#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
VPS13D	55187	broad.mit.edu	37	1	12557552	12557552	+	Splice_Site	SNP	A	A	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr1:12557552A>G	ENST00000358136.3	+	68	12792		c.e68-1		VPS13D_ENST00000543710.1_Splice_Site|VPS13D_ENST00000356315.4_Splice_Site|VPS13D_ENST00000543766.1_Splice_Site|VPS13D_ENST00000471923.1_Splice_Site|VPS13D_ENST00000496628.1_Splice_Site	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)									p.?(1)		NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TTACCCATCTAGGACTCAAGC	0.502																																																1	Unknown(1)	ovary(1)	1											60.0	58.0	59.0					1																	12557552		2203	4300	6503	12480139	SO:0001630	splice_region_variant	55187			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.12663-1A>G	1.37:g.12557552A>G			12480139		Splice_Site_SNP	SNP	ENST00000358136.3	37	CCDS30588.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	22.3	4.274340	0.80580	.	.	ENSG00000048707	ENST00000356315;ENST00000358136;ENST00000011700;ENST00000543766;ENST00000543710	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7393	0.77876	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	VPS13D	12480139	1.000000	0.71417	0.937000	0.37676	0.934000	0.57294	7.663000	0.83820	2.308000	0.77769	0.533000	0.62120	.		0.502	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	Intron	Splice_Site_SNP
ACTL8	81569	broad.mit.edu	37	1	18152313	18152313	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr1:18152313C>T	ENST00000375406.1	+	3	616	c.400C>T	c.(400-402)Cag>Tag	p.Q134*		NM_030812.2	NP_110439.2	Q9H568	ACTL8_HUMAN	actin-like 8	134					epithelial cell differentiation (GO:0030855)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.Q134*(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	28		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		CGACCAGCTGCAGATGTCCCT	0.612											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Nonsense(1)	ovary(1)	1											87.0	73.0	78.0					1																	18152313		2203	4300	6503	18024900	SO:0001587	stop_gained	81569			AK057339	CCDS183.1	1p36.2-p35	2009-03-25			ENSG00000117148	ENSG00000117148			24018	protein-coding gene	gene with protein product	"""cancer/testis antigen 57"""						Standard	NM_030812		Approved	CT57	uc001bat.3	Q9H568	OTTHUMG00000002512	ENST00000375406.1:c.400C>T	1.37:g.18152313C>T	ENSP00000364555:p.Gln134*	723	18024900	Q13104|Q96M75	Nonsense_Mutation	SNP	ENST00000375406.1	37	CCDS183.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	14.06	2.421439	0.42918	.	.	ENSG00000117148	ENST00000375406	.	.	.	4.52	-3.74	0.04385	.	0.493419	0.16850	N	0.196985	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-24.2448	13.1846	0.59673	0.0:0.5892:0.2982:0.1126	.	.	.	.	X	134	.	ENSP00000364555:Q134X	Q	+	1	0	ACTL8	18024900	1.000000	0.71417	0.686000	0.30086	0.006000	0.05464	2.926000	0.48892	-0.396000	0.07703	-0.951000	0.02657	CAG		0.612	ACTL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007143.1	NM_030812		Nonsense_Mutation
ZMYM6	9204	broad.mit.edu	37	1	35480424	35480424	+	Silent	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr1:35480424T>C	ENST00000357182.4	-	6	896	c.669A>G	c.(667-669)aaA>aaG	p.K223K	ZMYM6_ENST00000487874.1_Silent_p.K223K|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000373340.2_Silent_p.K223K	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	223					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K223K(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TAGAGTGAAATTTTGAAAAAC	0.373																																																1	Substitution - coding silent(1)	ovary(1)	1											99.0	90.0	93.0					1																	35480424		2203	4300	6503	35253011	SO:0001819	synonymous_variant	9204			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.669A>G	1.37:g.35480424T>C			35253011	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Silent	SNP	ENST00000357182.4	37	CCDS387.2	SNP	52	Broad																																																																																				0.373	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167		Silent
LHX8	431707	broad.mit.edu	37	1	75622678	75622678	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr1:75622678C>A	ENST00000294638.5	+	9	1575	c.911C>A	c.(910-912)cCa>cAa	p.P304Q	LHX8_ENST00000356261.3_Missense_Mutation_p.P294Q	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	304					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.P304Q(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						AGGCTGTCTCCACCCATGTTA	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											250.0	217.0	228.0					1																	75622678		2203	4300	6503	75395266	SO:0001583	missense	431707			AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.911C>A	1.37:g.75622678C>A	ENSP00000294638:p.Pro304Gln		75395266	E9PGE3	Missense_Mutation	SNP	ENST00000294638.5	37	CCDS30756.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596593	0.66332	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.86865	-2.18;-2.16	5.12	5.12	0.69794	.	0.209202	0.51477	D	0.000098	D	0.90177	0.6930	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90095	0.4180	10	0.52906	T	0.07	.	18.9441	0.92615	0.0:1.0:0.0:0.0	.	304	Q68G74	LHX8_HUMAN	Q	304;294	ENSP00000294638:P304Q;ENSP00000348597:P294Q	ENSP00000294638:P304Q	P	+	2	0	LHX8	75395266	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.677000	0.68142	2.556000	0.86216	0.455000	0.32223	CCA		0.493	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933		Missense_Mutation
HSD3B2	3284	broad.mit.edu	37	1	119964949	119964949	+	Silent	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr1:119964949T>C	ENST00000543831.1	+	4	1074	c.825T>C	c.(823-825)ttT>ttC	p.F275F	HSD3B2_ENST00000369416.3_Silent_p.F275F	NM_001166120.1	NP_001159592.1	P26439	3BHS2_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2	275					androgen biosynthetic process (GO:0006702)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)	p.F275F(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(19)|ovary(2)|skin(1)	27	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	Corticotropin(DB01285)|Medroxyprogesterone Acetate(DB00603)|Trilostane(DB01108)	GCAAAGAGTTTGGCCTCCGCC	0.473																																																1	Substitution - coding silent(1)	ovary(1)	1											79.0	83.0	82.0					1																	119964949		2203	4300	6503	119766472	SO:0001819	synonymous_variant	3284			BC038419	CCDS902.1	1p12	2014-06-03			ENSG00000203859	ENSG00000203859	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5218	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 2"""	613890				1363812, 19027726	Standard	NM_000198		Approved	SDR11E2	uc001eht.3	P26439	OTTHUMG00000012526	ENST00000543831.1:c.825T>C	1.37:g.119964949T>C			119766472	A2RRA5|Q16010|Q53GD4|Q6AI10|Q6LDB9|Q99890|Q9UD08	Silent	SNP	ENST00000543831.1	37	CCDS902.1	SNP	63	Broad																																																																																				0.473	HSD3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034994.1	NM_000198		Silent
LINGO4	339398	broad.mit.edu	37	1	151773906	151773906	+	Silent	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr1:151773906T>C	ENST00000368820.3	-	2	2212	c.1275A>G	c.(1273-1275)gcA>gcG	p.A425A	RP11-98D18.17_ENST00000601909.1_lincRNA	NM_001004432.2	NP_001004432.1	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	425	Ig-like C2-type.					integral component of membrane (GO:0016021)		p.A425A(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CGCCCTCCTCTGCAATGACCC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	1											57.0	59.0	58.0					1																	151773906		2203	4300	6503	150040530	SO:0001819	synonymous_variant	339398				CCDS30855.1	1q21.3	2013-01-11	2007-02-01	2007-02-01	ENSG00000213171	ENSG00000213171		"""Immunoglobulin superfamily / I-set domain containing"""	31814	protein-coding gene	gene with protein product		609794	"""leucine rich repeat neuronal 6D"""	LRRN6D			Standard	NM_001004432		Approved		uc001ezf.1	Q6UY18	OTTHUMG00000013059	ENST00000368820.3:c.1275A>G	1.37:g.151773906T>C			150040530		Silent	SNP	ENST00000368820.3	37	CCDS30855.1	SNP	55	Broad																																																																																				0.617	LINGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036639.1	XM_291387		Silent
IVL	3713	broad.mit.edu	37	1	152882801	152882801	+	Silent	SNP	G	G	A	rs11205136	byFrequency	TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr1:152882801G>A	ENST00000368764.3	+	2	592	c.528G>A	c.(526-528)ccG>ccA	p.P176P	IVL_ENST00000392667.2_Silent_p.P30P			P07476	INVO_HUMAN	involucrin	176	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.P176P(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			tgaagcacccggagcagcagg	0.642													A|||	36	0.0071885	0.0008	0.0173	5008	,	,		16414	0.0		0.0179	False		,,,				2504	0.0051															1	Substitution - coding silent(1)	ovary(1)	1																																								151149425	SO:0001819	synonymous_variant	3713			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.528G>A	1.37:g.152882801G>A			151149425	Q5T7P4	Silent	SNP	ENST00000368764.3	37	CCDS1030.1	SNP	39	Broad																																																																																				0.642	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547		Silent
KIAA1614	57710	broad.mit.edu	37	1	180887004	180887004	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr1:180887004G>T	ENST00000367588.4	+	3	1070	c.1015G>T	c.(1015-1017)Gtg>Ttg	p.V339L		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	339								p.V339L(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						AGTGGGGGATGTGGACTGGGC	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											58.0	66.0	63.0					1																	180887004		2110	4243	6353	179153627	SO:0001583	missense	57710			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.1015G>T	1.37:g.180887004G>T	ENSP00000356560:p.Val339Leu		179153627	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	CCDS41442.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	6.760	0.509144	0.12883	.	.	ENSG00000135835	ENST00000367588	T	0.14893	2.47	5.23	-6.43	0.01926	.	2.273880	0.01902	N	0.039277	T	0.11495	0.0280	L	0.51422	1.61	0.23628	N	0.997254	B	0.11235	0.004	B	0.09377	0.004	T	0.28744	-1.0034	9	0.08381	T	0.77	0.0364	2.6667	0.05054	0.357:0.2946:0.2558:0.0927	.	339	Q5VZ46	K1614_HUMAN	L	339	ENSP00000356560:V339L	ENSP00000356560:V339L	V	+	1	0	KIAA1614	179153627	0.000000	0.05858	0.007000	0.13788	0.057000	0.15508	-1.339000	0.02652	-0.941000	0.03700	-0.251000	0.11542	GTG		0.577	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531		Missense_Mutation
TRMT1L	81627	broad.mit.edu	37	1	185113066	185113066	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr1:185113066A>G	ENST00000367506.5	-	6	1019	c.751T>C	c.(751-753)Tat>Cat	p.Y251H	TRMT1L_ENST00000367504.3_Missense_Mutation_p.Y95H	NM_001202423.1|NM_030934.4	NP_001189352.1|NP_112196.3	Q7Z2T5	TRM1L_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)-like	251	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.				adult locomotory behavior (GO:0008344)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)	p.Y251H(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	21						GGGTTAAAATAGGAATCTGTT	0.343																																																1	Substitution - Missense(1)	ovary(1)	1											82.0	86.0	85.0					1																	185113066		2203	4300	6503	183379689	SO:0001583	missense	81627			AF288399	CCDS1366.1	1q25.2	2012-06-29	2012-06-29	2011-01-24	ENSG00000121486	ENSG00000121486			16782	protein-coding gene	gene with protein product	"""TRM1-like"""	611673	"""chromosome 1 open reading frame 25"", ""TRM1 tRNA methyltransferase 1-like"""	C1orf25		11318611, 17198746	Standard	NM_030934		Approved		uc001grf.4	Q7Z2T5	OTTHUMG00000035389	ENST00000367506.5:c.751T>C	1.37:g.185113066A>G	ENSP00000356476:p.Tyr251His		183379689	Q5TEN0|Q6ZMX0|Q8IWH5|Q8NC68|Q9BZQ1	Missense_Mutation	SNP	ENST00000367506.5	37	CCDS1366.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	28.2	4.899574	0.91962	.	.	ENSG00000121486	ENST00000367504;ENST00000367506	.	.	.	4.88	4.88	0.63580	.	0.061213	0.64402	D	0.000002	T	0.67401	0.2889	L	0.43152	1.355	0.53688	D	0.99997	D	0.71674	0.998	D	0.68353	0.957	T	0.70846	-0.4761	9	0.87932	D	0	-16.7135	13.3615	0.60659	1.0:0.0:0.0:0.0	.	251	Q7Z2T5	TRM1L_HUMAN	H	95;251	.	ENSP00000356474:Y95H	Y	-	1	0	TRMT1L	183379689	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.399000	0.90197	1.943000	0.56356	0.477000	0.44152	TAT		0.343	TRMT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085787.1	NM_030934		Missense_Mutation
CUL2	8453	broad.mit.edu	37	10	35349820	35349820	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr10:35349820T>C	ENST00000374748.1	-	5	612	c.299A>G	c.(298-300)tAt>tGt	p.Y100C	CUL2_ENST00000537177.1_Missense_Mutation_p.Y119C|CUL2_ENST00000602371.1_Missense_Mutation_p.Y43C|CUL2_ENST00000374749.3_Missense_Mutation_p.Y100C|CUL2_ENST00000374751.3_Missense_Mutation_p.Y100C|CUL2_ENST00000478044.1_5'Flank|CUL2_ENST00000374746.1_Missense_Mutation_p.Y100C|CUL2_ENST00000374742.1_Missense_Mutation_p.Y100C			Q13617	CUL2_HUMAN	cullin 2	100					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)	p.Y100C(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						GCAGTCCATATAGTCTGCACC	0.363																																																1	Substitution - Missense(1)	ovary(1)	10											150.0	132.0	138.0					10																	35349820		2203	4300	6503	35389826	SO:0001583	missense	8453			U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.299A>G	10.37:g.35349820T>C	ENSP00000363880:p.Tyr100Cys		35389826	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Missense_Mutation	SNP	ENST00000374748.1	37	CCDS7179.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	23.1	4.369232	0.82463	.	.	ENSG00000108094	ENST00000374751;ENST00000374748;ENST00000374746;ENST00000374749;ENST00000374754;ENST00000374742;ENST00000537177;ENST00000421317	T;T;T;T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85	5.98	5.98	0.97165	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83991	0.5374	M	0.64997	1.995	0.80722	D	1	D;P;P	0.58268	0.982;0.709;0.914	D;P;P	0.66351	0.943;0.723;0.811	D	0.85496	0.1188	10	0.87932	D	0	-17.7302	16.1311	0.81442	0.0:0.0:0.0:1.0	.	100;119;100	Q5T2B5;G3V1S2;Q13617	.;.;CUL2_HUMAN	C	100;100;100;100;43;100;119;100	ENSP00000363883:Y100C;ENSP00000363880:Y100C;ENSP00000363878:Y100C;ENSP00000363881:Y100C;ENSP00000363874:Y100C;ENSP00000444856:Y119C;ENSP00000414095:Y100C	ENSP00000363874:Y100C	Y	-	2	0	CUL2	35389826	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.017000	0.70805	2.289000	0.77006	0.482000	0.46254	TAT		0.363	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591		Missense_Mutation
FAM13C	220965	broad.mit.edu	37	10	61083760	61083760	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr10:61083760C>T	ENST00000373868.2	-	4	518	c.431G>A	c.(430-432)cGa>cAa	p.R144Q	FAM13C_ENST00000419214.2_Missense_Mutation_p.R144Q|FAM13C_ENST00000422313.2_Missense_Mutation_p.R144Q|FAM13C_ENST00000277705.6_Missense_Mutation_p.R144Q|FAM13C_ENST00000468840.2_Missense_Mutation_p.R61Q|FAM13C_ENST00000510215.2_5'UTR|FAM13C_ENST00000373867.3_Missense_Mutation_p.R61Q|FAM13C_ENST00000435852.2_Missense_Mutation_p.R144Q|FAM13C_ENST00000442566.3_Missense_Mutation_p.R144Q	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	144								p.R144Q(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TGGTTGAAGTCGCACTGTTTC	0.498																																																1	Substitution - Missense(1)	ovary(1)	10											339.0	287.0	304.0					10																	61083760		2203	4300	6503	60753766	SO:0001583	missense	220965			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.431G>A	10.37:g.61083760C>T	ENSP00000362975:p.Arg144Gln		60753766	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	37	CCDS7255.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	13.97	2.396846	0.42512	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313	T;T;T;T;T;T	0.75821	0.46;-0.97;-0.97;0.41;0.47;0.49	5.96	0.529	0.17095	.	1.077470	0.07228	N	0.861974	T	0.61540	0.2355	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B	0.21381	0.055;0.001;0.032;0.013;0.032	B;B;B;B;B	0.12837	0.008;0.001;0.008;0.002;0.005	T	0.49021	-0.8982	10	0.51188	T	0.08	2.6657	7.3947	0.26929	0.1201:0.6628:0.0:0.217	.	144;61;144;144;144	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	Q	61;144;144;144;144;61;144;144	ENSP00000362975:R144Q;ENSP00000395661:R144Q;ENSP00000277705:R144Q;ENSP00000391993:R144Q;ENSP00000392302:R144Q;ENSP00000400241:R144Q	ENSP00000277705:R144Q	R	-	2	0	FAM13C	60753766	0.000000	0.05858	0.028000	0.17463	0.571000	0.35966	-0.007000	0.12810	-0.140000	0.11394	-1.929000	0.00512	CGA		0.498	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2			Missense_Mutation
MYOF	26509	broad.mit.edu	37	10	95123805	95123805	+	Silent	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr10:95123805G>A	ENST00000359263.4	-	27	2780	c.2781C>T	c.(2779-2781)caC>caT	p.H927H	MYOF_ENST00000371502.4_Silent_p.H927H|MYOF_ENST00000371501.4_Silent_p.H927H|MYOF_ENST00000358334.5_Silent_p.H914H	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	927					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)	p.H927H(1)		NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TGAACTCCGTGTGACCTGCAT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	10											69.0	69.0	69.0					10																	95123805		2007	4156	6163	95113795	SO:0001819	synonymous_variant	26509			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.2781C>T	10.37:g.95123805G>A			95113795	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Silent	SNP	ENST00000359263.4	37	CCDS41551.1	SNP	48	Broad																																																																																				0.627	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451		Silent
PLCE1	51196	broad.mit.edu	37	10	95791574	95791574	+	Silent	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr10:95791574C>T	ENST00000371380.3	+	1	1006	c.771C>T	c.(769-771)gaC>gaT	p.D257D	PLCE1_ENST00000260766.3_Silent_p.D257D			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	257					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)	p.D257D(1)		liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				ATCATTGTGACACCTTGAATG	0.368																																																1	Substitution - coding silent(1)	ovary(1)	10											105.0	100.0	102.0					10																	95791574		1946	4146	6092	95781564	SO:0001819	synonymous_variant	51196				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.771C>T	10.37:g.95791574C>T			95781564	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Silent	SNP	ENST00000371380.3	37	CCDS41552.1	SNP	17	Broad																																																																																				0.368	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341		Silent
CC2D2B	387707	broad.mit.edu	37	10	97791678	97791678	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr10:97791678A>C	ENST00000344386.3	+	9	1046	c.882A>C	c.(880-882)gaA>gaC	p.E294D	ENTPD1-AS1_ENST00000449197.1_RNA|CC2D2B_ENST00000371198.2_3'UTR|ENTPD1-AS1_ENST00000452728.1_RNA|CC2D2B_ENST00000410012.2_Missense_Mutation_p.E373D|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000458228.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000454638.1_RNA|RP11-690P14.4_ENST00000475252.2_3'UTR	NM_001001732.3	NP_001001732.2	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B	294								p.E294D(1)		large_intestine(1)|lung(7)|ovary(1)|urinary_tract(1)	10		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		CCCAGACAGAATTTGCTTTAG	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											155.0	138.0	143.0					10																	97791678		1849	4101	5950	97781668	SO:0001583	missense	387707			BC075861	CCDS41555.1, CCDS53560.1	10q23.33	2008-11-06	2007-10-19	2007-10-19	ENSG00000188649	ENSG00000188649			31666	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 130"""	C10orf130			Standard	NM_001001732		Approved	bA248J23.4	uc010qop.2	Q6DHV5	OTTHUMG00000018820	ENST00000344386.3:c.882A>C	10.37:g.97791678A>C	ENSP00000343747:p.Glu294Asp		97781668	A2A3E9|B4DYD4|E9PCC3|Q5VUS0	Missense_Mutation	SNP	ENST00000344386.3	37	CCDS41555.1	SNP	4	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.18|12.18	1.859132|1.859132	0.32884|0.32884	.|.	.|.	ENSG00000188649|ENSG00000188649	ENST00000451649;ENST00000344386|ENST00000410012	T|.	0.72725|.	-0.68|.	6.04|6.04	1.25|1.25	0.21368|0.21368	.|.	.|.	.|.	.|.	.|.	T|T	0.57125|0.57125	0.2032|0.2032	M|M	0.74467|0.74467	2.265|2.265	0.26975|0.26975	N|N	0.965486|0.965486	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.996;0.998|.	T|T	0.53697|0.53697	-0.8402|-0.8402	9|6	0.62326|0.87932	D|D	0.03|0	.|.	10.7126|10.7126	0.45993|0.45993	0.6877:0.0:0.3123:0.0|0.6877:0.0:0.3123:0.0	.|.	373;294|.	E9PCC3;Q6DHV5|.	.;C2D2B_HUMAN|.	D|T	373;294|374	ENSP00000343747:E294D|.	ENSP00000343747:E294D|ENSP00000386988:N374T	E|N	+|+	3|2	2|0	CC2D2B|CC2D2B	97781668|97781668	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.117000|0.117000	0.20001|0.20001	2.138000|2.138000	0.42140|0.42140	-0.039000|-0.039000	0.13602|0.13602	-2.026000|-2.026000	0.00426|0.00426	GAA|AAT		0.393	CC2D2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049573.3	NM_001001732		Missense_Mutation
DNTT	1791	broad.mit.edu	37	10	98064420	98064420	+	Missense_Mutation	SNP	G	G	T	rs373710274		TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr10:98064420G>T	ENST00000371174.2	+	1	268	c.166G>T	c.(166-168)Gcc>Tcc	p.A56S	DNTT_ENST00000419175.1_Missense_Mutation_p.A56S|RP11-35J23.1_ENST00000454484.2_RNA			P04053	TDT_HUMAN	DNA nucleotidylexotransferase	56	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA modification (GO:0006304)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA nucleotidylexotransferase activity (GO:0003912)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.A56S(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		CATGGAGCTGGCCCGCAGGAA	0.483																																																1	Substitution - Missense(1)	ovary(1)	10											38.0	45.0	42.0					10																	98064420		2203	4300	6503	98054410	SO:0001583	missense	1791			AB046378	CCDS7447.1	10q23-q24	2013-05-21	2013-05-21		ENSG00000107447	ENSG00000107447	2.7.7.31	"""DNA polymerases"""	2983	protein-coding gene	gene with protein product	"""Terminal deoxynucleotidyltransferase"""	187410	"""deoxynucleotidyltransferase, terminal"""				Standard	NM_004088		Approved	TDT	uc001kmf.3	P04053	OTTHUMG00000018832	ENST00000371174.2:c.166G>T	10.37:g.98064420G>T	ENSP00000360216:p.Ala56Ser		98054410	Q53FH1|Q5W103|Q96E50	Missense_Mutation	SNP	ENST00000371174.2	37	CCDS7447.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766447	0.90020	.	.	ENSG00000107447	ENST00000419175;ENST00000371174	T;T	0.80393	-1.37;-1.37	5.9	5.9	0.94986	BRCT (4);	0.000000	0.85682	D	0.000000	D	0.90528	0.7032	M	0.83603	2.65	0.58432	D	0.999994	D;D	0.62365	0.989;0.991	D;D	0.75484	0.976;0.986	D	0.90816	0.4705	10	0.62326	D	0.03	-1.5348	17.776	0.88508	0.0:0.0:1.0:0.0	.	56;56	P04053-2;P04053	.;TDT_HUMAN	S	56	ENSP00000401169:A56S;ENSP00000360216:A56S	ENSP00000360216:A56S	A	+	1	0	DNTT	98054410	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	6.309000	0.72825	2.806000	0.96561	0.655000	0.94253	GCC		0.483	DNTT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049607.1	NM_004088		Missense_Mutation
UBQLN3	50613	broad.mit.edu	37	11	5529473	5529473	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr11:5529473G>A	ENST00000311659.4	-	2	1463	c.1316C>T	c.(1315-1317)aCa>aTa	p.T439I	HBG2_ENST00000380252.1_5'Flank|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_5'Flank|HBG2_ENST00000380259.2_Intron	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	439								p.T439I(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGCAAGTTTGTGCTATGTCC	0.532																																					Ovarian(72;684 1260 12332 41642 52180)											1	Substitution - Missense(1)	ovary(1)	11											100.0	104.0	103.0					11																	5529473		2201	4297	6498	5486049	SO:0001583	missense	50613			AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1316C>T	11.37:g.5529473G>A	ENSP00000347997:p.Thr439Ile		5486049	Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	CCDS7758.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	0.951	-0.706356	0.03230	.	.	ENSG00000175520	ENST00000311659	T	0.39592	1.07	4.74	2.88	0.33553	.	0.407958	0.18083	N	0.152244	T	0.33731	0.0873	L	0.46157	1.445	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.29701	-1.0003	10	0.62326	D	0.03	-27.8745	7.5941	0.28037	0.1947:0.0:0.8053:0.0	.	439	Q9H347	UBQL3_HUMAN	I	439	ENSP00000347997:T439I	ENSP00000347997:T439I	T	-	2	0	UBQLN3	5486049	0.001000	0.12720	0.001000	0.08648	0.076000	0.17211	0.615000	0.24329	0.721000	0.32231	-0.137000	0.14449	ACA		0.532	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481		Missense_Mutation
DCHS1	8642	broad.mit.edu	37	11	6661233	6661233	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr11:6661233A>T	ENST00000299441.3	-	2	2023	c.1612T>A	c.(1612-1614)Tat>Aat	p.Y538N		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	538	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y538N(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCCAACTCATAGTCCAGTGAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	11											79.0	75.0	76.0					11																	6661233		2201	4296	6497	6617809	SO:0001583	missense	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.1612T>A	11.37:g.6661233A>T	ENSP00000299441:p.Tyr538Asn		6617809	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	14.17	2.455871	0.43634	.	.	ENSG00000166341	ENST00000299441	T	0.54479	0.57	5.18	5.18	0.71444	Cadherin (4);Cadherin-like (1);	0.413435	0.17892	N	0.158493	T	0.69495	0.3117	M	0.67700	2.07	0.50313	D	0.99986	D	0.76494	0.999	D	0.87578	0.998	T	0.66131	-0.6000	10	0.30078	T	0.28	.	14.515	0.67814	1.0:0.0:0.0:0.0	.	538	Q96JQ0	PCD16_HUMAN	N	538	ENSP00000299441:Y538N	ENSP00000299441:Y538N	Y	-	1	0	DCHS1	6617809	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.303000	0.72794	2.092000	0.63282	0.472000	0.43445	TAT		0.582	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		Missense_Mutation
OR5B2	390190	broad.mit.edu	37	11	58190501	58190501	+	Missense_Mutation	SNP	C	C	A	rs146758345		TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr11:58190501C>A	ENST00000302581.2	-	1	285	c.234G>T	c.(232-234)aaG>aaT	p.K78N		NM_001005566.2	NP_001005566.1	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B, member 2	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K78N(1)		NS(2)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CAGCCATGACCTTGGGAGTGA	0.488																																																1	Substitution - Missense(1)	ovary(1)	11											129.0	115.0	120.0					11																	58190501		2201	4295	6496	57947077	SO:0001583	missense	390190			AB065852	CCDS31550.1	11q12.1	2012-08-09			ENSG00000172365	ENSG00000172365		"""GPCR / Class A : Olfactory receptors"""	8323	protein-coding gene	gene with protein product							Standard	NM_001005566		Approved	OST073	uc010rkg.2	Q96R09	OTTHUMG00000167517	ENST00000302581.2:c.234G>T	11.37:g.58190501C>A	ENSP00000303076:p.Lys78Asn		57947077	B2RNJ6|B9EGY7|Q6IEV7|Q8NGF5	Missense_Mutation	SNP	ENST00000302581.2	37	CCDS31550.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	c	4.344	0.063214	0.08388	.	.	ENSG00000172365	ENST00000302581	T	0.07444	3.19	3.8	-6.35	0.01975	GPCR, rhodopsin-like superfamily (1);	0.441264	0.16321	U	0.219551	T	0.08714	0.0216	M	0.75150	2.29	0.09310	N	1	B	0.23937	0.094	B	0.25614	0.062	T	0.16335	-1.0406	10	0.52906	T	0.07	-1.0671	6.8604	0.24064	0.219:0.1526:0.0:0.6284	.	78	Q96R09	OR5B2_HUMAN	N	78	ENSP00000303076:K78N	ENSP00000303076:K78N	K	-	3	2	OR5B2	57947077	0.000000	0.05858	0.009000	0.14445	0.234000	0.25298	-4.372000	0.00244	-1.302000	0.02335	-0.921000	0.02739	AAG		0.488	OR5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394887.2	NM_001005566		Missense_Mutation
NRXN2	9379	broad.mit.edu	37	11	64416248	64416248	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr11:64416248C>T	ENST00000377551.1	-	15	3452	c.3241G>A	c.(3241-3243)Gac>Aac	p.D1081N	NRXN2_ENST00000377559.3_Missense_Mutation_p.D1041N|NRXN2_ENST00000265459.6_Missense_Mutation_p.D1081N|NRXN2_ENST00000409571.1_Missense_Mutation_p.D1074N|AP001092.4_ENST00000433606.1_RNA			Q9P2S2	NRX2A_HUMAN	neurexin 2	1081	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.D1081N(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TGCAGGGCGTCGGCGATGAGG	0.642																																																1	Substitution - Missense(1)	ovary(1)	11											91.0	78.0	83.0					11																	64416248		2201	4297	6498	64172824	SO:0001583	missense	9379				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.3241G>A	11.37:g.64416248C>T	ENSP00000366774:p.Asp1081Asn		64172824	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	CCDS8077.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	31	5.094373	0.94149	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	4.52	4.52	0.55395	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.44097	U	0.000496	D	0.88347	0.6412	M	0.72624	2.21	0.80722	D	1	D;D;D	0.89917	1.0;0.993;1.0	D;P;D	0.77557	0.977;0.701;0.99	D	0.89717	0.3916	10	0.87932	D	0	.	14.7847	0.69793	0.0:1.0:0.0:0.0	.	1041;1081;827	Q9P2S2-2;Q9P2S2;E7EV67	.;NRX2A_HUMAN;.	N	1081;1041;1081;1041;1074	ENSP00000366774:D1081N;ENSP00000366782:D1041N;ENSP00000265459:D1081N;ENSP00000386416:D1074N	ENSP00000265459:D1081N	D	-	1	0	NRXN2	64172824	1.000000	0.71417	0.936000	0.37596	0.930000	0.56654	7.620000	0.83070	2.345000	0.79718	0.561000	0.74099	GAC		0.642	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080		Missense_Mutation
GSTP1	2950	broad.mit.edu	37	11	67353898	67353898	+	Silent	SNP	G	G	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr11:67353898G>T	ENST00000398606.3	+	7	732	c.483G>T	c.(481-483)ctG>ctT	p.L161L	GSTP1_ENST00000498765.1_3'UTR|GSTP1_ENST00000398603.1_Silent_p.L125L	NM_000852.3	NP_000843.1	P09211	GSTP1_HUMAN	glutathione S-transferase pi 1	161	GST C-terminal.				cellular response to lipopolysaccharide (GO:0071222)|central nervous system development (GO:0007417)|common myeloid progenitor cell proliferation (GO:0035726)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biosynthetic process (GO:0009890)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of leukocyte proliferation (GO:0070664)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|nitric oxide storage (GO:0035732)|positive regulation of superoxide anion generation (GO:0032930)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of stress-activated MAPK cascade (GO:0032872)|response to reactive oxygen species (GO:0000302)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|TRAF2-GSTP1 complex (GO:0097057)|vesicle (GO:0031982)	dinitrosyl-iron complex binding (GO:0035731)|glutathione transferase activity (GO:0004364)|JUN kinase binding (GO:0008432)|kinase regulator activity (GO:0019207)|nitric oxide binding (GO:0070026)|S-nitrosoglutathione binding (GO:0035730)	p.L161L(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|lung(2)|ovary(1)	9					Busulfan(DB01008)|Carboplatin(DB00958)|Chlorambucil(DB00291)|Cisplatin(DB00515)|Clomipramine(DB01242)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	ACTTGCTGCTGATCCATGAGG	0.647																																																1	Substitution - coding silent(1)	ovary(1)	11											53.0	57.0	56.0					11																	67353898		2119	4244	6363	67110474	SO:0001819	synonymous_variant	2950			U12472	CCDS41679.1	11q13.2	2014-09-17	2008-07-18		ENSG00000084207	ENSG00000084207	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4638	protein-coding gene	gene with protein product		134660		FAEES3, GST3		1885604, 7587384, 19915149	Standard	NM_000852		Approved	GSTP	uc001omf.3	P09211	OTTHUMG00000137430	ENST00000398606.3:c.483G>T	11.37:g.67353898G>T			67110474	O00460|Q15690|Q5TZY3	Silent	SNP	ENST00000398606.3	37	CCDS41679.1	SNP	45	Broad																																																																																				0.647	GSTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268504.1	NM_000852		Silent
KCNE3	10008	broad.mit.edu	37	11	74168346	74168346	+	Missense_Mutation	SNP	C	C	A	rs17221833		TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr11:74168346C>A	ENST00000310128.4	-	3	682	c.263G>T	c.(262-264)cGt>cTt	p.R88L	RP11-702H23.4_ENST00000533008.1_RNA|KCNE3_ENST00000525550.1_Missense_Mutation_p.R88L|RP11-702H23.6_ENST00000530510.1_RNA	NM_005472.4	NP_005463.1	Q9Y6H6	KCNE3_HUMAN	potassium voltage-gated channel, Isk-related family, member 3	88					regulation of potassium ion transport (GO:0043266)	integral component of membrane (GO:0016021)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.R88L(1)		cervix(1)|large_intestine(1)|lung(1)|ovary(1)	4	Breast(11;2.86e-06)					GGGGTCACTACGCTTGTCCAC	0.502																																																1	Substitution - Missense(1)	ovary(1)	11											49.0	44.0	45.0					11																	74168346		2200	4293	6493	73845994	SO:0001583	missense	10008			AF076531	CCDS8232.1	11q13.4	2014-09-17				ENSG00000175538		"""Potassium channels"""	6243	protein-coding gene	gene with protein product		604433				10219239	Standard	NM_005472		Approved	MiRP2, HOKPP	uc001ovc.3	Q9Y6H6		ENST00000310128.4:c.263G>T	11.37:g.74168346C>A	ENSP00000310557:p.Arg88Leu		73845994		Missense_Mutation	SNP	ENST00000310128.4	37	CCDS8232.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	19.39	3.819135	0.71028	.	.	ENSG00000175538	ENST00000310128;ENST00000525550;ENST00000532569	D;D;D	0.92048	-2.96;-2.96;-2.96	5.22	4.31	0.51392	.	0.000000	0.85682	D	0.000000	D	0.94046	0.8092	L	0.60455	1.87	0.47819	D	0.999528	D	0.64830	0.994	D	0.66084	0.941	D	0.94058	0.7324	10	0.66056	D	0.02	-0.0017	11.6251	0.51139	0.0:0.9144:0.0:0.0856	.	88	Q9Y6H6	KCNE3_HUMAN	L	88	ENSP00000310557:R88L;ENSP00000433633:R88L;ENSP00000431739:R88L	ENSP00000310557:R88L	R	-	2	0	KCNE3	73845994	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	2.461000	0.45040	1.437000	0.47472	-0.258000	0.10820	CGT		0.502	KCNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385531.1	NM_005472		Missense_Mutation
ALKBH8	91801	broad.mit.edu	37	11	107403034	107403034	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr11:107403034C>G	ENST00000428149.2	-	8	1021	c.870G>C	c.(868-870)tgG>tgC	p.W290C	ALKBH8_ENST00000429370.1_Intron|ALKBH8_ENST00000417449.2_Missense_Mutation_p.W293C|ALKBH8_ENST00000389568.3_Missense_Mutation_p.W290C	NM_138775.2	NP_620130.2	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8 (E. coli)	290	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cellular response to DNA damage stimulus (GO:0006974)|tRNA methylation (GO:0030488)	cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|RNA binding (GO:0003723)|tRNA (uracil) methyltransferase activity (GO:0016300)	p.W293C(1)		breast(2)|large_intestine(2)|lung(5)	9		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		ACCCATGGGTCCAAAGGTATC	0.458																																																1	Substitution - Missense(1)	ovary(1)	11											104.0	88.0	93.0					11																	107403034		692	1591	2283	106908244	SO:0001583	missense	91801			AF086489	CCDS8337.2, CCDS73376.1	11q22.3	2013-10-04			ENSG00000137760	ENSG00000137760	2.1.1.229	"""Alkylation repair homologs"", ""RNA binding motif (RRM) containing"""	25189	protein-coding gene	gene with protein product		613306				20123966	Standard	NM_138775		Approved	MGC10235	uc009yxp.3	Q96BT7	OTTHUMG00000157008	ENST00000428149.2:c.870G>C	11.37:g.107403034C>G	ENSP00000415885:p.Trp290Cys		106908244	B1Q2M0|B4DEF6|Q8N989	Missense_Mutation	SNP	ENST00000428149.2	37	CCDS8337.2	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	22.5	4.294675	0.81025	.	.	ENSG00000137760	ENST00000428149;ENST00000389568;ENST00000417449	T;T;T	0.37584	1.19;1.19;1.19	5.01	5.01	0.66863	Oxoglutarate/iron-dependent oxygenase (2);	0.125717	0.64402	D	0.000019	T	0.72036	0.3411	H	0.95816	3.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.82121	-0.0614	10	0.87932	D	0	-18.4228	17.2915	0.87158	0.0:1.0:0.0:0.0	.	290;293	Q96BT7;Q96BT7-4	ALKB8_HUMAN;.	C	290;290;293	ENSP00000415885:W290C;ENSP00000374219:W290C;ENSP00000397673:W293C	ENSP00000374219:W290C	W	-	3	0	ALKBH8	106908244	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.324000	0.79115	2.324000	0.78689	0.655000	0.94253	TGG		0.458	ALKBH8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347071.2	NM_138775		Missense_Mutation
KIRREL3	84623	broad.mit.edu	37	11	126306737	126306737	+	Silent	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr11:126306737G>A	ENST00000525144.2	-	12	1770	c.1521C>T	c.(1519-1521)tcC>tcT	p.S507S	KIRREL3_ENST00000525704.2_Silent_p.S507S|KIRREL3_ENST00000529097.2_Silent_p.S507S|KIRREL3_ENST00000416561.2_5'UTR	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	507	Ig-like C2-type 5.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S466S(1)		central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TCTCAGTGTCGGAGCCGAAGC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	11											113.0	120.0	117.0					11																	126306737		2195	4297	6492	125811947	SO:0001819	synonymous_variant	84623			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.1521C>T	11.37:g.126306737G>A			125811947	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Silent	SNP	ENST00000525144.2	37	CCDS53723.1	SNP	39	Broad																																																																																				0.607	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531		Silent
LRRC23	10233	broad.mit.edu	37	12	7014876	7014876	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr12:7014876G>C	ENST00000007969.8	+	2	299	c.79G>C	c.(79-81)Gag>Cag	p.E27Q	LRRC23_ENST00000449039.1_3'UTR|LRRC23_ENST00000436789.1_Missense_Mutation_p.E27Q|LRRC23_ENST00000443597.2_Missense_Mutation_p.E27Q|LRRC23_ENST00000433346.1_Missense_Mutation_p.E27Q|LRRC23_ENST00000429740.1_Missense_Mutation_p.E27Q|LRRC23_ENST00000323702.5_Missense_Mutation_p.E27Q	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23	27								p.E27Q(2)		NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						gaaggagacagaggaggggga	0.537																																																2	Substitution - Missense(2)	ovary(2)	12											58.0	63.0	61.0					12																	7014876		2203	4300	6503	6885137	SO:0001583	missense	10233			BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.79G>C	12.37:g.7014876G>C	ENSP00000007969:p.Glu27Gln		6885137	A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Missense_Mutation	SNP	ENST00000007969.8	37	CCDS8569.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.93	2.084632	0.36758	.	.	ENSG00000010626	ENST00000433346;ENST00000007969;ENST00000323702;ENST00000443597;ENST00000415834;ENST00000436789;ENST00000429740	T;T;T;T;T;T;T	0.71461	1.47;-0.22;-0.57;-0.22;0.57;1.53;1.03	4.74	4.74	0.60224	.	.	.	.	.	T	0.77745	0.4176	L	0.50333	1.59	0.30042	N	0.812568	D;D;D;D	0.76494	0.999;0.997;0.984;0.984	D;P;P;P	0.65443	0.935;0.9;0.69;0.69	T	0.71748	-0.4499	9	0.30078	T	0.28	-11.4719	13.0943	0.59182	0.0:0.0:1.0:0.0	.	27;27;27;27	E9PDZ4;Q53EV4-2;Q53EV4;C9JKE8	.;.;LRC23_HUMAN;.	Q	27	ENSP00000402554:E27Q;ENSP00000007969:E27Q;ENSP00000317464:E27Q;ENSP00000390932:E27Q;ENSP00000408066:E27Q;ENSP00000396049:E27Q;ENSP00000397192:E27Q	ENSP00000007969:E27Q	E	+	1	0	LRRC23	6885137	0.961000	0.32948	1.000000	0.80357	0.434000	0.31775	1.634000	0.37123	2.452000	0.82932	0.561000	0.74099	GAG		0.537	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345214.1	NM_006992		Missense_Mutation
GUCY2C	2984	broad.mit.edu	37	12	14849316	14849316	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr12:14849316T>C	ENST00000261170.3	-	1	203	c.67A>G	c.(67-69)Agt>Ggt	p.S23G	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	23					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)	p.S23G(1)		breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	ACCTGGGAACTAAAGGACAGC	0.517																																																1	Substitution - Missense(1)	ovary(1)	12											99.0	95.0	97.0					12																	14849316		2203	4300	6503	14740583	SO:0001583	missense	2984				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.67A>G	12.37:g.14849316T>C	ENSP00000261170:p.Ser23Gly		14740583	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	CCDS8664.1	SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	T	8.055	0.766745	0.15983	.	.	ENSG00000070019	ENST00000261170	T	0.81163	-1.46	4.84	-9.68	0.00528	.	2.964170	0.00754	N	0.001080	T	0.57446	0.2054	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.13407	0.009	T	0.52510	-0.8566	10	0.22706	T	0.39	.	7.2912	0.26366	0.336:0.5063:0.0:0.1577	.	23	P25092	GUC2C_HUMAN	G	23	ENSP00000261170:S23G	ENSP00000261170:S23G	S	-	1	0	GUCY2C	14740583	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.286000	0.00134	-2.639000	0.00430	-0.339000	0.08088	AGT		0.517	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1			Missense_Mutation
SOX5	6660	broad.mit.edu	37	12	24048941	24048941	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr12:24048941G>C	ENST00000451604.2	-	2	157	c.56C>G	c.(55-57)cCa>cGa	p.P19R	SOX5_ENST00000541536.1_Missense_Mutation_p.P6R|SOX5_ENST00000545921.1_Missense_Mutation_p.P9R|SOX5_ENST00000537393.1_Missense_Mutation_p.P19R|SOX5_ENST00000541847.1_Missense_Mutation_p.P9R|SOX5_ENST00000441133.2_Missense_Mutation_p.P19R|SOX5_ENST00000381381.2_Missense_Mutation_p.P6R|SOX5_ENST00000309359.1_Missense_Mutation_p.P6R|SOX5_ENST00000546136.1_Missense_Mutation_p.P6R			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	19					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P19R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						CGGAGAGGCTGGTCGCTTGGA	0.493																																																1	Substitution - Missense(1)	ovary(1)	12											129.0	125.0	127.0					12																	24048941		2203	4300	6503	23940208	SO:0001583	missense	6660			AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.56C>G	12.37:g.24048941G>C	ENSP00000398273:p.Pro19Arg		23940208	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	CCDS8699.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925181	0.73213	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921;ENST00000541847;ENST00000441133;ENST00000538083	D;D;D;D;D;D;D	0.98044	-4.35;-4.35;-4.4;-4.37;-4.68;-4.4;-4.36	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.98566	0.9521	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;0.997;0.996	D;D;D;D	0.87578	0.998;0.931;0.994;0.944	D	0.99593	1.0976	10	0.87932	D	0	.	20.2366	0.98359	0.0:0.0:1.0:0.0	.	19;19;6;19	G3V0H1;F5H0I3;P35711-4;P35711	.;.;.;SOX5_HUMAN	R	6;6;6;19;6;19;6;9;9;19;6	ENSP00000437487:P6R;ENSP00000308927:P6R;ENSP00000370788:P6R;ENSP00000398273:P19R;ENSP00000439832:P19R;ENSP00000441973:P6R;ENSP00000443520:P9R	ENSP00000308927:P6R	P	-	2	0	SOX5	23940208	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.069000	0.93967	2.792000	0.96026	0.557000	0.71058	CCA		0.493	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940		Missense_Mutation
OR6C1	390321	broad.mit.edu	37	12	55714821	55714821	+	Silent	SNP	T	T	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr12:55714821T>G	ENST00000379668.2	+	1	476	c.438T>G	c.(436-438)tcT>tcG	p.S146S		NM_001005182.1	NP_001005182.1	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C, member 1	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S146S(1)		endometrium(3)|large_intestine(5)|liver(2)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	25						TTTTTACTTCTTGGCTGGTTT	0.403																																																1	Substitution - coding silent(1)	ovary(1)	12											45.0	42.0	43.0					12																	55714821		2203	4299	6502	54001088	SO:0001819	synonymous_variant	390321			AF399506	CCDS31818.1	12q13.13	2012-08-09			ENSG00000205330	ENSG00000205330		"""GPCR / Class A : Olfactory receptors"""	8355	protein-coding gene	gene with protein product							Standard	NM_001005182		Approved	OST267	uc010spi.2	Q96RD1	OTTHUMG00000168102	ENST00000379668.2:c.438T>G	12.37:g.55714821T>G			54001088	B2RNM0	Silent	SNP	ENST00000379668.2	37	CCDS31818.1	SNP	56	Broad																																																																																				0.403	OR6C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398152.1	NM_001005182		Silent
ARL11	115761	broad.mit.edu	37	13	50204629	50204629	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr13:50204629G>T	ENST00000282026.1	+	2	381	c.46G>T	c.(46-48)Gtg>Ttg	p.V16L	ARL11_ENST00000490932.1_Intron	NM_138450.5	NP_612459.1	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11	16					hematopoietic progenitor cell differentiation (GO:0002244)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)	p.V16L(1)		kidney(1)|large_intestine(4)|ovary(1)	6		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)		AGCCCAGGTGGTGATGATGGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	13											72.0	75.0	74.0					13																	50204629		2203	4300	6503	49102630	SO:0001583	missense	115761			AF441378	CCDS9419.1	13q14.12	2014-05-09			ENSG00000152213	ENSG00000152213		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	24046	protein-coding gene	gene with protein product		609351				12477932	Standard	NM_138450		Approved	ARLTS1, FLJ33930	uc001vdf.2	Q969Q4	OTTHUMG00000016919	ENST00000282026.1:c.46G>T	13.37:g.50204629G>T	ENSP00000282026:p.Val16Leu		49102630		Missense_Mutation	SNP	ENST00000282026.1	37	CCDS9419.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	3.343	-0.134234	0.06711	.	.	ENSG00000152213	ENST00000282026	T	0.56444	0.46	5.09	5.09	0.68999	Small GTP-binding protein domain (1);	0.207339	0.40640	N	0.001055	T	0.33847	0.0877	N	0.10618	0.005	0.36744	D	0.882381	P	0.48089	0.905	P	0.47376	0.545	T	0.35968	-0.9767	10	0.02654	T	1	1.0789	12.9025	0.58133	0.0809:0.0:0.9191:0.0	.	16	Q969Q4	ARL11_HUMAN	L	16	ENSP00000282026:V16L	ENSP00000282026:V16L	V	+	1	0	ARL11	49102630	0.994000	0.37717	1.000000	0.80357	0.694000	0.40290	0.845000	0.27668	2.368000	0.80403	0.655000	0.94253	GTG		0.587	ARL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044929.2	NM_138450		Missense_Mutation
MYO16	23026	broad.mit.edu	37	13	109704773	109704773	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr13:109704773A>G	ENST00000357550.2	+	24	2973	c.2932A>G	c.(2932-2934)Aca>Gca	p.T978A	MYO16_ENST00000457511.2_Missense_Mutation_p.T490A|MYO16_ENST00000356711.2_Missense_Mutation_p.T978A	NM_001198950.1	NP_001185879.1			myosin XVI									p.T978A(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TAAGAAAATGACAGCTTCTTC	0.338																																																1	Substitution - Missense(1)	ovary(1)	13											99.0	93.0	95.0					13																	109704773		2203	4300	6503	108502774	SO:0001583	missense	23026				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.2932A>G	13.37:g.109704773A>G	ENSP00000350160:p.Thr978Ala		108502774		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	5.098	0.203652	0.09704	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000375857;ENST00000457511	T;T;D	0.89746	-1.41;-1.41;-2.56	5.87	-5.21	0.02815	Myosin head, motor domain (2);	0.416720	0.17423	U	0.174758	T	0.70316	0.3210	N	0.13198	0.31	0.09310	N	1	B;B;B	0.17667	0.006;0.0;0.023	B;B;B	0.15052	0.007;0.002;0.012	T	0.59306	-0.7479	9	.	.	.	.	4.1795	0.10369	0.143:0.232:0.46:0.165	.	490;978;978	F8W883;Q9Y6X6-2;Q9Y6X6	.;.;MYO16_HUMAN	A	978;978;766;490	ENSP00000349145:T978A;ENSP00000350160:T978A;ENSP00000401633:T490A	.	T	+	1	0	MYO16	108502774	0.000000	0.05858	0.000000	0.03702	0.924000	0.55760	0.040000	0.13905	-0.766000	0.04639	-0.353000	0.07706	ACA		0.338	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		Missense_Mutation
PAPLN	89932	broad.mit.edu	37	14	73731040	73731040	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr14:73731040A>G	ENST00000554301.1	+	20	3146	c.2983A>G	c.(2983-2985)Ata>Gta	p.I995V	PAPLN_ENST00000555445.1_Missense_Mutation_p.I979V|PAPLN_ENST00000381166.3_Missense_Mutation_p.I995V|PAPLN_ENST00000554314.1_3'UTR|PAPLN_ENST00000427855.1_Missense_Mutation_p.I995V|PAPLN_ENST00000340738.5_Missense_Mutation_p.I968V			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	995	Ig-like C2-type 1.					basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)	p.I968V(1)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		ACTTCGCATCATAGGTCTCTG	0.657																																																1	Substitution - Missense(1)	ovary(1)	14											61.0	65.0	64.0					14																	73731040		2203	4300	6503	72800793	SO:0001583	missense	89932			BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.2983A>G	14.37:g.73731040A>G	ENSP00000451803:p.Ile995Val		72800793	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Missense_Mutation	SNP	ENST00000554301.1	37		SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	7.402	0.633051	0.14322	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000381166;ENST00000554301;ENST00000555445	T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68	4.14	0.408	0.16377	Immunoglobulin-like (1);	.	.	.	.	T	0.12263	0.0298	N	0.16790	0.44	0.22629	N	0.998918	B;B;B;B;B	0.21606	0.006;0.003;0.037;0.058;0.007	B;B;B;B;B	0.12837	0.004;0.002;0.008;0.008;0.005	T	0.35525	-0.9785	9	0.17369	T	0.5	.	5.5518	0.17095	0.634:0.135:0.231:0.0	.	979;995;995;194;968	O95428-5;O95428;O95428-4;O95428-2;O95428-6	.;PPN_HUMAN;.;.;.	V	968;995;995;995;979	ENSP00000345395:I968V;ENSP00000403403:I995V;ENSP00000370558:I995V;ENSP00000451803:I995V;ENSP00000451729:I979V	ENSP00000345395:I968V	I	+	1	0	PAPLN	72800793	0.998000	0.40836	0.954000	0.39281	0.351000	0.29236	2.292000	0.43549	-0.024000	0.13941	-0.488000	0.04728	ATA		0.657	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000413182.1	NM_173462		Missense_Mutation
SERPINA9	327657	broad.mit.edu	37	14	94929496	94929496	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr14:94929496C>A	ENST00000380365.3	-	5	1266	c.1188G>T	c.(1186-1188)atG>atT	p.M396I	SERPINA9_ENST00000448305.2_Missense_Mutation_p.M316I|SERPINA9_ENST00000337425.5_Missense_Mutation_p.M414I|RP11-349I1.2_ENST00000536735.1_RNA|SERPINA9_ENST00000298845.7_Missense_Mutation_p.M314I|SERPINA9_ENST00000424550.2_Missense_Mutation_p.M265I			Q86WD7	SPA9_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9	396					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.M414I(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(17)	21		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		TATTTGTAATCATCATCAGGA	0.473																																																1	Substitution - Missense(1)	ovary(1)	14											139.0	133.0	135.0					14																	94929496		1977	4159	6136	93999249	SO:0001583	missense	327657			AY185497	CCDS41982.1, CCDS41983.1, CCDS61542.1	14q32.1	2014-02-18	2005-08-18		ENSG00000170054	ENSG00000170054		"""Serine (or cysteine) peptidase inhibitors"""	15995	protein-coding gene	gene with protein product		615677	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9"""			24172014	Standard	NM_175739		Approved	CENTERIN, SERPINA11b, GCET1	uc001ydf.3	Q86WD7	OTTHUMG00000167710	ENST00000380365.3:c.1188G>T	14.37:g.94929496C>A	ENSP00000369723:p.Met396Ile		93999249	B4DVH4|B9ZVX3|Q2T9J2|Q6UWP9|Q86WD4|Q86WD5|Q86WD6|Q86YP6|Q86YP7	Missense_Mutation	SNP	ENST00000380365.3	37		SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	3.674	-0.066864	0.07273	.	.	ENSG00000170054	ENST00000448305;ENST00000298845;ENST00000424550;ENST00000337425;ENST00000380365	D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76	4.2	-0.788	0.10939	.	1.199070	0.06204	N	0.683803	T	0.61652	0.2364	N	0.05177	-0.1	0.09310	N	0.999992	B;B;B	0.19445	0.013;0.002;0.036	B;B;B	0.22386	0.012;0.006;0.039	T	0.48222	-0.9054	10	0.26408	T	0.33	.	1.7096	0.02889	0.1341:0.336:0.1321:0.3978	.	316;414;314	Q86WD7-6;Q86WD7-7;Q86WD7-2	.;.;.	I	316;314;265;414;396	ENSP00000414092:M316I;ENSP00000298845:M314I;ENSP00000409012:M265I;ENSP00000337133:M414I;ENSP00000369723:M396I	ENSP00000298845:M314I	M	-	3	0	SERPINA9	93999249	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.850000	0.01670	-0.032000	0.13758	0.555000	0.69702	ATG		0.473	SERPINA9-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395803.2	NM_175739		Missense_Mutation
ATP10A	57194	broad.mit.edu	37	15	25926004	25926004	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr15:25926004C>A	ENST00000356865.6	-	19	3742	c.3631G>T	c.(3631-3633)Gcg>Tcg	p.A1211S		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1211					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.A1211S(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GTGAGCAGCGCGATTGTCACA	0.572																																																1	Substitution - Missense(1)	ovary(1)	15											136.0	130.0	132.0					15																	25926004		2203	4300	6503	23477097	SO:0001583	missense	57194			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.3631G>T	15.37:g.25926004C>A	ENSP00000349325:p.Ala1211Ser		23477097	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506945	0.44558	.	.	ENSG00000206190	ENST00000356865	T	0.39229	1.09	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.33527	0.0866	L	0.28740	0.885	0.49915	D	0.999831	P	0.42620	0.785	B	0.37015	0.239	T	0.06588	-1.0818	10	0.30078	T	0.28	-21.8715	19.3809	0.94532	0.0:1.0:0.0:0.0	.	1211	O60312	AT10A_HUMAN	S	1211	ENSP00000349325:A1211S	ENSP00000349325:A1211S	A	-	1	0	ATP10A	23477097	1.000000	0.71417	0.106000	0.21319	0.015000	0.08874	4.490000	0.60319	2.578000	0.87016	0.655000	0.94253	GCG		0.572	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490		Missense_Mutation
MAP1A	4130	broad.mit.edu	37	15	43814204	43814204	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr15:43814204G>A	ENST00000300231.5	+	4	983	c.533G>A	c.(532-534)cGt>cAt	p.R178H	MAP1A_ENST00000399453.1_Missense_Mutation_p.R178H|MAP1A_ENST00000382031.1_Missense_Mutation_p.R416H			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	178					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)	p.R178H(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CCTCTATATCGTGTGGTCAGC	0.562																																																1	Substitution - Missense(1)	ovary(1)	15											63.0	62.0	62.0					15																	43814204		2005	4180	6185	41601496	SO:0001583	missense	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.533G>A	15.37:g.43814204G>A	ENSP00000300231:p.Arg178His		41601496	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	CCDS42031.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	17.09	3.299535	0.60195	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.24151	1.87;1.87;1.87	5.31	5.31	0.75309	.	0.000000	0.34291	N	0.004092	T	0.60209	0.2251	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67193	-0.5732	10	0.87932	D	0	-7.9003	19.1626	0.93539	0.0:0.0:1.0:0.0	.	178	P78559	MAP1A_HUMAN	H	416;178;178;178	ENSP00000371462:R416H;ENSP00000382380:R178H;ENSP00000300231:R178H	ENSP00000300231:R178H	R	+	2	0	MAP1A	41601496	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.657000	0.98554	2.768000	0.95171	0.561000	0.74099	CGT		0.562	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373		Missense_Mutation
FAM63B	54629	broad.mit.edu	37	15	59064310	59064310	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr15:59064310G>A	ENST00000559228.1	+	1	798	c.716G>A	c.(715-717)gGa>gAa	p.G239E	RP11-30K9.6_ENST00000500929.2_lincRNA|FAM63B_ENST00000450403.2_Missense_Mutation_p.G239E			Q8NBR6	FA63B_HUMAN	family with sequence similarity 63, member B	239								p.G239E(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						CGCTTCCCGGGACAATCTGTG	0.617																																																1	Substitution - Missense(1)	ovary(1)	15											64.0	70.0	68.0					15																	59064310		2081	4210	6291	56851602	SO:0001583	missense	54629			AK075319	CCDS42046.1, CCDS45268.1	15q21.3	2005-08-09							26954	protein-coding gene	gene with protein product						10574461	Standard	NM_001040450		Approved	KIAA1164	uc002afj.3	Q8NBR6		ENST00000559228.1:c.716G>A	15.37:g.59064310G>A	ENSP00000452885:p.Gly239Glu		56851602	B2RTT8|Q9ULQ6	Missense_Mutation	SNP	ENST00000559228.1	37	CCDS42046.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	13.88	2.369631	0.42003	.	.	ENSG00000128923	ENST00000316848;ENST00000450403	T	0.43688	0.94	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.27063	0.0663	N	0.17312	0.475	0.80722	D	1	B;B	0.28605	0.217;0.175	B;B	0.30943	0.057;0.122	T	0.09335	-1.0679	10	0.02654	T	1	-1.8224	17.7562	0.88450	0.0:0.0:1.0:0.0	.	239;239	Q8NBR6;Q8NBR6-2	FA63B_HUMAN;.	E	239	ENSP00000393231:G239E	ENSP00000326194:G239E	G	+	2	0	FAM63B	56851602	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.701000	0.98710	2.173000	0.68751	0.585000	0.79938	GGA		0.617	FAM63B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416230.1	NM_019092		Missense_Mutation
UNC45A	55898	broad.mit.edu	37	15	91485828	91485828	+	Silent	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr15:91485828C>T	ENST00000418476.2	+	7	889	c.849C>T	c.(847-849)atC>atT	p.I283I	UNC45A_ENST00000553671.2_Intron|UNC45A_ENST00000394275.2_Silent_p.I268I	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	283					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.I283I(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			AAGGTGCCATCATTGTGGGTG	0.557																																																1	Substitution - coding silent(1)	ovary(1)	15											100.0	71.0	81.0					15																	91485828		2198	4298	6496	89286832	SO:0001819	synonymous_variant	55898				CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.849C>T	15.37:g.91485828C>T			89286832	A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Silent	SNP	ENST00000418476.2	37	CCDS10367.1	SNP	29	Broad																																																																																				0.557	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280406.2	NM_018671		Silent
TBL3	10607	broad.mit.edu	37	16	2024216	2024216	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr16:2024216C>T	ENST00000568546.1	+	3	240	c.112C>T	c.(112-114)Cac>Tac	p.H38Y		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	38					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)	p.H38Y(1)		breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						GACTGGCCAGCACCTCTTCTG	0.672																																					Melanoma(118;616 1651 35077 38081 48633)											1	Substitution - Missense(1)	ovary(1)	16											54.0	59.0	57.0					16																	2024216		2199	4300	6499	1964217	SO:0001583	missense	10607			U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.112C>T	16.37:g.2024216C>T	ENSP00000454836:p.His38Tyr		1964217	Q59GD6|Q8IVB7|Q96A78	Missense_Mutation	SNP	ENST00000568546.1	37	CCDS10453.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	0.923	-0.715312	0.03206	.	.	ENSG00000183751	ENST00000332704	.	.	.	4.53	3.54	0.40534	.	1.198970	0.05636	N	0.582608	T	0.22859	0.0552	N	0.11131	0.1	0.28853	N	0.895951	B	0.11235	0.004	B	0.10450	0.005	T	0.19778	-1.0295	9	0.02654	T	1	-14.713	8.4506	0.32869	0.0:0.743:0.0:0.257	.	38	Q12788	TBL3_HUMAN	Y	38	.	ENSP00000331815:H38Y	H	+	1	0	TBL3	1964217	0.018000	0.18449	0.998000	0.56505	0.671000	0.39405	0.154000	0.16343	0.978000	0.38470	0.561000	0.74099	CAC		0.672	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250615.3	NM_006453		Missense_Mutation
MEFV	4210	broad.mit.edu	37	16	3293271	3293271	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr16:3293271T>G	ENST00000219596.1	-	10	2255	c.2216A>C	c.(2215-2217)cAc>cCc	p.H739P	MEFV_ENST00000339854.4_Missense_Mutation_p.H559P|MEFV_ENST00000541159.1_3'UTR|MEFV_ENST00000536379.1_Missense_Mutation_p.H528P	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	739	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.H739P(1)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						TGTATAGATGTGGGATCTGGC	0.532																																																1	Substitution - Missense(1)	ovary(1)	16											109.0	103.0	105.0					16																	3293271		2197	4300	6497	3233272	SO:0001583	missense	4210			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.2216A>C	16.37:g.3293271T>G	ENSP00000219596:p.His739Pro		3233272	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	37	CCDS10498.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	6.037	0.375201	0.11409	.	.	ENSG00000103313	ENST00000219596;ENST00000339854;ENST00000536379	T;T;T	0.62639	0.01;0.01;0.01	5.23	1.66	0.24008	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.849613	0.10206	N	0.702743	T	0.71978	0.3404	M	0.71920	2.185	0.20638	N	0.999878	D	0.60575	0.988	D	0.65140	0.932	T	0.56625	-0.7948	10	0.32370	T	0.25	-2.269	6.2471	0.20825	0.1276:0.1514:0.0:0.721	.	739	O15553	MEFV_HUMAN	P	739;559;528	ENSP00000219596:H739P;ENSP00000339639:H559P;ENSP00000445079:H528P	ENSP00000219596:H739P	H	-	2	0	MEFV	3233272	0.890000	0.30428	0.444000	0.26895	0.014000	0.08584	1.294000	0.33365	-0.171000	0.10797	-1.162000	0.01777	CAC		0.532	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243		Missense_Mutation
NLRC3	197358	broad.mit.edu	37	16	3598755	3598755	+	RNA	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr16:3598755T>C	ENST00000301749.7	-	0	3009				NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000419350.2_RNA|LA16c-390H2.4_ENST00000573820.1_RNA|NLRC3_ENST00000448023.2_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.?(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCTGTCAGGCTAGGAGGAAGG	0.632																																																1	Unknown(1)	ovary(1)	16											26.0	28.0	27.0					16																	3598755		2028	4180	6208	3538756			197358			BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3598755T>C			3538756	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Splice_Site_SNP	SNP	ENST00000301749.7	37		SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	T	12.64	1.998854	0.35226	.	.	ENSG00000167984	ENST00000301749;ENST00000448023	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1095	0.48223	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NLRC3	3538756	1.000000	0.71417	0.969000	0.41365	0.748000	0.42578	3.994000	0.56994	1.898000	0.54952	0.374000	0.22700	.		0.632	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844		Splice_Site_SNP
MYH11	4629	broad.mit.edu	37	16	15876260	15876260	+	Silent	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr16:15876260G>A	ENST00000300036.5	-	6	817	c.708C>T	c.(706-708)aaC>aaT	p.N236N	MYH11_ENST00000452625.2_Silent_p.N243N|MYH11_ENST00000396324.3_Silent_p.N243N|MYH11_ENST00000576790.2_Silent_p.N236N	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	236	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						AGGAGTTGTCGTTCTTCACTG	0.468			T	CBFB	AML																																		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0			16											174.0	157.0	163.0					16																	15876260		2197	4300	6497	15783761	SO:0001819	synonymous_variant	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.708C>T	16.37:g.15876260G>A			15783761	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	CCDS10565.1	SNP	40	Broad																																																																																				0.468	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		Silent
ABCC11	85320	broad.mit.edu	37	16	48227793	48227793	+	Silent	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr16:48227793C>T	ENST00000394747.1	-	18	2854	c.2505G>A	c.(2503-2505)tcG>tcA	p.S835S	ABCC11_ENST00000356608.2_Silent_p.S835S|ABCC11_ENST00000394748.1_Silent_p.S835S|ABCC11_ENST00000353782.5_Silent_p.S835S|ABCC11_ENST00000537808.1_3'UTR	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	835	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)	p.S835S(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	CACTCACCCCCGAGCCCTGCT	0.522																																																1	Substitution - coding silent(1)	ovary(1)	16											114.0	85.0	95.0					16																	48227793		2201	4300	6501	46785294	SO:0001819	synonymous_variant	85320			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.2505G>A	16.37:g.48227793C>T			46785294	Q8TDJ0|Q96JA6|Q9BX80	Silent	SNP	ENST00000394747.1	37	CCDS10732.1	SNP	23	Broad																																																																																				0.522	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583		Silent
TRPV3	162514	broad.mit.edu	37	17	3427603	3427603	+	Silent	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr17:3427603G>A	ENST00000576742.1	-	13	1953	c.1632C>T	c.(1630-1632)taC>taT	p.Y544Y	TRPV3_ENST00000301365.4_Silent_p.Y544Y|TRPV3_ENST00000572519.1_Silent_p.Y544Y	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	544					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)	p.Y544Y(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	GGTACTCTTTGTAGGCAAACA	0.527																																																1	Substitution - coding silent(1)	ovary(1)	17											116.0	105.0	109.0					17																	3427603		2203	4300	6503	3374353	SO:0001819	synonymous_variant	162514			AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.1632C>T	17.37:g.3427603G>A			3374353	Q8NDW7|Q8NET9|Q8NFH2	Silent	SNP	ENST00000576742.1	37	CCDS11029.1	SNP	48	Broad																																																																																				0.527	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068		Silent
SLC2A4	6517	broad.mit.edu	37	17	7187590	7187590	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr17:7187590G>C	ENST00000317370.8	+	6	887	c.619G>C	c.(619-621)Ggc>Cgc	p.G207R	SLC2A4_ENST00000424875.2_Missense_Mutation_p.G197R|RP1-4G17.2_ENST00000576271.1_RNA|SLC2A4_ENST00000571308.1_Missense_Mutation_p.G207R	NM_001042.2	NP_001033.1	P14672	GTR4_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 4	207					amylopectin biosynthetic process (GO:0010021)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|cellular response to osmotic stress (GO:0071470)|glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|membrane organization (GO:0061024)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|endomembrane system (GO:0012505)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|trans-Golgi network transport vesicle (GO:0030140)|vesicle membrane (GO:0012506)	D-glucose transmembrane transporter activity (GO:0055056)|glucose transmembrane transporter activity (GO:0005355)	p.G207R(1)		breast(1)|endometrium(3)|large_intestine(7)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17						ACTGCTCCTGGGCCTCACAGT	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											53.0	54.0	53.0					17																	7187590		2203	4300	6503	7128314	SO:0001583	missense	6517			M20747	CCDS11097.1	17p13	2013-05-22			ENSG00000181856	ENSG00000181856		"""Solute carriers"""	11009	protein-coding gene	gene with protein product		138190		GLUT4			Standard	NM_001042		Approved		uc002gfp.3	P14672	OTTHUMG00000102181	ENST00000317370.8:c.619G>C	17.37:g.7187590G>C	ENSP00000320935:p.Gly207Arg		7128314	Q05BQ3|Q14CX2	Missense_Mutation	SNP	ENST00000317370.8	37	CCDS11097.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	18.89	3.720252	0.68959	.	.	ENSG00000181856	ENST00000317370;ENST00000424875	T;T	0.81078	0.29;-1.45	5.66	4.5	0.54988	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.128603	0.53938	D	0.000052	D	0.88973	0.6583	H	0.97587	4.035	0.43603	D	0.995962	P;P	0.36616	0.491;0.561	B;B	0.42771	0.397;0.276	D	0.91477	0.5201	10	0.87932	D	0	.	12.7589	0.57352	0.0936:0.0:0.9064:0.0	.	207;197	P14672;F5H081	GTR4_HUMAN;.	R	207;197	ENSP00000320935:G207R;ENSP00000396887:G197R	ENSP00000320935:G207R	G	+	1	0	SLC2A4	7128314	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.696000	0.74598	2.665000	0.90641	0.655000	0.94253	GGC		0.637	SLC2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220031.3			Missense_Mutation
DNAH9	1770	broad.mit.edu	37	17	11604512	11604512	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr17:11604512C>A	ENST00000262442.4	+	24	5167	c.5099C>A	c.(5098-5100)aCt>aAt	p.T1700N	DNAH9_ENST00000454412.2_Missense_Mutation_p.T1700N	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1700	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.T1700N(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAAGGTGTAACTGCCTATGAA	0.498																																																1	Substitution - Missense(1)	ovary(1)	17											160.0	146.0	151.0					17																	11604512		2203	4300	6503	11545237	SO:0001583	missense	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.5099C>A	17.37:g.11604512C>A	ENSP00000262442:p.Thr1700Asn		11545237	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	2.957	-0.215353	0.06101	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.61158	0.13;0.13	5.95	4.96	0.65561	Dynein heavy chain, domain-2 (1);	0.518999	0.20157	N	0.098026	T	0.47600	0.1454	L	0.41027	1.25	0.21064	N	0.999793	B	0.13145	0.007	B	0.18561	0.022	T	0.33137	-0.9880	10	0.27082	T	0.32	.	11.4842	0.50344	0.0:0.8521:0.0:0.1479	.	1700	Q9NYC9	DYH9_HUMAN	N	1700;1700;282	ENSP00000262442:T1700N;ENSP00000414874:T1700N	ENSP00000262442:T1700N	T	+	2	0	DNAH9	11545237	0.000000	0.05858	0.750000	0.31169	0.024000	0.10985	0.227000	0.17795	1.460000	0.47911	0.655000	0.94253	ACT		0.498	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		Missense_Mutation
MYOCD	93649	broad.mit.edu	37	17	12639616	12639616	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr17:12639616C>T	ENST00000343344.4	+	6	554	c.554C>T	c.(553-555)tCa>tTa	p.S185L	AC005358.1_ENST00000609971.1_Missense_Mutation_p.S89L|MYOCD_ENST00000395988.1_3'UTR|MYOCD_ENST00000425538.1_Missense_Mutation_p.S185L			Q8IZQ8	MYCD_HUMAN	myocardin	185	HDAC5-binding. {ECO:0000250}.				cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.S185L(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GCTAAAGCCTCAGATACCCCT	0.483																																																1	Substitution - Missense(1)	ovary(1)	17											80.0	87.0	85.0					17																	12639616		2203	4300	6503	12580341	SO:0001583	missense	93649			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.554C>T	17.37:g.12639616C>T	ENSP00000341835:p.Ser185Leu		12580341	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	CCDS11163.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	9.054	0.992868	0.18966	.	.	ENSG00000141052	ENST00000425538;ENST00000343344;ENST00000395988	T	0.50548	0.74	6.03	1.72	0.24424	.	1.124580	0.06442	N	0.726145	T	0.38241	0.1033	L	0.36672	1.1	0.09310	N	1	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.06405	0.002;0.002;0.002	T	0.27262	-1.0079	10	0.30078	T	0.28	3.7688	9.0011	0.36083	0.0:0.6181:0.0:0.3819	.	89;185;185	Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	L	185;185;89	ENSP00000341835:S185L	ENSP00000341835:S185L	S	+	2	0	MYOCD	12580341	0.000000	0.05858	0.000000	0.03702	0.111000	0.19643	0.293000	0.19029	0.392000	0.25172	0.655000	0.94253	TCA		0.483	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604		Missense_Mutation
NLE1	54475	broad.mit.edu	37	17	33460466	33460466	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr17:33460466C>A	ENST00000442241.4	-	11	1305	c.1266G>T	c.(1264-1266)tgG>tgT	p.W422C	NLE1_ENST00000360831.5_Missense_Mutation_p.W380C|NLE1_ENST00000586869.1_Missense_Mutation_p.W130C	NM_001014445.1|NM_018096.3	NP_001014445.1|NP_060566.2	Q9NVX2	NLE1_HUMAN	notchless homolog 1 (Drosophila)	422					hematopoietic stem cell homeostasis (GO:0061484)|inner cell mass cell differentiation (GO:0001826)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of mitotic cell cycle (GO:0045930)|Notch signaling pathway (GO:0007219)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|ribosomal large subunit biogenesis (GO:0042273)	nucleolus (GO:0005730)|nucleus (GO:0005634)		p.W422C(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	22		Ovarian(249;0.17)				TGTCAGCTGACCACGCAATCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	17											39.0	33.0	35.0					17																	33460466		2203	4300	6503	30484579	SO:0001583	missense	54475				CCDS11291.1, CCDS45647.1	17q12	2013-01-10		2005-08-09	ENSG00000073536	ENSG00000073536		"""WD repeat domain containing"""	19889	protein-coding gene	gene with protein product	"""Notchless gene homolog, (Drosophila)"""						Standard	XM_005257989		Approved	FLJ10458	uc002hiy.1	Q9NVX2	OTTHUMG00000132928	ENST00000442241.4:c.1266G>T	17.37:g.33460466C>A	ENSP00000413572:p.Trp422Cys		30484579	O60868|Q59GJ8|Q9BU54	Missense_Mutation	SNP	ENST00000442241.4	37	CCDS11291.1	SNP	18	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.4|23.4	4.415411|4.415411	0.83449|0.83449	.|.	.|.	ENSG00000073536|ENSG00000073536	ENST00000436188|ENST00000442241;ENST00000360831;ENST00000537697	.|T	.|0.66280	.|-0.2	5.14|5.14	5.14|5.14	0.70334|0.70334	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);G-protein, beta subunit (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78972|0.78972	0.4368|0.4368	M|M	0.75884|0.75884	2.315|2.315	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.995;0.999	T|T	0.81206|0.81206	-0.1038|-0.1038	5|10	.|0.87932	.|D	.|0	-11.7276|-11.7276	16.146|16.146	0.81569|0.81569	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|398;422	.|B4E074;Q9NVX2	.|.;NLE1_HUMAN	V|C	241|422;130;398	.|ENSP00000413572:W422C	.|ENSP00000354075:W130C	G|W	-|-	2|3	0|0	NLE1|NLE1	30484579|30484579	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.979000|0.979000	0.70002|0.70002	5.449000|5.449000	0.66619|0.66619	2.653000|2.653000	0.90120|0.90120	0.563000|0.563000	0.77884|0.77884	GGT|TGG		0.592	NLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256441.2	NM_018096		Missense_Mutation
ARL4D	379	broad.mit.edu	37	17	41477150	41477150	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr17:41477150C>G	ENST00000320033.4	+	2	257	c.50C>G	c.(49-51)cCc>cGc	p.P17R		NM_001661.3	NP_001652.2	P49703	ARL4D_HUMAN	ADP-ribosylation factor-like 4D	17					GTP catabolic process (GO:0006184)|protein secretion (GO:0009306)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.P17R(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.155)		TCCTTCTTGCCCCACTTCCAA	0.557																																																1	Substitution - Missense(1)	ovary(1)	17											73.0	71.0	72.0					17																	41477150		2203	4300	6503	38832676	SO:0001583	missense	379			AB060692	CCDS11463.1	17q21.31	2014-05-09	2005-11-03	2005-11-03	ENSG00000175906	ENSG00000175906		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	656	protein-coding gene	gene with protein product		600732	"""ADP-ribosylation factor 4-like"""	ARF4L		7590735	Standard	NM_001661		Approved		uc002idt.3	P49703		ENST00000320033.4:c.50C>G	17.37:g.41477150C>G	ENSP00000322628:p.Pro17Arg		38832676	B2RC59|D3DX43	Missense_Mutation	SNP	ENST00000320033.4	37	CCDS11463.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	15.81	2.943351	0.53079	.	.	ENSG00000175906	ENST00000320033	T	0.75154	-0.91	4.82	4.82	0.62117	.	0.064960	0.64402	D	0.000007	T	0.78953	0.4365	L	0.36672	1.1	0.58432	D	0.999998	D	0.56746	0.977	D	0.65323	0.934	T	0.75230	-0.3391	10	0.27082	T	0.32	-9.645	17.1766	0.86843	0.0:1.0:0.0:0.0	.	17	P49703	ARL4D_HUMAN	R	17	ENSP00000322628:P17R	ENSP00000322628:P17R	P	+	2	0	ARL4D	38832676	0.997000	0.39634	0.968000	0.41197	0.005000	0.04900	5.691000	0.68249	2.643000	0.89663	0.563000	0.77884	CCC		0.557	ARL4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453481.2	NM_001661		Missense_Mutation
STXBP4	252983	broad.mit.edu	37	17	53063586	53063586	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr17:53063586T>G	ENST00000376352.2	+	3	213	c.6T>G	c.(4-6)aaT>aaG	p.N2K	STXBP4_ENST00000398391.2_De_novo_Start_OutOfFrame|STXBP4_ENST00000405898.1_Missense_Mutation_p.N2K|STXBP4_ENST00000299341.4_De_novo_Start_OutOfFrame|STXBP4_ENST00000434978.2_Missense_Mutation_p.N2K	NM_178509.5	NP_848604.3	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	2					cellular response to DNA damage stimulus (GO:0006974)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of keratinocyte proliferation (GO:0010838)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.N2K(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19						AAAGCATGAATAAAAATACAT	0.279																																																1	Substitution - Missense(1)	ovary(1)	17											58.0	63.0	61.0					17																	53063586		2203	4290	6493	50418585	SO:0001583	missense	252983			BC041485	CCDS11584.2	17q22	2008-02-05			ENSG00000166263	ENSG00000166263			19694	protein-coding gene	gene with protein product		610415				12855681	Standard	XM_005257187		Approved	Synip, MGC50337	uc002iuf.1	Q6ZWJ1	OTTHUMG00000074043	ENST00000376352.2:c.6T>G	17.37:g.53063586T>G	ENSP00000365530:p.Asn2Lys		50418585	Q8IVZ5	Missense_Mutation	SNP	ENST00000376352.2	37	CCDS11584.2	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	12.83	2.056606	0.36277	.	.	ENSG00000166263	ENST00000376352;ENST00000405898;ENST00000434978	T;T;T	0.03920	3.87;3.76;3.85	5.53	3.29	0.37713	.	0.683455	0.14806	N	0.297366	T	0.03915	0.0110	L	0.44542	1.39	0.80722	D	1	B;P	0.43094	0.18;0.799	B;B	0.30179	0.037;0.112	T	0.48445	-0.9035	10	0.66056	D	0.02	-5.6338	7.0757	0.25203	0.0:0.1781:0.0:0.8219	.	2;2	E7EPP7;Q6ZWJ1	.;STXB4_HUMAN	K	2	ENSP00000365530:N2K;ENSP00000385944:N2K;ENSP00000391087:N2K	ENSP00000365530:N2K	N	+	3	2	STXBP4	50418585	1.000000	0.71417	0.948000	0.38648	0.472000	0.32918	2.276000	0.43408	1.121000	0.41925	0.533000	0.62120	AAT		0.279	STXBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157184.1	NM_178509		Missense_Mutation
TUBD1	51174	broad.mit.edu	37	17	57937777	57937777	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr17:57937777A>G	ENST00000592426.1	-	8	1268	c.1268T>C	c.(1267-1269)aTt>aCt	p.I423T	TUBD1_ENST00000376094.4_Missense_Mutation_p.I321T|TUBD1_ENST00000340993.6_Missense_Mutation_p.I368T|TUBD1_ENST00000539018.1_Missense_Mutation_p.I207T|TUBD1_ENST00000346141.6_Missense_Mutation_p.I169T|TUBD1_ENST00000325752.3_Missense_Mutation_p.I423T|TUBD1_ENST00000394239.3_Missense_Mutation_p.I366T			Q9UJT1	TBD_HUMAN	tubulin, delta 1	423					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|protein polymerization (GO:0051258)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.I423T(1)		NS(2)|breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(2)	21	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)		Vinblastine(DB00570)	GTACTGATGAATGTAGGCTCT	0.333																																																1	Substitution - Missense(1)	ovary(1)	17											93.0	91.0	91.0					17																	57937777		2203	4300	6503	55292559	SO:0001583	missense	51174			AF201333	CCDS11620.1, CCDS54151.1, CCDS54152.1, CCDS54153.1, CCDS54154.1	17q23.1	2007-03-16						"""Tubulins"""	16811	protein-coding gene	gene with protein product		607344				10620804	Standard	NM_016261		Approved	FLJ12709, TUBD	uc002ixw.2	Q9UJT1		ENST00000592426.1:c.1268T>C	17.37:g.57937777A>G	ENSP00000468518:p.Ile423Thr		55292559	B4DPT8|B4DW01|D3DU02|E9PCA7|E9PCQ8|Q5KU36|Q9BWG9|Q9H7Z8	Missense_Mutation	SNP	ENST00000592426.1	37	CCDS11620.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	17.02	3.280780	0.59758	.	.	ENSG00000108423	ENST00000325752;ENST00000340993;ENST00000346141;ENST00000394239;ENST00000376094;ENST00000539018	T;T;T;T;T	0.80653	-1.26;-0.9;-1.4;-0.92;-1.05	5.95	5.95	0.96441	Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.552860	0.21365	N	0.075736	T	0.81702	0.4878	L	0.48362	1.52	0.52501	D	0.99995	B;B;B;B;B;B	0.33512	0.03;0.415;0.068;0.038;0.052;0.006	B;B;B;B;B;B	0.42522	0.047;0.39;0.015;0.022;0.037;0.017	T	0.82139	-0.0605	10	0.87932	D	0	-5.3213	16.4069	0.83677	1.0:0.0:0.0:0.0	.	366;169;368;321;368;423	E9PCA7;Q9UJT1-3;Q5KU37;E9PCQ8;Q9UJT1-2;Q9UJT1	.;.;.;.;.;TBD_HUMAN	T	423;368;169;366;321;207	ENSP00000320797:I423T;ENSP00000342399:I368T;ENSP00000342561:I169T;ENSP00000377785:I366T;ENSP00000365262:I321T	ENSP00000320797:I423T	I	-	2	0	TUBD1	55292559	1.000000	0.71417	0.972000	0.41901	0.953000	0.61014	8.726000	0.91474	2.272000	0.75746	0.460000	0.39030	ATT		0.333	TUBD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448815.1	NM_016261		Missense_Mutation
PDE6G	5148	broad.mit.edu	37	17	79615016	79615016	+	IGR	SNP	G	G	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr17:79615016G>T	ENST00000331056.5	-	0	1023				TSPAN10_ENST00000328585.4_RNA|PDE6G_ENST00000574777.1_5'Flank|TSPAN10_ENST00000572675.1_RNA	NM_002602.3	NP_002593.1	P18545	CNRG_HUMAN	phosphodiesterase 6G, cGMP-specific, rod, gamma						activation of MAPK activity (GO:0000187)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|enzyme inhibitor activity (GO:0004857)	p.V254F(1)		lung(2)|urinary_tract(1)	3	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)		Sildenafil(DB00203)|Vardenafil(DB00862)	TGGAGCCTCTGTCAACGACCA	0.682																																					GBM(189;38 2147 16440 40945 46567)											1	Substitution - Missense(1)	ovary(1)	17											17.0	21.0	20.0					17																	79615016		2008	4170	6178	77225421	SO:0001628	intergenic_variant	83882				CCDS11783.1	17q21.1	2014-01-28				ENSG00000185527	3.1.4.17	"""Phosphodiesterases"""	8789	protein-coding gene	gene with protein product		180073		PDEG		2155175	Standard	NM_002602		Approved	RP57	uc002kay.3	P18545			17.37:g.79615016G>T			77225421	Q3KP63|Q7Z3U8	Missense_Mutation	SNP	ENST00000331056.5	37	CCDS11783.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	11.15	1.553370	0.27739	.	.	ENSG00000182612	ENST00000328585	T	0.08008	3.14	4.48	-0.4	0.12411	Tetraspanin, EC2 domain (1);	0.700949	0.14102	N	0.341318	T	0.15782	0.0380	.	.	.	0.09310	N	1	D	0.60160	0.987	P	0.60789	0.879	T	0.08953	-1.0697	9	0.48119	T	0.1	-29.7327	5.0916	0.14711	0.5493:0.1605:0.2902:0.0	.	254	Q9H1Z9	TSN10_HUMAN	F	254	ENSP00000331620:V254F	ENSP00000331620:V254F	V	+	1	0	TSPAN10	77225421	0.010000	0.17322	0.002000	0.10522	0.872000	0.50106	0.250000	0.18235	0.059000	0.16252	-0.150000	0.13652	GTC		0.682	PDE6G-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440314.1			Missense_Mutation
TGIF1	7050	broad.mit.edu	37	18	3456474	3456474	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr18:3456474G>T	ENST00000330513.5	+	2	829	c.526G>T	c.(526-528)Gtg>Ttg	p.V176L	TGIF1_ENST00000548489.2_Missense_Mutation_p.V61L|TGIF1_ENST00000405385.3_Missense_Mutation_p.V27L|TGIF1_ENST00000577543.1_Missense_Mutation_p.V47L|TGIF1_ENST00000551402.1_Missense_Mutation_p.V47L|TGIF1_ENST00000551541.1_Missense_Mutation_p.V27L|TGIF1_ENST00000345133.5_Missense_Mutation_p.V27L|TGIF1_ENST00000343820.5_Missense_Mutation_p.V47L|TGIF1_ENST00000400167.2_Missense_Mutation_p.V27L|TGIF1_ENST00000407501.2_Missense_Mutation_p.V47L|TGIF1_ENST00000472042.1_Missense_Mutation_p.V27L|TGIF1_ENST00000401449.1_Missense_Mutation_p.V27L	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	176					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.V176L(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				CAAGGAGTCTGTGCAGATTCT	0.517																																																1	Substitution - Missense(1)	ovary(1)	18											217.0	195.0	202.0					18																	3456474		2203	4300	6503	3446474	SO:0001583	missense	7050			X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.526G>T	18.37:g.3456474G>T	ENSP00000327959:p.Val176Leu		3446474	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Missense_Mutation	SNP	ENST00000330513.5	37	CCDS11834.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303493	0.81136	.	.	ENSG00000177426	ENST00000552383;ENST00000401449;ENST00000550958;ENST00000548489;ENST00000549780;ENST00000549253;ENST00000405385;ENST00000343820;ENST00000407501;ENST00000546979;ENST00000551402;ENST00000551541;ENST00000345133;ENST00000330513;ENST00000549546;ENST00000549468;ENST00000400167;ENST00000551333;ENST00000472042	D;D;D;D;D;D;D;D;D;T;D;D;D;D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;0.72;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53	5.97	5.97	0.96955	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.88618	0.6485	L	0.52905	1.665	0.80722	D	1	D;P;D;D	0.89917	1.0;0.865;0.999;0.999	D;P;D;D	0.83275	0.996;0.838;0.993;0.995	D	0.88434	0.3037	10	0.87932	D	0	-23.1159	20.4214	0.99039	0.0:0.0:1.0:0.0	.	47;176;47;61	F8W1J9;Q15583;Q15583-2;F8VZB6	.;TGIF1_HUMAN;.;.	L	27;27;27;61;27;50;27;47;47;47;47;27;27;176;27;27;27;27;27	ENSP00000449287:V27L;ENSP00000385206:V27L;ENSP00000449531:V27L;ENSP00000447747:V61L;ENSP00000448121:V27L;ENSP00000384970:V27L;ENSP00000339631:V47L;ENSP00000384133:V47L;ENSP00000448934:V47L;ENSP00000446944:V47L;ENSP00000450025:V27L;ENSP00000343969:V27L;ENSP00000327959:V176L;ENSP00000449580:V27L;ENSP00000449722:V27L;ENSP00000383031:V27L;ENSP00000446838:V27L;ENSP00000449501:V27L	ENSP00000327959:V176L	V	+	1	0	TGIF1	3446474	1.000000	0.71417	0.966000	0.40874	0.870000	0.49936	9.473000	0.97714	2.820000	0.97059	0.655000	0.94253	GTG		0.517	TGIF1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254368.4	NM_170695		Missense_Mutation
DSC1	1823	broad.mit.edu	37	18	28714042	28714042	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr18:28714042G>A	ENST00000257198.5	-	13	2189	c.1928C>T	c.(1927-1929)tCt>tTt	p.S643F	RP11-408H20.2_ENST00000581836.1_RNA|RP11-408H20.3_ENST00000582307.1_RNA|DSC1_ENST00000257197.3_Missense_Mutation_p.S643F	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	643	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S643F(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			AATAGGCACAGAATAATAGTT	0.358																																																1	Substitution - Missense(1)	ovary(1)	18											114.0	114.0	114.0					18																	28714042		2203	4299	6502	26968040	SO:0001583	missense	1823			AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.1928C>T	18.37:g.28714042G>A	ENSP00000257198:p.Ser643Phe		26968040	Q9HB01	Missense_Mutation	SNP	ENST00000257198.5	37	CCDS11894.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	3.644	-0.072868	0.07228	.	.	ENSG00000134765	ENST00000257197;ENST00000257198	T;T	0.61392	0.11;0.11	5.91	-0.396	0.12427	Cadherin (2);Cadherin-like (1);	0.846377	0.10265	N	0.695502	T	0.38453	0.1041	L	0.34521	1.04	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.08055	0.003;0.003	T	0.21109	-1.0255	10	0.33940	T	0.23	.	1.888	0.03242	0.1365:0.2226:0.2985:0.3424	.	643;643	Q08554;Q9HB00	DSC1_HUMAN;.	F	643	ENSP00000257197:S643F;ENSP00000257198:S643F	ENSP00000257197:S643F	S	-	2	0	DSC1	26968040	0.000000	0.05858	0.012000	0.15200	0.042000	0.13812	-0.260000	0.08708	-0.401000	0.07644	-0.224000	0.12420	TCT		0.358	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	NM_004948, NM_024421		Missense_Mutation
INSR	3643	broad.mit.edu	37	19	7267483	7267483	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr19:7267483G>T	ENST00000302850.5	-	2	667	c.525C>A	c.(523-525)aaC>aaA	p.N175K	INSR_ENST00000341500.5_Missense_Mutation_p.N175K	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	175					activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.N175K(1)		breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TGTCATCTTTGTTCAACACGA	0.527																																																1	Substitution - Missense(1)	ovary(1)	19											165.0	128.0	141.0					19																	7267483		2203	4300	6503	7218483	SO:0001583	missense	3643			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.525C>A	19.37:g.7267483G>T	ENSP00000303830:p.Asn175Lys		7218483	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	CCDS12176.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305779	0.60305	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	D;D	0.82893	-1.66;-1.66	5.1	5.1	0.69264	.	0.000000	0.50627	D	0.000119	D	0.91751	0.7391	M	0.86097	2.795	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;P	0.91635	0.999;0.985;0.847	D	0.92970	0.6397	10	0.72032	D	0.01	.	16.0231	0.80512	0.0:0.0:1.0:0.0	.	166;175;175	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	K	175	ENSP00000303830:N175K;ENSP00000342838:N175K	ENSP00000303830:N175K	N	-	3	2	INSR	7218483	1.000000	0.71417	1.000000	0.80357	0.579000	0.36224	5.024000	0.64090	2.363000	0.80096	0.563000	0.77884	AAC		0.527	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1			Missense_Mutation
RAB3D	9545	broad.mit.edu	37	19	11446127	11446127	+	Silent	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr19:11446127G>A	ENST00000222120.3	-	4	728	c.468C>T	c.(466-468)gaC>gaT	p.D156D	RAB3D_ENST00000589655.1_Silent_p.D156D	NM_004283.3	NP_004274.1	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family	156					exocytosis (GO:0006887)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)|zymogen granule (GO:0042588)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.D156D(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|ovary(2)	14						ACTAACCAAGGTCGTCGGCGA	0.607																																																1	Substitution - coding silent(1)	ovary(1)	19											58.0	50.0	53.0					19																	11446127		2203	4300	6503	11307127	SO:0001819	synonymous_variant	9545			AF081353	CCDS12257.1	19p13.2	2012-10-02			ENSG00000105514	ENSG00000105514		"""RAB, member RAS oncogene"""	9779	protein-coding gene	gene with protein product	"""Rab3D upregulated with myeloid differentiation"", ""glioblastoma overexpressed"""	604350		GOV		10023084, 10072586	Standard	NM_004283		Approved	RAB16, D2-2, RAD3D	uc002mqx.3	O95716	OTTHUMG00000180835	ENST00000222120.3:c.468C>T	19.37:g.11446127G>A			11307127		Silent	SNP	ENST00000222120.3	37	CCDS12257.1	SNP	44	Broad																																																																																				0.607	RAB3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453211.1	NM_004283		Silent
SLC35E1	79939	broad.mit.edu	37	19	16677361	16677361	+	Silent	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr19:16677361G>A	ENST00000595753.1	-	4	755	c.738C>T	c.(736-738)ttC>ttT	p.F246F	CTD-3222D19.2_ENST00000409035.1_3'UTR|CTD-3222D19.10_ENST00000597851.1_RNA|SLC35E1_ENST00000431408.1_Silent_p.F90F	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	246					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.F102F(1)		central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						TGCTGACCAGGAAAGCCGAGA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	19											73.0	72.0	72.0					19																	16677361		2203	4300	6503	16538361	SO:0001819	synonymous_variant	79939			AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.738C>T	19.37:g.16677361G>A			16538361	Q8NBQ2|Q96JV7	Silent	SNP	ENST00000595753.1	37	CCDS12346.2	SNP	41	Broad																																																																																				0.542	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881		Silent
KPTN	11133	broad.mit.edu	37	19	47984046	47984046	+	Silent	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr19:47984046G>A	ENST00000338134.3	-	6	677	c.570C>T	c.(568-570)ctC>ctT	p.L190L	KPTN_ENST00000536339.1_5'UTR|KPTN_ENST00000595484.1_5'UTR	NM_007059.2	NP_008990.2	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)	190					actin filament organization (GO:0007015)|cellular component movement (GO:0006928)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.L190L(1)		breast(1)|lung(3)|ovary(2)|pancreas(2)	8		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		GCTCTGGGAAGAGGTTTTCCA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	19											134.0	139.0	138.0					19																	47984046		1943	4134	6077	52675858	SO:0001819	synonymous_variant	11133			AF105369	CCDS42583.1	19q13.32	2014-08-13	2001-11-28		ENSG00000118162	ENSG00000118162			6404	protein-coding gene	gene with protein product		615620	"""kaptin (actin-binding protein)"""			10099934	Standard	XM_005258467		Approved	2E4	uc002pgy.3	Q9Y664	OTTHUMG00000183443	ENST00000338134.3:c.570C>T	19.37:g.47984046G>A			52675858	B3KN86|B4DQ76|Q96GT1	Silent	SNP	ENST00000338134.3	37	CCDS42583.1	SNP	33	Broad																																																																																				0.597	KPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466672.2			Silent
CLEC11A	6320	broad.mit.edu	37	19	51228594	51228594	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr19:51228594A>C	ENST00000250340.4	+	4	1039	c.842A>C	c.(841-843)cAt>cCt	p.H281P	CLEC11A_ENST00000599973.1_Silent_p.A297A	NM_002975.2	NP_002966.1	Q9Y240	CLC11_HUMAN	C-type lectin domain family 11, member A	281	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)	p.H281P(1)		kidney(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	7		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		GCCTCGCCGCATCCGCTCAGC	0.711																																																1	Substitution - Missense(1)	ovary(1)	19											13.0	15.0	15.0					19																	51228594		2174	4264	6438	55920406	SO:0001583	missense	6320			AF087658	CCDS12800.1	19q13.3	2010-04-27	2005-02-09	2005-02-11		ENSG00000105472		"""C-type lectin domain containing"""	10576	protein-coding gene	gene with protein product		604713	"""stem cell growth factor; lymphocyte secreted C-type lectin"""	SCGF		9207134, 9442024	Standard	NM_002975		Approved	P47, LSLCL, CLECSF3	uc002psy.3	Q9Y240		ENST00000250340.4:c.842A>C	19.37:g.51228594A>C	ENSP00000250340:p.His281Pro		55920406	B2RAD4	Missense_Mutation	SNP	ENST00000250340.4	37	CCDS12800.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	13.27	2.187390	0.38609	.	.	ENSG00000105472	ENST00000250340;ENST00000445858	T	0.40756	1.02	4.59	2.05	0.26809	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.173882	0.27563	N	0.018817	T	0.22126	0.0533	N	0.08118	0	0.40351	D	0.979132	B	0.18461	0.028	B	0.21546	0.035	T	0.06844	-1.0804	10	0.62326	D	0.03	-27.1348	8.6452	0.34000	0.5151:0.4849:0.0:0.0	.	281	Q9Y240	CLC11_HUMAN	P	281;203	ENSP00000250340:H281P	ENSP00000250340:H281P	H	+	2	0	CLEC11A	55920406	1.000000	0.71417	0.989000	0.46669	0.452000	0.32318	1.577000	0.36515	0.669000	0.31146	0.374000	0.22700	CAT		0.711	CLEC11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464062.1	NM_002975		Missense_Mutation
NBAS	51594	broad.mit.edu	37	2	15330512	15330512	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:15330512T>A	ENST00000281513.5	-	49	6473	c.6448A>T	c.(6448-6450)Att>Ttt	p.I2150F	NBAS_ENST00000441750.1_Missense_Mutation_p.I2030F	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	2150					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.I2150F(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TCATTCTCAATGTCAGCTATG	0.378																																																1	Substitution - Missense(1)	ovary(1)	2											103.0	104.0	104.0					2																	15330512		2203	4300	6503	15247963	SO:0001583	missense	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.6448A>T	2.37:g.15330512T>A	ENSP00000281513:p.Ile2150Phe		15247963	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	19.94	3.919360	0.73098	.	.	ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000433283;ENST00000423602	T;T	0.10668	2.85;3.03	5.47	-4.32	0.03688	.	0.555420	0.20111	N	0.099008	T	0.17534	0.0421	L	0.48642	1.525	0.09310	N	0.999999	D;P	0.64830	0.994;0.49	P;B	0.59424	0.857;0.149	T	0.03296	-1.1051	10	0.87932	D	0	.	12.5309	0.56115	0.0:0.4952:0.0:0.5048	.	2030;2150	A2RRP1-2;A2RRP1	.;NBAS_HUMAN	F	2030;2150;6;4	ENSP00000413201:I2030F;ENSP00000281513:I2150F	ENSP00000281513:I2150F	I	-	1	0	NBAS	15247963	0.036000	0.19791	0.000000	0.03702	0.489000	0.33432	0.040000	0.13905	-1.003000	0.03425	-0.263000	0.10527	ATT		0.378	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		Missense_Mutation
APOB	338	broad.mit.edu	37	2	21230478	21230478	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:21230478G>T	ENST00000233242.1	-	26	9389	c.9262C>A	c.(9262-9264)Caa>Aaa	p.Q3088K		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3088					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.Q3088K(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCACTTACTTGCCAACTTGCT	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											103.0	104.0	104.0					2																	21230478		2203	4300	6503	21083983	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.9262C>A	2.37:g.21230478G>T	ENSP00000233242:p.Gln3088Lys		21083983	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	6.440	0.449364	0.12223	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.33654	1.4	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000002	T	0.39989	0.1099	M	0.74881	2.28	0.80722	D	1	P	0.42827	0.791	B	0.40864	0.342	T	0.29088	-1.0023	10	0.09338	T	0.73	.	16.462	0.84059	0.0:0.1309:0.8691:0.0	.	3088	P04114	APOB_HUMAN	K	3088	ENSP00000233242:Q3088K	ENSP00000233242:Q3088K	Q	-	1	0	APOB	21083983	0.991000	0.36638	1.000000	0.80357	0.897000	0.52465	1.719000	0.38011	2.780000	0.95670	0.655000	0.94253	CAA		0.408	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			Missense_Mutation
OTOF	9381	broad.mit.edu	37	2	26686897	26686897	+	Missense_Mutation	SNP	G	G	A	rs147070644	byFrequency	TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:26686897G>A	ENST00000272371.2	-	40	5164	c.5038C>T	c.(5038-5040)Cgc>Tgc	p.R1680C	OTOF_ENST00000403946.3_Missense_Mutation_p.R1680C|OTOF_ENST00000338581.6_Missense_Mutation_p.R913C|OTOF_ENST00000339598.3_Missense_Mutation_p.R913C|OTOF_ENST00000402415.3_Missense_Mutation_p.R990C	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1680			R -> H (in dbSNP:rs11893228).		membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.R913C(1)|p.R1680C(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCACCAGGCGGCAGCCTGCG	0.667																																					GBM(102;732 1451 20652 24062 31372)											2	Substitution - Missense(2)	ovary(2)	2						G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	68.0	72.0	71.0		2737,5038,2968,2737	4.4	1.0	2	dbSNP_134	71	8,8592	5.7+/-21.5	0,8,4292	yes	missense,missense,missense,missense	OTOF	NM_004802.3,NM_194248.2,NM_194322.2,NM_194323.2	180,180,180,180	0,10,6493	AA,AG,GG		0.093,0.0454,0.0769	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	913/1231,1680/1998,990/1308,913/1231	26686897	10,12996	2203	4300	6503	26540401	SO:0001583	missense	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.5038C>T	2.37:g.26686897G>A	ENSP00000272371:p.Arg1680Cys		26540401	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	16.29	3.081687	0.55753	4.54E-4	9.3E-4	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.80824	-1.16;-1.16;-1.15;-1.42;-1.42	4.4	4.4	0.53042	.	0.288557	0.33691	N	0.004654	T	0.78091	0.4229	L	0.50333	1.59	0.49798	D	0.999822	P;P;P;P	0.52061	0.917;0.719;0.95;0.719	B;P;P;P	0.47162	0.28;0.54;0.526;0.54	T	0.79962	-0.1582	10	0.62326	D	0.03	-18.079	10.2203	0.43192	0.0:0.0:0.6615:0.3385	.	1680;913;990;913	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	C	913;913;990;1680;1680	ENSP00000345137:R913C;ENSP00000344521:R913C;ENSP00000383906:R990C;ENSP00000272371:R1680C;ENSP00000385255:R1680C	ENSP00000272371:R1680C	R	-	1	0	OTOF	26540401	1.000000	0.71417	1.000000	0.80357	0.294000	0.27393	3.862000	0.56009	2.264000	0.75181	0.561000	0.74099	CGC		0.667	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			Missense_Mutation
CIB4	130106	broad.mit.edu	37	2	26818119	26818119	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:26818119C>T	ENST00000288861.4	-	4	306	c.253G>A	c.(253-255)Gtg>Atg	p.V85M	CIB4_ENST00000405346.3_5'UTR	NM_001029881.1	NP_001025052.1	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4	85	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)	p.V85M(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGCCCAGCACATCCTCAAAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	2											127.0	108.0	114.0					2																	26818119		2203	4300	6503	26671623	SO:0001583	missense	130106				CCDS33160.1	2p23.3	2013-01-10			ENSG00000157884	ENSG00000157884		"""EF-hand domain containing"""	33703	protein-coding gene	gene with protein product		610646				15574431	Standard	NM_001029881		Approved		uc002rhm.3	A0PJX0	OTTHUMG00000151993	ENST00000288861.4:c.253G>A	2.37:g.26818119C>T	ENSP00000288861:p.Val85Met		26671623	B2RU18	Missense_Mutation	SNP	ENST00000288861.4	37	CCDS33160.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	17.40	3.379912	0.61845	.	.	ENSG00000157884	ENST00000288861;ENST00000403670;ENST00000405346	T	0.67345	-0.26	6.08	3.23	0.37069	EF-hand-like domain (1);	0.253386	0.28104	N	0.016600	T	0.50548	0.1622	L	0.29908	0.895	0.31027	N	0.71789	B	0.24618	0.107	B	0.20577	0.03	T	0.55101	-0.8193	10	0.87932	D	0	.	7.3897	0.26903	0.2937:0.6285:0.0:0.0778	.	85	A0PJX0	CIB4_HUMAN	M	85;40;87	ENSP00000288861:V85M	ENSP00000288861:V85M	V	-	1	0	CIB4	26671623	0.939000	0.31865	0.997000	0.53966	0.932000	0.56968	1.089000	0.30890	0.862000	0.35528	0.591000	0.81541	GTG		0.562	CIB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324709.1			Missense_Mutation
ALK	238	broad.mit.edu	37	2	30143334	30143334	+	Missense_Mutation	SNP	G	G	T	rs376663390		TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:30143334G>T	ENST00000389048.3	-	1	1098	c.192C>A	c.(190-192)ttC>ttA	p.F64L	ALK_ENST00000431873.1_Missense_Mutation_p.F64L	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	64					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.F64L(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CGTAGACACGGAAGAGCGAGG	0.706			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	1	Substitution - Missense(1)	ovary(1)	2											30.0	31.0	31.0					2																	30143334		2201	4300	6501	29996838	SO:0001583	missense	238	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.192C>A	2.37:g.30143334G>T	ENSP00000373700:p.Phe64Leu		29996838	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	19.29	3.798953	0.70567	.	.	ENSG00000171094	ENST00000389048;ENST00000431873	T;T	0.75154	-0.91;3.03	5.36	2.48	0.30137	.	.	.	.	.	T	0.53334	0.1790	N	0.14661	0.345	0.36077	D	0.842514	B	0.24963	0.115	B	0.19666	0.026	T	0.50808	-0.8784	8	.	.	.	.	9.8043	0.40783	0.2517:0.0:0.7483:0.0	.	64	Q9UM73	ALK_HUMAN	L	64	ENSP00000373700:F64L;ENSP00000414027:F64L	.	F	-	3	2	ALK	29996838	0.979000	0.34478	1.000000	0.80357	0.746000	0.42486	0.626000	0.24492	0.718000	0.32166	-0.258000	0.10820	TTC		0.706	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304		Missense_Mutation
FANCL	55120	broad.mit.edu	37	2	58386928	58386928	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:58386928G>A	ENST00000233741.4	-	14	1136	c.1100C>T	c.(1099-1101)aCc>aTc	p.T367I	FANCL_ENST00000403295.3_Missense_Mutation_p.T339I|VRK2_ENST00000435505.2_3'UTR|FANCL_ENST00000403676.1_Missense_Mutation_p.T250I|VRK2_ENST00000412104.2_3'UTR|FANCL_ENST00000402135.3_Missense_Mutation_p.T372I|VRK2_ENST00000340157.4_3'UTR|VRK2_ENST00000417641.2_3'UTR	NM_018062.3	NP_060532.2	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L	367					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|gamete generation (GO:0007276)|protein monoubiquitination (GO:0006513)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T367I(1)		endometrium(1)|large_intestine(1)|lung(4)|ovary(2)	8						CATTTTTAAGGTAATTGGCTT	0.284								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																							1	Substitution - Missense(1)	ovary(1)	2											74.0	78.0	77.0					2																	58386928		2201	4285	6486	58240432	SO:0001583	missense	55120	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001197	CCDS1860.1, CCDS46294.1	2p16.1	2014-09-17	2003-10-14	2003-10-15	ENSG00000115392	ENSG00000115392		"""Zinc fingers, PHD-type"", ""Fanconi anemia, complementation groups"""	20748	protein-coding gene	gene with protein product		608111	"""PHD finger protein 9"""	PHF9			Standard	NM_018062		Approved	FLJ10335, FAAP43, Pog	uc002rzx.4	Q9NW38	OTTHUMG00000129349	ENST00000233741.4:c.1100C>T	2.37:g.58386928G>A	ENSP00000233741:p.Thr367Ile		58240432	Q6GU60	Missense_Mutation	SNP	ENST00000233741.4	37	CCDS1860.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600634	0.87055	.	.	ENSG00000115392	ENST00000403295;ENST00000233741;ENST00000402135;ENST00000403676	T;T;T;T	0.68331	-0.32;-0.28;-0.28;-0.32	6.16	6.16	0.99307	.	0.183062	0.56097	D	0.000028	D	0.83626	0.5295	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.993;0.999;1.0	D	0.83755	0.0211	10	0.87932	D	0	-6.4328	20.4702	0.99162	0.0:0.0:1.0:0.0	.	339;372;367	B5MC31;Q9NW38-2;Q9NW38	.;.;FANCL_HUMAN	I	339;367;372;250	ENSP00000386097:T339I;ENSP00000233741:T367I;ENSP00000385021:T372I;ENSP00000384046:T250I	ENSP00000233741:T367I	T	-	2	0	FANCL	58240432	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.664000	0.61540	2.937000	0.99478	0.650000	0.86243	ACC		0.284	FANCL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251497.1	NM_018062		Missense_Mutation
PUS10	150962	broad.mit.edu	37	2	61236067	61236067	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:61236067T>G	ENST00000316752.6	-	3	471	c.210A>C	c.(208-210)aaA>aaC	p.K70N	PUS10_ENST00000407787.1_Missense_Mutation_p.K70N	NM_144709.2	NP_653310.2	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	70					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.K70N(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)	22			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			GCAGTCGAATTTTCTTGGGAG	0.368																																																1	Substitution - Missense(1)	ovary(1)	2											68.0	66.0	67.0					2																	61236067		2203	4299	6502	61089571	SO:0001583	missense	150962			AK056874	CCDS1865.1	2p16.1	2008-02-05	2008-01-09	2008-01-09	ENSG00000162927	ENSG00000162927			26505	protein-coding gene	gene with protein product		612787	"""coiled-coil domain containing 139"""	CCDC139		17900615	Standard	NM_144709		Approved	FLJ32312	uc002sao.3	Q3MIT2	OTTHUMG00000129423	ENST00000316752.6:c.210A>C	2.37:g.61236067T>G	ENSP00000326003:p.Lys70Asn		61089571	Q5JPJ5|Q96MI8	Missense_Mutation	SNP	ENST00000316752.6	37	CCDS1865.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	17.17	3.321650	0.60634	.	.	ENSG00000162927	ENST00000316752;ENST00000407787;ENST00000421319	.	.	.	5.58	1.4	0.22301	.	0.112402	0.56097	D	0.000024	T	0.59945	0.2231	M	0.74881	2.28	0.80722	D	1	P	0.46142	0.873	P	0.47346	0.544	T	0.61515	-0.7047	9	0.62326	D	0.03	-20.5222	9.0091	0.36131	0.0:0.2611:0.0:0.7389	.	70	Q3MIT2	PUS10_HUMAN	N	70	.	ENSP00000326003:K70N	K	-	3	2	PUS10	61089571	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.303000	0.33470	0.395000	0.25257	0.477000	0.44152	AAA		0.368	PUS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251582.2	NM_144709		Missense_Mutation
SCTR	6344	broad.mit.edu	37	2	120231098	120231098	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:120231098C>A	ENST00000019103.5	-	4	603	c.336G>T	c.(334-336)tgG>tgT	p.W112C	AC013275.2_ENST00000413602.1_RNA	NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor	112					digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)	p.W112C(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	AGGTTTCTGACCAGCCATCCT	0.547																																																1	Substitution - Missense(1)	ovary(1)	2											108.0	94.0	99.0					2																	120231098		2203	4300	6503	119947568	SO:0001583	missense	6344				CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407	ENST00000019103.5:c.336G>T	2.37:g.120231098C>A	ENSP00000019103:p.Trp112Cys		119947568	Q12961|Q13213|Q53T00	Missense_Mutation	SNP	ENST00000019103.5	37	CCDS2127.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	19.76	3.886692	0.72410	.	.	ENSG00000080293	ENST00000019103	D	0.84516	-1.86	4.9	4.9	0.64082	GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.53938	D	0.000057	D	0.94706	0.8292	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96114	0.9079	10	0.87932	D	0	.	16.8007	0.85613	0.0:1.0:0.0:0.0	.	112	P47872	SCTR_HUMAN	C	112	ENSP00000019103:W112C	ENSP00000019103:W112C	W	-	3	0	SCTR	119947568	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.046000	0.64226	2.539000	0.85634	0.561000	0.74099	TGG		0.547	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254198.2			Missense_Mutation
IFIH1	64135	broad.mit.edu	37	2	163144689	163144689	+	Missense_Mutation	SNP	T	T	C	rs35207787		TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:163144689T>C	ENST00000263642.2	-	5	1446	c.1051A>G	c.(1051-1053)Aaa>Gaa	p.K351E		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	351	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.K351E(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						GATGCTTTTTTCTTCTTGTCT	0.388																																																1	Substitution - Missense(1)	ovary(1)	2											108.0	107.0	107.0					2																	163144689		2203	4300	6503	162852935	SO:0001583	missense	64135			AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.1051A>G	2.37:g.163144689T>C	ENSP00000263642:p.Lys351Glu		162852935	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	ENST00000263642.2	37	CCDS2217.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	14.23	2.473416	0.43942	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.05513	3.43	5.84	2.22	0.28083	DEAD-like helicase (2);Helicase/UvrB domain (1);	0.286088	0.42964	D	0.000622	T	0.04588	0.0125	L	0.38531	1.155	0.37041	D	0.897144	B	0.23891	0.093	B	0.23574	0.047	T	0.38845	-0.9642	10	0.11794	T	0.64	-9.9286	6.6718	0.23072	0.0:0.1346:0.1303:0.7351	rs35207787	351	Q9BYX4	IFIH1_HUMAN	E	351	ENSP00000263642:K351E	ENSP00000263642:K351E	K	-	1	0	IFIH1	162852935	0.991000	0.36638	0.985000	0.45067	0.985000	0.73830	3.062000	0.49971	0.473000	0.27368	0.528000	0.53228	AAA		0.388	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168		Missense_Mutation
COBLL1	22837	broad.mit.edu	37	2	165550786	165550786	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:165550786G>C	ENST00000392717.2	-	13	3348	c.3344C>G	c.(3343-3345)tCt>tGt	p.S1115C	COBLL1_ENST00000342193.4_Missense_Mutation_p.S1077C|COBLL1_ENST00000194871.6_Missense_Mutation_p.S1144C|COBLL1_ENST00000375458.2_Missense_Mutation_p.S1039C|COBLL1_ENST00000409184.3_Missense_Mutation_p.S1077C			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	1115						extracellular vesicular exosome (GO:0070062)		p.S1077C(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TACCTTATCAGACACACCAAG	0.398																																																1	Substitution - Missense(1)	ovary(1)	2											104.0	100.0	101.0					2																	165550786		2203	4300	6503	165259032	SO:0001583	missense	22837			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.3344C>G	2.37:g.165550786G>C	ENSP00000376478:p.Ser1115Cys		165259032	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	37		SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699589	0.48307	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.63	-11.3	0.00108	.	1.422500	0.04145	N	0.320247	T	0.29556	0.0737	L	0.36672	1.1	0.09310	N	1	P;P;P	0.45348	0.731;0.856;0.824	B;P;P	0.49597	0.412;0.497;0.616	T	0.53143	-0.8480	9	0.56958	D	0.05	4.7065	4.9547	0.14033	0.1818:0.2462:0.4315:0.1404	.	1115;1144;1077	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	C	1039;1077;1077;1115;1144	.	ENSP00000194871:S1144C	S	-	2	0	COBLL1	165259032	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.603000	0.05674	-2.041000	0.00915	-1.105000	0.02106	TCT		0.398	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014900		Missense_Mutation
HNRNPA3	220988	broad.mit.edu	37	2	178082475	178082475	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:178082475G>T	ENST00000392524.2	+	8	1100	c.863G>T	c.(862-864)gGc>gTc	p.G288V	HNRNPA3_ENST00000435711.1_Missense_Mutation_p.G288V|HNRNPA3_ENST00000411529.2_Missense_Mutation_p.G266V			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	288	Gly-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G288V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						AGTAGAGGGGGCTATGGTGGT	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											183.0	177.0	179.0					2																	178082475		2203	4299	6502	177790721	SO:0001583	missense	220988			AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.863G>T	2.37:g.178082475G>T	ENSP00000376309:p.Gly288Val		177790721	D3DPF4|Q53RW7|Q6URK5	Missense_Mutation	SNP	ENST00000392524.2	37	CCDS2273.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	g	18.47	3.629936	0.67015	.	.	ENSG00000170144	ENST00000392524;ENST00000411529;ENST00000416446;ENST00000420139;ENST00000435711	D;D;D	0.89415	-2.51;-2.51;-2.51	4.42	4.42	0.53409	.	0.156037	0.29348	U	0.012407	D	0.95194	0.8442	M	0.89785	3.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.94668	0.7854	10	0.31617	T	0.26	.	17.4329	0.87544	0.0:0.0:1.0:0.0	.	266;288	B4DDB6;P51991	.;ROA3_HUMAN	V	288;266;232;233;288	ENSP00000376309:G288V;ENSP00000408487:G266V;ENSP00000416340:G288V	ENSP00000376309:G288V	G	+	2	0	HNRNPA3	177790721	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	8.497000	0.90488	2.215000	0.71742	0.472000	0.43445	GGC		0.443	HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255729.3	NM_194247		Missense_Mutation
ZNF142	7701	broad.mit.edu	37	2	219509559	219509559	+	Silent	SNP	C	C	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:219509559C>G	ENST00000449707.1	-	8	2101	c.1680G>C	c.(1678-1680)ctG>ctC	p.L560L	ZNF142_ENST00000411696.2_Silent_p.L560L	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	560					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L397L(1)		breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		TCTCATGGCTCAGCACAGCCT	0.582																																					Colon(170;867 1942 8995 15834 18053)											1	Substitution - coding silent(1)	ovary(1)	2											91.0	104.0	99.0					2																	219509559		2200	4299	6499	219217803	SO:0001819	synonymous_variant	7701			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.1680G>C	2.37:g.219509559C>G			219217803	Q92510	Silent	SNP	ENST00000449707.1	37	CCDS42817.1	SNP	29	Broad																																																																																				0.582	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081		Silent
UGT1A3	54659	broad.mit.edu	37	2	234638614	234638614	+	Missense_Mutation	SNP	G	G	C	rs201755757		TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr2:234638614G>C	ENST00000482026.1	+	1	861	c.842G>C	c.(841-843)tGt>tCt	p.C281S	UGT1A1_ENST00000609767.1_Missense_Mutation_p.C281S|UGT1A5_ENST00000373414.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000480628.1_Intron			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	281					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)	p.C281S(1)		breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	GGCATCAACTGTGCCAACAGG	0.438																																																1	Substitution - Missense(1)	ovary(1)	2											88.0	94.0	92.0					2																	234638614		2203	4300	6503	234303353	SO:0001583	missense	54659			M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.842G>C	2.37:g.234638614G>C	ENSP00000418532:p.Cys281Ser		234303353	B8K287	Missense_Mutation	SNP	ENST00000482026.1	37	CCDS2509.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	g	16.84	3.232730	0.58777	.	.	ENSG00000243135	ENST00000482026	T	0.62498	0.02	4.0	3.11	0.35812	.	.	.	.	.	T	0.81375	0.4809	M	0.91920	3.255	0.43271	D	0.995227	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.83602	0.0129	9	0.87932	D	0	.	11.3574	0.49623	0.0912:0.0:0.9088:0.0	.	281;281	Q5DT01;P35503	.;UD13_HUMAN	S	281	ENSP00000418532:C281S	ENSP00000418532:C281S	C	+	2	0	UGT1A3	234303353	1.000000	0.71417	0.994000	0.49952	0.894000	0.52154	5.583000	0.67484	0.666000	0.31087	0.454000	0.30748	TGT		0.438	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130983.1	NM_019093		Missense_Mutation
ACSS1	84532	broad.mit.edu	37	20	25011592	25011592	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr20:25011592T>A	ENST00000323482.4	-	3	513	c.434A>T	c.(433-435)gAa>gTa	p.E145V	ACSS1_ENST00000432802.2_Missense_Mutation_p.E145V|ACSS1_ENST00000537502.1_Missense_Mutation_p.E62V|ACSS1_ENST00000542618.1_Missense_Mutation_p.E24V	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	145					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)	p.E145V(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CTCCAGTAGTTCCCTGCAGCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	20											52.0	44.0	47.0					20																	25011592		2203	4300	6503	24959592	SO:0001583	missense	84532				CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.434A>T	20.37:g.25011592T>A	ENSP00000316924:p.Glu145Val		24959592	B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	Missense_Mutation	SNP	ENST00000323482.4	37	CCDS13167.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	26.4	4.735381	0.89482	.	.	ENSG00000154930	ENST00000323482;ENST00000376727;ENST00000537502;ENST00000432802;ENST00000542618	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	5.95	5.95	0.96441	AMP-dependent synthetase/ligase (1);	0.048864	0.85682	D	0.000000	D	0.82393	0.5027	H	0.97465	4.01	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.995	D;D;D;D	0.85130	0.997;0.993;0.996;0.966	D	0.88560	0.3122	10	0.87932	D	0	-29.6522	15.2509	0.73545	0.0:0.0:0.0:1.0	.	145;145;145;62	E9PC79;Q9NUB1-2;Q9NUB1;Q6ZV30	.;.;ACS2L_HUMAN;.	V	145;145;62;145;24	ENSP00000316924:E145V;ENSP00000439304:E62V;ENSP00000388793:E145V;ENSP00000437657:E24V	ENSP00000316924:E145V	E	-	2	0	ACSS1	24959592	1.000000	0.71417	0.981000	0.43875	0.882000	0.50991	7.606000	0.82863	2.279000	0.76181	0.533000	0.62120	GAA		0.552	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078386.2	NM_032501		Missense_Mutation
ASPHD2	57168	broad.mit.edu	37	22	26829725	26829725	+	Silent	SNP	C	C	T	rs150944010		TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr22:26829725C>T	ENST00000215906.5	+	2	582	c.144C>T	c.(142-144)acC>acT	p.T48T		NM_020437.4	NP_065170.2	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	48					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.T22T(1)		endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	16						GCATCGCCACCGGCATCCAGT	0.637																																																1	Substitution - coding silent(1)	ovary(1)	22						C		1,4405	2.1+/-5.4	0,1,2202	84.0	73.0	77.0		144	-7.2	0.9	22	dbSNP_134	77	0,8600		0,0,4300	no	coding-synonymous	ASPHD2	NM_020437.4		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		48/370	26829725	1,13005	2203	4300	6503	25159725	SO:0001819	synonymous_variant	57168			AK097157	CCDS13834.2	22q12.1	2006-02-02			ENSG00000128203	ENSG00000128203			30437	protein-coding gene	gene with protein product							Standard	NM_020437		Approved	FLJ39838	uc003acg.2	Q6ICH7	OTTHUMG00000150884	ENST00000215906.5:c.144C>T	22.37:g.26829725C>T			25159725	B2RCH3|Q7L0W3|Q9NSN3	Silent	SNP	ENST00000215906.5	37	CCDS13834.2	SNP	23	Broad																																																																																				0.637	ASPHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320422.1	NM_020437		Silent
TBC1D10A	83874	broad.mit.edu	37	22	30700527	30700527	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr22:30700527T>C	ENST00000215790.7	-	2	466	c.302A>G	c.(301-303)cAc>cGc	p.H101R	TBC1D10A_ENST00000403362.1_Missense_Mutation_p.H13R|TBC1D10A_ENST00000490449.1_5'UTR|TBC1D10A_ENST00000403477.3_Missense_Mutation_p.H108R	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	101					activation of cysteine-type endopeptidase activity (GO:0097202)|positive regulation of proteolysis (GO:0045862)|retrograde transport, endosome to Golgi (GO:0042147)	extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rab GTPase activator activity (GO:0005097)	p.H101R(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23						CACCTTTTTGTGCTTCTTGGC	0.572																																																1	Substitution - Missense(1)	ovary(1)	22											149.0	107.0	121.0					22																	30700527		2203	4300	6503	29030527	SO:0001583	missense	83874			AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992			23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10		11285285, 20404108	Standard	NM_001204240		Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000215790.7:c.302A>G	22.37:g.30700527T>C	ENSP00000215790:p.His101Arg		29030527	B3KXT8|O76053|Q20WK7|Q543A2	Missense_Mutation	SNP	ENST00000215790.7	37	CCDS13874.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	23.6	4.431078	0.83776	.	.	ENSG00000099992	ENST00000215790;ENST00000403477;ENST00000403362;ENST00000393906	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	5.92	5.92	0.95590	Rab-GAP/TBC domain (1);	0.214341	0.47093	D	0.000257	T	0.26484	0.0647	L	0.31752	0.955	0.54753	D	0.999989	D;B;D	0.64830	0.994;0.162;0.994	P;B;P	0.58331	0.837;0.122;0.837	T	0.00958	-1.1500	10	0.44086	T	0.13	.	15.5405	0.76039	0.0:0.0:0.0:1.0	.	101;108;101	Q20WK7;B3KXT8;Q9BXI6	.;.;TB10A_HUMAN	R	101;108;13;13	ENSP00000215790:H101R;ENSP00000384996:H108R;ENSP00000385050:H13R;ENSP00000377484:H13R	ENSP00000215790:H101R	H	-	2	0	TBC1D10A	29030527	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.247000	0.72411	2.267000	0.75376	0.383000	0.25322	CAC		0.572	TBC1D10A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320550.1	NM_031937		Missense_Mutation
PISD	23761	broad.mit.edu	37	22	32015655	32015655	+	Silent	SNP	A	A	G	rs375120020		TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr22:32015655A>G	ENST00000439502.2	-	8	1396	c.1173T>C	c.(1171-1173)aaT>aaC	p.N391N	PISD_ENST00000382151.2_Silent_p.N357N|PISD_ENST00000478893.1_5'Flank|PISD_ENST00000336566.4_Silent_p.N390N|PISD_ENST00000266095.5_Silent_p.N357N|PISD_ENST00000397500.1_3'UTR			Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase	391					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatidylserine decarboxylase activity (GO:0004609)	p.N357N(1)		central_nervous_system(3)|endometrium(2)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12					Phosphatidylserine(DB00144)	TCAGCTGGAAATTGAAGTCCT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	22						A		0,4406		0,0,2203	82.0	79.0	80.0		1071	-0.6	0.8	22		80	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PISD	NM_014338.3		0,1,6502	GG,GA,AA		0.0116,0.0,0.0077		357/376	32015655	1,13005	2203	4300	6503	30345655	SO:0001819	synonymous_variant	23761				CCDS13899.1	22q12.2	2011-01-25			ENSG00000241878	ENSG00000241878	4.1.1.65		8999	protein-coding gene	gene with protein product		612770				10591208	Standard	NM_014338		Approved	dJ858B16.2, PSDC	uc003alk.2	Q9UG56	OTTHUMG00000030252	ENST00000439502.2:c.1173T>C	22.37:g.32015655A>G			30345655	B1AKM7|O43207|O95535|Q6IC28|Q96GQ2|Q9UGA9	Silent	SNP	ENST00000439502.2	37		SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	8.329	0.825993	0.16749	0.0	1.16E-4	ENSG00000241878	ENST00000435900	.	.	.	5.29	-0.557	0.11800	.	.	.	.	.	T	0.50667	0.1629	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38802	-0.9644	4	.	.	.	-14.4424	5.702	0.17887	0.3774:0.0:0.4965:0.1261	.	.	.	.	T	344	.	.	I	-	2	0	PISD	30345655	1.000000	0.71417	0.762000	0.31397	0.847000	0.48162	1.177000	0.31969	-0.013000	0.14199	-0.462000	0.05337	ATT		0.547	PISD-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000075106.4			Silent
TCF20	6942	broad.mit.edu	37	22	42609746	42609746	+	Silent	SNP	G	G	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr22:42609746G>C	ENST00000359486.3	-	1	1702	c.1566C>G	c.(1564-1566)ggC>ggG	p.G522G	TCF20_ENST00000335626.4_Silent_p.G522G	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	522					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.G522G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						TGCTGGAGCAGCCTCCATCTA	0.527																																																1	Substitution - coding silent(1)	ovary(1)	22											152.0	160.0	157.0					22																	42609746		2203	4300	6503	40939690	SO:0001819	synonymous_variant	6942			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.1566C>G	22.37:g.42609746G>C			40939690	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Silent	SNP	ENST00000359486.3	37	CCDS14033.1	SNP	34	Broad																																																																																				0.527	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492		Silent
SBF1	6305	broad.mit.edu	37	22	50902822	50902822	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr22:50902822C>G	ENST00000390679.3	-	15	1869	c.1685G>C	c.(1684-1686)cGg>cCg	p.R562P	SBF1_ENST00000348911.6_Missense_Mutation_p.R563P|SBF1_ENST00000380817.3_Missense_Mutation_p.R562P			O95248	MTMR5_HUMAN	SET binding factor 1	562					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R562P(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		AACCTCCAGCCGCCGGGCGCT	0.637																																																1	Substitution - Missense(1)	ovary(1)	22											60.0	68.0	66.0					22																	50902822		2112	4211	6323	49249688	SO:0001583	missense	6305			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.1685G>C	22.37:g.50902822C>G	ENSP00000375097:p.Arg562Pro		49249688	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	37		SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	19.59	3.855901	0.71834	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	T;T;T	0.57436	0.4;0.4;0.4	4.33	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.73164	0.3552	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.998	T	0.78357	-0.2235	10	0.87932	D	0	.	16.6034	0.84822	0.0:1.0:0.0:0.0	.	562;563;562	O95248;G5E933;O95248-4	MTMR5_HUMAN;.;.	P	562;563;573;572;562	ENSP00000370196:R562P;ENSP00000252027:R563P;ENSP00000375097:R562P	ENSP00000336522:R572P	R	-	2	0	SBF1	49249688	0.959000	0.32827	0.852000	0.33557	0.395000	0.30598	7.342000	0.79310	2.227000	0.72691	0.462000	0.41574	CGG		0.637	SBF1-201	KNOWN	basic	protein_coding	protein_coding				Missense_Mutation
MITF	4286	broad.mit.edu	37	3	70014107	70014107	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr3:70014107A>C	ENST00000448226.2	+	10	1416	c.1289A>C	c.(1288-1290)aAc>aCc	p.N430T	MITF_ENST00000394355.2_Missense_Mutation_p.N399T|MITF_ENST00000352241.4_Missense_Mutation_p.N424T|MITF_ENST00000328528.6_Missense_Mutation_p.N423T|MITF_ENST00000314557.6_Missense_Mutation_p.N317T|MITF_ENST00000472437.1_Missense_Mutation_p.N372T|MITF_ENST00000531774.1_Missense_Mutation_p.N261T|MITF_ENST00000314589.5_Missense_Mutation_p.N408T|MITF_ENST00000394351.3_Missense_Mutation_p.N323T			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	430	DNA binding regulation.				bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)	p.N323T(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		GTTCTTGAGAACTGCAGCCAA	0.502			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														Melanoma(29;269 969 31479 41502 42961)		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	1	Substitution - Missense(1)	ovary(1)	3											156.0	131.0	140.0					3																	70014107		2203	4300	6503	70096797	SO:0001583	missense	4286				CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.1289A>C	3.37:g.70014107A>C	ENSP00000391803:p.Asn430Thr		70096797	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Missense_Mutation	SNP	ENST00000448226.2	37		SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	16.49	3.137860	0.56936	.	.	ENSG00000187098	ENST00000352241;ENST00000448226;ENST00000472437;ENST00000328528;ENST00000314589;ENST00000394355;ENST00000314557;ENST00000394351;ENST00000531774	T;T;T;T;T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02	6.17	6.17	0.99709	.	0.079220	0.85682	D	0.000000	T	0.54870	0.1885	L	0.50333	1.59	0.45464	D	0.998436	B;B;B;B;B;B;B	0.21688	0.027;0.022;0.022;0.059;0.059;0.014;0.022	B;B;B;B;B;B;B	0.22386	0.038;0.022;0.022;0.039;0.039;0.039;0.022	T	0.50874	-0.8776	9	.	.	.	.	11.0511	0.47889	0.9315:0.0:0.0685:0.0	.	372;323;317;399;408;423;424	E9PFN0;O75030-9;O75030-10;O75030-4;O75030-8;O75030-6;O75030-2	.;.;.;.;.;.;.	T	424;430;372;423;408;399;317;323;261	ENSP00000295600:N424T;ENSP00000391803:N430T;ENSP00000418845:N372T;ENSP00000327867:N423T;ENSP00000324443:N408T;ENSP00000377884:N399T;ENSP00000324246:N317T;ENSP00000377880:N323T;ENSP00000435909:N261T	.	N	+	2	0	MITF	70096797	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.452000	0.66638	2.371000	0.80710	0.533000	0.62120	AAC		0.502	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159		Missense_Mutation
HMCES	56941	broad.mit.edu	37	3	129023640	129023640	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr3:129023640C>G	ENST00000383463.4	+	7	1126	c.1037C>G	c.(1036-1038)cCt>cGt	p.P346R	HMCES_ENST00000502878.2_Missense_Mutation_p.P346R|HMCES_ENST00000417226.2_Missense_Mutation_p.P304R|HMCES_ENST00000389735.3_Missense_Mutation_p.P346R	NM_020187.2	NP_064572.2	Q96FZ2	HMCES_HUMAN	5-hydroxymethylcytosine (hmC) binding, ES cell-specific	346							DNA binding (GO:0003677)|peptidase activity (GO:0008233)	p.P346R(1)									GAGGAGGAACCTGTGGCCAAG	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											57.0	50.0	52.0					3																	129023640		2203	4300	6503	130506330	SO:0001583	missense	56941			AF201934	CCDS33852.1	3q21.3	2013-08-30	2013-08-30	2013-08-30	ENSG00000183624	ENSG00000183624			24446	protein-coding gene	gene with protein product	"""SOS response associated peptidase domain containing 1"""		"""chromosome 3 open reading frame 37"""	C3orf37		23434322, 23945014	Standard	XM_005247636		Approved	DC12, SRAPD1	uc003elt.3	Q96FZ2	OTTHUMG00000159452	ENST00000383463.4:c.1037C>G	3.37:g.129023640C>G	ENSP00000372955:p.Pro346Arg		130506330	A6NJR9|Q96G34|Q9NRP3	Missense_Mutation	SNP	ENST00000383463.4	37	CCDS33852.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	17.84	3.486765	0.63962	.	.	ENSG00000183624	ENST00000383463;ENST00000417226;ENST00000502878;ENST00000389735	.	.	.	4.44	4.44	0.53790	.	0.871673	0.09801	N	0.754101	T	0.65585	0.2705	M	0.67953	2.075	0.28996	N	0.887776	D;D	0.76494	0.999;0.999	D;D	0.65233	0.933;0.933	T	0.57225	-0.7848	8	.	.	.	-4.4418	12.9413	0.58345	0.0:1.0:0.0:0.0	.	304;346	E7EMP6;Q96FZ2	.;CC037_HUMAN	R	346;304;346;346	.	.	P	+	2	0	C3orf37	130506330	0.972000	0.33761	0.696000	0.30242	0.948000	0.59901	3.984000	0.56923	2.187000	0.69744	0.591000	0.81541	CCT		0.537	HMCES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355470.2	NM_020187		Missense_Mutation
CHST2	9435	broad.mit.edu	37	3	142840830	142840830	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr3:142840830C>T	ENST00000309575.3	+	2	2556	c.1172C>T	c.(1171-1173)gCt>gTt	p.A391V		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	391					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.A391V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						GACTACCACGCTCTGGGCGCT	0.667																																																1	Substitution - Missense(1)	ovary(1)	3											45.0	53.0	50.0					3																	142840830		2203	4300	6503	144323520	SO:0001583	missense	9435			BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.1172C>T	3.37:g.142840830C>T	ENSP00000307911:p.Ala391Val		144323520	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	37	CCDS3129.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	18.86	3.714343	0.68730	.	.	ENSG00000175040	ENST00000309575	D	0.82433	-1.61	4.47	4.47	0.54385	Sulfotransferase domain (1);	0.236707	0.35320	N	0.003291	T	0.80171	0.4574	N	0.08118	0	0.58432	D	0.999997	D	0.61697	0.99	P	0.60949	0.881	T	0.81180	-0.1050	10	0.30854	T	0.27	-1.1166	17.3237	0.87242	0.0:1.0:0.0:0.0	.	391	Q9Y4C5	CHST2_HUMAN	V	391	ENSP00000307911:A391V	ENSP00000307911:A391V	A	+	2	0	CHST2	144323520	1.000000	0.71417	0.612000	0.29024	0.844000	0.47949	5.916000	0.69981	2.322000	0.78497	0.407000	0.27541	GCT		0.667	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267		Missense_Mutation
VPS8	23355	broad.mit.edu	37	3	184585842	184585842	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr3:184585842A>G	ENST00000437079.3	+	18	1672	c.1501A>G	c.(1501-1503)Aga>Gga	p.R501G	VPS8_ENST00000436792.2_Missense_Mutation_p.R499G|VPS8_ENST00000287546.4_Missense_Mutation_p.R501G|VPS8_ENST00000446204.2_Missense_Mutation_p.R499G	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	501							zinc ion binding (GO:0008270)	p.R501G(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			GAGGAGCTGGAGAGAGGTGAG	0.368																																																1	Substitution - Missense(1)	ovary(1)	3											189.0	186.0	187.0					3																	184585842		1927	4141	6068	186068536	SO:0001583	missense	23355			AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.1501A>G	3.37:g.184585842A>G	ENSP00000397879:p.Arg501Gly		186068536	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	37	CCDS46971.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	a	14.64	2.597037	0.46318	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.07	5.07	0.68467	.	0.098569	0.64402	D	0.000003	T	0.28699	0.0711	L	0.59436	1.845	0.58432	D	0.999996	D;D	0.56035	0.969;0.974	P;P	0.50659	0.554;0.647	T	0.02567	-1.1140	10	0.27082	T	0.32	-17.2356	10.9422	0.47281	0.8433:0.1567:0.0:0.0	.	499;499	Q8N3P4-2;Q8N3P4-3	.;.	G	501;501;499;499	ENSP00000287546:R501G;ENSP00000397879:R501G;ENSP00000404704:R499G;ENSP00000405483:R499G	ENSP00000287546:R501G	R	+	1	2	VPS8	186068536	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.460000	0.53028	1.910000	0.55303	0.456000	0.33151	AGA		0.368	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303		Missense_Mutation
TEC	7006	broad.mit.edu	37	4	48140734	48140734	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr4:48140734G>A	ENST00000381501.3	-	17	1917	c.1760C>T	c.(1759-1761)cCg>cTg	p.P587L	TEC_ENST00000511471.2_5'Flank	NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	587	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						CGCCAACTTCGGCTGGTAGAG	0.438																																																0			4											112.0	111.0	112.0					4																	48140734		2203	4300	6503	47835491	SO:0001583	missense	7006			D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.1760C>T	4.37:g.48140734G>A	ENSP00000370912:p.Pro587Leu		47835491	B7ZKZ6|Q3MIS5	Missense_Mutation	SNP	ENST00000381501.3	37	CCDS3481.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	22.6	4.311603	0.81358	.	.	ENSG00000135605	ENST00000381501	D	0.86366	-2.11	5.43	4.59	0.56863	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.129405	0.51477	N	0.000093	D	0.93887	0.8044	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94782	0.7954	10	0.87932	D	0	.	14.2323	0.65901	0.0718:0.0:0.9282:0.0	.	587	P42680	TEC_HUMAN	L	587	ENSP00000370912:P587L	ENSP00000370912:P587L	P	-	2	0	TEC	47835491	1.000000	0.71417	0.660000	0.29694	0.669000	0.39330	9.793000	0.99091	1.432000	0.47375	0.561000	0.74099	CCG		0.438	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250492.3			Missense_Mutation
KIT	3815	broad.mit.edu	37	4	55604673	55604673	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr4:55604673G>A	ENST00000288135.5	+	21	2978	c.2881G>A	c.(2881-2883)Ggc>Agc	p.G961S		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	961					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G961S(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAATTCTGTCGGCAGCACCGC	0.527		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	1	Substitution - Missense(1)	ovary(1)	4											127.0	123.0	124.0					4																	55604673		2203	4300	6503	55299430	SO:0001583	missense	3815	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2881G>A	4.37:g.55604673G>A	ENSP00000288135:p.Gly961Ser		55299430	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	19.48	3.834834	0.71373	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	T;T	0.76578	-1.03;-1.03	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000009	D	0.87237	0.6127	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.944;1.0	D	0.85232	0.1033	10	0.34782	T	0.22	.	17.6745	0.88226	0.0:0.0:1.0:0.0	.	957;961	P10721-2;P10721	.;KIT_HUMAN	S	961;957	ENSP00000288135:G961S;ENSP00000390987:G957S	ENSP00000288135:G961S	G	+	1	0	KIT	55299430	1.000000	0.71417	0.964000	0.40570	0.261000	0.26267	5.963000	0.70372	2.706000	0.92434	0.561000	0.74099	GGC		0.527	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1			Missense_Mutation
GK2	2712	broad.mit.edu	37	4	80328507	80328507	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr4:80328507C>A	ENST00000358842.3	-	1	865	c.848G>T	c.(847-849)tGc>tTc	p.C283F		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)	p.C283F(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						CAGTAAGAAGCAACCTGTTCC	0.453																																																1	Substitution - Missense(1)	ovary(1)	4											128.0	109.0	116.0					4																	80328507		2203	4300	6503	80547531	SO:0001583	missense	2712			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.848G>T	4.37:g.80328507C>A	ENSP00000351706:p.Cys283Phe		80547531	Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	CCDS3585.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	11.98	1.799511	0.31869	.	.	ENSG00000196475	ENST00000358842	D	0.86164	-2.08	3.92	3.92	0.45320	Carbohydrate kinase, FGGY, C-terminal (1);	0.099735	0.64402	D	0.000001	D	0.95332	0.8485	H	0.98089	4.145	0.58432	D	0.999994	D	0.55605	0.972	D	0.67900	0.954	D	0.95883	0.8900	10	0.87932	D	0	-18.2298	11.7305	0.51735	0.0:1.0:0.0:0.0	.	283	Q14410	GLPK2_HUMAN	F	283	ENSP00000351706:C283F	ENSP00000351706:C283F	C	-	2	0	GK2	80547531	0.993000	0.37304	0.991000	0.47740	0.466000	0.32739	3.387000	0.52501	2.496000	0.84212	0.585000	0.79938	TGC		0.453	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214		Missense_Mutation
TNFAIP8	25816	broad.mit.edu	37	5	118728778	118728778	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr5:118728778A>C	ENST00000503646.1	+	3	987	c.299A>C	c.(298-300)gAg>gCg	p.E100A	TNFAIP8_ENST00000513374.1_Missense_Mutation_p.E112A|TNFAIP8_ENST00000274456.6_Missense_Mutation_p.E90A|TNFAIP8_ENST00000504771.2_Missense_Mutation_p.E100A|TNFAIP8_ENST00000415806.2_3'UTR|TNFAIP8_ENST00000504642.1_Missense_Mutation_p.E102A			O95379	TFIP8_HUMAN	tumor necrosis factor, alpha-induced protein 8	100					defense response to Gram-positive bacterium (GO:0050830)|interleukin-1 beta production (GO:0032611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)	p.E100A(1)		ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)		GCATTGATGGAGAAATTTAAG	0.398																																																1	Substitution - Missense(1)	ovary(1)	5											78.0	77.0	77.0					5																	118728778		1902	4139	6041	118756677	SO:0001583	missense	25816			AF070671	CCDS47257.1, CCDS47258.1, CCDS68933.1	5q23.1	2008-02-05			ENSG00000145779	ENSG00000145779			17260	protein-coding gene	gene with protein product		612111				10233894, 10644768	Standard	NM_001286813		Approved	GG2-1, MDC-3.13, SCC-S2	uc003ksi.3	O95379	OTTHUMG00000162949	ENST00000503646.1:c.299A>C	5.37:g.118728778A>C	ENSP00000421848:p.Glu100Ala		118756677	B3KMH1|B3KMI2|B7Z713|Q9P1Q1|Q9UER5|Q9UP47	Missense_Mutation	SNP	ENST00000503646.1	37	CCDS47258.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	24.8	4.576087	0.86645	.	.	ENSG00000145779	ENST00000274456;ENST00000388882;ENST00000513374;ENST00000504771;ENST00000503646;ENST00000504642	T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000001	T	0.49098	0.1537	L	0.49126	1.545	0.80722	D	1	P;P;P	0.50528	0.858;0.936;0.932	P;P;P	0.56434	0.528;0.798;0.655	T	0.36792	-0.9733	10	0.36615	T	0.2	-20.8707	15.8076	0.78527	1.0:0.0:0.0:0.0	.	112;100;90	B7Z713;O95379;O95379-3	.;TFIP8_HUMAN;.	A	90;68;112;100;100;102	ENSP00000274456:E90A;ENSP00000429432:E68A;ENSP00000427424:E112A;ENSP00000422245:E100A;ENSP00000421848:E100A;ENSP00000427160:E102A	ENSP00000274456:E90A	E	+	2	0	TNFAIP8	118756677	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.219000	0.72066	0.533000	0.62120	GAG		0.398	TNFAIP8-002	PUTATIVE	alternative_5_UTR|basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000371134.2	NM_014350		Missense_Mutation
TEX43	389320	broad.mit.edu	37	5	125971835	125971835	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr5:125971835C>G	ENST00000357147.3	+	3	320	c.307C>G	c.(307-309)Cca>Gca	p.P103A		NM_207408.1	NP_997291.1	Q6ZNM6	TEX43_HUMAN		103								p.P103A(1)		large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	7						CCAAAAAGGCCCACCAGAAAT	0.453																																																1	Substitution - Missense(1)	ovary(1)	5											119.0	123.0	121.0					5																	125971835		2203	4300	6503	125999734	SO:0001583	missense	389320																														ENST00000357147.3:c.307C>G	5.37:g.125971835C>G	ENSP00000349669:p.Pro103Ala		125999734		Missense_Mutation	SNP	ENST00000357147.3	37	CCDS4139.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	0.425	-0.906092	0.02453	.	.	ENSG00000196900	ENST00000357147	.	.	.	4.29	3.42	0.39159	.	0.529477	0.17531	N	0.170887	T	0.23014	0.0556	N	0.24115	0.695	0.09310	N	1	B	0.32101	0.356	B	0.33454	0.164	T	0.12243	-1.0555	9	0.37606	T	0.19	-1.8201	7.3777	0.26837	0.0:0.7353:0.1703:0.0945	.	103	Q6ZNM6	CE048_HUMAN	A	103	.	ENSP00000349669:P103A	P	+	1	0	C5orf48	125999734	0.000000	0.05858	0.200000	0.23457	0.015000	0.08874	0.669000	0.25142	1.142000	0.42291	0.462000	0.41574	CCA		0.453	C5orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250923.1			Missense_Mutation
PCDHB2	56133	broad.mit.edu	37	5	140476407	140476407	+	Missense_Mutation	SNP	C	C	T	rs201070541		TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr5:140476407C>T	ENST00000194155.4	+	1	2181	c.2033C>T	c.(2032-2034)gCg>gTg	p.A678V		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	678					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A678E(1)|p.A678V(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCCCGGAGGCGGCACCGGCC	0.682																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	5											64.0	66.0	66.0					5																	140476407		2182	4247	6429	140456591	SO:0001583	missense	56133			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2033C>T	5.37:g.140476407C>T	ENSP00000194155:p.Ala678Val		140456591	Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	CCDS4244.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	5.135	0.210478	0.09757	.	.	ENSG00000112852	ENST00000194155	T	0.50277	0.75	3.99	-1.85	0.07784	.	.	.	.	.	T	0.24851	0.0603	L	0.37897	1.145	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31308	-0.9948	9	0.02654	T	1	.	1.5061	0.02486	0.1377:0.3305:0.1357:0.3961	.	678	Q9Y5E7	PCDB2_HUMAN	V	678	ENSP00000194155:A678V	ENSP00000194155:A678V	A	+	2	0	PCDHB2	140456591	0.000000	0.05858	0.007000	0.13788	0.495000	0.33615	-1.445000	0.02401	-0.399000	0.07668	0.456000	0.33151	GCG		0.682	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		Missense_Mutation
PCDHB7	56129	broad.mit.edu	37	5	140553318	140553318	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr5:140553318T>C	ENST00000231137.3	+	1	1076	c.902T>C	c.(901-903)cTt>cCt	p.L301P		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	301	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L301P(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCTGGCAGTCTTCATCTTAAA	0.413																																																1	Substitution - Missense(1)	ovary(1)	5											81.0	87.0	85.0					5																	140553318		2203	4300	6503	140533502	SO:0001583	missense	56129			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.902T>C	5.37:g.140553318T>C	ENSP00000231137:p.Leu301Pro		140533502	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	CCDS4249.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	10.97	1.502098	0.26949	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.68181	-0.31	4.61	4.61	0.57282	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.81240	0.4781	M	0.80982	2.52	0.31252	N	0.69393	D	0.60160	0.987	D	0.65573	0.936	T	0.83210	-0.0074	9	0.87932	D	0	.	13.9717	0.64245	0.0:0.0:0.0:1.0	.	301	Q9Y5E2	PCDB7_HUMAN	P	301;84	ENSP00000231137:L301P	ENSP00000231137:L301P	L	+	2	0	PCDHB7	140533502	0.970000	0.33590	0.004000	0.12327	0.001000	0.01503	7.657000	0.83745	1.823000	0.53134	0.533000	0.62120	CTT		0.413	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		Missense_Mutation
ZNF318	24149	broad.mit.edu	37	6	43306905	43306905	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr6:43306905C>T	ENST00000361428.2	-	10	4908	c.4831G>A	c.(4831-4833)Gac>Aac	p.D1611N	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1611					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.D1611N(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GAAGAGGTGTCTGAACTTTTG	0.493																																																1	Substitution - Missense(1)	ovary(1)	6											123.0	127.0	125.0					6																	43306905		2203	4300	6503	43414883	SO:0001583	missense	24149			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.4831G>A	6.37:g.43306905C>T	ENSP00000354964:p.Asp1611Asn		43414883	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	CCDS4895.2	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	10.58	1.391139	0.25118	.	.	ENSG00000171467	ENST00000361428	T	0.15603	2.41	5.82	2.77	0.32553	.	0.306075	0.30126	N	0.010353	T	0.04907	0.0132	L	0.34521	1.04	0.80722	D	1	B	0.17268	0.021	B	0.14578	0.011	T	0.15578	-1.0432	10	0.72032	D	0.01	-3.348	6.8364	0.23939	0.1379:0.7071:0.0:0.155	.	1611	Q5VUA4	ZN318_HUMAN	N	1611	ENSP00000354964:D1611N	ENSP00000354964:D1611N	D	-	1	0	ZNF318	43414883	0.991000	0.36638	0.832000	0.32986	0.742000	0.42306	0.384000	0.20668	0.258000	0.21686	0.563000	0.77884	GAC		0.493	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345		Missense_Mutation
GSTA2	2939	broad.mit.edu	37	6	52621092	52621092	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr6:52621092T>A	ENST00000493422.1	-	3	258	c.103A>T	c.(103-105)Ata>Tta	p.I35L		NM_000846.4	NP_000837.3	P09210	GSTA2_HUMAN	glutathione S-transferase alpha 2	35	GST N-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)	p.I35L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Chloroquine(DB00608)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Vitamin E(DB00163)	GCAGATTTTATAAATTTCTCT	0.363																																																1	Substitution - Missense(1)	ovary(1)	6											67.0	66.0	66.0					6																	52621092		2201	4299	6500	52729051	SO:0001583	missense	2939			AL109918	CCDS4944.1	6p12.2	2012-06-21	2008-11-26		ENSG00000244067	ENSG00000244067	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4627	protein-coding gene	gene with protein product		138360	"""glutathione S-transferase A2"""	GST2			Standard	NM_000846		Approved		uc003pay.3	P09210	OTTHUMG00000016263	ENST00000493422.1:c.103A>T	6.37:g.52621092T>A	ENSP00000420168:p.Ile35Leu		52729051	Q12759|Q16491|Q9NTY6	Missense_Mutation	SNP	ENST00000493422.1	37	CCDS4944.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	N	0.019	-1.449926	0.01080	.	.	ENSG00000244067	ENST00000493422	T	0.05925	3.37	3.43	-5.68	0.02436	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.650662	0.15581	N	0.254947	T	0.00524	0.0017	N	0.11023	0.085	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.44467	-0.9326	10	0.02654	T	1	.	3.4468	0.07483	0.1222:0.1942:0.4885:0.1951	.	35	P09210	GSTA2_HUMAN	L	35	ENSP00000420168:I35L	ENSP00000420168:I35L	I	-	1	0	GSTA2	52729051	0.000000	0.05858	0.028000	0.17463	0.029000	0.11900	-1.406000	0.02490	-0.462000	0.06984	-1.667000	0.00748	ATA		0.363	GSTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043589.1	NM_000846		Missense_Mutation
GARS	2617	broad.mit.edu	37	7	30655605	30655605	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr7:30655605G>T	ENST00000389266.3	+	9	1366	c.1125G>T	c.(1123-1125)ttG>ttT	p.L375F		NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	375					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.L375F(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	ACCTTTATTTGTATTCAGCAA	0.463																																																1	Substitution - Missense(1)	ovary(1)	7											85.0	87.0	86.0					7																	30655605		1922	4138	6060	30622130	SO:0001583	missense	2617			AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.1125G>T	7.37:g.30655605G>T	ENSP00000373918:p.Leu375Phe		30622130	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	17.26	3.343487	0.61073	.	.	ENSG00000106105	ENST00000389266	D	0.85411	-1.98	5.46	4.58	0.56647	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.83454	0.5258	L	0.39692	1.235	0.80722	D	1	P	0.41643	0.758	P	0.50659	0.647	T	0.81722	-0.0803	10	0.41790	T	0.15	-13.3061	8.028	0.30448	0.0851:0.1602:0.7547:0.0	.	375	P41250	SYG_HUMAN	F	375	ENSP00000373918:L375F	ENSP00000373918:L375F	L	+	3	2	GARS	30622130	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.721000	0.38032	1.449000	0.47699	0.655000	0.94253	TTG		0.463	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047		Missense_Mutation
PPP1R9A	55607	broad.mit.edu	37	7	94827712	94827712	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr7:94827712G>C	ENST00000433881.1	+	6	2338	c.1806G>C	c.(1804-1806)ttG>ttC	p.L602F	PPP1R9A_ENST00000340694.4_Missense_Mutation_p.L602F|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.L602F|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.L602F|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.L602F|AC002429.5_ENST00000417881.2_RNA|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.L602F			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	602	Interacts with TGN38. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)		p.L602F(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TTGCCCAGTTGATAAGCCAGA	0.483										HNSCC(28;0.073)																																						1	Substitution - Missense(1)	ovary(1)	7											115.0	113.0	114.0					7																	94827712		2203	4300	6503	94665648	SO:0001583	missense	55607			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.1806G>C	7.37:g.94827712G>C	ENSP00000398870:p.Leu602Phe		94665648	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	37	CCDS34683.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630909	0.67015	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.24908	1.89;1.87;1.83;1.87;1.87;1.83	5.61	4.71	0.59529	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.50718	0.1632	M	0.68317	2.08	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.999;0.995;0.998	T	0.56384	-0.7988	10	0.87932	D	0	.	16.7706	0.85536	0.0:0.1291:0.8709:0.0	.	602;602;602;602;602	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	F	602	ENSP00000405514:L602F;ENSP00000344524:L602F;ENSP00000411342:L602F;ENSP00000398870:L602F;ENSP00000289495:L602F;ENSP00000402893:L602F	ENSP00000289495:L602F	L	+	3	2	PPP1R9A	94665648	1.000000	0.71417	1.000000	0.80357	0.610000	0.37248	2.717000	0.47227	1.477000	0.48234	0.591000	0.81541	TTG		0.483	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160		Missense_Mutation
ZNF655	79027	broad.mit.edu	37	7	99170957	99170957	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr7:99170957A>G	ENST00000394163.2	+	3	1409	c.1226A>G	c.(1225-1227)gAa>gGa	p.E409G	ZNF655_ENST00000493277.1_Missense_Mutation_p.E444G|ZNF655_ENST00000419215.2_3'UTR|ZNF655_ENST00000424881.1_Missense_Mutation_p.E444G|GS1-259H13.10_ENST00000486324.1_Intron|GS1-259H13.10_ENST00000455905.1_Intron|ZNF655_ENST00000425063.1_3'UTR|ZNF655_ENST00000252713.4_Missense_Mutation_p.E409G	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655	409					negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E409G(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					AAAGCACATGAATGTAATGAA	0.363																																																1	Substitution - Missense(1)	ovary(1)	7											80.0	79.0	80.0					7																	99170957		2203	4300	6503	99008893	SO:0001583	missense	79027			AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.1226A>G	7.37:g.99170957A>G	ENSP00000377718:p.Glu409Gly		99008893	A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	Missense_Mutation	SNP	ENST00000394163.2	37	CCDS5669.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	7.692	0.691340	0.15039	.	.	ENSG00000197343	ENST00000252713;ENST00000493277;ENST00000424881;ENST00000394163	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	4.74	4.74	0.60224	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.176955	0.27469	N	0.019226	T	0.24392	0.0591	L	0.52759	1.655	0.18873	N	0.999981	P;D	0.53312	0.949;0.959	B;P	0.47603	0.415;0.551	T	0.14035	-1.0487	10	0.59425	D	0.04	-8.2794	9.0998	0.36662	0.8152:0.1847:0.0:0.0	.	444;409	Q8N720-3;Q8N720	.;ZN655_HUMAN	G	409;444;444;409	ENSP00000252713:E409G;ENSP00000419135:E444G;ENSP00000393876:E444G;ENSP00000377718:E409G	ENSP00000252713:E409G	E	+	2	0	ZNF655	99008893	0.000000	0.05858	0.952000	0.39060	0.057000	0.15508	0.226000	0.17776	2.065000	0.61736	0.528000	0.53228	GAA		0.363	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000344929.1	NM_138494		Missense_Mutation
RINT1	60561	broad.mit.edu	37	7	105187420	105187420	+	Silent	SNP	T	T	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr7:105187420T>G	ENST00000257700.2	+	5	810	c.579T>G	c.(577-579)tcT>tcG	p.S193S		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	193					G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.S193S(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CTCTAGTGTCTATGGCAGAAC	0.363																																																1	Substitution - coding silent(1)	ovary(1)	7											116.0	99.0	105.0					7																	105187420		2203	4300	6503	104974656	SO:0001819	synonymous_variant	60561			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.579T>G	7.37:g.105187420T>G			104974656	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Silent	SNP	ENST00000257700.2	37	CCDS34726.1	SNP	53	Broad																																																																																				0.363	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930		Silent
NDUFB2	4708	broad.mit.edu	37	7	140404711	140404711	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr7:140404711A>G	ENST00000476279.1	+	3	369	c.295A>G	c.(295-297)Atc>Gtc	p.I99V	NDUFB2_ENST00000460088.1_Missense_Mutation_p.I35V|NDUFB2_ENST00000247866.4_Missense_Mutation_p.I99V|NDUFB2_ENST00000464564.2_3'UTR|NDUFB2_ENST00000471136.1_Missense_Mutation_p.I87V|NDUFB2_ENST00000476470.1_Missense_Mutation_p.I35V|NDUFB2_ENST00000472695.1_Missense_Mutation_p.I35V|NDUFB2_ENST00000461457.1_Intron|NDUFB2_ENST00000482954.1_Missense_Mutation_p.I35V|NDUFB2_ENST00000475276.1_Missense_Mutation_p.I72V|NDUFB2_ENST00000465506.1_Missense_Mutation_p.I99V|NDUFB2_ENST00000204307.5_Missense_Mutation_p.I89V			O95178	NDUB2_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa	99					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.I99V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|stomach(1)	10	Melanoma(164;0.00956)					AGAATTAGGTATCCCTCCTGA	0.393																																																1	Substitution - Missense(1)	ovary(1)	7											120.0	117.0	118.0					7																	140404711		2203	4300	6503	140051180	SO:0001583	missense	4708			AF050639	CCDS5862.1	7q34	2011-07-04	2002-08-29		ENSG00000090266	ENSG00000090266		"""Mitochondrial respiratory chain complex / Complex I"""	7697	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase AGGG subunit"", ""complex I AGGG subunit"""	603838	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 (8kD, AGGG)"""			9763677, 9878551	Standard	NM_004546		Approved	AGGG, CI-AGGG	uc003vwa.3	O95178	OTTHUMG00000157424	ENST00000476279.1:c.295A>G	7.37:g.140404711A>G	ENSP00000419087:p.Ile99Val		140051180	Q6FGI6	Missense_Mutation	SNP	ENST00000476279.1	37	CCDS5862.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	13.98	2.399697	0.42512	.	.	ENSG00000090266	ENST00000482954;ENST00000476279;ENST00000247866;ENST00000465506;ENST00000204307;ENST00000464566;ENST00000460088;ENST00000472695;ENST00000476470;ENST00000471136;ENST00000475276	.	.	.	5.8	4.62	0.57501	.	0.093036	0.64402	N	0.000001	T	0.57858	0.2082	M	0.72118	2.19	0.47123	D	0.999326	B	0.19583	0.037	B	0.19148	0.024	T	0.55515	-0.8129	9	0.45353	T	0.12	-12.2059	7.2721	0.26262	0.7799:0.1448:0.0753:0.0	.	99	O95178	NDUB2_HUMAN	V	35;99;99;99;89;98;35;35;35;87;72	.	ENSP00000204307:I89V	I	+	1	0	NDUFB2	140051180	1.000000	0.71417	0.387000	0.26183	0.950000	0.60333	5.063000	0.64332	0.978000	0.38470	0.533000	0.62120	ATC		0.393	NDUFB2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348784.1	NM_004546		Missense_Mutation
OR2F2	135948	broad.mit.edu	37	7	143632419	143632419	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr7:143632419T>A	ENST00000408955.2	+	1	161	c.94T>A	c.(94-96)Ttg>Atg	p.L32M		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L32M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					TTCCCTGTTCTTGGTCACATA	0.448																																																1	Substitution - Missense(1)	ovary(1)	7											194.0	189.0	191.0					7																	143632419		2203	4300	6503	143263352	SO:0001583	missense	135948				CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.94T>A	7.37:g.143632419T>A	ENSP00000386222:p.Leu32Met		143263352	A4D2G0|Q6IFP8	Missense_Mutation	SNP	ENST00000408955.2	37	CCDS43666.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	14.30	2.495558	0.44352	.	.	ENSG00000221910	ENST00000408955	T	0.01902	4.57	3.26	0.795	0.18643	.	0.617739	0.13493	N	0.383824	T	0.09905	0.0243	M	0.91717	3.235	0.28172	N	0.928523	D	0.59767	0.986	P	0.57204	0.815	T	0.05852	-1.0860	10	0.87932	D	0	-1.3192	5.1199	0.14854	0.0:0.3906:0.0:0.6094	.	32	O95006	OR2F2_HUMAN	M	32	ENSP00000386222:L32M	ENSP00000386222:L32M	L	+	1	2	OR2F2	143263352	0.000000	0.05858	0.808000	0.32385	0.532000	0.34746	0.104000	0.15313	0.409000	0.25649	0.402000	0.26972	TTG		0.448	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1			Missense_Mutation
ZNF425	155054	broad.mit.edu	37	7	148801561	148801561	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr7:148801561T>G	ENST00000378061.2	-	4	1534	c.1402A>C	c.(1402-1404)Aag>Cag	p.K468Q		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	468					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K468Q(1)		breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GGGAAGGGCTTTTGCTCGCTG	0.667																																																1	Substitution - Missense(1)	ovary(1)	7											38.0	38.0	38.0					7																	148801561		2202	4300	6502	148432494	SO:0001583	missense	155054			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.1402A>C	7.37:g.148801561T>G	ENSP00000367300:p.Lys468Gln		148432494	B3KPM1|Q08AG3	Missense_Mutation	SNP	ENST00000378061.2	37	CCDS34773.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	17.01	3.280575	0.59758	.	.	ENSG00000204947	ENST00000378061	T	0.27104	1.69	3.39	0.641	0.17759	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34919	0.0914	M	0.73217	2.22	0.09310	N	1	D	0.59767	0.986	P	0.50590	0.645	T	0.19484	-1.0304	9	0.87932	D	0	.	8.27	0.31838	0.0:0.0:0.3913:0.6087	.	468	Q6IV72	ZN425_HUMAN	Q	468	ENSP00000367300:K468Q	ENSP00000367300:K468Q	K	-	1	0	ZNF425	148432494	0.000000	0.05858	0.004000	0.12327	0.283000	0.27025	0.271000	0.18626	0.024000	0.15214	0.533000	0.62120	AAG		0.667	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352726.1	XM_088140		Missense_Mutation
PAXIP1	22976	broad.mit.edu	37	7	154760786	154760786	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr7:154760786A>C	ENST00000404141.1	-	7	1279	c.1125T>G	c.(1123-1125)aaT>aaG	p.N375K	PAXIP1_ENST00000397192.1_Missense_Mutation_p.N375K|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	375					adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)		p.N341K(1)		NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GCTGGCTGTGATTCACCTGCT	0.443																																																1	Substitution - Missense(1)	ovary(1)	7											54.0	51.0	52.0					7																	154760786		2107	4222	6329	154391719	SO:0001583	missense	22976			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1125T>G	7.37:g.154760786A>C	ENSP00000384048:p.Asn375Lys		154391719	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	ENST00000404141.1	37	CCDS47753.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	16.02	3.003451	0.54254	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	T;T	0.39997	1.05;1.05	5.37	-8.16	0.01061	.	0.609454	0.14708	U	0.303136	T	0.33294	0.0858	L	0.29908	0.895	0.20403	N	0.999902	B;P;P;D	0.56035	0.361;0.763;0.634;0.974	B;B;B;P	0.49752	0.058;0.311;0.167;0.621	T	0.49634	-0.8919	10	0.48119	T	0.1	-9.6031	14.6351	0.68682	0.2431:0.0:0.6543:0.1026	.	328;284;341;375	B4DEQ6;Q6ZW49-3;Q6ZW49-1;Q6ZW49	.;.;.;PAXI1_HUMAN	K	375;375;323;328	ENSP00000384048:N375K;ENSP00000380376:N375K	ENSP00000319149:N328K	N	-	3	2	PAXIP1	154391719	0.753000	0.28349	0.126000	0.21872	0.955000	0.61496	-0.126000	0.10563	-1.800000	0.01247	0.528000	0.53228	AAT		0.443	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349		Missense_Mutation
SNAI2	6591	broad.mit.edu	37	8	49832680	49832680	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr8:49832680T>C	ENST00000396822.1	-	3	757	c.400A>G	c.(400-402)Aat>Gat	p.N134D	SNAI2_ENST00000020945.1_Missense_Mutation_p.N134D			O43623	SNAI2_HUMAN	snail family zinc finger 2	134					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)	p.N134D(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				TAGGTCTTATTGCATAAATTG	0.438																																																1	Substitution - Missense(1)	ovary(1)	8											128.0	128.0	128.0					8																	49832680		2203	4300	6503	49995233	SO:0001583	missense	6591			U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.400A>G	8.37:g.49832680T>C	ENSP00000380034:p.Asn134Asp		49995233	B2R6P6|Q53FC1	Missense_Mutation	SNP	ENST00000396822.1	37	CCDS6146.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	10.46	1.355742	0.24598	.	.	ENSG00000019549	ENST00000020945;ENST00000396822	T;T	0.29655	1.56;1.56	5.19	5.19	0.71726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.120387	0.85682	D	0.000000	T	0.20292	0.0488	N	0.08118	0	0.48975	D	0.999737	B	0.22851	0.076	B	0.29440	0.102	T	0.07712	-1.0758	10	0.49607	T	0.09	-8.0304	15.0148	0.71576	0.0:0.0:0.0:1.0	.	134	O43623	SNAI2_HUMAN	D	134	ENSP00000020945:N134D;ENSP00000380034:N134D	ENSP00000020945:N134D	N	-	1	0	SNAI2	49995233	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.681000	0.61663	1.950000	0.56595	0.459000	0.35465	AAT		0.438	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313873.2	NM_003068		Missense_Mutation
TMEM68	137695	broad.mit.edu	37	8	56668869	56668869	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr8:56668869T>C	ENST00000434581.2	-	4	626	c.427A>G	c.(427-429)Aaa>Gaa	p.K143E	TMEM68_ENST00000334667.2_Missense_Mutation_p.K143E|TMEM68_ENST00000523073.1_Missense_Mutation_p.K29E|TMEM68_ENST00000519784.1_Missense_Mutation_p.K29E			Q96MH6	TMM68_HUMAN	transmembrane protein 68	143						integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)	p.K143E(1)		NS(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6			Epithelial(17;0.000361)|all cancers(17;0.00326)			ATAAATATTTTAGCCATGAAA	0.313																																																1	Substitution - Missense(1)	ovary(1)	8											48.0	51.0	50.0					8																	56668869		2202	4295	6497	56831423	SO:0001583	missense	137695			AK056932	CCDS6161.1, CCDS75740.1, CCDS75741.1, CCDS75742.1	8q12.1	2011-12-12			ENSG00000167904	ENSG00000167904			26510	protein-coding gene	gene with protein product						12477932	Standard	XM_005251150		Approved	FLJ32370	uc003xsh.1	Q96MH6	OTTHUMG00000164293	ENST00000434581.2:c.427A>G	8.37:g.56668869T>C	ENSP00000395204:p.Lys143Glu		56831423	Q658X6|Q8WUD2	Missense_Mutation	SNP	ENST00000434581.2	37		SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	14.14	2.445370	0.43429	.	.	ENSG00000167904	ENST00000434581;ENST00000334667;ENST00000519784;ENST00000523073;ENST00000519780;ENST00000522090;ENST00000523423	D;D;D;D;D;D	0.97161	-4.27;-4.27;-4.27;-4.27;-4.27;-4.27	5.57	5.57	0.84162	Phospholipid/glycerol acyltransferase (2);	0.319851	0.36972	N	0.002320	D	0.95335	0.8486	L	0.53729	1.69	0.80722	D	1	B;B	0.19583	0.037;0.007	B;B	0.23018	0.02;0.043	D	0.93172	0.6567	10	0.29301	T	0.29	-21.5536	15.7494	0.77972	0.0:0.0:0.0:1.0	.	143;143	Q96MH6-2;Q96MH6	.;TMM68_HUMAN	E	143;143;29;29;29;143;143	ENSP00000395204:K143E;ENSP00000335416:K143E;ENSP00000428688:K29E;ENSP00000429026:K29E;ENSP00000429667:K29E;ENSP00000430542:K143E	ENSP00000335416:K143E	K	-	1	0	TMEM68	56831423	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	4.059000	0.57470	2.126000	0.65437	0.482000	0.46254	AAA		0.313	TMEM68-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000378137.1	NM_152417		Missense_Mutation
IMPAD1	54928	broad.mit.edu	37	8	57878752	57878752	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr8:57878752G>C	ENST00000262644.4	-	4	1064	c.806C>G	c.(805-807)gCt>gGt	p.A269G		NM_017813.4	NP_060283.3	Q9NX62	IMPA3_HUMAN	inositol monophosphatase domain containing 1	269					chondrocyte development (GO:0002063)|chondroitin sulfate metabolic process (GO:0030204)|embryonic digit morphogenesis (GO:0042733)|endochondral ossification (GO:0001958)|inositol biosynthetic process (GO:0006021)|phosphatidylinositol phosphorylation (GO:0046854)|post-embryonic development (GO:0009791)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|3'-nucleotidase activity (GO:0008254)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)	p.A269G(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		all_cancers(86;0.175)|all_lung(136;0.0321)|Lung NSC(129;0.0417)|all_epithelial(80;0.0448)				GAACATACCAGCACCACCAGC	0.493																																																1	Substitution - Missense(1)	ovary(1)	8											134.0	109.0	118.0					8																	57878752		2203	4300	6503	58041306	SO:0001583	missense	54928				CCDS6169.1	8q12.1	2013-05-16			ENSG00000104331	ENSG00000104331			26019	protein-coding gene	gene with protein product		614010				21549340	Standard	NM_017813		Approved	FLJ20421, IMPA3, gPAPP	uc003xte.4	Q9NX62	OTTHUMG00000164415	ENST00000262644.4:c.806C>G	8.37:g.57878752G>C	ENSP00000262644:p.Ala269Gly		58041306	Q6NVY7	Missense_Mutation	SNP	ENST00000262644.4	37	CCDS6169.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.330993	0.95733	.	.	ENSG00000104331	ENST00000262644	T	0.55052	0.54	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.80204	0.4580	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.84336	0.0524	10	0.87932	D	0	-14.2858	19.0349	0.92972	0.0:0.0:1.0:0.0	.	269	Q9NX62	IMPA3_HUMAN	G	269	ENSP00000262644:A269G	ENSP00000262644:A269G	A	-	2	0	IMPAD1	58041306	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.336000	0.96533	2.749000	0.94314	0.655000	0.94253	GCT		0.493	IMPAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378665.1	NM_017813		Missense_Mutation
MPDZ	8777	broad.mit.edu	37	9	13188816	13188816	+	Silent	SNP	C	C	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr9:13188816C>A	ENST00000319217.7	-	17	2578	c.2331G>T	c.(2329-2331)ggG>ggT	p.G777G	MPDZ_ENST00000381015.4_Silent_p.G777G|MPDZ_ENST00000381022.2_Silent_p.G777G|MPDZ_ENST00000546205.1_Silent_p.G777G|MPDZ_ENST00000536827.1_Silent_p.G777G|MPDZ_ENST00000447879.1_Silent_p.G777G|MPDZ_ENST00000541718.1_Silent_p.G777G	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	777	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.G777G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TTCTCACAGTCCCTGACGGTG	0.418																																																1	Substitution - coding silent(1)	ovary(1)	9											254.0	251.0	252.0					9																	13188816		1956	4145	6101	13178816	SO:0001819	synonymous_variant	8777			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.2331G>T	9.37:g.13188816C>A			13178816	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Silent	SNP	ENST00000319217.7	37		SNP	30	Broad																																																																																				0.418	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		Silent
ADAMTSL1	92949	broad.mit.edu	37	9	18504910	18504910	+	Silent	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr9:18504910C>T	ENST00000380548.4	+	2	486	c.147C>T	c.(145-147)tgC>tgT	p.C49C	ADAMTSL1_ENST00000380566.4_Silent_p.C49C|ADAMTSL1_ENST00000276935.6_Silent_p.C49C|ADAMTSL1_ENST00000327883.7_Silent_p.C49C|ADAMTSL1_ENST00000431052.2_Silent_p.C49C|ADAMTSL1_ENST00000380570.4_Silent_p.C49C	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	49	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C49C(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CACGCACCTGCGGGGGTGGGG	0.617																																																2	Substitution - coding silent(2)	ovary(2)	9											43.0	45.0	44.0					9																	18504910		2203	4300	6503	18494910	SO:0001819	synonymous_variant	92949			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.147C>T	9.37:g.18504910C>T			18494910	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	ENST00000380548.4	37	CCDS47954.1	SNP	27	Broad																																																																																				0.617	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			Silent
FOCAD	54914	broad.mit.edu	37	9	20740325	20740325	+	Silent	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr9:20740325T>C	ENST00000380249.1	+	7	742	c.378T>C	c.(376-378)agT>agC	p.S126S	FOCAD_ENST00000338382.6_Silent_p.S126S	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	126						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.S126S(1)									ATATTCAGAGTATATATACCA	0.294																																																1	Substitution - coding silent(1)	ovary(1)	9											76.0	75.0	75.0					9																	20740325		2203	4297	6500	20730325	SO:0001819	synonymous_variant	54914			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.378T>C	9.37:g.20740325T>C			20730325	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Silent	SNP	ENST00000380249.1	37	CCDS34993.1	SNP	57	Broad																																																																																				0.294	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794		Silent
IFNA4	3441	broad.mit.edu	37	9	21187176	21187176	+	Silent	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr9:21187176G>A	ENST00000421715.1	-	1	422	c.355C>T	c.(355-357)Ctg>Ttg	p.L119L		NM_021068.2	NP_066546.1	P05014	IFNA4_HUMAN	interferon, alpha 4	119					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.L119L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17				GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CATGCTTCCAGGTCATTCAGT	0.478																																					NSCLC(154;890 1986 23660 27800 51138)											1	Substitution - coding silent(1)	ovary(1)	9											27.0	29.0	29.0					9																	21187176		2163	4261	6424	21177176	SO:0001819	synonymous_variant	3441				CCDS6498.1	9p22	2010-08-24			ENSG00000236637	ENSG00000236637		"""Interferons"""	5425	protein-coding gene	gene with protein product		147564				1385305	Standard	NM_021068		Approved	MGC142200, IFN-alpha4a	uc003zon.2	P05014	OTTHUMG00000019660	ENST00000421715.1:c.355C>T	9.37:g.21187176G>A			21177176	P13358|Q14CS4|Q5VV15	Silent	SNP	ENST00000421715.1	37	CCDS6498.1	SNP	35	Broad																																																																																				0.478	IFNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051889.1	NM_021068		Silent
COL15A1	1306	broad.mit.edu	37	9	101829166	101829166	+	Silent	SNP	G	G	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr9:101829166G>T	ENST00000375001.3	+	40	4077	c.3654G>T	c.(3652-3654)ctG>ctT	p.L1218L		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	1218	Nonhelical region 10 (NC10).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.L1218L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				TTTTTCAGCTGCATTTGGCTG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	9											104.0	97.0	100.0					9																	101829166		2203	4300	6503	100868987	SO:0001819	synonymous_variant	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.3654G>T	9.37:g.101829166G>T			100868987	Q5T6J4|Q9UDC5|Q9Y4W4	Silent	SNP	ENST00000375001.3	37	CCDS35081.1	SNP	46	Broad																																																																																				0.488	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855		Silent
RNF20	56254	broad.mit.edu	37	9	104307065	104307065	+	Silent	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr9:104307065G>A	ENST00000389120.3	+	6	735	c.645G>A	c.(643-645)gaG>gaA	p.E215E		NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	215					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E215E(1)		breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TGATAGTGGAGGAAGCAGTGC	0.418																																																1	Substitution - coding silent(1)	ovary(1)	9											85.0	88.0	87.0					9																	104307065		2203	4300	6503	103346886	SO:0001819	synonymous_variant	56254			AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.645G>A	9.37:g.104307065G>A			103346886	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Silent	SNP	ENST00000389120.3	37	CCDS35084.1	SNP	35	Broad																																																																																				0.418	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592		Silent
CNTRL	11064	broad.mit.edu	37	9	123877468	123877468	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chr9:123877468A>C	ENST00000373855.1	+	11	1705	c.1445A>C	c.(1444-1446)cAa>cCa	p.Q482P	CNTRL_ENST00000373865.2_3'UTR|CNTRL_ENST00000238341.5_Missense_Mutation_p.Q482P			Q7Z7A1	CNTRL_HUMAN	centriolin	482					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)		p.Q482P(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GAAGCTATACAACTAAAAAAG	0.318																																																1	Substitution - Missense(1)	ovary(1)	9											68.0	70.0	69.0					9																	123877468		2203	4297	6500	122917289	SO:0001583	missense	11064			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.1445A>C	9.37:g.123877468A>C	ENSP00000362962:p.Gln482Pro		122917289	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	13.78	2.339795	0.41398	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238	T;T	0.25579	1.79;1.79	5.09	2.49	0.30216	.	.	.	.	.	T	0.22126	0.0533	L	0.51422	1.61	0.27096	N	0.962727	P;P	0.41265	0.744;0.627	B;B	0.38327	0.271;0.099	T	0.13282	-1.0515	9	0.66056	D	0.02	.	6.5895	0.22639	0.6122:0.2979:0.0899:0.0	.	482;482	F5GZN0;Q7Z7A1	.;CNTRL_HUMAN	P	482	ENSP00000362962:Q482P;ENSP00000238341:Q482P	ENSP00000238341:Q482P	Q	+	2	0	CNTRL	122917289	0.970000	0.33590	0.999000	0.59377	0.996000	0.88848	1.329000	0.33770	0.853000	0.35312	0.533000	0.62120	CAA		0.318	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018		Missense_Mutation
PIR	8544	broad.mit.edu	37	X	15497905	15497905	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chrX:15497905T>C	ENST00000380421.3	-	3	596	c.136A>G	c.(136-138)Aaa>Gaa	p.K46E	PIR_ENST00000380420.5_Missense_Mutation_p.K46E|PIR_ENST00000476381.1_5'UTR|BMX_ENST00000357607.2_Intron	NM_001018109.2|NM_003662.3	NP_001018119.1|NP_003653.1	O00625	PIR_HUMAN	pirin (iron-binding nuclear protein)	46					monocyte differentiation (GO:0030224)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|quercetin 2,3-dioxygenase activity (GO:0008127)|transcription cofactor activity (GO:0003712)	p.K46E(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9	Hepatocellular(33;0.183)					CTACCTCCTTTAAATTCATCA	0.338																																					Ovarian(180;1587 2015 10555 34192 51653)											1	Substitution - Missense(1)	ovary(1)	X											68.0	61.0	63.0					X																	15497905		2202	4299	6501	15407826	SO:0001583	missense	8544			Y07868	CCDS14167.1	Xp22.31	2008-02-05			ENSG00000087842	ENSG00000087842			30048	protein-coding gene	gene with protein product		300931				9079676	Standard	NM_003662		Approved		uc004cwv.3	O00625	OTTHUMG00000021176	ENST00000380421.3:c.136A>G	X.37:g.15497905T>C	ENSP00000369786:p.Lys46Glu		15407826	Q5U0G0|Q6FHD2	Missense_Mutation	SNP	ENST00000380421.3	37	CCDS14167.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	t	9.071	0.996977	0.19043	.	.	ENSG00000087842	ENST00000380420;ENST00000380421	T;T	0.42513	0.97;0.97	5.24	4.07	0.47477	Cupin, RmlC-type (1);RmlC-like jelly roll fold (1);Pirin, N-terminal (1);	0.484665	0.25175	N	0.032573	T	0.29126	0.0724	L	0.39514	1.22	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.06232	-1.0838	10	0.10377	T	0.69	-19.0768	8.5023	0.33165	0.0:0.0943:0.0:0.9057	.	46	O00625	PIR_HUMAN	E	46	ENSP00000369785:K46E;ENSP00000369786:K46E	ENSP00000369785:K46E	K	-	1	0	PIR	15407826	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	2.970000	0.49240	0.643000	0.30638	-0.411000	0.06167	AAA		0.338	PIR-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055863.1	NM_003662		Missense_Mutation
DMD	1756	broad.mit.edu	37	X	31165499	31165499	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chrX:31165499G>T	ENST00000357033.4	-	75	10896	c.10690C>A	c.(10690-10692)Cta>Ata	p.L3564I	DMD_ENST00000541735.1_Missense_Mutation_p.L994I|DMD_ENST00000378723.3_Missense_Mutation_p.L496I|DMD_ENST00000378702.4_Missense_Mutation_p.L496I|DMD_ENST00000378680.2_Missense_Mutation_p.L386I|DMD_ENST00000378677.2_Missense_Mutation_p.L3560I|DMD_ENST00000343523.2_Missense_Mutation_p.L994I|DMD_ENST00000361471.4_Missense_Mutation_p.L483I|DMD_ENST00000378707.3_Missense_Mutation_p.L1104I|DMD_ENST00000359836.1_Missense_Mutation_p.L1091I|DMD_ENST00000474231.1_Missense_Mutation_p.L1104I	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3564					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.L1104I(1)|p.L3559I(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGACGCAGTAGCTTGGCCTCA	0.567																																																2	Substitution - Missense(2)	ovary(2)	X											82.0	67.0	72.0					X																	31165499		2202	4300	6502	31075420	SO:0001583	missense	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.10690C>A	X.37:g.31165499G>T	ENSP00000354923:p.Leu3564Ile		31075420	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	SNP	34	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.1|23.1	4.373322|4.373322	0.82573|0.82573	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000465285|ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680	.|T;T;T;T;T;T;T;T;T;T;T;T	.|0.70749	.|1.91;3.47;-0.51;-0.51;3.44;3.41;3.38;3.39;1.9;3.43;1.93;1.84	4.62|4.62	4.62|4.62	0.57501|0.57501	.|.	.|0.000000	.|0.28533	.|U	.|0.015020	T|T	0.77974|0.77974	0.4211|0.4211	L|L	0.55213|0.55213	1.73|1.73	0.25117|0.25117	N|N	0.99067|0.99067	.|D;P;D;D;D;D;P;D;D;D;D;D;D;D;D;D	.|0.89917	.|0.982;0.821;0.997;0.993;0.997;0.997;0.931;0.974;0.974;0.993;0.996;0.996;0.99;1.0;0.997;0.997	.|D;P;D;D;D;D;P;P;P;D;D;D;D;D;D;D	.|0.87578	.|0.952;0.672;0.978;0.987;0.991;0.991;0.747;0.841;0.841;0.952;0.978;0.979;0.979;0.998;0.926;0.978	T|T	0.67360|0.67360	-0.5690|-0.5690	5|10	.|0.24483	.|T	.|0.36	.|.	11.2207|11.2207	0.48853|0.48853	0.0906:0.0:0.9094:0.0|0.0906:0.0:0.9094:0.0	.|.	.|386;3556;3564;3560;2223;2220;1091;1104;1104;994;994;3441;483;496;483;496	.|B4DSV7;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3;P11532-5;Q8N754;Q6NSJ9;E9PDN1	.|.;.;DMD_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.	D|I	1292|3556;2223;2220;496;1247;3560;3564;1091;994;3564;3441;1104;994;496;1104;483;386	.|ENSP00000367997:L496I;ENSP00000350765:L1247I;ENSP00000367948:L3560I;ENSP00000354923:L3564I;ENSP00000352894:L1091I;ENSP00000340057:L994I;ENSP00000367979:L1104I;ENSP00000444119:L994I;ENSP00000367974:L496I;ENSP00000417123:L1104I;ENSP00000354464:L483I;ENSP00000367951:L386I	.|ENSP00000340057:L994I	A|L	-|-	2|1	0|2	DMD|DMD	31075420|31075420	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	3.265000|3.265000	0.51561|0.51561	2.118000|2.118000	0.64928|0.64928	0.513000|0.513000	0.50165|0.50165	GCT|CTA		0.567	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		Missense_Mutation
XAGE5	170627	broad.mit.edu	37	X	52844155	52844155	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chrX:52844155C>A	ENST00000375501.1	+	3	218	c.218C>A	c.(217-219)tCa>tAa	p.S73*	XAGE5_ENST00000375503.3_3'UTR|XAGE5_ENST00000425386.1_Nonsense_Mutation_p.S73*|XAGE5_ENST00000445860.2_3'UTR|XAGE5_ENST00000351072.1_Nonsense_Mutation_p.S73*			Q8WWM1	XAGE5_HUMAN	X antigen family, member 5	73								p.S73*(1)		endometrium(1)|large_intestine(1)|lung(5)|ovary(1)	8						CTGTCTCAGTCAAAGACTGGG	0.443																																																1	Substitution - Nonsense(1)	ovary(1)	X											59.0	51.0	54.0					X																	52844155		2203	4297	6500	52860880	SO:0001587	stop_gained	170627			BC069129	CCDS14346.1	Xp11.23	2010-10-19		2005-01-27	ENSG00000171405	ENSG00000171405			30930	protein-coding gene	gene with protein product	"""cancer/testis antigen family 12, member 5"""		"""G antigen, family D, 5"""	GAGED5		12477932	Standard	NM_130775		Approved	XAGE-5, CT12.5	uc004drd.1	Q8WWM1	OTTHUMG00000021589	ENST00000375501.1:c.218C>A	X.37:g.52844155C>A	ENSP00000364651:p.Ser73*		52860880	Q5JS81	Nonsense_Mutation	SNP	ENST00000375501.1	37	CCDS14346.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	c	11.22	1.573150	0.28092	.	.	ENSG00000171405	ENST00000351072;ENST00000425386;ENST00000375501	.	.	.	0.785	-1.57	0.08506	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	73	.	ENSP00000342240:S73X	S	+	2	0	XAGE5	52860880	0.005000	0.15991	0.001000	0.08648	0.107000	0.19398	-0.138000	0.10374	-1.025000	0.03334	0.279000	0.19357	TCA		0.443	XAGE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056689.1	NM_130775		Nonsense_Mutation
NKAP	79576	broad.mit.edu	37	X	119077312	119077312	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chrX:119077312G>A	ENST00000371410.3	-	1	423	c.257C>T	c.(256-258)gCg>gTg	p.A86V		NM_024528.3	NP_078804.2	Q8N5F7	NKAP_HUMAN	NFKB activating protein	86	Ser-rich.				granulocyte differentiation (GO:0030851)|hematopoietic stem cell proliferation (GO:0071425)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|stem cell maintenance (GO:0019827)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.A86V(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	20						GCCCCGGGGCGCAGAGGGCCG	0.657																																																1	Substitution - Missense(1)	ovary(1)	X											37.0	38.0	37.0					X																	119077312		2203	4300	6503	118961340	SO:0001583	missense	79576			BC012770	CCDS14592.1	Xq24	2010-07-20			ENSG00000101882	ENSG00000101882			29873	protein-coding gene	gene with protein product	"""NF kappaB activating protein"""	300766				14550261	Standard	NM_024528		Approved	FLJ22626	uc004esh.3	Q8N5F7	OTTHUMG00000022284	ENST00000371410.3:c.257C>T	X.37:g.119077312G>A	ENSP00000360464:p.Ala86Val		118961340	Q6IPW6|Q96BQ2|Q9H638	Missense_Mutation	SNP	ENST00000371410.3	37	CCDS14592.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	g	9.336	1.061846	0.19987	.	.	ENSG00000101882	ENST00000371410	T	0.14516	2.5	4.0	2.23	0.28157	.	1.255580	0.04976	N	0.464748	T	0.09730	0.0239	L	0.29908	0.895	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.36768	-0.9734	10	0.27785	T	0.31	-4.866	1.713	0.02896	0.1324:0.2441:0.444:0.1794	.	86	Q8N5F7	NKAP_HUMAN	V	86	ENSP00000360464:A86V	ENSP00000360464:A86V	A	-	2	0	NKAP	118961340	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	0.316000	0.19469	0.488000	0.27723	0.544000	0.68410	GCG		0.657	NKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058072.1	NM_024528		Missense_Mutation
STAG2	10735	broad.mit.edu	37	X	123200090	123200090	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chrX:123200090A>T	ENST00000371160.1	+	22	2452	c.2162A>T	c.(2161-2163)gAa>gTa	p.E721V	STAG2_ENST00000371157.3_Missense_Mutation_p.E721V|STAG2_ENST00000371144.3_Missense_Mutation_p.E721V|STAG2_ENST00000371145.3_Missense_Mutation_p.E721V|STAG2_ENST00000354548.5_Missense_Mutation_p.E652V|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.E721V	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	721					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.E721V(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						ACTGGAATCGAAAATGGAGAC	0.279																																																1	Substitution - Missense(1)	ovary(1)	X											95.0	101.0	99.0					X																	123200090		2202	4297	6499	123027771	SO:0001583	missense	10735			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.2162A>T	X.37:g.123200090A>T	ENSP00000360202:p.Glu721Val		123027771	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	18.16	3.561735	0.65538	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.3	5.76	5.76	0.90799	Armadillo-type fold (1);	0.100775	0.64402	D	0.000002	T	0.60077	0.2241	M	0.79475	2.455	0.80722	D	1	D;P	0.56035	0.974;0.849	D;B	0.63488	0.915;0.439	T	0.64672	-0.6352	10	0.66056	D	0.02	-2.2045	15.0823	0.72125	1.0:0.0:0.0:0.0	.	721;721	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	V	721;652;721;721;721;721	ENSP00000218089:E721V;ENSP00000346555:E652V;ENSP00000360202:E721V;ENSP00000360199:E721V;ENSP00000360187:E721V;ENSP00000360186:E721V	ENSP00000218089:E721V	E	+	2	0	STAG2	123027771	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.339000	0.96797	1.944000	0.56390	0.486000	0.48141	GAA		0.279	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603		Missense_Mutation
TENM1	10178	broad.mit.edu	37	X	123775707	123775707	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chrX:123775707T>A	ENST00000371130.3	-	11	2074	c.2011A>T	c.(2011-2013)Act>Tct	p.T671S	TENM1_ENST00000422452.2_Missense_Mutation_p.T671S	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	671	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.T673S(1)									AGAAGAAAAGTTCCGTGTCCT	0.478																																																1	Substitution - Missense(1)	ovary(1)	X											243.0	207.0	220.0					X																	123775707		2203	4300	6503	123603388	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2011A>T	X.37:g.123775707T>A	ENSP00000360171:p.Thr671Ser		123603388	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	20.3	3.973607	0.74246	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.65732	-0.17;-0.17	5.33	5.33	0.75918	Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.76586	0.4008	M	0.66939	2.045	0.51482	D	0.999929	D;D;B	0.76494	0.997;0.999;0.374	D;D;B	0.73380	0.97;0.98;0.131	T	0.78560	-0.2157	10	0.56958	D	0.05	.	14.3976	0.67022	0.0:0.0:0.0:1.0	.	670;671;671	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	S	671	ENSP00000360171:T671S;ENSP00000403954:T671S	ENSP00000360171:T671S	T	-	1	0	ODZ1	123603388	0.980000	0.34600	0.995000	0.50966	0.985000	0.73830	1.987000	0.40687	1.780000	0.52325	0.486000	0.48141	ACT		0.478	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		Missense_Mutation
GPR112	139378	broad.mit.edu	37	X	135485439	135485439	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chrX:135485439T>G	ENST00000394143.1	+	22	8903	c.8612T>G	c.(8611-8613)gTg>gGg	p.V2871G	GPR112_ENST00000412101.1_Missense_Mutation_p.V2666G|GPR112_ENST00000370652.1_Missense_Mutation_p.V2871G|GPR112_ENST00000287534.4_Missense_Mutation_p.V2624G|GPR112_ENST00000394141.1_Missense_Mutation_p.V2666G	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2871					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V2871G(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACAGTCAGTGTGAAAAAAGAT	0.498																																																1	Substitution - Missense(1)	ovary(1)	X											139.0	96.0	111.0					X																	135485439		2203	4300	6503	135313105	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8612T>G	X.37:g.135485439T>G	ENSP00000377699:p.Val2871Gly		135313105	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	17.29	3.353236	0.61293	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73	5.67	5.67	0.87782	GPCR, family 2-like (1);	.	.	.	.	T	0.66416	0.2787	M	0.79123	2.44	0.47737	D	0.999505	D;P	0.71674	0.998;0.904	P;P	0.62813	0.907;0.877	T	0.71388	-0.4608	9	0.87932	D	0	.	12.8415	0.57805	0.0:0.0:0.0:1.0	.	2666;2871	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	G	2871;2871;2666;2624;2666	ENSP00000377699:V2871G;ENSP00000359686:V2871G;ENSP00000416526:V2666G;ENSP00000287534:V2624G;ENSP00000377697:V2666G	ENSP00000287534:V2624G	V	+	2	0	GPR112	135313105	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	4.596000	0.61055	2.009000	0.58944	0.486000	0.48141	GTG		0.498	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			Missense_Mutation
ATP11C	286410	broad.mit.edu	37	X	138901496	138901496	+	Splice_Site	SNP	C	C	T			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chrX:138901496C>T	ENST00000327569.3	-	3	345		c.e3+1		ATP11C_ENST00000359686.2_Splice_Site|ATP11C_ENST00000370543.1_Splice_Site|ATP11C_ENST00000361648.2_Splice_Site|ATP11C_ENST00000370557.1_Splice_Site	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C						ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.?(1)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					GGAGCTCTTACCTGTACAAGG	0.294																																																1	Unknown(1)	ovary(1)	X											26.0	29.0	28.0					X																	138901496		2198	4276	6474	138729162	SO:0001630	splice_region_variant	286410			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.246+1G>A	X.37:g.138901496C>T			138729162	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Splice_Site_SNP	SNP	ENST00000327569.3	37	CCDS14668.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979809	0.74360	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9685	0.71213	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP11C	138729162	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	6.969000	0.76092	2.415000	0.81967	0.600000	0.82982	.		0.294	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694	Intron	Splice_Site_SNP
G6PD	2539	broad.mit.edu	37	X	153760891	153760891	+	Missense_Mutation	SNP	C	C	A	rs137852316		TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2267-01	TCGA-24-2267-11	g.chrX:153760891C>A	ENST00000393564.2	-	10	1290	c.1178G>T	c.(1177-1179)cGc>cTc	p.R393L	G6PD_ENST00000393562.2_Missense_Mutation_p.R423L|G6PD_ENST00000497281.1_5'Flank|G6PD_ENST00000369620.2_Missense_Mutation_p.R439L	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase	393			R -> H (in Nashville/Anaheim; class I). {ECO:0000269|PubMed:1536798}.		carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.R393L(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGGCTGCACGCGGATCACCAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	X	GRCh37	CM910161	G6PD	M	rs137852316						75.0	64.0	68.0					X																	153760891		2203	4300	6503	153414085	SO:0001583	missense	2539			X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.1178G>T	X.37:g.153760891C>A	ENSP00000377194:p.Arg393Leu		153414085	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Missense_Mutation	SNP	ENST00000393564.2	37	CCDS44023.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	21.0	4.076046	0.76415	.	.	ENSG00000160211	ENST00000393562;ENST00000291567;ENST00000393564;ENST00000369620	D;D;D	0.99836	-7.05;-7.05;-7.05	5.82	5.82	0.92795	Glucose-6-phosphate dehydrogenase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.94101	3.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.985	D	0.96596	0.9441	10	0.87932	D	0	.	16.3143	0.82909	0.0:1.0:0.0:0.0	.	393;423	P11413;P11413-3	G6PD_HUMAN;.	L	423;393;393;439	ENSP00000377192:R423L;ENSP00000377194:R393L;ENSP00000358633:R439L	ENSP00000291567:R393L	R	-	2	0	G6PD	153414085	1.000000	0.71417	0.992000	0.48379	0.295000	0.27426	7.279000	0.78599	2.457000	0.83068	0.597000	0.82753	CGC		0.612	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061170.3	NM_000402		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577088	7577088	+	Frame_Shift_Del	DEL	T	T	-			TCGA-24-2267-01	TCGA-24-2267-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-2267-01	TCGA-24-2267-11	g.chr17:7577088delT	ENST00000269305.4	-	8	1039	c.850delA	c.(850-852)acafs	p.T284fs	TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.T284fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.T284fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.T284fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.T284fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	284	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T284P(9)|p.0?(8)|p.T284A(3)|p.?(2)|p.T284fs*21(2)|p.T284fs*62(2)|p.R283fs*16(2)|p.T284fs*61(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.R283fs*56(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.R283fs*59(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTTCCTCTGTGCGCCGGTCT	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	39	Substitution - Missense(12)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(2)|Unknown(2)	haematopoietic_and_lymphoid_tissue(7)|upper_aerodigestive_tract(5)|large_intestine(5)|breast(4)|ovary(4)|bone(4)|stomach(3)|lung(3)|central_nervous_system(2)|urinary_tract(1)|skin(1)	17											88.0	75.0	79.0					17																	7577088		2203	4300	6503	7517813	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.850delA	17.37:g.7577088delT	ENSP00000269305:p.Thr284fs		7517813	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	59	Broad																																																																																				0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Del
