#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
COL11A1	1301	broad.mit.edu	37	1	103470190	103470190	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr1:103470190C>T	ENST00000370096.3	-	19	2185	c.1873G>A	c.(1873-1875)Ggt>Agt	p.G625S	COL11A1_ENST00000461720.1_5'UTR|COL11A1_ENST00000358392.2_Missense_Mutation_p.G637S|COL11A1_ENST00000353414.4_Missense_Mutation_p.G586S|COL11A1_ENST00000512756.1_Missense_Mutation_p.G509S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	625	Collagen-like 3.|Collagen-like 4.|Triple-helical region.		G -> V (in STL2). {ECO:0000269|PubMed:8872475}.		cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.G637S(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCAGGAGGACCTGGAGGACCT	0.323																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	37.0	38.0					1																	103470190		2203	4300	6503	103242778	SO:0001583	missense	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1873G>A	1.37:g.103470190C>T	ENSP00000359114:p.Gly625Ser		103242778	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	29.3	4.990652	0.93106	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.99607	-6.27;-6.27;-6.27;-6.27	5.83	4.92	0.64577	.	0.052522	0.85682	N	0.000000	D	0.99492	0.9819	H	0.99650	4.68	0.80722	D	1	B;B;B;B	0.32245	0.106;0.087;0.361;0.234	B;B;B;B	0.31946	0.084;0.05;0.138;0.119	D	0.97964	1.0339	10	0.87932	D	0	.	14.9259	0.70878	0.0:0.9315:0.0:0.0685	.	509;586;637;625	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	S	625;637;586;509	ENSP00000359114:G625S;ENSP00000351163:G637S;ENSP00000302551:G586S;ENSP00000426533:G509S	ENSP00000302551:G586S	G	-	1	0	COL11A1	103242778	1.000000	0.71417	0.648000	0.29521	0.996000	0.88848	5.090000	0.64498	1.468000	0.48064	0.655000	0.94253	GGT		0.323	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		Missense_Mutation
TDRD5	163589	broad.mit.edu	37	1	179609181	179609181	+	Silent	SNP	C	C	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr1:179609181C>T	ENST00000367614.1	+	10	2087	c.1728C>T	c.(1726-1728)ttC>ttT	p.F576F	TDRD5_ENST00000294848.8_Silent_p.F576F|TDRD5_ENST00000444136.1_Silent_p.F576F	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	576	Tudor. {ECO:0000255|PROSITE- ProRule:PRU00211}.				DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)		p.F576F(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						CCCTGAGGTTCCTCAAGTGAG	0.408																																																1	Substitution - coding silent(1)	ovary(1)	1											118.0	116.0	117.0					1																	179609181		2203	4300	6503	177875804	SO:0001819	synonymous_variant	163589			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1728C>T	1.37:g.179609181C>T			177875804	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Silent	SNP	ENST00000367614.1	37	CCDS1332.1	SNP	30	Broad																																																																																				0.408	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533		Silent
TPR	7175	broad.mit.edu	37	1	186312598	186312598	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr1:186312598G>A	ENST00000367478.4	-	27	3906	c.3610C>T	c.(3610-3612)Cga>Tga	p.R1204*		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1204					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)	p.R1205*(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TTTTCTCGTCGTATAAATCTA	0.333			T	NTRK1	papillary thyroid																																		Dom	yes		1	1q25	7175	translocated promoter region		E	1	Substitution - Nonsense(1)	ovary(1)	1											63.0	59.0	60.0					1																	186312598		1851	4093	5944	184579221	SO:0001587	stop_gained	7175			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.3610C>T	1.37:g.186312598G>A	ENSP00000356448:p.Arg1204*		184579221	Q15655|Q5SWY0|Q99968	Nonsense_Mutation	SNP	ENST00000367478.4	37	CCDS41446.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	45	11.910955	0.99616	.	.	ENSG00000047410	ENST00000367478	.	.	.	5.07	5.07	0.68467	.	0.124249	0.56097	D	0.000031	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.4489	0.90696	0.0:0.0:1.0:0.0	.	.	.	.	X	1204	.	ENSP00000356448:R1204X	R	-	1	2	TPR	184579221	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	7.644000	0.83416	2.372000	0.80975	0.561000	0.74099	CGA		0.333	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292		Nonsense_Mutation
HNRNPU	3192	broad.mit.edu	37	1	245027114	245027114	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr1:245027114G>A	ENST00000283179.9	-	1	659	c.496C>T	c.(496-498)Ccg>Tcg	p.P166S	HNRNPU_ENST00000444376.2_Missense_Mutation_p.P166S|RP11-11N7.4_ENST00000610145.1_lincRNA			Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)	166	Gln-rich.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasmic ribonucleoprotein granule (GO:0036464)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P166S(1)		NS(1)|endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			TGCGTCGCCGGCGGTTGAGGC	0.711																																					NSCLC(33;911 1010 3329 23631 49995)											1	Substitution - Missense(1)	ovary(1)	1											11.0	13.0	13.0					1																	245027114		2132	4228	6360	243093737	SO:0001583	missense	3192			X65488	CCDS31081.1, CCDS41479.1	1q44	2011-10-24		2007-08-16	ENSG00000153187	ENSG00000153187			5048	protein-coding gene	gene with protein product		602869		HNRPU		7509195, 8068679	Standard	NM_031844		Approved	SAF-A, hnRNPU	uc001iaz.1	Q00839	OTTHUMG00000040396	ENST00000283179.9:c.496C>T	1.37:g.245027114G>A	ENSP00000283179:p.Pro166Ser		243093737	O75507|Q8N174|Q96HY9|Q9BQ09	Missense_Mutation	SNP	ENST00000283179.9	37	CCDS41479.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	g	13.11	2.138491	0.37728	.	.	ENSG00000153187	ENST00000444376;ENST00000283179;ENST00000427948	T;T	0.42900	1.0;0.96	4.34	4.34	0.51931	.	0.747059	0.11552	U	0.552712	T	0.26268	0.0641	N	0.22421	0.69	0.33189	D	0.550589	B;B	0.22604	0.072;0.043	B;B	0.17098	0.008;0.017	T	0.21793	-1.0235	10	0.08837	T	0.75	-4.243	9.7543	0.40494	0.0:0.0:0.7935:0.2065	.	166;166	Q00839-2;Q00839	.;HNRPU_HUMAN	S	166;166;91	ENSP00000393151:P166S;ENSP00000283179:P166S	ENSP00000283179:P166S	P	-	1	0	HNRNPU	243093737	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	0.574000	0.23714	1.951000	0.56629	0.457000	0.33378	CCG		0.711	HNRNPU-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097163.3	NM_031844		Missense_Mutation
ITIH5	80760	broad.mit.edu	37	10	7608315	7608315	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr10:7608315C>G	ENST00000256861.6	-	13	2283	c.2205G>C	c.(2203-2205)aaG>aaC	p.K735N	ITIH5_ENST00000397146.2_Intron|ITIH5_ENST00000298441.6_Missense_Mutation_p.K521N|ITIH5_ENST00000446830.2_Missense_Mutation_p.K517N	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	735					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TGCGCTGTTTCTTGTGGCCAT	0.507																																																0			10											98.0	90.0	92.0					10																	7608315		2203	4300	6503	7648321	SO:0001583	missense	80760					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2205G>C	10.37:g.7608315C>G	ENSP00000256861:p.Lys735Asn		7648321	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316859	0.60524	.	.	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.12879	2.64;2.64;2.64	5.84	5.84	0.93424	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.42585	0.1209	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.14868	-1.0457	9	0.54805	T	0.06	-49.0381	20.1165	0.97939	0.0:1.0:0.0:0.0	.	735;521	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	N	735;521;517	ENSP00000256861:K735N;ENSP00000298441:K521N;ENSP00000387969:K517N	ENSP00000256861:K735N	K	-	3	2	ITIH5	7648321	1.000000	0.71417	1.000000	0.80357	0.473000	0.32948	2.944000	0.49034	2.746000	0.94184	0.655000	0.94253	AAG		0.507	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		Missense_Mutation
PCDH15	65217	broad.mit.edu	37	10	55582089	55582089	+	Silent	SNP	G	G	A	rs367881384		TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr10:55582089G>A	ENST00000320301.6	-	33	5791	c.5397C>T	c.(5395-5397)tcC>tcT	p.S1799S	PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000395433.1_Silent_p.S1776S|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000361849.3_Silent_p.S1801S|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395432.2_Silent_p.S1759S|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000395430.1_Silent_p.S1796S|PCDH15_ENST00000437009.1_Silent_p.S1730S	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1799					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.S1799S(2)|p.S1806S(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ACGTTGAAACGGAAAGTGGAA	0.502										HNSCC(58;0.16)																																						3	Substitution - coding silent(3)	ovary(2)|kidney(1)	10						G	,,,,,,,,,,,	0,4404		0,0,2202	39.0	34.0	36.0		5418,5403,5190,5388,5277,5337,,,,,5328,5397	-7.6	0.0	10		36	1,8597		0,1,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron,intron,intron,intron,coding-synonymous,coding-synonymous	PCDH15	NM_001142763.1,NM_001142764.1,NM_001142765.1,NM_001142766.1,NM_001142767.1,NM_001142768.1,NM_001142769.1,NM_001142770.1,NM_001142771.1,NM_001142772.1,NM_001142773.1,NM_033056.3	,,,,,,,,,,,	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	,,,,,,,,,,,	1806/1963,1801/1958,1730/1887,1796/1953,1759/1916,1779/1936,,,,,1776/1933,1799/1956	55582089	1,13001	2202	4299	6501	55252095	SO:0001819	synonymous_variant	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.5397C>T	10.37:g.55582089G>A			55252095	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1	SNP	39	Broad																																																																																				0.502	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		Silent
RHOG	391	broad.mit.edu	37	11	3849245	3849245	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr11:3849245C>A	ENST00000351018.4	-	2	281	c.124G>T	c.(124-126)Gcg>Tcg	p.A42S	RHOG_ENST00000396978.1_Missense_Mutation_p.A42S|RHOG_ENST00000533217.1_Missense_Mutation_p.A42S|RHOG_ENST00000396979.1_Missense_Mutation_p.A42S	NM_001665.3	NP_001656.2	P84095	RHOG_HUMAN	ras homolog family member G	42					actin cytoskeleton organization (GO:0030036)|activation of Rac GTPase activity (GO:0032863)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|GTP catabolic process (GO:0006184)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of transcription, DNA-templated (GO:0045893)|Rac protein signal transduction (GO:0016601)|regulation of ruffle assembly (GO:1900027)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)	2		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0349)|LUSC - Lung squamous cell carcinoma(625;0.194)		GCGCTCTGCGCGCTGTAATTG	0.592																																																0			11											90.0	76.0	80.0					11																	3849245		2201	4298	6499	3805821	SO:0001583	missense	391			X61587	CCDS7748.1	11p15.5-p15.4	2012-02-27	2012-02-27	2004-03-24	ENSG00000177105	ENSG00000177105			672	protein-coding gene	gene with protein product		179505	"""ras homolog gene family, member G (rho G)"""	ARHG		8325658	Standard	NM_001665		Approved	RhoG, MGC125835, MGC125836	uc001lyu.2	P84095	OTTHUMG00000012287	ENST00000351018.4:c.124G>T	11.37:g.3849245C>A	ENSP00000339467:p.Ala42Ser		3805821	P35238|Q8NI04	Missense_Mutation	SNP	ENST00000351018.4	37	CCDS7748.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	9.465	1.094238	0.20471	.	.	ENSG00000177105	ENST00000351018;ENST00000396979;ENST00000396978;ENST00000533217	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.78	4.87	0.63330	Small GTP-binding protein domain (1);	0.146485	0.64402	D	0.000008	D	0.84511	0.5488	L	0.48877	1.53	0.43351	D	0.99541	P	0.35807	0.522	P	0.60541	0.876	D	0.85041	0.0923	10	0.66056	D	0.02	.	12.599	0.56487	0.0:0.9202:0.0:0.0798	.	42	P84095	RHOG_HUMAN	S	42	ENSP00000339467:A42S;ENSP00000380176:A42S;ENSP00000380175:A42S;ENSP00000436932:A42S	ENSP00000339467:A42S	A	-	1	0	RHOG	3805821	0.993000	0.37304	0.977000	0.42913	0.026000	0.11368	2.808000	0.47963	1.450000	0.47717	-0.251000	0.11542	GCG		0.592	RHOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034125.2	NM_001665		Missense_Mutation
CREB3L1	90993	broad.mit.edu	37	11	46334468	46334468	+	Silent	SNP	C	C	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr11:46334468C>T	ENST00000529193.1	+	8	1480	c.1029C>T	c.(1027-1029)aaC>aaT	p.N343N	CREB3L1_ENST00000288400.3_Silent_p.N343N			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	343	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.N343N(1)	FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		AGAATGCCAACAGGTGGGTAG	0.592			T	FUS	myxofibrosarcoma																																Pancreas(3;159 194 19597 26278 47995)		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	1	Substitution - coding silent(1)	ovary(1)	11											41.0	45.0	44.0					11																	46334468		2038	4189	6227	46291044	SO:0001819	synonymous_variant	90993				CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.1029C>T	11.37:g.46334468C>T			46291044	Q8N2D5|Q96CP0	Silent	SNP	ENST00000529193.1	37	CCDS53620.1	SNP	17	Broad																																																																																				0.592	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389702.1	NM_052854		Silent
C12orf40	283461	broad.mit.edu	37	12	40076668	40076668	+	Silent	SNP	G	G	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr12:40076668G>A	ENST00000324616.5	+	8	1096	c.942G>A	c.(940-942)agG>agA	p.R314R	C12orf40_ENST00000405531.3_Silent_p.R314R|C12orf40_ENST00000398716.1_Silent_p.R237R	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	314								p.R314R(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						ATGAGCAAAGGATAAAGAAAA	0.328																																																1	Substitution - coding silent(1)	ovary(1)	12											101.0	96.0	98.0					12																	40076668		1863	4090	5953	38362935	SO:0001819	synonymous_variant	283461			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.942G>A	12.37:g.40076668G>A			38362935	B7WNU1|Q8IXY6|Q8N818|V9HW02	Silent	SNP	ENST00000324616.5	37	CCDS41770.1	SNP	41	Broad																																																																																				0.328	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257664.2	NM_173599		Silent
BAG5	9529	broad.mit.edu	37	14	104026804	104026804	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr14:104026804C>G	ENST00000445922.2	-	2	944	c.698G>C	c.(697-699)tGc>tCc	p.C233S	RP11-73M18.2_ENST00000472726.2_5'Flank|APOPT1_ENST00000556253.2_5'Flank|BAG5_ENST00000299204.4_Missense_Mutation_p.C233S|RP11-894P9.2_ENST00000556332.1_RNA|BAG5_ENST00000337322.4_Missense_Mutation_p.C274S|APOPT1_ENST00000409074.2_5'Flank|APOPT1_ENST00000247618.4_5'Flank	NM_004873.3	NP_004864.1	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5	233	BAG 3. {ECO:0000255|PROSITE- ProRule:PRU00369}.				negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein refolding (GO:0061084)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron death (GO:0070997)|protein folding (GO:0006457)|regulation of inclusion body assembly (GO:0090083)	inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chaperone binding (GO:0051087)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	24		Melanoma(154;0.155)	Epithelial(46;0.144)			TGTCCGGCCGCACACATCTAG	0.458																																					NSCLC(171;1832 2055 18950 31566 41632)											0			14											103.0	100.0	101.0					14																	104026804		2203	4300	6503	103096557	SO:0001583	missense	9529			AF095195	CCDS9982.1, CCDS41995.1	14q32	2008-08-01				ENSG00000166170			941	protein-coding gene	gene with protein product		603885				9873016, 15603737	Standard	NM_001015048		Approved		uc001ynh.2	Q9UL15		ENST00000445922.2:c.698G>C	14.37:g.104026804C>G	ENSP00000391713:p.Cys233Ser		103096557	O94950|Q86W59	Missense_Mutation	SNP	ENST00000445922.2	37	CCDS9982.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	6.093	0.385463	0.11524	.	.	ENSG00000166170	ENST00000299204;ENST00000445922;ENST00000337322	T;T;T	0.66460	-0.21;-0.21;-0.21	5.76	4.87	0.63330	BAG domain (3);	0.177421	0.51477	D	0.000098	T	0.43055	0.1230	N	0.04880	-0.145	0.42411	D	0.992601	B;B	0.16603	0.005;0.018	B;B	0.20384	0.007;0.029	T	0.31613	-0.9937	10	0.13853	T	0.58	-17.4673	11.8509	0.52412	0.1378:0.7297:0.1325:0.0	.	233;274	Q9UL15;Q9UL15-2	BAG5_HUMAN;.	S	233;233;274	ENSP00000299204:C233S;ENSP00000391713:C233S;ENSP00000338814:C274S	ENSP00000299204:C233S	C	-	2	0	BAG5	103096557	1.000000	0.71417	0.645000	0.29479	0.974000	0.67602	5.415000	0.66411	1.432000	0.47375	0.655000	0.94253	TGC		0.458	BAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414990.1			Missense_Mutation
LCAT	3931	broad.mit.edu	37	16	67974238	67974238	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr16:67974238T>C	ENST00000264005.5	-	6	921	c.892A>G	c.(892-894)Aca>Gca	p.T298A		NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	298			T -> A (in FED and LCATD). {ECO:0000269|PubMed:11423760, ECO:0000269|PubMed:15994445}.|T -> I (in LCATD). {ECO:0000269|PubMed:15994445}.		cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)	p.T298A(1)		cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		TCACGGCCTGTGTAGTTGAAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	16	GRCh37	CM012147	LCAT	M							125.0	107.0	113.0					16																	67974238		2198	4300	6498	66531739	SO:0001583	missense	3931				CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.892A>G	16.37:g.67974238T>C	ENSP00000264005:p.Thr298Ala		66531739	Q53XQ3	Missense_Mutation	SNP	ENST00000264005.5	37	CCDS10854.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	25.4	4.636160	0.87760	.	.	ENSG00000213398	ENST00000264005	D	0.96073	-3.9	5.88	5.88	0.94601	.	0.000000	0.85682	U	0.000000	D	0.98381	0.9462	H	0.95470	3.675	0.54753	D	0.999984	D	0.89917	1.0	D	0.87578	0.998	D	0.99521	1.0958	10	0.87932	D	0	-24.1829	14.2482	0.66001	0.0:0.0:0.0:1.0	.	298	P04180	LCAT_HUMAN	A	298	ENSP00000264005:T298A	ENSP00000264005:T298A	T	-	1	0	LCAT	66531739	1.000000	0.71417	0.995000	0.50966	0.940000	0.58332	7.978000	0.88095	2.250000	0.74265	0.454000	0.30748	ACA		0.582	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3			Missense_Mutation
WDR59	79726	broad.mit.edu	37	16	74920294	74920294	+	Splice_Site	SNP	G	G	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr16:74920294G>A	ENST00000262144.6	-	24	2550	c.2420C>T	c.(2419-2421)gCg>gTg	p.A807V		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	807								p.A807V(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						CTCTCTTCCCGCTGAAGAAAA	0.512																																																1	Substitution - Missense(1)	ovary(1)	16											58.0	57.0	57.0					16																	74920294		2198	4300	6498	73477795	SO:0001630	splice_region_variant	79726			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.2420-1C>T	16.37:g.74920294G>A			73477795	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Missense_Mutation	SNP	ENST00000262144.6	37	CCDS32488.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689193	0.29962	.	.	ENSG00000103091	ENST00000262144	T	0.68331	-0.32	5.29	3.07	0.35406	.	0.445679	0.25341	N	0.031370	T	0.46580	0.1400	N	0.22421	0.69	0.32492	N	0.5401	B;B	0.10296	0.0;0.003	B;B	0.08055	0.0;0.003	T	0.47736	-0.9094	10	0.25751	T	0.34	.	6.965	0.24617	0.3418:0.0:0.6582:0.0	.	807;252	Q6PJI9;Q6PJI9-4	WDR59_HUMAN;.	V	807	ENSP00000262144:A807V	ENSP00000262144:A807V	A	-	2	0	WDR59	73477795	0.998000	0.40836	0.991000	0.47740	0.391000	0.30476	2.607000	0.46300	1.177000	0.42855	0.505000	0.49811	GCG		0.512	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581	Missense_Mutation	Missense_Mutation
ZFPM1	161882	broad.mit.edu	37	16	88601258	88601258	+	Silent	SNP	G	G	C			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr16:88601258G>C	ENST00000319555.3	+	10	3214	c.2892G>C	c.(2890-2892)acG>acC	p.T964T		NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	964					atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)	p.T964T(1)|p.T964fs*39(1)		central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCAAGGGCACGCCGGCGCCGC	0.701																																					Pancreas(49;850 1106 29641 32847 38344)											2	Deletion - Frameshift(1)|Substitution - coding silent(1)	ovary(2)	16											28.0	33.0	31.0					16																	88601258		2173	4278	6451	87128759	SO:0001819	synonymous_variant	161882			AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.2892G>C	16.37:g.88601258G>C			87128759		Silent	SNP	ENST00000319555.3	37	CCDS32502.1	SNP	38	Broad																																																																																				0.701	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2			Silent
TP53	7157	broad.mit.edu	37	17	7576885	7576885	+	Nonsense_Mutation	SNP	T	T	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr17:7576885T>A	ENST00000269305.4	-	9	1150	c.961A>T	c.(961-963)Aaa>Taa	p.K321*	TP53_ENST00000359597.4_Nonsense_Mutation_p.K321*|TP53_ENST00000455263.2_Nonsense_Mutation_p.K321*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Nonsense_Mutation_p.K321*|TP53_ENST00000420246.2_Nonsense_Mutation_p.K321*|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	321	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.		K -> E (in kidney cancer; germline mutation).|K -> R (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.K321fs*24(3)|p.P318fs*15(2)|p.K321*(2)|p.P318fs*21(1)|p.S315fs*22(1)|p.?(1)|p.L308fs*15(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCAGTGGTTTCTTCTTTGGC	0.458		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	19	Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Nonsense(2)|Unknown(1)	bone(4)|breast(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|ovary(2)|stomach(1)|soft_tissue(1)|endometrium(1)|lung(1)	17											129.0	119.0	122.0					17																	7576885		2203	4300	6503	7517610	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.961A>T	17.37:g.7576885T>A	ENSP00000269305:p.Lys321*		7517610	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	62	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	37|37	6.314282|6.314282	0.97467|0.97467	.|.	.|.	ENSG00000141510|ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690|ENST00000419024	.|.	.|.	.|.	4.88|4.88	4.88|4.88	0.63580|0.63580	.|.	0.806142|.	0.11658|.	N|.	0.542146|.	.|T	.|0.65523	.|0.2699	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77000	.|-0.2750	.|4	0.02654|0.87932	T|D	1|0	-22.8989|-22.8989	10.7895|10.7895	0.46424|0.46424	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	X|S	321;321;321;321;321;310;189|7	.|.	ENSP00000269305:K321X|ENSP00000402130:R7S	K|R	-|-	1|3	0|2	TP53|TP53	7517610|7517610	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	3.768000|3.768000	0.55295|0.55295	2.030000|2.030000	0.59900|0.59900	0.459000|0.459000	0.35465|0.35465	AAA|AGA		0.458	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
ALKBH5	54890	broad.mit.edu	37	17	18088078	18088078	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr17:18088078A>G	ENST00000399138.4	+	1	526	c.521A>G	c.(520-522)cAa>cGa	p.Q174R	RP11-258F1.1_ENST00000583062.1_RNA|RP11-258F1.1_ENST00000577847.1_RNA|ALKBH5_ENST00000541285.1_Intron	NM_017758.3	NP_060228.3	Q6P6C2	ALKB5_HUMAN	AlkB family member 5, RNA demethylase	174					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|oxidative single-stranded RNA demethylation (GO:0035553)|response to hypoxia (GO:0001666)|spermatogenesis (GO:0007283)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidative RNA demethylase activity (GO:0035515)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|poly(A) RNA binding (GO:0044822)	p.Q174R(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|skin(1)	10	all_neural(463;0.228)					CTGGTGATCCAAAAGCTGGTG	0.687																																					Ovarian(166;154 1953 40235 46283 46309)											1	Substitution - Missense(1)	ovary(1)	17											31.0	35.0	34.0					17																	18088078		2015	4163	6178	18028803	SO:0001583	missense	54890			AK000315	CCDS42272.1	17p11.2	2014-07-23	2014-07-23	2006-02-09	ENSG00000091542	ENSG00000091542	1.14.11.-	"""Alkylation repair homologs"""	25996	protein-coding gene	gene with protein product		613303	"""oxoglutarate and iron-dependent oxygenase domain containing"", ""alkB, alkylation repair homolog 5 (E. coli)"""	OFOXD1		11997338, 24778178	Standard	NM_017758		Approved	FLJ20308	uc010cpw.3	Q6P6C2	OTTHUMG00000059397	ENST00000399138.4:c.521A>G	17.37:g.18088078A>G	ENSP00000382091:p.Gln174Arg		18028803	B4DVJ4|D3DXC6|Q9NXD6	Missense_Mutation	SNP	ENST00000399138.4	37	CCDS42272.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	5.149	0.213060	0.09757	.	.	ENSG00000091542	ENST00000261650;ENST00000500385;ENST00000399138	T	0.10763	2.84	4.98	4.98	0.66077	.	0.285871	0.36034	N	0.002826	T	0.02970	0.0088	N	0.01751	-0.74	0.27754	N	0.944044	B	0.02656	0.0	B	0.04013	0.001	T	0.42207	-0.9465	10	0.06891	T	0.86	-12.9609	4.9317	0.13921	0.7765:0.0:0.2235:0.0	.	174	Q6P6C2-2	.	R	174;163;174	ENSP00000382091:Q174R	ENSP00000261650:Q174R	Q	+	2	0	ALKBH5	18028803	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.926000	0.56491	2.094000	0.63399	0.533000	0.62120	CAA		0.687	ALKBH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132069.3	NM_017758		Missense_Mutation
CARD14	79092	broad.mit.edu	37	17	78169003	78169003	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr17:78169003C>T	ENST00000573882.1	+	12	1906	c.1370C>T	c.(1369-1371)tCg>tTg	p.S457L	CARD14_ENST00000344227.2_Missense_Mutation_p.S457L|CARD14_ENST00000570421.1_Missense_Mutation_p.S457L|CARD14_ENST00000392434.2_Missense_Mutation_p.S220L|CARD14_ENST00000573754.1_3'UTR			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	457					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)	p.S457L(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CAGCTCTTGTCGGACCTGAGT	0.677																																																1	Substitution - Missense(1)	ovary(1)	17											44.0	42.0	43.0					17																	78169003		2203	4300	6503	75783598	SO:0001583	missense	79092			AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1370C>T	17.37:g.78169003C>T	ENSP00000458715:p.Ser457Leu		75783598	B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	37	CCDS11768.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	6.016	0.371343	0.11409	.	.	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	T;T	0.36878	1.23;1.23	4.55	2.56	0.30785	.	1.811070	0.02701	N	0.111750	T	0.33585	0.0868	L	0.51422	1.61	0.09310	N	1	B;B;B	0.18013	0.004;0.025;0.002	B;B;B	0.09377	0.001;0.004;0.001	T	0.15549	-1.0433	10	0.21014	T	0.42	-3.8235	6.8276	0.23893	0.0:0.6697:0.2248:0.1055	.	457;220;457	B8QQJ3;E7ETJ2;Q9BXL6	.;.;CAR14_HUMAN	L	457;220;220	ENSP00000344549:S457L;ENSP00000376229:S220L	ENSP00000308507:S220L	S	+	2	0	CARD14	75783598	0.952000	0.32445	0.007000	0.13788	0.006000	0.05464	2.327000	0.43858	0.556000	0.29098	0.650000	0.86243	TCG		0.677	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1			Missense_Mutation
CD22	933	broad.mit.edu	37	19	35828818	35828818	+	Silent	SNP	G	G	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr19:35828818G>A	ENST00000085219.5	+	5	945	c.879G>A	c.(877-879)acG>acA	p.T293T	CD22_ENST00000270311.6_Silent_p.T173T|CD22_ENST00000341773.6_Intron|CD22_ENST00000544992.2_Silent_p.T293T|CD22_ENST00000594250.1_Intron|CD22_ENST00000419549.2_Silent_p.T121T|CD22_ENST00000536635.2_Silent_p.T293T	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	293	Ig-like C2-type 2.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.T293T(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ATACATTCACGCTAAACCTGC	0.567																																					Ovarian(42;1009 1133 23674 26041)											1	Substitution - coding silent(1)	ovary(1)	19											111.0	77.0	88.0					19																	35828818		2203	4300	6503	40520658	SO:0001819	synonymous_variant	933			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.879G>A	19.37:g.35828818G>A			40520658	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Silent	SNP	ENST00000085219.5	37	CCDS12457.1	SNP	38	Broad																																																																																				0.567	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771		Silent
ZNF227	7770	broad.mit.edu	37	19	44739757	44739757	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr19:44739757A>G	ENST00000313040.7	+	6	1379	c.1174A>G	c.(1174-1176)Agt>Ggt	p.S392G	ZNF227_ENST00000391961.2_Missense_Mutation_p.S341G|ZNF227_ENST00000589005.1_Missense_Mutation_p.S341G	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	392					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S392G(1)		central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				CTTCGGTTGGAGTGTTAATCT	0.448																																																1	Substitution - Missense(1)	ovary(1)	19											87.0	95.0	93.0					19																	44739757		2203	4300	6503	49431597	SO:0001583	missense	7770			AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.1174A>G	19.37:g.44739757A>G	ENSP00000321049:p.Ser392Gly		49431597	B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	37	CCDS12636.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	14.99	2.701403	0.48307	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980;ENST00000377916	T;T	0.16324	2.35;2.87	4.54	2.35	0.29111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17066	0.0410	M	0.79343	2.45	0.09310	N	0.999996	B;B;B;B	0.33807	0.117;0.117;0.426;0.117	B;B;B;B	0.24701	0.007;0.015;0.055;0.015	T	0.15780	-1.0425	9	0.30854	T	0.27	.	6.1318	0.20209	0.7455:0.1651:0.0895:0.0	.	313;371;344;392	B7Z6M2;Q658S5;Q9NS43;Q86WZ6	.;.;.;ZN227_HUMAN	G	392;349;341;371;93	ENSP00000321049:S392G;ENSP00000375823:S341G	ENSP00000321049:S392G	S	+	1	0	ZNF227	49431597	0.000000	0.05858	0.998000	0.56505	0.983000	0.72400	0.130000	0.15850	0.659000	0.30945	0.460000	0.39030	AGT		0.448	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490		Missense_Mutation
SIGLEC11	114132	broad.mit.edu	37	19	50462666	50462666	+	Silent	SNP	C	C	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr19:50462666C>T	ENST00000447370.2	-	5	1098	c.1008G>A	c.(1006-1008)gcG>gcA	p.A336A	CTC-326K19.6_ENST00000451973.1_5'Flank|SIGLEC11_ENST00000426971.2_Silent_p.A336A	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	336	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.A324A(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		GCCTGTTCTCCGCTCGGCAGG	0.662																																																1	Substitution - coding silent(1)	ovary(1)	19											29.0	45.0	40.0					19																	50462666		1957	4292	6249	55154478	SO:0001819	synonymous_variant	114132			AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1008G>A	19.37:g.50462666C>T			55154478		Silent	SNP	ENST00000447370.2	37	CCDS12790.2	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	0.258	-1.001602	0.02128	.	.	ENSG00000161640	ENST00000426971	.	.	.	1.61	-3.23	0.05109	.	.	.	.	.	T	0.49508	0.1561	.	.	.	0.58432	D	0.999993	.	.	.	.	.	.	T	0.41858	-0.9485	4	.	.	.	.	6.2332	0.20747	0.0:0.5744:0.0:0.4256	.	.	.	.	Q	326	.	.	R	-	2	0	SIGLEC11	55154478	0.000000	0.05858	0.769000	0.31535	0.031000	0.12232	-3.504000	0.00449	-0.896000	0.03915	-1.219000	0.01604	CGG		0.662	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884		Silent
DUXA	503835	broad.mit.edu	37	19	57666681	57666681	+	Silent	SNP	C	C	T	rs370297842		TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr19:57666681C>T	ENST00000554048.2	-	5	497	c.498G>A	c.(496-498)gcG>gcA	p.A166A		NM_001012729.1	NP_001012747.1	A6NLW8	DUXA_HUMAN	double homeobox A	166					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		GTTCTAAGGACGCCACAGGTT	0.428																																																0			19						C		0,4406		0,0,2203	124.0	98.0	107.0		498	-4.4	0.0	19		107	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DUXA	NM_001012729.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		166/205	57666681	1,13005	2203	4300	6503	62358493	SO:0001819	synonymous_variant	503835				CCDS33126.1	19q13.43	2012-10-04			ENSG00000258873	ENSG00000258873		"""Homeoboxes / PRD class"""	32179	protein-coding gene	gene with protein product		611168					Standard	NM_001012729		Approved		uc002qoa.1	A6NLW8	OTTHUMG00000170714	ENST00000554048.2:c.498G>A	19.37:g.57666681C>T			62358493		Silent	SNP	ENST00000554048.2	37	CCDS33126.1	SNP	19	Broad																																																																																				0.428	DUXA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410075.3	NM_001012729		Silent
CNTNAP5	129684	broad.mit.edu	37	2	125521567	125521567	+	Silent	SNP	C	C	T	rs566175180		TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr2:125521567C>T	ENST00000431078.1	+	16	2737	c.2373C>T	c.(2371-2373)aaC>aaT	p.N791N		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	791	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.N791N(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCTTCTGGAACGCCGTCTCAT	0.413													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18170	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	2											124.0	118.0	120.0					2																	125521567		1883	4093	5976	125238037	SO:0001819	synonymous_variant	129684			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2373C>T	2.37:g.125521567C>T			125238037	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	CCDS46401.1	SNP	19	Broad																																																																																				0.413	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			Silent
SCN7A	6332	broad.mit.edu	37	2	167262119	167262119	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr2:167262119C>T	ENST00000409855.1	-	25	5146	c.5020G>A	c.(5020-5022)Gaa>Aaa	p.E1674K		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1674					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.E1674K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	GGTGACTTTTCCTTAGCTTTG	0.353																																																1	Substitution - Missense(1)	ovary(1)	2											244.0	230.0	234.0					2																	167262119		1846	4097	5943	166970365	SO:0001583	missense	6332			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.5020G>A	2.37:g.167262119C>T	ENSP00000386796:p.Glu1674Lys		166970365		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	21.2	4.115764	0.77323	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.96774	-4.12	4.75	4.75	0.60458	.	0.521196	0.17591	N	0.168756	D	0.92077	0.7489	N	0.22421	0.69	0.39221	D	0.963505	P	0.39060	0.657	B	0.35182	0.197	D	0.93094	0.6502	10	0.54805	T	0.06	.	15.1315	0.72527	0.0:1.0:0.0:0.0	.	1674	Q01118	SCN7A_HUMAN	K	1674	ENSP00000386796:E1674K	ENSP00000259060:E1674K	E	-	1	0	SCN7A	166970365	0.639000	0.27234	0.220000	0.23810	0.217000	0.24651	2.927000	0.48900	2.630000	0.89119	0.655000	0.94253	GAA		0.353	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1			Missense_Mutation
HAT1	8520	broad.mit.edu	37	2	172779019	172779019	+	Splice_Site	SNP	T	T	G	rs76979357		TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr2:172779019T>G	ENST00000264108.4	+	1	43		c.e1+2		SLC25A12_ENST00000472748.1_Intron|HAT1_ENST00000460481.1_Splice_Site|HAT1_ENST00000392584.1_Splice_Site	NM_003642.3	NP_003633.1	O14929	HAT1_HUMAN	histone acetyltransferase 1						chromatin organization (GO:0006325)|chromatin silencing at telomere (GO:0006348)|DNA packaging (GO:0006323)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4 acetylation (GO:0043967)|internal protein amino acid acetylation (GO:0006475)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	H4 histone acetyltransferase activity (GO:0010485)|histone acetyltransferase activity (GO:0004402)			breast(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|prostate(1)	19			OV - Ovarian serous cystadenocarcinoma(117;0.216)			AAATGGCGGGTAAGTTACCGG	0.597																																																0			2											45.0	48.0	47.0					2																	172779019		2203	4300	6503	172487265	SO:0001630	splice_region_variant	8520			AF030424	CCDS2245.1	2q31.2-q33.1	2011-07-01			ENSG00000128708	ENSG00000128708	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"""	4821	protein-coding gene	gene with protein product		603053				9427644	Standard	NM_003642		Approved	KAT1	uc002uhi.3	O14929	OTTHUMG00000132282	ENST00000264108.4:c.7+2T>G	2.37:g.172779019T>G			172487265	Q49A44|Q53QF0|Q53SU4|Q6P594|Q8WWB9	Splice_Site_SNP	SNP	ENST00000264108.4	37	CCDS2245.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	24.0	4.486075	0.84854	.	.	ENSG00000128708	ENST00000264108	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6654	0.56840	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HAT1	172487265	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.069000	0.57541	2.247000	0.74100	0.477000	0.44152	.		0.597	HAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255377.1	NM_003642	Intron	Splice_Site_SNP
ADAM23	8745	broad.mit.edu	37	2	207424691	207424691	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr2:207424691C>T	ENST00000264377.3	+	11	1346	c.1018C>T	c.(1018-1020)Cag>Tag	p.Q340*	ADAM23_ENST00000374415.3_Nonsense_Mutation_p.Q340*|ADAM23_ENST00000374416.1_Nonsense_Mutation_p.Q340*	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	340	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		TTACAAGGAGCAGCTCAACAC	0.512																																					Melanoma(194;1127 2130 19620 24042 27855)											0			2											91.0	83.0	85.0					2																	207424691		2203	4300	6503	207132936	SO:0001587	stop_gained	8745			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1018C>T	2.37:g.207424691C>T	ENSP00000264377:p.Gln340*		207132936	A2RU59	Nonsense_Mutation	SNP	ENST00000264377.3	37	CCDS2369.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	37	6.318056	0.97471	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	.	.	.	5.64	5.64	0.86602	.	0.109694	0.41001	D	0.000969	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	19.7201	0.96139	0.0:1.0:0.0:0.0	.	.	.	.	X	340;340;234;340	.	ENSP00000264377:Q340X	Q	+	1	0	ADAM23	207132936	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.661000	0.90470	0.561000	0.74099	CAG		0.512	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812		Nonsense_Mutation
STX16	8675	broad.mit.edu	37	20	57251255	57251255	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr20:57251255C>T	ENST00000371141.4	+	9	1610	c.886C>T	c.(886-888)Caa>Taa	p.Q296*	STX16_ENST00000359617.4_Nonsense_Mutation_p.Q243*|STX16_ENST00000361770.5_Nonsense_Mutation_p.Q279*|STX16_ENST00000358029.4_Nonsense_Mutation_p.Q292*|STX16-NPEPL1_ENST00000530122.1_Intron|STX16_ENST00000361830.3_Nonsense_Mutation_p.Q296*|STX16_ENST00000355957.5_Nonsense_Mutation_p.Q279*|STX16_ENST00000371132.4_Nonsense_Mutation_p.Q275*	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16	296					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)	p.Q275*(1)		breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			AGAACAGTATCAAAAGAAGAA	0.413																																																1	Substitution - Nonsense(1)	ovary(1)	20											201.0	200.0	200.0					20																	57251255		2203	4300	6503	56684661	SO:0001587	stop_gained	8675			AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.886C>T	20.37:g.57251255C>T	ENSP00000360183:p.Gln296*		56684661	A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Nonsense_Mutation	SNP	ENST00000371141.4	37	CCDS13468.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	44	10.548866	0.99425	.	.	ENSG00000124222	ENST00000355957;ENST00000361770;ENST00000359617;ENST00000371141;ENST00000371138;ENST00000371132;ENST00000358029;ENST00000361830;ENST00000438253;ENST00000435446	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.2859	0.94069	0.0:1.0:0.0:0.0	.	.	.	.	X	279;279;243;296;243;275;292;296;190;110	.	ENSP00000360180:Q243X	Q	+	1	0	STX16	56684661	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.784000	0.75084	2.873000	0.98535	0.563000	0.77884	CAA		0.413	STX16-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080517.2	NM_001001433		Nonsense_Mutation
POFUT2	23275	broad.mit.edu	37	21	46705748	46705748	+	Missense_Mutation	SNP	G	G	T	rs145949373	byFrequency	TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr21:46705748G>T	ENST00000349485.5	-	2	253	c.227C>A	c.(226-228)aCg>aAg	p.T76K	BX322557.10_ENST00000454115.2_RNA|POFUT2_ENST00000471540.1_5'Flank|POFUT2_ENST00000331343.7_Missense_Mutation_p.T76K	NM_133635.4	NP_598368.2	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2	76					fucose metabolic process (GO:0006004)|mesoderm formation (GO:0001707)|protein O-linked fucosylation (GO:0036066)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of gene expression (GO:0010468)|regulation of secretion (GO:0051046)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	20				Colorectal(79;0.243)		CCACTCCTCCGTCTTCAGCAG	0.557																																																0			21											87.0	96.0	93.0					21																	46705748		2203	4300	6503	45530176	SO:0001583	missense	23275			AJ203079	CCDS13719.1, CCDS13721.1	21q22.3	2013-03-06	2004-06-07	2004-06-09	ENSG00000186866	ENSG00000186866	2.4.1.221	"""Fucosyltransferases"""	14683	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 2"""	610249	"""chromosome 21 open reading frame 80"""	C21orf80			Standard	NM_133635		Approved	KIAA0958, FUT13	uc002zhc.3	Q9Y2G5	OTTHUMG00000084874	ENST00000349485.5:c.227C>A	21.37:g.46705748G>T	ENSP00000339613:p.Thr76Lys		45530176	Q6PJV1|Q7Z4N0|Q8WWU6|Q9BQS4|Q9BQS5|Q9UFY3	Missense_Mutation	SNP	ENST00000349485.5	37	CCDS13719.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	1.898	-0.453843	0.04540	.	.	ENSG00000186866	ENST00000331343;ENST00000349485	.	.	.	4.63	1.7	0.24286	.	0.550372	0.20727	N	0.086786	T	0.12603	0.0306	N	0.12569	0.235	0.09310	N	0.999993	P;B;B	0.48834	0.916;0.05;0.001	B;B;B	0.43225	0.412;0.021;0.007	T	0.22208	-1.0223	9	0.02654	T	1	-13.0983	5.4257	0.16425	0.1809:0.3112:0.5079:0.0	.	76;76;76	B4DH78;Q9Y2G5-1;Q9Y2G5	.;.;OFUT2_HUMAN	K	76	.	ENSP00000329682:T76K	T	-	2	0	POFUT2	45530176	0.990000	0.36364	0.100000	0.21137	0.914000	0.54420	2.216000	0.42871	0.119000	0.18210	0.655000	0.94253	ACG		0.557	POFUT2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192573.2	NM_015227		Missense_Mutation
PPM1F	9647	broad.mit.edu	37	22	22285650	22285650	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr22:22285650C>A	ENST00000263212.5	-	6	866	c.761G>T	c.(760-762)gGc>gTc	p.G254V	PPM1F_ENST00000407142.1_Missense_Mutation_p.G86V|PPM1F_ENST00000397495.4_Missense_Mutation_p.G254V|PPM1F_ENST00000538191.1_Missense_Mutation_p.G150V	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	254					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)	p.G254V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		ACCTGTGGTGCCGCTCTGCAG	0.627																																																1	Substitution - Missense(1)	ovary(1)	22											40.0	33.0	36.0					22																	22285650		2203	4300	6503	20615650	SO:0001583	missense	9647			D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.761G>T	22.37:g.22285650C>A	ENSP00000263212:p.Gly254Val		20615650	A8K6G3|B7Z2C3|Q96PM2	Missense_Mutation	SNP	ENST00000263212.5	37	CCDS13796.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.225093	0.95173	.	.	ENSG00000100034	ENST00000263212;ENST00000407142;ENST00000406981;ENST00000538191;ENST00000397495;ENST00000445205	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	4.84	4.84	0.62591	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	D	0.89008	0.6593	H	0.98111	4.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92947	0.6377	10	0.87932	D	0	-28.1433	18.5176	0.90941	0.0:1.0:0.0:0.0	.	150;254;254	B7Z2C3;A8MX49;P49593	.;.;PPM1F_HUMAN	V	254;86;86;150;254;86	ENSP00000263212:G254V;ENSP00000384930:G86V;ENSP00000439915:G150V;ENSP00000380632:G254V;ENSP00000392372:G86V	ENSP00000263212:G254V	G	-	2	0	PPM1F	20615650	1.000000	0.71417	0.996000	0.52242	0.955000	0.61496	7.567000	0.82357	2.700000	0.92200	0.561000	0.74099	GGC		0.627	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320267.2	NM_014634		Missense_Mutation
NEFH	4744	broad.mit.edu	37	22	29879555	29879555	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr22:29879555T>A	ENST00000310624.6	+	2	1108	c.1075T>A	c.(1075-1077)Tcc>Acc	p.S359T		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	359	Coil 2B.|Rod.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.S359T(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CGACATTGCCTCCTACCAGGT	0.602																																																1	Substitution - Missense(1)	ovary(1)	22											58.0	43.0	48.0					22																	29879555		2203	4300	6503	28209555	SO:0001583	missense	4744				CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1075T>A	22.37:g.29879555T>A	ENSP00000311997:p.Ser359Thr		28209555	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	14.45	2.539754	0.45176	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.88741	-2.42	5.3	5.3	0.74995	Filament (1);	0.000000	0.47852	D	0.000201	D	0.92453	0.7604	M	0.62723	1.935	0.38711	D	0.953214	D	0.64830	0.994	D	0.66716	0.946	D	0.93671	0.6990	10	0.72032	D	0.01	.	12.0063	0.53261	0.0:0.0:0.1442:0.8558	.	359	P12036	NFH_HUMAN	T	359	ENSP00000311997:S359T	ENSP00000311997:S359T	S	+	1	0	NEFH	28209555	0.972000	0.33761	0.941000	0.38009	0.941000	0.58515	1.777000	0.38604	2.228000	0.72767	0.528000	0.53228	TCC		0.602	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076		Missense_Mutation
ACAD9	28976	broad.mit.edu	37	3	128628866	128628866	+	Silent	SNP	C	C	G	rs377418003		TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr3:128628866C>G	ENST00000308982.7	+	16	1647	c.1566C>G	c.(1564-1566)acC>acG	p.T522T	RP11-723O4.6_ENST00000508239.1_3'UTR|ACAD9_ENST00000511526.1_3'UTR|KIAA1257_ENST00000511438.1_3'UTR	NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	522						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.T522T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						GATCCCAGACCATCATGGAGG	0.602																																																1	Substitution - coding silent(1)	ovary(1)	3											54.0	52.0	53.0					3																	128628866		2203	4300	6503	130111556	SO:0001819	synonymous_variant	28976			AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.1566C>G	3.37:g.128628866C>G			130111556	D3DNB8|Q8WXX3	Silent	SNP	ENST00000308982.7	37	CCDS3053.1	SNP	21	Broad																																																																																				0.602	ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358405.1	NM_014049		Silent
PCDH18	54510	broad.mit.edu	37	4	138451981	138451981	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr4:138451981G>T	ENST00000344876.4	-	1	1648	c.1262C>A	c.(1261-1263)gCc>gAc	p.A421D	PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.A421D|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000507846.1_Missense_Mutation_p.A201D	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	421	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A421D(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					ATCCAGTGTGGCATTAGTTAA	0.378																																																1	Substitution - Missense(1)	ovary(1)	4											122.0	128.0	126.0					4																	138451981		2203	4300	6503	138671431	SO:0001583	missense	54510			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1262C>A	4.37:g.138451981G>T	ENSP00000355082:p.Ala421Asp		138671431	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	CCDS34064.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	16.78	3.216698	0.58452	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.52754	0.65;0.65;0.65	6.03	6.03	0.97812	Cadherin (4);Cadherin-like (1);	0.000000	0.43110	D	0.000620	T	0.52354	0.1729	L	0.44542	1.39	0.80722	D	1	B;P;P	0.48230	0.452;0.907;0.728	P;P;B	0.51193	0.493;0.662;0.424	T	0.27226	-1.0080	10	0.12103	T	0.63	.	20.5752	0.99366	0.0:0.0:1.0:0.0	.	201;421;421	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	D	421;421;201	ENSP00000355082:A421D;ENSP00000390688:A421D;ENSP00000425903:A201D	ENSP00000355082:A421D	A	-	2	0	PCDH18	138671431	1.000000	0.71417	0.999000	0.59377	0.740000	0.42216	6.182000	0.71995	2.868000	0.98415	0.557000	0.71058	GCC		0.378	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035		Missense_Mutation
C7	730	broad.mit.edu	37	5	40981517	40981517	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr5:40981517C>T	ENST00000313164.9	+	18	2733	c.2374C>T	c.(2374-2376)Cga>Tga	p.R792*		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	792	Factor I module (FIM) 2.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.R792*(1)					Ovarian(839;0.0112)				ATGTGTCTGCCGAGAAGCATC	0.502																																																1	Substitution - Nonsense(1)	ovary(1)	5											54.0	55.0	54.0					5																	40981517		2070	4203	6273	41017274	SO:0001587	stop_gained	730			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.2374C>T	5.37:g.40981517C>T	ENSP00000322061:p.Arg792*		41017274	Q6P3T5|Q92489	Nonsense_Mutation	SNP	ENST00000313164.9	37	CCDS47201.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	42	9.517932	0.99193	.	.	ENSG00000112936	ENST00000313164	.	.	.	5.83	1.47	0.22746	.	0.462043	0.21307	N	0.076703	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.0824	9.8439	0.41015	0.4699:0.381:0.149:0.0	.	.	.	.	X	792	.	ENSP00000322061:R792X	R	+	1	2	C7	41017274	0.896000	0.30565	0.996000	0.52242	0.982000	0.71751	0.108000	0.15396	0.241000	0.21283	0.563000	0.77884	CGA		0.502	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			Nonsense_Mutation
CCL28	56477	broad.mit.edu	37	5	43381982	43381982	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr5:43381982C>T	ENST00000361115.4	-	3	438	c.364G>A	c.(364-366)Ggc>Agc	p.G122S	CCL28_ENST00000513525.1_Missense_Mutation_p.G75S	NM_148672.2	NP_683513.1	Q9NRJ3	CCL28_HUMAN	chemokine (C-C motif) ligand 28	122					cell chemotaxis (GO:0060326)|chemotaxis (GO:0006935)|immune response (GO:0006955)|negative regulation of leukocyte tethering or rolling (GO:1903237)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	chemokine activity (GO:0008009)	p.G122S(1)		kidney(3)|lung(3)|ovary(1)	7						GTTTTATGGCCGTATGTTTCG	0.413																																					Esophageal Squamous(178;1549 1997 2043 22794 27051)											1	Substitution - Missense(1)	ovary(1)	5											291.0	264.0	273.0					5																	43381982		2203	4300	6503	43417739	SO:0001583	missense	56477			AF110384	CCDS3944.1	5p12	2013-02-25			ENSG00000151882	ENSG00000151882		"""Chemokine ligands"", ""Endogenous ligands"""	17700	protein-coding gene	gene with protein product	"""CC chemokine CCL28"", ""mucosae-associated epithelial chemokine"", ""small inducible cytokine subfamily A (Cys-Cys), member 28"", ""small inducible cytokine A28"""	605240				10781587, 11295038	Standard	XR_241707		Approved	SCYA28, MEC, CCK1	uc003jnu.3	Q9NRJ3	OTTHUMG00000094811	ENST00000361115.4:c.364G>A	5.37:g.43381982C>T	ENSP00000354416:p.Gly122Ser		43417739	D7RIE7	Missense_Mutation	SNP	ENST00000361115.4	37	CCDS3944.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	11.33	1.605969	0.28623	.	.	ENSG00000151882	ENST00000361115;ENST00000513525	T;T	0.45668	1.39;0.89	4.99	2.2	0.27929	.	1.281610	0.05413	N	0.542883	T	0.21881	0.0527	N	0.12182	0.205	0.09310	N	1	P	0.38195	0.622	B	0.24848	0.056	T	0.16070	-1.0415	10	0.34782	T	0.22	-0.5687	7.5798	0.27959	0.0:0.7291:0.0:0.2709	.	122	Q9NRJ3	CCL28_HUMAN	S	122;75	ENSP00000354416:G122S;ENSP00000422369:G75S	ENSP00000354416:G122S	G	-	1	0	CCL28	43417739	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.126000	0.10563	0.359000	0.24239	-0.145000	0.13849	GGC		0.413	CCL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211631.2	NM_148672		Missense_Mutation
PPP2CA	5515	broad.mit.edu	37	5	133541780	133541780	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr5:133541780G>A	ENST00000481195.1	-	2	425	c.145C>T	c.(145-147)Cga>Tga	p.R49*	PPP2CA_ENST00000231504.5_5'UTR|CDKL3_ENST00000609654.1_Nonsense_Mutation_p.R399*|CDKL3_ENST00000609383.1_3'UTR|CTD-2410N18.4_ENST00000518409.1_RNA|CTD-2410N18.5_ENST00000519718.1_Intron	NM_002715.2	NP_002706.1	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha isozyme	49					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|meiotic nuclear division (GO:0007126)|mesoderm development (GO:0007498)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein dephosphorylation (GO:0006470)|protein heterotrimerization (GO:0070208)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of protein autophosphorylation (GO:0031952)|regulation of protein catabolic process (GO:0042176)|regulation of receptor activity (GO:0010469)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.R49*(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	ACTGGACATCGAACCTCTTGC	0.378																																																1	Substitution - Nonsense(1)	ovary(1)	5											154.0	136.0	142.0					5																	133541780		2203	4300	6503	133569679	SO:0001587	stop_gained	5515				CCDS4173.1	5q31.1	2013-01-24	2010-03-05		ENSG00000113575	ENSG00000113575	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9299	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, alpha isoform"""	176915	"""protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform"""			8383590	Standard	NM_002715		Approved	PP2Calpha		P67775	OTTHUMG00000129119	ENST00000481195.1:c.145C>T	5.37:g.133541780G>A	ENSP00000418447:p.Arg49*		133569679	P05323|P13197	Nonsense_Mutation	SNP	ENST00000481195.1	37	CCDS4173.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	37	6.174370	0.97348	.	.	ENSG00000113575	ENST00000481195;ENST00000523082	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-3.2523	19.3944	0.94601	0.0:0.0:1.0:0.0	.	.	.	.	X	49;36	.	ENSP00000418447:R49X	R	-	1	2	PPP2CA	133569679	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.333000	0.72939	2.665000	0.90641	0.591000	0.81541	CGA		0.378	PPP2CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251165.1	NM_002715		Nonsense_Mutation
SAP30L	79685	broad.mit.edu	37	5	153833055	153833055	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr5:153833055G>T	ENST00000297109.6	+	3	1066	c.418G>T	c.(418-420)Gca>Tca	p.A140S	SAP30L_ENST00000426761.2_Missense_Mutation_p.A94S|SAP30L_ENST00000440364.2_Missense_Mutation_p.A99S|SAP30L_ENST00000523198.1_3'UTR	NM_024632.5	NP_078908.1	Q9HAJ7	SP30L_HUMAN	SAP30-like	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|lung(3)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			GGCCCAGTTAGCAGAAGTAGG	0.473																																																0			5											98.0	89.0	92.0					5																	153833055		2203	4300	6503	153813248	SO:0001583	missense	79685			AY341060	CCDS4326.1, CCDS47321.1, CCDS47322.1	5q33.2	2008-02-05			ENSG00000164576	ENSG00000164576			25663	protein-coding gene	gene with protein product		610398				14680513	Standard	NM_001131062		Approved	FLJ11526, NS4ATP2	uc003lvk.3	Q9HAJ7	OTTHUMG00000130146	ENST00000297109.6:c.418G>T	5.37:g.153833055G>T	ENSP00000297109:p.Ala140Ser		153813248	E9PAU7|E9PAY2	Missense_Mutation	SNP	ENST00000297109.6	37	CCDS4326.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.593951	0.96602	.	.	ENSG00000164576	ENST00000297109;ENST00000440364;ENST00000426761	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.78773	0.4336	M	0.67700	2.07	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.99	D;D;P	0.80764	0.994;0.994;0.818	T	0.78380	-0.2226	9	0.51188	T	0.08	-25.4221	19.5581	0.95361	0.0:0.0:1.0:0.0	.	94;99;140	E9PAY2;E9PAU7;Q9HAJ7	.;.;SP30L_HUMAN	S	140;99;94	.	ENSP00000297109:A140S	A	+	1	0	SAP30L	153813248	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.640000	0.98453	2.614000	0.88457	0.655000	0.94253	GCA		0.473	SAP30L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252454.3	NM_024632		Missense_Mutation
FIG4	9896	broad.mit.edu	37	6	110118031	110118031	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr6:110118031G>T	ENST00000230124.3	+	22	2647	c.2523G>T	c.(2521-2523)agG>agT	p.R841S	FIG4_ENST00000441478.2_Intron	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	841					cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)	p.R841S(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		CCTGTTCTAGGTGCTCAGATG	0.368																																																1	Substitution - Missense(1)	ovary(1)	6											114.0	115.0	114.0					6																	110118031		2203	4300	6503	110224724	SO:0001583	missense	9896			D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.2523G>T	6.37:g.110118031G>T	ENSP00000230124:p.Arg841Ser		110224724	Q53H49|Q5TCS6	Missense_Mutation	SNP	ENST00000230124.3	37	CCDS5078.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	12.21	1.870200	0.33069	.	.	ENSG00000112367	ENST00000230124	T	0.54071	0.59	4.98	4.1	0.47936	.	0.782790	0.11898	N	0.518944	T	0.12092	0.0294	N	0.08118	0	0.80722	D	1	B	0.12630	0.006	B	0.11329	0.006	T	0.25813	-1.0121	10	0.14656	T	0.56	-10.1955	5.8269	0.18558	0.1916:0.0:0.6554:0.153	.	841	Q92562	FIG4_HUMAN	S	841	ENSP00000230124:R841S	ENSP00000230124:R841S	R	+	3	2	FIG4	110224724	0.929000	0.31497	0.998000	0.56505	0.975000	0.68041	1.658000	0.37376	1.209000	0.43321	0.655000	0.94253	AGG		0.368	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1	NM_014845		Missense_Mutation
FAM214B	80256	broad.mit.edu	37	9	35106541	35106541	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr9:35106541G>C	ENST00000378561.1	-	4	4108	c.1053C>G	c.(1051-1053)aaC>aaG	p.N351K	FAM214B_ENST00000603301.1_Missense_Mutation_p.N351K|FAM214B_ENST00000322813.5_Missense_Mutation_p.N351K|FAM214B_ENST00000488109.2_Missense_Mutation_p.N351K|FAM214B_ENST00000378554.2_Missense_Mutation_p.N351K|FAM214B_ENST00000378557.1_Missense_Mutation_p.N351K|FAM214B_ENST00000605392.1_5'Flank|FAM214B_ENST00000605244.1_Missense_Mutation_p.N351K|FAM214B_ENST00000378566.1_Missense_Mutation_p.N46K			Q7L5A3	F214B_HUMAN	family with sequence similarity 214, member B	351						nucleus (GO:0005634)											CTACCTCAAAGTTGCCCAGCA	0.617																																																0			9											16.0	20.0	19.0					9																	35106541		2196	4296	6492	35096541	SO:0001583	missense	80256			AB040972	CCDS6578.1	9p13.2	2011-12-01	2011-12-01	2011-12-01	ENSG00000005238	ENSG00000005238			25666	protein-coding gene	gene with protein product			"""KIAA1539"""	KIAA1539		10819331	Standard	NM_025182		Approved	FLJ11560, bA182N22.6	uc003zwo.3	Q7L5A3	OTTHUMG00000019847	ENST00000378561.1:c.1053C>G	9.37:g.35106541G>C	ENSP00000367823:p.Asn351Lys		35096541	B1AML4|B1AML5|D3DRN5|O60377|Q9BQ60|Q9HAI9|Q9P1Y9	Missense_Mutation	SNP	ENST00000378561.1	37	CCDS6578.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257137	0.59321	.	.	ENSG00000005238	ENST00000378566;ENST00000322813;ENST00000378561;ENST00000378557;ENST00000378554	.	.	.	5.38	4.47	0.54385	.	0.043367	0.85682	D	0.000000	T	0.70745	0.3259	M	0.67700	2.07	0.49389	D	0.99978	D	0.76494	0.999	D	0.69824	0.966	T	0.72541	-0.4262	9	0.87932	D	0	-22.9186	10.9227	0.47174	0.1379:0.0:0.8621:0.0	.	351	Q7L5A3	K1539_HUMAN	K	46;351;351;351;351	.	ENSP00000319897:N351K	N	-	3	2	KIAA1539	35096541	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.372000	0.52387	2.813000	0.96785	0.655000	0.94253	AAC		0.617	FAM214B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052261.1	NM_025182		Missense_Mutation
ASTN2	23245	broad.mit.edu	37	9	119976858	119976858	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chr9:119976858C>T	ENST00000313400.4	-	3	894	c.794G>A	c.(793-795)cGg>cAg	p.R265Q	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.R265Q|ASTN2_ENST00000361209.2_Missense_Mutation_p.R265Q			O75129	ASTN2_HUMAN	astrotactin 2	265					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.R265Q(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GAAGCTCTCCCGCGCCTGGGG	0.597																																																1	Substitution - Missense(1)	ovary(1)	9											84.0	75.0	78.0					9																	119976858		2203	4300	6503	119016679	SO:0001583	missense	23245			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.794G>A	9.37:g.119976858C>T	ENSP00000314038:p.Arg265Gln		119016679	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	18.17	3.565489	0.65651	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.24350	2.03;2.02;1.86	5.51	4.6	0.57074	.	0.081526	0.49305	D	0.000150	T	0.36248	0.0960	N	0.24115	0.695	0.44117	D	0.99689	D;D;D	0.89917	0.999;0.996;1.0	D;P;D	0.77557	0.99;0.575;0.968	T	0.10776	-1.0615	9	.	.	.	-19.6359	15.8965	0.79338	0.0:0.864:0.136:0.0	.	265;265;265	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	Q	265	ENSP00000314038:R265Q;ENSP00000363108:R265Q;ENSP00000354504:R265Q	.	R	-	2	0	ASTN2	119016679	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.867000	0.69597	1.298000	0.44778	0.655000	0.94253	CGG		0.597	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		Missense_Mutation
ZNF41	7592	broad.mit.edu	37	X	47308183	47308183	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chrX:47308183C>A	ENST00000377065.4	-	5	1625	c.986G>T	c.(985-987)tGt>tTt	p.C329F	ZNF41_ENST00000313116.7_Missense_Mutation_p.C329F|ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000397050.2_Missense_Mutation_p.C339F	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	371					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				ACATTGAGTACACAGATAGGG	0.408																																																0			X											63.0	64.0	64.0					X																	47308183		2203	4292	6495	47193127	SO:0001583	missense	7592			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.986G>T	X.37:g.47308183C>A	ENSP00000366265:p.Cys329Phe		47193127	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	ENST00000377065.4	37	CCDS14279.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	15.57	2.873667	0.51695	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	T;T;T	0.39229	1.09;1.09;1.09	3.53	2.66	0.31614	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35805	N	0.002975	T	0.73001	0.3531	H	0.98218	4.175	0.23747	N	0.996956	D;D;D;D;D	0.89917	0.999;0.999;0.995;0.999;1.0	D;D;P;D;D	0.79108	0.985;0.985;0.826;0.985;0.992	T	0.65977	-0.6037	10	0.87932	D	0	.	8.3631	0.32369	0.0:0.8753:0.0:0.1247	.	329;331;339;363;371	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	F	329;329;339	ENSP00000315173:C329F;ENSP00000366265:C329F;ENSP00000380243:C339F	ENSP00000315173:C329F	C	-	2	0	ZNF41	47193127	1.000000	0.71417	0.003000	0.11579	0.005000	0.04900	6.735000	0.74806	0.872000	0.35775	0.594000	0.82650	TGT		0.408	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056429.1	NM_153380		Missense_Mutation
PJA1	64219	broad.mit.edu	37	X	68381193	68381193	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chrX:68381193C>A	ENST00000361478.1	-	2	2266	c.1889G>T	c.(1888-1890)gGc>gTc	p.G630V	PJA1_ENST00000374584.3_Missense_Mutation_p.G442V|PJA1_ENST00000477231.1_5'Flank|PJA1_ENST00000374571.4_Missense_Mutation_p.G575V|PJA1_ENST00000374583.1_Missense_Mutation_p.G630V	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	630					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G630D(1)|p.G442D(1)|p.G442V(1)		endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						GGGGCAGGTGCCTGACTTCTG	0.537																																																3	Substitution - Missense(3)	large_intestine(2)|ovary(1)	X											51.0	41.0	44.0					X																	68381193		2203	4300	6503	68297918	SO:0001583	missense	64219			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.1889G>T	X.37:g.68381193C>A	ENSP00000355014:p.Gly630Val		68297918	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	ENST00000361478.1	37	CCDS14393.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	11.74	1.728818	0.30593	.	.	ENSG00000181191	ENST00000396010;ENST00000374584;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	3.68	3.68	0.42216	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.132235	0.33127	U	0.005257	T	0.67543	0.2904	L	0.31294	0.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.71414	-0.4600	10	0.87932	D	0	-12.9359	12.5562	0.56254	0.0:1.0:0.0:0.0	.	630;442	Q8NG27;Q8NG27-2	PJA1_HUMAN;.	V	545;442;630;630;575	ENSP00000363712:G442V;ENSP00000363711:G630V;ENSP00000355014:G630V;ENSP00000363699:G575V	ENSP00000355014:G630V	G	-	2	0	PJA1	68297918	1.000000	0.71417	0.995000	0.50966	0.011000	0.07611	4.683000	0.61679	2.115000	0.64714	0.544000	0.68410	GGC		0.537	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119		Missense_Mutation
TEX13A	56157	broad.mit.edu	37	X	104464292	104464292	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2271-01	TCGA-24-2271-10	g.chrX:104464292C>G	ENST00000413579.1	-	3	697	c.586G>C	c.(586-588)Gag>Cag	p.E196Q	TEX13A_ENST00000372575.1_Missense_Mutation_p.E196Q|IL1RAPL2_ENST00000372582.1_Intron|TEX13A_ENST00000372578.3_Missense_Mutation_p.E196Q|IL1RAPL2_ENST00000344799.4_Intron			Q9BXU3	TX13A_HUMAN	testis expressed 13A	196							zinc ion binding (GO:0008270)	p.E196Q(1)		large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						CCCCTCTGCTCTTCTTCTGCT	0.652																																																1	Substitution - Missense(1)	ovary(1)	X											23.0	26.0	25.0					X																	104464292		2092	4131	6223	104350948	SO:0001583	missense	56157			AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.586G>C	X.37:g.104464292C>G	ENSP00000399753:p.Glu196Gln		104350948	B1B1G8|Q32NB6	Missense_Mutation	SNP	ENST00000413579.1	37		SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.622647	0.00820	.	.	ENSG00000133149	ENST00000372578;ENST00000372575;ENST00000413579	.	.	.	1.69	-3.39	0.04868	.	1.807170	0.03666	N	0.243298	T	0.27134	0.0665	.	.	.	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.07966	-1.0745	8	0.34782	T	0.22	.	3.9763	0.09476	0.0:0.3334:0.3416:0.325	.	196;196	C9JWK0;Q9BXU3	.;TX13A_HUMAN	Q	196	.	ENSP00000361656:E196Q	E	-	1	0	TEX13A	104350948	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.013000	0.03645	-2.080000	0.00870	-0.735000	0.03563	GAG		0.652	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_031274		Missense_Mutation
NEK8	284086	broad.mit.edu	37	17	27064673	27064710	+	Splice_Site	DEL	GGCCCCCATCTGTCCTGCAGGGCAGAGAAGTCCGTGGC	GGCCCCCATCTGTCCTGCAGGGCAGAGAAGTCCGTGGC	-	rs369911992|rs547832553		TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-2271-01	TCGA-24-2271-10	g.chr17:27064673_27064710delGGCCCCCATCTGTCCTGCAGGGCAGAGAAGTCCGTGGC	ENST00000268766.6	+	6	861_879	c.827_845delGGCCCCCATCTGTCCTGCAGGGCAGAGAAGTCCGTGGC	c.(826-846)aggcccccatctgtcctgcag>ag	p.RPPSVLQ276fs	AC010761.6_ENST00000584779.1_RNA	NM_178170.2	NP_835464.1	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	276					organ morphogenesis (GO:0009887)|regulation of hippo signaling (GO:0035330)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|primary cilium (GO:0072372)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Lung NSC(42;0.0158)					TTTGTCCTTAGGCCCCCATCTGTCCTGCAGGGCAGAGAAGTCCGTGGCCCCCAGCAAC	0.605																																					NSCLC(6;19 293 14866 25253 49845)											0			17																																								24088837	SO:0001630	splice_region_variant	284086			AY267371	CCDS32597.1	17q11.1	2012-11-15	2012-11-15			ENSG00000160602			13387	protein-coding gene	gene with protein product		609799	"""NIMA (never in mitosis gene a)- related kinase 8"""			18199800	Standard	NM_178170		Approved	NPHP9	uc002hcp.3	Q86SG6		ENST00000268766.6:c.828-1GGCCCCCATCTGTCCTGCAGGGCAGAGAAGTCCGTGGC>-	17.37:g.27064673_27064710delGGCCCCCATCTGTCCTGCAGGGCAGAGAAGTCCGTGGC			24088800	A6NIC5|Q14CL7|Q2M1S6|Q8NDH1	Splice_Site_Del	DEL	ENST00000268766.6	37	CCDS32597.1	DEL	35	Broad																																																																																				0.605	NEK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446467.2		Frame_Shift_Del	Splice_Site_Del
CTSL	1514	broad.mit.edu	37	9	90343265	90343265	+	Frame_Shift_Del	DEL	C	C	-	rs76801214	byFrequency	TCGA-24-2271-01	TCGA-24-2271-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-2271-01	TCGA-24-2271-10	g.chr9:90343265delC	ENST00000343150.5	+	4	1240	c.350delC	c.(349-351)tctfs	p.S117fs	CTSL_ENST00000342020.5_Frame_Shift_Del_p.S117fs|CTSL_ENST00000495822.1_Intron|CTSL_ENST00000340342.6_Frame_Shift_Del_p.S117fs			P07711	CATL1_HUMAN	cathepsin L	117					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)	p.S117fs*10(1)									GCCCCCAGATCTGTGGATTGG	0.498																																																1	Deletion - Frameshift(1)	ovary(1)	9											65.0	62.0	63.0					9																	90343265		2203	4300	6503	89533085	SO:0001589	frameshift_variant	1514			X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.350delC	9.37:g.90343265delC	ENSP00000345344:p.Ser117fs		89533085	Q6IAV1|Q96QJ0	Frame_Shift_Del	DEL	ENST00000343150.5	37	CCDS6675.1	DEL	32	Broad																																																																																				0.498	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052936.1	NM_001912		Frame_Shift_Del
