#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PRAMEF10	343071	broad.mit.edu	37	1	12954564	12954564	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:12954564G>T	ENST00000235347.4	-	3	798	c.719C>A	c.(718-720)gCc>gAc	p.A240D		NM_001039361.3	NP_001034450.2	O60809	PRA10_HUMAN	PRAME family member 10	240					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.A240D(1)		NS(2)|breast(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATAACCGAAGGCTAAAAAGAG	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											124.0	90.0	101.0					1																	12954564		1915	4091	6006	12877151	SO:0001583	missense	343071			AL049682	CCDS41255.1	1p36.21	2013-01-17			ENSG00000187545	ENSG00000187545		"""-"""	27997	protein-coding gene	gene with protein product							Standard	NM_001039361		Approved		uc001auo.3	O60809	OTTHUMG00000001981	ENST00000235347.4:c.719C>A	1.37:g.12954564G>T	ENSP00000235347:p.Ala240Asp		12877151	Q2M1V2	Missense_Mutation	SNP	ENST00000235347.4	37	CCDS41255.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	.	9.086	1.000586	0.19121	.	.	ENSG00000187545	ENST00000235347	T	0.16073	2.37	1.08	1.08	0.20341	.	1.589470	0.03447	N	0.210089	T	0.10680	0.0261	N	0.11064	0.09	0.09310	N	1	P	0.44429	0.835	B	0.41946	0.371	T	0.20538	-1.0272	10	0.35671	T	0.21	.	5.5582	0.17129	0.0:0.0:1.0:0.0	.	240	O60809	PRA10_HUMAN	D	240	ENSP00000235347:A240D	ENSP00000235347:A240D	A	-	2	0	PRAMEF10	12877151	0.002000	0.14202	0.001000	0.08648	0.046000	0.14306	1.316000	0.33620	0.889000	0.36185	0.194000	0.17425	GCC		0.488	PRAMEF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005512.2	XM_496342		Missense_Mutation
EIF4G3	8672	broad.mit.edu	37	1	21177859	21177859	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:21177859G>C	ENST00000264211.8	-	22	3690	c.3496C>G	c.(3496-3498)Caa>Gaa	p.Q1166E	EIF4G3_ENST00000374937.3_Missense_Mutation_p.Q1172E|EIF4G3_ENST00000400422.1_Missense_Mutation_p.Q1166E|EIF4G3_ENST00000537738.1_Missense_Mutation_p.Q656E|EIF4G3_ENST00000374935.3_Missense_Mutation_p.Q886E|EIF4G3_ENST00000536266.1_Missense_Mutation_p.Q770E|EIF4G3_ENST00000602326.1_Missense_Mutation_p.Q1172E	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1166					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.Q1166E(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TGCTCTTCTTGAGACTGATTG	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											137.0	127.0	130.0					1																	21177859		2203	4300	6503	21050446	SO:0001583	missense	8672			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.3496C>G	1.37:g.21177859G>C	ENSP00000264211:p.Gln1166Glu		21050446	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586878	0.66105	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	T;T;T;T;T;T	0.06294	3.87;3.87;3.69;3.32;3.86;3.56	5.73	5.73	0.89815	.	0.309371	0.35739	N	0.003003	T	0.10937	0.0267	N	0.19112	0.55	0.80722	D	1	D;P;B;P;P	0.60160	0.987;0.761;0.012;0.865;0.863	P;B;B;P;B	0.54706	0.53;0.277;0.016;0.759;0.428	T	0.10660	-1.0620	10	0.45353	T	0.12	-12.5223	18.0733	0.89419	0.0:0.0:1.0:0.0	.	1361;886;770;1172;1166	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	E	1166;1362;1166;886;656;1172;770	ENSP00000264211:Q1166E;ENSP00000383274:Q1166E;ENSP00000364071:Q886E;ENSP00000442010:Q656E;ENSP00000364073:Q1172E;ENSP00000444693:Q770E	ENSP00000264211:Q1166E	Q	-	1	0	EIF4G3	21050446	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.351000	0.90072	2.713000	0.92767	0.591000	0.81541	CAA		0.527	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760		Missense_Mutation
EPB41	2035	broad.mit.edu	37	1	29435908	29435908	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:29435908T>C	ENST00000343067.4	+	18	2501	c.2374T>C	c.(2374-2376)Tct>Cct	p.S792P	EPB41_ENST00000398863.2_Missense_Mutation_p.S695P|EPB41_ENST00000356093.2_Missense_Mutation_p.S759P|EPB41_ENST00000373800.3_Intron|EPB41_ENST00000373798.1_Missense_Mutation_p.S792P|EPB41_ENST00000347529.3_Missense_Mutation_p.S703P|EPB41_ENST00000349460.4_Missense_Mutation_p.S569P|EPB41_ENST00000460378.1_3'UTR	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	792	C-terminal (CTD).				actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.S569P(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		AACTATCACATCTGAGACCCC	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											153.0	131.0	139.0					1																	29435908		2203	4300	6503	29308495	SO:0001583	missense	2035			BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.2374T>C	1.37:g.29435908T>C	ENSP00000345259:p.Ser792Pro		29308495	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Missense_Mutation	SNP	ENST00000343067.4	37	CCDS53288.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	29.7	5.029491	0.93518	.	.	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000349460;ENST00000347529;ENST00000373798	T;T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27;-1.27	5.22	5.22	0.72569	Band 4.1, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89079	0.6613	M	0.87827	2.91	0.58432	D	0.999997	D;D;D;D;D;D;D	0.76494	0.998;0.996;0.993;0.998;0.999;0.999;0.976	D;D;P;D;D;D;D	0.91635	0.968;0.982;0.904;0.981;0.989;0.999;0.937	D	0.90880	0.4753	10	0.72032	D	0.01	.	14.2635	0.66099	0.0:0.0:0.0:1.0	.	632;695;792;759;755;703;569	E9PEX0;E9PEW9;P11171;P11171-2;Q59F12;P11171-5;P11171-3	.;.;41_HUMAN;.;.;.;.	P	755;792;759;695;632;569;703;792	ENSP00000345259:S792P;ENSP00000348397:S759P;ENSP00000381839:S695P;ENSP00000317597:S569P;ENSP00000290100:S703P;ENSP00000362904:S792P	ENSP00000345259:S792P	S	+	1	0	EPB41	29308495	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.680000	0.84062	2.097000	0.63578	0.529000	0.55759	TCT		0.512	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010312.1	NM_203342		Missense_Mutation
HPCA	3208	broad.mit.edu	37	1	33354857	33354857	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:33354857G>C	ENST00000373467.3	+	2	460	c.358G>C	c.(358-360)Gag>Cag	p.E120Q	HPCA_ENST00000480118.1_3'UTR	NM_002143.2	NP_002134.2	P84074	HPCA_HUMAN	hippocalcin	120	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				inner ear development (GO:0048839)		actin binding (GO:0003779)|calcium ion binding (GO:0005509)	p.E120Q(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				CAGCCGGGAGGAGATGCTGGA	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											41.0	40.0	40.0					1																	33354857		2203	4299	6502	33127444	SO:0001583	missense	3208			BC001777	CCDS370.1	1p35-p34.2	2013-01-10			ENSG00000121905	ENSG00000121905		"""EF-hand domain containing"""	5144	protein-coding gene	gene with protein product		142622				8166736, 9931466	Standard	NM_002143		Approved		uc001bwh.3	P84074	OTTHUMG00000004017	ENST00000373467.3:c.358G>C	1.37:g.33354857G>C	ENSP00000362566:p.Glu120Gln		33127444	B2R9T3|D3DPQ7|P32076|P41211|P70510	Missense_Mutation	SNP	ENST00000373467.3	37	CCDS370.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.151978	0.94645	.	.	ENSG00000121905	ENST00000373467	T	0.79940	-1.32	5.75	5.75	0.90469	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.93406	0.7897	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94728	0.7907	10	0.87932	D	0	.	18.8942	0.92417	0.0:0.0:1.0:0.0	.	120	P84074	HPCA_HUMAN	Q	120	ENSP00000362566:E120Q	ENSP00000362566:E120Q	E	+	1	0	HPCA	33127444	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.777000	0.99008	2.894000	0.99253	0.655000	0.94253	GAG		0.647	HPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011480.1	NM_002143		Missense_Mutation
TRIT1	54802	broad.mit.edu	37	1	40318530	40318530	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:40318530C>T	ENST00000316891.5	-	4	447	c.433G>A	c.(433-435)Gag>Aag	p.E145K	TRIT1_ENST00000441669.2_Missense_Mutation_p.E65K|TRIT1_ENST00000545233.1_Intron|TRIT1_ENST00000491865.1_Intron|TRIT1_ENST00000541099.1_Intron|TRIT1_ENST00000372818.1_Missense_Mutation_p.E145K|TRIT1_ENST00000544981.1_Intron|TRIT1_ENST00000537440.1_Intron|TRIT1_ENST00000537223.1_Intron	NM_017646.4	NP_060116.2	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1	145					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|tRNA dimethylallyltransferase activity (GO:0052381)	p.E145K(1)		breast(1)|large_intestine(5)|liver(1)|lung(3)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(1)	15	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			ATCACTTTCTCAGTGCCCATC	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											209.0	196.0	201.0					1																	40318530		2203	4300	6503	40091117	SO:0001583	missense	54802			AF074918	CCDS30681.1	1p34.2	2012-10-05			ENSG00000043514	ENSG00000043514	2.5.1.8		20286	protein-coding gene	gene with protein product						11111046, 15870694	Standard	NM_017646		Approved	FLJ20061, IPT	uc021olz.1	Q9H3H1	OTTHUMG00000009245	ENST00000316891.5:c.433G>A	1.37:g.40318530C>T	ENSP00000321810:p.Glu145Lys		40091117	A1A4X7|Q3T7B5|Q5QPK5|Q5QPK6|Q6IAC9|Q96FJ3|Q96L45|Q9NXT7	Missense_Mutation	SNP	ENST00000316891.5	37	CCDS30681.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	10.98	1.505878	0.26949	.	.	ENSG00000043514	ENST00000046894;ENST00000372825;ENST00000441669;ENST00000316891;ENST00000372818	T;T	0.39406	1.08;1.08	4.54	3.62	0.41486	.	0.598021	0.19347	N	0.116501	T	0.27967	0.0689	L	0.35593	1.075	0.80722	D	1	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.10450	0.005;0.003;0.004	T	0.05402	-1.0887	10	0.06625	T	0.88	-5.0E-4	11.4924	0.50389	0.0:0.9149:0.0:0.0851	.	145;145;65	Q9H3H1;Q9H3H1-4;Q9H3H1-5	MOD5_HUMAN;.;.	K	145;65;59;145;145	ENSP00000321810:E145K;ENSP00000361905:E145K	ENSP00000046894:E145K	E	-	1	0	TRIT1	40091117	0.007000	0.16637	0.483000	0.27378	0.670000	0.39368	2.140000	0.42159	1.245000	0.43885	0.467000	0.42956	GAG		0.458	TRIT1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025627.2	NM_017646		Missense_Mutation
TIE1	7075	broad.mit.edu	37	1	43786953	43786953	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:43786953G>T	ENST00000372476.3	+	20	3200	c.3121G>T	c.(3121-3123)Gtc>Ttc	p.V1041F	TIE1_ENST00000433781.2_Missense_Mutation_p.V686F	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	1041	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V1041F(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GTCCTTTGGAGTCCTTCTTTG	0.552																																																1	Substitution - Missense(1)	ovary(1)	1											283.0	243.0	257.0					1																	43786953		2203	4300	6503	43559540	SO:0001583	missense	7075			BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.3121G>T	1.37:g.43786953G>T	ENSP00000361554:p.Val1041Phe		43559540	B5A949|B5A950	Missense_Mutation	SNP	ENST00000372476.3	37	CCDS482.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	25.6	4.652519	0.88056	.	.	ENSG00000066056	ENST00000372476;ENST00000372475;ENST00000536913;ENST00000433781	D;D	0.87179	-2.22;-2.22	4.88	4.88	0.63580	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.33346	N	0.005001	D	0.94522	0.8236	M	0.88241	2.94	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.76071	0.978;0.96;0.987	D	0.95373	0.8466	10	0.87932	D	0	.	18.295	0.90143	0.0:0.0:1.0:0.0	.	996;686;1041	B4DTW8;B4DKW0;P35590	.;.;TIE1_HUMAN	F	1041;444;324;686	ENSP00000361554:V1041F;ENSP00000411728:V686F	ENSP00000361553:V444F	V	+	1	0	TIE1	43559540	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.736000	0.91554	2.568000	0.86640	0.556000	0.70494	GTC		0.552	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424		Missense_Mutation
DPYD	1806	broad.mit.edu	37	1	98293671	98293671	+	Splice_Site	SNP	T	T	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:98293671T>A	ENST00000370192.3	-	3	332	c.232A>T	c.(232-234)Aga>Tga	p.R78*	DPYD_ENST00000306031.5_Splice_Site_p.R78*|DPYD_ENST00000423006.2_Splice_Site_p.R41*	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	78	4Fe-4S ferredoxin-type 1. {ECO:0000255|PROSITE-ProRule:PRU00711}.				beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.R78*(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	CAGACTTACCTCATTGCTTCT	0.408																																																1	Substitution - Nonsense(1)	ovary(1)	1											100.0	88.0	92.0					1																	98293671		2203	4300	6503	98066259	SO:0001630	splice_region_variant	1806			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.233+1A>T	1.37:g.98293671T>A			98066259	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Nonsense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	36	5.747163	0.96882	.	.	ENSG00000188641	ENST00000370192;ENST00000423006;ENST00000306031	.	.	.	5.68	5.68	0.88126	.	0.094728	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.8588	15.9299	0.79651	0.0:0.0:0.0:1.0	.	.	.	.	X	78;41;78	.	ENSP00000307107:R78X	R	-	1	2	DPYD	98066259	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.150000	0.64869	2.162000	0.67917	0.460000	0.39030	AGA		0.408	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	Nonsense_Mutation	Nonsense_Mutation
MYBPHL	343263	broad.mit.edu	37	1	109840103	109840103	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:109840103T>G	ENST00000357155.1	-	3	420	c.371A>C	c.(370-372)cAa>cCa	p.Q124P	MYBPHL_ENST00000477962.1_Intron	NM_001010985.2|NM_001265613.1	NP_001010985.2|NP_001252542.1	A2RUH7	MBPHL_HUMAN	myosin binding protein H-like	124	Ig-like C2-type 1.							p.Q124P(1)		central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(2)	14		all_lung(203;0.00519)|all_epithelial(167;0.00575)|Lung NSC(277;0.00822)		Colorectal(144;0.0306)|Lung(183;0.0681)|COAD - Colon adenocarcinoma(174;0.117)|Epithelial(280;0.197)|all cancers(265;0.225)		CACGCGGAGTTGGTAGCGACC	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											82.0	75.0	77.0					1																	109840103		2203	4300	6503	109641626	SO:0001583	missense	343263			AK129834	CCDS30793.1	1p13	2013-02-11			ENSG00000221986	ENSG00000221986		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	30434	protein-coding gene	gene with protein product							Standard	NM_001010985		Approved		uc001dxk.1	A2RUH7	OTTHUMG00000012002	ENST00000357155.1:c.371A>C	1.37:g.109840103T>G	ENSP00000349678:p.Gln124Pro		109641626	B7ZME5|Q5T2Z7	Missense_Mutation	SNP	ENST00000357155.1	37	CCDS30793.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	17.24	3.338633	0.60963	.	.	ENSG00000221986	ENST00000357155	T	0.42513	0.97	4.92	4.92	0.64577	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.31918	0.0812	M	0.61703	1.905	0.42806	D	0.993946	P	0.42039	0.769	P	0.46885	0.53	T	0.18241	-1.0343	9	0.35671	T	0.21	.	8.0047	0.30319	0.1813:0.0:0.0:0.8187	.	124	A2RUH7	MBPHL_HUMAN	P	124	ENSP00000349678:Q124P	ENSP00000349678:Q124P	Q	-	2	0	MYBPHL	109641626	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	7.320000	0.79064	2.080000	0.62538	0.528000	0.53228	CAA		0.622	MYBPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033197.1	NM_001010985		Missense_Mutation
EPS8L3	79574	broad.mit.edu	37	1	110301262	110301262	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:110301262G>C	ENST00000361965.4	-	7	591	c.485C>G	c.(484-486)cCa>cGa	p.P162R	EPS8L3_ENST00000494151.1_5'UTR|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000361852.4_Missense_Mutation_p.P162R|EPS8L3_ENST00000369805.3_Missense_Mutation_p.P163R	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	162						cytoplasm (GO:0005737)		p.P163R(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		GTCCTGGCCTGGCTGAAGGCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											52.0	51.0	52.0					1																	110301262		2203	4300	6503	110102785	SO:0001583	missense	79574			AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.485C>G	1.37:g.110301262G>C	ENSP00000355255:p.Pro162Arg		110102785	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	CCDS814.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	11.22	1.574032	0.28092	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.59772	2.6;0.25;0.24	5.51	2.42	0.29668	.	1.079620	0.06982	N	0.820071	T	0.30324	0.0761	M	0.71581	2.175	0.09310	N	1	B;B;B;B	0.30763	0.006;0.279;0.294;0.023	B;B;B;B	0.30495	0.004;0.116;0.054;0.007	T	0.30001	-0.9993	10	0.16896	T	0.51	-0.0154	3.9811	0.09495	0.0871:0.1611:0.5851:0.1666	.	162;162;162;163	A8K2J6;Q8TE67-2;Q8TE67;Q8TE67-3	.;.;ES8L3_HUMAN;.	R	162;163;162	ENSP00000354551:P162R;ENSP00000358820:P163R;ENSP00000355255:P162R	ENSP00000354551:P162R	P	-	2	0	EPS8L3	110102785	0.042000	0.20092	0.002000	0.10522	0.458000	0.32498	2.527000	0.45615	0.785000	0.33685	0.655000	0.94253	CCA		0.612	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526		Missense_Mutation
IGSF3	3321	broad.mit.edu	37	1	117122242	117122242	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:117122242C>T	ENST00000369486.3	-	10	3871	c.3106G>A	c.(3106-3108)Gtg>Atg	p.V1036M	IGSF3_ENST00000369483.1_Missense_Mutation_p.V1056M|IGSF3_ENST00000318837.6_Missense_Mutation_p.V1056M	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1036	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.V1036M(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TCTGGGCCCACGCTCAGCAGG	0.652																																																1	Substitution - Missense(1)	ovary(1)	1											36.0	35.0	36.0					1																	117122242		2203	4300	6503	116923765	SO:0001583	missense	3321			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3106G>A	1.37:g.117122242C>T	ENSP00000358498:p.Val1036Met		116923765	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	19.30	3.801804	0.70682	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.22743	1.94;1.94;1.94	4.67	4.67	0.58626	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.395384	0.26258	N	0.025407	T	0.17280	0.0415	L	0.29908	0.895	0.38711	D	0.95321	D;D	0.67145	0.996;0.996	P;P	0.53224	0.721;0.584	T	0.01600	-1.1315	10	0.72032	D	0.01	-20.8612	15.1177	0.72416	0.0:1.0:0.0:0.0	.	1036;1056	O75054;A6NJZ6	IGSF3_HUMAN;.	M	1036;1056;1056	ENSP00000358498:V1036M;ENSP00000358495:V1056M;ENSP00000321184:V1056M	ENSP00000321184:V1056M	V	-	1	0	IGSF3	116923765	1.000000	0.71417	0.987000	0.45799	0.959000	0.62525	4.013000	0.57138	2.421000	0.82119	0.462000	0.41574	GTG		0.652	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542		Missense_Mutation
ANKRD35	148741	broad.mit.edu	37	1	145563050	145563050	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:145563050A>T	ENST00000355594.4	+	10	2825	c.2738A>T	c.(2737-2739)aAa>aTa	p.K913I		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	913								p.K913I(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GAGCTGCTGAAAGAGAAGATG	0.607																																					Melanoma(9;127 754 22988 51047)											1	Substitution - Missense(1)	ovary(1)	1											31.0	34.0	33.0					1																	145563050		2202	4298	6500	144274407	SO:0001583	missense	148741			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.2738A>T	1.37:g.145563050A>T	ENSP00000347802:p.Lys913Ile		144274407	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	37	CCDS919.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	15.64	2.892184	0.52014	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.69175	-0.38	5.49	1.78	0.24846	.	0.231996	0.30109	N	0.010387	T	0.50171	0.1600	M	0.73598	2.24	0.09310	N	0.999996	P	0.46395	0.877	P	0.45037	0.467	T	0.49457	-0.8938	10	0.72032	D	0.01	-5.1634	6.8152	0.23826	0.708:0.0:0.292:0.0	.	913	Q8N283	ANR35_HUMAN	I	822;913	ENSP00000347802:K913I	ENSP00000347802:K913I	K	+	2	0	ANKRD35	144274407	0.001000	0.12720	0.001000	0.08648	0.887000	0.51463	0.227000	0.17795	0.137000	0.18759	0.528000	0.53228	AAA		0.607	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698		Missense_Mutation
RPRD2	23248	broad.mit.edu	37	1	150418821	150418821	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:150418821G>C	ENST00000369068.4	+	7	818	c.814G>C	c.(814-816)Gaa>Caa	p.E272Q	RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Missense_Mutation_p.E246Q|RPRD2_ENST00000539519.1_Missense_Mutation_p.E246Q	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	272						DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						AGAAGCACTGGAAAATGCTGG	0.363																																																0			1											100.0	95.0	97.0					1																	150418821		1829	4076	5905	148685445	SO:0001583	missense	23248			BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.814G>C	1.37:g.150418821G>C	ENSP00000358064:p.Glu272Gln		148685445	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	37	CCDS44216.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214231	0.79352	.	.	ENSG00000163125	ENST00000401000;ENST00000539519;ENST00000369068	T;T;T	0.52983	0.64;0.64;0.7	4.84	4.84	0.62591	.	0.111511	0.64402	D	0.000011	T	0.53883	0.1824	L	0.54323	1.7	0.47949	D	0.999554	D;D;D	0.59357	0.985;0.985;0.978	P;P;P	0.59171	0.637;0.637;0.853	T	0.56992	-0.7887	10	0.62326	D	0.03	-10.7744	18.1313	0.89602	0.0:0.0:1.0:0.0	.	246;272;246	B4E2Q6;Q5VT52;Q5VT52-3	.;RPRD2_HUMAN;.	Q	246;246;272	ENSP00000383785:E246Q;ENSP00000445482:E246Q;ENSP00000358064:E272Q	ENSP00000358064:E272Q	E	+	1	0	RPRD2	148685445	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.684000	0.84104	2.522000	0.85027	0.563000	0.77884	GAA		0.363	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203		Missense_Mutation
FLG2	388698	broad.mit.edu	37	1	152328546	152328546	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:152328546C>G	ENST00000388718.5	-	3	1788	c.1716G>C	c.(1714-1716)ttG>ttC	p.L572F	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	572	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.L572F(3)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCTGAGCCCAACCCATGTT	0.522																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	1											267.0	275.0	272.0					1																	152328546		2203	4300	6503	150595170	SO:0001583	missense	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1716G>C	1.37:g.152328546C>G	ENSP00000373370:p.Leu572Phe		150595170	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	0.236	-1.016995	0.02078	.	.	ENSG00000143520	ENST00000388718	T	0.03920	3.76	3.72	-7.44	0.01379	.	.	.	.	.	T	0.00496	0.0016	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49062	-0.8978	9	0.10377	T	0.69	1.1488	1.2764	0.02031	0.1368:0.2035:0.2521:0.4076	.	572	Q5D862	FILA2_HUMAN	F	572	ENSP00000373370:L572F	ENSP00000373370:L572F	L	-	3	2	FLG2	150595170	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.229000	0.02945	-2.438000	0.00552	-1.191000	0.01696	TTG		0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		Missense_Mutation
NTRK1	4914	broad.mit.edu	37	1	156841488	156841488	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:156841488C>T	ENST00000524377.1	+	7	832	c.791C>T	c.(790-792)aCg>aTg	p.T264M	NTRK1_ENST00000358660.3_Missense_Mutation_p.T264M|NTRK1_ENST00000392302.2_Missense_Mutation_p.T234M|NTRK1_ENST00000368196.3_Missense_Mutation_p.T264M	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	264	Ig-like C2-type 1.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T264M(1)|p.T234M(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	AAGAACGTGACGTGCTGGGCA	0.587			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																													Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	2	Substitution - Missense(2)	ovary(2)	1											99.0	84.0	89.0					1																	156841488		2203	4300	6503	155108112	SO:0001583	missense	4914			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.791C>T	1.37:g.156841488C>T	ENSP00000431418:p.Thr264Met		155108112	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972003	0.53614	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	T;T;T;T	0.18657	2.2;2.2;2.2;2.2	4.7	3.76	0.43208	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.110599	0.39615	N	0.001304	T	0.32194	0.0821	M	0.64170	1.965	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.78314	0.985;0.989;0.958;0.991	T	0.04400	-1.0954	10	0.87932	D	0	.	12.0239	0.53358	0.0:0.9133:0.0:0.0866	.	264;264;264;234	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	M	234;264;264;264	ENSP00000376120:T234M;ENSP00000357179:T264M;ENSP00000431418:T264M;ENSP00000351486:T264M	ENSP00000351486:T264M	T	+	2	0	NTRK1	155108112	0.797000	0.28877	0.957000	0.39632	0.595000	0.36748	1.829000	0.39121	2.432000	0.82394	0.655000	0.94253	ACG		0.587	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529		Missense_Mutation
NTRK1	4914	broad.mit.edu	37	1	156845981	156845981	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:156845981C>A	ENST00000524377.1	+	13	1652	c.1611C>A	c.(1609-1611)gaC>gaA	p.D537E	NTRK1_ENST00000358660.3_Missense_Mutation_p.D534E|NTRK1_ENST00000392302.2_Missense_Mutation_p.D501E|NTRK1_ENST00000368196.3_Missense_Mutation_p.D531E	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	537	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D501E(1)|p.D537E(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	CTGAGCAGGACAAGATGCTGG	0.642			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																													Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	2	Substitution - Missense(2)	ovary(2)	1											61.0	61.0	61.0					1																	156845981		2203	4300	6503	155112605	SO:0001583	missense	4914			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1611C>A	1.37:g.156845981C>A	ENSP00000431418:p.Asp537Glu		155112605	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	11.83	1.756948	0.31137	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55	5.03	4.12	0.48240	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.096845	0.45126	D	0.000384	T	0.55862	0.1947	N	0.02916	-0.46	0.43103	D	0.994792	B;B;P;B	0.41978	0.002;0.001;0.767;0.1	B;B;B;B	0.38683	0.03;0.005;0.279;0.057	T	0.62144	-0.6916	10	0.19590	T	0.45	.	6.8649	0.24088	0.0:0.7297:0.1772:0.0932	.	534;531;537;501	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	E	501;531;537;534	ENSP00000376120:D501E;ENSP00000357179:D531E;ENSP00000431418:D537E;ENSP00000351486:D534E	ENSP00000351486:D534E	D	+	3	2	NTRK1	155112605	0.609000	0.26975	1.000000	0.80357	0.984000	0.73092	-0.158000	0.10070	1.355000	0.45865	0.462000	0.41574	GAC		0.642	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529		Missense_Mutation
FCRL5	83416	broad.mit.edu	37	1	157508937	157508937	+	Silent	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:157508937G>A	ENST00000361835.3	-	7	1498	c.1341C>T	c.(1339-1341)taC>taT	p.Y447Y	FCRL5_ENST00000368191.3_Silent_p.Y362Y|FCRL5_ENST00000368189.3_Silent_p.Y447Y|FCRL5_ENST00000356953.4_Silent_p.Y447Y|FCRL5_ENST00000368190.3_Silent_p.Y447Y	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	447	Ig-like C2-type 4.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.Y447Y(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CAGCTGTGCAGTAGTAGTTCC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	1											68.0	58.0	61.0					1																	157508937		2203	4300	6503	155775561	SO:0001819	synonymous_variant	83416			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1341C>T	1.37:g.157508937G>A			155775561	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Silent	SNP	ENST00000361835.3	37	CCDS1165.1	SNP	36	Broad																																																																																				0.597	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281		Silent
GPR161	23432	broad.mit.edu	37	1	168073976	168073976	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:168073976G>C	ENST00000367838.1	-	4	426	c.113C>G	c.(112-114)aCc>aGc	p.T38S	GPR161_ENST00000271357.5_Missense_Mutation_p.T38S|GPR161_ENST00000367835.1_Missense_Mutation_p.T38S|GPR161_ENST00000537209.1_Missense_Mutation_p.T58S|GPR161_ENST00000539777.1_Intron|GPR161_ENST00000367836.1_Intron|GPR161_ENST00000546300.1_Intron|GPR161_ENST00000361697.2_Missense_Mutation_p.T38S	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	38					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)	p.T38S(1)		breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					GACAAAAATGGTGATGACAAT	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											261.0	212.0	229.0					1																	168073976		2203	4300	6503	166340600	SO:0001583	missense	23432			AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.113C>G	1.37:g.168073976G>C	ENSP00000356812:p.Thr38Ser		166340600	B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	ENST00000367838.1	37	CCDS1268.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	11.70	1.717042	0.30413	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367835;ENST00000537209;ENST00000361697	T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31	5.34	4.41	0.53225	.	0.221859	0.46442	N	0.000283	T	0.11281	0.0275	N	0.19112	0.55	0.34940	D	0.750192	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.06405	0.002;0.001;0.002;0.001	T	0.06041	-1.0849	9	0.62326	D	0.03	-27.4892	10.547	0.45066	0.0:0.1449:0.7048:0.1503	.	58;58;38;38	F5GXD6;B7Z5Z6;Q8N6U8-2;Q8N6U8	.;.;.;GP161_HUMAN	S	38;38;38;58;38	ENSP00000356812:T38S;ENSP00000271357:T38S;ENSP00000356809:T38S;ENSP00000441039:T58S;ENSP00000355194:T38S	ENSP00000271357:T38S	T	-	2	0	GPR161	166340600	1.000000	0.71417	0.860000	0.33809	0.995000	0.86356	6.082000	0.71318	1.201000	0.43203	0.561000	0.74099	ACC		0.537	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	NM_007369		Missense_Mutation
AVPR1B	553	broad.mit.edu	37	1	206224928	206224928	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr1:206224928T>A	ENST00000367126.4	+	1	953	c.488T>A	c.(487-489)aTc>aAc	p.I163N	RP11-38J22.3_ENST00000425896.1_RNA	NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	163					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)	p.I163N(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	CTGGCCGCCATCTTCAGCCTC	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											34.0	36.0	35.0					1																	206224928		2201	4293	6494	204391551	SO:0001583	missense	553			D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.488T>A	1.37:g.206224928T>A	ENSP00000356094:p.Ile163Asn		204391551	B0M0J6|Q5TZ00	Missense_Mutation	SNP	ENST00000367126.4	37	CCDS30994.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	16.51	3.142772	0.57044	.	.	ENSG00000198049	ENST00000367126	T	0.39787	1.06	5.84	4.74	0.60224	GPCR, rhodopsin-like superfamily (1);	1.056250	0.07326	N	0.878444	T	0.64746	0.2626	M	0.80183	2.485	0.41394	D	0.98763	P	0.37370	0.592	P	0.51550	0.673	T	0.58567	-0.7614	10	0.87932	D	0	-14.9525	13.7194	0.62717	0.0:0.0:0.1557:0.8443	.	163	P47901	V1BR_HUMAN	N	163	ENSP00000356094:I163N	ENSP00000356094:I163N	I	+	2	0	AVPR1B	204391551	0.946000	0.32159	0.928000	0.36995	0.768000	0.43524	2.792000	0.47837	2.221000	0.72209	0.421000	0.28195	ATC		0.647	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087996.1	NM_000707		Missense_Mutation
ZNF485	220992	broad.mit.edu	37	10	44104095	44104095	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr10:44104095T>G	ENST00000361807.3	+	3	252	c.58T>G	c.(58-60)Ttt>Gtt	p.F20V	ZNF485_ENST00000374437.2_Intron|ZNF485_ENST00000374435.3_Missense_Mutation_p.F20V	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	20	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F20V(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						GGCTGTGGCCTTTACCCGGAT	0.567																																																1	Substitution - Missense(1)	ovary(1)	10											170.0	159.0	163.0					10																	44104095		692	1591	2283	43424101	SO:0001583	missense	220992			AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.58T>G	10.37:g.44104095T>G	ENSP00000354694:p.Phe20Val		43424101	B4DSE6|Q96CL0	Missense_Mutation	SNP	ENST00000361807.3	37	CCDS7205.2	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	16.89	3.247803	0.59103	.	.	ENSG00000198298	ENST00000361807;ENST00000430885;ENST00000374435	T;T;T	0.14640	2.49;2.49;2.49	2.96	2.96	0.34315	Krueppel-associated box (4);	.	.	.	.	T	0.35770	0.0943	H	0.94847	3.59	0.80722	D	1	P	0.49253	0.921	P	0.51701	0.677	T	0.46331	-0.9199	9	0.87932	D	0	.	9.3218	0.37968	0.0:0.0:0.0:1.0	.	20	Q8NCK3	ZN485_HUMAN	V	20	ENSP00000354694:F20V;ENSP00000393570:F20V;ENSP00000363558:F20V	ENSP00000354694:F20V	F	+	1	0	ZNF485	43424101	0.054000	0.20591	0.059000	0.19551	0.927000	0.56198	0.632000	0.24583	1.352000	0.45808	0.379000	0.24179	TTT		0.567	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047719.2	NM_145312		Missense_Mutation
PAPSS2	9060	broad.mit.edu	37	10	89503196	89503196	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr10:89503196C>G	ENST00000361175.4	+	10	1643	c.1274C>G	c.(1273-1275)aCt>aGt	p.T425S	PAPSS2_ENST00000427144.2_Missense_Mutation_p.T429S|PAPSS2_ENST00000456849.1_Missense_Mutation_p.T430S	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	425					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)	p.T425S(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		ATGCAGGACACTCGCCGCAGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	10											124.0	117.0	119.0					10																	89503196		2203	4300	6503	89493176	SO:0001583	missense	9060			AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.1274C>G	10.37:g.89503196C>G	ENSP00000354436:p.Thr425Ser		89493176	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Missense_Mutation	SNP	ENST00000361175.4	37	CCDS7385.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887098	0.91814	.	.	ENSG00000198682	ENST00000361175;ENST00000456849;ENST00000427144;ENST00000371981	T;T;T	0.32272	1.46;1.46;1.46	5.33	5.33	0.75918	Sulphate adenylyltransferase (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.091491	0.85682	D	0.000000	T	0.64627	0.2615	M	0.91249	3.19	0.80722	D	1	D;D	0.76494	0.984;0.999	D;D	0.71414	0.939;0.973	T	0.68704	-0.5338	10	0.41790	T	0.15	-23.129	19.2123	0.93760	0.0:1.0:0.0:0.0	.	425;430	O95340;O95340-2	PAPS2_HUMAN;.	S	425;430;429;429	ENSP00000354436:T425S;ENSP00000406157:T430S;ENSP00000397123:T429S	ENSP00000354436:T425S	T	+	2	0	PAPSS2	89493176	1.000000	0.71417	0.970000	0.41538	0.971000	0.66376	7.315000	0.78998	2.771000	0.95319	0.561000	0.74099	ACT		0.587	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049229.1			Missense_Mutation
EXOC6	54536	broad.mit.edu	37	10	94654744	94654744	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr10:94654744A>G	ENST00000260762.6	+	4	393	c.379A>G	c.(379-381)Act>Gct	p.T127A	EXOC6_ENST00000371552.4_Missense_Mutation_p.T122A|EXOC6_ENST00000371547.4_Missense_Mutation_p.T143A|EXOC6_ENST00000443748.2_Missense_Mutation_p.T127A|EXOC6_ENST00000371543.1_Missense_Mutation_p.T127A	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	127					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)		p.T127A(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				AAATATTACAACTGTAGTAGA	0.308																																																1	Substitution - Missense(1)	ovary(1)	10											154.0	168.0	163.0					10																	94654744		2203	4299	6502	94644724	SO:0001583	missense	54536			BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.379A>G	10.37:g.94654744A>G	ENSP00000260762:p.Thr127Ala		94644724	E9PHI3|Q5VXH8|Q9NZ24	Missense_Mutation	SNP	ENST00000260762.6	37	CCDS7424.2	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	8.532	0.871208	0.17322	.	.	ENSG00000138190	ENST00000371547;ENST00000371552;ENST00000371543;ENST00000443748;ENST00000260762	T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68	5.73	5.73	0.89815	.	0.046351	0.85682	D	0.000000	T	0.13713	0.0332	N	0.11201	0.11	0.32596	N	0.526594	B;B;B;B;B	0.23316	0.001;0.083;0.001;0.001;0.001	B;B;B;B;B	0.21917	0.006;0.037;0.002;0.001;0.001	T	0.07888	-1.0749	10	0.05833	T	0.94	-4.191	16.0048	0.80354	1.0:0.0:0.0:0.0	.	143;127;119;127;122	F2Z2Q3;E7EW84;B4DEZ1;Q8TAG9;E9PHI3	.;.;.;EXOC6_HUMAN;.	A	143;122;127;127;127	ENSP00000360602:T143A;ENSP00000360607:T122A;ENSP00000360598:T127A;ENSP00000396206:T127A;ENSP00000260762:T127A	ENSP00000260762:T127A	T	+	1	0	EXOC6	94644724	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.618000	0.90932	2.190000	0.69967	0.533000	0.62120	ACT		0.308	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049410.2	NM_019053		Missense_Mutation
SLIT1	6585	broad.mit.edu	37	10	98807736	98807736	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr10:98807736T>A	ENST00000266058.4	-	15	1728	c.1483A>T	c.(1483-1485)Att>Ttt	p.I495F	SLIT1_ENST00000371070.4_Missense_Mutation_p.I495F|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	495					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.I495F(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CTACCTGGAATGAAGTACTGC	0.597																																																1	Substitution - Missense(1)	ovary(1)	10											144.0	140.0	142.0					10																	98807736		2203	4300	6503	98797726	SO:0001583	missense	6585			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1483A>T	10.37:g.98807736T>A	ENSP00000266058:p.Ile495Phe		98797726	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	15.44	2.835407	0.50951	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	T;T;T	0.81330	-1.48;-1.47;0.42	4.63	3.48	0.39840	.	0.051512	0.85682	D	0.000000	T	0.69495	0.3117	L	0.34521	1.04	0.80722	D	1	B;P	0.42785	0.037;0.79	B;B	0.37650	0.025;0.255	T	0.72513	-0.4270	10	0.45353	T	0.12	.	12.3964	0.55386	0.0:0.0:0.1496:0.8503	.	505;495	E7EWQ8;O75093	.;SLIT1_HUMAN	F	495;505;495;488	ENSP00000266058:I495F;ENSP00000360109:I495F;ENSP00000315005:I488F	ENSP00000266058:I495F	I	-	1	0	SLIT1	98797726	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	1.825000	0.39081	1.936000	0.56123	0.379000	0.24179	ATT		0.597	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061		Missense_Mutation
ACADSB	36	broad.mit.edu	37	10	124800142	124800142	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr10:124800142C>G	ENST00000358776.4	+	4	478	c.464C>G	c.(463-465)aCa>aGa	p.T155R	ACADSB_ENST00000368869.4_Missense_Mutation_p.T53R|ACADSB_ENST00000496730.2_3'UTR	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	155					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.T155R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	AAACATGGAACAGAAGAACAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	10											117.0	116.0	116.0					10																	124800142		2203	4300	6503	124790132	SO:0001583	missense	36			U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.464C>G	10.37:g.124800142C>G	ENSP00000357873:p.Thr155Arg		124790132	B4DQ51|Q5SQN6|Q96CX7	Missense_Mutation	SNP	ENST00000358776.4	37	CCDS7634.1	SNP	17	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.9|24.9	4.585332|4.585332	0.86748|0.86748	.|.	.|.	ENSG00000196177|ENSG00000196177	ENST00000411816|ENST00000368869;ENST00000358776	.|D;D	.|0.99369	.|-5.78;-5.78	5.68|5.68	5.68|5.68	0.88126|0.88126	.|Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	.|0.050656	.|0.85682	.|D	.|0.000000	D|D	0.99498|0.99498	0.9821|0.9821	M|M	0.94021|0.94021	3.485|3.485	0.80722|0.80722	D|D	1|1	.|D	.|0.60160	.|0.987	.|P	.|0.57425	.|0.82	D|D	0.98611|0.98611	1.0663|1.0663	5|10	.|0.87932	.|D	.|0	.|.	19.7785|19.7785	0.96405|0.96405	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|155	.|P45954	.|ACDSB_HUMAN	E|R	161|53;155	.|ENSP00000357862:T53R;ENSP00000357873:T155R	.|ENSP00000357873:T155R	Q|T	+|+	1|2	0|0	ACADSB|ACADSB	124790132|124790132	1.000000|1.000000	0.71417|0.71417	0.741000|0.741000	0.31004|0.31004	0.815000|0.815000	0.46073|0.46073	7.623000|7.623000	0.83113|0.83113	2.675000|2.675000	0.91044|0.91044	0.655000|0.655000	0.94253|0.94253	CAG|ACA		0.373	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050843.1	NM_001609		Missense_Mutation
OR52A4	390053	broad.mit.edu	37	11	5142372	5142372	+	RNA	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:5142372G>T	ENST00000498233.1	-	0	1014							A6NMU1	O52A4_HUMAN	olfactory receptor, family 52, subfamily A, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T146N(1)		breast(1)|endometrium(2)|kidney(1)|lung(12)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		TACAATATAAGTGACTAGCTG	0.458																																																1	Substitution - Missense(1)	ovary(1)	11											71.0	64.0	67.0					11																	5142372		2201	4298	6499	5098948			390053					11p15.4	2012-10-03	2012-10-03	2012-10-03	ENSG00000205494	ENSG00000205494		"""GPCR / Class A : Olfactory receptors"""	19579	pseudogene	pseudogene							Standard	NG_029079		Approved			A6NMU1	OTTHUMG00000066610		11.37:g.5142372G>T			5098948		Missense_Mutation	SNP	ENST00000498233.1	37		SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	0.495	-0.873354	0.02570	.	.	ENSG00000248953	ENST00000380369	.	.	.	3.15	2.24	0.28232	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.64227	0.2579	.	.	.	0.23089	N	0.998312	D	0.57571	0.98	P	0.60541	0.876	T	0.72134	-0.4382	6	0.62326	D	0.03	.	8.4832	0.33057	0.1218:0.0:0.8782:0.0	.	146	A6NMU1	O52A4_HUMAN	N	146	.	ENSP00000369727:T146N	T	-	2	0	OR52A4	5098948	0.000000	0.05858	0.017000	0.16124	0.008000	0.06430	-2.095000	0.01350	0.891000	0.36235	0.650000	0.86243	ACT		0.458	OR52A4-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000268565.1	NG_029079		Missense_Mutation
OR52N5	390075	broad.mit.edu	37	11	5799507	5799507	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:5799507C>A	ENST00000317093.2	-	1	390	c.358G>T	c.(358-360)Gag>Tag	p.E120*	TRIM5_ENST00000380027.1_Intron	NM_001001922.2	NP_001001922.2	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N, member 5	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E120*(1)		endometrium(2)|large_intestine(3)|liver(1)|lung(17)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		ACCCCAGACTCCACACCTGTG	0.483																																																1	Substitution - Nonsense(1)	ovary(1)	11											106.0	92.0	97.0					11																	5799507		2121	4085	6206	5756083	SO:0001587	stop_gained	390075			AB065535	CCDS31397.1	11p15.4	2012-08-09			ENSG00000181009	ENSG00000181009		"""GPCR / Class A : Olfactory receptors"""	15231	protein-coding gene	gene with protein product							Standard	NM_001001922		Approved	OR52N5Q	uc010qzn.2	Q8NH56	OTTHUMG00000168799	ENST00000317093.2:c.358G>T	11.37:g.5799507C>A	ENSP00000322866:p.Glu120*		5756083	B9EH12|Q6IFG2	Nonsense_Mutation	SNP	ENST00000317093.2	37	CCDS31397.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362905	0.82353	.	.	ENSG00000181009	ENST00000317093	.	.	.	3.7	3.7	0.42460	.	0.000000	0.31145	U	0.008177	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.5626	0.68151	0.0:1.0:0.0:0.0	.	.	.	.	X	120	.	ENSP00000322866:E120X	E	-	1	0	OR52N5	5756083	0.944000	0.32072	1.000000	0.80357	0.936000	0.57629	2.446000	0.44908	2.066000	0.61787	0.494000	0.49563	GAG		0.483	OR52N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401141.1	NM_001001922		Nonsense_Mutation
APBB1	322	broad.mit.edu	37	11	6415741	6415741	+	IGR	SNP	T	T	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:6415741T>G	ENST00000609360.1	-	0	2642				SMPD1_ENST00000299397.3_Silent_p.S556S|SMPD1_ENST00000527275.1_Silent_p.S599S|APBB1_ENST00000526240.1_5'Flank|SMPD1_ENST00000342245.4_Silent_p.S600S|SMPD1_ENST00000356761.2_Silent_p.S544S	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)						apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)	p.S556S(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		CCCAGCTCTCTGCCCGTGCTG	0.627																																					GBM(147;1810 2556 5672 39622)											1	Substitution - coding silent(1)	ovary(1)	11											71.0	73.0	72.0					11																	6415741		2201	4296	6497	6372317	SO:0001628	intergenic_variant	6609			L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213			11.37:g.6415741T>G			6372317	A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Silent	SNP	ENST00000609360.1	37		SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	8.205	0.799037	0.16397	.	.	ENSG00000166311	ENST00000526280	.	.	.	5.41	-10.8	0.00216	.	.	.	.	.	T	0.31544	0.0800	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40831	-0.9542	4	.	.	.	-40.4328	1.5699	0.02612	0.1806:0.2114:0.1639:0.4441	.	.	.	.	R	286	.	.	L	+	2	0	SMPD1	6372317	0.010000	0.17322	0.624000	0.29186	0.719000	0.41307	-1.277000	0.02812	-1.753000	0.01323	-0.464000	0.05259	CTG		0.627	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471831.1	NM_001164		Silent
OR6A2	8590	broad.mit.edu	37	11	6816839	6816839	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:6816839A>G	ENST00000332601.3	-	1	289	c.101T>C	c.(100-102)cTg>cCg	p.L34P		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	34					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L34P(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CACATAGGCCAGCAGCAAAAG	0.478																																																1	Substitution - Missense(1)	ovary(1)	11											140.0	110.0	120.0					11																	6816839		2201	4296	6497	6773415	SO:0001583	missense	8590			AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.101T>C	11.37:g.6816839A>G	ENSP00000330384:p.Leu34Pro		6773415	Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	ENST00000332601.3	37	CCDS7772.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	11.09	1.536517	0.27475	.	.	ENSG00000184933	ENST00000332601	T	0.14266	2.52	4.95	3.82	0.43975	.	0.000000	0.41938	D	0.000786	T	0.27027	0.0662	L	0.60067	1.865	0.52099	D	0.999949	D	0.71674	0.998	P	0.62014	0.897	T	0.01039	-1.1472	10	0.62326	D	0.03	.	8.9306	0.35668	0.9112:0.0:0.0888:0.0	.	34	O95222	OR6A2_HUMAN	P	34	ENSP00000330384:L34P	ENSP00000330384:L34P	L	-	2	0	OR6A2	6773415	0.001000	0.12720	0.130000	0.21974	0.003000	0.03518	1.841000	0.39240	1.020000	0.39573	0.533000	0.62120	CTG		0.478	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385981.1	NM_003696		Missense_Mutation
OR4C46	119749	broad.mit.edu	37	11	51515956	51515956	+	Silent	SNP	T	T	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:51515956T>A	ENST00000328188.1	+	1	675	c.675T>A	c.(673-675)acT>acA	p.T225T		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T225T(1)		endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						CCCTAAGGACTCATAGCTTGG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	11											121.0	102.0	109.0					11																	51515956		2201	4296	6497	51372532	SO:0001819	synonymous_variant	119749				CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.675T>A	11.37:g.51515956T>A			51372532		Silent	SNP	ENST00000328188.1	37	CCDS31498.1	SNP	54	Broad																																																																																				0.488	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703		Silent
OR6Q1	219952	broad.mit.edu	37	11	57798751	57798751	+	Silent	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:57798751C>A	ENST00000302622.3	+	1	350	c.327C>A	c.(325-327)acC>acA	p.T109T	OR9Q1_ENST00000335397.3_Intron	NM_001005186.2	NP_001005186.2	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q, member 1	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T109T(1)		biliary_tract(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(21;0.0707)|all_epithelial(135;0.142)				TCATCTTCACCTTTCTTGGGG	0.493																																																1	Substitution - coding silent(1)	ovary(1)	11											153.0	146.0	148.0					11																	57798751		2201	4296	6497	57555327	SO:0001819	synonymous_variant	219952			AB065737	CCDS31541.1	11q12.1	2012-08-09			ENSG00000172381	ENSG00000172381		"""GPCR / Class A : Olfactory receptors"""	15302	protein-coding gene	gene with protein product							Standard	NM_001005186		Approved		uc010rjz.2	Q8NGQ2	OTTHUMG00000168831	ENST00000302622.3:c.327C>A	11.37:g.57798751C>A			57555327	B9EKW1|Q6IFH1|Q96R34	Silent	SNP	ENST00000302622.3	37	CCDS31541.1	SNP	24	Broad																																																																																				0.493	OR6Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401257.1	NM_001005186		Silent
OR1S2	219958	broad.mit.edu	37	11	57971290	57971290	+	Missense_Mutation	SNP	C	C	T	rs138124206		TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:57971290C>T	ENST00000302592.6	-	1	363	c.364G>A	c.(364-366)Gtc>Atc	p.V122I		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V122I(2)		endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				TTGTCAGTGACGACAAACACA	0.473													C|||	1	0.000199681	0.0	0.0014	5008	,	,		23345	0.0		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|lung(1)	11						C	ILE/VAL	1,4401	2.1+/-5.4	0,1,2200	170.0	160.0	163.0		364	2.6	0.1	11	dbSNP_134	163	1,8591	1.2+/-3.3	0,1,4295	no	missense	OR1S2	NM_001004459.1	29	0,2,6495	TT,TC,CC		0.0116,0.0227,0.0154	possibly-damaging	122/326	57971290	2,12992	2201	4296	6497	57727866	SO:0001583	missense	219958			BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.364G>A	11.37:g.57971290C>T	ENSP00000305469:p.Val122Ile		57727866	Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	0.227	-1.023837	0.02061	2.27E-4	1.16E-4	ENSG00000197887	ENST00000302592	T	0.03004	4.08	4.47	2.58	0.30949	GPCR, rhodopsin-like superfamily (1);	0.549745	0.14948	N	0.289105	T	0.02571	0.0078	N	0.16201	0.385	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.46289	-0.9202	10	0.25751	T	0.34	.	9.9047	0.41368	0.0:0.8296:0.0:0.1704	.	122	Q8NGQ3	OR1S2_HUMAN	I	122	ENSP00000305469:V122I	ENSP00000305469:V122I	V	-	1	0	OR1S2	57727866	0.000000	0.05858	0.071000	0.20095	0.143000	0.21401	-0.693000	0.05121	0.625000	0.30304	0.655000	0.94253	GTC		0.473	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459		Missense_Mutation
AHNAK	79026	broad.mit.edu	37	11	62291166	62291166	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:62291166G>A	ENST00000378024.4	-	5	10997	c.10723C>T	c.(10723-10725)Cca>Tca	p.P3575S	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3575					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.P3575S(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TCAACCTCTGGCCCTTTCAGA	0.468																																																1	Substitution - Missense(1)	ovary(1)	11											155.0	159.0	158.0					11																	62291166		2202	4299	6501	62047742	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.10723C>T	11.37:g.62291166G>A	ENSP00000367263:p.Pro3575Ser		62047742	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	g	14.57	2.574279	0.45902	.	.	ENSG00000124942	ENST00000378024	T	0.05649	3.41	4.71	3.74	0.42951	.	0.000000	0.85682	D	0.000000	T	0.12902	0.0313	M	0.88105	2.93	0.42393	D	0.992539	P	0.46277	0.875	B	0.43301	0.415	T	0.01059	-1.1465	10	0.41790	T	0.15	-2.384	8.1983	0.31409	0.0839:0.0:0.7595:0.1566	.	3575	Q09666	AHNK_HUMAN	S	3575	ENSP00000367263:P3575S	ENSP00000367263:P3575S	P	-	1	0	AHNAK	62047742	1.000000	0.71417	0.062000	0.19696	0.960000	0.62799	5.507000	0.66999	2.325000	0.78763	0.453000	0.30009	CCA		0.468	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		Missense_Mutation
CPT1A	1374	broad.mit.edu	37	11	68548134	68548134	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:68548134C>A	ENST00000265641.5	-	12	1586	c.1432G>T	c.(1432-1434)Gcg>Tcg	p.A478S	CPT1A_ENST00000540367.1_Missense_Mutation_p.A478S|CPT1A_ENST00000539743.1_Missense_Mutation_p.A478S|CPT1A_ENST00000376618.2_Missense_Mutation_p.A478S	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	478					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)	p.A478S(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	ACGATCGGCGCATCTGCCCAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											122.0	104.0	110.0					11																	68548134		2200	4294	6494	68304710	SO:0001583	missense	1374			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1432G>T	11.37:g.68548134C>A	ENSP00000265641:p.Ala478Ser		68304710	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	37	CCDS8185.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	15.89	2.967854	0.53507	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75	5.19	4.26	0.50523	.	0.054498	0.64402	D	0.000001	D	0.94348	0.8183	M	0.90082	3.085	0.80722	D	1	P;P	0.39480	0.484;0.675	P;P	0.48425	0.517;0.577	D	0.94812	0.7979	10	0.72032	D	0.01	.	15.0156	0.71581	0.1435:0.8565:0.0:0.0	.	478;478	P50416;P50416-2	CPT1A_HUMAN;.	S	478	ENSP00000439084:A478S;ENSP00000365803:A478S;ENSP00000265641:A478S;ENSP00000446108:A478S	ENSP00000265641:A478S	A	-	1	0	CPT1A	68304710	1.000000	0.71417	0.020000	0.16555	0.033000	0.12548	7.459000	0.80802	1.162000	0.42619	0.655000	0.94253	GCG		0.507	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876		Missense_Mutation
ARHGEF17	9828	broad.mit.edu	37	11	73075609	73075609	+	Silent	SNP	A	A	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:73075609A>G	ENST00000263674.3	+	18	5864	c.5514A>G	c.(5512-5514)cgA>cgG	p.R1838R		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1838					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1838R(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GCCAGAACCGAGTCCTTGTCC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	11											38.0	40.0	40.0					11																	73075609		2200	4293	6493	72753257	SO:0001819	synonymous_variant	9828			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.5514A>G	11.37:g.73075609A>G			72753257	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Silent	SNP	ENST00000263674.3	37	CCDS8221.1	SNP	11	Broad																																																																																				0.607	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786		Silent
FAT3	120114	broad.mit.edu	37	11	92495111	92495111	+	Missense_Mutation	SNP	G	G	T	rs373586130		TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:92495111G>T	ENST00000298047.6	+	4	3776	c.3759G>T	c.(3757-3759)caG>caT	p.Q1253H	RP11-203F8.1_ENST00000529884.1_RNA|FAT3_ENST00000409404.2_Missense_Mutation_p.Q1253H|FAT3_ENST00000525166.1_Missense_Mutation_p.Q1103H			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1253	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q1253H(2)|p.Q1253Q(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACAAGCCCCAGTTCCCAGAGA	0.483										TCGA Ovarian(4;0.039)																																						4	Substitution - Missense(2)|Substitution - coding silent(2)	ovary(2)|lung(2)	11											179.0	175.0	176.0					11																	92495111		1912	4119	6031	92134759	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3759G>T	11.37:g.92495111G>T	ENSP00000298047:p.Gln1253His		92134759	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	18.67	3.672902	0.67928	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.60920	0.15;0.15;0.15	5.58	4.67	0.58626	.	.	.	.	.	T	0.64080	0.2566	L	0.37897	1.145	0.80722	D	1	D	0.67145	0.996	P	0.60682	0.878	T	0.66618	-0.5878	9	0.56958	D	0.05	.	14.6388	0.68708	0.0701:0.0:0.9299:0.0	.	1253	Q8TDW7-3	.	H	1253;1253;1103	ENSP00000298047:Q1253H;ENSP00000387040:Q1253H;ENSP00000432586:Q1103H	ENSP00000298047:Q1253H	Q	+	3	2	FAT3	92134759	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.408000	0.44574	1.351000	0.45789	0.563000	0.77884	CAG		0.483	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		Missense_Mutation
DYNC2H1	79659	broad.mit.edu	37	11	103027164	103027164	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:103027164A>T	ENST00000375735.2	+	26	3936	c.3792A>T	c.(3790-3792)ttA>ttT	p.L1264F	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.L1264F	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1264	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GAGAAGCTTTACGTGAACTTG	0.333																																																0			11											58.0	58.0	58.0					11																	103027164		1848	4093	5941	102532374	SO:0001583	missense	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.3792A>T	11.37:g.103027164A>T	ENSP00000364887:p.Leu1264Phe		102532374	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	18.19	3.568073	0.65651	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.77098	-1.07;-1.07	5.27	0.085	0.14439	Dynein heavy chain, domain-2 (1);	0.000000	0.42548	D	0.000698	D	0.87822	0.6274	M	0.92880	3.355	0.46849	D	0.999227	D;D	0.67145	0.996;0.984	D;P	0.64687	0.928;0.882	D	0.87529	0.2451	10	0.72032	D	0.01	.	10.6816	0.45817	0.4476:0.0:0.5524:0.0	.	1264;1264	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	F	1264	ENSP00000364887:L1264F;ENSP00000381167:L1264F	ENSP00000364887:L1264F	L	+	3	2	DYNC2H1	102532374	0.998000	0.40836	0.999000	0.59377	0.998000	0.95712	0.536000	0.23129	-0.011000	0.14247	0.460000	0.39030	TTA		0.333	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652		Missense_Mutation
DSCAML1	57453	broad.mit.edu	37	11	117299111	117299111	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:117299111G>A	ENST00000321322.6	-	33	6276	c.6275C>T	c.(6274-6276)aCa>aTa	p.T2092I	DSCAML1_ENST00000527706.1_Missense_Mutation_p.T1822I	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	2032					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.T2092I(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TACCCCCGATGTGCTCATCTC	0.692																																																1	Substitution - Missense(1)	ovary(1)	11											26.0	31.0	29.0					11																	117299111		2141	4193	6334	116804321	SO:0001583	missense	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.6275C>T	11.37:g.117299111G>A	ENSP00000315465:p.Thr2092Ile		116804321	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	9.295	1.051709	0.19827	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.61980	0.1;0.06	4.8	4.8	0.61643	.	.	.	.	.	T	0.46092	0.1375	N	0.14661	0.345	0.32928	D	0.516723	B	0.31730	0.337	B	0.29785	0.107	T	0.61436	-0.7063	9	0.72032	D	0.01	.	13.2524	0.60060	0.0:0.1598:0.8402:0.0	.	2032	Q8TD84	DSCL1_HUMAN	I	1822;2092;1799	ENSP00000434335:T1822I;ENSP00000315465:T2092I	ENSP00000315465:T2092I	T	-	2	0	DSCAML1	116804321	1.000000	0.71417	0.854000	0.33618	0.137000	0.21094	6.144000	0.71762	2.214000	0.71695	0.313000	0.20887	ACA		0.692	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		Missense_Mutation
TECTA	7007	broad.mit.edu	37	11	121037383	121037383	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:121037383G>C	ENST00000392793.1	+	18	5751	c.5480G>C	c.(5479-5481)aGg>aCg	p.R1827T	TECTA_ENST00000264037.2_Missense_Mutation_p.R1827T			O75443	TECTA_HUMAN	tectorin alpha	1827	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.R1827T(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GGTTTTGAGAGGGAGGGCGTG	0.478																																																1	Substitution - Missense(1)	ovary(1)	11											141.0	121.0	128.0					11																	121037383		2203	4299	6502	120542593	SO:0001583	missense	7007			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.5480G>C	11.37:g.121037383G>C	ENSP00000376543:p.Arg1827Thr		120542593		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	27.3	4.816983	0.90790	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	D;D	0.81579	-1.51;-1.51	6.05	6.05	0.98169	Zona pellucida sperm-binding protein (3);	0.000000	0.85682	D	0.000000	D	0.88876	0.6556	L	0.60455	1.87	0.52099	D	0.999948	D	0.76494	0.999	D	0.85130	0.997	D	0.87548	0.2463	10	0.52906	T	0.07	.	20.6087	0.99469	0.0:0.0:1.0:0.0	.	1827	O75443	TECTA_HUMAN	T	1827	ENSP00000376543:R1827T;ENSP00000264037:R1827T	ENSP00000264037:R1827T	R	+	2	0	TECTA	120542593	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.429000	0.97481	2.866000	0.98385	0.650000	0.86243	AGG		0.478	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422		Missense_Mutation
CRTAM	56253	broad.mit.edu	37	11	122726443	122726443	+	Nonsense_Mutation	SNP	T	T	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:122726443T>A	ENST00000227348.4	+	5	578	c.531T>A	c.(529-531)tgT>tgA	p.C177*		NM_019604.2	NP_062550.2			cytotoxic and regulatory T cell molecule									p.C177*(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|prostate(1)	19		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		GGAAGAAATGTAATACTACCA	0.418																																																1	Substitution - Nonsense(1)	ovary(1)	11											112.0	107.0	109.0					11																	122726443		2202	4299	6501	122231653	SO:0001587	stop_gained	56253			AF001622	CCDS8437.1	11q24.1	2013-01-11			ENSG00000109943	ENSG00000109943		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24313	protein-coding gene	gene with protein product	"""class I MHC restricted T cell associated molecule"""	612597				10811014, 16300832	Standard	NM_019604		Approved	CD355	uc001pyj.3	O95727	OTTHUMG00000166026	ENST00000227348.4:c.531T>A	11.37:g.122726443T>A	ENSP00000227348:p.Cys177*		122231653		Nonsense_Mutation	SNP	ENST00000227348.4	37	CCDS8437.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	21.7	4.193203	0.78902	.	.	ENSG00000109943	ENST00000227348	.	.	.	4.86	-3.6	0.04570	.	0.491146	0.24388	N	0.038957	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	6.1712	0.20418	0.0:0.3735:0.2569:0.3696	.	.	.	.	X	177	.	ENSP00000227348:C177X	C	+	3	2	CRTAM	122231653	0.415000	0.25416	0.000000	0.03702	0.418000	0.31294	-0.724000	0.04947	-0.617000	0.05664	-0.464000	0.05259	TGT		0.418	CRTAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387507.1	NM_019604		Nonsense_Mutation
ARHGAP32	9743	broad.mit.edu	37	11	128843289	128843289	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:128843289C>A	ENST00000310343.9	-	21	3069	c.3070G>T	c.(3070-3072)Gtc>Ttc	p.V1024F	ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.V675F|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.V675F	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1024					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)	p.V675F(1)|p.V1024F(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						ACTGAACTGACAGGAACGGAA	0.488																																																2	Substitution - Missense(2)	ovary(2)	11											90.0	101.0	97.0					11																	128843289		2194	4293	6487	128348499	SO:0001583	missense	9743			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.3070G>T	11.37:g.128843289C>A	ENSP00000310561:p.Val1024Phe		128348499	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	CCDS44769.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	19.39	3.818056	0.71028	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000527272	T;T;T	0.19250	2.16;2.16;2.16	5.78	5.78	0.91487	.	0.267477	0.37530	N	0.002043	T	0.37919	0.1021	L	0.32530	0.975	0.49130	D	0.999753	D	0.76494	0.999	D	0.66716	0.946	T	0.05920	-1.0856	10	0.62326	D	0.03	.	20.0027	0.97425	0.0:1.0:0.0:0.0	.	1024	A7KAX9	RHG32_HUMAN	F	1024;675;675	ENSP00000310561:V1024F;ENSP00000376425:V675F;ENSP00000432862:V675F	ENSP00000310561:V1024F	V	-	1	0	ARHGAP32	128348499	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.403000	0.52615	2.733000	0.93635	0.655000	0.94253	GTC		0.488	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715		Missense_Mutation
SLC2A14	144195	broad.mit.edu	37	12	7967124	7967124	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr12:7967124A>C	ENST00000543909.1	-	16	2110	c.1351T>G	c.(1351-1353)Tta>Gta	p.L451V	SLC2A14_ENST00000431042.2_Missense_Mutation_p.L428V|SLC2A14_ENST00000340749.5_Missense_Mutation_p.L428V|SLC2A14_ENST00000535295.1_Missense_Mutation_p.L342V|SLC2A14_ENST00000539924.1_Missense_Mutation_p.L466V|SLC2A14_ENST00000542546.1_Missense_Mutation_p.L342V|SLC2A14_ENST00000396589.2_Missense_Mutation_p.L451V|SLC2A14_ENST00000542505.1_Missense_Mutation_p.L92V			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	451					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)	p.L451V(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		TAGGCTCCTAAATAGTACTAG	0.388																																																1	Substitution - Missense(1)	ovary(1)	12											34.0	34.0	34.0					12																	7967124		2203	4300	6503	7858391	SO:0001583	missense	144195			AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.1351T>G	12.37:g.7967124A>C	ENSP00000440480:p.Leu451Val		7858391	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	37	CCDS8585.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	10.27	1.304324	0.23736	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000542505;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924	T;T;T;T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94	3.71	1.03	0.20045	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.233244	0.43416	D	0.000579	T	0.69806	0.3152	M	0.71296	2.17	0.09310	N	0.999998	B;B;B;B	0.31153	0.31;0.31;0.136;0.31	B;B;B;B	0.37387	0.178;0.248;0.105;0.248	T	0.62595	-0.6821	10	0.54805	T	0.06	.	4.2956	0.10899	0.7174:0.0:0.1071:0.1755	.	466;342;428;451	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	V	428;451;428;92;451;342;342;466	ENSP00000340450:L428V;ENSP00000440480:L451V;ENSP00000407287:L428V;ENSP00000438484:L92V;ENSP00000379834:L451V;ENSP00000440492:L342V;ENSP00000443903:L342V;ENSP00000445929:L466V	ENSP00000340450:L428V	L	-	1	2	SLC2A14	7858391	0.955000	0.32602	0.019000	0.16419	0.121000	0.20230	2.398000	0.44486	-0.025000	0.13918	0.377000	0.23210	TTA		0.388	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449		Missense_Mutation
GPRC5A	9052	broad.mit.edu	37	12	13061770	13061770	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr12:13061770C>T	ENST00000014914.5	+	2	1477	c.587C>T	c.(586-588)tCc>tTc	p.S196F	GPRC5A_ENST00000542056.1_Intron	NM_003979.3	NP_003970.1	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, class C, group 5, member A	196					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S196F(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	18		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	CTCATGTCCTCCTTCACCTTC	0.547																																																1	Substitution - Missense(1)	ovary(1)	12											268.0	238.0	248.0					12																	13061770		2203	4300	6503	12953037	SO:0001583	missense	9052			AF095448	CCDS8657.1	12p13-p12.3	2014-01-30	2014-01-30	2005-05-03		ENSG00000013588		"""GPCR / Class C : Orphans"""	9836	protein-coding gene	gene with protein product		604138	"""retinoic acid induced 3"", ""G protein-coupled receptor, family C, group 5, member A"""	RAI3, GPCR5A		9857033	Standard	NM_003979		Approved	RAIG1	uc001rba.3	Q8NFJ5		ENST00000014914.5:c.587C>T	12.37:g.13061770C>T	ENSP00000014914:p.Ser196Phe		12953037	B3KV45|O95357	Missense_Mutation	SNP	ENST00000014914.5	37	CCDS8657.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	4.139	0.024101	0.08006	.	.	ENSG00000013588	ENST00000014914;ENST00000534831	D;D	0.85171	-1.95;-1.95	5.42	-3.24	0.05094	GPCR, family 3, C-terminal (1);	1.000890	0.08060	N	0.998116	T	0.67859	0.2938	N	0.21373	0.66	0.09310	N	1	B;B	0.12630	0.006;0.003	B;B	0.08055	0.003;0.003	T	0.56165	-0.8024	10	0.02654	T	1	-5.5966	7.1509	0.25610	0.0:0.2705:0.2116:0.5179	.	196;196	Q8NFJ5;A8K556	RAI3_HUMAN;.	F	196	ENSP00000014914:S196F;ENSP00000441627:S196F	ENSP00000014914:S196F	S	+	2	0	GPRC5A	12953037	0.002000	0.14202	0.008000	0.14137	0.921000	0.55340	0.689000	0.25437	-0.512000	0.06505	-0.265000	0.10407	TCC		0.547	GPRC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400682.1			Missense_Mutation
HOXC9	3225	broad.mit.edu	37	12	54396404	54396404	+	Silent	SNP	A	A	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr12:54396404A>G	ENST00000303450.4	+	2	799	c.729A>G	c.(727-729)cgA>cgG	p.R243R	HOXC-AS1_ENST00000505700.1_RNA|HOXC-AS1_ENST00000512427.1_RNA|HOXC9_ENST00000508190.1_Silent_p.R243R|HOXC9_ENST00000504557.1_3'UTR|RP11-834C11.12_ENST00000513209.1_Intron	NM_006897.1	NP_008828.1	P31274	HXC9_HUMAN	homeobox C9	243					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.R243R(1)		large_intestine(3)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14						TTCAGAATCGAAGGATGAAGA	0.468																																																1	Substitution - coding silent(1)	ovary(1)	12											52.0	56.0	54.0					12																	54396404		2203	4300	6503	52682671	SO:0001819	synonymous_variant	3225				CCDS8869.1	12q13.13	2011-06-20	2005-12-22			ENSG00000180806		"""Homeoboxes / ANTP class : HOXL subclass"""	5130	protein-coding gene	gene with protein product		142971	"""homeo box C9"""	HOX3, HOX3B		1973146	Standard	NM_006897		Approved		uc001seq.3	P31274		ENST00000303450.4:c.729A>G	12.37:g.54396404A>G			52682671	B2RCN7|Q9H1I0	Silent	SNP	ENST00000303450.4	37	CCDS8869.1	SNP	9	Broad																																																																																				0.468	HOXC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358958.1			Silent
DGKA	1606	broad.mit.edu	37	12	56346576	56346576	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr12:56346576A>C	ENST00000331886.5	+	21	2256	c.1802A>C	c.(1801-1803)aAc>aCc	p.N601T	DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000551156.1_Missense_Mutation_p.N601T|DGKA_ENST00000394147.1_Missense_Mutation_p.N601T	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	601					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)	p.N601T(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	GCAGTGCTAAACATCCCTAGC	0.547																																																1	Substitution - Missense(1)	ovary(1)	12											159.0	138.0	145.0					12																	56346576		2203	4300	6503	54632843	SO:0001583	missense	1606			AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.1802A>C	12.37:g.56346576A>C	ENSP00000328405:p.Asn601Thr		54632843	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	ENST00000331886.5	37	CCDS8896.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	20.4	3.977636	0.74360	.	.	ENSG00000065357	ENST00000331886;ENST00000555218;ENST00000394147;ENST00000551156	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	4.67	4.67	0.58626	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.79764	0.4502	H	0.95365	3.66	0.58432	D	0.999995	D;D	0.89917	0.964;1.0	P;D	0.97110	0.882;1.0	D	0.85850	0.1403	10	0.87932	D	0	.	13.3945	0.60843	1.0:0.0:0.0:0.0	.	520;601	G3V4E1;P23743	.;DGKA_HUMAN	T	601;520;601;601	ENSP00000328405:N601T;ENSP00000451743:N520T;ENSP00000377703:N601T;ENSP00000450359:N601T	ENSP00000328405:N601T	N	+	2	0	DGKA	54632843	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	8.762000	0.91711	1.876000	0.54355	0.260000	0.18958	AAC		0.547	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1			Missense_Mutation
CS	1431	broad.mit.edu	37	12	56667402	56667402	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr12:56667402T>C	ENST00000351328.3	-	10	1389	c.1199A>G	c.(1198-1200)aAt>aGt	p.N400S	CS_ENST00000548567.1_Missense_Mutation_p.N334S|CS_ENST00000542324.2_Missense_Mutation_p.N387S	NM_004077.2	NP_004068.2	O75390	CISY_HUMAN	citrate synthase	400					carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	citrate (Si)-synthase activity (GO:0004108)|poly(A) RNA binding (GO:0044822)	p.N400S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	17		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)		AGCATCTACATTGGGCCAAGG	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											119.0	98.0	105.0					12																	56667402		2203	4300	6503	54953669	SO:0001583	missense	1431				CCDS8913.1	12q13.2	2012-10-02				ENSG00000062485	2.3.3.1		2422	protein-coding gene	gene with protein product		118950					Standard	NM_004077		Approved		uc001sks.1	O75390	OTTHUMG00000170344	ENST00000351328.3:c.1199A>G	12.37:g.56667402T>C	ENSP00000342056:p.Asn400Ser		54953669	Q71UT9|Q7KZH0|Q96FZ8|Q9BWN8	Missense_Mutation	SNP	ENST00000351328.3	37	CCDS8913.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	28.1	4.890083	0.91889	.	.	ENSG00000062485	ENST00000548567;ENST00000351328;ENST00000548746;ENST00000542324	.	.	.	5.69	5.69	0.88448	Citrate synthase-like, core (1);	0.000000	0.85682	D	0.000000	D	0.87470	0.6185	H	0.97103	3.94	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.71414	0.973;0.963;0.963	D	0.91422	0.5159	9	0.72032	D	0.01	-20.9762	15.2513	0.73549	0.0:0.0:0.0:1.0	.	387;355;400	B4DJV2;B3KTN4;O75390	.;.;CISY_HUMAN	S	334;400;73;387	.	ENSP00000342056:N400S	N	-	2	0	CS	54953669	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.341000	0.79300	2.311000	0.77944	0.533000	0.62120	AAT		0.478	CS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408588.2	NM_004077		Missense_Mutation
SOCS2	8835	broad.mit.edu	37	12	93968573	93968573	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr12:93968573T>A	ENST00000340600.2	+	3	813	c.215T>A	c.(214-216)aTt>aAt	p.I72N	SOCS2_ENST00000549206.1_Missense_Mutation_p.I72N|SOCS2_ENST00000549122.1_Missense_Mutation_p.I72N|SOCS2_ENST00000548537.1_3'UTR|SOCS2_ENST00000551556.1_Missense_Mutation_p.I72N|SOCS2_ENST00000536696.2_Missense_Mutation_p.I72N	NM_001270468.1|NM_001270469.1|NM_001270471.1|NM_003877.4	NP_001257397.1|NP_001257398.1|NP_001257400.1|NP_003868.1	O14508	SOCS2_HUMAN	suppressor of cytokine signaling 2	72	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to hormone stimulus (GO:0032870)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of signal transduction (GO:0009967)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of signal transduction (GO:0009966)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	growth hormone receptor binding (GO:0005131)|insulin-like growth factor receptor binding (GO:0005159)|JAK pathway signal transduction adaptor activity (GO:0008269)|SH3/SH2 adaptor activity (GO:0005070)	p.I72N(1)		cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)	14						ACTTTCTTGATTAGAGATAGC	0.378																																																1	Substitution - Missense(1)	ovary(1)	12											70.0	69.0	69.0					12																	93968573		2203	4300	6503	92492704	SO:0001583	missense	8835			AF037989	CCDS9047.1	12q	2013-02-14			ENSG00000120833	ENSG00000120833		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19382	protein-coding gene	gene with protein product	"""STAT-induced STAT inhibitor-2"""	605117				9344848, 9266833	Standard	NM_003877		Approved	STATI2, SSI2, SOCS-2, SSI-2, CIS2, Cish2	uc031qjc.1	O14508		ENST00000340600.2:c.215T>A	12.37:g.93968573T>A	ENSP00000339428:p.Ile72Asn		92492704	A8K3D1|O14542|O95102|Q9UKS5	Missense_Mutation	SNP	ENST00000340600.2	37	CCDS9047.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	21.7	4.182535	0.78677	.	.	ENSG00000120833	ENST00000340600;ENST00000549206;ENST00000536696;ENST00000539385;ENST00000548091;ENST00000549122;ENST00000549887;ENST00000551556	T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17	5.84	5.84	0.93424	SH2 motif (5);	0.172250	0.50627	D	0.000119	T	0.66366	0.2782	M	0.90483	3.12	0.48087	D	0.999582	D	0.65815	0.995	D	0.65233	0.933	T	0.74447	-0.3662	10	0.87932	D	0	-0.2471	16.2108	0.82158	0.0:0.0:0.0:1.0	.	72	O14508	SOCS2_HUMAN	N	72;72;72;20;72;72;72;72	ENSP00000339428:I72N;ENSP00000448815:I72N;ENSP00000442898:I72N;ENSP00000447902:I72N;ENSP00000447161:I72N;ENSP00000448611:I72N;ENSP00000449227:I72N	ENSP00000339428:I72N	I	+	2	0	SOCS2	92492704	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.736000	0.84948	2.232000	0.73038	0.533000	0.62120	ATT		0.378	SOCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407731.2			Missense_Mutation
CUX2	23316	broad.mit.edu	37	12	111786039	111786039	+	Silent	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr12:111786039G>C	ENST00000261726.6	+	22	4525	c.4371G>C	c.(4369-4371)cgG>cgC	p.R1457R		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1457					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.R1457R(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						ACTTGCAGCGGCGGCATGAGA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	12											87.0	95.0	92.0					12																	111786039		1999	4157	6156	110270422	SO:0001819	synonymous_variant	23316			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.4371G>C	12.37:g.111786039G>C			110270422	A7E2Y4	Silent	SNP	ENST00000261726.6	37	CCDS41837.1	SNP	42	Broad																																																																																				0.622	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267		Silent
RNASE13	440163	broad.mit.edu	37	14	21502218	21502218	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr14:21502218G>T	ENST00000382951.3	-	2	367	c.230C>A	c.(229-231)gCc>gAc	p.A77D	NDRG2_ENST00000403829.3_Intron	NM_001012264.3	NP_001012264.1	Q5GAN3	RNS13_HUMAN	ribonuclease, RNase A family, 13 (non-active)	77						extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)	p.A77D(1)		cervix(1)|endometrium(1)|lung(5)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	12	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.019)		CTTCCAAGGGGCATGTATCAC	0.463																																																1	Substitution - Missense(1)	ovary(1)	14											155.0	127.0	137.0					14																	21502218		2203	4300	6503	20572058	SO:0001583	missense	440163			AY665808	CCDS32039.1	14q11.1	2011-02-10			ENSG00000206150	ENSG00000206150		"""Ribonucleases, RNase A"""	25285	protein-coding gene	gene with protein product							Standard	NM_001012264		Approved		uc001vzj.3	Q5GAN3		ENST00000382951.3:c.230C>A	14.37:g.21502218G>T	ENSP00000372410:p.Ala77Asp		20572058		Missense_Mutation	SNP	ENST00000382951.3	37	CCDS32039.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934247	0.52866	.	.	ENSG00000206150	ENST00000382951	T	0.73258	-0.73	5.42	3.49	0.39957	Ribonuclease A, domain (3);	0.353444	0.24238	N	0.040288	T	0.69540	0.3122	L	0.34521	1.04	0.09310	N	1	P	0.52577	0.954	P	0.60012	0.867	T	0.58509	-0.7624	10	0.48119	T	0.1	-24.9132	6.1092	0.20092	0.1106:0.1903:0.6991:0.0	.	77	Q5GAN3	RNS13_HUMAN	D	77	ENSP00000372410:A77D	ENSP00000372410:A77D	A	-	2	0	RNASE13	20572058	0.053000	0.20554	0.013000	0.15412	0.056000	0.15407	1.435000	0.34969	0.591000	0.29711	0.650000	0.86243	GCC		0.463	RNASE13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411744.1			Missense_Mutation
C14orf28	122525	broad.mit.edu	37	14	45369708	45369708	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr14:45369708A>T	ENST00000325192.3	+	2	345	c.70A>T	c.(70-72)Agg>Tgg	p.R24W	C14orf28_ENST00000557112.1_Missense_Mutation_p.R24W|RP11-857B24.5_ENST00000555157.1_RNA	NM_001017923.1	NP_001017923.1	Q4W4Y0	CN028_HUMAN	chromosome 14 open reading frame 28	24								p.R24W(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(2)	11						ATCATTTTGTAGGCCTGTTCT	0.363																																																1	Substitution - Missense(1)	ovary(1)	14											77.0	84.0	82.0					14																	45369708		2203	4300	6503	44439458	SO:0001583	missense	122525			AA496212	CCDS32069.1	14q21.2	2012-08-16			ENSG00000179476	ENSG00000179476			19834	protein-coding gene	gene with protein product	"""dopamine receptor interacting protein 1"""						Standard	XM_005267316		Approved	DRIP-1	uc001wvo.3	Q4W4Y0	OTTHUMG00000170722	ENST00000325192.3:c.70A>T	14.37:g.45369708A>T	ENSP00000326846:p.Arg24Trp		44439458		Missense_Mutation	SNP	ENST00000325192.3	37	CCDS32069.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	13.85	2.360121	0.41801	.	.	ENSG00000179476	ENST00000325192;ENST00000557112	T;T	0.36520	1.25;1.25	5.6	5.6	0.85130	.	0.044239	0.85682	D	0.000000	T	0.36331	0.0963	N	0.19112	0.55	0.58432	D	0.999999	P	0.46457	0.878	P	0.51266	0.664	T	0.26780	-1.0093	10	0.87932	D	0	.	14.0159	0.64523	1.0:0.0:0.0:0.0	.	24	Q4W4Y0	CN028_HUMAN	W	24	ENSP00000326846:R24W;ENSP00000451791:R24W	ENSP00000326846:R24W	R	+	1	2	C14orf28	44439458	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.697000	0.84279	2.260000	0.74910	0.528000	0.53228	AGG		0.363	C14orf28-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410086.1	NM_001017923		Missense_Mutation
ZBTB25	7597	broad.mit.edu	37	14	64954669	64954669	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr14:64954669G>A	ENST00000608382.1	-	3	471	c.280C>T	c.(280-282)Cgt>Tgt	p.R94C	ZBTB25_ENST00000555424.1_Intron|ZBTB25_ENST00000394715.1_Missense_Mutation_p.R94C|ZBTB25_ENST00000555220.1_Intron	NM_006977.2	NP_008908.2	P24278	ZBT25_HUMAN	zinc finger and BTB domain containing 25	94	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				gene expression (GO:0010467)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R94C(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	10				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		TCCTCCAAACGACTATGATCC	0.423																																																1	Substitution - Missense(1)	ovary(1)	14											104.0	91.0	95.0					14																	64954669		2203	4300	6503	64024422	SO:0001583	missense	7597			X16576	CCDS9765.1	14q23-q24	2013-01-08	2005-05-22	2005-05-22	ENSG00000089775	ENSG00000089775		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13112	protein-coding gene	gene with protein product		194541	"""zinc finger protein 46 (KUP)"", ""chromosome 14 open reading frame 51"""	ZNF46, C14orf51			Standard	NM_006977		Approved	KUP	uc001xhf.3	P24278	OTTHUMG00000141310	ENST00000608382.1:c.280C>T	14.37:g.64954669G>A	ENSP00000476746:p.Arg94Cys		64024422	B3KUX6|Q8IYH9	Missense_Mutation	SNP	ENST00000608382.1	37	CCDS9765.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	21.2	4.120989	0.77436	.	.	ENSG00000089775	ENST00000261683;ENST00000394715	T;T	0.68025	-0.3;-0.3	5.92	5.92	0.95590	BTB/POZ-like (1);BTB/POZ fold (1);	0.000000	0.85682	D	0.000000	D	0.82458	0.5041	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82283	-0.0534	10	0.62326	D	0.03	-19.8211	20.3206	0.98668	0.0:0.0:1.0:0.0	.	94	P24278	ZBT25_HUMAN	C	94	ENSP00000261683:R94C;ENSP00000378204:R94C	ENSP00000261683:R94C	R	-	1	0	ZBTB25	64024422	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.602000	0.82796	2.813000	0.96785	0.561000	0.74099	CGT		0.423	ZBTB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280649.2	NM_006977		Missense_Mutation
ASB2	51676	broad.mit.edu	37	14	94417441	94417441	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr14:94417441C>T	ENST00000315988.4	-	4	1128	c.640G>A	c.(640-642)Gcc>Acc	p.A214T	ASB2_ENST00000555019.1_Missense_Mutation_p.A262T|MIR4506_ENST00000584693.1_RNA|ASB2_ENST00000556337.1_Intron	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	214					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)	p.A214T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		TCCACCTTGGCTCCTCCGCTC	0.602																																																1	Substitution - Missense(1)	ovary(1)	14											117.0	94.0	102.0					14																	94417441		2203	4300	6503	93487194	SO:0001583	missense	51676			AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.640G>A	14.37:g.94417441C>T	ENSP00000320675:p.Ala214Thr		93487194	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	CCDS9915.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041556	0.93685	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507;ENST00000556062	T;T;T;T	0.71341	-0.5;-0.5;-0.5;-0.56	5.62	5.62	0.85841	Ankyrin repeat-containing domain (4);	0.108387	0.64402	D	0.000006	D	0.87366	0.6159	M	0.90483	3.12	0.80722	D	1	D;P;D	0.67145	0.996;0.939;0.996	D;P;D	0.68353	0.957;0.67;0.957	D	0.89287	0.3616	10	0.72032	D	0.01	-3.0E-4	19.6758	0.95932	0.0:1.0:0.0:0.0	.	230;262;214	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	T	262;230;214;160;160;108	ENSP00000451575:A262T;ENSP00000320675:A214T;ENSP00000450940:A160T;ENSP00000451694:A108T	ENSP00000320675:A214T	A	-	1	0	ASB2	93487194	1.000000	0.71417	0.959000	0.39883	0.581000	0.36288	7.818000	0.86416	2.644000	0.89710	0.561000	0.74099	GCC		0.602	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1			Missense_Mutation
NPAP1	23742	broad.mit.edu	37	15	24922882	24922882	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr15:24922882C>A	ENST00000329468.2	+	1	2342	c.1868C>A	c.(1867-1869)cCa>cAa	p.P623Q		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	623					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P623Q(1)									TACACATCCCCACTTCCATTT	0.493																																																1	Substitution - Missense(1)	ovary(1)	15											93.0	108.0	103.0					15																	24922882		2203	4300	6503	22473975	SO:0001583	missense	23742			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1868C>A	15.37:g.24922882C>A	ENSP00000333735:p.Pro623Gln		22473975		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	.	6.346	0.431948	0.12045	.	.	ENSG00000185823	ENST00000329468	T	0.09538	2.97	1.56	-0.643	0.11482	.	.	.	.	.	T	0.05227	0.0139	N	0.22421	0.69	0.09310	N	1	P	0.34587	0.458	B	0.28232	0.087	T	0.34378	-0.9831	9	0.42905	T	0.14	.	2.052	0.03573	0.3107:0.4781:0.0:0.2112	.	623	Q9NZP6	CO002_HUMAN	Q	623	ENSP00000333735:P623Q	ENSP00000333735:P623Q	P	+	2	0	C15orf2	22473975	0.000000	0.05858	0.001000	0.08648	0.443000	0.32047	-0.423000	0.07034	-0.175000	0.10725	0.205000	0.17691	CCA		0.493	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		Missense_Mutation
HYPK	25764	broad.mit.edu	37	15	44092896	44092896	+	Silent	SNP	C	C	A	rs34257400		TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr15:44092896C>A	ENST00000406925.1	+	2	4211	c.100C>A	c.(100-102)Cgg>Agg	p.R34R	HYPK_ENST00000458412.1_Silent_p.R34R|SERINC4_ENST00000299969.6_5'Flank|SERF2_ENST00000600633.1_Silent_p.R34R|SERINC4_ENST00000319327.6_5'Flank|HYPK_ENST00000498605.1_3'UTR|HYPK_ENST00000442995.2_Silent_p.R34R|RP11-296A16.1_ENST00000417761.2_5'Flank|SERF2_ENST00000594896.1_Silent_p.R80R|SERINC4_ENST00000249714.3_5'Flank			Q9NX55	HYPK_HUMAN	huntingtin interacting protein K	34						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R34R(1)					all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		GBM - Glioblastoma multiforme(94;8.1e-07)		GGAGAAGCCACGGAAACATGA	0.592																																																1	Substitution - coding silent(1)	ovary(1)	15											43.0	40.0	41.0					15																	44092896		2198	4298	6496	41880188	SO:0001819	synonymous_variant	25764			AF049613	CCDS10104.1	15q14	2012-10-08	2012-10-08	2012-10-08	ENSG00000242028	ENSG00000242028			18418	protein-coding gene	gene with protein product	"""Huntingtin yeast partner K"""	612784	"""chromosome 15 open reading frame 63"""	C15orf63		9700202, 20154145	Standard	NM_016400		Approved	HSPC136, FLJ20431	uc001ztf.3	Q9NX55	OTTHUMG00000060146	ENST00000406925.1:c.100C>A	15.37:g.44092896C>A			41880188	C9JKJ0|O75408|Q8WUW8|Q9P024	Silent	SNP	ENST00000406925.1	37	CCDS10104.1	SNP	19	Broad																																																																																				0.592	HYPK-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133876.3	NM_016400		Silent
FBN1	2200	broad.mit.edu	37	15	48707945	48707945	+	Silent	SNP	G	G	A	rs193922238		TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr15:48707945G>A	ENST00000316623.5	-	64	8294	c.7839C>T	c.(7837-7839)agC>agT	p.S2613S	FBN1_ENST00000561429.1_5'UTR	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2613	EGF-like 46; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.S2613S(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		AGATGTGAGCGCTGAGGCATT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	15											72.0	68.0	69.0					15																	48707945		2198	4296	6494	46495237	SO:0001819	synonymous_variant	2200			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7839C>T	15.37:g.48707945G>A			46495237	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	ENST00000316623.5	37	CCDS32232.1	SNP	38	Broad																																																																																				0.547	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1			Silent
UNC13C	440279	broad.mit.edu	37	15	54306889	54306889	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr15:54306889C>A	ENST00000260323.11	+	1	1789	c.1789C>A	c.(1789-1791)Ctg>Atg	p.L597M	UNC13C_ENST00000545554.1_Missense_Mutation_p.L597M|UNC13C_ENST00000537900.1_Missense_Mutation_p.L597M	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	597					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.L597M(1)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AACAGCGACCCTGTATGACAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	15											116.0	111.0	113.0					15																	54306889		1961	4144	6105	52094181	SO:0001583	missense	440279			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1789C>A	15.37:g.54306889C>A	ENSP00000260323:p.Leu597Met		52094181	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	G	0	-2.753350	0.00085	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.79940	-1.32;-1.32;-1.32	5.17	1.58	0.23477	.	.	.	.	.	T	0.62454	0.2429	N	0.19112	0.55	0.19575	N	0.999965	B	0.06786	0.001	B	0.06405	0.002	T	0.47661	-0.9100	9	0.36615	T	0.2	.	2.5067	0.04646	0.1267:0.095:0.2222:0.556	.	597	Q8NB66	UN13C_HUMAN	M	597	ENSP00000260323:L597M;ENSP00000438156:L597M;ENSP00000442569:L597M	ENSP00000260323:L597M	L	+	1	2	UNC13C	52094181	0.997000	0.39634	0.283000	0.24790	0.033000	0.12548	2.555000	0.45854	-0.123000	0.11745	-2.098000	0.00363	CTG		0.463	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		Missense_Mutation
VPS13C	54832	broad.mit.edu	37	15	62199518	62199518	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr15:62199518G>T	ENST00000261517.5	-	66	9123	c.9050C>A	c.(9049-9051)aCc>aAc	p.T3017N	VPS13C_ENST00000249837.3_Missense_Mutation_p.T2974N|VPS13C_ENST00000395896.4_Missense_Mutation_p.T3017N|VPS13C_ENST00000395898.3_Missense_Mutation_p.T2974N	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.T3017N(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						AAGTTTTCTGGTACCAGTAGG	0.423																																																1	Substitution - Missense(1)	ovary(1)	15											182.0	163.0	169.0					15																	62199518		2203	4300	6503	59986810	SO:0001583	missense	54832			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.9050C>A	15.37:g.62199518G>T	ENSP00000261517:p.Thr3017Asn		59986810		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	14.75	2.627607	0.46944	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.29397	1.57;1.57;1.57	5.6	4.67	0.58626	Vacuolar protein sorting-associated protein (1);	0.425981	0.27604	N	0.018631	T	0.30070	0.0753	M	0.62723	1.935	0.22050	N	0.999393	B;B;B;B;B	0.33345	0.008;0.008;0.409;0.016;0.336	B;B;B;B;B	0.32583	0.026;0.026;0.091;0.026;0.148	T	0.14531	-1.0469	10	0.23891	T	0.37	.	11.9842	0.53138	0.1419:0.0:0.8581:0.0	.	3017;2974;3017;2974;3017	F5GZG8;Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;.;VP13C_HUMAN	N	2974;3017;3017;3017	ENSP00000249837:T2974N;ENSP00000261517:T3017N;ENSP00000379233:T3017N	ENSP00000249837:T2974N	T	-	2	0	VPS13C	59986810	1.000000	0.71417	0.018000	0.16275	0.993000	0.82548	2.262000	0.43285	1.346000	0.45694	0.585000	0.79938	ACC		0.423	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684		Missense_Mutation
CELF6	60677	broad.mit.edu	37	15	72580883	72580883	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr15:72580883T>G	ENST00000569547.1	-	10	1241	c.1170A>C	c.(1168-1170)agA>agC	p.R390S	CELF6_ENST00000567083.1_Intron|CELF6_ENST00000539635.1_Missense_Mutation_p.R251S|CELF6_ENST00000569311.1_5'Flank|CELF6_ENST00000395258.2_Missense_Mutation_p.R277S|CELF6_ENST00000287202.5_Missense_Mutation_p.R390S|CELF6_ENST00000543764.2_Missense_Mutation_p.R253S|RP11-106M3.2_ENST00000379915.4_RNA|RP11-106M3.3_ENST00000570175.1_RNA			Q96J87	CELF6_HUMAN	CUGBP, Elav-like family member 6	390					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R390S(1)		breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(2)	13						CCTCACCTTCTCTCTGCTGCT	0.637																																																1	Substitution - Missense(1)	ovary(1)	15											56.0	60.0	59.0					15																	72580883		2199	4297	6496	70367937	SO:0001583	missense	60677			AF425606	CCDS10242.1, CCDS53955.1, CCDS53956.1	15q24	2013-02-12	2010-02-19	2010-02-19	ENSG00000140488	ENSG00000140488		"""RNA binding motif (RRM) containing"""	14059	protein-coding gene	gene with protein product		612681	"""Bruno (Drosophila) -like 6, RNA binding protein"", ""bruno-like 6, RNA binding protein (Drosophila)"""	BRUNOL6		10893231	Standard	NM_052840		Approved		uc002auh.2	Q96J87	OTTHUMG00000133444	ENST00000569547.1:c.1170A>C	15.37:g.72580883T>G	ENSP00000454749:p.Arg390Ser		70367937	B4DG28|B4DJB6|Q6PII4|Q6ZNJ7|Q8N607	Missense_Mutation	SNP	ENST00000569547.1	37	CCDS10242.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	15.88	2.964501	0.53507	.	.	ENSG00000140488	ENST00000287202;ENST00000543764;ENST00000395258;ENST00000539635	T;T;T;T	0.43688	0.94;2.29;0.94;0.94	5.61	5.61	0.85477	.	0.000000	0.64402	U	0.000001	T	0.66187	0.2764	M	0.81497	2.545	0.50467	D	0.999874	D;P;B;D	0.57899	0.981;0.843;0.197;0.981	D;B;B;D	0.69824	0.966;0.425;0.027;0.966	T	0.69960	-0.5003	10	0.59425	D	0.04	-7.3125	15.2833	0.73806	0.0:0.0:0.0:1.0	.	253;277;251;390	B4DG28;Q96J87-2;B3KWE6;Q96J87	.;.;.;CELF6_HUMAN	S	390;253;277;251	ENSP00000287202:R390S;ENSP00000439956:R253S;ENSP00000378677:R277S;ENSP00000443162:R251S	ENSP00000287202:R390S	R	-	3	2	CELF6	70367937	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.525000	0.53502	2.259000	0.74868	0.528000	0.53228	AGA		0.637	CELF6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000420180.1	NM_052840		Missense_Mutation
RASGRF1	5923	broad.mit.edu	37	15	79292250	79292250	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr15:79292250G>A	ENST00000419573.3	-	18	2903	c.2629C>T	c.(2629-2631)Cca>Tca	p.P877S	RASGRF1_ENST00000558480.2_Missense_Mutation_p.P861S|RASGRF1_ENST00000394745.3_Missense_Mutation_p.P93S|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	877					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P877S(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GAAAAGAGTGGGAACTCTGCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	15											74.0	70.0	72.0					15																	79292250		2196	4293	6489	77079305	SO:0001583	missense	5923			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2629C>T	15.37:g.79292250G>A	ENSP00000405963:p.Pro877Ser		77079305	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	2.312	-0.357684	0.05138	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.60171	0.21;0.21	4.47	3.47	0.39725	Ras guanine nucleotide exchange factor, domain (1);	0.831378	0.10276	N	0.694192	T	0.27098	0.0664	N	0.03948	-0.315	0.48830	D	0.999715	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.38156	-0.9674	10	0.08837	T	0.75	.	4.1901	0.10417	0.1224:0.0:0.6458:0.2318	.	273;861;879;861	B7Z6Z6;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	S	877;861;93	ENSP00000405963:P877S;ENSP00000378228:P93S	ENSP00000378224:P861S	P	-	1	0	RASGRF1	77079305	1.000000	0.71417	0.882000	0.34594	0.372000	0.29890	3.823000	0.55715	2.320000	0.78422	0.585000	0.79938	CCA		0.552	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891		Missense_Mutation
SH3GL3	6457	broad.mit.edu	37	15	84287022	84287022	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr15:84287022G>A	ENST00000427482.2	+	9	1333	c.1027G>A	c.(1027-1029)Gtg>Atg	p.V343M	SH3GL3_ENST00000564054.1_3'UTR|AC087738.1_ENST00000411248.1_RNA|SH3GL3_ENST00000324537.5_Missense_Mutation_p.V351M|SH3GL3_ENST00000434347.1_Missense_Mutation_p.V351M|SH3GL3_ENST00000535412.1_3'UTR	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	343	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.V351M(1)		central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						GGAAGTGATCGTGCCTTTACC	0.403																																																1	Substitution - Missense(1)	ovary(1)	15											98.0	87.0	90.0					15																	84287022		2203	4300	6503	82078026	SO:0001583	missense	6457			AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.1027G>A	15.37:g.84287022G>A	ENSP00000391372:p.Val343Met		82078026	O43553|O43554	Missense_Mutation	SNP	ENST00000427482.2	37	CCDS10325.2	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950597	0.92660	.	.	ENSG00000140600	ENST00000427482;ENST00000324537;ENST00000434347	T;T;T	0.29917	1.55;1.55;1.55	5.57	5.57	0.84162	Src homology-3 domain (3);	0.182275	0.46758	D	0.000263	T	0.46870	0.1415	L	0.61387	1.9	0.80722	D	1	D;D	0.67145	0.996;0.992	P;P	0.52957	0.648;0.714	T	0.47509	-0.9112	10	0.87932	D	0	-27.9574	18.5386	0.91019	0.0:0.0:1.0:0.0	.	343;351	Q99963;Q99963-3	SH3G3_HUMAN;.	M	343;351;351	ENSP00000391372:V343M;ENSP00000320092:V351M;ENSP00000397871:V351M	ENSP00000320092:V351M	V	+	1	0	SH3GL3	82078026	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.462000	0.80851	2.612000	0.88384	0.655000	0.94253	GTG		0.403	SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347797.1	NM_003027		Missense_Mutation
NOMO1	23420	broad.mit.edu	37	16	14960538	14960538	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr16:14960538C>T	ENST00000287667.7	+	15	1967	c.1796C>T	c.(1795-1797)gCc>gTc	p.A599V		NM_014287.3	NP_055102.3	Q15155	NOMO1_HUMAN	NODAL modulator 1	599						integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)	p.A599V(1)		endometrium(6)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|skin(2)	30						CTGTCTCACGCCATCACTCTG	0.483																																																1	Substitution - Missense(1)	ovary(1)	16											175.0	170.0	172.0					16																	14960538		2190	4299	6489	14868039	SO:0001583	missense	23420			X57398	CCDS10556.1	16p13.11	2008-02-05			ENSG00000103512	ENSG00000103512			30060	protein-coding gene	gene with protein product		609157				1310294, 15257293	Standard	NM_014287		Approved	PM5	uc002dcv.3	Q15155	OTTHUMG00000090541	ENST00000287667.7:c.1796C>T	16.37:g.14960538C>T	ENSP00000287667:p.Ala599Val		14868039	P78421|Q8IW21|Q96DG0	Missense_Mutation	SNP	ENST00000287667.7	37	CCDS10556.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	.	21.9	4.211494	0.79240	.	.	ENSG00000103512	ENST00000287667;ENST00000456867;ENST00000536948	T	0.04156	3.69	3.55	3.55	0.40652	.	0.000000	0.85682	D	0.000000	T	0.11153	0.0272	M	0.70595	2.14	0.80722	D	1	D	0.59357	0.985	P	0.50537	0.643	T	0.14980	-1.0453	10	0.30078	T	0.28	-28.0073	13.0411	0.58899	0.0:1.0:0.0:0.0	.	599	Q15155	NOMO1_HUMAN	V	599;599;432	ENSP00000287667:A599V	ENSP00000287667:A599V	A	+	2	0	NOMO1	14868039	1.000000	0.71417	0.995000	0.50966	0.868000	0.49771	7.453000	0.80700	1.974000	0.57490	0.398000	0.26397	GCC		0.483	NOMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207065.1			Missense_Mutation
SRCAP	10847	broad.mit.edu	37	16	30740862	30740862	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr16:30740862C>G	ENST00000262518.4	+	27	6481	c.6096C>G	c.(6094-6096)ttC>ttG	p.F2032L	SRCAP_ENST00000395059.2_Missense_Mutation_p.F1970L|SRCAP_ENST00000344771.4_Missense_Mutation_p.F1874L	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2032					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.F2032L(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GCACCCAGTTCCCTGACTTAA	0.517																																																1	Substitution - Missense(1)	ovary(1)	16											145.0	129.0	134.0					16																	30740862		2197	4300	6497	30648363	SO:0001583	missense	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.6096C>G	16.37:g.30740862C>G	ENSP00000262518:p.Phe2032Leu		30648363	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	14.00	2.403878	0.42613	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.81996	-1.56;-1.56;-1.56	6.16	-2.33	0.06724	.	0.105479	0.42821	D	0.000647	T	0.79598	0.4473	M	0.76727	2.345	0.31055	N	0.714744	B;B	0.34200	0.433;0.441	B;B	0.34301	0.179;0.087	T	0.76526	-0.2927	10	0.66056	D	0.02	-11.6116	12.0228	0.53352	0.0:0.3621:0.0:0.6379	.	1970;2032	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	L	2032;1970;1874	ENSP00000262518:F2032L;ENSP00000378499:F1970L;ENSP00000343042:F1874L	ENSP00000262518:F2032L	F	+	3	2	SRCAP	30648363	0.998000	0.40836	0.982000	0.44146	0.994000	0.84299	0.625000	0.24477	-0.406000	0.07588	0.650000	0.86243	TTC		0.517	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662		Missense_Mutation
PRSS36	146547	broad.mit.edu	37	16	31154937	31154937	+	Silent	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr16:31154937C>T	ENST00000268281.4	-	7	1000	c.942G>A	c.(940-942)agG>agA	p.R314R	PRSS36_ENST00000569305.1_Silent_p.R314R|PRSS36_ENST00000418068.2_Silent_p.R314R	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	314						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)	p.R314R(1)		kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						AGTTCTCCTCCCTGGGCTCCT	0.622																																																1	Substitution - coding silent(1)	ovary(1)	16											91.0	97.0	95.0					16																	31154937		2197	4300	6497	31062438	SO:0001819	synonymous_variant	146547			AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.942G>A	16.37:g.31154937C>T			31062438	A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Silent	SNP	ENST00000268281.4	37	CCDS32436.1	SNP	22	Broad																																																																																				0.622	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433542.1	NM_173502		Silent
CNGB1	1258	broad.mit.edu	37	16	57957259	57957259	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr16:57957259C>A	ENST00000251102.8	-	18	1621	c.1561G>T	c.(1561-1563)Gag>Tag	p.E521*	CNGB1_ENST00000564448.1_Nonsense_Mutation_p.E515*	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	521					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.E521*(1)		breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						TCTTCAGCCTCATCATCCTCA	0.582																																					Colon(156;1293 1853 16336 28962 38659)											1	Substitution - Nonsense(1)	ovary(1)	16											62.0	66.0	65.0					16																	57957259		2045	4199	6244	56514760	SO:0001587	stop_gained	1258			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.1561G>T	16.37:g.57957259C>A	ENSP00000251102:p.Glu521*		56514760	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Nonsense_Mutation	SNP	ENST00000251102.8	37	CCDS42169.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.479640	0.96307	.	.	ENSG00000070729	ENST00000251102	.	.	.	4.97	4.97	0.65823	.	0.000000	0.49305	D	0.000155	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	13.6163	0.62110	0.0:1.0:0.0:0.0	.	.	.	.	X	521	.	ENSP00000251102:E521X	E	-	1	0	CNGB1	56514760	0.993000	0.37304	1.000000	0.80357	0.584000	0.36387	1.768000	0.38511	2.576000	0.86940	0.655000	0.94253	GAG		0.582	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337167.2	NM_001297		Nonsense_Mutation
FAM92B	339145	broad.mit.edu	37	16	85138981	85138981	+	Silent	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr16:85138981C>A	ENST00000539556.1	-	6	644	c.489G>T	c.(487-489)ctG>ctT	p.L163L		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	163								p.L163L(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						CAGTCTCCTCCAGCTGGAGGG	0.642																																																1	Substitution - coding silent(1)	ovary(1)	16											85.0	68.0	74.0					16																	85138981		2198	4300	6498	83696482	SO:0001819	synonymous_variant	339145				CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.489G>T	16.37:g.85138981C>A			83696482		Silent	SNP	ENST00000539556.1	37	CCDS32500.1	SNP	21	Broad																																																																																				0.642	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_198491		Silent
SPG7	6687	broad.mit.edu	37	16	89576909	89576909	+	Silent	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr16:89576909G>A	ENST00000268704.2	+	2	210	c.195G>A	c.(193-195)ttG>ttA	p.L65L	SPG7_ENST00000341316.2_Silent_p.L65L	NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	65					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.L65L(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		GCTTACAATTGAGACTGCTAA	0.363																																																1	Substitution - coding silent(1)	ovary(1)	16											55.0	54.0	54.0					16																	89576909		2198	4300	6498	88104410	SO:0001819	synonymous_variant	6687			Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.195G>A	16.37:g.89576909G>A			88104410	O75756|Q2TB70|Q58F00|Q96IB0	Silent	SNP	ENST00000268704.2	37	CCDS10977.1	SNP	45	Broad																																																																																				0.363	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119		Silent
ULK2	9706	broad.mit.edu	37	17	19700937	19700937	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr17:19700937C>A	ENST00000395544.4	-	18	2080	c.1581G>T	c.(1579-1581)caG>caT	p.Q527H	ULK2_ENST00000361658.2_Missense_Mutation_p.Q527H|ULK2_ENST00000580130.1_5'UTR	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	527					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q527H(1)		large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TGGGGGCGCTCTGCAGTCTAG	0.512																																																1	Substitution - Missense(1)	ovary(1)	17											53.0	45.0	47.0					17																	19700937		2203	4300	6503	19641529	SO:0001583	missense	9706			AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.1581G>T	17.37:g.19700937C>A	ENSP00000378914:p.Gln527His		19641529	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	37	CCDS11213.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	6.406	0.443029	0.12164	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.26067	1.76;1.76	5.45	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.29093	0.0723	N	0.26130	0.795	0.43039	D	0.994625	D	0.71674	0.998	P	0.61940	0.896	T	0.04307	-1.0961	10	0.10377	T	0.69	-12.129	11.3324	0.49484	0.0:0.8502:0.0:0.1498	.	527	Q8IYT8	ULK2_HUMAN	H	527	ENSP00000354877:Q527H;ENSP00000378914:Q527H	ENSP00000354877:Q527H	Q	-	3	2	ULK2	19641529	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.268000	0.33062	1.541000	0.49316	0.655000	0.94253	CAG		0.512	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683		Missense_Mutation
SEZ6	124925	broad.mit.edu	37	17	27285049	27285049	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr17:27285049G>T	ENST00000317338.12	-	11	2646	c.2218C>A	c.(2218-2220)Cct>Act	p.P740T	PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000335960.6_Intron|SEZ6_ENST00000360295.9_Missense_Mutation_p.P740T|SEZ6_ENST00000442608.3_Missense_Mutation_p.P740T			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	740	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.P740T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			TGGTAGCCAGGGTAGCACTGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	17											77.0	77.0	77.0					17																	27285049		2078	4202	6280	24309175	SO:0001583	missense	124925			AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.2218C>A	17.37:g.27285049G>T	ENSP00000312942:p.Pro740Thr		24309175	B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Missense_Mutation	SNP	ENST00000317338.12	37	CCDS45639.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720947	0.89205	.	.	ENSG00000063015	ENST00000442608;ENST00000360295;ENST00000317338;ENST00000541381	T;T	0.65916	-0.18;-0.18	5.07	5.07	0.68467	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.77025	0.4070	M	0.64630	1.985	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.79317	-0.1853	10	0.87932	D	0	.	16.3161	0.82928	0.0:0.0:1.0:0.0	.	740;740	Q53EL9-3;Q53EL9	.;SEZ6_HUMAN	T	740;740;615;740	ENSP00000403784:P740T;ENSP00000353440:P740T	ENSP00000312942:P615T	P	-	1	0	SEZ6	24309175	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.476000	0.97823	2.531000	0.85337	0.462000	0.41574	CCT		0.582	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397475.3			Missense_Mutation
ASIC2	40	broad.mit.edu	37	17	32483404	32483404	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr17:32483404C>T	ENST00000359872.6	-	1	909	c.148G>A	c.(148-150)Gtg>Atg	p.V50M		NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	50					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)	p.V50M(1)								Amiloride(DB00594)	AGAGAGCCCACGAAGGCCACT	0.592																																																1	Substitution - Missense(1)	ovary(1)	17											48.0	53.0	52.0					17																	32483404		2203	4298	6501	29507517	SO:0001583	missense	40			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.148G>A	17.37:g.32483404C>T	ENSP00000352934:p.Val50Met		29507517	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668593	0.29604	.	.	ENSG00000108684	ENST00000359872	T	0.65549	-0.16	4.96	1.72	0.24424	.	.	.	.	.	T	0.39172	0.1068	N	0.15975	0.35	0.21933	N	0.999462	B	0.30114	0.269	B	0.22753	0.041	T	0.25433	-1.0132	9	0.54805	T	0.06	.	5.8652	0.18771	0.0:0.592:0.0:0.408	.	50	Q16515	ACCN1_HUMAN	M	50	ENSP00000352934:V50M	ENSP00000352934:V50M	V	-	1	0	ACCN1	29507517	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.332000	0.33805	0.681000	0.31386	-0.126000	0.14955	GTG		0.592	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094		Missense_Mutation
TAF15	8148	broad.mit.edu	37	17	34165477	34165477	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr17:34165477A>T	ENST00000588240.1	+	11	948	c.833A>T	c.(832-834)gAc>gTc	p.D278V	TAF15_ENST00000592237.1_Missense_Mutation_p.D187V|TAF15_ENST00000311979.3_Missense_Mutation_p.D275V	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.D278V(1)	TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		ACAGACAAGGACACAGGAAAG	0.398			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																		Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	1	Substitution - Missense(1)	ovary(1)	17											126.0	124.0	125.0					17																	34165477		2203	4300	6503	31189590	SO:0001583	missense	8148			U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.833A>T	17.37:g.34165477A>T	ENSP00000466950:p.Asp278Val		31189590	D3DPM5|Q15775|Q5T077	Missense_Mutation	SNP	ENST00000588240.1	37	CCDS32623.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	19.09	3.759317	0.69763	.	.	ENSG00000172660	ENST00000311979;ENST00000536077	.	.	.	5.98	5.98	0.97165	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.	.	.	.	T	0.67785	0.2930	L	0.42487	1.325	0.80722	D	1	D;D	0.67145	0.996;0.995	D;D	0.67548	0.952;0.92	T	0.67941	-0.5540	8	0.48119	T	0.1	-10.8458	14.4217	0.67187	1.0:0.0:0.0:0.0	.	278;275	Q92804;Q92804-2	RBP56_HUMAN;.	V	278;81	.	ENSP00000309558:D278V	D	+	2	0	TAF15	31189590	0.996000	0.38824	0.999000	0.59377	0.995000	0.86356	2.902000	0.48703	2.289000	0.77006	0.482000	0.46254	GAC		0.398	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449134.1	NM_139215		Missense_Mutation
CACNA1G	8913	broad.mit.edu	37	17	48687291	48687291	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr17:48687291C>G	ENST00000359106.5	+	26	4754	c.4754C>G	c.(4753-4755)gCg>gGg	p.A1585G	CACNA1G_ENST00000505165.1_Missense_Mutation_p.A1585G|CACNA1G_ENST00000510115.1_Intron|CACNA1G_ENST00000514181.1_Intron|CACNA1G_ENST00000442258.2_Intron|CACNA1G_ENST00000510366.1_Intron|CACNA1G_ENST00000515411.1_Intron|CACNA1G_ENST00000514717.1_Missense_Mutation_p.A1528G|CACNA1G_ENST00000507336.1_Intron|CACNA1G_ENST00000514079.1_Missense_Mutation_p.A1592G|CACNA1G_ENST00000512389.1_Intron|CACNA1G_ENST00000513964.1_Intron|CACNA1G_ENST00000507609.1_Missense_Mutation_p.A1585G|CACNA1G_ENST00000513689.2_Intron|CACNA1G_ENST00000502264.1_Missense_Mutation_p.A1562G|CACNA1G_ENST00000507510.2_Missense_Mutation_p.A1585G|CACNA1G_ENST00000515765.1_Intron|CACNA1G_ENST00000515165.1_Missense_Mutation_p.A1585G|CACNA1G_ENST00000354983.4_Intron|CACNA1G_ENST00000503485.1_Missense_Mutation_p.A1551G|CACNA1G_ENST00000360761.4_Missense_Mutation_p.A1562G|CACNA1G_ENST00000429973.2_Intron|CACNA1G_ENST00000507896.1_Intron|CACNA1G_ENST00000352832.5_Intron|CACNA1G_ENST00000358244.5_Intron	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1585					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)	p.A1585G(1)		breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GCCAGCGCTGCGTCAGGTACT	0.572																																																1	Substitution - Missense(1)	ovary(1)	17											63.0	74.0	70.0					17																	48687291		2171	4260	6431	46042290	SO:0001583	missense	8913			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.4754C>G	17.37:g.48687291C>G	ENSP00000352011:p.Ala1585Gly		46042290	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	37	CCDS45730.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	12.63	1.994169	0.35226	.	.	ENSG00000006283	ENST00000360761;ENST00000502264;ENST00000514717;ENST00000503485;ENST00000507510;ENST00000507609;ENST00000515165;ENST00000514079;ENST00000359106;ENST00000505165	D;D;D;D;D;D;D;D;D;D	0.96885	-4.05;-4.03;-4.13;-4.16;-4.0;-4.04;-4.08;-4.07;-4.02;-4.08	5.64	4.61	0.57282	.	0.538329	0.17762	N	0.162863	D	0.86806	0.6021	N	0.03115	-0.41	0.80722	D	1	B;B;B;B;B;B;B;B;B;B;B	0.26512	0.028;0.151;0.043;0.151;0.074;0.0;0.074;0.001;0.024;0.074;0.0	B;B;B;B;B;B;B;B;B;B;B	0.29440	0.05;0.102;0.038;0.102;0.038;0.003;0.102;0.004;0.068;0.024;0.001	T	0.81057	-0.1105	10	0.14252	T	0.57	.	4.2773	0.10815	0.0:0.6002:0.212:0.1878	.	1528;1592;1551;1585;1585;1562;1585;1562;1585;1562;1585	Q19QZ5;Q19QZ6;Q19QZ3;Q19R06;Q19R04;O43497-10;Q19R03;O43497-4;Q19R02;Q2TAC4;O43497	.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN	G	1562;1562;1528;1551;1585;1585;1585;1592;1585;1585	ENSP00000353990:A1562G;ENSP00000425522:A1562G;ENSP00000422407:A1528G;ENSP00000427238:A1551G;ENSP00000423112:A1585G;ENSP00000423045:A1585G;ENSP00000426098:A1585G;ENSP00000423317:A1592G;ENSP00000352011:A1585G;ENSP00000422268:A1585G	ENSP00000352011:A1585G	A	+	2	0	CACNA1G	46042290	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.046000	0.49846	2.660000	0.90430	0.484000	0.47621	GCG		0.572	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896		Missense_Mutation
MSI2	124540	broad.mit.edu	37	17	55334854	55334854	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr17:55334854T>G	ENST00000284073.2	+	3	340	c.131T>G	c.(130-132)tTt>tGt	p.F44C	MSI2_ENST00000416426.2_Missense_Mutation_p.F22C|MSI2_ENST00000322684.3_Missense_Mutation_p.F40C	NM_138962.2	NP_620412.1	Q96DH6	MSI2H_HUMAN	musashi RNA-binding protein 2	44	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)	p.F40C(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	7	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		TTTAGCAAATTTGGAGAAATT	0.388			T	HOXA9	CML																																		Dom	yes		17	17q23.2	124540	musashi homolog 2 (Drosophila)		L	1	Substitution - Missense(1)	ovary(1)	17											58.0	59.0	59.0					17																	55334854		2203	4300	6503	52689853	SO:0001583	missense	124540			BC001526	CCDS11596.1, CCDS11597.1	17q23.2	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	18585	protein-coding gene	gene with protein product		607897	"""musashi homolog 2 (Drosophila)"""			11588182	Standard	NM_138962		Approved		uc002iuz.1	Q96DH6		ENST00000284073.2:c.131T>G	17.37:g.55334854T>G	ENSP00000284073:p.Phe44Cys		52689853	Q7Z6M7|Q8N9T4	Missense_Mutation	SNP	ENST00000284073.2	37	CCDS11596.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	8.919	0.960699	0.18583	.	.	ENSG00000153944	ENST00000416426;ENST00000284073;ENST00000322684	T;T;T	0.22134	1.97;1.97;1.97	3.87	1.25	0.21368	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.105638	0.35013	U	0.003510	T	0.41558	0.1164	M	0.76433	2.335	0.80722	D	1	D;D;D	0.89917	0.986;0.999;1.0	P;D;D	0.79108	0.67;0.978;0.992	T	0.32402	-0.9908	10	0.87932	D	0	.	9.9285	0.41507	0.0:0.0:0.3211:0.6789	.	22;40;44	B4DHE8;Q96DH6-2;Q96DH6	.;.;MSI2H_HUMAN	C	22;44;40	ENSP00000414671:F22C;ENSP00000284073:F44C;ENSP00000313616:F40C	ENSP00000284073:F44C	F	+	2	0	MSI2	52689853	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.150000	0.77403	0.446000	0.26666	0.379000	0.24179	TTT		0.388	MSI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441813.1			Missense_Mutation
TRIM37	4591	broad.mit.edu	37	17	57057692	57057692	+	IGR	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr17:57057692G>T	ENST00000393066.3	-	0	3622				PPM1E_ENST00000308249.2_Missense_Mutation_p.G523V	NM_001005207.2	NP_001005207.1	O94972	TRI37_HUMAN	tripartite motif containing 37						aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G523V(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					GAGAATCATGGAGAGTGCAAA	0.493									Mulibrey Nanism																																							1	Substitution - Missense(1)	ovary(1)	17											111.0	109.0	109.0					17																	57057692		2203	4300	6503	54412474	SO:0001628	intergenic_variant	22843	Familial Cancer Database	Perheentupa syndrome	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972			17.37:g.57057692G>T			54412474	Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000393066.3	37	CCDS45746.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	19.26	3.792943	0.70452	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.27557	1.66	5.71	5.71	0.89125	.	0.211848	0.49916	D	0.000137	T	0.48241	0.1489	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.993	T	0.45877	-0.9231	10	0.87932	D	0	-8.9054	19.4414	0.94823	0.0:0.0:1.0:0.0	.	532;523	Q8WY54-3;Q8WY54-2	.;.	V	523;374	ENSP00000312411:G523V	ENSP00000312411:G523V	G	+	2	0	PPM1E	54412474	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.198000	0.94994	2.710000	0.92621	0.491000	0.48974	GGA		0.493	TRIM37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445928.1	NM_015294		Missense_Mutation
SEC14L1	6397	broad.mit.edu	37	17	75187363	75187364	+	Missense_Mutation	DNP	GG	GG	CC			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr17:75187363_75187364GG>CC	ENST00000413679.2	+	5	617_618	c.314_315GG>CC	c.(313-315)cGG>cCC	p.R105P	SEC14L1_ENST00000392476.2_Missense_Mutation_p.R105P|SEC14L1_ENST00000443798.4_Missense_Mutation_p.R105P|SEC14L1_ENST00000585618.1_Missense_Mutation_p.R105P|SEC14L1_ENST00000430767.4_Missense_Mutation_p.R105P|SEC14L1_ENST00000436233.4_Missense_Mutation_p.R105P|SEC14L1_ENST00000431431.2_Missense_Mutation_p.R71P|SEC14L1_ENST00000591437.1_Missense_Mutation_p.R71P	NM_001143998.1|NM_001143999.1|NM_003003.3	NP_001137470|NP_001137471|NP_002994	Q92503	S14L1_HUMAN	SEC14-like 1 (S. cerevisiae)	105	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.R105P(1)|p.R105L(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(2)	31						TTTTCCAATCGGGTCATCATTA	0.416																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	17																																								72698959	SO:0001583	missense	6397			D67029	CCDS11752.1, CCDS42385.1, CCDS45789.1	17q25.2	2008-02-01	2001-11-28			ENSG00000129657			10698	protein-coding gene	gene with protein product		601504	"""SEC14 (S. cerevisiae)-like 1"""	SEC14L		8697811	Standard	NM_001143998		Approved	PRELID4A	uc002jto.3	Q92503		Exception_encountered	17.37:g.75187363_75187364delinsCC	ENSP00000394716:p.Arg105Pro		72698958	A8K4E8|B4DDI5|D5G3K1|Q99780	Missense_Mutation	DNP	ENST00000413679.2	37	CCDS11752.1	DNP	39	Broad																																																																																				0.416	SEC14L1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000436240.1	NM_003003		Missense_Mutation
DSG1	1828	broad.mit.edu	37	18	28923481	28923481	+	Missense_Mutation	SNP	G	G	T	rs373183283		TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr18:28923481G>T	ENST00000257192.4	+	12	1968	c.1756G>T	c.(1756-1758)Gtt>Ttt	p.V586F	RP11-534N16.1_ENST00000581856.1_RNA|RNU6-167P_ENST00000384292.1_RNA|RP11-534N16.1_ENST00000578119.1_RNA|DSG1_ENST00000462981.2_5'Flank	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	586					apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)	p.V586F(1)		NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			CTTTGAGCCTGTTCCCGAATG	0.483																																																1	Substitution - Missense(1)	ovary(1)	18											199.0	167.0	178.0					18																	28923481		2203	4300	6503	27177479	SO:0001583	missense	1828			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.1756G>T	18.37:g.28923481G>T	ENSP00000257192:p.Val586Phe		27177479	B7Z845	Missense_Mutation	SNP	ENST00000257192.4	37	CCDS11896.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068496	0.76301	.	.	ENSG00000134760	ENST00000257192	T	0.66995	-0.24	5.45	5.45	0.79879	.	0.000000	0.56097	D	0.000029	T	0.81413	0.4817	M	0.79258	2.445	0.80722	D	1	D	0.71674	0.998	D	0.66602	0.945	T	0.83198	-0.0080	10	0.62326	D	0.03	.	17.0457	0.86501	0.0:0.0:1.0:0.0	.	586	Q02413	DSG1_HUMAN	F	586	ENSP00000257192:V586F	ENSP00000257192:V586F	V	+	1	0	DSG1	27177479	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	5.725000	0.68507	2.566000	0.86566	0.655000	0.94253	GTT		0.483	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254947.1	NM_001942		Missense_Mutation
GALNT1	2589	broad.mit.edu	37	18	33234701	33234701	+	Silent	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr18:33234701G>A	ENST00000269195.5	+	1	178	c.75G>A	c.(73-75)ctG>ctA	p.L25L	GALNT1_ENST00000591081.1_Silent_p.L25L|GALNT1_ENST00000537549.1_5'UTR	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	25					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L25L(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						TGTTCCTGCTGCTTTACTTCA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	18											105.0	89.0	95.0					18																	33234701		2203	4300	6503	31488699	SO:0001819	synonymous_variant	2589				CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.75G>A	18.37:g.33234701G>A			31488699	Q86TJ7|Q9UM86	Silent	SNP	ENST00000269195.5	37	CCDS11915.1	SNP	46	Broad																																																																																				0.393	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255771.2	NM_020474		Silent
PTPRS	5802	broad.mit.edu	37	19	5265025	5265025	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:5265025G>A	ENST00000587303.1	-	4	661	c.562C>T	c.(562-564)Cga>Tga	p.R188*	PTPRS_ENST00000588012.1_Nonsense_Mutation_p.R188*|PTPRS_ENST00000592099.1_Nonsense_Mutation_p.R188*|PTPRS_ENST00000372412.4_Splice_Site_p.R188*|PTPRS_ENST00000353284.2_Nonsense_Mutation_p.R188*|PTPRS_ENST00000357368.4_Nonsense_Mutation_p.R188*|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000348075.2_Nonsense_Mutation_p.R188*|PTPRS_ENST00000262963.6_Nonsense_Mutation_p.R188*			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	188	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R188*(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	TCACCTGATCGCAGCTGTTTG	0.617																																																1	Substitution - Nonsense(1)	ovary(1)	19											114.0	82.0	93.0					19																	5265025		2203	4300	6503	5216025	SO:0001587	stop_gained	5802			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.562C>T	19.37:g.5265025G>A	ENSP00000467537:p.Arg188*		5216025	O75255|O75870|Q15718|Q16341|Q2M3R7	Nonsense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361900	0.82353	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	.	.	.	3.31	-0.663	0.11410	.	0.000000	0.56097	U	0.000030	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4744	0.50288	0.0:0.0:0.4362:0.5638	.	.	.	.	X	214;188;188;188;188;188;188;188;188;188	.	ENSP00000262963:R188X	R	-	1	2	PTPRS	5216025	0.236000	0.23804	0.525000	0.27900	0.108000	0.19459	0.486000	0.22340	0.200000	0.20447	0.561000	0.74099	CGA		0.617	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2			Nonsense_Mutation
CATSPERD	257062	broad.mit.edu	37	19	5772900	5772900	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:5772900C>G	ENST00000381624.3	+	20	1926	c.1865C>G	c.(1864-1866)gCc>gGc	p.A622G	CATSPERD_ENST00000309164.7_3'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	622					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)		p.A622G(1)									GCCCAGTCGGCCATGTGTACC	0.547																																																1	Substitution - Missense(1)	ovary(1)	19											55.0	60.0	58.0					19																	5772900		1999	4169	6168	5723900	SO:0001583	missense	257062			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.1865C>G	19.37:g.5772900C>G	ENSP00000371037:p.Ala622Gly		5723900	Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	37	CCDS12149.2	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851732	0.51270	.	.	ENSG00000174898	ENST00000381624;ENST00000381613	T	0.27402	1.67	3.22	3.22	0.36961	.	0.377447	0.19159	N	0.121253	T	0.47838	0.1467	L	0.57536	1.79	0.39284	D	0.964614	D	0.89917	1.0	D	0.85130	0.997	T	0.49184	-0.8966	10	0.52906	T	0.07	-22.5625	10.1765	0.42941	0.0:1.0:0.0:0.0	.	622	Q86XM0	TM146_HUMAN	G	622;291	ENSP00000371037:A622G	ENSP00000371026:A291G	A	+	2	0	TMEM146	5723900	0.265000	0.24102	0.030000	0.17652	0.001000	0.01503	1.584000	0.36589	2.105000	0.64084	0.561000	0.74099	GCC		0.547	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784		Missense_Mutation
INSR	3643	broad.mit.edu	37	19	7122978	7122978	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:7122978G>T	ENST00000302850.5	-	18	3423	c.3281C>A	c.(3280-3282)tCc>tAc	p.S1094Y	INSR_ENST00000341500.5_Missense_Mutation_p.S1082Y	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	1094	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.S1094Y(1)		breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CTGGCCCTTGGACACCACTCC	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											41.0	35.0	37.0					19																	7122978		2202	4299	6501	7073978	SO:0001583	missense	3643			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.3281C>A	19.37:g.7122978G>T	ENSP00000303830:p.Ser1094Tyr		7073978	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	CCDS12176.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	22.2	4.257060	0.80246	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	D;D	0.83075	-1.68;-1.68	5.15	4.11	0.48088	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.148934	0.31145	N	0.008163	D	0.83575	0.5284	N	0.17674	0.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85106	0.0960	10	0.87932	D	0	.	11.591	0.50945	0.0874:0.0:0.9126:0.0	.	1082;1094	P06213-2;P06213	.;INSR_HUMAN	Y	1094;1082	ENSP00000303830:S1094Y;ENSP00000342838:S1082Y	ENSP00000303830:S1094Y	S	-	2	0	INSR	7073978	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.501000	0.81600	1.166000	0.42689	0.561000	0.74099	TCC		0.622	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1			Missense_Mutation
COL5A3	50509	broad.mit.edu	37	19	10084475	10084475	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:10084475C>A	ENST00000264828.3	-	49	3654	c.3569G>T	c.(3568-3570)gGg>gTg	p.G1190V		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1190	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.G1190V(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TCCAGGCAGCCCTGGAGTGCC	0.577																																																1	Substitution - Missense(1)	ovary(1)	19											74.0	83.0	80.0					19																	10084475		2203	4300	6503	9945475	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3569G>T	19.37:g.10084475C>A	ENSP00000264828:p.Gly1190Val		9945475	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707704	0.68615	.	.	ENSG00000080573	ENST00000264828	D	0.99637	-6.29	4.28	4.28	0.50868	.	0.159107	0.40554	U	0.001063	D	0.99539	0.9835	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97931	1.0320	10	0.87932	D	0	.	14.245	0.65983	0.0:1.0:0.0:0.0	.	1190	P25940	CO5A3_HUMAN	V	1190	ENSP00000264828:G1190V	ENSP00000264828:G1190V	G	-	2	0	COL5A3	9945475	0.997000	0.39634	0.996000	0.52242	0.671000	0.39405	4.889000	0.63171	2.192000	0.70111	0.491000	0.48974	GGG		0.577	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719		Missense_Mutation
DNM2	1785	broad.mit.edu	37	19	10908071	10908071	+	Intron	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:10908071C>A	ENST00000355667.6	+	11	1415				DNM2_ENST00000359692.6_Intron|DNM2_ENST00000408974.4_Silent_p.T404T|DNM2_ENST00000585892.1_Intron|DNM2_ENST00000314646.5_Silent_p.T404T|DNM2_ENST00000389253.4_Silent_p.T404T	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			GGCTCTTCACCCCCGACATGG	0.552			"""F, N, Splice, Mis, O"""		ETP ALL																																		Rec	yes		19	19p13.2	1785	dynamin 2		L	0			19											46.0	45.0	46.0					19																	10908071		2203	4300	6503	10769071	SO:0001627	intron_variant	1785				CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.1336-1091C>A	19.37:g.10908071C>A			10769071	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Silent	SNP	ENST00000355667.6	37	CCDS45968.1	SNP	22	Broad																																																																																				0.552	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1	NM_004945		Silent
NDUFA13	51079	broad.mit.edu	37	19	19627083	19627083	+	Silent	SNP	G	G	C	rs11552886		TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:19627083G>C	ENST00000507754.4	+	1	520	c.36G>C	c.(34-36)ccG>ccC	p.P12P	NDUFA13_ENST00000503283.1_Silent_p.P12P|CTC-260F20.3_ENST00000555938.1_Silent_p.P12P|NDUFA13_ENST00000512771.3_Silent_p.P12P|TSSK6_ENST00000360913.3_5'Flank|CTC-260F20.3_ENST00000586674.1_3'UTR|NDUFA13_ENST00000252576.5_Silent_p.P95P|YJEFN3_ENST00000608404.1_Silent_p.P12P|TSSK6_ENST00000585580.3_5'Flank|NDUFA13_ENST00000428459.2_Silent_p.P12P			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13	12					apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)	p.P95P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						ACATGCCTCCGCCGGGGGGCT	0.622																																																1	Substitution - coding silent(1)	ovary(1)	19											38.0	43.0	41.0					19																	19627083		2203	4300	6503	19488083	SO:0001819	synonymous_variant	51079			AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211	ENST00000507754.4:c.36G>C	19.37:g.19627083G>C			19488083	B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Silent	SNP	ENST00000507754.4	37	CCDS12404.2	SNP	38	Broad																																																																																				0.622	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367916.6	NM_015965		Silent
ZNF546	339327	broad.mit.edu	37	19	40513243	40513243	+	Silent	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:40513243C>T	ENST00000347077.4	+	5	450	c.234C>T	c.(232-234)gaC>gaT	p.D78D	ZNF546_ENST00000600094.1_Silent_p.D52D|ZNF546_ENST00000596894.1_Intron	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	78	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D78D(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGTGCCTGGACGCTGTGCAGA	0.423																																																1	Substitution - coding silent(1)	ovary(1)	19											133.0	116.0	122.0					19																	40513243		2203	4300	6503	45205083	SO:0001819	synonymous_variant	339327			BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.234C>T	19.37:g.40513243C>T			45205083	A8K913	Silent	SNP	ENST00000347077.4	37	CCDS12548.1	SNP	19	Broad																																																																																				0.423	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	NM_178544		Silent
GRIN2D	2906	broad.mit.edu	37	19	48925110	48925110	+	Silent	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:48925110G>A	ENST00000263269.3	+	10	2248	c.2160G>A	c.(2158-2160)aaG>aaA	p.K720K		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	720					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.K720K(1)		autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCACGGAGAAGAACATCCGCA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	19											96.0	88.0	91.0					19																	48925110		2203	4300	6503	53616922	SO:0001819	synonymous_variant	2906			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2160G>A	19.37:g.48925110G>A			53616922		Silent	SNP	ENST00000263269.3	37	CCDS12719.1	SNP	33	Broad																																																																																				0.622	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1			Silent
GRIN2D	2906	broad.mit.edu	37	19	48925177	48925177	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:48925177G>A	ENST00000263269.3	+	10	2315	c.2227G>A	c.(2227-2229)Gaa>Aaa	p.E743K		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	743					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.E743K(1)		autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCGCGTAGAGGAAGCGCTCAC	0.637																																																1	Substitution - Missense(1)	ovary(1)	19											72.0	68.0	69.0					19																	48925177		2203	4300	6503	53616989	SO:0001583	missense	2906			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2227G>A	19.37:g.48925177G>A	ENSP00000263269:p.Glu743Lys		53616989		Missense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.706286	0.96821	.	.	ENSG00000105464	ENST00000263269	T	0.57273	0.41	4.57	4.57	0.56435	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.183542	0.45126	D	0.000387	T	0.53142	0.1778	M	0.65975	2.015	0.48830	D	0.999715	P	0.48089	0.905	B	0.40375	0.327	T	0.64592	-0.6371	10	0.87932	D	0	.	16.6522	0.85219	0.0:0.0:1.0:0.0	.	743	O15399	NMDE4_HUMAN	K	743	ENSP00000263269:E743K	ENSP00000263269:E743K	E	+	1	0	GRIN2D	53616989	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.582000	0.98214	2.538000	0.85594	0.655000	0.94253	GAA		0.637	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1			Missense_Mutation
GYS1	2997	broad.mit.edu	37	19	49485527	49485527	+	Silent	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:49485527G>C	ENST00000323798.3	-	7	1243	c.1047C>G	c.(1045-1047)ctC>ctG	p.L349L	GYS1_ENST00000263276.6_Silent_p.L285L|GYS1_ENST00000541188.1_Silent_p.L269L|GYS1_ENST00000540532.1_Nonsense_Mutation_p.S230*|GYS1_ENST00000544287.1_5'UTR	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	349					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)	p.L349L(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		GCAGATAGTTGAGCCGAGCCA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	19											96.0	90.0	92.0					19																	49485527		2203	4300	6503	54177339	SO:0001819	synonymous_variant	2997				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1047C>G	19.37:g.49485527G>C			54177339	Q9BTT9	Silent	SNP	ENST00000323798.3	37	CCDS12747.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	39	7.521834	0.98335	.	.	ENSG00000104812	ENST00000540532	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.44816	A	0.997827	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-37.2587	16.6519	0.85218	0.0:0.0:1.0:0.0	.	.	.	.	X	230	.	ENSP00000445197:S230X	S	-	2	0	GYS1	54177339	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.971000	0.29396	2.613000	0.88420	0.650000	0.86243	TCA		0.537	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103		Silent
KIR3DL3	115653	broad.mit.edu	37	19	55246748	55246748	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:55246748T>G	ENST00000291860.1	+	6	996	c.978T>G	c.(976-978)atT>atG	p.I326M	CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000538269.1_Intron	NM_153443.3	NP_703144.2	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3	326						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I326M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(3)|prostate(1)|skin(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		ACGTTCTGATTGGGACCTCAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	19											290.0	235.0	254.0					19																	55246748		2002	3956	5958	59938560	SO:0001583	missense	115653			AF352324	CCDS12903.1	19q13.4	2014-05-22			ENSG00000242019	ENSG00000242019		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16312	protein-coding gene	gene with protein product		610095				11513144	Standard	NM_153443		Approved	KIRC1, KIR3DL7, KIR44, CD158z	uc002qgu.1	Q8N743	OTTHUMG00000065884	ENST00000291860.1:c.978T>G	19.37:g.55246748T>G	ENSP00000291860:p.Ile326Met		59938560	A9PL62|A9PL64|A9PL65|A9PL66|A9PL67|A9PL68|A9PZV4|A9PZV7|A9PZV8|A9Q066|A9Q0R5|A9Q242|A9Q250|A9Q251|O95056|Q1X775|Q1X777|Q1X778|Q1X779|Q1X780|Q1X781|Q1X782|Q1X783|Q7Z7N4|Q8NHI2|Q8NHI3|Q9UEI4	Missense_Mutation	SNP	ENST00000291860.1	37	CCDS12903.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	t	9.845	1.192017	0.21954	.	.	ENSG00000242019	ENST00000291860	T	0.00542	6.69	0.929	0.929	0.19449	.	2.274410	0.03864	U	0.274447	T	0.02610	0.0079	H	0.94264	3.515	0.09310	N	0.999999	P	0.40534	0.72	P	0.53954	0.738	T	0.35919	-0.9769	10	0.87932	D	0	.	4.1028	0.10023	0.0:0.0:0.0:1.0	.	326	Q8N743	KI3L3_HUMAN	M	326	ENSP00000291860:I326M	ENSP00000291860:I326M	I	+	3	3	KIR3DL3	59938560	0.001000	0.12720	0.012000	0.15200	0.014000	0.08584	-0.184000	0.09698	0.661000	0.30985	0.155000	0.16302	ATT		0.453	KIR3DL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141147.1	NM_153443		Missense_Mutation
NLRP8	126205	broad.mit.edu	37	19	56463906	56463906	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr19:56463906A>C	ENST00000291971.3	+	2	441	c.370A>C	c.(370-372)Att>Ctt	p.I124L	NLRP8_ENST00000590542.1_Missense_Mutation_p.I124L	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	124	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.I124L(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TGTTACAGCCATTCTGCCTAC	0.493																																																1	Substitution - Missense(1)	ovary(1)	19											157.0	144.0	149.0					19																	56463906		2203	4300	6503	61155718	SO:0001583	missense	126205			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.370A>C	19.37:g.56463906A>C	ENSP00000291971:p.Ile124Leu		61155718	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	0.191	-1.053070	0.01965	.	.	ENSG00000179709	ENST00000291971	T	0.72835	-0.69	1.77	-2.41	0.06562	Pyrin (1);DEATH-like (2);	.	.	.	.	T	0.42200	0.1192	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.004;0.003	B;B	0.09377	0.004;0.003	T	0.13656	-1.0501	9	0.27785	T	0.31	.	3.5326	0.07782	0.3111:0.4612:0.0:0.2277	.	124;124	Q86W28-2;Q86W28	.;NALP8_HUMAN	L	124	ENSP00000291971:I124L	ENSP00000291971:I124L	I	+	1	0	NLRP8	61155718	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-0.171000	0.09883	-0.823000	0.04301	-0.622000	0.04023	ATT		0.493	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811		Missense_Mutation
NDUFAF7	55471	broad.mit.edu	37	2	37473247	37473247	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr2:37473247T>C	ENST00000002125.4	+	8	885	c.845T>C	c.(844-846)aTc>aCc	p.I282T	NDUFAF7_ENST00000483999.1_3'UTR|NDUFAF7_ENST00000336237.6_Missense_Mutation_p.I184T	NM_144736.4	NP_653337.1	Q7L592	NDUF7_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 7	282					methylation (GO:0032259)|mitochondrial respiratory chain complex I assembly (GO:0032981)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|methyltransferase activity (GO:0008168)	p.I282T(1)									GGTGTTATCATCGAGGAACTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											213.0	168.0	183.0					2																	37473247		2203	4300	6503	37326751	SO:0001583	missense	55471				CCDS1788.1, CCDS42673.1	2p22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000003509	ENSG00000003509		"""Mitochondrial respiratory chain complex assembly factors"""	28816	protein-coding gene	gene with protein product	"""mitochondrial dysfunction protein A homolog"""	615898	"""chromosome 2 open reading frame 56"""	C2orf56			Standard	NM_144736		Approved	PRO1853, MidA	uc002rqa.4	Q7L592	OTTHUMG00000128468	ENST00000002125.4:c.845T>C	2.37:g.37473247T>C	ENSP00000002125:p.Ile282Thr		37326751	Q7Z399|Q9P1G3	Missense_Mutation	SNP	ENST00000002125.4	37	CCDS1788.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	15.98	2.991283	0.54041	.	.	ENSG00000003509	ENST00000002125;ENST00000336237;ENST00000431821;ENST00000439218	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09	5.67	5.67	0.87782	.	0.264992	0.43747	D	0.000530	T	0.72309	0.3444	L	0.41710	1.295	0.42902	D	0.994235	B;B;B;B	0.24258	0.072;0.1;0.082;0.033	B;B;B;B	0.26517	0.07;0.06;0.036;0.07	T	0.69529	-0.5121	10	0.45353	T	0.12	-14.3991	15.9053	0.79423	0.0:0.0:0.0:1.0	.	255;211;184;282	E7EUC2;B4DQY3;Q7L592-2;Q7L592	.;.;.;MIDA_HUMAN	T	282;184;203;240	ENSP00000002125:I282T;ENSP00000337431:I184T;ENSP00000399207:I203T;ENSP00000394436:I240T	ENSP00000002125:I282T	I	+	2	0	C2orf56	37326751	1.000000	0.71417	0.344000	0.25628	0.791000	0.44710	7.565000	0.82337	2.156000	0.67533	0.533000	0.62120	ATC		0.408	NDUFAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250267.1	NM_144736		Missense_Mutation
ADD2	119	broad.mit.edu	37	2	70919667	70919667	+	Silent	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr2:70919667C>T	ENST00000264436.4	-	7	1017	c.573G>A	c.(571-573)ctG>ctA	p.L191L	ADD2_ENST00000407644.2_Silent_p.L191L|ADD2_ENST00000413157.2_Silent_p.L191L|ADD2_ENST00000430656.1_Silent_p.L207L|ADD2_ENST00000355733.3_Silent_p.L191L|AC007395.3_ENST00000457851.1_RNA	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	191					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)	p.L191L(1)		autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CCACCTCTCCCAGAATGTTCA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	2											88.0	72.0	78.0					2																	70919667		2203	4300	6503	70773175	SO:0001819	synonymous_variant	119			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.573G>A	2.37:g.70919667C>T			70773175	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Silent	SNP	ENST00000264436.4	37	CCDS1906.1	SNP	21	Broad																																																																																				0.622	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617		Silent
C2orf78	388960	broad.mit.edu	37	2	74040994	74040994	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr2:74040994C>A	ENST00000409561.1	+	2	609	c.488C>A	c.(487-489)gCc>gAc	p.A163D		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	163										cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						TCTATGACAGCCCAGTATTAT	0.433																																																0			2											70.0	63.0	65.0					2																	74040994		1922	4136	6058	73894502	SO:0001583	missense	388960			AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.488C>A	2.37:g.74040994C>A	ENSP00000387124:p.Ala163Asp		73894502		Missense_Mutation	SNP	ENST00000409561.1	37	CCDS46338.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	10.13	1.265866	0.23136	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.31247	1.5	5.23	2.32	0.28847	.	1.209550	0.06664	U	0.764968	T	0.47801	0.1465	M	0.69823	2.125	0.09310	N	1	D	0.69078	0.997	D	0.63283	0.913	T	0.17048	-1.0382	10	0.46703	T	0.11	0.1088	3.4776	0.07590	0.1782:0.5576:0.1721:0.0921	.	163	A6NCI8	CB078_HUMAN	D	163	ENSP00000387124:A163D	ENSP00000340692:A163D	A	+	2	0	C2orf78	73894502	0.000000	0.05858	0.001000	0.08648	0.058000	0.15608	-0.287000	0.08388	0.660000	0.30964	-0.182000	0.12963	GCC		0.433	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474		Missense_Mutation
TET3	200424	broad.mit.edu	37	2	74275380	74275380	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr2:74275380G>A	ENST00000409262.3	+	1	1931	c.1931G>A	c.(1930-1932)gGa>gAa	p.G644E		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	644					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)	p.G644E(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAGGAGGGAGGACAGGAGGCC	0.567																																																1	Substitution - Missense(1)	ovary(1)	2											45.0	58.0	54.0					2																	74275380		2027	4192	6219	74128888	SO:0001583	missense	200424				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.1931G>A	2.37:g.74275380G>A	ENSP00000386869:p.Gly644Glu		74128888	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	37	CCDS46339.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	7.988	0.752638	0.15778	.	.	ENSG00000187605	ENST00000305799;ENST00000409262;ENST00000233310	T;T	0.22539	1.95;2.8	5.38	3.6	0.41247	.	.	.	.	.	T	0.12603	0.0306	L	0.34521	1.04	0.25830	N	0.984174	B	0.24258	0.1	B	0.18561	0.022	T	0.33317	-0.9873	9	0.05351	T	0.99	.	8.5727	0.33578	0.237:0.0:0.763:0.0	.	644	O43151	TET3_HUMAN	E	686;644;644	ENSP00000307803:G686E;ENSP00000386869:G644E	ENSP00000233310:G644E	G	+	2	0	TET3	74128888	1.000000	0.71417	0.976000	0.42696	0.718000	0.41266	2.350000	0.44063	0.846000	0.35142	-0.136000	0.14681	GGA		0.567	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4			Missense_Mutation
ARHGEF4	50649	broad.mit.edu	37	2	131801135	131801135	+	Silent	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr2:131801135C>T	ENST00000326016.5	+	11	2097	c.1578C>T	c.(1576-1578)caC>caT	p.H526H	ARHGEF4_ENST00000409303.1_Silent_p.H466H|ARHGEF4_ENST00000392953.3_Silent_p.H526H|ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000525839.1_Silent_p.H526H|ARHGEF4_ENST00000355771.3_Silent_p.H455H	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	526	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.H526H(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		TCTTTGACCACCAGCTCATCT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	2											114.0	102.0	106.0					2																	131801135		2203	4300	6503	131517605	SO:0001819	synonymous_variant	50649			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.1578C>T	2.37:g.131801135C>T			131517605	Q9HDC6|Q9UPP0	Silent	SNP	ENST00000326016.5	37	CCDS2165.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	8.901	0.956474	0.18507	.	.	ENSG00000136002	ENST00000532720	.	.	.	5.02	2.23	0.28157	.	.	.	.	.	T	0.55162	0.1903	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43925	-0.9361	4	.	.	.	.	7.3004	0.26418	0.0:0.6408:0.0:0.3592	.	.	.	.	S	143	.	.	P	+	1	0	ARHGEF4	131517605	0.983000	0.35010	1.000000	0.80357	0.972000	0.66771	0.180000	0.16860	0.163000	0.19507	0.561000	0.74099	CCA		0.562	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4			Silent
PKP4	8502	broad.mit.edu	37	2	159488436	159488436	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr2:159488436T>C	ENST00000389759.3	+	8	1437	c.1325T>C	c.(1324-1326)tTg>tCg	p.L442S	PKP4_ENST00000389757.3_Missense_Mutation_p.L442S	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	442					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)		p.L442S(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						CAGACGGCGTTGTATCGCACA	0.488										HNSCC(62;0.18)																																						1	Substitution - Missense(1)	ovary(1)	2											104.0	96.0	99.0					2																	159488436		2203	4300	6503	159196682	SO:0001583	missense	8502			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.1325T>C	2.37:g.159488436T>C	ENSP00000374409:p.Leu442Ser		159196682	Q86W91	Missense_Mutation	SNP	ENST00000389759.3	37	CCDS33305.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	20.8	4.045336	0.75846	.	.	ENSG00000144283	ENST00000428353;ENST00000389757;ENST00000389759	T;T	0.74842	-0.87;-0.88	5.97	5.97	0.96955	.	1.402880	0.04440	N	0.370767	T	0.75774	0.3895	N	0.22421	0.69	0.43846	D	0.996432	P;P;P;P;P	0.48640	0.857;0.626;0.702;0.913;0.746	P;B;B;P;P	0.49502	0.613;0.282;0.367;0.448;0.57	T	0.62440	-0.6854	10	0.51188	T	0.08	-5.1392	16.4608	0.84044	0.0:0.0:0.0:1.0	.	294;398;442;442;293	Q6LCG8;Q4W5T8;Q99569-2;Q99569;F8W7E2	.;.;.;PKP4_HUMAN;.	S	293;442;442	ENSP00000374407:L442S;ENSP00000374409:L442S	ENSP00000374407:L442S	L	+	2	0	PKP4	159196682	0.991000	0.36638	0.758000	0.31321	0.974000	0.67602	6.557000	0.73937	2.288000	0.76882	0.533000	0.62120	TTG		0.488	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1			Missense_Mutation
PDE11A	50940	broad.mit.edu	37	2	178769908	178769908	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr2:178769908G>T	ENST00000286063.6	-	3	1395	c.1078C>A	c.(1078-1080)Cag>Aag	p.Q360K	PDE11A_ENST00000497003.1_5'UTR|PDE11A_ENST00000409504.1_Missense_Mutation_p.Q2K|PDE11A_ENST00000449286.2_Missense_Mutation_p.Q2K|PDE11A_ENST00000358450.4_Missense_Mutation_p.Q110K	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	360	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)	p.Q360K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	AGATACATCTGCATAACCTGG	0.368									Primary Pigmented Nodular Adrenocortical Disease, Familial																																							1	Substitution - Missense(1)	ovary(1)	2											101.0	89.0	93.0					2																	178769908		2203	4300	6503	178478154	SO:0001583	missense	50940	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1078C>A	2.37:g.178769908G>T	ENSP00000286063:p.Gln360Lys		178478154	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	ENST00000286063.6	37	CCDS33334.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	10.92	1.486015	0.26686	.	.	ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000409504;ENST00000431253;ENST00000449286	T;T;T;T	0.70282	-0.47;-0.47;-0.18;-0.18	5.36	4.43	0.53597	GAF (2);	0.122077	0.56097	D	0.000026	T	0.58119	0.2100	L	0.28649	0.875	0.80722	D	1	B;B	0.28178	0.125;0.202	B;B	0.32624	0.149;0.14	T	0.52571	-0.8558	10	0.08837	T	0.75	.	14.9329	0.70929	0.0:0.2542:0.7458:0.0	.	110;360	Q9HCR9-2;Q9HCR9	.;PDE11_HUMAN	K	360;110;2;35;2	ENSP00000286063:Q360K;ENSP00000351232:Q110K;ENSP00000386539:Q2K;ENSP00000390599:Q2K	ENSP00000286063:Q360K	Q	-	1	0	PDE11A	178478154	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	6.207000	0.72159	2.513000	0.84729	0.563000	0.77884	CAG		0.368	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2			Missense_Mutation
DNAH7	56171	broad.mit.edu	37	2	196661445	196661445	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr2:196661445T>A	ENST00000312428.6	-	56	10470	c.10370A>T	c.(10369-10371)aAa>aTa	p.K3457I	DNAH7_ENST00000409063.1_5'Flank	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3457	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.K3457I(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AGAGCTAAGTTTTGATCCCCC	0.343																																																1	Substitution - Missense(1)	ovary(1)	2											77.0	72.0	74.0					2																	196661445		1855	4083	5938	196369690	SO:0001583	missense	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.10370A>T	2.37:g.196661445T>A	ENSP00000311273:p.Lys3457Ile		196369690	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	19.60	3.857448	0.71834	.	.	ENSG00000118997	ENST00000312428	T	0.10668	2.85	5.4	5.4	0.78164	Dynein heavy chain (1);	2.036090	0.01910	N	0.039750	T	0.48021	0.1477	M	0.92026	3.265	0.80722	D	1	P	0.49447	0.924	D	0.63283	0.913	T	0.04115	-1.0976	10	0.87932	D	0	.	15.2561	0.73585	0.0:0.0:0.0:1.0	.	3457	Q8WXX0	DYH7_HUMAN	I	3457	ENSP00000311273:K3457I	ENSP00000311273:K3457I	K	-	2	0	DNAH7	196369690	1.000000	0.71417	0.976000	0.42696	0.961000	0.63080	3.127000	0.50484	2.271000	0.75665	0.533000	0.62120	AAA		0.343	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		Missense_Mutation
CYP20A1	57404	broad.mit.edu	37	2	204143408	204143408	+	Silent	SNP	A	A	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr2:204143408A>G	ENST00000356079.4	+	7	915	c.792A>G	c.(790-792)caA>caG	p.Q264Q	CYP20A1_ENST00000429815.2_Silent_p.Q272Q|CYP20A1_ENST00000461371.1_3'UTR	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	264						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)	p.Q264Q(1)		cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						TTAATGACCAACAGGTGATAT	0.388																																																1	Substitution - coding silent(1)	ovary(1)	2											57.0	52.0	54.0					2																	204143408		2203	4300	6503	203851653	SO:0001819	synonymous_variant	57404			AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.792A>G	2.37:g.204143408A>G			203851653	Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Silent	SNP	ENST00000356079.4	37	CCDS2357.1	SNP	2	Broad																																																																																				0.388	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256328.3	NM_020674		Silent
UGT1A5	54579	broad.mit.edu	37	2	234621894	234621894	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr2:234621894A>C	ENST00000373414.3	+	1	257	c.257A>C	c.(256-258)cAg>cCg	p.Q86P	UGT1A1_ENST00000608381.1_Missense_Mutation_p.Q86P|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron			P35504	UD15_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A5	86						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.Q86P(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		TCATGGACCCAGGACGAATTT	0.438																																																1	Substitution - Missense(1)	ovary(1)	2											111.0	105.0	107.0					2																	234621894		2203	4300	6503	234286633	SO:0001583	missense	54579			M84129	CCDS33404.1	2q37	2010-03-05	2005-07-20		ENSG00000240224	ENSG00000240224		"""UDP glucuronosyltransferases"""	12537	other	complex locus constituent		606430	"""UDP glycosyltransferase 1 family, polypeptide A5"""			9295054, 1339448	Standard	NM_019078		Approved	UGT1E		P35504	OTTHUMG00000059120	ENST00000373414.3:c.257A>C	2.37:g.234621894A>C	ENSP00000362513:p.Gln86Pro		234286633	B8K294	Missense_Mutation	SNP	ENST00000373414.3	37	CCDS33404.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	15.57	2.872574	0.51695	.	.	ENSG00000240224	ENST00000373414	T	0.60040	0.22	4.83	1.99	0.26369	.	0.862650	0.10358	N	0.684304	T	0.62950	0.2470	L	0.53561	1.675	0.09310	N	1	P;P	0.45212	0.853;0.853	P;P	0.53102	0.718;0.718	T	0.51810	-0.8658	10	0.62326	D	0.03	.	7.9718	0.30132	0.7901:0.0:0.2099:0.0	.	86;86	Q5DSZ9;P35504	.;UD15_HUMAN	P	86	ENSP00000362513:Q86P	ENSP00000362513:Q86P	Q	+	2	0	UGT1A5	234286633	0.024000	0.19004	0.001000	0.08648	0.010000	0.07245	2.649000	0.46656	0.110000	0.17919	0.449000	0.29647	CAG		0.438	UGT1A5-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130985.1	NM_019078		Missense_Mutation
OR6B3	150681	broad.mit.edu	37	2	240985219	240985219	+	Missense_Mutation	SNP	G	G	A	rs535624583		TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr2:240985219G>A	ENST00000319423.4	-	1	270	c.271C>T	c.(271-273)Cgc>Tgc	p.R91C	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R91C(2)		endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		AAAGAGATGCGTTTCTGCTGG	0.557													g|||	1	0.000199681	0.0008	0.0	5008	,	,		22478	0.0		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	2											37.0	39.0	38.0					2																	240985219		1923	4115	6038	240633892	SO:0001583	missense	150681				CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.271C>T	2.37:g.240985219G>A	ENSP00000322435:p.Arg91Cys		240633892	Q6IFH3	Missense_Mutation	SNP	ENST00000319423.4	37	CCDS42837.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	3.917	-0.018940	0.07681	.	.	ENSG00000178586	ENST00000319423	T	0.01359	4.98	3.96	-2.58	0.06228	GPCR, rhodopsin-like superfamily (1);	1.116300	0.07024	N	0.827325	T	0.01558	0.0050	L	0.45352	1.415	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.46555	-0.9183	10	0.52906	T	0.07	.	4.3807	0.11293	0.2511:0.0:0.2314:0.5174	.	91	Q8NGW1	OR6B3_HUMAN	C	91	ENSP00000322435:R91C	ENSP00000322435:R91C	R	-	1	0	OR6B3	240633892	0.000000	0.05858	0.000000	0.03702	0.624000	0.37722	-0.700000	0.05081	-0.593000	0.05844	-0.319000	0.08680	CGC		0.557	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1			Missense_Mutation
TGIF2	60436	broad.mit.edu	37	20	35219660	35219660	+	Silent	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr20:35219660C>T	ENST00000373874.2	+	3	739	c.540C>T	c.(538-540)ttC>ttT	p.F180F	TGIF2_ENST00000373872.4_Silent_p.F180F|RP5-977B1.11_ENST00000561134.1_RNA|TGIF2-C20orf24_ENST00000558530.1_Intron	NM_001199514.1|NM_001199515.1	NP_001186443.1|NP_001186444.1	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	180	Repressive function.				gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway (GO:0038092)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F180F(1)		cervix(3)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				GTGGACTCTTCAACACGCCAC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	20											54.0	60.0	58.0					20																	35219660		2203	4300	6503	34653074	SO:0001819	synonymous_variant	60436			AB042646	CCDS13278.1	20q11.23	2012-12-12	2007-02-07		ENSG00000118707	ENSG00000118707		"""Homeoboxes / TALE class"""	15764	protein-coding gene	gene with protein product		607294	"""TGFB-induced factor 2 (TALE family homeobox)"""			11006116	Standard	NM_021809		Approved		uc021wcv.1	Q9GZN2	OTTHUMG00000172332	ENST00000373874.2:c.540C>T	20.37:g.35219660C>T			34653074	B2R9U3|E1P5T9|H0YNI0	Silent	SNP	ENST00000373874.2	37	CCDS13278.1	SNP	29	Broad																																																																																				0.627	TGIF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079004.2	NM_021809		Silent
ZNF831	128611	broad.mit.edu	37	20	57829349	57829349	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr20:57829349C>A	ENST00000371030.2	+	5	4585	c.4585C>A	c.(4585-4587)Cca>Aca	p.P1529T		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1529							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.P1529T(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					ATCAAGCTCCCCAGACAGCAA	0.517																																																1	Substitution - Missense(1)	ovary(1)	20											37.0	41.0	40.0					20																	57829349		2091	4225	6316	57262744	SO:0001583	missense	128611			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4585C>A	20.37:g.57829349C>A	ENSP00000360069:p.Pro1529Thr		57262744	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	14.67	2.603810	0.46423	.	.	ENSG00000124203	ENST00000371030	T	0.08008	3.14	5.66	2.49	0.30216	.	0.641780	0.14616	N	0.308721	T	0.09379	0.0231	M	0.64997	1.995	0.09310	N	1	P	0.47350	0.894	B	0.39935	0.314	T	0.22034	-1.0228	10	0.66056	D	0.02	-0.909	6.1087	0.20087	0.3319:0.5817:0.0:0.0865	.	1529	Q5JPB2	ZN831_HUMAN	T	1529	ENSP00000360069:P1529T	ENSP00000360069:P1529T	P	+	1	0	ZNF831	57262744	0.000000	0.05858	0.024000	0.17045	0.080000	0.17528	0.431000	0.21444	0.737000	0.32582	0.650000	0.86243	CCA		0.517	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		Missense_Mutation
KRTAP20-2	337976	broad.mit.edu	37	21	32007753	32007753	+	Silent	SNP	A	A	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr21:32007753A>T	ENST00000330798.2	+	1	199	c.171A>T	c.(169-171)ggA>ggT	p.G57G		NM_181616.1	NP_853647.1	Q3LI61	KR202_HUMAN	keratin associated protein 20-2	57						intermediate filament (GO:0005882)		p.G57G(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|ovary(1)	8						CTTGCTATGGAAGATACTGGT	0.507																																																1	Substitution - coding silent(1)	ovary(1)	21											160.0	138.0	146.0					21																	32007753		2203	4300	6503	30929624	SO:0001819	synonymous_variant	337976			AP001708	CCDS13604.1	21q22.1	2006-03-13			ENSG00000184032	ENSG00000184032		"""Keratin associated proteins"""	18944	protein-coding gene	gene with protein product						12359730	Standard	NM_181616		Approved	KAP20.2	uc011adg.2	Q3LI61	OTTHUMG00000057786	ENST00000330798.2:c.171A>T	21.37:g.32007753A>T			30929624		Silent	SNP	ENST00000330798.2	37	CCDS13604.1	SNP	9	Broad																																																																																				0.507	KRTAP20-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128238.3			Silent
PRDM15	63977	broad.mit.edu	37	21	43246400	43246400	+	Silent	SNP	T	T	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr21:43246400T>C	ENST00000269844.3	-	20	2753	c.2643A>G	c.(2641-2643)cgA>cgG	p.R881R	PRDM15_ENST00000447207.2_Silent_p.R515R|PRDM15_ENST00000422911.1_Silent_p.R572R|PRDM15_ENST00000538201.1_Silent_p.R535R|PRDM15_ENST00000398548.1_Silent_p.R552R	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	881					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.R881R(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CTCGCTTCACTCGCCGCACTC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	21											79.0	70.0	73.0					21																	43246400		2203	4300	6503	42119469	SO:0001819	synonymous_variant	63977			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.2643A>G	21.37:g.43246400T>C			42119469	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	ENST00000269844.3	37	CCDS13676.1	SNP	54	Broad																																																																																				0.572	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115		Silent
TMEM211	255349	broad.mit.edu	37	22	25334229	25334229	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr22:25334229C>G	ENST00000423535.1	-	2	226	c.227G>C	c.(226-228)gGc>gCc	p.G76A	TMEM211_ENST00000407886.1_Missense_Mutation_p.G5A|TMEM211_ENST00000382744.1_Missense_Mutation_p.G5A			Q6ICI0	TM211_HUMAN	transmembrane protein 211	76						integral component of membrane (GO:0016021)		p.G5A(1)		endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						CAGGAGCCAGCCTCCGAGGAG	0.577																																																1	Substitution - Missense(1)	ovary(1)	22											63.0	59.0	60.0					22																	25334229		2203	4300	6503	23664229	SO:0001583	missense	255349				CCDS33624.1	22q11.23	2009-01-12			ENSG00000206069	ENSG00000206069			33725	protein-coding gene	gene with protein product							Standard	NM_001001663		Approved	bA9F11.1	uc003abk.1	Q6ICI0	OTTHUMG00000150790	ENST00000423535.1:c.227G>C	22.37:g.25334229C>G	ENSP00000387813:p.Gly76Ala		23664229		Missense_Mutation	SNP	ENST00000423535.1	37		SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	14.62	2.590368	0.46214	.	.	ENSG00000206069	ENST00000407886;ENST00000423535;ENST00000382744	T;T;T	0.79845	-1.31;-0.76;-1.31	4.06	4.06	0.47325	.	0.000000	0.49305	D	0.000158	D	0.88235	0.6382	M	0.71581	2.175	0.42414	D	0.992611	D	0.89917	1.0	D	0.83275	0.996	D	0.89829	0.3994	10	0.87932	D	0	-37.4368	14.3359	0.66589	0.0:1.0:0.0:0.0	.	76	Q6ICI0	TM211_HUMAN	A	5;76;5	ENSP00000385494:G5A;ENSP00000387813:G76A;ENSP00000372192:G5A	ENSP00000372192:G5A	G	-	2	0	TMEM211	23664229	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.293000	0.43558	2.308000	0.77769	0.538000	0.68166	GGC		0.577	TMEM211-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001663		Missense_Mutation
NCF4	4689	broad.mit.edu	37	22	37271866	37271866	+	Intron	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr22:37271866C>A	ENST00000248899.6	+	8	942				NCF4_ENST00000397147.4_Missense_Mutation_p.P267T	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	AGCCTTCCTGCCATCCCTACG	0.597																																																0			22											159.0	132.0	141.0					22																	37271866		2203	4300	6503	35601812	SO:0001627	intron_variant	4689			X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.758+41C>A	22.37:g.37271866C>A			35601812	A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Missense_Mutation	SNP	ENST00000248899.6	37	CCDS13934.1	SNP	26	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.83|14.83	2.652515|2.652515	0.47362|0.47362	.|.	.|.	ENSG00000100365|ENSG00000100365	ENST00000415063|ENST00000447071;ENST00000397147	.|T;T	.|0.60797	.|0.98;0.16	4.25|4.25	-2.57|-2.57	0.06248|0.06248	.|.	.|3.475250	.|0.01360	.|N	.|0.012205	T|T	0.31638|0.31638	0.0803|0.0803	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.15141	.|0.012	.|B	.|0.08055	.|0.003	T|T	0.11591|0.11591	-1.0581|-1.0581	5|10	.|0.34782	.|T	.|0.22	-6.494|-6.494	0.5301|0.5301	0.00627|0.00627	0.179:0.2839:0.1758:0.3614|0.179:0.2839:0.1758:0.3614	.|.	.|267	.|A8K4F9	.|.	D|T	130|164;267	.|ENSP00000414958:P164T;ENSP00000380334:P267T	.|ENSP00000380334:P267T	A|P	+|+	2|1	0|0	NCF4|NCF4	35601812|35601812	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.068000|0.068000	0.16541|0.16541	-0.107000|-0.107000	0.10873|0.10873	-0.003000|-0.003000	0.14444|0.14444	0.650000|0.650000	0.86243|0.86243	GCC|CCA		0.597	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318863.1	NM_000631		Missense_Mutation
SSUH2	51066	broad.mit.edu	37	3	8675578	8675578	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr3:8675578G>C	ENST00000317371.4	-	11	1272	c.47C>G	c.(46-48)cCt>cGt	p.P16R	SSUH2_ENST00000544814.1_Intron|SSUH2_ENST00000415132.1_Missense_Mutation_p.P16R|SSUH2_ENST00000341795.3_Missense_Mutation_p.P16R			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)	16						cytoplasm (GO:0005737)		p.P16R(1)									GAGAAACTGAGGCCACGGTAG	0.642																																																1	Substitution - Missense(1)	ovary(1)	3											33.0	34.0	33.0					3																	8675578		2203	4300	6503	8650578	SO:0001583	missense	51066			AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.47C>G	3.37:g.8675578G>C	ENSP00000324551:p.Pro16Arg		8650578	A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Missense_Mutation	SNP	ENST00000317371.4	37	CCDS2568.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	11.15	1.555239	0.27739	.	.	ENSG00000125046	ENST00000341795;ENST00000317371;ENST00000415132	T;T;T	0.50813	0.79;0.79;0.73	4.24	2.42	0.29668	.	0.061073	0.64402	D	0.000003	T	0.23572	0.0570	N	0.08118	0	0.09310	N	1	B	0.26195	0.144	B	0.23716	0.048	T	0.15607	-1.0431	10	0.72032	D	0.01	-0.5745	5.2568	0.15552	0.1058:0.0:0.6929:0.2013	.	16	Q9Y2M2	CC032_HUMAN	R	16	ENSP00000339150:P16R;ENSP00000324551:P16R;ENSP00000410757:P16R	ENSP00000324551:P16R	P	-	2	0	C3orf32	8650578	0.003000	0.15002	0.002000	0.10522	0.056000	0.15407	0.315000	0.19451	0.531000	0.28639	0.585000	0.79938	CCT		0.642	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337900.1	NM_015931		Missense_Mutation
KCNH8	131096	broad.mit.edu	37	3	19384132	19384132	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr3:19384132C>G	ENST00000328405.2	+	4	762	c.496C>G	c.(496-498)Cgg>Ggg	p.R166G		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	166					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.R166G(1)|p.R166W(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						AGCCCGGAGACGGAGTCGAGC	0.433																																					NSCLC(124;1625 1765 8018 24930 42026)											2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	3											88.0	86.0	86.0					3																	19384132		2203	4300	6503	19359136	SO:0001583	missense	131096			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.496C>G	3.37:g.19384132C>G	ENSP00000328813:p.Arg166Gly		19359136	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	CCDS2632.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005166	0.74932	.	.	ENSG00000183960	ENST00000328405	D	0.98978	-5.29	5.76	4.87	0.63330	.	0.000000	0.29466	U	0.012070	D	0.98940	0.9640	M	0.79011	2.435	0.80722	D	1	P;D	0.59767	0.77;0.986	P;P	0.56700	0.456;0.804	D	0.98794	1.0737	9	.	.	.	.	16.0147	0.80427	0.1356:0.8644:0.0:0.0	.	166;166	B7Z398;Q96L42	.;KCNH8_HUMAN	G	166	ENSP00000328813:R166G	.	R	+	1	2	KCNH8	19359136	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.562000	0.45914	1.388000	0.46506	0.585000	0.79938	CGG		0.433	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		Missense_Mutation
EOMES	8320	broad.mit.edu	37	3	27758585	27758585	+	Nonsense_Mutation	SNP	A	A	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr3:27758585A>C	ENST00000295743.4	-	6	2240	c.2037T>G	c.(2035-2037)taT>taG	p.Y679*	EOMES_ENST00000537516.1_Nonsense_Mutation_p.Y403*|EOMES_ENST00000449599.1_Nonsense_Mutation_p.Y698*|EOMES_ENST00000461503.1_5'Flank			O95936	EOMES_HUMAN	eomesodermin	679	Required for transcription activation. {ECO:0000250}.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y679*(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						AAAAAGCATAATACCCTCCCA	0.378																																																1	Substitution - Nonsense(1)	ovary(1)	3											117.0	113.0	114.0					3																	27758585		2203	4300	6503	27733589	SO:0001587	stop_gained	8320			BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.2037T>G	3.37:g.27758585A>C	ENSP00000295743:p.Tyr679*		27733589	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Nonsense_Mutation	SNP	ENST00000295743.4	37	CCDS2646.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	36	5.706424	0.96821	.	.	ENSG00000163508	ENST00000295743;ENST00000449599;ENST00000537516;ENST00000535713	.	.	.	4.34	0.665	0.17896	.	0.491469	0.23226	N	0.050509	.	.	.	.	.	.	0.58432	D	0.999994	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.0406	0.25019	0.5747:0.0:0.4253:0.0	.	.	.	.	X	679;698;403;563	.	ENSP00000295743:Y679X	Y	-	3	2	EOMES	27733589	1.000000	0.71417	0.988000	0.46212	0.991000	0.79684	0.852000	0.27764	0.253000	0.21552	0.460000	0.39030	TAT		0.378	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252995.1	NM_005442		Nonsense_Mutation
NBEAL2	23218	broad.mit.edu	37	3	47046018	47046019	+	Missense_Mutation	DNP	TA	TA	CC			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr3:47046018_47046019TA>CC	ENST00000450053.3	+	38	6411_6412	c.6232_6233TA>CC	c.(6232-6234)TAc>CCc	p.Y2078P	NBEAL2_ENST00000383740.2_Missense_Mutation_p.Y357P|NBEAL2_ENST00000292309.5_Missense_Mutation_p.Y1894P	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2078	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.Y1455P(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CAACTTCGAGTACTTGATGCAA	0.589																																																1	Substitution - Missense(1)	ovary(1)	3																																								47021023	SO:0001583	missense	23218			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	Exception_encountered	3.37:g.47046018_47046019delinsCC	ENSP00000415034:p.Tyr2078Pro		47021022	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	DNP	ENST00000450053.3	37	CCDS46817.1	DNP	57	Broad																																																																																				0.589	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064		Missense_Mutation
DNAH1	25981	broad.mit.edu	37	3	52403854	52403854	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr3:52403854T>C	ENST00000420323.2	+	38	6218	c.5957T>C	c.(5956-5958)aTg>aCg	p.M1986T		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1986	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.M1986T(1)		cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ATGACCATGATGTTCGAGGTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	3											69.0	74.0	73.0					3																	52403854		2061	4212	6273	52378894	SO:0001583	missense	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5957T>C	3.37:g.52403854T>C	ENSP00000401514:p.Met1986Thr		52378894	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	19.68	3.872321	0.72180	.	.	ENSG00000114841	ENST00000420323	T	0.39592	1.07	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000009	T	0.70876	0.3274	M	0.91612	3.225	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	T	0.78952	-0.2001	10	0.87932	D	0	.	14.6654	0.68904	0.0:0.0:0.0:1.0	.	1986	C9JXH6	.	T	1986	ENSP00000401514:M1986T	ENSP00000401514:M1986T	M	+	2	0	DNAH1	52378894	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.219000	0.78000	2.069000	0.61940	0.459000	0.35465	ATG		0.622	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512		Missense_Mutation
CADPS	8618	broad.mit.edu	37	3	62499332	62499332	+	Intron	SNP	T	T	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr3:62499332T>G	ENST00000383710.4	-	17	2931				CADPS_ENST00000357948.3_Intron|CADPS_ENST00000283269.9_Missense_Mutation_p.Q877H	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator						catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.Q877H(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		AATCCATCACTTGGGAGGCCA	0.428																																																1	Substitution - Missense(1)	ovary(1)	3											124.0	98.0	107.0					3																	62499332		2203	4299	6502	62474372	SO:0001627	intron_variant	8618			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2582-889A>C	3.37:g.62499332T>G			62474372	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	10.11	1.260472	0.23051	.	.	ENSG00000163618	ENST00000283269	T	0.46063	0.88	5.65	5.65	0.86999	.	.	.	.	.	T	0.63331	0.2502	.	.	.	0.80722	D	1	D	0.60575	0.988	D	0.74674	0.984	T	0.61821	-0.6984	8	0.36615	T	0.2	.	16.17	0.81801	0.0:0.0:0.0:1.0	.	877	Q9ULU8-3	.	H	877	ENSP00000283269:Q877H	ENSP00000283269:Q877H	Q	-	3	2	CADPS	62474372	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.997000	0.88414	2.279000	0.76181	0.533000	0.62120	CAA		0.428	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394		Missense_Mutation
PHLDB2	90102	broad.mit.edu	37	3	111672788	111672788	+	Silent	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr3:111672788C>A	ENST00000431670.2	+	12	3195	c.2784C>A	c.(2782-2784)ccC>ccA	p.P928P	PHLDB2_ENST00000393923.3_Silent_p.P912P|PHLDB2_ENST00000495180.1_Silent_p.P419P|PHLDB2_ENST00000481953.1_Silent_p.P885P|PHLDB2_ENST00000412622.1_Silent_p.P885P|PHLDB2_ENST00000393925.3_Silent_p.P928P	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	928						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.P885P(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						CCCATCTGCCCCTAGGACAGA	0.552																																																1	Substitution - coding silent(1)	ovary(1)	3											85.0	70.0	75.0					3																	111672788		2203	4300	6503	113155478	SO:0001819	synonymous_variant	90102				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.2784C>A	3.37:g.111672788C>A			113155478	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Silent	SNP	ENST00000431670.2	37	CCDS46886.1	SNP	22	Broad																																																																																				0.552	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753		Silent
PFN2	5217	broad.mit.edu	37	3	149686160	149686160	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr3:149686160C>G	ENST00000239940.7	-	2	562	c.310G>C	c.(310-312)Ggc>Cgc	p.G104R	PFN2_ENST00000481275.1_Missense_Mutation_p.G55R|PFN2_ENST00000497148.1_Missense_Mutation_p.G55R|PFN2_ENST00000475518.1_Missense_Mutation_p.G55R|PFN2_ENST00000498307.1_Missense_Mutation_p.G55R|PFN2_ENST00000461868.1_Missense_Mutation_p.G104R|AC117395.1_ENST00000593416.1_5'Flank|PFN2_ENST00000452853.2_Missense_Mutation_p.G104R|PFN2_ENST00000489155.1_Missense_Mutation_p.G55R|PFN2_ENST00000494827.1_Missense_Mutation_p.G55R|PFN2_ENST00000423691.2_Missense_Mutation_p.G104R|PFN2_ENST00000481767.1_Missense_Mutation_p.G55R|PFN2_ENST00000490975.1_Intron|PFN2_ENST00000461930.1_3'UTR			P35080	PROF2_HUMAN	profilin 2	104					actin cytoskeleton organization (GO:0030036)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of ATPase activity (GO:0032781)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|regulation of synaptic vesicle exocytosis (GO:2000300)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|terminal bouton (GO:0043195)	actin monomer binding (GO:0003785)|adenyl-nucleotide exchange factor activity (GO:0000774)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.G104R(1)		large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CCAGCTCTGCCGACAGCCACA	0.418																																																1	Substitution - Missense(1)	ovary(1)	3											203.0	208.0	206.0					3																	149686160		2203	4300	6503	151168850	SO:0001583	missense	5217			L10678	CCDS3148.1, CCDS46934.1	3q25.1	2006-10-16			ENSG00000070087	ENSG00000070087			8882	protein-coding gene	gene with protein product		176590				8975700, 8365484	Standard	NM_002628		Approved		uc003ext.1	P35080	OTTHUMG00000159683	ENST00000239940.7:c.310G>C	3.37:g.149686160C>G	ENSP00000239940:p.Gly104Arg		151168850	B2R4C8|D3DNI4|Q4VBQ4|Q8WVF9|Q9HBK2	Missense_Mutation	SNP	ENST00000239940.7	37	CCDS3148.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	.	32	5.110721	0.94292	.	.	ENSG00000070087	ENST00000452853;ENST00000239940;ENST00000423691;ENST00000481767;ENST00000494827;ENST00000497148;ENST00000475518;ENST00000481275;ENST00000498307;ENST00000489155;ENST00000461868	D;D;D;D;D;D;D;D;D;D;D	0.85861	-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.04	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.92541	0.7631	M	0.81942	2.565	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.91058	0.4883	10	0.31617	T	0.26	.	19.1246	0.93376	0.0:1.0:0.0:0.0	.	104;298;104;55	G5E9Q6;D3DNI2;P35080;C9J0J7	.;.;PROF2_HUMAN;.	R	104;104;104;55;55;55;55;55;55;55;104	ENSP00000410464:G104R;ENSP00000239940:G104R;ENSP00000408283:G104R;ENSP00000420417:G55R;ENSP00000418523:G55R;ENSP00000417817:G55R;ENSP00000418142:G55R;ENSP00000418216:G55R;ENSP00000420202:G55R;ENSP00000420504:G55R;ENSP00000420244:G104R	ENSP00000239940:G104R	G	-	1	0	PFN2	151168850	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.487000	0.81328	2.501000	0.84356	0.655000	0.94253	GGC		0.418	PFN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356873.2	NM_002628		Missense_Mutation
TACC3	10460	broad.mit.edu	37	4	1742565	1742565	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr4:1742565A>G	ENST00000313288.4	+	13	2181	c.2075A>G	c.(2074-2076)aAg>aGg	p.K692R		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	692					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			GAAGTTCAGAAGCAGAAGGAA	0.463																																					Ovarian(120;482 2294 11894 35824)											0			4											75.0	76.0	76.0					4																	1742565		2203	4300	6503	1712363	SO:0001583	missense	10460			AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.2075A>G	4.37:g.1742565A>G	ENSP00000326550:p.Lys692Arg		1712363	Q2NKK4|Q3KQS5|Q9UMQ1	Missense_Mutation	SNP	ENST00000313288.4	37	CCDS3352.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	12.88	2.071933	0.36566	.	.	ENSG00000013810	ENST00000313288	T	0.46063	0.88	4.99	2.6	0.31112	.	0.354917	0.23185	N	0.050977	T	0.26774	0.0655	N	0.21194	0.64	0.32343	N	0.559556	B;B	0.24258	0.1;0.016	B;B	0.26094	0.066;0.019	T	0.21724	-1.0237	10	0.39692	T	0.17	-12.2227	7.5102	0.27569	0.6678:0.0:0.3322:0.0	.	692;692	Q2NKK4;Q9Y6A5	.;TACC3_HUMAN	R	692	ENSP00000326550:K692R	ENSP00000326550:K692R	K	+	2	0	TACC3	1712363	0.902000	0.30710	0.849000	0.33467	0.685000	0.39939	1.862000	0.39448	0.413000	0.25759	0.529000	0.55759	AAG		0.463	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2			Missense_Mutation
WHSC1	7468	broad.mit.edu	37	4	1919957	1919957	+	Silent	SNP	G	G	A	rs375995389		TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr4:1919957G>A	ENST00000382895.3	+	7	1448	c.1017G>A	c.(1015-1017)gaG>gaA	p.E339E	WHSC1_ENST00000503128.1_Silent_p.E339E|WHSC1_ENST00000514045.1_Silent_p.E339E|WHSC1_ENST00000382891.5_Silent_p.E339E|WHSC1_ENST00000508803.1_Silent_p.E339E|WHSC1_ENST00000382892.2_Silent_p.E339E|WHSC1_ENST00000420906.2_Silent_p.E339E|WHSC1_ENST00000398261.1_Silent_p.E339E	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	339					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.E339E(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		CAGTGGAGGAGCGGAAAGCCA	0.493			T	IGH@	MM								G|||	1	0.000199681	0.0008	0.0	5008	,	,		19157	0.0		0.0	False		,,,				2504	0.0						Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	1	Substitution - coding silent(1)	ovary(1)	4						G	,,,,,	1,4405	2.1+/-5.4	0,1,2202	78.0	78.0	78.0		1017,1017,1017,1017,1017,1017	0.7	1.0	4		78	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	WHSC1	NM_001042424.2,NM_007331.1,NM_133330.2,NM_133331.2,NM_133334.2,NM_133335.3	,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,	339/1366,339/630,339/1366,339/1366,339/648,339/1366	1919957	1,13005	2203	4300	6503	1889755	SO:0001819	synonymous_variant	7468			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.1017G>A	4.37:g.1919957G>A			1889755	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Silent	SNP	ENST00000382895.3	37	CCDS33940.1	SNP	34	Broad																																																																																				0.493	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330		Silent
PDGFRA	5156	broad.mit.edu	37	4	55130020	55130020	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr4:55130020G>A	ENST00000257290.5	+	4	885	c.554G>A	c.(553-555)gGg>gAg	p.G185E	PDGFRA_ENST00000508170.1_Missense_Mutation_p.G185E|FIP1L1_ENST00000507166.1_Intron	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	185	Ig-like C2-type 2.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.G185E(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	TTCACTGTAGGGCCCTATATC	0.473			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	1	Substitution - Missense(1)	ovary(1)	4											97.0	92.0	94.0					4																	55130020		2203	4300	6503	54824777	SO:0001583	missense	5156	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.554G>A	4.37:g.55130020G>A	ENSP00000257290:p.Gly185Glu		54824777	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	CCDS3495.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.113706	0.94339	.	.	ENSG00000134853	ENST00000257290;ENST00000508170	T;T	0.16897	2.31;2.31	5.64	5.64	0.86602	Immunoglobulin-like fold (1);	0.000000	0.32518	U	0.005986	T	0.46795	0.1411	M	0.83312	2.635	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.97110	0.972;1.0;1.0	T	0.31081	-0.9956	10	0.23891	T	0.37	.	19.7137	0.96107	0.0:0.0:1.0:0.0	.	185;185;185	P16234-3;P16234;P16234-2	.;PGFRA_HUMAN;.	E	185	ENSP00000257290:G185E;ENSP00000425648:G185E	ENSP00000257290:G185E	G	+	2	0	PDGFRA	54824777	1.000000	0.71417	0.937000	0.37676	0.978000	0.69477	7.762000	0.85270	2.655000	0.90218	0.462000	0.41574	GGG		0.473	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206		Missense_Mutation
DMP1	1758	broad.mit.edu	37	4	88583266	88583266	+	Silent	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr4:88583266C>T	ENST00000339673.6	+	6	435	c.336C>T	c.(334-336)gaC>gaT	p.D112D	RP11-742B18.1_ENST00000506480.1_RNA|RP11-742B18.1_ENST00000507894.1_RNA|DMP1_ENST00000282479.7_Silent_p.D96D|RP11-742B18.1_ENST00000506814.1_RNA	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	112					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)	p.D112D(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		GTGGAGATGACACCTTTGGTG	0.478																																																1	Substitution - coding silent(1)	ovary(1)	4											92.0	86.0	88.0					4																	88583266		2203	4300	6503	88802290	SO:0001819	synonymous_variant	1758			U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.336C>T	4.37:g.88583266C>T			88802290	A1L4L3|O43265	Silent	SNP	ENST00000339673.6	37	CCDS3623.1	SNP	17	Broad																																																																																				0.478	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253047.1			Silent
FGA	2243	broad.mit.edu	37	4	155506959	155506959	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr4:155506959A>T	ENST00000302053.3	-	5	1700	c.1622T>A	c.(1621-1623)gTc>gAc	p.V541D	FGA_ENST00000403106.3_Missense_Mutation_p.V541D	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	541					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)	p.V541D(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	AGTCTCACTGACAAACTCTCC	0.493																																					NSCLC(143;340 1922 20892 22370 48145)											1	Substitution - Missense(1)	ovary(1)	4	GRCh37	CD972214	FGA	D							72.0	72.0	72.0					4																	155506959		2203	4300	6503	155726409	SO:0001583	missense	2243				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1622T>A	4.37:g.155506959A>T	ENSP00000306361:p.Val541Asp		155726409	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	CCDS3787.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	2.387	-0.340684	0.05243	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.57436	0.4;2.8	5.53	-1.16	0.09678	.	20.307200	0.00166	N	0.000000	T	0.26593	0.0650	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12268	-1.0554	10	0.12430	T	0.62	.	3.9654	0.09429	0.1241:0.22:0.4837:0.1722	.	541;541	P02671-2;P02671	.;FIBA_HUMAN	D	541	ENSP00000306361:V541D;ENSP00000385981:V541D	ENSP00000306361:V541D	V	-	2	0	FGA	155726409	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.163000	0.03138	-0.117000	0.11872	-1.856000	0.00563	GTC		0.493	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508		Missense_Mutation
RAPGEF2	9693	broad.mit.edu	37	4	160264553	160264553	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr4:160264553C>T	ENST00000264431.4	+	16	3187	c.2768C>T	c.(2767-2769)aCt>aTt	p.T923I		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	923	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)	p.T911I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		ATGTTCAGGACTCGGTGAGTA	0.408																																																1	Substitution - Missense(1)	ovary(1)	4											104.0	101.0	102.0					4																	160264553		1941	4141	6082	160484003	SO:0001583	missense	9693			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.2768C>T	4.37:g.160264553C>T	ENSP00000264431:p.Thr923Ile		160484003	D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	CCDS43277.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	16.05	3.014193	0.54468	.	.	ENSG00000109756	ENST00000264431	T	0.38240	1.15	5.73	5.73	0.89815	Guanine-nucleotide dissociation stimulator CDC25 (2);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.29355	0.0731	N	0.19112	0.55	0.80722	D	1	B	0.30179	0.271	B	0.28916	0.096	T	0.05053	-1.0909	10	0.44086	T	0.13	.	19.8852	0.96909	0.0:1.0:0.0:0.0	.	923	Q9Y4G8	RPGF2_HUMAN	I	923	ENSP00000264431:T923I	ENSP00000264431:T923I	T	+	2	0	RAPGEF2	160484003	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.916000	0.69981	2.697000	0.92050	0.491000	0.48974	ACT		0.408	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247		Missense_Mutation
DNAH5	1767	broad.mit.edu	37	5	13913898	13913898	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr5:13913898T>G	ENST00000265104.4	-	11	1594	c.1490A>C	c.(1489-1491)cAa>cCa	p.Q497P		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	497	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGTGGAATCTTGCAGGACTGA	0.358									Kartagener syndrome																																							0			5											121.0	127.0	125.0					5																	13913898		2203	4300	6503	13966898	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.1490A>C	5.37:g.13913898T>G	ENSP00000265104:p.Gln497Pro		13966898	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	11.95	1.792146	0.31685	.	.	ENSG00000039139	ENST00000265104	T	0.55588	0.51	5.67	4.5	0.54988	Dynein heavy chain, domain-1 (1);	0.121891	0.56097	D	0.000026	T	0.47135	0.1429	L	0.55743	1.74	0.47153	D	0.999336	B	0.06786	0.001	B	0.15484	0.013	T	0.34850	-0.9812	10	0.32370	T	0.25	.	11.821	0.52238	0.0:0.0692:0.0:0.9308	.	497	Q8TE73	DYH5_HUMAN	P	497	ENSP00000265104:Q497P	ENSP00000265104:Q497P	Q	-	2	0	DNAH5	13966898	1.000000	0.71417	0.996000	0.52242	0.803000	0.45373	3.486000	0.53215	0.970000	0.38263	0.455000	0.32223	CAA		0.358	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		Missense_Mutation
RICTOR	253260	broad.mit.edu	37	5	38964946	38964946	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr5:38964946G>A	ENST00000357387.3	-	16	1378	c.1348C>T	c.(1348-1350)Cca>Tca	p.P450S	RICTOR_ENST00000296782.5_Missense_Mutation_p.P450S	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					ATTAGGGTTGGCAAGCAGTGT	0.343																																																0			5											131.0	122.0	125.0					5																	38964946		2203	4300	6503	39000703	SO:0001583	missense	253260				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.1348C>T	5.37:g.38964946G>A	ENSP00000349959:p.Pro450Ser		39000703		Missense_Mutation	SNP	ENST00000357387.3	37	CCDS34148.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.099453	0.94197	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.69040	0.25;-0.37	5.46	5.46	0.80206	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82600	0.5072	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.87578	0.816;0.998	D	0.84336	0.0524	10	0.87932	D	0	-10.673	19.2882	0.94087	0.0:0.0:1.0:0.0	.	450;450	Q6R327;Q6R327-3	RICTR_HUMAN;.	S	450	ENSP00000349959:P450S;ENSP00000296782:P450S	ENSP00000296782:P450S	P	-	1	0	RICTOR	39000703	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.543000	0.82106	2.543000	0.85770	0.655000	0.94253	CCA		0.343	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756		Missense_Mutation
GHR	2690	broad.mit.edu	37	5	42718778	42718778	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr5:42718778G>C	ENST00000230882.4	+	10	1359	c.1169G>C	c.(1168-1170)tGt>tCt	p.C390S	GHR_ENST00000357703.3_Missense_Mutation_p.C368S|GHR_ENST00000513625.1_3'UTR|GHR_ENST00000537449.1_Missense_Mutation_p.C203S	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	390					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)	p.C390S(1)		NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	ACCAGCTGTTGTGAACCTGAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	5											149.0	115.0	126.0					5																	42718778		2203	4300	6503	42754535	SO:0001583	missense	2690				CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.1169G>C	5.37:g.42718778G>C	ENSP00000230882:p.Cys390Ser		42754535	Q9HCX2	Missense_Mutation	SNP	ENST00000230882.4	37	CCDS3940.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417405	0.25552	.	.	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000537449	T;T;T	0.37058	1.22;1.22;1.22	5.86	0.741	0.18336	.	0.157946	0.64402	D	0.000015	T	0.38188	0.1031	M	0.77486	2.375	0.25544	N	0.987156	B	0.10296	0.003	B	0.19666	0.026	T	0.38542	-0.9656	10	0.44086	T	0.13	-0.0102	11.5674	0.50813	0.5421:0.0:0.4579:0.0	.	390	P10912	GHR_HUMAN	S	390;368;203	ENSP00000230882:C390S;ENSP00000350335:C368S;ENSP00000442206:C203S	ENSP00000230882:C390S	C	+	2	0	GHR	42754535	0.997000	0.39634	0.990000	0.47175	0.981000	0.71138	1.330000	0.33781	-0.076000	0.12775	-0.312000	0.09012	TGT		0.478	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211605.2	NM_000163		Missense_Mutation
C5orf34	375444	broad.mit.edu	37	5	43508704	43508704	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr5:43508704G>C	ENST00000306862.2	-	3	635	c.260C>G	c.(259-261)aCc>aGc	p.T87S	RP11-159F24.3_ENST00000505645.1_RNA|RP11-159F24.6_ENST00000512498.1_RNA	NM_198566.2	NP_940968	Q96MH7	CE034_HUMAN	chromosome 5 open reading frame 34	87								p.T87S(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|stomach(2)	21	Lung NSC(6;2.07e-05)					AGGTATGATGGTTTCAGATAA	0.303																																																1	Substitution - Missense(1)	ovary(1)	5											75.0	88.0	84.0					5																	43508704		2203	4300	6503	43544461	SO:0001583	missense	375444			AK056925	CCDS3946.1	5p12	2012-02-23			ENSG00000172244	ENSG00000172244			24738	protein-coding gene	gene with protein product						12477932	Standard	XM_006714473		Approved	FLJ32363	uc003jnz.2	Q96MH7	OTTHUMG00000131151	ENST00000306862.2:c.260C>G	5.37:g.43508704G>C	ENSP00000303490:p.Thr87Ser		43544461		Missense_Mutation	SNP	ENST00000306862.2	37	CCDS3946.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	2.275	-0.365991	0.05069	.	.	ENSG00000172244	ENST00000306862	T	0.39056	1.1	5.14	-1.42	0.08913	.	0.400286	0.30329	N	0.009870	T	0.06416	0.0165	N	0.00116	-2.08	0.20403	N	0.999904	B	0.02656	0.0	B	0.01281	0.0	T	0.41378	-0.9512	10	0.02654	T	1	-0.3534	6.1155	0.20124	0.0:0.5175:0.1238:0.3587	.	87	Q96MH7	CE034_HUMAN	S	87	ENSP00000303490:T87S	ENSP00000303490:T87S	T	-	2	0	C5orf34	43544461	0.044000	0.20184	0.991000	0.47740	0.981000	0.71138	-0.267000	0.08619	-0.340000	0.08388	-0.976000	0.02587	ACC		0.303	C5orf34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253843.1	NM_198566		Missense_Mutation
KIF3A	11127	broad.mit.edu	37	5	132038260	132038260	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr5:132038260G>A	ENST00000378746.4	-	12	1885	c.1667C>T	c.(1666-1668)gCa>gTa	p.A556V	KIF3A_ENST00000403231.1_Missense_Mutation_p.A583V|AC004237.1_ENST00000431165.1_RNA|KIF3A_ENST00000378735.1_Missense_Mutation_p.A559V|KIF3A_ENST00000487055.1_5'UTR	NM_007054.5	NP_008985.3	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	556					anterior/posterior pattern specification (GO:0009952)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|organelle organization (GO:0006996)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of receptor-mediated endocytosis (GO:0048260)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|spectrin binding (GO:0030507)	p.A559G(2)|p.A556G(2)|p.A556V(1)		endometrium(1)|kidney(4)|large_intestine(8)|lung(3)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	25		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTCTGACTTTGCAGCCATCAG	0.343																																																5	Substitution - Missense(5)	prostate(4)|ovary(1)	5											148.0	146.0	147.0					5																	132038260		2203	4300	6503	132066159	SO:0001583	missense	11127			AF041853	CCDS34235.1, CCDS75295.1, CCDS75296.1	5q31	2012-08-01			ENSG00000131437	ENSG00000131437		"""Kinesins"""	6319	protein-coding gene	gene with protein product	"""kinesin family protein 3A"""	604683				1054846	Standard	XM_005271868		Approved	FLA10, KLP-20	uc003kxo.3	Q9Y496	OTTHUMG00000059725	ENST00000378746.4:c.1667C>T	5.37:g.132038260G>A	ENSP00000368020:p.Ala556Val		132066159	A8MSW9|Q59EN1|Q86XE9|Q9Y6V4	Missense_Mutation	SNP	ENST00000378746.4	37	CCDS34235.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	20.4	3.975928	0.74360	.	.	ENSG00000131437	ENST00000378746;ENST00000378735;ENST00000541316;ENST00000450441;ENST00000403231	T;T;T;T	0.09817	3.11;3.11;2.94;3.11	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.21267	0.0512	L	0.33624	1.015	0.80722	D	1	D;D;D;D	0.63880	0.993;0.993;0.957;0.993	D;D;P;D	0.65443	0.935;0.935;0.643;0.935	T	0.03852	-1.0998	10	0.10377	T	0.69	.	19.8411	0.96685	0.0:0.0:1.0:0.0	.	583;583;556;582	E9PES4;B4DHG8;Q9Y496;Q2UVF2	.;.;KIF3A_HUMAN;.	V	556;559;583;84;583	ENSP00000368020:A556V;ENSP00000368009:A559V;ENSP00000405619:A84V;ENSP00000385808:A583V	ENSP00000368009:A559V	A	-	2	0	KIF3A	132066159	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	9.869000	0.99810	2.683000	0.91414	0.655000	0.94253	GCA		0.343	KIF3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132788.3	NM_007054		Missense_Mutation
AFF4	27125	broad.mit.edu	37	5	132223577	132223577	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr5:132223577G>A	ENST00000265343.5	-	16	3273	c.2894C>T	c.(2893-2895)tCc>tTc	p.S965F		NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	965					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S965F(1)	SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGGAATGGGGATTTGGATTC	0.398																																					Ovarian(126;889 1733 2942 10745 11605)											1	Substitution - Missense(1)	ovary(1)	5											149.0	138.0	141.0					5																	132223577		2203	4300	6503	132251476	SO:0001583	missense	27125			AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.2894C>T	5.37:g.132223577G>A	ENSP00000265343:p.Ser965Phe		132251476	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	ENST00000265343.5	37	CCDS4164.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	21.0	4.089363	0.76756	.	.	ENSG00000072364	ENST00000265343	T	0.76316	-1.01	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.90079	0.6901	M	0.85630	2.765	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.90481	0.4460	10	0.87932	D	0	-7.1004	20.3539	0.98825	0.0:0.0:1.0:0.0	.	965	Q9UHB7	AFF4_HUMAN	F	965	ENSP00000265343:S965F	ENSP00000265343:S965F	S	-	2	0	AFF4	132251476	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.827000	0.99397	2.826000	0.97356	0.655000	0.94253	TCC		0.398	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423		Missense_Mutation
IK	3550	broad.mit.edu	37	5	140031363	140031363	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr5:140031363G>T	ENST00000417647.2	+	3	287	c.148G>T	c.(148-150)Gca>Tca	p.A50S	IK_ENST00000523672.1_3'UTR	NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II	50					cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.A50S(1)		large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCTACCTCTGCACCACCTTC	0.428																																																1	Substitution - Missense(1)	ovary(1)	5											85.0	81.0	82.0					5																	140031363		1891	4124	6015	140011547	SO:0001583	missense	3550			BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.148G>T	5.37:g.140031363G>T	ENSP00000396301:p.Ala50Ser		140011547	Q6IPD8	Missense_Mutation	SNP	ENST00000417647.2	37	CCDS47280.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275706	0.80580	.	.	ENSG00000113141	ENST00000513256;ENST00000417647;ENST00000507593;ENST00000508301;ENST00000261812;ENST00000502899	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.66867	0.2833	L	0.37750	1.13	0.80722	D	1	B;D	0.58970	0.259;0.984	B;D	0.65443	0.026;0.935	T	0.60357	-0.7279	9	0.24483	T	0.36	.	19.1778	0.93609	0.0:0.0:1.0:0.0	.	50;50	Q9UK43;Q13123	.;RED_HUMAN	S	46;50;50;50;50;50	.	ENSP00000261812:A50S	A	+	1	0	IK	140011547	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.507000	0.97996	2.640000	0.89533	0.563000	0.77884	GCA		0.428	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372897.1	NM_006083		Missense_Mutation
PCDHA4	56144	broad.mit.edu	37	5	140188077	140188077	+	Silent	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr5:140188077G>A	ENST00000530339.1	+	1	1305	c.1305G>A	c.(1303-1305)ctG>ctA	p.L435L	PCDHA4_ENST00000512229.2_Silent_p.L435L|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000356878.4_Silent_p.L435L|PCDHA1_ENST00000504120.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	435	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L435L(1)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCTTCGCTGTGGGCCACGG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	5											96.0	97.0	97.0					5																	140188077		2203	4300	6503	140168261	SO:0001819	synonymous_variant	56144			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1305G>A	5.37:g.140188077G>A			140168261	O75285|Q2M253	Silent	SNP	ENST00000530339.1	37	CCDS54916.1	SNP	48	Broad																																																																																				0.617	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907		Silent
TCERG1	10915	broad.mit.edu	37	5	145887487	145887487	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr5:145887487C>G	ENST00000296702.5	+	20	3000	c.2962C>G	c.(2962-2964)Cct>Gct	p.P988A	TCERG1_ENST00000394421.2_Missense_Mutation_p.P967A	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	988	FF 5.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)	p.P988A(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TAAGGAAGATCCTCGATGTAT	0.338																																																1	Substitution - Missense(1)	ovary(1)	5											98.0	92.0	94.0					5																	145887487		2203	4300	6503	145867680	SO:0001583	missense	10915			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.2962C>G	5.37:g.145887487C>G	ENSP00000296702:p.Pro988Ala		145867680	Q2NKN2|Q59EA1	Missense_Mutation	SNP	ENST00000296702.5	37	CCDS4282.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284823	0.80803	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.39787	1.06;1.06	5.92	5.92	0.95590	FF domain (4);	0.000000	0.85682	D	0.000000	T	0.69611	0.3130	M	0.83953	2.67	0.80722	D	1	D;D	0.76494	0.992;0.999	D;D	0.87578	0.959;0.998	T	0.67917	-0.5546	10	0.41790	T	0.15	-10.8412	20.33	0.98713	0.0:1.0:0.0:0.0	.	967;988	O14776-2;O14776	.;TCRG1_HUMAN	A	988;967	ENSP00000296702:P988A;ENSP00000377943:P967A	ENSP00000296702:P988A	P	+	1	0	TCERG1	145867680	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.730000	0.84881	2.810000	0.96702	0.585000	0.79938	CCT		0.338	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006		Missense_Mutation
DSP	1832	broad.mit.edu	37	6	7578101	7578101	+	Silent	SNP	T	T	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr6:7578101T>C	ENST00000379802.3	+	21	3308	c.2967T>C	c.(2965-2967)tcT>tcC	p.S989S	DSP_ENST00000418664.2_Silent_p.S989S	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	989	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.S989S(1)		biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AGTCCCCTTCTGGGGTGATTC	0.478																																																1	Substitution - coding silent(1)	ovary(1)	6											108.0	104.0	105.0					6																	7578101		2203	4300	6503	7523100	SO:0001819	synonymous_variant	1832			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.2967T>C	6.37:g.7578101T>C			7523100	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	37	CCDS4501.1	SNP	55	Broad																																																																																				0.478	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		Silent
SLC17A1	6568	broad.mit.edu	37	6	25811900	25811900	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr6:25811900G>T	ENST00000244527.4	-	9	1111	c.996C>A	c.(994-996)agC>agA	p.S332R	SLC17A1_ENST00000468082.1_Missense_Mutation_p.S278R|SLC17A1_ENST00000476801.1_Missense_Mutation_p.S332R|SLC17A1_ENST00000427328.1_Missense_Mutation_p.S278R	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	332					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.S332R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						CAGCAATTACGCTGAGAATAT	0.463																																																1	Substitution - Missense(1)	ovary(1)	6											98.0	88.0	92.0					6																	25811900		2203	4300	6503	25919879	SO:0001583	missense	6568				CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.996C>A	6.37:g.25811900G>T	ENSP00000244527:p.Ser332Arg		25919879	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	ENST00000244527.4	37	CCDS4565.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.185541	0.00026	.	.	ENSG00000124568	ENST00000244527;ENST00000427328;ENST00000476801;ENST00000468082	T;T;T;T	0.74315	0.4;-0.83;0.4;-0.83	3.38	0.631	0.17699	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.242522	0.29225	N	0.012774	T	0.37999	0.1024	L	0.37507	1.11	0.09310	N	0.999997	B;B	0.13145	0.006;0.007	B;B	0.19391	0.022;0.025	T	0.32188	-0.9916	10	0.30854	T	0.27	.	5.5821	0.17254	0.3676:0.0:0.6324:0.0	.	278;332	Q14916-2;Q14916	.;NPT1_HUMAN	R	332;278;332;278	ENSP00000244527:S332R;ENSP00000410549:S278R;ENSP00000420614:S332R;ENSP00000420546:S278R	ENSP00000244527:S332R	S	-	3	2	SLC17A1	25919879	0.018000	0.18449	0.047000	0.18901	0.008000	0.06430	-0.139000	0.10358	0.113000	0.18004	-0.781000	0.03364	AGC		0.463	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2			Missense_Mutation
HIST1H1A	3024	broad.mit.edu	37	6	26017749	26017749	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr6:26017749G>A	ENST00000244573.3	-	1	291	c.212C>T	c.(211-213)gCc>gTc	p.A71V	HIST1H3A_ENST00000357647.3_5'Flank	NM_005325.3	NP_005316.1	Q02539	H11_HUMAN	histone cluster 1, H1a	71	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|spermatogenesis (GO:0007283)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)	p.A71V(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|ovary(3)|prostate(1)	13						GTAGCCTGCGGCCGCCAGCGC	0.592																																																1	Substitution - Missense(1)	ovary(1)	6											50.0	53.0	52.0					6																	26017749		2203	4300	6503	26125728	SO:0001583	missense	3024			AF531299	CCDS4569.1	6p22.1	2012-11-16	2006-10-11	2003-02-21	ENSG00000124610	ENSG00000124610		"""Histones / Replication-dependent"""	4715	protein-coding gene	gene with protein product		142709	"""H1 histone family, member 1"", ""histone 1, H1a"""	H1F1		2759094, 12408966	Standard	NM_005325		Approved	H1.1, H1a	uc003nfo.3	Q02539	OTTHUMG00000016413	ENST00000244573.3:c.212C>T	6.37:g.26017749G>A	ENSP00000244573:p.Ala71Val		26125728	Q3MJ34	Missense_Mutation	SNP	ENST00000244573.3	37	CCDS4569.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	N	18.12	3.553021	0.65425	.	.	ENSG00000124610	ENST00000244573	T	0.11277	2.79	4.2	3.33	0.38152	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.176452	0.49916	N	0.000134	T	0.31136	0.0787	M	0.93283	3.4	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.43734	-0.9373	10	0.72032	D	0.01	0.1821	12.0335	0.53412	0.0864:0.0:0.9136:0.0	.	71	Q02539	H11_HUMAN	V	71	ENSP00000244573:A71V	ENSP00000244573:A71V	A	-	2	0	HIST1H1A	26125728	1.000000	0.71417	0.977000	0.42913	0.362000	0.29581	3.896000	0.56266	1.066000	0.40716	-0.173000	0.13275	GCC		0.592	HIST1H1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043884.1	NM_005325		Missense_Mutation
MLIP	90523	broad.mit.edu	37	6	54095652	54095652	+	Silent	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr6:54095652C>T	ENST00000274897.5	+	11	1367	c.1254C>T	c.(1252-1254)tcC>tcT	p.S418S	MLIP_ENST00000358276.5_Intron|MLIP_ENST00000509997.1_Intron|MLIP_ENST00000370877.2_Intron|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000502396.1_Silent_p.S953S	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	418						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)		p.S418S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						GTCATCTGTCCTTCTCCTTGA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	6											234.0	206.0	216.0					6																	54095652		2203	4300	6503	54203611	SO:0001819	synonymous_variant	90523			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.1254C>T	6.37:g.54095652C>T			54203611	B7Z2N0|D6RE05|Q96H08|Q96NF7	Silent	SNP	ENST00000274897.5	37	CCDS4954.1	SNP	24	Broad																																																																																				0.483	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040979.3	NM_138569		Silent
BAI3	577	broad.mit.edu	37	6	69348991	69348991	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr6:69348991C>A	ENST00000370598.1	+	3	1245	c.424C>A	c.(424-426)Cag>Aag	p.Q142K		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	142	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.Q142K(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CCCAGGATTACAGAAAAAAGG	0.343																																																1	Substitution - Missense(1)	ovary(1)	6											46.0	48.0	48.0					6																	69348991		2203	4300	6503	69405712	SO:0001583	missense	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.424C>A	6.37:g.69348991C>A	ENSP00000359630:p.Gln142Lys		69405712	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	1.152	-0.646385	0.03531	.	.	ENSG00000135298	ENST00000370598	T	0.19532	2.14	5.47	5.47	0.80525	CUB (1);	0.256644	0.33327	N	0.005026	T	0.05135	0.0137	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.27739	-1.0065	10	0.26408	T	0.33	.	13.9382	0.64039	0.0:0.927:0.0:0.073	.	142	O60242	BAI3_HUMAN	K	142	ENSP00000359630:Q142K	ENSP00000359630:Q142K	Q	+	1	0	BAI3	69405712	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.383000	0.52471	2.726000	0.93360	0.655000	0.94253	CAG		0.343	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			Missense_Mutation
OLIG3	167826	broad.mit.edu	37	6	137815211	137815211	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr6:137815211G>T	ENST00000367734.2	-	1	320	c.97C>A	c.(97-99)Cag>Aag	p.Q33K		NM_175747.2	NP_786923.1	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3	33					spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron migration (GO:0097476)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.Q33K(1)		endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	11	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		CGGCTCTCCtggtggtggtgg	0.597																																																1	Substitution - Missense(1)	ovary(1)	6											55.0	59.0	58.0					6																	137815211		2203	4300	6503	137856904	SO:0001583	missense	167826			AK096362	CCDS5186.1	6q23.3	2013-05-21			ENSG00000177468	ENSG00000177468		"""Basic helix-loop-helix proteins"""	18003	protein-coding gene	gene with protein product		609323					Standard	NM_175747		Approved	Bhlhb7, bHLHe20	uc003qhp.1	Q7RTU3	OTTHUMG00000015657	ENST00000367734.2:c.97C>A	6.37:g.137815211G>T	ENSP00000356708:p.Gln33Lys		137856904	Q8N8Q0	Missense_Mutation	SNP	ENST00000367734.2	37	CCDS5186.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	10.62	1.399963	0.25291	.	.	ENSG00000177468	ENST00000367734	D	0.99382	-5.8	5.55	5.55	0.83447	.	0.158341	0.29342	N	0.012422	D	0.94374	0.8191	N	0.08118	0	0.38077	D	0.936548	P	0.34587	0.458	B	0.39152	0.292	D	0.95042	0.8179	10	0.05351	T	0.99	-8.1215	17.282	0.87131	0.0:0.0:1.0:0.0	.	33	Q7RTU3	OLIG3_HUMAN	K	33	ENSP00000356708:Q33K	ENSP00000356708:Q33K	Q	-	1	0	OLIG3	137856904	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.869000	0.75521	2.594000	0.87642	0.591000	0.81541	CAG		0.597	OLIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042405.1	NM_175747		Missense_Mutation
AIG1	51390	broad.mit.edu	37	6	143382186	143382186	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr6:143382186C>G	ENST00000275235.4	+	1	149	c.124C>G	c.(124-126)Ctg>Gtg	p.L42V	AIG1_ENST00000494282.2_Missense_Mutation_p.L42V|AIG1_ENST00000357847.4_Missense_Mutation_p.L42V|AIG1_ENST00000367596.1_Missense_Mutation_p.L42V|AIG1_ENST00000367598.5_Missense_Mutation_p.L42V|AIG1_ENST00000344492.5_Missense_Mutation_p.L42V			Q9NVV5	AIG1_HUMAN	androgen-induced 1	42						integral component of membrane (GO:0016021)		p.L42V(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)		CTGGAAATTCCTGACGTTCAT	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											160.0	130.0	140.0					6																	143382186		2203	4300	6503	143423879	SO:0001583	missense	51390			AF153605	CCDS5198.1, CCDS69216.1	6q24.1	2008-02-05			ENSG00000146416	ENSG00000146416			21607	protein-coding gene	gene with protein product		608514				11266118	Standard	NM_001286587		Approved	dJ95L4.1, AIG-1, FLJ10485	uc003qjh.3	Q9NVV5	OTTHUMG00000015721	ENST00000275235.4:c.124C>G	6.37:g.143382186C>G	ENSP00000275235:p.Leu42Val		143423879	B4DPX2|C9J569|Q5T2H2|Q6N047|Q7Z378|Q8TB14|Q9Y3A9|Q9Y5B4	Missense_Mutation	SNP	ENST00000275235.4	37		SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083087	0.76642	.	.	ENSG00000146416	ENST00000367601;ENST00000419072;ENST00000367598;ENST00000447498;ENST00000357847;ENST00000344492;ENST00000367596;ENST00000275235	T;T;T;T;T;T;T	0.65364	-0.15;-0.15;0.39;-0.15;0.96;-0.15;-0.15	4.03	3.16	0.36331	.	0.000000	0.64402	D	0.000007	T	0.72969	0.3527	M	0.82323	2.585	0.58432	D	0.999995	D;D;D;D;D	0.89917	0.997;0.999;1.0;0.996;1.0	D;D;D;D;D	0.87578	0.997;0.994;0.997;0.994;0.998	T	0.77859	-0.2431	10	0.72032	D	0.01	-4.9453	12.0242	0.53360	0.0:0.9148:0.0:0.0852	.	42;42;42;42;38	B4DPX2;Q9NVV5-3;Q9NVV5-2;Q9NVV5-5;E7ENG8	.;.;.;.;.	V	38;38;42;42;42;42;42;42	ENSP00000356573:L38V;ENSP00000356570:L42V;ENSP00000405048:L42V;ENSP00000350509:L42V;ENSP00000340090:L42V;ENSP00000356568:L42V;ENSP00000275235:L42V	ENSP00000275235:L42V	L	+	1	2	AIG1	143423879	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.310000	0.51911	1.052000	0.40392	0.563000	0.77884	CTG		0.577	AIG1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000042510.1	NM_016108		Missense_Mutation
CARD11	84433	broad.mit.edu	37	7	2954938	2954938	+	Silent	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr7:2954938C>T	ENST00000396946.4	-	21	3175	c.2772G>A	c.(2770-2772)ggG>ggA	p.G924G		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	924					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.G917G(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CTAGCGGACTCCCCGAGATGA	0.632			Mis		DLBCL																																		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	1	Substitution - coding silent(1)	ovary(1)	7											90.0	82.0	85.0					7																	2954938		2203	4300	6503	2921464	SO:0001819	synonymous_variant	84433			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2772G>A	7.37:g.2954938C>T			2921464	A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	ENST00000396946.4	37	CCDS5336.2	SNP	30	Broad																																																																																				0.632	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415		Silent
SDK1	221935	broad.mit.edu	37	7	3991483	3991483	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr7:3991483G>T	ENST00000404826.2	+	7	1220	c.1081G>T	c.(1081-1083)Gtc>Ttc	p.V361F	SDK1_ENST00000389531.3_Missense_Mutation_p.V361F	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	361	Ig-like C2-type 3.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.V361F(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CGGGCCATACGTCTGCGAGGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	7											51.0	51.0	51.0					7																	3991483		2203	4300	6503	3958009	SO:0001583	missense	221935			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1081G>T	7.37:g.3991483G>T	ENSP00000385899:p.Val361Phe		3958009	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	5.697	0.313120	0.10789	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.03181	4.02;4.02	4.87	1.52	0.23074	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.299156	0.27084	N	0.021020	T	0.03136	0.0092	L	0.51422	1.61	0.26427	N	0.975993	B	0.24132	0.098	B	0.25614	0.062	T	0.44345	-0.9334	10	0.08599	T	0.76	.	4.5079	0.11898	0.3171:0.0:0.5173:0.1657	.	361	Q7Z5N4	SDK1_HUMAN	F	361	ENSP00000385899:V361F;ENSP00000374182:V361F	ENSP00000374182:V361F	V	+	1	0	SDK1	3958009	0.918000	0.31147	0.027000	0.17364	0.031000	0.12232	1.139000	0.31504	0.585000	0.29608	-0.136000	0.14681	GTC		0.607	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		Missense_Mutation
GTF2IRD1	9569	broad.mit.edu	37	7	73922455	73922455	+	Silent	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr7:73922455C>T	ENST00000265755.3	+	2	438	c.45C>T	c.(43-45)tgC>tgT	p.C15C	GTF2IRD1_ENST00000455841.2_Silent_p.C15C|GTF2IRD1_ENST00000476977.1_Silent_p.C15C|GTF2IRD1_ENST00000424337.2_Silent_p.C15C|GTF2IRD1_ENST00000489094.1_3'UTR	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	15					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C15C(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CCAACGGCTGCGGACCCGACC	0.642																																																1	Substitution - coding silent(1)	ovary(1)	7											88.0	68.0	75.0					7																	73922455		2203	4300	6503	73560391	SO:0001819	synonymous_variant	9569			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.45C>T	7.37:g.73922455C>T			73560391	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Silent	SNP	ENST00000265755.3	37	CCDS5571.1	SNP	27	Broad																																																																																				0.642	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328		Silent
YWHAG	7532	broad.mit.edu	37	7	75959349	75959350	+	Missense_Mutation	DNP	AC	AC	TT			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr7:75959349_75959350AC>TT	ENST00000307630.3	-	2	510_511	c.288_289GT>AA	c.(286-291)gtGTgc>gtAAgc	p.C97S		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	97					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)	p.C97S(1)		endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						ACATCCTGGCACACAGCCTCCA	0.5																																																1	Substitution - Missense(1)	ovary(1)	7																																								75797286	SO:0001583	missense	7532			AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.288_289delinsTT	7.37:g.75959349_75959350delinsTT	ENSP00000306330:p.Cys97Ser		75797285	O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Missense_Mutation	DNP	ENST00000307630.3	37	CCDS5584.1	DNP	6	Broad																																																																																				0.500	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253002.1	NM_012479		Missense_Mutation
RNF133	168433	broad.mit.edu	37	7	122338188	122338188	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr7:122338188C>A	ENST00000340112.2	-	1	1022	c.785G>T	c.(784-786)cGc>cTc	p.R262L	CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000313070.7_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	262					protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R262L(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						AGGCTTATAGCGTTCAAAGCA	0.403																																					Colon(198;1778 2057 7449 19869 45985)											1	Substitution - Missense(1)	ovary(1)	7											155.0	144.0	148.0					7																	122338188		2203	4300	6503	122125424	SO:0001583	missense	168433			AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.785G>T	7.37:g.122338188C>A	ENSP00000344489:p.Arg262Leu		122125424	A4D0W2|Q8N7G7	Missense_Mutation	SNP	ENST00000340112.2	37	CCDS5784.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.404514	0.00195	.	.	ENSG00000188050	ENST00000340112	T	0.41065	1.01	5.53	-6.62	0.01813	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.713262	0.12945	N	0.426283	T	0.13157	0.0319	N	0.04132	-0.27	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.11616	-1.0580	10	0.26408	T	0.33	.	2.9162	0.05754	0.2693:0.1043:0.4405:0.186	.	262	Q8WVZ7	RN133_HUMAN	L	262	ENSP00000344489:R262L	ENSP00000344489:R262L	R	-	2	0	RNF133	122125424	0.025000	0.19082	0.264000	0.24511	0.001000	0.01503	-0.127000	0.10547	-1.336000	0.02238	-4.215000	0.00009	CGC		0.403	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	NM_139175		Missense_Mutation
CPA5	93979	broad.mit.edu	37	7	130007377	130007377	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr7:130007377C>T	ENST00000485477.1	+	10	2132	c.1003C>T	c.(1003-1005)Cga>Tga	p.R335*	CPA5_ENST00000431780.2_Nonsense_Mutation_p.R335*|CPA5_ENST00000355388.3_Nonsense_Mutation_p.R335*|CPA5_ENST00000461828.1_Nonsense_Mutation_p.R335*|CPA5_ENST00000466363.2_Nonsense_Mutation_p.R335*|CPA5_ENST00000474905.1_Nonsense_Mutation_p.R335*|CPA5_ENST00000393213.3_Nonsense_Mutation_p.R335*			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	335						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R335*(1)		NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					CCCTTACGGCCGATTGCTGGA	0.522																																																1	Substitution - Nonsense(1)	ovary(1)	7											126.0	120.0	122.0					7																	130007377		2203	4300	6503	129794613	SO:0001587	stop_gained	93979			AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.1003C>T	7.37:g.130007377C>T	ENSP00000420237:p.Arg335*		129794613	G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Nonsense_Mutation	SNP	ENST00000485477.1	37	CCDS5819.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	39	7.540474	0.98345	.	.	ENSG00000158525	ENST00000355388;ENST00000461828;ENST00000466363;ENST00000485477;ENST00000431780;ENST00000474905;ENST00000393213	.	.	.	5.61	3.57	0.40892	.	0.570222	0.17125	N	0.186070	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.5025	0.11870	0.0:0.6562:0.0:0.3438	.	.	.	.	X	335	.	.	R	+	1	2	CPA5	129794613	1.000000	0.71417	0.924000	0.36721	0.015000	0.08874	1.399000	0.34566	1.375000	0.46248	0.462000	0.41574	CGA		0.522	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	NM_001127441		Nonsense_Mutation
RAB11FIP1	80223	broad.mit.edu	37	8	37734873	37734873	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr8:37734873A>T	ENST00000330843.4	-	2	580	c.568T>A	c.(568-570)Tcc>Acc	p.S190T	RAB11FIP1_ENST00000287263.4_Missense_Mutation_p.S190T|RAB11FIP1_ENST00000522727.1_Missense_Mutation_p.S42T|RAB11FIP1_ENST00000524118.1_Missense_Mutation_p.S42T	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	190					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)		p.S190T(1)		NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			ATGATGGCGGAGGCGGTGTCT	0.448																																																1	Substitution - Missense(1)	ovary(1)	8											308.0	282.0	291.0					8																	37734873		2203	4300	6503	37854031	SO:0001583	missense	80223			AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.568T>A	8.37:g.37734873A>T	ENSP00000331342:p.Ser190Thr		37854031	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	ENST00000330843.4	37	CCDS34882.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	14.37	2.515669	0.44763	.	.	ENSG00000156675	ENST00000287263;ENST00000330843;ENST00000522727;ENST00000524118	T;T;T;T	0.33654	1.4;1.4;1.4;1.4	5.67	5.67	0.87782	.	0.000000	0.52532	D	0.000075	T	0.65821	0.2728	M	0.86420	2.815	0.53688	D	0.999977	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.79784	0.955;0.991;0.98;0.993	T	0.72547	-0.4260	10	0.72032	D	0.01	-12.3326	15.9132	0.79488	1.0:0.0:0.0:0.0	.	42;42;190;190	E7EX40;Q6WKZ4-2;Q6WKZ4-3;Q6WKZ4	.;.;.;RFIP1_HUMAN	T	190;190;42;42	ENSP00000287263:S190T;ENSP00000331342:S190T;ENSP00000430009:S42T;ENSP00000430680:S42T	ENSP00000287263:S190T	S	-	1	0	RAB11FIP1	37854031	1.000000	0.71417	0.067000	0.19924	0.005000	0.04900	7.274000	0.78538	2.154000	0.67381	0.482000	0.46254	TCC		0.448	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151		Missense_Mutation
MCMDC2	157777	broad.mit.edu	37	8	67808410	67808410	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr8:67808410G>T	ENST00000422365.2	+	11	1456	c.1285G>T	c.(1285-1287)Gag>Tag	p.E429*	MCMDC2_ENST00000313616.5_Nonsense_Mutation_p.E429*|MCMDC2_ENST00000541540.1_Nonsense_Mutation_p.E366*|MCMDC2_ENST00000396592.3_Nonsense_Mutation_p.E429*	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	429					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.E424*(1)		endometrium(2)|kidney(2)|lung(5)	9						CTTAGTTCTGGAGAGCAGAAG	0.343																																																1	Substitution - Nonsense(1)	ovary(1)	8											164.0	147.0	153.0					8																	67808410		2203	4300	6503	67970964	SO:0001587	stop_gained	157777			BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.1285G>T	8.37:g.67808410G>T	ENSP00000413632:p.Glu429*		67970964	B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Nonsense_Mutation	SNP	ENST00000422365.2	37	CCDS6197.2	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.699666	0.96802	.	.	ENSG00000178460	ENST00000379356;ENST00000396592;ENST00000422365;ENST00000313616;ENST00000541540	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.9212	20.5666	0.99351	0.0:0.0:1.0:0.0	.	.	.	.	X	301;429;429;429;366	.	ENSP00000317234:E429X	E	+	1	0	C8orf45	67970964	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.836000	0.75349	2.854000	0.98071	0.655000	0.94253	GAG		0.343	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347350.1	NM_173518		Nonsense_Mutation
MTERF3	51001	broad.mit.edu	37	8	97256229	97256229	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr8:97256229T>A	ENST00000287025.3	-	7	1075	c.977A>T	c.(976-978)aAt>aTt	p.N326I	MTERFD1_ENST00000522822.1_Missense_Mutation_p.N205I|MTERFD1_ENST00000523821.1_Missense_Mutation_p.N326I|MTERFD1_ENST00000524341.1_Intron	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		326					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)	p.N326I(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					TTTCATTTTATTTGCAGTTAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	8											225.0	218.0	220.0					8																	97256229		2203	4300	6503	97325405	SO:0001583	missense	51001																														ENST00000287025.3:c.977A>T	8.37:g.97256229T>A	ENSP00000287025:p.Asn326Ile		97325405	B3KMG6|G3V130|Q9Y301	Missense_Mutation	SNP	ENST00000287025.3	37	CCDS6270.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	20.7	4.033961	0.75504	.	.	ENSG00000156469	ENST00000523821;ENST00000522822;ENST00000287025	T;T;T	0.12039	2.72;2.72;2.72	6.16	3.82	0.43975	.	0.178643	0.64402	D	0.000012	T	0.24928	0.0605	M	0.78049	2.395	0.48341	D	0.999634	P;P	0.50066	0.89;0.931	P;P	0.51918	0.684;0.684	T	0.01692	-1.1294	10	0.72032	D	0.01	-14.8235	6.5438	0.22394	0.0:0.256:0.0:0.744	.	326;326	E5RIK9;Q96E29	.;MTER1_HUMAN	I	326;205;326	ENSP00000429400:N326I;ENSP00000430138:N205I;ENSP00000287025:N326I	ENSP00000287025:N326I	N	-	2	0	MTERFD1	97325405	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.255000	0.32909	1.143000	0.42306	0.528000	0.53228	AAT		0.368	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379876.1			Missense_Mutation
ZNF572	137209	broad.mit.edu	37	8	125989527	125989527	+	Silent	SNP	T	T	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr8:125989527T>C	ENST00000319286.5	+	3	1171	c.1017T>C	c.(1015-1017)cgT>cgC	p.R339R		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R339R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			ATTTTAGTCGTAGTTCAAACC	0.353										HNSCC(60;0.17)																																						1	Substitution - coding silent(1)	ovary(1)	8											61.0	63.0	62.0					8																	125989527		2203	4300	6503	126058708	SO:0001819	synonymous_variant	137209			BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.1017T>C	8.37:g.125989527T>C			126058708	A1L4F1|Q8N1Q0	Silent	SNP	ENST00000319286.5	37	CCDS6354.1	SNP	57	Broad																																																																																				0.353	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381359.1	NM_152412		Silent
FAM135B	51059	broad.mit.edu	37	8	139144851	139144851	+	Silent	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr8:139144851G>T	ENST00000395297.1	-	20	4376	c.4206C>A	c.(4204-4206)ctC>ctA	p.L1402L		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1402								p.L1402L(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TGAAGTAGTTGAGTCCTGCCA	0.517										HNSCC(54;0.14)																																						2	Substitution - coding silent(2)	ovary(2)	8											147.0	154.0	152.0					8																	139144851		1951	4155	6106	139214033	SO:0001819	synonymous_variant	51059			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.4206C>A	8.37:g.139144851G>T			139214033	B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	37	CCDS6375.2	SNP	45	Broad																																																																																				0.517	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		Silent
VLDLR	7436	broad.mit.edu	37	9	2645614	2645614	+	Silent	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr9:2645614C>T	ENST00000382100.3	+	10	1709	c.1353C>T	c.(1351-1353)atC>atT	p.I451I	VLDLR_ENST00000382099.2_Silent_p.I451I	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	451					cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.I451I(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		GAAGAGACATCAGGAAGATTG	0.418																																																1	Substitution - coding silent(1)	ovary(1)	9											127.0	131.0	129.0					9																	2645614		2203	4300	6503	2635614	SO:0001819	synonymous_variant	7436				CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.1353C>T	9.37:g.2645614C>T			2635614	B2RMZ7|D3DRH6|Q5VVF6	Silent	SNP	ENST00000382100.3	37	CCDS6446.1	SNP	29	Broad																																																																																				0.418	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051519.2	NM_003383		Silent
JAK2	3717	broad.mit.edu	37	9	5065041	5065041	+	Splice_Site	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr9:5065041G>C	ENST00000381652.3	+	9	1708		c.e9+1		JAK2_ENST00000544510.1_Splice_Site|JAK2_ENST00000539801.1_Splice_Site	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)	p.?(1)	BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	GCCCAATTTCGTGAGTAATAC	0.313		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																														Dom	yes		9	9p24	3717	Janus kinase 2		L	1	Unknown(1)	ovary(1)	9											56.0	54.0	54.0					9																	5065041		2203	4300	6503	5055041	SO:0001630	splice_region_variant	3717	Familial Cancer Database			CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.1214+1G>C	9.37:g.5065041G>C			5055041	O14636|O75297	Splice_Site_SNP	SNP	ENST00000381652.3	37	CCDS6457.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135411	0.77662	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6185	0.91313	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	JAK2	5055041	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.459000	0.97638	2.412000	0.81896	0.313000	0.20887	.		0.313	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		Intron	Splice_Site_SNP
PTPRD	5789	broad.mit.edu	37	9	8485897	8485897	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr9:8485897G>A	ENST00000381196.4	-	25	3463	c.2920C>T	c.(2920-2922)Cca>Tca	p.P974S	PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000356435.5_Missense_Mutation_p.P974S|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000540109.1_Missense_Mutation_p.P974S|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000358503.5_Missense_Mutation_p.P952S|PTPRD_ENST00000360074.4_Missense_Mutation_p.P961S	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	974	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.P974S(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GTGTCAGCTGGAACAATAAGC	0.478										TSP Lung(15;0.13)																																						1	Substitution - Missense(1)	ovary(1)	9											164.0	153.0	157.0					9																	8485897		2203	4300	6503	8475897	SO:0001583	missense	5789			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2920C>T	9.37:g.8485897G>A	ENSP00000370593:p.Pro974Ser		8475897	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	13.47	2.245611	0.39697	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000540109	T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38	5.48	5.48	0.80851	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.052873	0.85682	D	0.000000	T	0.38719	0.1051	N	0.11284	0.12	0.54753	D	0.999986	B;B;B	0.20459	0.021;0.016;0.045	B;B;B	0.29663	0.037;0.025;0.105	T	0.18935	-1.0321	9	.	.	.	.	19.7157	0.96119	0.0:0.0:1.0:0.0	.	961;974;974	G3XAE2;Q2HXI4;P23468	.;.;PTPRD_HUMAN	S	974;974;961;952;974	ENSP00000370593:P974S;ENSP00000348812:P974S;ENSP00000353187:P961S;ENSP00000351293:P952S;ENSP00000438164:P974S	.	P	-	1	0	PTPRD	8475897	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.225000	0.58600	2.749000	0.94314	0.655000	0.94253	CCA		0.478	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			Missense_Mutation
LINGO2	158038	broad.mit.edu	37	9	27949897	27949897	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr9:27949897T>C	ENST00000379992.2	-	6	1222	c.773A>G	c.(772-774)aAc>aGc	p.N258S	LINGO2_ENST00000308675.3_Missense_Mutation_p.N258S	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	258						integral component of membrane (GO:0016021)		p.N258S(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		CAGATTGGTGTTGGTGACTGA	0.468																																																2	Substitution - Missense(2)	ovary(2)	9											255.0	231.0	239.0					9																	27949897		2203	4300	6503	27939897	SO:0001583	missense	158038			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.773A>G	9.37:g.27949897T>C	ENSP00000369328:p.Asn258Ser		27939897	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	ENST00000379992.2	37	CCDS6524.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	4.733	0.136395	0.09032	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.80033	-1.33;-1.33	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.70710	0.3255	N	0.16037	0.36	0.58432	D	0.999999	B	0.29341	0.242	B	0.36378	0.223	T	0.67217	-0.5726	9	.	.	.	.	16.4484	0.83959	0.0:0.0:0.0:1.0	.	258	Q7L985	LIGO2_HUMAN	S	258	ENSP00000369328:N258S;ENSP00000310126:N258S	.	N	-	2	0	LINGO2	27939897	1.000000	0.71417	0.999000	0.59377	0.075000	0.17131	6.139000	0.71728	2.285000	0.76669	0.533000	0.62120	AAC		0.468	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570		Missense_Mutation
CNTFR	1271	broad.mit.edu	37	9	34552726	34552726	+	Missense_Mutation	SNP	C	C	T	rs376033873		TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr9:34552726C>T	ENST00000378980.3	-	8	1188	c.895G>A	c.(895-897)Gct>Act	p.A299T	CNTFR_ENST00000351266.4_Missense_Mutation_p.A299T	NM_001207011.1|NM_147164.2	NP_001193940.1|NP_671693.1	P26992	CNTFR_HUMAN	ciliary neurotrophic factor receptor	299	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brainstem development (GO:0003360)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|skeletal muscle organ development (GO:0060538)|suckling behavior (GO:0001967)	anchored component of membrane (GO:0031225)|CNTFR-CLCF1 complex (GO:0097059)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|cytokine binding (GO:0019955)|receptor binding (GO:0005102)	p.A299T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(4)|skin(1)	15	all_epithelial(49;0.0899)		STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.00494)		CAGGGCGTAGCGTGGGCGGCT	0.627																																																1	Substitution - Missense(1)	ovary(1)	9							THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	159.0	112.0	128.0		895,895,895	3.7	0.9	9		128	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	CNTFR	NM_001207011.1,NM_001842.4,NM_147164.2	58,58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	299/373,299/373,299/373	34552726	1,13005	2203	4300	6503	34542726	SO:0001583	missense	1271			M73238	CCDS6558.1	9p13	2013-02-11			ENSG00000122756	ENSG00000122756		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2170	protein-coding gene	gene with protein product		118946				1648265	Standard	NM_001842		Approved		uc003zuq.2	P26992	OTTHUMG00000019821	ENST00000378980.3:c.895G>A	9.37:g.34552726C>T	ENSP00000368265:p.Ala299Thr		34542726	Q5U050	Missense_Mutation	SNP	ENST00000378980.3	37	CCDS6558.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	17.67	3.447068	0.63178	0.0	1.16E-4	ENSG00000122756	ENST00000378980;ENST00000351266	T;T	0.52983	0.64;0.64	4.64	3.74	0.42951	Fibronectin, type III (2);	0.495221	0.18585	N	0.136892	T	0.58032	0.2094	L	0.45137	1.4	0.35237	D	0.777453	D	0.89917	1.0	D	0.75020	0.985	T	0.67601	-0.5629	9	0.62326	D	0.03	.	10.6881	0.45854	0.0:0.904:0.0:0.096	.	299	P26992	CNTFR_HUMAN	T	299	ENSP00000368265:A299T;ENSP00000242338:A299T	ENSP00000242338:A299T	A	-	1	0	CNTFR	34542726	1.000000	0.71417	0.939000	0.37840	0.130000	0.20726	6.803000	0.75180	0.937000	0.37394	0.461000	0.40582	GCT		0.627	CNTFR-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052176.1			Missense_Mutation
SPATA31D1	389763	broad.mit.edu	37	9	84607311	84607311	+	Silent	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr9:84607311G>T	ENST00000344803.2	+	4	1973	c.1926G>T	c.(1924-1926)gtG>gtT	p.V642V		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	642					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.V642V(1)									TACCCTCTGTGGTTCAAAAAT	0.488																																																1	Substitution - coding silent(1)	ovary(1)	9											91.0	90.0	90.0					9																	84607311		1849	4099	5948	83797131	SO:0001819	synonymous_variant	389763				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.1926G>T	9.37:g.84607311G>T			83797131		Silent	SNP	ENST00000344803.2	37	CCDS47986.1	SNP	47	Broad																																																																																				0.488	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		Silent
OMD	4958	broad.mit.edu	37	9	95177580	95177580	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr9:95177580G>C	ENST00000375550.4	-	3	1395	c.1120C>G	c.(1120-1122)Caa>Gaa	p.Q374E	CENPP_ENST00000375587.3_Intron	NM_005014.2	NP_005005.1	Q99983	OMD_HUMAN	osteomodulin	374					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.Q374E(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|skin(2)	16						GTCTTTAGTTGTATTGTTTGA	0.373			T	USP6	aneurysmal bone cysts																																		Dom	yes		9	9q22.31	4958	osteomodulin		M	1	Substitution - Missense(1)	ovary(1)	9											220.0	205.0	210.0					9																	95177580		2203	4300	6503	94217401	SO:0001583	missense	4958			AB000114	CCDS6696.1	9q22.31	2008-02-05			ENSG00000127083	ENSG00000127083		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8134	protein-coding gene	gene with protein product	"""osteoadherin proteoglycan"""						Standard	NM_005014		Approved	osteoadherin, SLRR2C	uc004asd.4	Q99983	OTTHUMG00000020225	ENST00000375550.4:c.1120C>G	9.37:g.95177580G>C	ENSP00000364700:p.Gln374Glu		94217401	Q5TBF4	Missense_Mutation	SNP	ENST00000375550.4	37	CCDS6696.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517216	0.44763	.	.	ENSG00000127083	ENST00000375550	T	0.34667	1.35	5.59	4.68	0.58851	.	0.358411	0.26213	N	0.025666	T	0.37732	0.1014	L	0.57536	1.79	0.33741	D	0.619393	B	0.10296	0.003	B	0.08055	0.003	T	0.51204	-0.8735	10	0.72032	D	0.01	-5.4197	15.0434	0.71807	0.0:0.1416:0.8584:0.0	.	374	Q99983	OMD_HUMAN	E	374	ENSP00000364700:Q374E	ENSP00000364700:Q374E	Q	-	1	0	OMD	94217401	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.003000	0.57061	1.463000	0.47967	0.555000	0.69702	CAA		0.373	OMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053090.1	NM_005014		Missense_Mutation
ZDHHC12	84885	broad.mit.edu	37	9	131486308	131486308	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr9:131486308C>T	ENST00000372663.4	-	1	77	c.65G>A	c.(64-66)tGg>tAg	p.W22*	ZDHHC12_ENST00000372672.2_Nonsense_Mutation_p.W22*|RP11-545E17.3_ENST00000443631.1_RNA|ZDHHC12_ENST00000372667.5_Nonsense_Mutation_p.W22*|ZDHHC12_ENST00000467312.1_5'UTR	NM_032799.4	NP_116188	Q96GR4	ZDH12_HUMAN	zinc finger, DHHC-type containing 12	22					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.W22*(1)		central_nervous_system(1)|ovary(2)|upper_aerodigestive_tract(1)	4						CGTGATTCCCCAGGTCAGCAC	0.721																																																1	Substitution - Nonsense(1)	ovary(1)	9											29.0	30.0	29.0					9																	131486308		2202	4299	6501	130526129	SO:0001587	stop_gained	84885			AK027430	CCDS6909.1	9q34.11	2008-02-05			ENSG00000160446	ENSG00000160446		"""Zinc fingers, DHHC-type"""	19159	protein-coding gene	gene with protein product							Standard	NM_032799		Approved	ZNF400, FLJ14524	uc004bvy.3	Q96GR4	OTTHUMG00000020756	ENST00000372663.4:c.65G>A	9.37:g.131486308C>T	ENSP00000361748:p.Trp22*		130526129	A6NH95|B2RE03|Q5T265|Q5T267|Q5T268|Q86VT5|Q96T09	Nonsense_Mutation	SNP	ENST00000372663.4	37	CCDS6909.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	37	6.149229	0.97324	.	.	ENSG00000160446	ENST00000372663;ENST00000372672;ENST00000372667;ENST00000372664;ENST00000452105;ENST00000406904	.	.	.	5.12	5.12	0.69794	.	0.141884	0.52532	D	0.000078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	17.1729	0.86834	0.0:1.0:0.0:0.0	.	.	.	.	X	22	.	ENSP00000361748:W22X	W	-	2	0	ZDHHC12	130526129	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.956000	0.49129	2.398000	0.81561	0.456000	0.33151	TGG		0.721	ZDHHC12-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054484.1	NM_032799		Nonsense_Mutation
CACFD1	11094	broad.mit.edu	37	9	136333142	136333142	+	Silent	SNP	G	G	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chr9:136333142G>T	ENST00000316948.4	+	4	500	c.420G>T	c.(418-420)ctG>ctT	p.L140L	CACFD1_ENST00000542192.1_Silent_p.L98L|CACFD1_ENST00000291722.7_Silent_p.L98L|CACFD1_ENST00000540581.1_Silent_p.L140L	NM_017586.3	NP_060056.1	Q9UGQ2	FLOWR_HUMAN	calcium channel flower domain containing 1	140					synaptic vesicle endocytosis (GO:0048488)	integral component of synaptic vesicle membrane (GO:0030285)	calcium channel activity (GO:0005262)	p.L140L(1)									TCTCTGCTCTGGGCAAAAAGT	0.642																																																1	Substitution - coding silent(1)	ovary(1)	9											61.0	57.0	58.0					9																	136333142		2203	4300	6503	135322963	SO:0001819	synonymous_variant	11094				CCDS6974.1, CCDS48051.1, CCDS56591.1, CCDS56592.1	9q34	2012-03-06	2012-03-06	2012-03-06	ENSG00000160325	ENSG00000160325			1365	protein-coding gene	gene with protein product		613104	"""chromosome 9 open reading frame 7"""	C9orf7		19737521	Standard	NM_001242370		Approved	D9S2135, flower	uc011mdh.1	Q9UGQ2	OTTHUMG00000020875	ENST00000316948.4:c.420G>T	9.37:g.136333142G>T			135322963	B7Z3T8|B7Z5E1|F5GXX4|Q5SXD4|Q8NBM6	Silent	SNP	ENST00000316948.4	37	CCDS6974.1	SNP	47	Broad																																																																																				0.642	CACFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054915.1	NM_017586		Silent
SERPINA7	6906	broad.mit.edu	37	X	105280805	105280805	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chrX:105280805A>T	ENST00000327674.4	-	1	580	c.245T>A	c.(244-246)tTt>tAt	p.F82Y	SERPINA7_ENST00000372563.1_Missense_Mutation_p.F82Y|SERPINA7_ENST00000487487.1_5'Flank			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	82					aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.F82Y(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GCAGGCCCCAAAGGAAAGCAT	0.498																																																1	Substitution - Missense(1)	ovary(1)	X											89.0	79.0	83.0					X																	105280805		2203	4300	6503	105167461	SO:0001583	missense	6906			M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.245T>A	X.37:g.105280805A>T	ENSP00000329374:p.Phe82Tyr		105167461	D3DUX1	Missense_Mutation	SNP	ENST00000327674.4	37	CCDS14518.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	10.82	1.457676	0.26161	.	.	ENSG00000123561	ENST00000327674;ENST00000372563	D;D	0.87729	-2.29;-2.29	4.9	-0.394	0.12434	Serpin domain (3);	0.414217	0.22298	N	0.061917	D	0.84424	0.5469	M	0.65975	2.015	0.09310	N	1	P	0.40909	0.732	P	0.45071	0.468	T	0.76737	-0.2849	10	0.87932	D	0	.	4.5149	0.11930	0.6503:0.0:0.2077:0.142	.	82	P05543	THBG_HUMAN	Y	82	ENSP00000329374:F82Y;ENSP00000361644:F82Y	ENSP00000329374:F82Y	F	-	2	0	SERPINA7	105167461	0.007000	0.16637	0.000000	0.03702	0.153000	0.21895	1.924000	0.40065	-0.262000	0.09392	0.481000	0.45027	TTT		0.498	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057790.1	NM_000354		Missense_Mutation
SAGE1	55511	broad.mit.edu	37	X	134990687	134990687	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2280-01	TCGA-24-2280-10	g.chrX:134990687G>A	ENST00000370709.3	+	11	1352	c.1352G>A	c.(1351-1353)cGa>cAa	p.R451Q	SAGE1_ENST00000324447.3_Missense_Mutation_p.R451Q|SAGE1_ENST00000537770.1_Intron|SAGE1_ENST00000535938.1_Missense_Mutation_p.R451Q			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	451						nucleus (GO:0005634)		p.R451Q(1)		breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					AATGGCCAACGAAAACAGGAT	0.428																																																1	Substitution - Missense(1)	ovary(1)	X											186.0	165.0	172.0					X																	134990687		2203	4299	6502	134818353	SO:0001583	missense	55511			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.1352G>A	X.37:g.134990687G>A	ENSP00000359743:p.Arg451Gln		134818353	Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	37	CCDS14652.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	11.53	1.666580	0.29604	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000370709	T;T;T	0.34859	1.34;1.34;1.34	1.42	-2.84	0.05751	.	0.068566	0.56097	U	0.000030	T	0.12050	0.0293	N	0.08118	0	0.09310	N	1	D	0.65815	0.995	B	0.42030	0.373	T	0.46034	-0.9220	10	0.15499	T	0.54	.	3.977	0.09478	0.0:0.3017:0.4994:0.1989	.	451	Q9NXZ1	SAGE1_HUMAN	Q	451	ENSP00000323191:R451Q;ENSP00000445959:R451Q;ENSP00000359743:R451Q	ENSP00000323191:R451Q	R	+	2	0	SAGE1	134818353	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.649000	0.05384	-1.018000	0.03363	-1.375000	0.01183	CGA		0.428	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666		Missense_Mutation
SKIDA1	387640	broad.mit.edu	37	10	21805466	21805467	+	In_Frame_Ins	INS	-	-	CCTCCT	rs112207161	byFrequency	TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-2280-01	TCGA-24-2280-10	g.chr10:21805466_21805467insCCTCCT	ENST00000449193.2	-	4	3537_3538	c.1285_1286insAGGAGG	c.(1285-1287)ggg>gAGGAGGgg	p.428_429insEE	SKIDA1_ENST00000444772.3_In_Frame_Ins_p.349_350insEE|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	347						nucleus (GO:0005634)		p.E428_G429insEE(2)									CCCGCTGCccccctcctcctcc	0.619														2708	0.540735	0.916	0.4063	5008	,	,		10303	0.3244		0.5408	False		,,,				2504	0.3517															2	Insertion - In frame(2)	soft_tissue(2)	10								3173,56,18,597		1435,46,11,246,5,0,0,3,1,175						3.0	1.0		dbSNP_132	7	4189,51,27,3619		1322,36,14,1495,1,0,13,2,9,1051	no	codingComplex	C10orf140	NM_207371.3		2757,82,25,1741,6,0,13,5,10,1226	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		46.8805,17.4558,37.2379				7362,107,45,4216				21845473	SO:0001652	inframe_insertion	387640			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1280_1285dupAGGAGG	10.37:g.21805467_21805472dupCCTCCT	ENSP00000410041:p.Glu427_Glu428dup		21845472	B1ANA5|Q6ZMX4|Q8N3C3	In_Frame_Ins	INS	ENST00000449193.2	37	CCDS44363.1	INS	22	Broad																																																																																				0.619	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371		In_Frame_Ins
CCDC87	55231	broad.mit.edu	37	11	66358421	66358439	+	Frame_Shift_Del	DEL	GACCACAGTTGTTCCAGAT	GACCACAGTTGTTCCAGAT	-			TCGA-24-2280-01	TCGA-24-2280-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-2280-01	TCGA-24-2280-10	g.chr11:66358421_66358439delGACCACAGTTGTTCCAGAT	ENST00000333861.3	-	1	2115_2133	c.2048_2066delATCTGGAACAACTGTGGTC	c.(2047-2067)catctggaacaactgtggtctfs	p.HLEQLWS683fs	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	683					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)			p.H683fs*13(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						CTCAAGCACAGACCACAGTTGTTCCAGATGCTTCTGCAG	0.548																																																1	Deletion - Frameshift(1)	ovary(1)	11																																								66115015	SO:0001589	frameshift_variant	55231			BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.2048_2066delATCTGGAACAACTGTGGTC	11.37:g.66358421_66358439delGACCACAGTTGTTCCAGAT	ENSP00000328487:p.His683fs		66114997	Q8NE76	Frame_Shift_Del	DEL	ENST00000333861.3	37	CCDS8145.1	DEL	33	Broad																																																																																				0.548	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	NM_018219		Frame_Shift_Del
