNA|RP11-96C23.5_ENST00000433214.2_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										GTGGGGAGGGAGACGGCTGCA	0.672																																																0			10											20.0	25.0	23.0					10																	88769467		2074	4185	6259	88759447			119385					10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88769467A>T			88759447	B9EIP7|D3DWE4	Silent	SNP	ENST00000444431.1	37		SNP	11	Broad																																																																																				0.672	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000049193.1	NM_133447		Silent
C11orf40	143501	broad.mit.edu	37	11	4594547	4594547	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr11:4594547G>T	ENST00000307616.1	-	2	296	c.297C>A	c.(295-297)tgC>tgA	p.C99*		NM_144663.1	NP_653264.1	Q8WZ69	CK040_HUMAN	chromosome 11 open reading frame 40	99								p.C99*(1)		large_intestine(3)|lung(1)|ovary(2)|stomach(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;4.28e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		GTACCCTAAAGCAAGGTCTTT	0.488																																																1	Substitution - Nonsense(1)	ovary(1)	11											215.0	175.0	188.0					11																	4594547		2201	4298	6499	4551123	SO:0001587	stop_gained	143501				CCDS31354.1	11p15.5	2005-10-03			ENSG00000171987	ENSG00000171987			23986	protein-coding gene	gene with protein product							Standard	NM_144663		Approved	NOV1	uc010qyg.2	Q8WZ69	OTTHUMG00000165345	ENST00000307616.1:c.297C>A	11.37:g.4594547G>T	ENSP00000302918:p.Cys99*		4551123		Nonsense_Mutation	SNP	ENST00000307616.1	37	CCDS31354.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	7.892	0.732480	0.15507	.	.	ENSG00000171987	ENST00000307616	.	.	.	1.45	-1.97	0.07503	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999999	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	1.9769	0.03418	0.381:0.0:0.3577:0.2613	.	.	.	.	X	99	.	ENSP00000302918:C99X	C	-	3	2	C11orf40	4551123	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.424000	0.07025	-0.653000	0.05401	-0.718000	0.03613	TGC		0.488	C11orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383529.1	NM_144663		Nonsense_Mutation
TRIM3	10612	broad.mit.edu	37	11	6478209	6478209	+	Silent	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr11:6478209G>A	ENST00000525074.1	-	6	1141	c.747C>T	c.(745-747)ggC>ggT	p.G249G	TRIM3_ENST00000536344.1_Silent_p.G130G|TRIM3_ENST00000359518.3_Silent_p.G249G|TRIM3_ENST00000345851.3_Silent_p.G249G|TRIM3_ENST00000537602.1_Intron|TRIM3_ENST00000529058.1_5'UTR	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	249					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G249G(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCAGCTACTGCCGATGTGTT	0.647																																					Melanoma(6;5 510 1540 25169 29084)											1	Substitution - coding silent(1)	ovary(1)	11											55.0	57.0	56.0					11																	6478209		2201	4296	6497	6434785	SO:0001819	synonymous_variant	10612			AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.747C>T	11.37:g.6478209G>A			6434785	B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Silent	SNP	ENST00000525074.1	37	CCDS7764.1	SNP	46	Broad																																																																																				0.647	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384224.2	NM_006458		Silent
TTC17	55761	broad.mit.edu	37	11	43472793	43472793	+	Missense_Mutation	SNP	G	G	A	rs372683087|rs34999083		TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr11:43472793G>A	ENST00000039989.4	+	21	3022	c.3008G>A	c.(3007-3009)cGa>cAa	p.R1003Q		NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	1003					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.R1003Q(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						ATTGGCACCCGAATTGCCAAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	11						G	GLN/ARG	0,4406		0,0,2203	99.0	94.0	96.0		3008	5.8	1.0	11		96	1,8599	1.2+/-3.3	0,1,4299	no	missense	TTC17	NM_018259.5	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1003/1142	43472793	1,13005	2203	4300	6503	43429369	SO:0001583	missense	55761			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.3008G>A	11.37:g.43472793G>A	ENSP00000039989:p.Arg1003Gln		43429369	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	CCDS31466.1	SNP	37	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.343505|5.343505	0.95783|0.95783	0.0|0.0	1.16E-4|1.16E-4	ENSG00000052841|ENSG00000052841	ENST00000418561|ENST00000039989	.|T	.|0.36699	.|1.24	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.54208|0.54208	0.1844|0.1844	L|L	0.52573|0.52573	1.65|1.65	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.72625	.|0.978	T|T	0.34650|0.34650	-0.9820|-0.9820	5|10	.|0.24483	.|T	.|0.36	-9.1702|-9.1702	18.3318|18.3318	0.90271|0.90271	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1003	.|Q96AE7	.|TTC17_HUMAN	K|Q	22|1003	.|ENSP00000039989:R1003Q	.|ENSP00000039989:R1003Q	E|R	+|+	1|2	0|0	TTC17|TTC17	43429369|43429369	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.528000|8.528000	0.90598|0.90598	2.757000|2.757000	0.94681|0.94681	0.650000|0.650000	0.86243|0.86243	GAA|CGA		0.403	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259		Missense_Mutation
OR4D10	390197	broad.mit.edu	37	11	59245208	59245208	+	Silent	SNP	T	T	C			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr11:59245208T>C	ENST00000530162.1	+	1	363	c.306T>C	c.(304-306)ttT>ttC	p.F102F		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F100F(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CTCAGATGTTTCTATTCCACC	0.468																																																1	Substitution - coding silent(1)	ovary(1)	11											94.0	95.0	94.0					11																	59245208		2103	4240	6343	59001784	SO:0001819	synonymous_variant	390197			AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.306T>C	11.37:g.59245208T>C			59001784	B2RNH6	Silent	SNP	ENST00000530162.1	37	CCDS53636.1	SNP	62	Broad																																																																																				0.468	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394235.1	NM_001004705		Silent
ASRGL1	80150	broad.mit.edu	37	11	62124528	62124528	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr11:62124528C>G	ENST00000415229.2	+	4	618	c.403C>G	c.(403-405)Cct>Gct	p.P135A	ASRGL1_ENST00000301776.5_Missense_Mutation_p.P135A|ASRGL1_ENST00000528206.1_3'UTR|ASRGL1_ENST00000535727.1_Missense_Mutation_p.P7A	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1	135					asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)	p.P135A(1)		endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	TCCAGAGATTCCTGGAGAAAA	0.443																																																1	Substitution - Missense(1)	ovary(1)	11											58.0	66.0	63.0					11																	62124528		2202	4299	6501	61881104	SO:0001583	missense	80150				CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.403C>G	11.37:g.62124528C>G	ENSP00000400057:p.Pro135Ala		61881104	B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	Missense_Mutation	SNP	ENST00000415229.2	37	CCDS8019.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	c	14.54	2.566351	0.45694	.	.	ENSG00000162174	ENST00000415229;ENST00000535727;ENST00000301776	D;D;D	0.87334	-2.24;-2.18;-2.24	5.77	2.87	0.33458	.	0.154659	0.64402	N	0.000015	D	0.85813	0.5784	M	0.69823	2.125	0.43043	D	0.994633	B	0.24963	0.115	B	0.37091	0.241	T	0.77117	-0.2706	10	0.27082	T	0.32	-6.4881	7.3545	0.26711	0.0:0.7056:0.1399:0.1545	.	135	Q7L266	ASGL1_HUMAN	A	135;7;135	ENSP00000400057:P135A;ENSP00000443284:P7A;ENSP00000301776:P135A	ENSP00000301776:P135A	P	+	1	0	ASRGL1	61881104	1.000000	0.71417	0.030000	0.17652	0.280000	0.26924	4.255000	0.58804	0.362000	0.24319	0.552000	0.68991	CCT		0.443	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394865.1	NM_001083926		Missense_Mutation
C11orf30	56946	broad.mit.edu	37	11	76224579	76224579	+	Splice_Site	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr11:76224579G>A	ENST00000529032.1	+	9	1513	c.1513G>A	c.(1513-1515)Ggc>Agc	p.G505S	C11orf30_ENST00000533248.1_Splice_Site_p.G519S|C11orf30_ENST00000525919.1_Splice_Site_p.G506S|C11orf30_ENST00000524767.1_Splice_Site_p.G520S|C11orf30_ENST00000524490.1_Splice_Site_p.G421S|C11orf30_ENST00000525038.1_Splice_Site_p.G520S|C11orf30_ENST00000343878.3_Splice_Site_p.G505S|C11orf30_ENST00000334736.3_Splice_Site_p.G505S			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	505	Thr-rich.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						CACTCCTACTGGTAAGTTCTC	0.393																																																0			11											110.0	96.0	101.0					11																	76224579		2200	4292	6492	75902227	SO:0001630	splice_region_variant	56946			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.1513+1G>A	11.37:g.76224579G>A			75902227	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	CCDS8244.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295813	0.81025	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000533972;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032;ENST00000531998	.	.	.	5.19	5.19	0.71726	.	0.050192	0.85682	D	0.000000	T	0.58722	0.2142	L	0.27053	0.805	0.80722	D	1	D;D;D;P;D;P	0.61080	0.957;0.957;0.957;0.91;0.989;0.91	P;P;P;B;P;B	0.58331	0.461;0.461;0.461;0.388;0.837;0.388	T	0.51148	-0.8742	9	0.09590	T	0.72	-3.8621	18.7323	0.91739	0.0:0.0:1.0:0.0	.	519;520;520;506;421;505	B7ZKT8;B7ZKU2;B7ZKU0;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;EMSY_HUMAN	S	421;505;505;74;520;519;506;520;505;47	.	ENSP00000334130:G505S	G	+	1	0	C11orf30	75902227	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.790000	0.99075	2.437000	0.82529	0.655000	0.94253	GGC		0.393	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193	Missense_Mutation	Missense_Mutation
IGSF9B	22997	broad.mit.edu	37	11	133790346	133790346	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr11:133790346G>T	ENST00000321016.8	-	18	3504	c.3274C>A	c.(3274-3276)Ccg>Acg	p.P1092T	IGSF9B_ENST00000533871.2_Missense_Mutation_p.P1092T			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1092	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.P1092T(1)|p.P548T(1)		breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		AGGATGCCCGGGTAGGCCGCG	0.731																																																2	Substitution - Missense(2)	ovary(2)	11											18.0	21.0	20.0					11																	133790346		1873	4087	5960	133295556	SO:0001583	missense	22997			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3274C>A	11.37:g.133790346G>T	ENSP00000317980:p.Pro1092Thr		133295556	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37		SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	11.33	1.608032	0.28623	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.66995	0.08;-0.24	5.15	5.15	0.70609	.	0.000000	0.44285	D	0.000467	T	0.46946	0.1419	N	0.14661	0.345	0.39189	D	0.962927	B	0.27823	0.19	B	0.24701	0.055	T	0.52071	-0.8624	10	0.56958	D	0.05	.	8.527	0.33311	0.0826:0.1558:0.7615:0.0	.	1092	Q9UPX0	TUTLB_HUMAN	T	1092;934	ENSP00000317980:P1092T;ENSP00000436552:P934T	ENSP00000317980:P1092T	P	-	1	0	IGSF9B	133295556	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	3.462000	0.53042	2.394000	0.81467	0.455000	0.32223	CCG		0.731	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502		Missense_Mutation
B4GALNT3	283358	broad.mit.edu	37	12	675225	675225	+	IGR	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr12:675225C>T	ENST00000266383.5	+	0	5068				NINJ2_ENST00000537416.1_Intron|NINJ2_ENST00000433832.2_Silent_p.K15K|NINJ2_ENST00000305108.4_Silent_p.K97K|NINJ2_ENST00000542920.1_Silent_p.K15K|NINJ2_ENST00000397265.3_Silent_p.K44K	NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3						metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)	p.K97K(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			CCAGCACCGCCTTCAGCCGCA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	12											146.0	100.0	116.0					12																	675225		2203	4300	6503	545486	SO:0001628	intergenic_variant	4815			AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283		12.37:g.675225C>T			545486	Q6ZNC1|Q8N7T6	Silent	SNP	ENST00000266383.5	37	CCDS8504.1	SNP	24	Broad																																																																																				0.612	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593		Silent
ANKRD52	283373	broad.mit.edu	37	12	56646344	56646344	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr12:56646344A>C	ENST00000267116.7	-	13	1433	c.1312T>G	c.(1312-1314)Tgt>Ggt	p.C438G		NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	438										endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						AAATTAAGACATTCAACATTC	0.463																																																0			12											141.0	134.0	136.0					12																	56646344		1920	4142	6062	54932611	SO:0001583	missense	283373			AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.1312T>G	12.37:g.56646344A>C	ENSP00000267116:p.Cys438Gly		54932611	A6NE79|B1Q2K2	Missense_Mutation	SNP	ENST00000267116.7	37	CCDS44920.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	22.4	4.283169	0.80803	.	.	ENSG00000139645	ENST00000267116;ENST00000417002	T	0.63255	-0.03	4.67	4.67	0.58626	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.70868	0.3273	L	0.39692	1.235	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.73007	-0.4118	10	0.56958	D	0.05	.	13.4294	0.61046	1.0:0.0:0.0:0.0	.	438	Q8NB46	ANR52_HUMAN	G	438	ENSP00000267116:C438G	ENSP00000267116:C438G	C	-	1	0	ANKRD52	54932611	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.087000	0.94110	1.881000	0.54492	0.460000	0.39030	TGT		0.463	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408539.1	NM_173595		Missense_Mutation
UBE3B	89910	broad.mit.edu	37	12	109961915	109961915	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr12:109961915A>T	ENST00000342494.3	+	22	3092	c.2497A>T	c.(2497-2499)Atc>Ttc	p.I833F	UBE3B_ENST00000434735.2_Missense_Mutation_p.I833F	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	833	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.I833F(1)		NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						CCTCACCTCCATCAAGGTGAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											78.0	70.0	73.0					12																	109961915		2203	4300	6503	108446298	SO:0001583	missense	89910			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.2497A>T	12.37:g.109961915A>T	ENSP00000340596:p.Ile833Phe		108446298	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	ENST00000342494.3	37	CCDS9129.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	35	5.461905	0.96240	.	.	ENSG00000151148	ENST00000434735;ENST00000539599;ENST00000342494;ENST00000538070	T;T;T	0.60548	0.18;0.18;0.18	5.05	5.05	0.67936	HECT (4);	0.047901	0.85682	D	0.000000	T	0.79616	0.4476	M	0.90309	3.105	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.84119	0.0405	10	0.72032	D	0.01	-21.4827	14.1129	0.65134	1.0:0.0:0.0:0.0	.	833	Q7Z3V4	UBE3B_HUMAN	F	833;833;833;128	ENSP00000391529:I833F;ENSP00000443131:I833F;ENSP00000340596:I833F	ENSP00000340596:I833F	I	+	1	0	UBE3B	108446298	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	8.683000	0.91236	2.128000	0.65567	0.459000	0.35465	ATC		0.532	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415		Missense_Mutation
SLC7A8	23428	broad.mit.edu	37	14	23609786	23609786	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr14:23609786C>T	ENST00000316902.7	-	5	1407	c.682G>A	c.(682-684)Gaa>Aaa	p.E228K	SLC7A8_ENST00000529705.2_Missense_Mutation_p.E123K|SLC7A8_ENST00000469263.1_Missense_Mutation_p.E228K|SLC7A8_ENST00000532568.1_5'UTR|SLC7A8_ENST00000422941.2_Intron|SLC7A8_ENST00000453702.1_Missense_Mutation_p.E25K	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	228					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)	p.E228K(1)		autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	ATGTCAGGTTCCTGGAAATTC	0.537																																																1	Substitution - Missense(1)	ovary(1)	14											147.0	145.0	146.0					14																	23609786		2203	4300	6503	22679626	SO:0001583	missense	23428			Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.682G>A	14.37:g.23609786C>T	ENSP00000320378:p.Glu228Lys		22679626	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	ENST00000316902.7	37	CCDS9590.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	12.84	2.059610	0.36373	.	.	ENSG00000092068	ENST00000316902;ENST00000334354;ENST00000469263;ENST00000453702;ENST00000529705;ENST00000206514	D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53	4.81	2.95	0.34219	Amino acid permease domain (1);	0.503622	0.22202	N	0.063231	T	0.75568	0.3867	N	0.12887	0.27	0.80722	D	1	B;B;B	0.14012	0.009;0.003;0.003	B;B;B	0.17979	0.02;0.008;0.014	T	0.65331	-0.6194	10	0.13470	T	0.59	.	9.1864	0.37174	0.0:0.7533:0.0:0.2467	.	123;228;228	B4DKT4;E9PLV9;Q9UHI5	.;.;LAT2_HUMAN	K	228;25;228;25;123;25	ENSP00000320378:E228K;ENSP00000435114:E228K;ENSP00000391577:E25K;ENSP00000434345:E123K	ENSP00000206514:E25K	E	-	1	0	SLC7A8	22679626	0.991000	0.36638	0.996000	0.52242	0.975000	0.68041	0.811000	0.27198	1.177000	0.42855	0.563000	0.77884	GAA		0.537	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3			Missense_Mutation
KCNH5	27133	broad.mit.edu	37	14	63483609	63483609	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr14:63483609C>A	ENST00000322893.7	-	2	405	c.137G>T	c.(136-138)gGt>gTt	p.G46V	KCNH5_ENST00000420622.2_Missense_Mutation_p.G46V|KCNH5_ENST00000394964.2_5'UTR|KCNH5_ENST00000394968.1_5'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	46	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.G46V(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TTTACAAAAACCGTCATTACT	0.378																																																1	Substitution - Missense(1)	ovary(1)	14											102.0	93.0	96.0					14																	63483609		2203	4299	6502	62553362	SO:0001583	missense	27133			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.137G>T	14.37:g.63483609C>A	ENSP00000321427:p.Gly46Val		62553362	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	28.0	4.884120	0.91814	.	.	ENSG00000140015	ENST00000322893;ENST00000420622	D;D	0.99563	-6.17;-6.17	5.43	5.43	0.79202	PAS (2);PAS fold (1);	0.000000	0.85682	D	0.000000	D	0.99680	0.9880	M	0.88512	2.96	0.80722	D	1	D;D	0.76494	0.99;0.999	D;D	0.79784	0.929;0.993	D	0.97835	1.0265	10	0.87932	D	0	.	19.2407	0.93881	0.0:1.0:0.0:0.0	.	46;46	Q8NCM2-2;Q8NCM2	.;KCNH5_HUMAN	V	46	ENSP00000321427:G46V;ENSP00000395439:G46V	ENSP00000321427:G46V	G	-	2	0	KCNH5	62553362	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.569000	0.86673	0.591000	0.81541	GGT		0.378	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318		Missense_Mutation
DYNC1H1	1778	broad.mit.edu	37	14	102489219	102489219	+	Splice_Site	SNP	T	T	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr14:102489219T>A	ENST00000360184.4	+	43	8801		c.e43+2			NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.?(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CTGTCAAAGGTAGCAAACTCG	0.423																																																1	Unknown(1)	ovary(1)	14											203.0	168.0	180.0					14																	102489219		2203	4300	6503	101558972	SO:0001630	splice_region_variant	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8637+2T>A	14.37:g.102489219T>A			101558972	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Splice_Site_SNP	SNP	ENST00000360184.4	37	CCDS9966.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	15.54	2.865127	0.51482	.	.	ENSG00000197102	ENST00000360184	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2481	0.49008	0.0:0.0741:0.0:0.9259	.	.	.	.	.	-1	.	.	.	+	.	.	DYNC1H1	101558972	1.000000	0.71417	0.943000	0.38184	0.487000	0.33371	5.955000	0.70306	2.005000	0.58758	0.383000	0.25322	.		0.423	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	Intron	Splice_Site_SNP
ACSBG1	23205	broad.mit.edu	37	15	78471038	78471038	+	Silent	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr15:78471038G>A	ENST00000258873.4	-	11	1825	c.1620C>T	c.(1618-1620)atC>atT	p.I540I	ACSBG1_ENST00000560817.1_Silent_p.I298I|ACSBG1_ENST00000541759.1_Silent_p.I298I	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	540					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.I540I(1)		endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CTTCCTCGTCGATGGCCTCAC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	15											116.0	74.0	88.0					15																	78471038		2196	4293	6489	76258093	SO:0001819	synonymous_variant	23205			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.1620C>T	15.37:g.78471038G>A			76258093	B2RB61|O75126|Q76N27|Q9HC26	Silent	SNP	ENST00000258873.4	37	CCDS10298.1	SNP	37	Broad																																																																																				0.617	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162		Silent
NLRC3	197358	broad.mit.edu	37	16	3598160	3598160	+	RNA	SNP	G	G	C			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr16:3598160G>C	ENST00000301749.7	-	0	3151				NLRC3_ENST00000419350.2_RNA|LA16c-390H2.4_ENST00000573820.1_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.L962V(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTCCTGTTGAGCTGTAGTGCT	0.587																																																1	Substitution - Missense(1)	ovary(1)	16											32.0	35.0	34.0					16																	3598160		1958	4131	6089	3538161			197358			BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3598160G>C			3538161	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	ENST00000301749.7	37		SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735390	0.30774	.	.	ENSG00000167984	ENST00000301749;ENST00000359128;ENST00000448023	T;T;T	0.52983	0.64;0.64;0.64	4.84	2.26	0.28386	.	0.394433	0.26143	N	0.026086	T	0.13884	0.0336	N	0.00815	-1.16	0.19775	N	0.999955	B	0.09022	0.002	B	0.14023	0.01	T	0.23833	-1.0177	10	0.15499	T	0.54	.	5.0393	0.14451	0.3471:0.0:0.6529:0.0	.	962	C9JLH9	.	V	916;887;962	ENSP00000301749:L916V;ENSP00000352039:L887V;ENSP00000414415:L962V	ENSP00000301749:L916V	L	-	1	0	NLRC3	3538161	0.999000	0.42202	1.000000	0.80357	0.971000	0.66376	1.606000	0.36826	1.045000	0.40225	0.557000	0.71058	CTC		0.587	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844		Missense_Mutation
ALG1	56052	broad.mit.edu	37	16	5131001	5131001	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr16:5131001A>G	ENST00000262374.5	+	10	1047	c.1016A>G	c.(1015-1017)cAg>cGg	p.Q339R	ALG1_ENST00000588623.1_Missense_Mutation_p.Q228R|ALG1_ENST00000544428.1_Missense_Mutation_p.Q228R	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase	339					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipopolysaccharide biosynthetic process (GO:0009103)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitobiosyldiphosphodolichol beta-mannosyltransferase activity (GO:0004578)|mannosyltransferase activity (GO:0000030)	p.Q339R(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)				AAGCACTTCCAGCACATCCAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	16											76.0	93.0	87.0					16																	5131001		1385	2358	3743	5071002	SO:0001583	missense	56052			AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	2.4.1.142	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""			10704531	Standard	NM_019109		Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	ENST00000262374.5:c.1016A>G	16.37:g.5131001A>G	ENSP00000262374:p.Gln339Arg		5071002	B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	Missense_Mutation	SNP	ENST00000262374.5	37	CCDS10528.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	8.115	0.779672	0.16120	.	.	ENSG00000033011	ENST00000262374;ENST00000544428	D;D	0.84298	-1.83;-1.83	6.07	0.186	0.15105	Glycosyl transferase, family 1 (1);	0.351137	0.33161	N	0.005210	T	0.77718	0.4172	L	0.46741	1.465	0.40506	D	0.980691	B;B	0.14012	0.003;0.009	B;B	0.19391	0.01;0.025	T	0.66208	-0.5981	10	0.34782	T	0.22	-16.4513	9.69	0.40123	0.6472:0.0:0.3528:0.0	.	228;339	B4DP08;Q9BT22	.;ALG1_HUMAN	R	339;228	ENSP00000262374:Q339R;ENSP00000440019:Q228R	ENSP00000262374:Q339R	Q	+	2	0	ALG1	5071002	0.993000	0.37304	0.427000	0.26684	0.020000	0.10135	0.924000	0.28777	-0.025000	0.13918	0.528000	0.53228	CAG		0.612	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251716.2	NM_019109		Missense_Mutation
KIAA0556	23247	broad.mit.edu	37	16	27788290	27788290	+	Silent	SNP	G	G	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr16:27788290G>T	ENST00000261588.4	+	25	4510	c.4491G>T	c.(4489-4491)gtG>gtT	p.V1497V		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1497						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.V1497V(1)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						CTACCACCGTGTCAATGATCA	0.448																																																1	Substitution - coding silent(1)	ovary(1)	16											220.0	215.0	217.0					16																	27788290		2197	4300	6497	27695791	SO:0001819	synonymous_variant	23247			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.4491G>T	16.37:g.27788290G>T			27695791	A7E2C2	Silent	SNP	ENST00000261588.4	37	CCDS32415.1	SNP	48	Broad																																																																																				0.448	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202		Silent
SLC6A2	6530	broad.mit.edu	37	16	55735775	55735775	+	Splice_Site	SNP	A	A	G			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr16:55735775A>G	ENST00000379906.2	+	13	2014	c.1759A>G	c.(1759-1761)Aga>Gga	p.R587G	SLC6A2_ENST00000219833.8_Splice_Site_p.R587G|SLC6A2_ENST00000566163.1_Splice_Site_p.R542G|SLC6A2_ENST00000568943.1_Splice_Site_p.R587G|SLC6A2_ENST00000561820.1_Intron|SLC6A2_ENST00000414754.3_Splice_Site_p.R531G|SLC6A2_ENST00000567238.1_Splice_Site_p.R482G	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	587					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)	p.R587G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	TTCCTTTCAGAGACTGGCCTA	0.612											OREG0023807	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	16											74.0	73.0	73.0					16																	55735775		2198	4300	6498	54293276	SO:0001630	splice_region_variant	6530				CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.1759-1A>G	16.37:g.55735775A>G		1010	54293276	B2R707|B4DX48|Q96KH8	Missense_Mutation	SNP	ENST00000379906.2	37	CCDS10754.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	18.12	3.553451	0.65425	.	.	ENSG00000103546	ENST00000414754;ENST00000537705;ENST00000379906;ENST00000219833	T;T	0.79033	-1.23;-1.17	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.63307	0.2500	N	0.19112	0.55	0.80722	D	1	P;P;P	0.44521	0.837;0.615;0.615	B;B;B	0.38985	0.287;0.284;0.284	T	0.63791	-0.6557	9	.	.	.	.	13.7726	0.63036	1.0:0.0:0.0:0.0	.	301;482;587	F5H0T4;B4DX48;P23975	.;.;SC6A2_HUMAN	G	587;301;587;587	ENSP00000369237:R587G;ENSP00000219833:R587G	.	R	+	1	2	SLC6A2	54293276	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	5.388000	0.66249	1.902000	0.55061	0.528000	0.53228	AGA		0.612	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2		Missense_Mutation	Missense_Mutation
ANKFY1	51479	broad.mit.edu	37	17	4076650	4076650	+	Splice_Site	SNP	T	T	G			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr17:4076650T>G	ENST00000341657.4	-	21	3048	c.3013A>C	c.(3013-3015)Aga>Cga	p.R1005R	ANKFY1_ENST00000574367.1_Splice_Site_p.R1006R|CYB5D2_ENST00000573984.1_Intron|ANKFY1_ENST00000570535.1_Splice_Site_p.R1047R	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	1005					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)	p.R1006R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						CGCGCTCACCTGAGATTAAAG	0.622																																																1	Substitution - coding silent(1)	ovary(1)	17											57.0	62.0	61.0					17																	4076650		1953	4147	6100	4023399	SO:0001630	splice_region_variant	51479			AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.3014+1A>C	17.37:g.4076650T>G			4023399	A8KA65|Q5RKV4|Q9ULG5	Silent	SNP	ENST00000341657.4	37		SNP	55	Broad																																																																																				0.622	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376	Silent	Silent
TP53	7157	broad.mit.edu	37	17	7578534	7578534	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr17:7578534C>A	ENST00000269305.4	-	5	585	c.396G>T	c.(394-396)aaG>aaT	p.K132N	TP53_ENST00000455263.2_Missense_Mutation_p.K132N|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.K132N|TP53_ENST00000413465.2_Missense_Mutation_p.K132N|TP53_ENST00000445888.2_Missense_Mutation_p.K132N|TP53_ENST00000359597.4_Missense_Mutation_p.K132N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	132	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in LFS; germline mutation and in sporadic cancers; somatic mutation).|K -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).|K -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|KM -> NL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132N(49)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.K39N(2)|p.N131fs*27(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.K132K(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.M133fs*37(1)|p.M133fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAAAACATCTTGTTGAGGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	77	Substitution - Missense(51)|Deletion - In frame(10)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(1)|Substitution - coding silent(1)	urinary_tract(13)|breast(10)|ovary(10)|lung(9)|large_intestine(8)|haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(4)|bone(4)|adrenal_gland(3)|upper_aerodigestive_tract(2)|skin(2)|liver(2)|stomach(1)|penis(1)|oesophagus(1)|pancreas(1)	17											47.0	48.0	48.0					17																	7578534		2203	4300	6503	7519259	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.396G>T	17.37:g.7578534C>A	ENSP00000269305:p.Lys132Asn		7519259	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186174	0.78789	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99859	-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23	5.48	3.5	0.40072	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99857	0.9933	M	0.91768	3.24	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.998;0.993;0.996;0.999;0.998;1.0	D	0.97328	0.9948	10	0.87932	D	0	-14.0777	10.5581	0.45129	0.0:0.841:0.0:0.159	.	93;132;132;39;132;132;132	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	132;132;132;132;132;132;121;39;39;132	ENSP00000410739:K132N;ENSP00000352610:K132N;ENSP00000269305:K132N;ENSP00000398846:K132N;ENSP00000391127:K132N;ENSP00000391478:K132N;ENSP00000423862:K39N;ENSP00000424104:K132N	ENSP00000269305:K132N	K	-	3	2	TP53	7519259	1.000000	0.71417	0.994000	0.49952	0.784000	0.44337	1.646000	0.37249	0.804000	0.34136	0.655000	0.94253	AAG		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TOP3A	7156	broad.mit.edu	37	17	18188789	18188789	+	Missense_Mutation	SNP	C	C	T	rs151096656		TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr17:18188789C>T	ENST00000321105.5	-	14	1857	c.1643G>A	c.(1642-1644)cGg>cAg	p.R548Q	TOP3A_ENST00000542570.1_Missense_Mutation_p.R453Q|TOP3A_ENST00000540524.1_Missense_Mutation_p.R78Q	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	548					DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)	p.R548Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						CACGTACATCCGGGCTTTGAT	0.587																																																1	Substitution - Missense(1)	ovary(1)	17						C	GLN/ARG	0,4406		0,0,2203	117.0	81.0	93.0		1643	5.6	1.0	17	dbSNP_134	93	1,8599	1.2+/-3.3	0,1,4299	no	missense	TOP3A	NM_004618.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	548/1002	18188789	1,13005	2203	4300	6503	18129514	SO:0001583	missense	7156			U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.1643G>A	17.37:g.18188789C>T	ENSP00000321636:p.Arg548Gln		18129514	A8KA61|B4DK80|D3DXC7|Q13473	Missense_Mutation	SNP	ENST00000321105.5	37	CCDS11194.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	21.0	4.075712	0.76415	0.0	1.16E-4	ENSG00000177302	ENST00000321105;ENST00000540524;ENST00000542570	T;T;T	0.35605	1.3;1.53;1.53	5.61	5.61	0.85477	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central (1);DNA topoisomerase, type IA, DNA-binding (1);DNA topoisomerase, type IA, central region, subdomain 1 (1);	0.000000	0.85682	D	0.000000	T	0.77585	0.4152	H	0.98701	4.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.978	D	0.86960	0.2091	10	0.87932	D	0	-30.8058	19.6246	0.95672	0.0:1.0:0.0:0.0	.	453;548	B4DK80;Q13472	.;TOP3A_HUMAN	Q	548;78;453	ENSP00000321636:R548Q;ENSP00000446425:R78Q;ENSP00000442336:R453Q	ENSP00000321636:R548Q	R	-	2	0	TOP3A	18129514	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.731000	0.84895	2.631000	0.89168	0.603000	0.83216	CGG		0.587	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132052.2			Missense_Mutation
DHRS13	147015	broad.mit.edu	37	17	27225731	27225731	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr17:27225731C>T	ENST00000378895.4	-	5	988	c.862G>A	c.(862-864)Gaa>Aaa	p.E288K	FLOT2_ENST00000577789.1_5'Flank|RP11-20B24.4_ENST00000579187.1_RNA|DHRS13_ENST00000426464.2_Missense_Mutation_p.E207K|FLOT2_ENST00000394908.4_5'Flank|DHRS13_ENST00000581974.1_5'Flank|DHRS13_ENST00000394901.3_Missense_Mutation_p.E238K|FLOT2_ENST00000394906.2_5'Flank|FLOT2_ENST00000585169.1_5'Flank|RP11-20B24.4_ENST00000580603.1_RNA	NM_144683.3	NP_653284.2	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	288						extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)	p.E288K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	9	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			GGCACCTCTTCCACATGGCAG	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											21.0	23.0	22.0					17																	27225731		2203	4297	6500	24249857	SO:0001583	missense	147015			BC015582	CCDS11246.2	17q11.2	2011-09-14			ENSG00000167536	ENSG00000167536	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	28326	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 5"""					12975309, 19027726	Standard	NM_144683		Approved	MGC23280, SDR7C5	uc002hde.4	Q6UX07	OTTHUMG00000132678	ENST00000378895.4:c.862G>A	17.37:g.27225731C>T	ENSP00000368173:p.Glu288Lys		24249857	Q96BH7	Missense_Mutation	SNP	ENST00000378895.4	37	CCDS11246.2	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	11.44	1.640327	0.29157	.	.	ENSG00000167536	ENST00000378895;ENST00000394901;ENST00000426464	T;T;T	0.59638	0.25;0.25;0.25	4.95	4.95	0.65309	NAD(P)-binding domain (1);	0.523805	0.22753	N	0.056053	T	0.28732	0.0712	N	0.11313	0.125	0.29375	N	0.863749	B;B	0.29432	0.244;0.158	B;B	0.25506	0.061;0.027	T	0.32455	-0.9906	10	0.02654	T	1	.	6.9906	0.24753	0.0:0.7329:0.1763:0.0908	.	207;288	B4DJC5;Q6UX07	.;DHR13_HUMAN	K	288;238;207	ENSP00000368173:E288K;ENSP00000378361:E238K;ENSP00000412826:E207K	ENSP00000368173:E288K	E	-	1	0	DHRS13	24249857	0.004000	0.15560	0.996000	0.52242	0.977000	0.68977	0.658000	0.24979	2.593000	0.87608	0.561000	0.74099	GAA		0.637	DHRS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255952.1	NM_144683		Missense_Mutation
KRT17	3872	broad.mit.edu	37	17	39780467	39780467	+	Silent	SNP	G	G	A	rs57674130|rs267607416|rs267607415|rs267607414		TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr17:39780467G>A	ENST00000311208.8	-	1	362	c.295C>T	c.(295-297)Ctg>Ttg	p.L99L	KRT42P_ENST00000438131.1_RNA|JUP_ENST00000540235.1_Intron	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	99	Coil 1A.|Rod.		L -> P (in PC2). {ECO:0000269|PubMed:11886499}.	Missing (in Ref. 5; AAH72018). {ECO:0000305}.	epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)	p.L99L(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				ACCTTGTCCAGGTAGGAGGCC	0.637																																					Pancreas(92;1242 2086 39193 50508)											1	Substitution - coding silent(1)	ovary(1)	17	GRCh37	CD012267	KRT17	D							92.0	99.0	97.0					17																	39780467		2203	4298	6501	37033993	SO:0001819	synonymous_variant	3872			X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.295C>T	17.37:g.39780467G>A			37033993	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Silent	SNP	ENST00000311208.8	37	CCDS11402.1	SNP	35	Broad																																																																																				0.637	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	NM_000422		Silent
WFIKKN2	124857	broad.mit.edu	37	17	48917993	48917993	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr17:48917993C>A	ENST00000311378.4	+	2	1872	c.1344C>A	c.(1342-1344)tgC>tgA	p.C448*	RP11-506D12.5_ENST00000572491.2_RNA|WFIKKN2_ENST00000426127.1_Nonsense_Mutation_p.C355*	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	448	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.C448*(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			GTCGGGCCTGCAAGCCTCGGC	0.642																																																1	Substitution - Nonsense(1)	ovary(1)	17											41.0	43.0	42.0					17																	48917993		2203	4300	6503	46272992	SO:0001587	stop_gained	124857			AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.1344C>A	17.37:g.48917993C>A	ENSP00000311184:p.Cys448*		46272992	Q6UXZ9	Nonsense_Mutation	SNP	ENST00000311378.4	37	CCDS11575.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	41	9.026189	0.99040	.	.	ENSG00000173714	ENST00000426127;ENST00000311378;ENST00000393226	.	.	.	5.38	3.4	0.38934	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7392	0.51784	0.0:0.857:0.0:0.143	.	.	.	.	X	355;448;154	.	ENSP00000311184:C448X	C	+	3	2	WFIKKN2	46272992	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	3.281000	0.51685	0.663000	0.31027	-0.265000	0.10407	TGC		0.642	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	NM_175575		Nonsense_Mutation
TMEM105	284186	broad.mit.edu	37	17	79287664	79287664	+	Silent	SNP	G	G	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr17:79287664G>T	ENST00000332900.1	-	3	726	c.177C>A	c.(175-177)tcC>tcA	p.S59S		NM_178520.3	NP_848615.1	Q8N8V8	TM105_HUMAN	transmembrane protein 105	59						integral component of membrane (GO:0016021)		p.S59S(1)		NS(1)|large_intestine(3)|lung(1)|ovary(2)	7	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.0892)			ACCGAGGTGGGGACCCCTGGG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	17											34.0	43.0	40.0					17																	79287664		2200	4298	6498	76902259	SO:0001819	synonymous_variant	284186			AK096111	CCDS11781.1	17q25.3	2008-04-21	2008-04-21	2008-04-21		ENSG00000185332			26794	protein-coding gene	gene with protein product							Standard	NM_178520		Approved	FLJ38792	uc002kad.2	Q8N8V8		ENST00000332900.1:c.177C>A	17.37:g.79287664G>T			76902259		Silent	SNP	ENST00000332900.1	37	CCDS11781.1	SNP	43	Broad																																																																																				0.627	TMEM105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439607.1	NM_178520		Silent
LAMA1	284217	broad.mit.edu	37	18	7013922	7013922	+	Silent	SNP	G	G	A	rs375804587		TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr18:7013922G>A	ENST00000389658.3	-	23	3348	c.3255C>T	c.(3253-3255)ccC>ccT	p.P1085P		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1085	Laminin EGF-like 12. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.P1085P(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GAACACAGTCGGGAAAGTCTC	0.612																																																1	Substitution - coding silent(1)	ovary(1)	18						G		0,4406		0,0,2203	58.0	49.0	52.0		3255	-3.2	1.0	18		52	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LAMA1	NM_005559.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1085/3076	7013922	1,13005	2203	4300	6503	7003922	SO:0001819	synonymous_variant	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3255C>T	18.37:g.7013922G>A			7003922		Silent	SNP	ENST00000389658.3	37	CCDS32787.1	SNP	39	Broad																																																																																				0.612	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		Silent
ZNF521	25925	broad.mit.edu	37	18	22805704	22805704	+	Silent	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr18:22805704G>A	ENST00000361524.3	-	4	2326	c.2178C>T	c.(2176-2178)ctC>ctT	p.L726L	ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000538137.2_Silent_p.L726L|ZNF521_ENST00000584787.1_Silent_p.L506L	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	726					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.L726L(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CTTCCTGGCAGAGGGTGCAGC	0.458			T	PAX5	ALL																																		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	1	Substitution - coding silent(1)	ovary(1)	18											78.0	79.0	79.0					18																	22805704		2203	4300	6503	21059702	SO:0001819	synonymous_variant	25925			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2178C>T	18.37:g.22805704G>A			21059702	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	ENST00000361524.3	37	CCDS32806.1	SNP	33	Broad																																																																																				0.458	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		Silent
HNRNPM	4670	broad.mit.edu	37	19	8550730	8550731	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr19:8550730_8550731GC>TT	ENST00000325495.4	+	14	1459_1460	c.1418_1419GC>TT	c.(1417-1419)gGC>gTT	p.G473V	HNRNPM_ENST00000348943.3_Missense_Mutation_p.G434V	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	473	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)	p.G473V(1)		endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						GAGCGCATGGGCCAGACCATGG	0.683																																																1	Substitution - Missense(1)	ovary(1)	19																																								8456731	SO:0001583	missense	4670			L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	Exception_encountered	19.37:g.8550730_8550731delinsTT	ENSP00000325376:p.Gly473Val		8456730	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	DNP	ENST00000325495.4	37	CCDS12203.1	DNP	42	Broad																																																																																				0.683	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1			Missense_Mutation
ZNF564	163050	broad.mit.edu	37	19	12638453	12638453	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr19:12638453G>A	ENST00000339282.7	-	4	665	c.469C>T	c.(469-471)Cga>Tga	p.R157*	ZNF709_ENST00000428311.1_Intron|CTD-2192J16.21_ENST00000601420.1_RNA|CTD-2192J16.20_ENST00000593682.1_3'UTR	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R157*(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						TCATGTCTTCGAAAGGATTGA	0.418																																																1	Substitution - Nonsense(1)	ovary(1)	19											105.0	112.0	110.0					19																	12638453		2200	4299	6499	12499453	SO:0001587	stop_gained	163050			BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.469C>T	19.37:g.12638453G>A	ENSP00000340004:p.Arg157*		12499453	B9EGT4|Q6P1K6	Nonsense_Mutation	SNP	ENST00000339282.7	37	CCDS42505.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803077	0.90623	.	.	ENSG00000249709	ENST00000339282	.	.	.	1.71	0.599	0.17519	.	.	.	.	.	.	.	.	.	.	.	0.20975	N	0.999818	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	7.4997	0.27511	0.0:0.2715:0.7285:0.0	.	.	.	.	X	157	.	ENSP00000340004:R157X	R	-	1	2	ZNF564	12499453	0.031000	0.19500	0.005000	0.12908	0.937000	0.57800	-0.367000	0.07553	0.271000	0.22005	0.643000	0.83706	CGA		0.418	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344120.2	NM_144976		Nonsense_Mutation
FKBP8	23770	broad.mit.edu	37	19	18642978	18642979	+	Nonstop_Mutation	DNP	GT	GT	CG			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr19:18642978_18642979GT>CG	ENST00000596558.2	-	9	1348_1349	c.1239_1240AC>CG	c.(1237-1242)tgACca>tgCGca	p.413_414*>CA	AC005387.2_ENST00000596596.1_RNA|AC005387.3_ENST00000597837.2_RNA|FKBP8_ENST00000597960.3_Nonstop_Mutation_p.414_415*>CA|FKBP8_ENST00000608443.1_Nonstop_Mutation_p.414_415*>CA|FKBP8_ENST00000610101.1_Nonstop_Mutation_p.254_255*>CA|FKBP8_ENST00000453489.2_Nonstop_Mutation_p.442_443*>CA|FKBP8_ENST00000222308.4_Nonstop_Mutation_p.413_414*>CA			Q14318	FKBP8_HUMAN	FK506 binding protein 8, 38kDa	0					apoptotic process (GO:0006915)|camera-type eye development (GO:0043010)|cell fate specification (GO:0001708)|chaperone-mediated protein folding (GO:0061077)|dorsal/ventral neural tube patterning (GO:0021904)|intracellular signal transduction (GO:0035556)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|positive regulation of BMP signaling pathway (GO:0030513)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of gene expression (GO:0010468)|smoothened signaling pathway (GO:0007224)|viral process (GO:0016032)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	FK506 binding (GO:0005528)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	15						CACCTAGGTGGTCAGTTCCTGG	0.639																																																0			19																																								18503979	SO:0001578	stop_lost	23770			L37033	CCDS32961.1	19p12	2013-01-10	2002-08-29		ENSG00000105701	ENSG00000105701		"""Tetratricopeptide (TTC) repeat domain containing"""	3724	protein-coding gene	gene with protein product	"""FK506-binding protein 8 (38kD)"""	604840	"""FK506-binding protein 8 (38kD)"""			7543869	Standard	NM_012181		Approved	FKBP38, FKBPr38	uc002njj.1	Q14318		ENST00000596558.2:c.1237_1237delinsCG	19.37:g.18642978_18642979delinsCG	ENSP00000472302:p.*413_*414delinsCysAlaext*105		18503978	C8C9T5|Q53GU3|Q7Z349|Q86YK6	Nonstop_Mutation	DNP	ENST00000596558.2	37		DNP	44	Broad																																																																																				0.639	FKBP8-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000466374.3	NM_012181		Nonstop_Mutation
ZFP14	57677	broad.mit.edu	37	19	36832293	36832293	+	Silent	SNP	A	A	G			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr19:36832293A>G	ENST00000270001.7	-	5	550	c.435T>C	c.(433-435)atT>atC	p.I145I		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	145					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I145I(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					TTTCAGAGGTAATTTTCACTT	0.383																																																1	Substitution - coding silent(1)	ovary(1)	19											144.0	136.0	139.0					19																	36832293		2203	4300	6503	41524133	SO:0001819	synonymous_variant	57677			AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.435T>C	19.37:g.36832293A>G			41524133	A7MD23	Silent	SNP	ENST00000270001.7	37	CCDS33002.1	SNP	13	Broad																																																																																				0.383	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917		Silent
GRIK5	2901	broad.mit.edu	37	19	42569434	42569434	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr19:42569434C>T	ENST00000262895.3	-	2	184	c.185G>A	c.(184-186)cGa>cAa	p.R62Q	GRIK5_ENST00000593562.1_Missense_Mutation_p.R62Q|GRIK5_ENST00000301218.4_Missense_Mutation_p.R62Q	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	62					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.R62Q(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				TACTTCCACTCGGGCCTTGGC	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											82.0	73.0	76.0					19																	42569434		2203	4300	6503	47261274	SO:0001583	missense	2901				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.185G>A	19.37:g.42569434C>T	ENSP00000262895:p.Arg62Gln		47261274	Q8WWG8	Missense_Mutation	SNP	ENST00000262895.3	37	CCDS12595.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	c	23.9	4.472342	0.84533	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	D;D	0.82984	-1.67;-1.67	4.61	4.61	0.57282	Extracellular ligand-binding receptor (1);	0.271893	0.27971	N	0.017115	T	0.82006	0.4943	L	0.44542	1.39	0.40436	D	0.979998	D	0.58268	0.982	P	0.48795	0.59	T	0.82794	-0.0281	10	0.39692	T	0.17	.	16.4193	0.83753	0.0:1.0:0.0:0.0	.	62	Q16478	GRIK5_HUMAN	Q	62	ENSP00000262895:R62Q;ENSP00000301218:R62Q	ENSP00000262895:R62Q	R	-	2	0	GRIK5	47261274	0.986000	0.35501	1.000000	0.80357	0.995000	0.86356	2.580000	0.46068	2.395000	0.81488	0.632000	0.83419	CGA		0.642	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1			Missense_Mutation
TPRX1	284355	broad.mit.edu	37	19	48305265	48305266	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr19:48305265_48305266GC>AA	ENST00000322175.3	-	2	1157_1158	c.1002_1003GC>TT	c.(1000-1005)tgGCct>tgTTct	p.334_335WP>CS	TPRX1_ENST00000535759.1_Missense_Mutation_p.431_432WP>CS|TPRX1_ENST00000543508.1_Missense_Mutation_p.324_325WP>CS	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	334						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.W334_P335>CS(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		GGGCTCTGAGGCCATAAGgggg	0.624																																					Esophageal Squamous(123;175 2281 3051 32395)											1	Complex - compound substitution(1)	ovary(1)	19																																								52997078	SO:0001583	missense	284355				CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.1002_1003delinsAA	19.37:g.48305265_48305266delinsAA	ENSP00000323455:p.W334_P335delinsCS		52997077	A5D8Y3|B2RPL5	Missense_Mutation	DNP	ENST00000322175.3	37	CCDS33066.1	DNP	42	Broad																																																																																				0.624	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479		Missense_Mutation
SHANK1	50944	broad.mit.edu	37	19	51175356	51175356	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr19:51175356G>A	ENST00000293441.1	-	21	2611	c.2593C>T	c.(2593-2595)Cac>Tac	p.H865Y	SHANK1_ENST00000391814.1_Missense_Mutation_p.H873Y|SHANK1_ENST00000359082.3_Missense_Mutation_p.H856Y|SHANK1_ENST00000391813.1_Missense_Mutation_p.H252Y	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	865					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GCACGGTGGTGGGGATCGAAG	0.547																																																0			19											69.0	58.0	62.0					19																	51175356		2203	4300	6503	55867168	SO:0001583	missense	50944			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.2593C>T	19.37:g.51175356G>A	ENSP00000293441:p.His865Tyr		55867168	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	CCDS12799.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	13.87	2.367459	0.42003	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.38401	1.3;1.73;1.28;1.14	3.87	3.87	0.44632	.	1.221100	0.06707	U	0.772403	T	0.37571	0.1008	N	0.08118	0	0.36156	D	0.84776	P;D	0.61080	0.851;0.989	P;D	0.70487	0.775;0.969	T	0.21348	-1.0248	10	0.02654	T	1	-14.731	15.1098	0.72346	0.0:0.0:1.0:0.0	.	865;252	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	Y	865;252;856;873	ENSP00000293441:H865Y;ENSP00000375689:H252Y;ENSP00000351984:H856Y;ENSP00000375690:H873Y	ENSP00000293441:H865Y	H	-	1	0	SHANK1	55867168	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	3.897000	0.56273	2.161000	0.67846	0.491000	0.48974	CAC		0.547	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148		Missense_Mutation
DNAAF3	352909	broad.mit.edu	37	19	55677721	55677721	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr19:55677721G>A	ENST00000524407.2	-	2	94	c.61C>T	c.(61-63)Ccg>Tcg	p.P21S	DNAAF3_ENST00000455045.1_5'Flank|DNAAF3_ENST00000391720.4_Missense_Mutation_p.P68S|CTD-2587H24.5_ENST00000591665.1_RNA|snoU13_ENST00000459370.1_RNA|DNAAF3_ENST00000527223.2_Missense_Mutation_p.P68S			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	21					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)		p.P68S(1)									TCCAGCGCCGGGGACAGGCCC	0.622											OREG0025679	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	19											27.0	36.0	33.0					19																	55677721		1998	4147	6145	60369533	SO:0001583	missense	352909			AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.61C>T	19.37:g.55677721G>A	ENSP00000432046:p.Pro21Ser	1009	60369533	A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	ENST00000524407.2	37	CCDS59422.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.122758	0.94429	.	.	ENSG00000167646	ENST00000301249;ENST00000391720;ENST00000528476	T	0.24723	1.84	4.68	4.68	0.58851	.	0.123969	0.53938	D	0.000046	T	0.44393	0.1291	L	0.45285	1.41	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.36359	-0.9751	10	0.66056	D	0.02	-38.0341	16.8869	0.86078	0.0:0.0:1.0:0.0	.	68;21;21	E9PAX5;Q8N9W5-3;Q8N9W5	.;.;CS051_HUMAN	S	68	ENSP00000375600:P68S	ENSP00000301249:P68S	P	-	1	0	C19orf51	60369533	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.954000	0.70298	2.594000	0.87642	0.655000	0.94253	CCG		0.622	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250388.5	NM_178837		Missense_Mutation
LRPPRC	10128	broad.mit.edu	37	2	44171017	44171017	+	Silent	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr2:44171017C>T	ENST00000260665.7	-	23	2370	c.2313G>A	c.(2311-2313)ctG>ctA	p.L771L		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	771					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.L771L(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TCATCTCCTTCAGAATGTTAA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	2											82.0	83.0	83.0					2																	44171017		2202	4300	6502	44024521	SO:0001819	synonymous_variant	10128			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.2313G>A	2.37:g.44171017C>T			44024521	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Silent	SNP	ENST00000260665.7	37	CCDS33189.1	SNP	29	Broad																																																																																				0.373	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259		Silent
RPS27A	6233	broad.mit.edu	37	2	55462090	55462090	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr2:55462090T>C	ENST00000272317.6	+	5	637	c.313T>C	c.(313-315)Tat>Cat	p.Y105H	CLHC1_ENST00000406437.2_5'Flank|RPS27A_ENST00000404735.1_Missense_Mutation_p.Y105H|CLHC1_ENST00000401408.1_5'Flank|CLHC1_ENST00000494539.1_5'Flank|RPS27A_ENST00000402285.3_Missense_Mutation_p.Y105H|CLHC1_ENST00000407122.1_5'Flank|CLHC1_ENST00000406076.1_5'Flank	NM_002954.5	NP_002945.1	P62979	RS27A_HUMAN	ribosomal protein S27a	105					activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|viral transcription (GO:0019083)|virion assembly (GO:0019068)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|small ribosomal subunit (GO:0015935)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.Y105H(1)		cervix(1)|ovary(1)|urinary_tract(1)	3						TGTCCTGAAATATTATAAGGT	0.383																																																1	Substitution - Missense(1)	ovary(1)	2											45.0	43.0	44.0					2																	55462090		2203	4300	6503	55315594	SO:0001583	missense	6233			AB007163	CCDS33202.1	2p16	2011-04-06			ENSG00000143947	ENSG00000143947		"""S ribosomal proteins"""	10417	protein-coding gene	gene with protein product	"""ubiquitin carboxyl extension protein 80"""	191343				9582194	Standard	NM_001135592		Approved	UBCEP80, Uba80, S27A	uc010yow.2	P62979	OTTHUMG00000151919	ENST00000272317.6:c.313T>C	2.37:g.55462090T>C	ENSP00000272317:p.Tyr105His		55315594	P02248|P02249|P02250|P14798|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BQ77|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000272317.6	37	CCDS33202.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	16.78	3.217190	0.58560	.	.	ENSG00000143947	ENST00000402285;ENST00000272317;ENST00000449323;ENST00000404735	T;T;T;T	0.78246	-1.11;-1.11;-1.16;-1.11	5.01	5.01	0.66863	Ribosomal protein S27a (1);	0.000000	0.85682	D	0.000000	T	0.76169	0.3950	M	0.64630	1.985	0.80722	D	1	B	0.13145	0.007	B	0.20767	0.031	T	0.74469	-0.3655	10	0.59425	D	0.04	.	14.7212	0.69308	0.0:0.0:0.0:1.0	.	105	P62979	RS27A_HUMAN	H	105	ENSP00000383981:Y105H;ENSP00000272317:Y105H;ENSP00000408482:Y105H;ENSP00000385659:Y105H	ENSP00000272317:Y105H	Y	+	1	0	RPS27A	55315594	1.000000	0.71417	0.987000	0.45799	0.944000	0.59088	7.727000	0.84838	1.882000	0.54519	0.477000	0.44152	TAT		0.383	RPS27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324423.15			Missense_Mutation
LOXL3	84695	broad.mit.edu	37	2	74763565	74763565	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr2:74763565C>G	ENST00000264094.3	-	6	1017	c.946G>C	c.(946-948)Gga>Cga	p.G316R	LOXL3_ENST00000393937.2_Missense_Mutation_p.G171R|LOXL3_ENST00000409549.1_Missense_Mutation_p.G316R|LOXL3_ENST00000409249.1_Missense_Mutation_p.G316R|LOXL3_ENST00000409986.1_Missense_Mutation_p.G171R	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	316	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)	p.G316R(1)		endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						CGGCCCTCTCCAGGGTGGGCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	2											35.0	32.0	33.0					2																	74763565		2202	4300	6502	74617073	SO:0001583	missense	84695			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.946G>C	2.37:g.74763565C>G	ENSP00000264094:p.Gly316Arg		74617073	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	ENST00000264094.3	37	CCDS1953.1	SNP	21	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.021939|4.021939	0.75275|0.75275	.|.	.|.	ENSG00000115318|ENSG00000115318	ENST00000264094;ENST00000409249;ENST00000393937;ENST00000409549;ENST00000409986|ENST00000420535	T;T;T;T;T|.	0.28255|.	1.62;1.62;1.62;1.62;1.62|.	4.9|4.9	4.02|4.02	0.46733|0.46733	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68952|0.68952	0.3057|0.3057	M|M	0.68728|0.68728	2.09|2.09	0.54753|0.54753	D|D	0.999984|0.999984	D;D;D;D|.	0.89917|.	0.999;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.979;0.998;0.999;1.0|.	T|T	0.68678|0.68678	-0.5345|-0.5345	10|5	0.26408|.	T|.	0.33|.	.|.	11.3015|11.3015	0.49309|0.49309	0.0:0.9106:0.0:0.0894|0.0:0.9106:0.0:0.0894	.|.	171;316;171;316|.	B9A025;E7END4;Q6IPL7;P58215|.	.;.;.;LOXL3_HUMAN|.	R|S	316;316;171;316;171|42	ENSP00000264094:G316R;ENSP00000387103:G316R;ENSP00000377512:G171R;ENSP00000386696:G316R;ENSP00000386545:G171R|.	ENSP00000264094:G316R|.	G|W	-|-	1|2	0|0	LOXL3|LOXL3	74617073|74617073	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.987000|0.987000	0.75469|0.75469	5.869000|5.869000	0.69613|0.69613	1.420000|1.420000	0.47138|0.47138	0.563000|0.563000	0.77884|0.77884	GGA|TGG		0.622	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603		Missense_Mutation
SOGA1	140710	broad.mit.edu	37	20	35444287	35444287	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr20:35444287C>T	ENST00000357779.3	-	5	1170	c.844G>A	c.(844-846)Gaa>Aaa	p.E282K	SOGA1_ENST00000456801.2_Missense_Mutation_p.E123K|SOGA1_ENST00000279034.6_Missense_Mutation_p.E282K|SOGA1_ENST00000237536.4_Missense_Mutation_p.E520K			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	282					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.E520K(1)		endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						GCCTCCTCTTCGACAAACTGC	0.672																																																1	Substitution - Missense(1)	ovary(1)	20											27.0	33.0	31.0					20																	35444287		2124	4239	6363	34877701	SO:0001583	missense	140710			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.844G>A	20.37:g.35444287C>T	ENSP00000350424:p.Glu282Lys		34877701	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.209838	0.95069	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.51071	1.62;1.69;0.72;1.71	5.24	5.24	0.73138	.	0.346456	0.32147	N	0.006503	T	0.69593	0.3128	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71151	-0.4676	10	0.56958	D	0.05	-38.1258	17.7588	0.88457	0.0:1.0:0.0:0.0	.	282	O94964-4	.	K	520;282;123;282	ENSP00000237536:E520K;ENSP00000279034:E282K;ENSP00000413886:E123K;ENSP00000350424:E282K	ENSP00000237536:E520K	E	-	1	0	KIAA0889	34877701	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.651000	0.83577	2.723000	0.93209	0.655000	0.94253	GAA		0.672	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181		Missense_Mutation
TOP1	7150	broad.mit.edu	37	20	39741530	39741530	+	Silent	SNP	C	C	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr20:39741530C>A	ENST00000361337.2	+	14	1667	c.1417C>A	c.(1417-1419)Cgg>Agg	p.R473R	RP1-1J6.2_ENST00000454626.1_RNA	NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	473					chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	GATGAAAGTCCGGCAGAGAGC	0.502			T	NUP98	AML*																																		Dom	yes		20	20q12-q13.1	7150	topoisomerase (DNA) I		L	0			20											95.0	84.0	88.0					20																	39741530		2203	4300	6503	39174944	SO:0001819	synonymous_variant	7150				CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.1417C>A	20.37:g.39741530C>A			39174944	A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Silent	SNP	ENST00000361337.2	37	CCDS13312.1	SNP	23	Broad																																																																																				0.502	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080397.2			Silent
ZNF335	63925	broad.mit.edu	37	20	44592403	44592403	+	Silent	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr20:44592403C>T	ENST00000322927.2	-	8	1429	c.1329G>A	c.(1327-1329)agG>agA	p.R443R	ZNF335_ENST00000426788.1_Silent_p.R288R	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	443					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)	p.R443R(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				CTAGGAAGCGCCTGGAAGGTC	0.612																																																1	Substitution - coding silent(1)	ovary(1)	20											173.0	164.0	167.0					20																	44592403		2203	4300	6503	44025810	SO:0001819	synonymous_variant	63925			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1329G>A	20.37:g.44592403C>T			44025810	B4DLG7|Q548D0|Q9H684	Silent	SNP	ENST00000322927.2	37	CCDS13389.1	SNP	26	Broad																																																																																				0.612	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095		Silent
ATP9A	10079	broad.mit.edu	37	20	50234046	50234046	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr20:50234046C>T	ENST00000338821.5	-	22	2662	c.2398G>A	c.(2398-2400)Gtg>Atg	p.V800M	ATP9A_ENST00000311637.5_Missense_Mutation_p.V664M|ATP9A_ENST00000402822.1_Missense_Mutation_p.V679M	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	800					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.V800M(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TCCACTCCCACGCCGCAGTCA	0.493																																																1	Substitution - Missense(1)	ovary(1)	20											134.0	85.0	102.0					20																	50234046		2203	4300	6503	49667453	SO:0001583	missense	10079			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.2398G>A	20.37:g.50234046C>T	ENSP00000342481:p.Val800Met		49667453	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	17.70	3.454708	0.63290	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	D;D;D	0.83673	-1.75;-1.75;-1.75	5.15	5.15	0.70609	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.92743	0.7693	H	0.95645	3.7	0.80722	D	1	D;D	0.58620	0.981;0.983	P;P	0.56398	0.64;0.797	D	0.94957	0.8105	10	0.87932	D	0	-26.5456	18.6016	0.91249	0.0:1.0:0.0:0.0	.	679;800	O75110-2;O75110	.;ATP9A_HUMAN	M	664;800;679	ENSP00000309086:V664M;ENSP00000342481:V800M;ENSP00000385875:V679M	ENSP00000309086:V664M	V	-	1	0	ATP9A	49667453	1.000000	0.71417	0.992000	0.48379	0.225000	0.24961	4.574000	0.60900	2.374000	0.81015	0.511000	0.50034	GTG		0.493	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045		Missense_Mutation
RASL10A	10633	broad.mit.edu	37	22	29707990	29707990	+	IGR	SNP	T	T	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr22:29707990T>A	ENST00000216101.6	-	0	1490				GAS2L1_ENST00000407647.2_Missense_Mutation_p.C517S|GAS2L1_ENST00000406549.3_Intron|GAS2L1_ENST00000360113.2_3'UTR|RASL10A_ENST00000608559.1_5'Flank|GAS2L1_ENST00000341313.6_3'UTR|GAS2L1_ENST00000407854.1_Missense_Mutation_p.C517S|GAS2L1_ENST00000403764.1_Missense_Mutation_p.C517S|GAS2L1_ENST00000471961.1_Missense_Mutation_p.C517S	NM_006477.4	NP_006468.1	Q92737	RSLAA_HUMAN	RAS-like, family 10, member A						small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L516Q(1)		NS(1)	1						GAGCAGCAGCTGTTCCGGCGC	0.687																																																1	Substitution - Missense(1)	ovary(1)	22											36.0	47.0	43.0					22																	29707990		2049	4202	6251	28037990	SO:0001628	intergenic_variant	10634			Y07847	CCDS13854.1	22q12.2	2014-05-09			ENSG00000100276	ENSG00000100276			16954	protein-coding gene	gene with protein product		602220				8975699, 15731001	Standard	NM_006477		Approved	RRP22	uc031rxl.1	Q92737	OTTHUMG00000151106		22.37:g.29707990T>A			28037990	Q49AU5|Q6PI03	Missense_Mutation	SNP	ENST00000216101.6	37	CCDS13854.1	SNP	55	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.48|10.48	1.360888|1.360888	0.24684|0.24684	.|.	.|.	ENSG00000185340|ENSG00000185340	ENST00000407647;ENST00000403764;ENST00000471961;ENST00000407854|ENST00000333679	T;T;T;T|.	0.45276|.	0.9;0.9;0.9;0.9|.	3.68|3.68	3.68|3.68	0.42216|0.42216	.|.	.|0.141093	.|0.28360	.|U	.|0.015635	T|T	0.49064|0.49064	0.1535|0.1535	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B|D;D	0.06786|0.89917	0.001|1.0;1.0	B|D;D	0.04013|0.68192	0.001|0.956;0.956	T|T	0.53500|0.53500	-0.8430|-0.8430	9|9	0.02654|0.44086	T|T	1|0.13	-7.4973|-7.4973	11.4541|11.4541	0.50171|0.50171	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	517|517;517	E7EQM6|A0A5E8;Q99501	.|.;GA2L1_HUMAN	S|Q	517|516	ENSP00000385554:C517S;ENSP00000385358:C517S;ENSP00000450152:C517S;ENSP00000385023:C517S|.	ENSP00000385358:C517S|ENSP00000332834:L516Q	C|L	+|+	1|2	0|0	GAS2L1|GAS2L1	28037990|28037990	1.000000|1.000000	0.71417|0.71417	0.142000|0.142000	0.22268|0.22268	0.447000|0.447000	0.32167|0.32167	3.552000|3.552000	0.53705|0.53705	1.540000|1.540000	0.49301|0.49301	0.402000|0.402000	0.26972|0.26972	TGT|CTG		0.687	RASL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321342.1			Missense_Mutation
SBF1	6305	broad.mit.edu	37	22	50901053	50901053	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr22:50901053C>A	ENST00000390679.3	-	18	2246	c.2062G>T	c.(2062-2064)Ggg>Tgg	p.G688W	SBF1_ENST00000380817.3_Missense_Mutation_p.G688W|SBF1_ENST00000348911.6_Missense_Mutation_p.G689W			O95248	MTMR5_HUMAN	SET binding factor 1	688					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.G688W(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		TGCACATCCCCATAGAACATG	0.672																																																1	Substitution - Missense(1)	ovary(1)	22											20.0	23.0	22.0					22																	50901053		2060	4204	6264	49247919	SO:0001583	missense	6305			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.2062G>T	22.37:g.50901053C>A	ENSP00000375097:p.Gly688Trp		49247919	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	37		SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	18.42	3.620837	0.66787	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	T;T;T	0.44083	0.93;0.93;0.93	4.63	4.63	0.57726	.	0.113121	0.64402	D	0.000014	T	0.51669	0.1688	L	0.36672	1.1	0.43896	D	0.996521	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.74023	0.977;0.982;0.971	T	0.49862	-0.8894	10	0.49607	T	0.09	.	12.1585	0.54091	0.0:0.9144:0.0:0.0856	.	688;689;688	O95248;G5E933;O95248-4	MTMR5_HUMAN;.;.	W	688;689;699;698;688	ENSP00000370196:G688W;ENSP00000252027:G689W;ENSP00000375097:G688W	ENSP00000336522:G698W	G	-	1	0	SBF1	49247919	0.058000	0.20735	0.996000	0.52242	0.983000	0.72400	0.750000	0.26334	2.414000	0.81942	0.561000	0.74099	GGG		0.672	SBF1-201	KNOWN	basic	protein_coding	protein_coding				Missense_Mutation
ATP2B2	491	broad.mit.edu	37	3	10491191	10491191	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr3:10491191T>C	ENST00000352432.4	-	1	106	c.37A>G	c.(37-39)Aac>Gac	p.N13D	ATP2B2_ENST00000343816.4_Missense_Mutation_p.N13D|ATP2B2_ENST00000360273.2_Missense_Mutation_p.N13D|ATP2B2_ENST00000397077.1_Missense_Mutation_p.N13D|ATP2B2_ENST00000383800.4_Missense_Mutation_p.N13D			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	13					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.N13D(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						TTTCTTTGGTTTTTGGAGTAA	0.597																																					Ovarian(125;1619 1709 15675 19819 38835)											1	Substitution - Missense(1)	ovary(1)	3											135.0	120.0	125.0					3																	10491191		2203	4300	6503	10466191	SO:0001583	missense	491			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.37A>G	3.37:g.10491191T>C	ENSP00000324172:p.Asn13Asp		10466191	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	CCDS33701.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	20.2	3.956816	0.73902	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000342354	D;D;D;D;D	0.92048	-2.94;-2.96;-2.96;-2.94;-2.95	4.45	4.45	0.53987	.	0.531524	0.18420	N	0.141791	D	0.94341	0.8181	L	0.60455	1.87	0.43830	D	0.996405	D;B;B	0.61697	0.99;0.02;0.224	D;B;B	0.72982	0.979;0.028;0.071	D	0.93529	0.6868	10	0.46703	T	0.11	-41.0036	11.9674	0.53044	0.0:0.0:0.0:1.0	.	13;25;13	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	D	13	ENSP00000324172:N13D;ENSP00000373311:N13D;ENSP00000380267:N13D;ENSP00000353414:N13D;ENSP00000344677:N13D	ENSP00000342954:N13D	N	-	1	0	ATP2B2	10466191	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.843000	0.86859	1.780000	0.52325	0.379000	0.24179	AAC		0.597	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		Missense_Mutation
SKIL	6498	broad.mit.edu	37	3	170110051	170110051	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr3:170110051C>T	ENST00000458537.3	+	6	2610	c.1901C>T	c.(1900-1902)gCa>gTa	p.A634V	SKIL_ENST00000426052.2_Missense_Mutation_p.A614V|SKIL_ENST00000413427.2_Missense_Mutation_p.A588V|SKIL_ENST00000259119.4_Missense_Mutation_p.A634V	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	634					blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)	p.A634V(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			ACATAGTTGGCAGAACTGAGG	0.368																																																1	Substitution - Missense(1)	ovary(1)	3											83.0	87.0	86.0					3																	170110051		2203	4300	6503	171592745	SO:0001583	missense	6498			X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.1901C>T	3.37:g.170110051C>T	ENSP00000415243:p.Ala634Val		171592745	A6NGT1|B4DT50|O00464|P12756|Q07501	Missense_Mutation	SNP	ENST00000458537.3	37	CCDS33890.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	15.22	2.767602	0.49574	.	.	ENSG00000136603	ENST00000259119;ENST00000426052;ENST00000413427;ENST00000458537	D;D;D;D	0.91521	-2.84;-2.84;-2.86;-2.84	5.89	5.01	0.66863	.	0.240378	0.43260	D	0.000586	D	0.87394	0.6166	L	0.44542	1.39	0.36181	D	0.84944	B;B	0.27971	0.196;0.148	B;B	0.29077	0.098;0.046	D	0.87821	0.2638	10	0.46703	T	0.11	-13.1473	15.4548	0.75305	0.0:0.9326:0.0:0.0674	.	588;634	P12757-3;P12757	.;SKIL_HUMAN	V	634;614;588;634	ENSP00000259119:A634V;ENSP00000406520:A614V;ENSP00000400193:A588V;ENSP00000415243:A634V	ENSP00000259119:A634V	A	+	2	0	SKIL	171592745	1.000000	0.71417	0.996000	0.52242	0.763000	0.43281	4.073000	0.57570	2.793000	0.96121	0.655000	0.94253	GCA		0.368	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352351.4	NM_005414		Missense_Mutation
DCUN1D1	54165	broad.mit.edu	37	3	182681668	182681668	+	Splice_Site	SNP	C	C	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr3:182681668C>A	ENST00000292782.4	-	3	543		c.e3+1		DCUN1D1_ENST00000469954.1_Splice_Site	NM_020640.2	NP_065691.2	Q96GG9	DCNL1_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 1							ubiquitin ligase complex (GO:0000151)		p.?(1)		endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TATATACTCACCCTAATTCTG	0.383																																																1	Unknown(1)	lung(1)	3											98.0	89.0	92.0					3																	182681668		2203	4300	6503	184164362	SO:0001630	splice_region_variant	54165			AF292100, AK056335	CCDS3240.1	3q26.3	2013-06-10	2013-06-10		ENSG00000043093	ENSG00000043093			18184	protein-coding gene	gene with protein product	"""squamous cell carcinoma related oncogene"""	605905	"""DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)"""			10777668, 15988528	Standard	NM_020640		Approved	RP42, SCRO, DCUN1L1, Tes3, SCCRO	uc003fld.1	Q96GG9	OTTHUMG00000158314	ENST00000292782.4:c.389+1G>T	3.37:g.182681668C>A			184164362	B2RB37|Q7L3G9|Q8TEX7|Q9H6M1|Q9HCT3	Splice_Site_SNP	SNP	ENST00000292782.4	37	CCDS3240.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656208	0.88056	.	.	ENSG00000043093	ENST00000292782;ENST00000458486;ENST00000469954;ENST00000497606	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4509	0.90703	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DCUN1D1	184164362	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.487000	0.81328	2.793000	0.96121	0.591000	0.81541	.		0.383	DCUN1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350658.1	NM_020640	Intron	Splice_Site_SNP
GPR78	27201	broad.mit.edu	37	4	8584292	8584292	+	Missense_Mutation	SNP	C	C	T	rs144674484	byFrequency	TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr4:8584292C>T	ENST00000382487.4	+	2	1120	c.703C>T	c.(703-705)Cgc>Tgc	p.R235C	GPR78_ENST00000509216.1_3'UTR	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	235					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R235C(1)		central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						GCAGAAGCGGCGCCGCCACCG	0.637																																																1	Substitution - Missense(1)	ovary(1)	4						C	CYS/ARG	4,4402	8.1+/-20.4	0,4,2199	105.0	91.0	95.0		703	-1.9	0.0	4	dbSNP_134	95	0,8600		0,0,4300	no	missense	GPR78	NM_080819.2	180	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	probably-damaging	235/364	8584292	4,13002	2203	4300	6503	8635192	SO:0001583	missense	27201			AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.703C>T	4.37:g.8584292C>T	ENSP00000371927:p.Arg235Cys		8635192	Q8NGV3	Missense_Mutation	SNP	ENST00000382487.4	37	CCDS3403.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	12.55	1.970980	0.34754	9.08E-4	0.0	ENSG00000155269	ENST00000382487	T	0.73469	-0.75	2.43	-1.94	0.07571	GPCR, rhodopsin-like superfamily (1);	0.069959	0.53938	U	0.000051	T	0.76190	0.3953	L	0.54323	1.7	0.09310	N	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.67719	-0.5598	10	0.87932	D	0	.	2.7544	0.05289	0.5543:0.196:0.1397:0.11	.	235	Q96P69	GPR78_HUMAN	C	235	ENSP00000371927:R235C	ENSP00000371927:R235C	R	+	1	0	GPR78	8635192	0.789000	0.28775	0.000000	0.03702	0.001000	0.01503	0.219000	0.17641	-1.145000	0.02858	-0.311000	0.09066	CGC		0.637	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359201.1			Missense_Mutation
CEP135	9662	broad.mit.edu	37	4	56865776	56865776	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr4:56865776A>G	ENST00000257287.4	+	17	2369	c.2245A>G	c.(2245-2247)Aag>Gag	p.K749E		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	749					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)	p.K749E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					GAAGACAGAAAAGATTGCAAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	4											70.0	78.0	75.0					4																	56865776		2203	4300	6503	56560533	SO:0001583	missense	9662			AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.2245A>G	4.37:g.56865776A>G	ENSP00000257287:p.Lys749Glu		56560533	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	37	CCDS33986.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	13.99	2.400709	0.42613	.	.	ENSG00000174799	ENST00000257287	T	0.60672	0.17	5.18	2.69	0.31865	.	0.248856	0.47093	D	0.000257	T	0.47820	0.1466	M	0.61703	1.905	0.31832	N	0.624658	B	0.31837	0.342	B	0.36092	0.217	T	0.49652	-0.8917	10	0.05620	T	0.96	.	7.4383	0.27169	0.7817:0.1432:0.0751:0.0	.	749	Q66GS9	CP135_HUMAN	E	749	ENSP00000257287:K749E	ENSP00000257287:K749E	K	+	1	0	CEP135	56560533	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	2.637000	0.46553	0.287000	0.22375	-0.288000	0.09946	AAG		0.333	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009		Missense_Mutation
SMR3A	26952	broad.mit.edu	37	4	71227877	71227877	+	Silent	SNP	G	G	C	rs62322478	byFrequency	TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr4:71227877G>C	ENST00000226460.4	+	2	141	c.45G>C	c.(43-45)gcG>gcC	p.A15A		NM_012390.3	NP_036522.3	Q99954	SMR3A_HUMAN	submaxillary gland androgen regulated protein 3A	15						extracellular region (GO:0005576)		p.A15A(1)		endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)	15		all_hematologic(202;0.196)				CTCTTGCAGCGTGTTTCACAG	0.353																																																1	Substitution - coding silent(1)	ovary(1)	4											210.0	188.0	196.0					4																	71227877		2203	4300	6503	71262466	SO:0001819	synonymous_variant	26952			D89501	CCDS34000.1	4q13.3	2009-04-17	2008-02-27	2005-02-07	ENSG00000109208	ENSG00000109208			19216	protein-coding gene	gene with protein product			"""proline rich 5 (salivary)"", ""submaxillary gland androgen regulated protein 3 homolog A (mouse)"""	PROL5		9354371, 17512016	Standard	NM_012390		Approved	PBI, PRL5	uc003hfg.1	Q99954	OTTHUMG00000160839	ENST00000226460.4:c.45G>C	4.37:g.71227877G>C			71262466		Silent	SNP	ENST00000226460.4	37	CCDS34000.1	SNP	40	Broad																																																																																				0.353	SMR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362574.1	NM_012390		Silent
SDAD1	55153	broad.mit.edu	37	4	76892517	76892517	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr4:76892517A>G	ENST00000356260.5	-	9	924	c.806T>C	c.(805-807)gTg>gCg	p.V269A	SDAD1_ENST00000395711.4_Missense_Mutation_p.V232A|SDAD1_ENST00000513089.1_5'UTR	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	269					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)		p.V269A(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CACCTTGAGCACTTTCATTGC	0.378																																																1	Substitution - Missense(1)	ovary(1)	4											218.0	194.0	202.0					4																	76892517		2203	4300	6503	77111541	SO:0001583	missense	55153			AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.806T>C	4.37:g.76892517A>G	ENSP00000348596:p.Val269Ala		77111541	Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Missense_Mutation	SNP	ENST00000356260.5	37	CCDS3573.2	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	12.21	1.869720	0.33069	.	.	ENSG00000198301	ENST00000356260;ENST00000395711	T;T	0.73469	2.87;-0.75	5.26	5.26	0.73747	Armadillo-type fold (1);	0.182670	0.47852	D	0.000220	T	0.57125	0.2032	N	0.17723	0.515	0.58432	D	0.999998	B;B	0.15141	0.005;0.012	B;B	0.12837	0.008;0.008	T	0.53099	-0.8486	10	0.08381	T	0.77	-11.9602	13.1213	0.59327	1.0:0.0:0.0:0.0	.	232;269	E7EW05;Q9NVU7	.;SDA1_HUMAN	A	269;232	ENSP00000348596:V269A;ENSP00000379061:V232A	ENSP00000348596:V269A	V	-	2	0	SDAD1	77111541	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.312000	0.89976	1.984000	0.57885	0.455000	0.32223	GTG		0.378	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252418.3	NM_018115		Missense_Mutation
LPCAT1	79888	broad.mit.edu	37	5	1494896	1494896	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr5:1494896A>C	ENST00000283415.3	-	3	544	c.412T>G	c.(412-414)Tac>Gac	p.Y138D		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	138					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)	p.Y138D(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		GCGTCGAAGTAGGACGAGTGA	0.652																																																1	Substitution - Missense(1)	ovary(1)	5											96.0	82.0	87.0					5																	1494896		2203	4300	6503	1547896	SO:0001583	missense	79888			BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.412T>G	5.37:g.1494896A>C	ENSP00000283415:p.Tyr138Asp		1547896	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Missense_Mutation	SNP	ENST00000283415.3	37	CCDS3864.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	22.4	4.289496	0.80914	.	.	ENSG00000153395	ENST00000283415	D	0.93488	-3.23	4.99	4.99	0.66335	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.96137	0.8741	M	0.75264	2.295	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.96390	0.9288	10	0.59425	D	0.04	-27.6096	14.6639	0.68893	1.0:0.0:0.0:0.0	.	138	Q8NF37	PCAT1_HUMAN	D	138	ENSP00000283415:Y138D	ENSP00000283415:Y138D	Y	-	1	0	LPCAT1	1547896	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	8.591000	0.90824	1.860000	0.53959	0.460000	0.39030	TAC		0.652	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304032.1	NM_024830		Missense_Mutation
PCDHB11	56125	broad.mit.edu	37	5	140581012	140581012	+	Silent	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr5:140581012C>T	ENST00000354757.3	+	1	1665	c.1665C>T	c.(1663-1665)aaC>aaT	p.N555N	PCDHB11_ENST00000536699.1_Silent_p.N190N	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	555	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N555N(2)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGACGCCAACGACAACTCGC	0.716																																																2	Substitution - coding silent(2)	ovary(1)|endometrium(1)	5											11.0	15.0	14.0					5																	140581012		2165	4239	6404	140561196	SO:0001819	synonymous_variant	56125			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1665C>T	5.37:g.140581012C>T			140561196	B4DSF7|Q2M223	Silent	SNP	ENST00000354757.3	37	CCDS4253.1	SNP	19	Broad																																																																																				0.716	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		Silent
HIVEP1	3096	broad.mit.edu	37	6	12124959	12124959	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr6:12124959T>A	ENST00000379388.2	+	4	5263	c.4931T>A	c.(4930-4932)gTt>gAt	p.V1644D	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1644					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V1644D(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CAGAGTAGTGTTCCTGCTTAC	0.498																																																1	Substitution - Missense(1)	ovary(1)	6											140.0	137.0	138.0					6																	12124959		2084	4224	6308	12232945	SO:0001583	missense	3096			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.4931T>A	6.37:g.12124959T>A	ENSP00000368698:p.Val1644Asp		12232945	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	17.08	3.298134	0.60086	.	.	ENSG00000095951	ENST00000379388	T	0.11821	2.74	5.54	4.37	0.52481	.	0.000000	0.30347	N	0.009840	T	0.10423	0.0255	M	0.78637	2.42	0.37890	D	0.930686	P	0.51351	0.944	B	0.41036	0.346	T	0.04607	-1.0939	9	.	.	.	-12.574	11.5936	0.50959	0.0:0.0711:0.0:0.9289	.	1644	P15822	ZEP1_HUMAN	D	1644	ENSP00000368698:V1644D	.	V	+	2	0	HIVEP1	12232945	0.143000	0.22626	0.004000	0.12327	0.022000	0.10575	2.293000	0.43558	2.097000	0.63578	0.459000	0.35465	GTT		0.498	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114		Missense_Mutation
DCDC2	51473	broad.mit.edu	37	6	24357707	24357707	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr6:24357707T>C	ENST00000378454.3	-	1	573	c.272A>G	c.(271-273)cAg>cGg	p.Q91R	KAAG1_ENST00000274766.1_5'UTR	NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	91	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)			p.Q91R(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				GAAGGCTTCCTGGCCTCCAGC	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											48.0	45.0	46.0					6																	24357707		2203	4300	6503	24465686	SO:0001583	missense	51473			AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.272A>G	6.37:g.24357707T>C	ENSP00000367715:p.Gln91Arg		24465686	Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Missense_Mutation	SNP	ENST00000378454.3	37	CCDS4550.1	SNP	55	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.19|10.19	1.282258|1.282258	0.23392|0.23392	.|.	.|.	ENSG00000146038|ENSG00000146038	ENST00000378454;ENST00000451359|ENST00000436313	D|.	0.91237|.	-2.81|.	5.67|5.67	-1.93|-1.93	0.07594|0.07594	Doublecortin domain (5);|.	0.800688|.	0.11330|.	N|.	0.575147|.	T|T	0.02304|0.02304	0.0071|0.0071	N|N	0.00459|0.00459	-1.475|-1.475	0.80722|0.80722	D|D	1|1	B|.	0.09022|.	0.002|.	B|.	0.12156|.	0.007|.	T|T	0.39014|0.39014	-0.9634|-0.9634	10|5	0.13470|.	T|.	0.59|.	-11.9043|-11.9043	0.4813|0.4813	0.00548|0.00548	0.3446:0.143:0.2987:0.2137|0.3446:0.143:0.2987:0.2137	.|.	91|.	Q9UHG0|.	DCDC2_HUMAN|.	R|G	91|59	ENSP00000367715:Q91R|.	ENSP00000367715:Q91R|.	Q|R	-|-	2|1	0|2	DCDC2|DCDC2	24465686|24465686	0.980000|0.980000	0.34600|0.34600	0.999000|0.999000	0.59377|0.59377	0.941000|0.941000	0.58515|0.58515	0.226000|0.226000	0.17776|0.17776	0.055000|0.055000	0.16094|0.16094	0.533000|0.533000	0.62120|0.62120	CAG|AGG		0.577	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043604.1	NM_016356		Missense_Mutation
OR5V1	81696	broad.mit.edu	37	6	29323086	29323086	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr6:29323086T>C	ENST00000377154.1	-	4	1186	c.887A>G	c.(886-888)gAc>gGc	p.D296G	OR5V1_ENST00000543825.1_Missense_Mutation_p.D296G			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	296						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D296G(1)		breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TTCTTTGATGTCCTTATTCCT	0.378																																					Ovarian(32;43 883 21137 32120 42650)											1	Substitution - Missense(1)	ovary(1)	6											113.0	110.0	111.0					6																	29323086		2203	4300	6503	29431065	SO:0001583	missense	81696				CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.887A>G	6.37:g.29323086T>C	ENSP00000366359:p.Asp296Gly		29431065	A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Missense_Mutation	SNP	ENST00000377154.1	37	CCDS4657.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	18.86	3.714295	0.68730	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	T;T	0.39592	1.07;1.07	4.53	4.53	0.55603	.	0.000000	0.34580	N	0.003844	T	0.46425	0.1392	L	0.49126	1.545	0.46458	D	0.999056	D	0.69078	0.997	P	0.62885	0.908	T	0.51710	-0.8671	10	0.87932	D	0	-25.7631	13.9454	0.64082	0.0:0.0:0.0:1.0	.	296	Q9UGF6	OR5V1_HUMAN	G	296	ENSP00000366359:D296G;ENSP00000443309:D296G	ENSP00000366356:D296G	D	-	2	0	OR5V1	29431065	1.000000	0.71417	0.932000	0.37286	0.634000	0.38068	6.942000	0.75928	2.021000	0.59480	0.443000	0.29094	GAC		0.378	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076398.3			Missense_Mutation
C6orf222	389384	broad.mit.edu	37	6	36291094	36291094	+	Missense_Mutation	SNP	G	G	A	rs193920980		TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr6:36291094G>A	ENST00000437635.2	-	8	1624	c.1447C>T	c.(1447-1449)Cgg>Tgg	p.R483W		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	483								p.R483W(1)		breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						GTGGAGGGCCGATGGCCACCA	0.647																																																1	Substitution - Missense(1)	ovary(1)	6											66.0	75.0	72.0					6																	36291094		2203	4300	6503	36399072	SO:0001583	missense	389384				CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.1447C>T	6.37:g.36291094G>A	ENSP00000418983:p.Arg483Trp		36399072	B2RTY8	Missense_Mutation	SNP	ENST00000437635.2	37	CCDS34439.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	20.2	3.949675	0.73787	.	.	ENSG00000189325	ENST00000437635	T	0.62639	0.01	4.59	1.7	0.24286	.	0.306667	0.23752	N	0.044902	T	0.24392	0.0591	L	0.41492	1.28	0.09310	N	1	B	0.32128	0.357	B	0.26693	0.072	T	0.08432	-1.0722	10	0.51188	T	0.08	-15.9759	3.2857	0.06931	0.2183:0.0:0.5642:0.2175	.	483	P0C671	CF222_HUMAN	W	483	ENSP00000418983:R483W	ENSP00000418983:R483W	R	-	1	2	C6orf222	36399072	0.007000	0.16637	0.014000	0.15608	0.913000	0.54294	0.642000	0.24735	0.570000	0.29347	0.591000	0.81541	CGG		0.647	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040338.2	NM_001010903		Missense_Mutation
DAAM2	23500	broad.mit.edu	37	6	39846032	39846032	+	Missense_Mutation	SNP	G	G	A	rs377282686		TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr6:39846032G>A	ENST00000398904.2	+	12	1537	c.1355G>A	c.(1354-1356)cGg>cAg	p.R452Q	DAAM2_ENST00000538976.1_Missense_Mutation_p.R452Q|DAAM2_ENST00000274867.4_Missense_Mutation_p.R452Q			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	452					actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)			p.R452Q(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GAGAAGTTCCGGAAAGGTGAG	0.552																																																1	Substitution - Missense(1)	ovary(1)	6						G	GLN/ARG,GLN/ARG	1,4189		0,1,2094	79.0	89.0	86.0		1355,1355	5.4	1.0	6		86	0,8404		0,0,4202	no	missense,missense	DAAM2	NM_001201427.1,NM_015345.3	43,43	0,1,6296	AA,AG,GG		0.0,0.0239,0.0079	benign,benign	452/1069,452/1068	39846032	1,12593	2095	4202	6297	39954010	SO:0001583	missense	23500			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.1355G>A	6.37:g.39846032G>A	ENSP00000381876:p.Arg452Gln		39954010	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	37	CCDS56426.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	27.8	4.867365	0.91511	2.39E-4	0.0	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.73681	-0.77;-0.77;-0.77	5.45	5.45	0.79879	.	0.346678	0.28659	N	0.014562	T	0.79598	0.4473	L	0.47716	1.5	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.75484	0.986;0.968	T	0.77933	-0.2402	10	0.41790	T	0.15	.	18.8758	0.92334	0.0:0.0:1.0:0.0	.	452;452	G5EA45;Q86T65	.;DAAM2_HUMAN	Q	452	ENSP00000274867:R452Q;ENSP00000381876:R452Q;ENSP00000437808:R452Q	ENSP00000274867:R452Q	R	+	2	0	DAAM2	39954010	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.822000	0.99363	2.555000	0.86185	0.655000	0.94253	CGG		0.552	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1			Missense_Mutation
TJAP1	93643	broad.mit.edu	37	6	43471138	43471138	+	Splice_Site	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr6:43471138G>A	ENST00000372445.5	+	9	763		c.e9-1		TJAP1_ENST00000259751.1_Splice_Site|TJAP1_ENST00000436109.2_Splice_Site|TJAP1_ENST00000438588.2_Splice_Site|TJAP1_ENST00000372444.2_Splice_Site|TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000372452.1_Splice_Site|TJAP1_ENST00000372449.1_Splice_Site	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)						Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)		p.?(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CTGTGCTTCAGATCAAGAAGG	0.547																																																1	Unknown(1)	ovary(1)	6											67.0	61.0	63.0					6																	43471138		2203	4300	6503	43579116	SO:0001630	splice_region_variant	93643			AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.388-1G>A	6.37:g.43471138G>A			43579116	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Splice_Site_SNP	SNP	ENST00000372445.5	37	CCDS55004.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327944	0.81690	.	.	ENSG00000137221	ENST00000372444;ENST00000372445;ENST00000436109;ENST00000442878;ENST00000259751;ENST00000372454;ENST00000372452;ENST00000372449;ENST00000438588;ENST00000454762	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9761	0.92736	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TJAP1	43579116	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	9.416000	0.97383	2.507000	0.84556	0.462000	0.41574	.		0.547	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040629.1	NM_080604	Intron	Splice_Site_SNP
DNAH11	8701	broad.mit.edu	37	7	21912912	21912912	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr7:21912912G>C	ENST00000409508.3	+	74	12019	c.11988G>C	c.(11986-11988)aaG>aaC	p.K3996N	DNAH11_ENST00000328843.6_Missense_Mutation_p.K4003N	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	4003	AAA 6. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K4003N(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TGGTAGCCAAGTGGCTAGGAA	0.408									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	7											34.0	33.0	33.0					7																	21912912		1885	4111	5996	21879437	SO:0001583	missense	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.11988G>C	7.37:g.21912912G>C	ENSP00000475939:p.Lys3996Asn		21879437	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	15.47	2.844302	0.51164	.	.	ENSG00000105877	ENST00000328843	T	0.09255	3.0	5.78	1.82	0.25136	Dynein heavy chain (1);	0.317119	0.33854	N	0.004490	T	0.19127	0.0459	.	.	.	0.44908	D	0.997924	D	0.67145	0.996	P	0.61658	0.892	T	0.02574	-1.1139	9	0.31617	T	0.26	.	6.0514	0.19787	0.2727:0.1237:0.6037:0.0	.	4003	Q96DT5	DYH11_HUMAN	N	4003	ENSP00000330671:K4003N	ENSP00000330671:K4003N	K	+	3	2	DNAH11	21879437	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	0.384000	0.20668	0.330000	0.23485	0.650000	0.86243	AAG		0.408	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		Missense_Mutation
AUTS2	26053	broad.mit.edu	37	7	70236588	70236588	+	Silent	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr7:70236588C>T	ENST00000342771.4	+	11	2109	c.1788C>T	c.(1786-1788)ccC>ccT	p.P596P	AUTS2_ENST00000406775.2_Silent_p.P596P	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	596								p.P596P(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		TGATCCCACCCACTGGCCCTT	0.532																																																1	Substitution - coding silent(1)	ovary(1)	7											118.0	103.0	108.0					7																	70236588		2203	4300	6503	69874524	SO:0001819	synonymous_variant	26053			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1788C>T	7.37:g.70236588C>T			69874524	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	37	CCDS5539.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	8.397	0.841132	0.16891	.	.	ENSG00000158321	ENST00000443672	T	0.47869	0.83	5.64	4.57	0.56435	.	0.094705	0.85682	D	0.000000	T	0.45915	0.1366	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35375	-0.9791	6	.	.	.	-15.2841	6.0174	0.19611	0.2174:0.5911:0.1142:0.0774	.	.	.	.	L	123	ENSP00000393548:P123L	.	P	+	2	0	AUTS2	69874524	0.947000	0.32204	1.000000	0.80357	0.956000	0.61745	0.060000	0.14342	2.669000	0.90835	0.650000	0.86243	CCA		0.532	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2			Silent
VPS37D	155382	broad.mit.edu	37	7	73085437	73085438	+	Missense_Mutation	DNP	AC	AC	TT	rs543109499		TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr7:73085437_73085438AC>TT	ENST00000324941.4	+	4	621_622	c.487_488AC>TT	c.(487-489)ACg>TTg	p.T163L	VPS37D_ENST00000451519.1_Missense_Mutation_p.T78L	NM_001077621.1	NP_001071089.1			vacuolar protein sorting 37 homolog D (S. cerevisiae)									p.T163L(1)		central_nervous_system(1)|ovary(1)	2		Lung NSC(55;0.0908)|all_lung(88;0.198)				CCTGAGGCGGACGCAGGCAGAG	0.708																																																1	Substitution - Missense(1)	ovary(1)	7																																								72723374	SO:0001583	missense	155382			AY081952	CCDS43596.1	7q11.23	2007-07-27	2006-04-04	2005-08-18	ENSG00000176428	ENSG00000176428			18287	protein-coding gene	gene with protein product		610039	"""Williams Beuren syndrome chromosome region 24"", ""vacuolar protein sorting 37D (yeast)"""	WBSCR24		15218037	Standard	NM_001077621		Approved	MGC35352	uc003tyr.3	Q86XT2	OTTHUMG00000157227	Exception_encountered	7.37:g.73085437_73085438delinsTT	ENSP00000320416:p.Thr163Leu		72723373		Missense_Mutation	DNP	ENST00000324941.4	37	CCDS43596.1	DNP	10	Broad																																																																																				0.708	VPS37D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348064.1	NM_152560		Missense_Mutation
COL1A2	1278	broad.mit.edu	37	7	94052392	94052392	+	Missense_Mutation	SNP	G	G	A	rs112697991		TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr7:94052392G>A	ENST00000297268.6	+	40	2998	c.2527G>A	c.(2527-2529)Gct>Act	p.A843T		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	843			Missing (in OI2). {ECO:0000269|PubMed:1339453}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.A843T(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CCCTGGCTTCGCTGGTGAGAA	0.527										HNSCC(75;0.22)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		16689	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	7						G	THR/ALA	0,4406		0,0,2203	128.0	121.0	123.0		2527	-1.0	0.9	7	dbSNP_132	123	1,8599	1.2+/-3.3	0,1,4299	no	missense	COL1A2	NM_000089.3	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	843/1367	94052392	1,13005	2203	4300	6503	93890328	SO:0001583	missense	1278			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2527G>A	7.37:g.94052392G>A	ENSP00000297268:p.Ala843Thr		93890328	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	SNP	38	Broad	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	15.56	2.870574	0.51588	0.0	1.16E-4	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.93426	-3.22	5.23	-1.03	0.10102	.	0.591070	0.17334	N	0.178009	D	0.83672	0.5305	N	0.16833	0.445	0.20196	N	0.99992	B	0.02656	0.0	B	0.04013	0.001	T	0.72821	-0.4177	10	0.56958	D	0.05	.	5.7653	0.18224	0.4096:0.2333:0.357:0.0	.	843	P08123	CO1A2_HUMAN	T	843;844	ENSP00000297268:A843T	ENSP00000297268:A843T	A	+	1	0	COL1A2	93890328	0.000000	0.05858	0.927000	0.36925	0.950000	0.60333	-2.788000	0.00768	-0.177000	0.10690	0.563000	0.77884	GCT		0.527	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089		Missense_Mutation
TMEM168	64418	broad.mit.edu	37	7	112407693	112407693	+	Silent	SNP	A	A	C			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr7:112407693A>C	ENST00000312814.6	-	5	2213	c.1653T>G	c.(1651-1653)ccT>ccG	p.P551P	TMEM168_ENST00000454074.1_Silent_p.P551P	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	551						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)		p.P551P(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						CTTTCACCCAAGGGGTTGAAT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	7											78.0	81.0	80.0					7																	112407693		2203	4300	6503	112194929	SO:0001819	synonymous_variant	64418				CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.1653T>G	7.37:g.112407693A>C			112194929	A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Silent	SNP	ENST00000312814.6	37	CCDS5757.1	SNP	3	Broad																																																																																				0.413	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338696.4	NM_022484		Silent
RP1L1	94137	broad.mit.edu	37	8	10466744	10466744	+	Missense_Mutation	SNP	G	G	A	rs201695025		TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr8:10466744G>A	ENST00000382483.3	-	4	5087	c.4864C>T	c.(4864-4866)Cgg>Tgg	p.R1622W		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1702					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.R1622W(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCCAGGGTCCGCTCAGAGAAG	0.716																																																1	Substitution - Missense(1)	ovary(1)	8						G	TRP/ARG	0,3932		0,0,1966	15.0	19.0	18.0		4864	4.4	0.1	8		18	1,8269		0,1,4134	yes	missense	RP1L1	NM_178857.5	101	0,1,6100	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging	1622/2401	10466744	1,12201	1966	4135	6101	10504154	SO:0001583	missense	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4864C>T	8.37:g.10466744G>A	ENSP00000371923:p.Arg1622Trp		10504154	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	9.044	0.990449	0.18966	0.0	1.21E-4	ENSG00000183638	ENST00000382483	T	0.04862	3.54	4.38	4.38	0.52667	.	.	.	.	.	T	0.07999	0.0200	N	0.14661	0.345	0.09310	N	1	D	0.71674	0.998	P	0.55667	0.781	T	0.28267	-1.0049	9	0.62326	D	0.03	-0.6309	7.5962	0.28050	0.0:0.1787:0.6368:0.1845	.	1622	A6NKC6	.	W	1622	ENSP00000371923:R1622W	ENSP00000371923:R1622W	R	-	1	2	RP1L1	10504154	0.008000	0.16893	0.077000	0.20336	0.146000	0.21551	0.866000	0.27954	2.265000	0.75225	0.491000	0.48974	CGG		0.716	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			Missense_Mutation
INTS10	55174	broad.mit.edu	37	8	19690775	19690775	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr8:19690775G>T	ENST00000397977.3	+	12	1871	c.1473G>T	c.(1471-1473)gaG>gaT	p.E491D		NM_018142.2	NP_060612.2	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	491					snRNA processing (GO:0016180)	integrator complex (GO:0032039)		p.E491D(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	20				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		GGACCCTGGAGCATCAGAGGG	0.577																																																1	Substitution - Missense(1)	ovary(1)	8											47.0	52.0	51.0					8																	19690775		2087	4225	6312	19735055	SO:0001583	missense	55174			AK001431	CCDS6011.2	8p21.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000104613	ENSG00000104613			25548	protein-coding gene	gene with protein product		611353	"""chromosome 8 open reading frame 35"""	C8orf35		16239144	Standard	XM_005273558		Approved	FLJ10569, INT10	uc003wzj.3	Q9NVR2	OTTHUMG00000131065	ENST00000397977.3:c.1473G>T	8.37:g.19690775G>T	ENSP00000381064:p.Glu491Asp		19735055	Q6IA93|Q7L538|Q7L8C8|Q9H3W8	Missense_Mutation	SNP	ENST00000397977.3	37	CCDS6011.2	SNP	34	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.14|16.14	3.039820|3.039820	0.55003|0.55003	.|.	.|.	ENSG00000104613|ENSG00000104613	ENST00000518799|ENST00000397977	.|.	.|.	.|.	5.37|5.37	1.31|1.31	0.21738|0.21738	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63977|0.63977	0.2557|0.2557	L|L	0.50333|0.50333	1.59|1.59	0.46901|0.46901	D|D	0.999249|0.999249	.|D	.|0.61697	.|0.99	.|D	.|0.73380	.|0.98	T|T	0.56709|0.56709	-0.7934|-0.7934	5|9	.|0.28530	.|T	.|0.3	-25.7053|-25.7053	8.751|8.751	0.34616|0.34616	0.5518:0.0:0.4482:0.0|0.5518:0.0:0.4482:0.0	.|.	.|491	.|Q9NVR2	.|INT10_HUMAN	S|D	74|491	.|.	.|ENSP00000381064:E491D	A|E	+|+	1|3	0|2	INTS10|INTS10	19735055|19735055	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.917000|0.917000	0.54804|0.54804	0.902000|0.902000	0.28459|0.28459	0.010000|0.010000	0.14839|0.14839	-0.222000|-0.222000	0.12452|0.12452	GCA|GAG		0.577	INTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253724.2	NM_018142		Missense_Mutation
SULF1	23213	broad.mit.edu	37	8	70540087	70540087	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr8:70540087C>A	ENST00000260128.4	+	17	2745	c.2028C>A	c.(2026-2028)agC>agA	p.S676R	SULF1_ENST00000402687.4_Missense_Mutation_p.S676R|SULF1_ENST00000458141.2_Missense_Mutation_p.S676R|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000419716.3_Missense_Mutation_p.S676R	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	676					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.S676R(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			AGGAATGTAGCTGCAGTAAAC	0.413																																																1	Substitution - Missense(1)	ovary(1)	8											123.0	141.0	135.0					8																	70540087		2203	4300	6503	70702641	SO:0001583	missense	23213			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2028C>A	8.37:g.70540087C>A	ENSP00000260128:p.Ser676Arg		70702641	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	37	CCDS6204.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	11.81	1.750589	0.31046	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	D;D;D;D	0.98822	-5.16;-5.16;-5.16;-5.16	4.92	3.02	0.34903	Extracellular sulfatase, C-terminal (1);Alkaline-phosphatase-like, core domain (1);	0.673364	0.15436	N	0.262443	D	0.95475	0.8530	N	0.22421	0.69	0.24954	N	0.991776	B	0.19706	0.038	B	0.23852	0.049	D	0.91938	0.5560	10	0.62326	D	0.03	.	7.987	0.30218	0.0:0.7187:0.1352:0.1461	.	676	Q8IWU6	SULF1_HUMAN	R	676	ENSP00000403040:S676R;ENSP00000260128:S676R;ENSP00000385704:S676R;ENSP00000390315:S676R	ENSP00000260128:S676R	S	+	3	2	SULF1	70702641	1.000000	0.71417	0.091000	0.20842	0.015000	0.08874	1.590000	0.36654	1.004000	0.39156	0.462000	0.41574	AGC		0.413	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170		Missense_Mutation
PDP1	54704	broad.mit.edu	37	8	94935840	94935840	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr8:94935840T>G	ENST00000297598.4	+	2	1822	c.1553T>G	c.(1552-1554)aTt>aGt	p.I518S	PDP1_ENST00000396200.3_Missense_Mutation_p.I543S|PDP1_ENST00000520728.1_Missense_Mutation_p.I518S|PDP1_ENST00000517764.1_Missense_Mutation_p.I518S	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	518					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.I518S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						AGAGATGACATTACAATCATT	0.423																																																1	Substitution - Missense(1)	ovary(1)	8											98.0	91.0	94.0					8																	94935840		2203	4300	6503	95005016	SO:0001583	missense	54704			AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.1553T>G	8.37:g.94935840T>G	ENSP00000297598:p.Ile518Ser		95005016	B3KX71|J3KPU0|Q5U5K1	Missense_Mutation	SNP	ENST00000297598.4	37	CCDS6259.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	17.44	3.390532	0.62066	.	.	ENSG00000164951	ENST00000297598;ENST00000520728;ENST00000396200;ENST00000517764	T;T;T;T	0.13089	2.62;2.62;2.62;2.62	6.17	6.17	0.99709	Protein phosphatase 2C-like (4);	0.000000	0.85682	D	0.000000	T	0.41994	0.1183	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	T	0.34925	-0.9809	10	0.87932	D	0	-19.8909	16.8222	0.85835	0.0:0.0:0.0:1.0	.	569;518	B4DYX8;Q9P0J1	.;PDP1_HUMAN	S	518;518;543;518	ENSP00000297598:I518S;ENSP00000428317:I518S;ENSP00000379503:I543S;ENSP00000430380:I518S	ENSP00000297598:I518S	I	+	2	0	PDP1	95005016	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.671000	0.83941	2.371000	0.80710	0.533000	0.62120	ATT		0.423	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378415.2	NM_018444		Missense_Mutation
FER1L6	654463	broad.mit.edu	37	8	125115513	125115513	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr8:125115513G>A	ENST00000522917.1	+	39	5458	c.5252G>A	c.(5251-5253)cGt>cAt	p.R1751H	FER1L6_ENST00000399018.1_Missense_Mutation_p.R1751H|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1751						integral component of membrane (GO:0016021)		p.R1751H(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AAACGTGTGCGTGGCTGGTGG	0.483																																																1	Substitution - Missense(1)	ovary(1)	8											138.0	134.0	135.0					8																	125115513		1925	4149	6074	125184694	SO:0001583	missense	654463			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.5252G>A	8.37:g.125115513G>A	ENSP00000428280:p.Arg1751His		125184694		Missense_Mutation	SNP	ENST00000522917.1	37	CCDS43767.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218563	0.79464	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.82526	-1.62;-1.62	5.58	5.58	0.84498	.	0.056479	0.64402	U	0.000002	D	0.91257	0.7244	M	0.74881	2.28	0.45634	D	0.998561	D	0.89917	1.0	D	0.79108	0.992	D	0.91169	0.4967	10	0.62326	D	0.03	-19.1959	19.9313	0.97120	0.0:0.0:1.0:0.0	.	1751	Q2WGJ9	FR1L6_HUMAN	H	1751	ENSP00000428280:R1751H;ENSP00000381982:R1751H	ENSP00000381982:R1751H	R	+	2	0	FER1L6	125184694	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.311000	0.51919	2.778000	0.95560	0.655000	0.94253	CGT		0.483	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		Missense_Mutation
NEK6	10783	broad.mit.edu	37	9	127110067	127110067	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr9:127110067A>G	ENST00000320246.5	+	9	942	c.797A>G	c.(796-798)tAc>tGc	p.Y266C	AL137846.1_ENST00000583657.1_RNA|NEK6_ENST00000373603.1_Missense_Mutation_p.Y266C|NEK6_ENST00000545174.1_Missense_Mutation_p.Y266C|NEK6_ENST00000373600.3_Missense_Mutation_p.Y300C|NEK6_ENST00000394199.2_Missense_Mutation_p.Y300C|NEK6_ENST00000540326.1_Missense_Mutation_p.Y284C|NEK6_ENST00000539416.1_Missense_Mutation_p.Y291C|NEK6_ENST00000546191.1_Missense_Mutation_p.Y266C	NM_014397.5	NP_055212.2	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cellular senescence (GO:2000772)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)	p.Y259C(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15						CAGTGTGACTACCCCCCACTC	0.617																																					NSCLC(122;934 1785 18647 44295 45571)											1	Substitution - Missense(1)	ovary(1)	9											136.0	140.0	139.0					9																	127110067		2203	4300	6503	126149888	SO:0001583	missense	10783			AF087909	CCDS6854.1, CCDS48015.1, CCDS55338.1, CCDS55339.1	9q33.3-q34.11	2012-11-15	2012-11-15		ENSG00000119408	ENSG00000119408			7749	protein-coding gene	gene with protein product	"""putative serine-threonine protein kinase"""	604884	"""NIMA (never in mitosis gene a)-related kinase 6"""			10702691	Standard	NM_001145001		Approved	SID6-1512	uc004boh.3	Q9HC98	OTTHUMG00000020650	ENST00000320246.5:c.797A>G	9.37:g.127110067A>G	ENSP00000319734:p.Tyr266Cys		126149888	B7Z2D9|Q5TBG3|Q5TBG9|Q6FG86|Q6IAR3|Q96E83|Q9ULX2	Missense_Mutation	SNP	ENST00000320246.5	37	CCDS6854.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	17.70	3.455149	0.63401	.	.	ENSG00000119408	ENST00000373603;ENST00000540326;ENST00000373600;ENST00000320246;ENST00000373601;ENST00000545174;ENST00000454453;ENST00000394199;ENST00000546191;ENST00000539416	T;T;T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;1.0;-0.17;-0.17;-0.17	5.03	5.03	0.67393	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.76543	0.4002	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.994;0.986;0.988;0.986	T	0.79087	-0.1947	10	0.66056	D	0.02	.	14.1149	0.65146	1.0:0.0:0.0:0.0	.	291;300;266;284	Q9HC98-4;Q9HC98-2;Q9HC98;Q9HC98-3	.;.;NEK6_HUMAN;.	C	266;284;300;266;198;266;198;300;266;291	ENSP00000362705:Y266C;ENSP00000441469:Y284C;ENSP00000362702:Y300C;ENSP00000319734:Y266C;ENSP00000442636:Y266C;ENSP00000405215:Y198C;ENSP00000377749:Y300C;ENSP00000441426:Y266C;ENSP00000439651:Y291C	ENSP00000319734:Y266C	Y	+	2	0	NEK6	126149888	1.000000	0.71417	1.000000	0.80357	0.296000	0.27459	8.742000	0.91588	2.118000	0.64928	0.533000	0.62120	TAC		0.617	NEK6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054016.1	NM_014397		Missense_Mutation
NUP214	8021	broad.mit.edu	37	9	134108873	134108873	+	Silent	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chr9:134108873G>A	ENST00000359428.5	+	36	6416	c.6272G>A	c.(6271-6273)tGa>tAa	p.*2091*	NUP214_ENST00000451030.1_Silent_p.*2092*|NUP214_ENST00000411637.2_Silent_p.*2081*|NUP214_ENST00000483497.2_Silent_p.*917*			P35658	NU214_HUMAN	nucleoporin 214kDa	0					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)	p.*2091*(1)		NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TGGCGAAGCTGAGGGCGTGTC	0.597			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	1	Substitution - coding silent(1)	ovary(1)	9											92.0	71.0	78.0					9																	134108873		2203	4300	6503	133098694	SO:0001819	synonymous_variant	8021			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.6272G>A	9.37:g.134108873G>A			133098694	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Silent	SNP	ENST00000359428.5	37	CCDS6940.1	SNP	45	Broad																																																																																				0.597	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085		Silent
REPS2	9185	broad.mit.edu	37	X	17153387	17153387	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chrX:17153387G>T	ENST00000357277.3	+	16	1837	c.1666G>T	c.(1666-1668)Gta>Tta	p.V556L	REPS2_ENST00000380064.4_Missense_Mutation_p.V355L|REPS2_ENST00000469714.1_3'UTR|REPS2_ENST00000303843.7_Missense_Mutation_p.V555L	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	556	Interaction with RALBP1.				epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)	p.V417L(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					TCCACAGGATGTACTGTATTC	0.433																																																1	Substitution - Missense(1)	ovary(1)	X											109.0	113.0	112.0					X																	17153387		2203	4299	6502	17063308	SO:0001583	missense	9185			AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.1666G>T	X.37:g.17153387G>T	ENSP00000349824:p.Val556Leu		17063308	A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Missense_Mutation	SNP	ENST00000357277.3	37	CCDS14180.2	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	10.27	1.303763	0.23736	.	.	ENSG00000169891	ENST00000357277;ENST00000380063;ENST00000303843;ENST00000380064	T;T;T	0.30714	1.52;1.52;1.54	5.27	-7.99	0.01131	.	1.698360	0.02752	N	0.117616	T	0.15003	0.0362	N	0.16478	0.41	0.09310	N	1	B;B;B	0.11235	0.0;0.004;0.0	B;B;B	0.09377	0.0;0.004;0.001	T	0.12243	-1.0555	10	0.23302	T	0.38	0.9889	5.7791	0.18295	0.2033:0.227:0.4811:0.0885	.	355;555;556	B4DQQ8;Q8NFH8-4;Q8NFH8	.;.;REPS2_HUMAN	L	556;556;555;355	ENSP00000349824:V556L;ENSP00000306033:V555L;ENSP00000369404:V355L	ENSP00000306033:V555L	V	+	1	0	REPS2	17063308	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	-0.031000	0.12287	-1.296000	0.02353	-0.340000	0.08031	GTA		0.433	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316778.1	NM_004726		Missense_Mutation
ZXDB	158586	broad.mit.edu	37	X	57620274	57620274	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chrX:57620274G>C	ENST00000374888.1	+	1	2006	c.1793G>C	c.(1792-1794)aGa>aCa	p.R598T		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	598	Required for transcriptional activation. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.R598T(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						ACCAGCCAGAGACAGAATGAT	0.478																																																1	Substitution - Missense(1)	ovary(1)	X											123.0	97.0	106.0					X																	57620274		2203	4298	6501	57636999	SO:0001583	missense	158586			L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.1793G>C	X.37:g.57620274G>C	ENSP00000364023:p.Arg598Thr		57636999	A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	37	CCDS35313.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	.	4.304	0.055613	0.08291	.	.	ENSG00000198455	ENST00000374888	T	0.09350	2.99	3.5	2.53	0.30540	.	0.250608	0.38837	N	0.001556	T	0.04998	0.0134	N	0.08118	0	0.20764	N	0.99986	B	0.19817	0.039	B	0.17722	0.019	T	0.40776	-0.9545	10	0.22109	T	0.4	.	9.7387	0.40404	0.0:0.2099:0.7901:0.0	.	598	P98169	ZXDB_HUMAN	T	598	ENSP00000364023:R598T	ENSP00000364023:R598T	R	+	2	0	ZXDB	57636999	1.000000	0.71417	0.996000	0.52242	0.429000	0.31625	5.678000	0.68153	1.762000	0.52044	0.483000	0.47432	AGA		0.478	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157		Missense_Mutation
RBM41	55285	broad.mit.edu	37	X	106312507	106312507	+	Silent	SNP	G	G	A			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chrX:106312507G>A	ENST00000372479.3	-	6	1083	c.1053C>T	c.(1051-1053)ggC>ggT	p.G351G	RBM41_ENST00000372487.1_Silent_p.G351G	NM_018301.3	NP_060771.3	Q96IZ5	RBM41_HUMAN	RNA binding motif protein 41	351	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.G351G(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	13						TAAAAGCCTGGCCCCTCATTC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	X											145.0	131.0	136.0					X																	106312507		2203	4300	6503	106199163	SO:0001819	synonymous_variant	55285			BC006986	CCDS14526.1, CCDS55472.1	Xq22.3	2013-02-12			ENSG00000089682	ENSG00000089682		"""RNA binding motif (RRM) containing"""	25617	protein-coding gene	gene with protein product						12477932	Standard	NM_001171080		Approved	FLJ11016	uc004emz.3	Q96IZ5	OTTHUMG00000022156	ENST00000372479.3:c.1053C>T	X.37:g.106312507G>A			106199163	Q5JSN7|Q5JSN8|Q9H8F7|Q9NV04	Silent	SNP	ENST00000372479.3	37	CCDS14526.1	SNP	42	Broad																																																																																				0.443	RBM41-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057819.1	NM_018301		Silent
BCORL1	63035	broad.mit.edu	37	X	129185903	129185903	+	Missense_Mutation	SNP	G	G	A	rs150455678	byFrequency	TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chrX:129185903G>A	ENST00000218147.7	+	12	4962	c.4765G>A	c.(4765-4767)Gat>Aat	p.D1589N	BCORL1_ENST00000303743.5_Missense_Mutation_p.D1663N|BCORL1_ENST00000540052.1_Missense_Mutation_p.D1589N|BCORL1_ENST00000359304.2_Missense_Mutation_p.D1459N			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1589					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						AGAAGGAGACGATCCGATGGA	0.507																																																0			X						G	ASN/ASP	1,3834		0,1,1631,571	195.0	154.0	167.0		4765	4.7	0.1	X	dbSNP_134	167	1,6727		0,1,2427,1872	no	missense	BCORL1	NM_021946.4	23	0,2,4058,2443	AA,AG,GG,G		0.0149,0.0261,0.0189	benign	1589/1712	129185903	2,10561	2203	4300	6503	129013584	SO:0001583	missense	63035			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.4765G>A	X.37:g.129185903G>A	ENSP00000218147:p.Asp1589Asn		129013584	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	37	CCDS14616.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	16.04	3.011192	0.54361	2.61E-4	1.49E-4	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822	T;T;T;T;T	0.41400	1.0;1.32;1.01;1.0;1.37	5.53	4.66	0.58398	.	0.231517	0.22261	N	0.062411	T	0.43590	0.1254	L	0.32530	0.975	0.30399	N	0.780246	D;P	0.71674	0.998;0.883	P;B	0.56751	0.805;0.218	T	0.39231	-0.9624	10	0.30078	T	0.28	-0.5301	9.4994	0.39008	0.1677:0.0:0.8323:0.0	.	1663;1589	Q5H9F3-3;Q5H9F3	.;BCORL_HUMAN	N	1589;1663;1459;1589;1263	ENSP00000218147:D1589N;ENSP00000307541:D1663N;ENSP00000352253:D1459N;ENSP00000437775:D1589N;ENSP00000399483:D1263N	ENSP00000218147:D1589N	D	+	1	0	BCORL1	129013584	1.000000	0.71417	0.060000	0.19600	0.351000	0.29236	5.264000	0.65513	1.088000	0.41272	0.513000	0.50165	GAT		0.507	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		Missense_Mutation
SLITRK2	84631	broad.mit.edu	37	X	144904007	144904007	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2262-01	TCGA-24-2262-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2262-01	TCGA-24-2262-11	g.chrX:144904007C>T	ENST00000370490.1	+	1	4319	c.64C>T	c.(64-66)Cgc>Tgc	p.R22C	SLITRK2_ENST00000413937.2_Missense_Mutation_p.R22C|SLITRK2_ENST00000434188.2_Missense_Mutation_p.R22C|SLITRK2_ENST00000447897.2_Missense_Mutation_p.R22C|SLITRK2_ENST00000428560.2_Missense_Mutation_p.R22C			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	22					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.R22C(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GACAGAGAGTCGCAAAACTGC	0.468																																																1	Substitution - Missense(1)	ovary(1)	X											74.0	65.0	68.0					X																	144904007		2203	4300	6503	144711699	SO:0001583	missense	84631			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.64C>T	X.37:g.144904007C>T	ENSP00000359521:p.Arg22Cys		144711699	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	21.2	4.105992	0.77096	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.52754	0.7;0.65;0.65;0.65;0.65;0.65	4.56	4.56	0.56223	.	0.135690	0.45867	U	0.000324	T	0.53965	0.1829	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	P	0.61722	0.893	T	0.51996	-0.8634	10	0.36615	T	0.2	-5.6787	13.8997	0.63794	0.0:1.0:0.0:0.0	.	22	Q9H156	SLIK2_HUMAN	C	22	ENSP00000334374:R22C;ENSP00000411681:R22C;ENSP00000359521:R22C;ENSP00000397015:R22C;ENSP00000407347:R22C;ENSP00000412010:R22C	ENSP00000334374:R22C	R	+	1	0	SLITRK2	144711699	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.493000	0.60341	1.846000	0.53633	0.436000	0.28706	CGC		0.468	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		Missense_Mutation
