#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
LY9	4063	broad.mit.edu	37	1	160783668	160783668	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr1:160783668T>A	ENST00000263285.6	+	3	727	c.697T>A	c.(697-699)Tcc>Acc	p.S233T	LY9_ENST00000341032.4_Missense_Mutation_p.S233T|LY9_ENST00000368040.1_5'UTR|LY9_ENST00000392203.4_Missense_Mutation_p.S233T|LY9_ENST00000368041.2_Missense_Mutation_p.S193T|LY9_ENST00000368037.5_Missense_Mutation_p.S233T|LY9_ENST00000471816.1_3'UTR			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	233	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.S233T(1)		autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CCAGAGAAGCTCCCTCCCTGT	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											182.0	173.0	176.0					1																	160783668		2203	4300	6503	159050292	SO:0001583	missense	4063			L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.697T>A	1.37:g.160783668T>A	ENSP00000263285:p.Ser233Thr		159050292	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Missense_Mutation	SNP	ENST00000263285.6	37	CCDS30916.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	14.30	2.494226	0.44352	.	.	ENSG00000122224	ENST00000368041;ENST00000341032;ENST00000263285;ENST00000542780;ENST00000392203;ENST00000368037;ENST00000368036	T;T	0.38077	1.16;1.16	4.12	4.12	0.48240	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.374205	0.24980	N	0.034073	T	0.54013	0.1832	M	0.88105	2.93	0.80722	D	1	D;D;D;D;D;D	0.76494	0.997;0.997;0.999;0.997;0.999;0.997	D;D;D;D;D;D	0.75484	0.98;0.98;0.986;0.98;0.986;0.985	T	0.61574	-0.7035	10	0.56958	D	0.05	-17.1272	10.1036	0.42519	0.0:0.0:0.0:1.0	.	233;193;193;233;233;233	B4E0J5;Q5VYH7;Q5VYH9;E7EME5;Q9HBG7-2;Q9HBG7	.;.;.;.;.;LY9_HUMAN	T	233;233;233;233;193;193;135	ENSP00000342921:S233T;ENSP00000263285:S233T	ENSP00000263285:S233T	S	+	1	0	LY9	159050292	0.670000	0.27512	0.405000	0.26409	0.079000	0.17450	3.290000	0.51755	1.793000	0.52555	0.455000	0.32223	TCC		0.537	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348		Missense_Mutation
GPR158	57512	broad.mit.edu	37	10	25887864	25887864	+	Silent	SNP	C	C	T	rs149155339		TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr10:25887864C>T	ENST00000376351.3	+	11	3668	c.3309C>T	c.(3307-3309)aaC>aaT	p.N1103N	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	1103					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.N1103N(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						AAGAGGAGAACGGAGGTCAGC	0.493													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18272	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	10						C		1,4405		0,1,2202	79.0	84.0	82.0		3309	-11.8	0.0	10	dbSNP_134	82	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	GPR158	NM_020752.2		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		1103/1216	25887864	3,13003	2203	4300	6503	25927870	SO:0001819	synonymous_variant	57512			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.3309C>T	10.37:g.25887864C>T			25927870	Q6QR81|Q9ULT3	Silent	SNP	ENST00000376351.3	37	CCDS31166.1	SNP	19	Broad																																																																																				0.493	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		Silent
SVIL	6840	broad.mit.edu	37	10	29840004	29840004	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr10:29840004C>A	ENST00000355867.4	-	6	1101	c.349G>T	c.(349-351)Gca>Tca	p.A117S	SVIL_ENST00000375400.3_Missense_Mutation_p.A117S|SVIL_ENST00000375398.2_Missense_Mutation_p.A117S	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	117	Interaction with MYLK. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.A117S(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TACTTCTCTGCCAGCTGTCGC	0.552																																																1	Substitution - Missense(1)	ovary(1)	10											191.0	160.0	171.0					10																	29840004		2203	4300	6503	29880010	SO:0001583	missense	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.349G>T	10.37:g.29840004C>A	ENSP00000348128:p.Ala117Ser		29880010	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	CCDS7164.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914051	0.72983	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	T;T;T	0.47528	0.84;0.84;0.84	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.67562	0.2906	M	0.62016	1.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.65524	-0.6147	9	.	.	.	-19.2864	19.203	0.93719	0.0:1.0:0.0:0.0	.	117;117	O95425-2;O95425	.;SVIL_HUMAN	S	117	ENSP00000364549:A117S;ENSP00000364547:A117S;ENSP00000348128:A117S	.	A	-	1	0	SVIL	29880010	1.000000	0.71417	0.999000	0.59377	0.429000	0.31625	5.181000	0.65054	2.535000	0.85469	0.591000	0.81541	GCA		0.552	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1			Missense_Mutation
PCDH15	65217	broad.mit.edu	37	10	55955527	55955527	+	Silent	SNP	A	A	G			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr10:55955527A>G	ENST00000320301.6	-	11	1615	c.1221T>C	c.(1219-1221)tcT>tcC	p.S407S	PCDH15_ENST00000373957.3_Silent_p.S385S|PCDH15_ENST00000409834.1_Silent_p.S11S|PCDH15_ENST00000414778.1_Silent_p.S412S|PCDH15_ENST00000373955.1_Silent_p.S407S|PCDH15_ENST00000395438.1_Silent_p.S407S|PCDH15_ENST00000437009.1_Silent_p.S407S|PCDH15_ENST00000395440.1_Silent_p.S407S|PCDH15_ENST00000395433.1_Silent_p.S385S|PCDH15_ENST00000395432.2_Silent_p.S370S|PCDH15_ENST00000373965.2_Silent_p.S407S|PCDH15_ENST00000395445.1_Silent_p.S407S|PCDH15_ENST00000395446.1_Silent_p.S407S|PCDH15_ENST00000395430.1_Silent_p.S407S|PCDH15_ENST00000361849.3_Silent_p.S407S|PCDH15_ENST00000395442.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	407	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.S407S(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CCACTGGGGCAGATTCCAGGA	0.403										HNSCC(58;0.16)																																						1	Substitution - coding silent(1)	ovary(1)	10											143.0	132.0	136.0					10																	55955527		2203	4300	6503	55625533	SO:0001819	synonymous_variant	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1221T>C	10.37:g.55955527A>G			55625533	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1	SNP	7	Broad																																																																																				0.403	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		Silent
FAM35A	54537	broad.mit.edu	37	10	88911656	88911656	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr10:88911656G>C	ENST00000298784.1	+	3	659	c.545G>C	c.(544-546)tGt>tCt	p.C182S	FAM35A_ENST00000298786.4_Missense_Mutation_p.C182S|RN7SL733P_ENST00000582253.1_RNA	NM_019054.2	NP_061927.2	Q86V20	FA35A_HUMAN	family with sequence similarity 35, member A	182								p.C182S(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(1)|ovary(2)|prostate(2)|skin(2)	16						GATTTGGTTTGTAGTACTGAA	0.368																																					Ovarian(175;703 2004 25460 32514 43441)											1	Substitution - Missense(1)	ovary(1)	10											23.0	25.0	24.0					10																	88911656		1991	3954	5945	88901636	SO:0001583	missense	54537			BC051863	CCDS7383.1	10q23.2	2010-06-02			ENSG00000122376	ENSG00000122376			28773	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_019054		Approved	MGC5560, bA163M19.1, FAM35A1	uc001kei.4	Q86V20	OTTHUMG00000018669	ENST00000298784.1:c.545G>C	10.37:g.88911656G>C	ENSP00000298784:p.Cys182Ser		88901636	O95885|Q9H991	Missense_Mutation	SNP	ENST00000298784.1	37	CCDS7383.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	g	6.934	0.542143	0.13250	.	.	ENSG00000122376	ENST00000298786;ENST00000298784;ENST00000358313	T;T;T	0.22539	1.95;1.95;1.95	4.23	1.21	0.21127	.	0.510762	0.16503	N	0.211575	T	0.15392	0.0371	L	0.40543	1.245	0.09310	N	1	B	0.13145	0.007	B	0.15484	0.013	T	0.30563	-0.9974	10	0.19590	T	0.45	-0.1512	9.8843	0.41253	0.0845:0.5117:0.4037:0.0	.	182	Q86V20	FA35A_HUMAN	S	182	ENSP00000298786:C182S;ENSP00000298784:C182S;ENSP00000351064:C182S	ENSP00000298784:C182S	C	+	2	0	FAM35A	88901636	0.000000	0.05858	0.000000	0.03702	0.528000	0.34623	-0.317000	0.08060	0.068000	0.16574	0.537000	0.68136	TGT		0.368	FAM35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049196.2	NM_019054		Missense_Mutation
TAF5	6877	broad.mit.edu	37	10	105147827	105147827	+	Silent	SNP	T	T	C			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr10:105147827T>C	ENST00000369839.3	+	11	2273	c.2250T>C	c.(2248-2250)gaT>gaC	p.D750D	TAF5_ENST00000351396.4_Silent_p.D695D	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	750					chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.D750D(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		TAGAGACCGATGACTTTACTA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	10											131.0	132.0	132.0					10																	105147827		2203	4300	6503	105137817	SO:0001819	synonymous_variant	6877			X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.2250T>C	10.37:g.105147827T>C			105137817	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Silent	SNP	ENST00000369839.3	37	CCDS7547.1	SNP	51	Broad																																																																																				0.393	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1			Silent
FANK1	92565	broad.mit.edu	37	10	127697035	127697035	+	Silent	SNP	G	G	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr10:127697035G>A	ENST00000368693.1	+	8	869	c.765G>A	c.(763-765)tcG>tcA	p.S255S	FANK1_ENST00000368695.1_Silent_p.S249S|FANK1_ENST00000477963.1_3'UTR			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	255						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S255S(2)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				CTGCGGTGTCGGGAAATCAGA	0.532																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	10											113.0	110.0	111.0					10																	127697035		2203	4300	6503	127687025	SO:0001819	synonymous_variant	92565			BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.765G>A	10.37:g.127697035G>A			127687025	Q6UXY9|Q6X7T6	Silent	SNP	ENST00000368693.1	37	CCDS31309.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	0.527	-0.859534	0.02610	.	.	ENSG00000203780	ENST00000456942	.	.	.	5.62	-11.2	0.00127	.	.	.	.	.	T	0.32194	0.0821	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46219	-0.9207	4	.	.	.	-13.9202	1.9821	0.03429	0.4587:0.2082:0.1125:0.2206	.	.	.	.	Q	150	.	.	R	+	2	0	FANK1	127687025	0.000000	0.05858	0.006000	0.13384	0.104000	0.19210	-3.541000	0.00437	-3.551000	0.00142	-0.140000	0.14226	CGG		0.532	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235		Silent
UBQLN3	50613	broad.mit.edu	37	11	5528829	5528829	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr11:5528829G>C	ENST00000311659.4	-	2	2107	c.1960C>G	c.(1960-1962)Cag>Gag	p.Q654E	HBG2_ENST00000380252.1_5'Flank|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_5'Flank	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	654	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.							p.Q654E(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCCTACGACTGTCTCAGCTTC	0.502																																					Ovarian(72;684 1260 12332 41642 52180)											1	Substitution - Missense(1)	ovary(1)	11											89.0	91.0	90.0					11																	5528829		2200	4297	6497	5485405	SO:0001583	missense	50613			AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1960C>G	11.37:g.5528829G>C	ENSP00000347997:p.Gln654Glu		5485405	Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	CCDS7758.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	8.394	0.840514	0.16891	.	.	ENSG00000175520	ENST00000311659	T	0.41065	1.01	5.02	-1.01	0.10169	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);UBA-like (1);	0.613760	0.14571	N	0.311477	T	0.23210	0.0561	N	0.17872	0.535	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.18745	-1.0327	10	0.26408	T	0.33	-0.1364	8.6267	0.33895	0.0:0.137:0.2722:0.5908	.	654	Q9H347	UBQL3_HUMAN	E	654	ENSP00000347997:Q654E	ENSP00000347997:Q654E	Q	-	1	0	UBQLN3	5485405	0.664000	0.27457	0.015000	0.15790	0.003000	0.03518	-0.016000	0.12613	0.027000	0.15297	-0.182000	0.12963	CAG		0.502	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481		Missense_Mutation
LRP4	4038	broad.mit.edu	37	11	46893168	46893168	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr11:46893168C>T	ENST00000378623.1	-	31	4842	c.4600G>A	c.(4600-4602)Gcg>Acg	p.A1534T	LRP4-AS1_ENST00000502049.2_RNA|LRP4-AS1_ENST00000531719.1_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1534					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)	p.A1534T(1)		breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		TCCAGATGCGCATCCACCCAG	0.572																																																1	Substitution - Missense(1)	ovary(1)	11											98.0	83.0	88.0					11																	46893168		2201	4299	6500	46849744	SO:0001583	missense	4038			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.4600G>A	11.37:g.46893168C>T	ENSP00000367888:p.Ala1534Thr		46849744	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.532635	0.96446	.	.	ENSG00000134569	ENST00000378623	D	0.96427	-4.01	5.81	5.81	0.92471	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.97857	0.9296	M	0.83692	2.655	0.80722	D	1	P	0.37500	0.597	P	0.51742	0.678	D	0.97727	1.0200	10	0.56958	D	0.05	.	19.6735	0.95921	0.0:1.0:0.0:0.0	.	1534	O75096	LRP4_HUMAN	T	1534	ENSP00000367888:A1534T	ENSP00000367888:A1534T	A	-	1	0	LRP4	46849744	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.565000	0.82337	2.736000	0.93811	0.655000	0.94253	GCG		0.572	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334		Missense_Mutation
CATSPER1	117144	broad.mit.edu	37	11	65788574	65788574	+	Missense_Mutation	SNP	T	T	G	rs199950402		TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr11:65788574T>G	ENST00000312106.5	-	5	1911	c.1774A>C	c.(1774-1776)Acc>Ccc	p.T592P		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	592					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.T592P(3)		breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						CAGAGGCAGGTAAACATGAGG	0.662																																																3	Substitution - Missense(3)	liver(2)|ovary(1)	11											51.0	37.0	42.0					11																	65788574		2199	4295	6494	65545150	SO:0001583	missense	117144			AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1774A>C	11.37:g.65788574T>G	ENSP00000309052:p.Thr592Pro		65545150	Q96P76	Missense_Mutation	SNP	ENST00000312106.5	37	CCDS8127.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	16.97	3.269605	0.59540	.	.	ENSG00000175294	ENST00000312106	D	0.98493	-4.96	4.95	3.79	0.43588	Ion transport (1);	0.000000	0.35555	N	0.003137	D	0.96306	0.8795	L	0.56769	1.78	0.31432	N	0.672961	B	0.19445	0.036	B	0.25884	0.064	D	0.94728	0.7907	10	0.62326	D	0.03	-30.2939	7.7959	0.29148	0.1857:0.0:0.0:0.8143	.	592	Q8NEC5	CTSR1_HUMAN	P	592	ENSP00000309052:T592P	ENSP00000309052:T592P	T	-	1	0	CATSPER1	65545150	0.992000	0.36948	1.000000	0.80357	0.994000	0.84299	1.572000	0.36461	0.704000	0.31869	0.459000	0.35465	ACC		0.662	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054		Missense_Mutation
GRM5	2915	broad.mit.edu	37	11	88780767	88780767	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr11:88780767C>G	ENST00000305447.4	-	1	423	c.274G>C	c.(274-276)Ggc>Cgc	p.G92R	GRM5_ENST00000418177.2_Missense_Mutation_p.G92R|GRM5_ENST00000455756.2_Missense_Mutation_p.G92R|GRM5_ENST00000393297.1_Missense_Mutation_p.G92R|GRM5_ENST00000305432.5_Missense_Mutation_p.G92R|GRM5_ENST00000393294.3_Missense_Mutation_p.G92R	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	92					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.G92C(2)|p.G92R(1)		NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	ATCTCACAGCCCAGTGTGATG	0.522																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	11											85.0	74.0	78.0					11																	88780767		2201	4299	6500	88420415	SO:0001583	missense	2915			D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.274G>C	11.37:g.88780767C>G	ENSP00000306138:p.Gly92Arg		88420415	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	CCDS44694.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	23.3	4.395409	0.83011	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297;ENST00000393294	T;T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23;-1.23	5.56	5.56	0.83823	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91341	0.7269	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92858	0.6303	9	.	.	.	.	19.5349	0.95247	0.0:1.0:0.0:0.0	.	92;92;92	A8MT20;P41594-2;P41594	.;.;GRM5_HUMAN	R	92	ENSP00000402912:G92R;ENSP00000405690:G92R;ENSP00000305905:G92R;ENSP00000306138:G92R;ENSP00000376975:G92R;ENSP00000376972:G92R	.	G	-	1	0	GRM5	88420415	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.687000	0.84139	2.605000	0.88082	0.563000	0.77884	GGC		0.522	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		Missense_Mutation
SLC36A4	120103	broad.mit.edu	37	11	92917625	92917625	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr11:92917625G>C	ENST00000326402.4	-	3	371	c.241C>G	c.(241-243)Cca>Gca	p.P81A	SLC36A4_ENST00000529184.1_5'UTR	NM_152313.2	NP_689526.2	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 4	81					L-alanine transport (GO:0015808)|proline transport (GO:0015824)|tryptophan transport (GO:0015827)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.P81A(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	25		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				ATTGCCAATGGAAGTCCTAAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	11											191.0	201.0	198.0					11																	92917625		2201	4298	6499	92557273	SO:0001583	missense	120103			AY162216	CCDS8291.1, CCDS66202.1	11q21	2013-05-22			ENSG00000180773	ENSG00000180773		"""Solute carriers"""	19660	protein-coding gene	gene with protein product		613760					Standard	XM_005273758		Approved	PAT4, FLJ38932	uc001pdn.3	Q6YBV0	OTTHUMG00000167368	ENST00000326402.4:c.241C>G	11.37:g.92917625G>C	ENSP00000317382:p.Pro81Ala		92557273	Q86X30|Q8IVM5|Q8N8S6	Missense_Mutation	SNP	ENST00000326402.4	37	CCDS8291.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	24.6	4.547523	0.86022	.	.	ENSG00000180773	ENST00000326402	T	0.04454	3.62	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000001	T	0.29256	0.0728	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01198	-1.1421	10	0.87932	D	0	-10.5433	20.2348	0.98355	0.0:0.0:1.0:0.0	.	81	Q6YBV0	S36A4_HUMAN	A	81	ENSP00000317382:P81A	ENSP00000317382:P81A	P	-	1	0	SLC36A4	92557273	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.710000	0.84655	2.880000	0.98712	0.650000	0.86243	CCA		0.333	SLC36A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394329.2			Missense_Mutation
POU2F3	25833	broad.mit.edu	37	11	120180221	120180221	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr11:120180221C>T	ENST00000543440.2	+	10	1144	c.994C>T	c.(994-996)Cga>Tga	p.R332*	POU2F3_ENST00000260264.4_Nonsense_Mutation_p.R334*	NM_014352.3	NP_055167.2	Q9UKI9	PO2F3_HUMAN	POU class 2 homeobox 3	332					epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|negative regulation by host of viral transcription (GO:0043922)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.R332*(1)		large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)	17		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		GTTCTGCAACCGACGCCAAAA	0.557																																																1	Substitution - Nonsense(1)	ovary(1)	11											125.0	93.0	104.0					11																	120180221		2203	4299	6502	119685431	SO:0001587	stop_gained	25833			AF133895	CCDS8431.1, CCDS58190.1	11q23.3	2011-06-20	2007-07-13		ENSG00000137709	ENSG00000137709		"""Homeoboxes / POU class"""	19864	protein-coding gene	gene with protein product		607394	"""POU domain class 2, transcription factor 3"""			10473598	Standard	NM_014352		Approved	OCT11, PLA-1, Skn-1a, Epoc-1	uc021qrk.1	Q9UKI9	OTTHUMG00000166140	ENST00000543440.2:c.994C>T	11.37:g.120180221C>T	ENSP00000441687:p.Arg332*		119685431	A8K7H8|B4DY07|F5GWW6|Q3MIY3|Q9UKR7|Q9Y504	Nonsense_Mutation	SNP	ENST00000543440.2	37	CCDS8431.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	38	7.252900	0.98164	.	.	ENSG00000137709	ENST00000543440;ENST00000260264;ENST00000533620;ENST00000532638	.	.	.	5.1	5.1	0.69264	.	0.068312	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9011	0.92443	0.0:1.0:0.0:0.0	.	.	.	.	X	334;332;286;117	.	ENSP00000260264:R332X	R	+	1	2	POU2F3	119685431	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.994000	0.70623	2.534000	0.85438	0.637000	0.83480	CGA		0.557	POU2F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388039.2			Nonsense_Mutation
PDE3A	5139	broad.mit.edu	37	12	20783055	20783055	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr12:20783055G>T	ENST00000359062.3	+	6	1794	c.1754G>T	c.(1753-1755)tGt>tTt	p.C585F	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	585					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.C585F(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CCTGTTATATGTAGCAGGTAA	0.448																																																1	Substitution - Missense(1)	ovary(1)	12											97.0	97.0	97.0					12																	20783055		2203	4300	6503	20674322	SO:0001583	missense	5139				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1754G>T	12.37:g.20783055G>T	ENSP00000351957:p.Cys585Phe		20674322	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069574	0.55539	.	.	ENSG00000172572	ENST00000359062	T	0.53423	0.62	5.38	5.38	0.77491	.	2.708520	0.01098	N	0.005310	T	0.53642	0.1809	L	0.47716	1.5	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.28235	-1.0050	10	0.62326	D	0.03	.	18.918	0.92513	0.0:0.0:1.0:0.0	.	585	Q14432	PDE3A_HUMAN	F	585	ENSP00000351957:C585F	ENSP00000351957:C585F	C	+	2	0	PDE3A	20674322	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.404000	0.90210	2.799000	0.96334	0.603000	0.83216	TGT		0.448	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2			Missense_Mutation
ATP2A2	488	broad.mit.edu	37	12	110778528	110778528	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr12:110778528C>A	ENST00000539276.2	+	14	1935	c.1826C>A	c.(1825-1827)tCc>tAc	p.S609Y	ATP2A2_ENST00000395494.2_Missense_Mutation_p.S582Y|ATP2A2_ENST00000308664.6_Missense_Mutation_p.S609Y			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	609					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)	p.S609Y(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						GTGGCCTCCTCCGTGAAGCTG	0.552																																																1	Substitution - Missense(1)	ovary(1)	12											104.0	103.0	103.0					12																	110778528		2203	4300	6503	109262911	SO:0001583	missense	488				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.1826C>A	12.37:g.110778528C>A	ENSP00000440045:p.Ser609Tyr		109262911	A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	37	CCDS9144.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	29.6	5.019596	0.93462	.	.	ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276	D;D;D	0.95821	-3.82;-3.82;-3.82	6.07	6.07	0.98685	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.047272	0.85682	D	0.000000	D	0.98566	0.9521	H	0.94423	3.535	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.967;0.993;0.996	D	0.98799	1.0739	10	0.87932	D	0	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	582;609;609	P16615-4;P16615-2;P16615	.;.;AT2A2_HUMAN	Y	609;582;609	ENSP00000311186:S609Y;ENSP00000378872:S582Y;ENSP00000440045:S609Y	ENSP00000311186:S609Y	S	+	2	0	ATP2A2	109262911	1.000000	0.71417	0.864000	0.33941	0.877000	0.50540	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	TCC		0.552	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681		Missense_Mutation
KNTC1	9735	broad.mit.edu	37	12	123019278	123019278	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr12:123019278C>A	ENST00000333479.7	+	3	374	c.197C>A	c.(196-198)tCa>tAa	p.S66*	KNTC1_ENST00000450485.2_Nonsense_Mutation_p.S66*	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	66					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GCCGACCAATCAGTGATATTG	0.348																																																0			12											166.0	149.0	154.0					12																	123019278		1873	4115	5988	121585231	SO:0001587	stop_gained	9735				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.197C>A	12.37:g.123019278C>A	ENSP00000328236:p.Ser66*		121585231	A7E2C4|B3KSG2	Nonsense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	37	6.618266	0.97709	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	.	.	.	5.75	5.75	0.90469	.	0.073904	0.56097	D	0.000022	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.924	19.5419	0.95277	0.0:1.0:0.0:0.0	.	.	.	.	X	66	.	ENSP00000328236:S66X	S	+	2	0	KNTC1	121585231	0.988000	0.35896	0.809000	0.32408	0.994000	0.84299	4.810000	0.62598	2.714000	0.92807	0.650000	0.86243	TCA		0.348	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2			Nonsense_Mutation
PAK6	56924	broad.mit.edu	37	15	40565547	40565547	+	Splice_Site	SNP	G	G	C			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr15:40565547G>C	ENST00000542403.2	+	6	1602	c.1491G>C	c.(1489-1491)agG>agC	p.R497S	RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000560346.1_Splice_Site_p.R497S|PAK6_ENST00000453867.1_Splice_Site_p.R497S|PAK6_ENST00000441369.1_Splice_Site_p.R497S|PAK6_ENST00000455577.2_Splice_Site_p.R497S|PAK6_ENST00000260404.4_Splice_Site_p.R497S	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	497	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R497S(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		TCCTGTCCAGGCTGAATGAGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	15											95.0	76.0	83.0					15																	40565547		2203	4300	6503	38352839	SO:0001630	splice_region_variant	56924			AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.1491-1G>C	15.37:g.40565547G>C			38352839	A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	ENST00000542403.2	37	CCDS10054.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	19.15	3.772558	0.69992	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	T;T;T;T;T	0.65178	-0.14;-0.14;1.06;-0.14;-0.14	5.02	4.09	0.47781	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.65821	0.2728	L	0.33668	1.02	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.81914	0.995;0.99	T	0.62803	-0.6777	9	.	.	.	.	9.0047	0.36104	0.1705:0.0:0.8295:0.0	.	497;497	Q9NQU5;G5E9R2	PAK6_HUMAN;.	S	497	ENSP00000406873:R497S;ENSP00000401153:R497S;ENSP00000409465:R497S;ENSP00000260404:R497S;ENSP00000439597:R497S	.	R	+	3	2	PAK6	38352839	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	3.411000	0.52672	1.077000	0.40990	0.563000	0.77884	AGG		0.602	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1		Missense_Mutation	Missense_Mutation
CNTNAP4	85445	broad.mit.edu	37	16	76592512	76592512	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr16:76592512G>A	ENST00000476707.1	+	23	4007	c.3868G>A	c.(3868-3870)Gct>Act	p.A1290T	CNTNAP4_ENST00000478060.1_Missense_Mutation_p.A1214T|RP11-58C22.1_ENST00000563764.1_Intron|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.A1286T|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.A1238T			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	1287					cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.A1286T(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CAGTGCTGAGGCTGTTCTGAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	16											79.0	76.0	77.0					16																	76592512		1897	4147	6044	75150013	SO:0001583	missense	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.3868G>A	16.37:g.76592512G>A	ENSP00000417628:p.Ala1290Thr		75150013	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	8.771	0.925950	0.18056	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.89050	-2.33;-2.42;-2.42;-2.46	5.65	3.59	0.41128	.	0.173822	0.27595	N	0.018672	T	0.77968	0.4210	.	.	.	0.33584	D	0.600258	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.72690	-0.4217	9	0.22109	T	0.4	.	5.3345	0.15949	0.2173:0.0:0.6127:0.17	.	1214;1290;1287	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	T	1286;1238;1214;1290	ENSP00000306893:A1286T;ENSP00000439733:A1238T;ENSP00000418741:A1214T;ENSP00000417628:A1290T	ENSP00000306893:A1286T	A	+	1	0	CNTNAP4	75150013	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.104000	0.31074	1.631000	0.50456	0.655000	0.94253	GCT		0.358	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		7519131	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
SLC6A4	6532	broad.mit.edu	37	17	28548917	28548917	+	Silent	SNP	A	A	G	rs201481422		TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr17:28548917A>G	ENST00000401766.2	-	2	572	c.60T>C	c.(58-60)gaT>gaC	p.D20D	SLC6A4_ENST00000261707.3_Silent_p.D20D			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	20					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)	p.D20D(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	TTTCCTGACAATCTTCTCCAT	0.502																																																1	Substitution - coding silent(1)	ovary(1)	17											104.0	92.0	96.0					17																	28548917		2203	4300	6503	25573043	SO:0001819	synonymous_variant	6532			L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.60T>C	17.37:g.28548917A>G			25573043	Q5EE02	Silent	SNP	ENST00000401766.2	37	CCDS11256.1	SNP	4	Broad																																																																																				0.502	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	NM_001045		Silent
CCDC40	55036	broad.mit.edu	37	17	78063611	78063611	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr17:78063611G>A	ENST00000397545.4	+	17	2787	c.2760G>A	c.(2758-2760)atG>atA	p.M920I	CCDC40_ENST00000573903.1_3'UTR|CCDC40_ENST00000374877.3_Missense_Mutation_p.M920I	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	920					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.M920I(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CAAAAGAGATGCGTTCCTCAG	0.517																																																1	Substitution - Missense(1)	ovary(1)	17											63.0	63.0	63.0					17																	78063611		1929	4131	6060	75678206	SO:0001583	missense	55036			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2760G>A	17.37:g.78063611G>A	ENSP00000380679:p.Met920Ile		75678206	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	ENST00000397545.4	37	CCDS42395.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702960	0.48412	.	.	ENSG00000141519	ENST00000374877;ENST00000397545	T;T	0.51574	0.7;0.72	4.63	4.63	0.57726	.	.	.	.	.	T	0.57961	0.2089	M	0.82323	2.585	0.39013	D	0.959599	P;P	0.48640	0.553;0.913	B;P	0.45099	0.218;0.469	T	0.67821	-0.5571	9	0.41790	T	0.15	-41.6276	17.808	0.88607	0.0:0.0:1.0:0.0	.	920;703	Q4G0X9;Q4G0X9-3	CCD40_HUMAN;.	I	920	ENSP00000364011:M920I;ENSP00000380679:M920I	ENSP00000364011:M920I	M	+	3	0	CCDC40	75678206	1.000000	0.71417	1.000000	0.80357	0.453000	0.32348	3.269000	0.51592	2.294000	0.77228	0.563000	0.77884	ATG		0.517	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082		Missense_Mutation
CEP192	55125	broad.mit.edu	37	18	13049205	13049205	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr18:13049205G>T	ENST00000325971.8	+	14	2220	c.627G>T	c.(625-627)atG>atT	p.M209I	CEP192_ENST00000430049.2_Missense_Mutation_p.M330I|CEP192_ENST00000506447.1_Missense_Mutation_p.M805I			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	209					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.M209I(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GGGCTAGTATGTCTGATACTT	0.378																																																1	Substitution - Missense(1)	ovary(1)	18											92.0	90.0	91.0					18																	13049205		2203	4300	6503	13039205	SO:0001583	missense	55125			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.627G>T	18.37:g.13049205G>T	ENSP00000317156:p.Met209Ile		13039205	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37		SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	0.629	-0.817857	0.02776	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.05319	3.46;3.46;3.47	5.27	-0.637	0.11504	.	1.437530	0.04543	N	0.388518	T	0.05044	0.0135	N	0.22421	0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.42965	-0.9420	10	0.36615	T	0.2	1.2997	5.6624	0.17676	0.5622:0.0:0.3016:0.1361	.	330;805;209	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	I	805;209;209;330	ENSP00000427550:M805I;ENSP00000317156:M209I;ENSP00000389190:M330I	ENSP00000317156:M209I	M	+	3	0	CEP192	13039205	0.000000	0.05858	0.076000	0.20297	0.220000	0.24768	-0.151000	0.10175	-0.092000	0.12417	-0.143000	0.13931	ATG		0.378	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142		Missense_Mutation
SIRT6	51548	broad.mit.edu	37	19	4174893	4174893	+	Silent	SNP	G	G	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr19:4174893G>A	ENST00000337491.2	-	8	853	c.789C>T	c.(787-789)acC>acT	p.T263T	SIRT6_ENST00000305232.6_Silent_p.T236T|SIRT6_ENST00000601488.1_3'UTR|SIRT6_ENST00000594279.1_3'UTR|SIRT6_ENST00000381935.3_Silent_p.T191T	NM_016539.2	NP_057623.2	Q8N6T7	SIR6_HUMAN	sirtuin 6	263	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|protein ADP-ribosylation (GO:0006471)|regulation of double-strand break repair via homologous recombination (GO:0010569)	nuclear telomeric heterochromatin (GO:0005724)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|zinc ion binding (GO:0008270)	p.T263T(1)		central_nervous_system(1)|kidney(1)|lung(4)|ovary(1)|skin(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		TCATGAGCCGGGTCATGACCT	0.716																																																1	Substitution - coding silent(1)	ovary(1)	19											21.0	19.0	20.0					19																	4174893		2186	4274	6460	4125893	SO:0001819	synonymous_variant	51548			AF233396	CCDS12122.1, CCDS54199.1	19p13.3	2010-06-25	2010-06-25			ENSG00000077463			14934	protein-coding gene	gene with protein product		606211	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 6"", ""sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)"""			10873683	Standard	NM_016539		Approved		uc002lzo.3	Q8N6T7		ENST00000337491.2:c.789C>T	19.37:g.4174893G>A			4125893	B2RCD0|O75291|Q6IAF5|Q6PK99|Q8NCD2|Q9BSI5|Q9BWP3|Q9NRC7|Q9UQD1	Silent	SNP	ENST00000337491.2	37	CCDS12122.1	SNP	43	Broad																																																																																				0.716	SIRT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457931.2			Silent
CHAF1A	10036	broad.mit.edu	37	19	4428827	4428827	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr19:4428827G>A	ENST00000301280.5	+	8	1645	c.1544G>A	c.(1543-1545)cGg>cAg	p.R515Q	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	515					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)	p.R515Q(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCAAAGGCCGGCAGCCCCTG	0.597								Chromatin Structure																																								1	Substitution - Missense(1)	ovary(1)	19											37.0	41.0	40.0					19																	4428827		2203	4300	6503	4379827	SO:0001583	missense	10036			U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1544G>A	19.37:g.4428827G>A	ENSP00000301280:p.Arg515Gln		4379827	Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	ENST00000301280.5	37	CCDS32875.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457769	0.43634	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.16597	2.33	5.24	5.24	0.73138	.	.	.	.	.	T	0.23133	0.0559	M	0.66939	2.045	0.54753	D	0.999986	P	0.46020	0.871	B	0.39094	0.29	T	0.07328	-1.0778	9	0.87932	D	0	-26.2075	17.7889	0.88547	0.0:0.0:1.0:0.0	.	515	Q13111	CAF1A_HUMAN	Q	515	ENSP00000301280:R515Q	ENSP00000301280:R515Q	R	+	2	0	CHAF1A	4379827	0.998000	0.40836	0.757000	0.31301	0.233000	0.25261	3.846000	0.55888	2.433000	0.82419	0.555000	0.69702	CGG		0.597	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2	NM_005483		Missense_Mutation
LPHN1	22859	broad.mit.edu	37	19	14268845	14268845	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr19:14268845G>T	ENST00000340736.6	-	14	2696	c.2399C>A	c.(2398-2400)gCt>gAt	p.A800D	CTB-55O6.12_ENST00000592086.1_RNA|CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.A795D|CTB-55O6.12_ENST00000588658.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	800	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.A800D(1)		central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGAGCAGTTAGCATTGAAGTG	0.572																																																1	Substitution - Missense(1)	ovary(1)	19											206.0	163.0	178.0					19																	14268845		2203	4300	6503	14129845	SO:0001583	missense	22859			AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.2399C>A	19.37:g.14268845G>T	ENSP00000340688:p.Ala800Asp		14129845	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	14.05	2.419346	0.42918	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.71461	-0.57;-0.57	4.73	3.67	0.42095	GPS domain (3);	0.137643	0.48767	D	0.000166	T	0.71863	0.3390	L	0.41492	1.28	0.51012	D	0.9999	P;P	0.45634	0.712;0.863	P;P	0.52823	0.71;0.665	T	0.74705	-0.3575	10	0.87932	D	0	.	12.9043	0.58143	0.0:0.1651:0.8349:0.0	.	795;800	O94910-2;O94910	.;LPHN1_HUMAN	D	800;795	ENSP00000340688:A800D;ENSP00000355328:A795D	ENSP00000340688:A800D	A	-	2	0	LPHN1	14129845	1.000000	0.71417	0.855000	0.33649	0.056000	0.15407	7.973000	0.88032	1.088000	0.41272	0.561000	0.74099	GCT		0.572	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921		Missense_Mutation
GPI	2821	broad.mit.edu	37	19	34870460	34870460	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr19:34870460C>A	ENST00000356487.5	+	8	984	c.743C>A	c.(742-744)aCt>aAt	p.T248N	GPI_ENST00000415930.3_Missense_Mutation_p.T259N|GPI_ENST00000586425.1_Missense_Mutation_p.T248N	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	248					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					GCCCTGTCTACTAACACAGTA	0.572																																																0			19											283.0	226.0	245.0					19																	34870460		2203	4300	6503	39562300	SO:0001583	missense	2821			M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.743C>A	19.37:g.34870460C>A	ENSP00000348877:p.Thr248Asn		39562300	B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	ENST00000356487.5	37	CCDS12437.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416179	0.83449	.	.	ENSG00000105220	ENST00000415930;ENST00000356487	D;D	0.93906	-3.31;-3.31	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.97399	0.9149	M	0.88310	2.945	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	0.995;1.0;0.995;0.992	D	0.97684	1.0174	10	0.87932	D	0	-15.3827	19.9196	0.97082	0.0:1.0:0.0:0.0	.	220;259;231;248	B4DE36;B4DG39;B4DVJ0;P06744	.;.;.;G6PI_HUMAN	N	259;248	ENSP00000405573:T259N;ENSP00000348877:T248N	ENSP00000348877:T248N	T	+	2	0	GPI	39562300	1.000000	0.71417	0.999000	0.59377	0.405000	0.30901	7.601000	0.82783	2.708000	0.92522	0.650000	0.86243	ACT		0.572	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451693.3			Missense_Mutation
HIPK4	147746	broad.mit.edu	37	19	40895777	40895777	+	Silent	SNP	G	G	A	rs370981376		TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr19:40895777G>A	ENST00000291823.2	-	1	317	c.33C>T	c.(31-33)taC>taT	p.Y11Y		NM_144685.3	NP_653286.2	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	11	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of signal transduction by p53 class mediator (GO:1901796)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Y11Y(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	20			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			CGATGATGTCGTAGCAGTCAG	0.652																																																1	Substitution - coding silent(1)	ovary(1)	19						G		0,4406		0,0,2203	61.0	47.0	52.0		33	-8.4	0.4	19		52	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	HIPK4	NM_144685.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		11/617	40895777	1,13005	2203	4300	6503	45587617	SO:0001819	synonymous_variant	147746			BC034501	CCDS12555.1	19q13.2	2008-02-05				ENSG00000160396			19007	protein-coding gene	gene with protein product		611712					Standard	NM_144685		Approved	FLJ32818	uc002onp.3	Q8NE63		ENST00000291823.2:c.33C>T	19.37:g.40895777G>A			45587617	A8K863|Q96M54	Silent	SNP	ENST00000291823.2	37	CCDS12555.1	SNP	40	Broad																																																																																				0.652	HIPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462593.1	NM_144685		Silent
LIPE	3991	broad.mit.edu	37	19	42907079	42907079	+	Missense_Mutation	SNP	C	C	T	rs145794577		TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr19:42907079C>T	ENST00000244289.4	-	9	2923	c.2647G>A	c.(2647-2649)Gga>Aga	p.G883R	LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000599276.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	883					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)	p.G883R(1)		breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				TCGGAGTTTCCCCTCAGGCTC	0.607																																																1	Substitution - Missense(1)	ovary(1)	19						C	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	76.0	63.0	67.0		2647	-3.2	0.0	19	dbSNP_134	67	0,8600		0,0,4300	no	missense	LIPE	NM_005357.2	125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	883/1077	42907079	1,13005	2203	4300	6503	47598919	SO:0001583	missense	3991			L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.2647G>A	19.37:g.42907079C>T	ENSP00000244289:p.Gly883Arg		47598919	Q3LRT2|Q6NSL7	Missense_Mutation	SNP	ENST00000244289.4	37	CCDS12607.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	9.327	1.059452	0.19987	2.27E-4	0.0	ENSG00000079435	ENST00000244289	T	0.03358	3.96	5.08	-3.16	0.05217	.	1.139660	0.06567	N	0.747768	T	0.04952	0.0133	L	0.51422	1.61	0.09310	N	1	P	0.50443	0.935	P	0.44394	0.448	T	0.43734	-0.9373	10	0.20046	T	0.44	-5.1393	9.4129	0.38503	0.0:0.4636:0.0:0.5364	.	883	Q05469	LIPS_HUMAN	R	883	ENSP00000244289:G883R	ENSP00000244289:G883R	G	-	1	0	LIPE	47598919	0.000000	0.05858	0.018000	0.16275	0.021000	0.10359	-1.991000	0.01478	-0.603000	0.05767	-0.218000	0.12543	GGA		0.607	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357		Missense_Mutation
KIF3C	3797	broad.mit.edu	37	2	26177255	26177255	+	Splice_Site	SNP	C	C	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr2:26177255C>T	ENST00000264712.3	-	4	2350		c.e4-1		KIF3C_ENST00000405914.1_Splice_Site|KIF3C_ENST00000496378.1_5'Flank	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.?(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGCGTAGAGCTGGGTGGGGA	0.647																																																1	Unknown(1)	ovary(1)	2											51.0	36.0	41.0					2																	26177255		2203	4300	6503	26030759	SO:0001630	splice_region_variant	3797				CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.1771-1G>A	2.37:g.26177255C>T			26030759	O43544|Q4ZG18|Q53SX5|Q562F7	Splice_Site_SNP	SNP	ENST00000264712.3	37	CCDS1719.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	19.45	3.829768	0.71258	.	.	ENSG00000084731	ENST00000264712;ENST00000542511;ENST00000405914	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9192	0.79547	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIF3C	26030759	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	7.755000	0.85180	2.354000	0.79902	0.462000	0.41574	.		0.647	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1		Intron	Splice_Site_SNP
DYSF	8291	broad.mit.edu	37	2	71762428	71762428	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr2:71762428C>T	ENST00000258104.3	+	15	1661	c.1384C>T	c.(1384-1386)Cgt>Tgt	p.R462C	DYSF_ENST00000429174.2_Missense_Mutation_p.R462C|DYSF_ENST00000410020.3_Missense_Mutation_p.R494C|DYSF_ENST00000409762.1_Missense_Mutation_p.R493C|DYSF_ENST00000409651.1_Missense_Mutation_p.R494C|DYSF_ENST00000410041.1_Missense_Mutation_p.R494C|DYSF_ENST00000413539.2_Missense_Mutation_p.R493C|DYSF_ENST00000409366.1_Missense_Mutation_p.R463C|DYSF_ENST00000409744.1_Missense_Mutation_p.R463C|DYSF_ENST00000394120.2_Missense_Mutation_p.R463C|DYSF_ENST00000409582.3_Missense_Mutation_p.R493C	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	462	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.R462C(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						AATGAGGATTCGTATCATAGA	0.527																																																1	Substitution - Missense(1)	ovary(1)	2											120.0	121.0	120.0					2																	71762428		2203	4300	6503	71615936	SO:0001583	missense	8291			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.1384C>T	2.37:g.71762428C>T	ENSP00000258104:p.Arg462Cys		71615936	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	19.74	3.883185	0.72410	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42	4.84	4.84	0.62591	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.123265	0.52532	D	0.000061	T	0.80319	0.4601	M	0.69358	2.11	0.58432	D	0.999993	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.83275	0.947;0.988;0.988;0.947;0.954;0.954;0.954;0.954;0.996;0.954;0.969;0.977;0.947;0.969	T	0.82059	-0.0645	10	0.72032	D	0.01	-13.9072	16.2466	0.82448	0.0:1.0:0.0:0.0	.	494;494;463;463;494;463;493;462;493;493;462;462;463;462	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	C	493;493;493;462;462;494;463;463;463;494;494	ENSP00000407046:R493C;ENSP00000387137:R493C;ENSP00000386547:R493C;ENSP00000398305:R462C;ENSP00000258104:R462C;ENSP00000386683:R494C;ENSP00000377678:R463C;ENSP00000386285:R463C;ENSP00000386512:R463C;ENSP00000386881:R494C;ENSP00000386617:R494C	ENSP00000258104:R462C	R	+	1	0	DYSF	71615936	1.000000	0.71417	0.993000	0.49108	0.893000	0.52053	2.681000	0.46926	2.640000	0.89533	0.655000	0.94253	CGT		0.527	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		Missense_Mutation
INPP4A	3631	broad.mit.edu	37	2	99181225	99181225	+	Splice_Site	SNP	C	C	T	rs374744040		TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr2:99181225C>T	ENST00000523221.1	+	18	2166	c.2166C>T	c.(2164-2166)taC>taT	p.Y722Y	INPP4A_ENST00000074304.5_Splice_Site_p.Y722Y|INPP4A_ENST00000545415.1_Splice_Site_p.Y683Y|INPP4A_ENST00000409540.3_Splice_Site_p.Y683Y|INPP4A_ENST00000409016.4_Splice_Site_p.Y683Y|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409851.3_Splice_Site_p.Y717Y			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	722					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.Y722Y(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						TGAGCACCTACGGTGAGGCGC	0.577																																																1	Substitution - coding silent(1)	ovary(1)	2						C	,,,	0,3922		0,0,1961	15.0	16.0	16.0		2166,2151,2049,2049	-5.5	0.8	2		16	1,8237		0,1,4118	no	coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice	INPP4A	NM_001134224.1,NM_001134225.1,NM_001566.2,NM_004027.2	,,,	0,1,6079	TT,TC,CC		0.0121,0.0,0.0082	,,,	722/978,717/973,683/955,683/939	99181225	1,12159	1961	4119	6080	98547657	SO:0001630	splice_region_variant	3631			U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.2167+1C>T	2.37:g.99181225C>T			98547657	O15326|Q13187|Q53TD8|Q8TC02	Silent	SNP	ENST00000523221.1	37	CCDS46369.1	SNP	19	Broad																																																																																				0.577	INPP4A-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376095.1	NM_001566	Silent	Silent
COBLL1	22837	broad.mit.edu	37	2	165550903	165550903	+	Missense_Mutation	SNP	C	C	T	rs201288773	byFrequency	TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr2:165550903C>T	ENST00000392717.2	-	13	3231	c.3227G>A	c.(3226-3228)aGt>aAt	p.S1076N	COBLL1_ENST00000375458.2_Missense_Mutation_p.S1000N|COBLL1_ENST00000409184.3_Missense_Mutation_p.S1038N|COBLL1_ENST00000194871.6_Missense_Mutation_p.S1105N|COBLL1_ENST00000342193.4_Missense_Mutation_p.S1038N			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	1076						extracellular vesicular exosome (GO:0070062)		p.S1038N(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						GCGCTCTTTACTGAAAGACTG	0.463													C|||	2	0.000399361	0.0	0.0	5008	,	,		18895	0.002		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2											116.0	106.0	109.0					2																	165550903		2203	4300	6503	165259149	SO:0001583	missense	22837			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.3227G>A	2.37:g.165550903C>T	ENSP00000376478:p.Ser1076Asn		165259149	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	37		SNP	20	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	10.55	1.381279	0.24944	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.95	5.07	0.68467	.	0.078221	0.64402	D	0.000011	T	0.34337	0.0894	L	0.43923	1.385	0.23946	N	0.996388	B;B;B	0.30021	0.142;0.265;0.222	B;B;B	0.31101	0.058;0.08;0.124	T	0.17018	-1.0383	9	0.27082	T	0.32	-16.8615	11.7379	0.51775	0.0:0.8694:0.0:0.1306	.	1076;1105;1038	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	N	1000;1038;1038;1076;1105	.	ENSP00000194871:S1105N	S	-	2	0	COBLL1	165259149	1.000000	0.71417	0.999000	0.59377	0.568000	0.35870	1.156000	0.31712	2.824000	0.97209	0.655000	0.94253	AGT		0.463	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014900		Missense_Mutation
ZNF804A	91752	broad.mit.edu	37	2	185802432	185802432	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr2:185802432G>A	ENST00000302277.6	+	4	2903	c.2309G>A	c.(2308-2310)cGa>cAa	p.R770Q		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	770							metal ion binding (GO:0046872)	p.R770Q(2)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AGATTCTATCGAAAACGTAGA	0.333																																																2	Substitution - Missense(2)	ovary(1)|skin(1)	2											54.0	56.0	55.0					2																	185802432		2203	4300	6503	185510677	SO:0001583	missense	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2309G>A	2.37:g.185802432G>A	ENSP00000303252:p.Arg770Gln		185510677	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896539	0.72639	.	.	ENSG00000170396	ENST00000302277	T	0.10382	2.88	5.96	4.17	0.49024	.	0.163547	0.29737	N	0.011328	T	0.09555	0.0235	L	0.55481	1.735	0.35851	D	0.826787	P	0.43519	0.809	B	0.27608	0.081	T	0.17899	-1.0354	10	0.87932	D	0	-1.2457	12.0638	0.53576	0.1391:0.0:0.8609:0.0	.	770	Q7Z570	Z804A_HUMAN	Q	770	ENSP00000303252:R770Q	ENSP00000303252:R770Q	R	+	2	0	ZNF804A	185510677	0.920000	0.31207	0.935000	0.37517	0.970000	0.65996	1.517000	0.35867	0.855000	0.35359	0.655000	0.94253	CGA		0.333	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		Missense_Mutation
PGAP1	80055	broad.mit.edu	37	2	197712711	197712711	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr2:197712711T>C	ENST00000354764.4	-	21	2026	c.1912A>G	c.(1912-1914)Aaa>Gaa	p.K638E	PGAP1_ENST00000409475.1_3'UTR	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	638					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)	p.K638E(1)		breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						GGATCAACTTTGTATGGTTTG	0.279																																																1	Substitution - Missense(1)	ovary(1)	2											115.0	114.0	114.0					2																	197712711		2202	4296	6498	197420956	SO:0001583	missense	80055				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.1912A>G	2.37:g.197712711T>C	ENSP00000346809:p.Lys638Glu		197420956	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	37	CCDS2318.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	21.0	4.084328	0.76642	.	.	ENSG00000197121	ENST00000422382;ENST00000354764	.	.	.	4.09	4.09	0.47781	.	0.000000	0.85682	D	0.000000	T	0.62295	0.2416	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.56571	-0.7957	9	0.16896	T	0.51	-11.6922	13.2227	0.59896	0.0:0.0:0.0:1.0	.	638	Q75T13	PGAP1_HUMAN	E	418;638	.	ENSP00000346809:K638E	K	-	1	0	PGAP1	197420956	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.302000	0.65733	1.707000	0.51288	0.533000	0.62120	AAA		0.279	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989		Missense_Mutation
OR6B3	150681	broad.mit.edu	37	2	240984785	240984785	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr2:240984785C>A	ENST00000319423.4	-	1	704	c.705G>T	c.(703-705)tgG>tgT	p.W235C	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W235C(1)		endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		AGAAGGCTCTCCAGCAGCCGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	2											46.0	54.0	51.0					2																	240984785		2101	4226	6327	240633458	SO:0001583	missense	150681				CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.705G>T	2.37:g.240984785C>A	ENSP00000322435:p.Trp235Cys		240633458	Q6IFH3	Missense_Mutation	SNP	ENST00000319423.4	37	CCDS42837.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	c	12.96	2.095883	0.36952	.	.	ENSG00000178586	ENST00000319423	T	0.00084	8.75	4.09	3.22	0.36961	GPCR, rhodopsin-like superfamily (1);	0.430202	0.18551	N	0.137907	T	0.00210	0.0006	N	0.17278	0.47	0.52099	D	0.999948	D	0.67145	0.996	D	0.64506	0.926	D	0.96873	0.9641	10	0.33141	T	0.24	.	9.8621	0.41120	0.0:0.8983:0.0:0.1017	.	235	Q8NGW1	OR6B3_HUMAN	C	235	ENSP00000322435:W235C	ENSP00000322435:W235C	W	-	3	0	OR6B3	240633458	0.405000	0.25336	0.181000	0.23098	0.750000	0.42670	0.740000	0.26188	1.288000	0.44600	0.603000	0.83216	TGG		0.592	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1			Missense_Mutation
PRDM15	63977	broad.mit.edu	37	21	43230511	43230511	+	Splice_Site	SNP	T	T	C			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr21:43230511T>C	ENST00000269844.3	-	28	3859	c.3749A>G	c.(3748-3750)gAg>gGg	p.E1250G	PRDM15_ENST00000422911.1_Splice_Site_p.E941G|PRDM15_ENST00000398548.1_Splice_Site_p.E921G|PRDM15_ENST00000447207.2_Splice_Site_p.E884G|PRDM15_ENST00000538201.1_Splice_Site_p.E904G|PRDM15_ENST00000470586.1_5'UTR	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1250					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.E1250G(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CCAGCTCACCTCGGGGTGCTT	0.706																																																1	Substitution - Missense(1)	ovary(1)	21											35.0	32.0	33.0					21																	43230511		2201	4299	6500	42103580	SO:0001630	splice_region_variant	63977			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.3750+1A>G	21.37:g.43230511T>C			42103580	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	37	CCDS13676.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	t	19.42	3.823973	0.71143	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	T;T;T;T;T	0.10192	2.94;2.93;2.93;2.93;2.9	4.11	4.11	0.48088	.	.	.	.	.	T	0.18593	0.0446	L	0.27053	0.805	0.58432	D	0.999991	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.80764	0.991;0.986;0.994	T	0.03025	-1.1081	9	0.32370	T	0.25	-29.3467	12.2904	0.54815	0.0:0.0:0.0:1.0	.	1250;941;921	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	G	941;921;904;884;1250	ENSP00000408592:E941G;ENSP00000381556:E921G;ENSP00000444044:E904G;ENSP00000390245:E884G;ENSP00000269844:E1250G	ENSP00000269844:E1250G	E	-	2	0	PRDM15	42103580	1.000000	0.71417	0.970000	0.41538	0.503000	0.33858	7.712000	0.84684	1.496000	0.48567	0.255000	0.18592	GAG		0.706	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	Missense_Mutation	Missense_Mutation
CCDC134	79879	broad.mit.edu	37	22	42205978	42205978	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr22:42205978G>C	ENST00000255784.5	+	3	303	c.199G>C	c.(199-201)Gat>Cat	p.D67H	CCDC134_ENST00000402061.3_Missense_Mutation_p.D67H	NM_024821.2	NP_079097.1	Q9H6E4	CC134_HUMAN	coiled-coil domain containing 134	67						extracellular region (GO:0005576)|membrane (GO:0016020)		p.D67H(1)		large_intestine(1)|lung(2)|ovary(2)|skin(1)	6						CAAGATCCTTGATGTCATGCT	0.542																																																1	Substitution - Missense(1)	ovary(1)	22											72.0	63.0	66.0					22																	42205978		2203	4300	6503	40535924	SO:0001583	missense	79879			AL021453	CCDS33654.1	22q13.2	2010-12-24			ENSG00000100147	ENSG00000100147			26185	protein-coding gene	gene with protein product						18087676	Standard	NM_024821		Approved	FLJ22349	uc003bbh.1	Q9H6E4	OTTHUMG00000151262	ENST00000255784.5:c.199G>C	22.37:g.42205978G>C	ENSP00000255784:p.Asp67His		40535924		Missense_Mutation	SNP	ENST00000255784.5	37	CCDS33654.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	28.9	4.961318	0.92791	.	.	ENSG00000100147	ENST00000402061;ENST00000255784	.	.	.	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.76933	0.4057	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.987	T	0.78059	-0.2352	9	0.59425	D	0.04	-15.8668	18.495	0.90861	0.0:0.0:1.0:0.0	.	67;67	B0QY51;Q9H6E4	.;CC134_HUMAN	H	67	.	ENSP00000255784:D67H	D	+	1	0	CCDC134	40535924	1.000000	0.71417	0.930000	0.37139	0.996000	0.88848	8.823000	0.92018	2.683000	0.91414	0.655000	0.94253	GAT		0.542	CCDC134-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000321964.1	NM_024821		Missense_Mutation
CCDC134	79879	broad.mit.edu	37	22	42206263	42206263	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr22:42206263G>A	ENST00000255784.5	+	4	382	c.278G>A	c.(277-279)gGg>gAg	p.G93E	CCDC134_ENST00000402061.3_Intron	NM_024821.2	NP_079097.1	Q9H6E4	CC134_HUMAN	coiled-coil domain containing 134	93						extracellular region (GO:0005576)|membrane (GO:0016020)		p.G93E(1)		large_intestine(1)|lung(2)|ovary(2)|skin(1)	6						CTCCCAGATGGGCCCTTCCCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	22											88.0	65.0	73.0					22																	42206263		2203	4300	6503	40536209	SO:0001583	missense	79879			AL021453	CCDS33654.1	22q13.2	2010-12-24			ENSG00000100147	ENSG00000100147			26185	protein-coding gene	gene with protein product						18087676	Standard	NM_024821		Approved	FLJ22349	uc003bbh.1	Q9H6E4	OTTHUMG00000151262	ENST00000255784.5:c.278G>A	22.37:g.42206263G>A	ENSP00000255784:p.Gly93Glu		40536209		Missense_Mutation	SNP	ENST00000255784.5	37	CCDS33654.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496184	0.85069	.	.	ENSG00000100147	ENST00000255784	.	.	.	5.54	5.54	0.83059	.	0.048456	0.85682	D	0.000000	T	0.58864	0.2152	L	0.48642	1.525	0.58432	D	0.999995	P	0.51537	0.946	P	0.48840	0.592	T	0.51188	-0.8737	9	0.11485	T	0.65	-35.7111	19.871	0.96851	0.0:0.0:1.0:0.0	.	93	Q9H6E4	CC134_HUMAN	E	93	.	ENSP00000255784:G93E	G	+	2	0	CCDC134	40536209	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.480000	0.66820	2.779000	0.95612	0.655000	0.94253	GGG		0.637	CCDC134-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000321964.1	NM_024821		Missense_Mutation
ADAMTS9	56999	broad.mit.edu	37	3	64672498	64672498	+	Missense_Mutation	SNP	A	A	C	rs550060251	byFrequency	TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr3:64672498A>C	ENST00000498707.1	-	2	604	c.262T>G	c.(262-264)Tcc>Gcc	p.S88A	ADAMTS9-AS2_ENST00000474768.1_RNA|ADAMTS9-AS2_ENST00000485174.1_RNA|ADAMTS9_ENST00000459780.1_Missense_Mutation_p.S88A|ADAMTS9-AS2_ENST00000481312.1_RNA|ADAMTS9-AS2_ENST00000460833.1_RNA|ADAMTS9_ENST00000295903.4_Missense_Mutation_p.S88A	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	88	Poly-Ser.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		gaagaggaggaggCGAAGGCA	0.572													A|||	3	0.000599042	0.0	0.0	5008	,	,		16614	0.003		0.0	False		,,,				2504	0.0															0			3											85.0	68.0	74.0					3																	64672498		2203	4300	6503	64647538	SO:0001583	missense	56999			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.262T>G	3.37:g.64672498A>C	ENSP00000418735:p.Ser88Ala		64647538	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	9.729	1.161789	0.21538	.	.	ENSG00000163638	ENST00000295903;ENST00000498707;ENST00000459780	T;T;T	0.61627	0.26;0.3;0.09	5.02	2.38	0.29361	Peptidase M12B, propeptide (1);	0.465896	0.18116	N	0.151194	T	0.27629	0.0679	N	0.02011	-0.69	0.25480	N	0.987749	B;B;B	0.11235	0.004;0.0;0.004	B;B;B	0.12156	0.007;0.001;0.007	T	0.16897	-1.0387	10	0.15066	T	0.55	.	11.4443	0.50114	0.5937:0.4063:0.0:0.0	.	88;88;88	B7ZVX9;Q9P2N4-2;Q9P2N4	.;.;ATS9_HUMAN	A	88	ENSP00000295903:S88A;ENSP00000418735:S88A;ENSP00000419217:S88A	ENSP00000295903:S88A	S	-	1	0	ADAMTS9	64647538	0.109000	0.22037	1.000000	0.80357	0.993000	0.82548	-0.193000	0.09573	0.848000	0.35191	0.402000	0.26972	TCC		0.572	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1			Missense_Mutation
C3orf22	152065	broad.mit.edu	37	3	126268764	126268764	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr3:126268764C>G	ENST00000318225.2	-	4	751	c.373G>C	c.(373-375)Gct>Cct	p.A125P		NM_152533.1	NP_689746.1	Q8N5N4	CC022_HUMAN	chromosome 3 open reading frame 22	125								p.A125P(1)		large_intestine(1)|lung(3)|ovary(2)|prostate(1)	7				GBM - Glioblastoma multiforme(114;0.147)		GGGCAGGCAGCCTCAGTGTGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	3											84.0	75.0	78.0					3																	126268764		2203	4300	6503	127751454	SO:0001583	missense	152065				CCDS3040.1	3q21.3	2011-09-30			ENSG00000180697	ENSG00000180697			28534	protein-coding gene	gene with protein product						12477932	Standard	NM_152533		Approved	MGC34728	uc003ejb.3	Q8N5N4	OTTHUMG00000162731	ENST00000318225.2:c.373G>C	3.37:g.126268764C>G	ENSP00000316644:p.Ala125Pro		127751454	B3KUS9	Missense_Mutation	SNP	ENST00000318225.2	37	CCDS3040.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	11.89	1.774908	0.31411	.	.	ENSG00000180697	ENST00000318225	.	.	.	2.59	0.696	0.18075	.	.	.	.	.	T	0.25754	0.0627	L	0.29908	0.895	0.09310	N	1	B	0.21225	0.053	B	0.19391	0.025	T	0.20672	-1.0268	8	0.30078	T	0.28	-0.0883	3.75	0.08563	0.0:0.591:0.257:0.152	.	125	Q8N5N4	CC022_HUMAN	P	125	.	ENSP00000316644:A125P	A	-	1	0	C3orf22	127751454	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.217000	0.02979	0.171000	0.19730	0.313000	0.20887	GCT		0.617	C3orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370231.2	NM_152533		Missense_Mutation
RHOH	399	broad.mit.edu	37	4	40245074	40245074	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr4:40245074G>A	ENST00000381799.5	+	3	792	c.68G>A	c.(67-69)cGc>cAc	p.R23H	RHOH_ENST00000505618.1_Missense_Mutation_p.R23H	NM_001278363.1|NM_001278365.1|NM_001278366.1|NM_001278367.1|NM_001278369.1|NM_004310.4	NP_001265292.1|NP_001265294.1|NP_001265295.1|NP_001265296.1|NP_001265298.1|NP_004301.1	Q15669	RHOH_HUMAN	ras homolog family member H	23					mast cell activation (GO:0045576)|negative regulation of catalytic activity (GO:0043086)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of phosphorylation (GO:0042326)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase inhibitor activity (GO:0005095)|kinase inhibitor activity (GO:0019210)|Rho GTPase binding (GO:0017048)	p.R23H(1)		kidney(1)|large_intestine(3)|lung(7)|ovary(1)	12						CTGTTGGTGCGCTTCACCTCC	0.582																																																1	Substitution - Missense(1)	ovary(1)	4											205.0	158.0	174.0					4																	40245074		2203	4300	6503	39921469	SO:0001583	missense	399			Z35227	CCDS3458.1	4p13	2014-09-17	2012-02-27	2004-03-24	ENSG00000168421	ENSG00000168421			686	protein-coding gene	gene with protein product		602037	"""ras homolog gene family, member H"""	ARHH		7784061	Standard	NM_001278359		Approved	RhoH, TTF	uc003guz.2	Q15669	OTTHUMG00000099373	ENST00000381799.5:c.68G>A	4.37:g.40245074G>A	ENSP00000371219:p.Arg23His		39921469		Missense_Mutation	SNP	ENST00000381799.5	37	CCDS3458.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	g	34	5.355464	0.95854	.	.	ENSG00000168421	ENST00000505618;ENST00000507851;ENST00000503941;ENST00000381799	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	5.74	5.74	0.90152	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.83427	0.5252	M	0.64676	1.99	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.84137	0.0415	10	0.87932	D	0	.	19.9197	0.97082	0.0:0.0:1.0:0.0	.	23	Q15669	RHOH_HUMAN	H	23	ENSP00000425010:R23H;ENSP00000423384:R23H;ENSP00000426439:R23H;ENSP00000371219:R23H	ENSP00000371219:R23H	R	+	2	0	RHOH	39921469	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.634000	0.83273	2.702000	0.92279	0.655000	0.94253	CGC		0.582	RHOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216820.3	NM_004310		Missense_Mutation
OTUD4	54726	broad.mit.edu	37	4	146058728	146058728	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr4:146058728C>A	ENST00000447906.2	-	21	3386	c.3199G>T	c.(3199-3201)Gtg>Ttg	p.V1067L	OTUD4_ENST00000454497.2_Missense_Mutation_p.V1002L|OTUD4_ENST00000455611.2_Intron			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	1067					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)	p.V1001L(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					TCACTTCTCACATGTTGATAT	0.453																																																1	Substitution - Missense(1)	ovary(1)	4											229.0	220.0	223.0					4																	146058728		2203	4300	6503	146278178	SO:0001583	missense	54726				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.3199G>T	4.37:g.146058728C>A	ENSP00000395487:p.Val1067Leu		146278178	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	ENST00000447906.2	37		SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	6.904	0.536317	0.13188	.	.	ENSG00000164164	ENST00000454497;ENST00000447906	T;T	0.30182	1.54;1.54	6.17	-0.376	0.12505	.	0.697933	0.13367	N	0.393189	T	0.13329	0.0323	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.20840	-1.0263	10	0.27082	T	0.32	0.0672	2.8746	0.05627	0.1864:0.2363:0.429:0.1482	.	1067;1066	G3V0I6;Q01804	.;OTUD4_HUMAN	L	1002;1067	ENSP00000409279:V1002L;ENSP00000395487:V1067L	ENSP00000395487:V1067L	V	-	1	0	OTUD4	146278178	0.000000	0.05858	0.000000	0.03702	0.976000	0.68499	0.188000	0.17018	0.140000	0.18849	0.655000	0.94253	GTG		0.453	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493		Missense_Mutation
SLC4A9	83697	broad.mit.edu	37	5	139743715	139743715	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr5:139743715T>G	ENST00000230993.6	+	10	1438	c.1403T>G	c.(1402-1404)aTt>aGt	p.I468S	SLC4A9_ENST00000432095.2_Missense_Mutation_p.I433S|SLC4A9_ENST00000506757.2_Missense_Mutation_p.I444S|SLC4A9_ENST00000507527.1_Missense_Mutation_p.I468S|SLC4A9_ENST00000506545.1_Missense_Mutation_p.I444S	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	468	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCCTCACCATTCTGAGCAGC	0.617																																																0			5											29.0	31.0	31.0					5																	139743715		1922	4125	6047	139723899	SO:0001583	missense	83697			AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.1403T>G	5.37:g.139743715T>G	ENSP00000230993:p.Ile468Ser		139723899	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Missense_Mutation	SNP	ENST00000230993.6	37	CCDS58973.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	17.50	3.405249	0.62288	.	.	ENSG00000113073	ENST00000230993;ENST00000506757;ENST00000432095;ENST00000506545;ENST00000507527	D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76	4.67	4.67	0.58626	Bicarbonate transporter, C-terminal (1);	0.085572	0.48286	D	0.000186	D	0.92044	0.7479	M	0.91920	3.255	0.80722	D	1	D;P;P;P	0.69078	0.997;0.942;0.928;0.928	D;P;P;P	0.65874	0.939;0.812;0.603;0.603	D	0.93852	0.7146	10	0.87932	D	0	.	14.5735	0.68229	0.0:0.0:0.0:1.0	.	444;468;433;444	E9PDK1;Q96Q91;Q96Q91-2;Q96Q91-3	.;B3A4_HUMAN;.;.	S	468;444;433;444;468	ENSP00000230993:I468S;ENSP00000424424:I444S;ENSP00000410056:I433S;ENSP00000422855:I444S;ENSP00000427661:I468S	ENSP00000230993:I468S	I	+	2	0	SLC4A9	139723899	1.000000	0.71417	1.000000	0.80357	0.131000	0.20780	7.868000	0.87116	2.110000	0.64415	0.260000	0.18958	ATT		0.617	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372823.1	NM_031467		Missense_Mutation
ANKHD1	54882	broad.mit.edu	37	5	139838209	139838209	+	Splice_Site	SNP	G	G	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr5:139838209G>T	ENST00000360839.2	+	8	1396		c.e8-1		ANKHD1_ENST00000297183.6_Splice_Site|ANKHD1-EIF4EBP3_ENST00000532219.1_Splice_Site|ANKHD1_ENST00000394723.3_Splice_Site|ANKHD1_ENST00000394722.3_Splice_Site	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1							cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.?(2)		breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAATCTGCAGGATGGACATG	0.398																																																2	Unknown(2)	ovary(2)	5											63.0	62.0	62.0					5																	139838209		2203	4300	6503	139818393	SO:0001630	splice_region_variant	404734			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.1243-1G>T	5.37:g.139838209G>T			139818393	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Splice_Site_SNP	SNP	ENST00000360839.2	37	CCDS4225.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242017	0.79912	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000421134;ENST00000394723;ENST00000394722;ENST00000532219	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0137	0.97470	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANKHD1-EIF4EBP3;ANKHD1	139818393	1.000000	0.71417	0.999000	0.59377	0.954000	0.61252	9.869000	0.99810	2.734000	0.93682	0.563000	0.77884	.		0.398	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	Intron	Splice_Site_SNP
PCDHGA9	56107	broad.mit.edu	37	5	140783157	140783157	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr5:140783157C>T	ENST00000573521.1	+	1	638	c.638C>T	c.(637-639)aCg>aTg	p.T213M	PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	213	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGTCCTCACGGCCTCGGAT	0.597																																																0			5											30.0	35.0	33.0					5																	140783157		2048	4181	6229	140763341	SO:0001583	missense	56107			AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.638C>T	5.37:g.140783157C>T	ENSP00000460274:p.Thr213Met		140763341	A2RU65|Q9Y5C9	Missense_Mutation	SNP	ENST00000573521.1	37	CCDS58981.1	SNP	19	Broad																																																																																				0.597	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921		Missense_Mutation
PCDHGA10	56106	broad.mit.edu	37	5	140794189	140794189	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr5:140794189C>G	ENST00000398610.2	+	1	1447	c.1447C>G	c.(1447-1449)Ccg>Gcg	p.P483A	PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	483	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCGCTGGACCCGGACAGCAA	0.512																																																0			5											128.0	137.0	134.0					5																	140794189		2081	4219	6300	140774373	SO:0001583	missense	56106				CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.1447C>G	5.37:g.140794189C>G	ENSP00000381611:p.Pro483Ala		140774373	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	37	CCDS47292.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	c	5.568	0.289682	0.10567	.	.	ENSG00000253846	ENST00000398610	T	0.01584	4.75	5.45	3.64	0.41730	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.02193	0.0068	L	0.35854	1.095	0.22096	N	0.999364	B;B	0.20988	0.033;0.05	B;B	0.30782	0.098;0.12	T	0.42816	-0.9429	9	0.52906	T	0.07	.	5.796	0.18387	0.1282:0.5506:0.2493:0.0719	.	483;483	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	A	483	ENSP00000381611:P483A	ENSP00000381611:P483A	P	+	1	0	PCDHGA10	140774373	0.000000	0.05858	0.982000	0.44146	0.459000	0.32528	-0.108000	0.10857	1.279000	0.44446	0.650000	0.86243	CCG		0.512	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913		Missense_Mutation
PCDHGA11	56105	broad.mit.edu	37	5	140801165	140801166	+	Missense_Mutation	DNP	TA	TA	GG			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr5:140801165_140801166TA>GG	ENST00000398587.2	+	1	404_405	c.371_372TA>GG	c.(370-372)aTA>aGG	p.I124R	PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.I124R|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	124	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I124R(1)		breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGTGGAAATAATAGATATTA	0.47																																																1	Substitution - Missense(1)	ovary(1)	5																																								140781350	SO:0001583	missense	56105			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	Exception_encountered	5.37:g.140801165_140801166delinsGG	ENSP00000381589:p.Ile124Arg		140781349	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	DNP	ENST00000398587.2	37	CCDS47294.1	DNP	49	Broad																																																																																				0.470	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914		Missense_Mutation
PPARGC1B	133522	broad.mit.edu	37	5	149210436	149210436	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr5:149210436C>T	ENST00000309241.5	+	4	604	c.572C>T	c.(571-573)cCt>cTt	p.P191L	PPARGC1B_ENST00000360453.4_Intron|PPARGC1B_ENST00000403750.1_Intron|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.P191L	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	191					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.P191L(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			AGTCAACGGCCTTGTGTTAAG	0.557																																																1	Substitution - Missense(1)	ovary(1)	5											88.0	89.0	89.0					5																	149210436		2203	4300	6503	149190629	SO:0001583	missense	133522			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.572C>T	5.37:g.149210436C>T	ENSP00000312649:p.Pro191Leu		149190629	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	37	CCDS4298.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803872	0.70682	.	.	ENSG00000155846	ENST00000394320;ENST00000309241	T;T	0.11495	2.77;2.79	5.29	3.48	0.39840	.	0.492157	0.21938	N	0.066939	T	0.10981	0.0268	L	0.59436	1.845	0.80722	D	1	B;B;B;B	0.32753	0.012;0.023;0.013;0.383	B;B;B;B	0.29716	0.011;0.016;0.007;0.106	T	0.07233	-1.0783	10	0.41790	T	0.15	0.286	8.0485	0.30564	0.0:0.7202:0.1329:0.147	.	170;170;191;191	Q86YN6-2;Q86YN6-4;Q86YN6;Q86YN6-3	.;.;PRGC2_HUMAN;.	L	191	ENSP00000377855:P191L;ENSP00000312649:P191L	ENSP00000312649:P191L	P	+	2	0	PPARGC1B	149190629	1.000000	0.71417	0.999000	0.59377	0.823000	0.46562	1.706000	0.37878	0.698000	0.31739	0.561000	0.74099	CCT		0.557	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263		Missense_Mutation
ATP10B	23120	broad.mit.edu	37	5	160016680	160016680	+	Missense_Mutation	SNP	A	A	C	rs371483735		TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr5:160016680A>C	ENST00000327245.5	-	24	4515	c.3669T>G	c.(3667-3669)gaT>gaG	p.D1223E		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1223					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.D1223E(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGTAAAGACATCTATATCAG	0.473																																																1	Substitution - Missense(1)	ovary(1)	5											176.0	181.0	179.0					5																	160016680		1953	4143	6096	159949258	SO:0001583	missense	23120			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.3669T>G	5.37:g.160016680A>C	ENSP00000313600:p.Asp1223Glu		159949258	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	CCDS43394.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	11.83	1.756686	0.31137	.	.	ENSG00000118322	ENST00000327245	T	0.40225	1.04	5.4	-10.8	0.00216	.	0.117031	0.56097	N	0.000034	T	0.38558	0.1045	M	0.85099	2.735	0.21105	N	0.999787	B	0.23650	0.089	B	0.17098	0.017	T	0.11916	-1.0568	9	.	.	.	.	16.1309	0.81436	0.7665:0.0:0.1577:0.0758	.	1223	O94823	AT10B_HUMAN	E	1223	ENSP00000313600:D1223E	.	D	-	3	2	ATP10B	159949258	0.000000	0.05858	0.011000	0.14972	0.656000	0.38851	-1.566000	0.02148	-2.998000	0.00277	-2.196000	0.00310	GAT		0.473	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153		Missense_Mutation
DNAH11	8701	broad.mit.edu	37	7	21640503	21640503	+	Silent	SNP	A	A	G			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr7:21640503A>G	ENST00000409508.3	+	16	3241	c.3210A>G	c.(3208-3210)gaA>gaG	p.E1070E	DNAH11_ENST00000328843.6_Silent_p.E1070E	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1070	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E1070E(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						ATGCAAATGAAGAAATTCCCG	0.418									Kartagener syndrome																																							1	Substitution - coding silent(1)	ovary(1)	7											128.0	120.0	122.0					7																	21640503		1893	4128	6021	21607028	SO:0001819	synonymous_variant	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.3210A>G	7.37:g.21640503A>G			21607028	Q9UJ82	Silent	SNP	ENST00000409508.3	37		SNP	3	Broad																																																																																				0.418	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		Silent
GPR37	2861	broad.mit.edu	37	7	124404475	124404475	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr7:124404475C>G	ENST00000303921.2	-	1	1206	c.556G>C	c.(556-558)Gcc>Ccc	p.A186P		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	186					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)	p.A186P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AGTTTCCCGGCTCTCCTTGGC	0.632																																																1	Substitution - Missense(1)	ovary(1)	7											47.0	54.0	52.0					7																	124404475		2203	4300	6503	124191711	SO:0001583	missense	2861				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.556G>C	7.37:g.124404475C>G	ENSP00000306449:p.Ala186Pro		124191711	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	37	CCDS5792.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	8.345	0.829676	0.16749	.	.	ENSG00000170775	ENST00000303921	T	0.09163	3.01	5.44	3.63	0.41609	.	0.862288	0.10478	N	0.670011	T	0.07098	0.0180	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.33828	-0.9853	10	0.49607	T	0.09	-6.2316	7.3676	0.26783	0.0:0.8042:0.0:0.1958	.	186	O15354	GPR37_HUMAN	P	186	ENSP00000306449:A186P	ENSP00000306449:A186P	A	-	1	0	GPR37	124191711	0.000000	0.05858	0.469000	0.27204	0.059000	0.15707	-0.158000	0.10070	0.844000	0.35094	0.655000	0.94253	GCC		0.632	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302		Missense_Mutation
FAM160B2	64760	broad.mit.edu	37	8	21958138	21958138	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr8:21958138C>A	ENST00000289921.7	+	11	1421	c.1375C>A	c.(1375-1377)Ctg>Atg	p.L459M		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	459								p.L185M(1)		endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						GTTTGAGGAGCTGCTGCAGAA	0.647																																																1	Substitution - Missense(1)	ovary(1)	8											40.0	46.0	44.0					8																	21958138		2012	4185	6197	22014083	SO:0001583	missense	64760			AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.1375C>A	8.37:g.21958138C>A	ENSP00000289921:p.Leu459Met		22014083	B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Missense_Mutation	SNP	ENST00000289921.7	37	CCDS6021.2	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	.	17.73	3.460949	0.63513	.	.	ENSG00000158863	ENST00000289921	T	0.72051	-0.62	5.74	3.95	0.45737	.	0.071965	0.56097	D	0.000029	T	0.74535	0.3729	L	0.53561	1.675	0.44816	D	0.997829	P	0.46142	0.873	P	0.58454	0.839	T	0.73799	-0.3869	10	0.87932	D	0	-12.1857	5.415	0.16368	0.1608:0.6726:0.0:0.1666	.	459	Q86V87	F16B2_HUMAN	M	459	ENSP00000289921:L459M	ENSP00000289921:L459M	L	+	1	2	FAM160B2	22014083	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	2.404000	0.44539	0.784000	0.33661	0.609000	0.83330	CTG		0.647	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375334.2			Missense_Mutation
PURG	29942	broad.mit.edu	37	8	30890192	30890192	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr8:30890192T>A	ENST00000475541.1	-	1	1039	c.107A>T	c.(106-108)cAc>cTc	p.H36L	PURG_ENST00000339382.2_Missense_Mutation_p.H36L|WRN_ENST00000298139.5_5'Flank	NM_013357.2	NP_037489.1	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G	36						nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.H36L(2)		endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		GTAGTGGGAGTGCTGGGCCTG	0.662																																																2	Substitution - Missense(2)	ovary(2)	8											19.0	22.0	21.0					8																	30890192		2203	4300	6503	31009734	SO:0001583	missense	29942			AF195513	CCDS34878.1, CCDS6081.1	8p11	2004-02-09			ENSG00000172733	ENSG00000172733			17930	protein-coding gene	gene with protein product						12034829	Standard	NM_013357		Approved	PURG-A, PURG-B	uc003xin.3	Q9UJV8	OTTHUMG00000157357	ENST00000475541.1:c.107A>T	8.37:g.30890192T>A	ENSP00000418721:p.His36Leu		31009734	Q8TE64	Missense_Mutation	SNP	ENST00000475541.1	37	CCDS6081.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447483	0.43429	.	.	ENSG00000172733	ENST00000339382;ENST00000475541	T;T	0.21361	2.01;2.02	4.68	3.44	0.39384	.	0.340540	0.21413	N	0.074945	T	0.11580	0.0282	N	0.08118	0	0.29038	N	0.885257	B;B	0.22604	0.024;0.072	B;B	0.24701	0.012;0.055	T	0.12630	-1.0540	10	0.59425	D	0.04	.	10.6543	0.45665	0.0:0.0:0.1607:0.8393	.	36;36	Q9UJV8;Q9UJV8-2	PURG_HUMAN;.	L	36	ENSP00000345168:H36L;ENSP00000418721:H36L	ENSP00000345168:H36L	H	-	2	0	PURG	31009734	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	3.472000	0.53114	1.736000	0.51660	0.260000	0.18958	CAC		0.662	PURG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348565.1	NM_013357		Missense_Mutation
TRAM1	23471	broad.mit.edu	37	8	71499191	71499191	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr8:71499191C>G	ENST00000262213.2	-	8	854	c.685G>C	c.(685-687)Gtt>Ctt	p.V229L	TRAM1_ENST00000521425.1_Missense_Mutation_p.V143L|TRAM1_ENST00000521049.1_5'UTR|TRAM1_ENST00000536748.1_Missense_Mutation_p.V198L	NM_014294.5	NP_055109.1	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1	229	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.V229L(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	17			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			AGAAATTCAACAAAATAATGT	0.328																																					Ovarian(85;984 1334 5116 12432 40638)											1	Substitution - Missense(1)	ovary(1)	8											96.0	92.0	93.0					8																	71499191		2203	4300	6503	71661745	SO:0001583	missense	23471			X63679	CCDS6207.1	8q13.1	2004-01-22			ENSG00000067167	ENSG00000067167			20568	protein-coding gene	gene with protein product		605190				1315422	Standard	NM_014294		Approved	TRAM, TRAMP	uc003xyo.2	Q15629	OTTHUMG00000164428	ENST00000262213.2:c.685G>C	8.37:g.71499191C>G	ENSP00000262213:p.Val229Leu		71661745	B4E0K2	Missense_Mutation	SNP	ENST00000262213.2	37	CCDS6207.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	23.2	4.385818	0.82792	.	.	ENSG00000067167	ENST00000521425;ENST00000262213;ENST00000536748	D;D;D	0.85484	-1.99;-1.99;-1.99	5.66	5.66	0.87406	TRAM/LAG1/CLN8 homology domain (3);	0.115894	0.56097	D	0.000021	D	0.90383	0.6990	M	0.80028	2.48	0.58432	D	0.999998	P	0.50156	0.932	P	0.51079	0.658	D	0.90709	0.4626	10	0.54805	T	0.06	-19.3657	19.7406	0.96230	0.0:1.0:0.0:0.0	.	229	Q15629	TRAM1_HUMAN	L	143;229;198	ENSP00000428052:V143L;ENSP00000262213:V229L;ENSP00000439359:V198L	ENSP00000262213:V229L	V	-	1	0	TRAM1	71661745	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.857000	0.55972	2.657000	0.90304	0.585000	0.79938	GTT		0.328	TRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378738.1	NM_014294		Missense_Mutation
OLFML2A	169611	broad.mit.edu	37	9	127561740	127561740	+	Silent	SNP	C	C	A			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chr9:127561740C>A	ENST00000373580.3	+	4	639	c.639C>A	c.(637-639)acC>acA	p.T213T	OLFML2A_ENST00000288815.5_5'Flank	NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	213					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.T213T(1)		endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						CCCCTGCCACCCCTGCCACGG	0.647																																																1	Substitution - coding silent(1)	ovary(1)	9											9.0	14.0	13.0					9																	127561740		1959	4129	6088	126601561	SO:0001819	synonymous_variant	169611			AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.639C>A	9.37:g.127561740C>A			126601561	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Silent	SNP	ENST00000373580.3	37	CCDS6857.2	SNP	22	Broad																																																																																				0.647	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487		Silent
RBM3	5935	broad.mit.edu	37	X	48434994	48434994	+	Splice_Site	SNP	T	T	G			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chrX:48434994T>G	ENST00000376759.3	+	5	476		c.e5+2		RBM3_ENST00000466764.1_Splice_Site|RBM3_ENST00000376755.1_Splice_Site|RBM3_ENST00000430348.2_Splice_Site|RBM3_ENST00000354480.2_Splice_Site|AC115618.1_ENST00000376775.2_5'Flank	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3						positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)	p.?(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						TAATGGCAGGTGGGTAGCCAA	0.517																																																1	Unknown(1)	ovary(1)	X											59.0	56.0	57.0					X																	48434994		2193	4272	6465	48319938	SO:0001630	splice_region_variant	5935			BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.413+2T>G	X.37:g.48434994T>G			48319938		Splice_Site_SNP	SNP	ENST00000376759.3	37	CCDS14301.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	t	11.97	1.798592	0.31777	.	.	ENSG00000102317	ENST00000376759;ENST00000430348;ENST00000376755;ENST00000354480	.	.	.	4.01	4.01	0.46588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3004	0.43648	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBM3	48319938	1.000000	0.71417	0.999000	0.59377	0.387000	0.30353	2.025000	0.41059	1.792000	0.52537	0.481000	0.45027	.		0.517	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060755.1	NM_006743	Intron	Splice_Site_SNP
SMC1A	8243	broad.mit.edu	37	X	53436003	53436003	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chrX:53436003G>T	ENST00000322213.4	-	9	1662	c.1535C>A	c.(1534-1536)cCt>cAt	p.P512H	SMC1A_ENST00000375340.6_Missense_Mutation_p.P278H	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	512	Flexible hinge.				DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.P512H(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						CACAGAGCCAGGGTAAAGGCG	0.557																																																1	Substitution - Missense(1)	ovary(1)	X											87.0	78.0	81.0					X																	53436003		2203	4300	6503	53452728	SO:0001583	missense	8243			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.1535C>A	X.37:g.53436003G>T	ENSP00000323421:p.Pro512His		53452728	O14995|Q16351|Q2M228	Missense_Mutation	SNP	ENST00000322213.4	37	CCDS14352.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	26.5	4.746401	0.89663	.	.	ENSG00000072501	ENST00000322213;ENST00000375340	D;D	0.86769	-2.17;-2.17	5.28	5.28	0.74379	SMCs flexible hinge (1);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.94637	0.8271	M	0.90595	3.13	0.80722	D	1	D;D;D	0.89917	0.987;1.0;1.0	P;D;D	0.81914	0.758;0.995;0.985	D	0.95622	0.8682	10	0.87932	D	0	.	16.9938	0.86361	0.0:0.0:1.0:0.0	.	278;490;512	B7Z709;Q6MZR8;Q14683	.;.;SMC1A_HUMAN	H	512;278	ENSP00000323421:P512H;ENSP00000364489:P278H	ENSP00000323421:P512H	P	-	2	0	SMC1A	53452728	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.791000	0.99081	2.362000	0.80069	0.600000	0.82982	CCT		0.557	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306		Missense_Mutation
KIAA2022	340533	broad.mit.edu	37	X	73963597	73963597	+	Silent	SNP	A	A	T			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2281-01	TCGA-24-2281-10	g.chrX:73963597A>T	ENST00000055682.6	-	3	1406	c.795T>A	c.(793-795)atT>atA	p.I265I		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	265					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TACTTTCACTAATAAAAGTCT	0.373																																																0			X											115.0	106.0	109.0					X																	73963597		2203	4300	6503	73880322	SO:0001819	synonymous_variant	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.795T>A	X.37:g.73963597A>T			73880322	A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	ENST00000055682.6	37	CCDS35337.1	SNP	13	Broad																																																																																				0.373	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		Silent
PDE4DIP	9659	broad.mit.edu	37	1	144854597	144854602	+	In_Frame_Del	DEL	TCGCTC	TCGCTC	-	rs3851873|rs3863691	byFrequency	TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-2281-01	TCGA-24-2281-10	g.chr1:144854597_144854602delTCGCTC	ENST00000369354.3	-	42	7057_7062	c.6868_6873delGAGCGA	c.(6868-6873)gagcgadel	p.ER2290del	PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369359.4_In_Frame_Del_p.ER2426del|PDE4DIP_ENST00000313382.9_In_Frame_Del_p.ER2184del|PDE4DIP_ENST00000530740.1_In_Frame_Del_p.ER2375del|PDE4DIP_ENST00000369356.4_In_Frame_Del_p.ER2290del			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	2290					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.E2290_R2291delER(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TCTGAAGGAGTCGCTCCTGTTTGGAT	0.49			T	PDGFRB	MPD																																		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	1	Deletion - In frame(1)	ovary(1)	1																																								143565959	SO:0001651	inframe_deletion	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.6868_6873delGAGCGA	1.37:g.144854597_144854602delTCGCTC	ENSP00000358360:p.Glu2290_Arg2291del		143565954	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	In_Frame_Del	DEL	ENST00000369354.3	37	CCDS30824.1	DEL	58	Broad																																																																																				0.490	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359		In_Frame_Del
BEND7	222389	broad.mit.edu	37	10	13481195	13481196	+	Frame_Shift_Ins	INS	-	-	TCCC			TCGA-24-2281-01	TCGA-24-2281-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-2281-01	TCGA-24-2281-10	g.chr10:13481195_13481196insTCCC	ENST00000396900.2	-	9	1535_1536	c.1536_1537insGGGA	c.(1534-1539)cttcacfs	p.H513fs	BEND7_ENST00000486542.1_5'UTR|BEND7_ENST00000341083.3_Frame_Shift_Ins_p.H462fs			Q8N7W2	BEND7_HUMAN	BEN domain containing 7	513						extracellular vesicular exosome (GO:0070062)		p.H462fs*>9(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						caagagatgtgaagggtaagag	0.46																																																1	Insertion - Frameshift(1)	ovary(1)	10																																								13521202	SO:0001589	frameshift_variant	222389			BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.1536_1537insGGGA	10.37:g.13481195_13481196insTCCC	ENSP00000380108:p.His513fs		13521201	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Frame_Shift_Ins	INS	ENST00000396900.2	37		INS	45	Broad																																																																																				0.460	BEND7-202	KNOWN	basic	protein_coding	protein_coding		NM_152751		Frame_Shift_Ins
