#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
RERE	473	broad.mit.edu	37	1	8555154	8555154	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr1:8555154C>T	ENST00000337907.3	-	11	1707	c.1073G>A	c.(1072-1074)cGg>cAg	p.R358Q	RERE_ENST00000400907.2_Missense_Mutation_p.R358Q|RERE_ENST00000377464.1_Missense_Mutation_p.R90Q|RERE_ENST00000400908.2_Missense_Mutation_p.R358Q	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	358	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R358Q(1)		central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GGTGTCATCCCGAGAGGCTGC	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											213.0	214.0	213.0					1																	8555154		2203	4300	6503	8477741	SO:0001583	missense	473			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1073G>A	1.37:g.8555154C>T	ENSP00000338629:p.Arg358Gln		8477741	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	37	CCDS95.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.266039	0.95399	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000400907;ENST00000400908	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.83	5.83	0.93111	ELM2 domain (1);	.	.	.	.	T	0.61073	0.2318	M	0.88450	2.955	0.80722	D	1	D;P	0.67145	0.996;0.95	P;B	0.48815	0.591;0.237	T	0.69734	-0.5065	9	0.62326	D	0.03	-12.5837	18.6875	0.91570	0.0:1.0:0.0:0.0	.	90;358	B1AKN3;Q9P2R6	.;RERE_HUMAN	Q	358;90;358;358	ENSP00000338629:R358Q;ENSP00000366684:R90Q;ENSP00000383699:R358Q;ENSP00000383700:R358Q	ENSP00000338629:R358Q	R	-	2	0	RERE	8477741	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.518000	0.81795	2.759000	0.94783	0.561000	0.74099	CGG		0.483	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1			Missense_Mutation
ARHGEF19	128272	broad.mit.edu	37	1	16534580	16534580	+	Missense_Mutation	SNP	G	G	C	rs201803513		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr1:16534580G>C	ENST00000270747.3	-	3	689	c.553C>G	c.(553-555)Cga>Gga	p.R185G	ARHGEF19_ENST00000478117.1_5'Flank	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	185					regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R185G(1)		cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCTCACTCGGGTGGACCCA	0.662																																																1	Substitution - Missense(1)	ovary(1)	1											60.0	65.0	63.0					1																	16534580		2203	4300	6503	16407167	SO:0001583	missense	128272			BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.553C>G	1.37:g.16534580G>C	ENSP00000270747:p.Arg185Gly		16407167	A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Missense_Mutation	SNP	ENST00000270747.3	37	CCDS170.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055106	0.36277	.	.	ENSG00000142632	ENST00000270747;ENST00000421561;ENST00000375607	T;T	0.61510	0.1;0.1	5.11	3.12	0.35913	.	0.531595	0.15698	N	0.249077	T	0.44603	0.1301	L	0.29908	0.895	0.23923	N	0.996451	P	0.43024	0.798	B	0.40101	0.319	T	0.18777	-1.0326	10	0.41790	T	0.15	.	10.6425	0.45600	0.0:0.0:0.6775:0.3225	.	185	Q8IW93	ARHGJ_HUMAN	G	185	ENSP00000270747:R185G;ENSP00000396001:R185G	ENSP00000270747:R185G	R	-	1	2	ARHGEF19	16407167	0.006000	0.16342	0.015000	0.15790	0.013000	0.08279	1.134000	0.31442	0.570000	0.29347	0.561000	0.74099	CGA		0.662	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006289.1	NM_153213		Missense_Mutation
HSPG2	3339	broad.mit.edu	37	1	22159000	22159000	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr1:22159000C>T	ENST00000374695.3	-	81	11274	c.11195G>A	c.(11194-11196)aGg>aAg	p.R3732K	HSPG2_ENST00000486901.1_5'Flank	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3732	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.R3732K(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GAACTCGGGCCTTCCCCCCAC	0.637																																																1	Substitution - Missense(1)	ovary(1)	1											55.0	58.0	57.0					1																	22159000		2203	4300	6503	22031587	SO:0001583	missense	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.11195G>A	1.37:g.22159000C>T	ENSP00000363827:p.Arg3732Lys		22031587	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	16.45	3.127306	0.56721	.	.	ENSG00000142798	ENST00000374695	T	0.77229	-1.08	4.63	4.63	0.57726	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.42682	D	0.000667	D	0.82751	0.5105	L	0.47016	1.485	0.41821	D	0.990023	P;D	0.63046	0.863;0.992	P;D	0.67231	0.497;0.95	T	0.79945	-0.1589	10	0.24483	T	0.36	.	16.2115	0.82165	0.0:1.0:0.0:0.0	.	1672;3732	Q59EG0;P98160	.;PGBM_HUMAN	K	3732	ENSP00000363827:R3732K	ENSP00000363827:R3732K	R	-	2	0	HSPG2	22031587	1.000000	0.71417	0.971000	0.41717	0.901000	0.52897	6.714000	0.74692	2.402000	0.81655	0.561000	0.74099	AGG		0.637	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529		Missense_Mutation
TMEM39B	55116	broad.mit.edu	37	1	32560520	32560520	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr1:32560520G>C	ENST00000336294.5	+	7	1209	c.1063G>C	c.(1063-1065)Ggc>Cgc	p.G355R	TMEM39B_ENST00000456834.2_3'UTR|TMEM39B_ENST00000373634.4_Missense_Mutation_p.G156R|TMEM39B_ENST00000427288.1_Missense_Mutation_p.G240R|TMEM39B_ENST00000487305.1_3'UTR	NM_018056.2	NP_060526.2	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B	355						integral component of membrane (GO:0016021)		p.G228R(1)		endometrium(2)|kidney(1)|lung(5)|ovary(1)|prostate(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CGCCCATCTGGGCTGTTGGCA	0.627																																																1	Substitution - Missense(1)	ovary(1)	1											51.0	44.0	46.0					1																	32560520		2203	4300	6503	32333107	SO:0001583	missense	55116			AL136695	CCDS351.2	1p35.1	2008-02-05			ENSG00000121775	ENSG00000121775			25510	protein-coding gene	gene with protein product						12477932	Standard	NM_018056		Approved	FLJ10315	uc010ogv.2	Q9GZU3	OTTHUMG00000004020	ENST00000336294.5:c.1063G>C	1.37:g.32560520G>C	ENSP00000338165:p.Gly355Arg		32333107	B4DKN8|B4DQE6|B4DTN8|D3DPP4|Q6IA44	Missense_Mutation	SNP	ENST00000336294.5	37	CCDS351.2	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.503689	0.96371	.	.	ENSG00000121775	ENST00000336294;ENST00000373634;ENST00000427288	.	.	.	5.33	5.33	0.75918	.	0.096900	0.64402	D	0.000001	D	0.83529	0.5274	M	0.79805	2.47	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85423	0.1144	9	0.87932	D	0	-16.8478	19.3979	0.94614	0.0:0.0:1.0:0.0	.	355;240;228	Q9GZU3;B4DTN8;Q9NW51	TM39B_HUMAN;.;.	R	355;156;240	.	ENSP00000338165:G355R	G	+	1	0	TMEM39B	32333107	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.295000	0.96095	2.645000	0.89757	0.655000	0.94253	GGC		0.627	TMEM39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011489.2	NM_018056		Missense_Mutation
MACF1	23499	broad.mit.edu	37	1	39806482	39806482	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr1:39806482G>C	ENST00000372915.3	+	39	10540	c.10453G>C	c.(10453-10455)Gtg>Ctg	p.V3485L	MACF1_ENST00000476350.1_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.V3517L|MACF1_ENST00000564288.1_Missense_Mutation_p.V3480L|MACF1_ENST00000289893.4_Missense_Mutation_p.V1920L|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3485					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.V1920L(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTAGACTAAAGTGTTAAATCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											56.0	55.0	55.0					1																	39806482		2203	4300	6503	39579069	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.10453G>C	1.37:g.39806482G>C	ENSP00000362006:p.Val3485Leu		39579069	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	4.818	0.152150	0.09185	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.26660	1.72;1.72	5.15	1.65	0.23941	.	0.957432	0.08562	N	0.927479	T	0.16257	0.0391	N	0.20766	0.605	0.09310	N	0.999997	B	0.15930	0.015	B	0.20184	0.028	T	0.35101	-0.9802	10	0.19590	T	0.45	.	8.8955	0.35460	0.3743:0.0:0.6257:0.0	.	3485	Q9UPN3	MACF1_HUMAN	L	3485;1920	ENSP00000362006:V3485L;ENSP00000289893:V1920L	ENSP00000289893:V1920L	V	+	1	0	MACF1	39579069	0.669000	0.27502	0.133000	0.22050	0.440000	0.31957	0.653000	0.24902	0.534000	0.28695	0.467000	0.42956	GTG		0.383	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		Missense_Mutation
KNCN	148930	broad.mit.edu	37	1	47016849	47016849	+	Silent	SNP	C	C	A	rs368434466		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr1:47016849C>A	ENST00000481882.2	-	1	350	c.39G>T	c.(37-39)ctG>ctT	p.L13L	KNCN_ENST00000524908.1_5'Flank|KNCN_ENST00000396314.3_Silent_p.L13L|MKNK1-AS1_ENST00000602433.1_RNA			A6PVL3	KNCN_HUMAN	kinocilin	13						apical plasma membrane (GO:0016324)|ciliary basal body (GO:0036064)|cuticular plate (GO:0032437)|integral component of membrane (GO:0016021)|kinocilium (GO:0060091)|neuronal cell body (GO:0043025)		p.L13L(1)		central_nervous_system(1)|endometrium(1)|lung(1)|ovary(1)	4	Acute lymphoblastic leukemia(166;0.155)					AGGCCAGCTGCAGGCCGCGGA	0.642																																																1	Substitution - coding silent(1)	ovary(1)	1											45.0	55.0	52.0					1																	47016849		2066	4198	6264	46789436	SO:0001819	synonymous_variant	148930			AK056573	CCDS44133.1	1p33	2014-02-12	2006-10-26		ENSG00000162456	ENSG00000162456			26488	protein-coding gene	gene with protein product		611455				15855039	Standard	NM_001097611		Approved	FLJ32011, KINO, L5	uc001cpy.2	A6PVL3	OTTHUMG00000007987	ENST00000481882.2:c.39G>T	1.37:g.47016849C>A			46789436	A8MXE3	Silent	SNP	ENST00000481882.2	37		SNP	25	Broad																																																																																				0.642	KNCN-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000316334.2	NM_182516		Silent
FPGT-TNNI3K	100526835	broad.mit.edu	37	1	74808802	74808802	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr1:74808802C>G	ENST00000370899.3	+	11	1211	c.1174C>G	c.(1174-1176)Caa>Gaa	p.Q392E	RP11-439H8.4_ENST00000415549.2_RNA|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.Q405E|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.Q392E|TNNI3K_ENST00000370891.2_Missense_Mutation_p.Q392E|TNNI3K_ENST00000326637.3_Missense_Mutation_p.Q291E	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough									p.Q291E(1)									GGAAATCATCCAAATATCAGG	0.343																																																1	Substitution - Missense(1)	ovary(1)	1											76.0	76.0	76.0					1																	74808802		2203	4300	6503	74581390	SO:0001583	missense	51086					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1174C>G	1.37:g.74808802C>G	ENSP00000359936:p.Gln392Glu		74581390		Missense_Mutation	SNP	ENST00000370899.3	37		SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	13.50	2.256476	0.39896	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.60920	0.15;0.15;2.47;2.47;0.15	5.63	5.63	0.86233	Ankyrin repeat-containing domain (3);	0.115764	0.64402	D	0.000011	T	0.18467	0.0443	N	0.03967	-0.31	0.52501	D	0.999952	B;B;B;B	0.15141	0.0;0.012;0.005;0.008	B;B;B;B	0.11329	0.001;0.005;0.004;0.006	T	0.30446	-0.9978	10	0.06891	T	0.86	.	19.6926	0.96008	0.0:1.0:0.0:0.0	.	291;392;392;392	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	E	392;392;392;392;291	ENSP00000359936:Q392E;ENSP00000359932:Q392E;ENSP00000450895:Q392E;ENSP00000359928:Q392E;ENSP00000322251:Q291E	ENSP00000322251:Q291E	Q	+	1	0	RP11-653A5.2;AC093158.1	74581390	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	5.646000	0.67916	2.676000	0.91093	0.555000	0.69702	CAA		0.343	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3			Missense_Mutation
DNAJB4	11080	broad.mit.edu	37	1	78481902	78481902	+	Missense_Mutation	SNP	G	G	T	rs371742387		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr1:78481902G>T	ENST00000370763.5	+	3	1242	c.985G>T	c.(985-987)Gta>Tta	p.V329L	GIPC2_ENST00000476882.1_Intron|DNAJB4_ENST00000487931.1_3'UTR	NM_007034.3	NP_008965.2	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	329					protein folding (GO:0006457)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)	p.V329L(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						ATCCAAAGAAGTACTTAGGAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	1											96.0	98.0	97.0					1																	78481902		2203	4300	6503	78254490	SO:0001583	missense	11080			U40992	CCDS684.1	1p31.1	2011-09-02			ENSG00000162616	ENSG00000162616		"""Heat shock proteins / DNAJ (HSP40)"""	14886	protein-coding gene	gene with protein product		611327				9546042, 11147971	Standard	NM_007034		Approved	HLJ1	uc001dij.3	Q9UDY4	OTTHUMG00000040905	ENST00000370763.5:c.985G>T	1.37:g.78481902G>T	ENSP00000359799:p.Val329Leu		78254490	B2R824|Q13431	Missense_Mutation	SNP	ENST00000370763.5	37	CCDS684.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	2.603	-0.292645	0.05568	.	.	ENSG00000162616	ENST00000370763	T	0.34859	1.34	5.86	2.58	0.30949	HSP40/DnaJ peptide-binding (1);	0.250065	0.40064	N	0.001197	T	0.04998	0.0134	N	0.02685	-0.53	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25293	-1.0136	10	0.19590	T	0.45	.	8.2349	0.31620	0.3606:0.0:0.6394:0.0	.	329	Q9UDY4	DNJB4_HUMAN	L	329	ENSP00000359799:V329L	ENSP00000359799:V329L	V	+	1	0	DNAJB4	78254490	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	1.867000	0.39499	0.318000	0.23185	-0.150000	0.13652	GTA		0.368	DNAJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098248.3			Missense_Mutation
REG4	83998	broad.mit.edu	37	1	120342452	120342452	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr1:120342452G>C	ENST00000354219.1	-	5	638	c.199C>G	c.(199-201)Ctg>Gtg	p.L67V	REG4_ENST00000530654.1_Missense_Mutation_p.L67V|REG4_ENST00000256585.5_Missense_Mutation_p.L67V	NM_001159352.1	NP_001152824.1	Q9BYZ8	REG4_HUMAN	regenerating islet-derived family, member 4	67	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|mannan binding (GO:2001065)	p.L67V(1)		central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(2)|prostate(1)|skin(2)	15	all_cancers(5;4.81e-10)|all_epithelial(5;7.98e-11)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;8.1e-07)|Lung NSC(69;5.89e-06)|all_epithelial(167;0.000959)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0588)		ATAGATGCCAGGTGGGCTCCG	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											213.0	196.0	202.0					1																	120342452		2203	4300	6503	120143975	SO:0001583	missense	83998			AY007243	CCDS906.1, CCDS53354.1	1p13.1-p12	2008-02-05			ENSG00000134193	ENSG00000134193			22977	protein-coding gene	gene with protein product	"""regenerating gene type IV"", "" gastrointestinal secretory protein"""	609846				11311942, 12455032	Standard	NM_032044		Approved	REG-IV, RELP, GISP	uc001eif.3	Q9BYZ8	OTTHUMG00000012175	ENST00000354219.1:c.199C>G	1.37:g.120342452G>C	ENSP00000346158:p.Leu67Val		120143975	Q8NER6|Q8NER7	Missense_Mutation	SNP	ENST00000354219.1	37	CCDS906.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750024	0.49257	.	.	ENSG00000134193	ENST00000354219;ENST00000256585;ENST00000369402;ENST00000530654	T;T;T	0.60299	1.12;1.12;0.2	4.89	0.968	0.19680	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.50627	D	0.000119	T	0.73297	0.3569	H	0.96208	3.785	0.80722	D	1	D	0.63046	0.992	D	0.85130	0.997	T	0.73795	-0.3870	10	0.87932	D	0	-18.0065	6.8777	0.24156	0.3795:0.0:0.6205:0.0	.	67	Q9BYZ8	REG4_HUMAN	V	67	ENSP00000346158:L67V;ENSP00000256585:L67V;ENSP00000437135:L67V	ENSP00000256585:L67V	L	-	1	2	REG4	120143975	0.994000	0.37717	0.598000	0.28837	0.022000	0.10575	0.754000	0.26390	0.034000	0.15491	-0.142000	0.14014	CTG		0.507	REG4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033675.1	NM_032044		Missense_Mutation
GON4L	54856	broad.mit.edu	37	1	155732034	155732034	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr1:155732034C>T	ENST00000368331.1	-	23	4906	c.4858G>A	c.(4858-4860)Gat>Aat	p.D1620N	GON4L_ENST00000437809.1_Missense_Mutation_p.D1620N|GON4L_ENST00000271883.5_Missense_Mutation_p.D1620N|GON4L_ENST00000471341.1_5'Flank	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1620					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.D1620N(2)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CTGAGTGGATCTCGCTCGAGA	0.542																																																2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)	1											66.0	64.0	64.0					1																	155732034		2025	4175	6200	153998658	SO:0001583	missense	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4858G>A	1.37:g.155732034C>T	ENSP00000357315:p.Asp1620Asn		153998658	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	37		SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	28.3	4.904549	0.92035	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883	T;T;T	0.50548	0.75;0.74;0.75	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.50905	0.1643	L	0.29908	0.895	0.58432	D	0.999993	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.87578	0.989;0.996;0.998	T	0.51028	-0.8757	10	0.48119	T	0.1	.	18.371	0.90407	0.0:1.0:0.0:0.0	.	816;1620;1620	Q1ED43;Q3T8J9;Q3T8J9-3	.;GON4L_HUMAN;.	N	1620	ENSP00000396117:D1620N;ENSP00000357315:D1620N;ENSP00000271883:D1620N	ENSP00000271883:D1620N	D	-	1	0	GON4L	153998658	1.000000	0.71417	1.000000	0.80357	0.613000	0.37349	7.056000	0.76662	2.665000	0.90641	0.305000	0.20034	GAT		0.542	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292		Missense_Mutation
ABL2	27	broad.mit.edu	37	1	179102457	179102457	+	Silent	SNP	G	G	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr1:179102457G>A	ENST00000502732.1	-	2	413	c.210C>T	c.(208-210)ggC>ggT	p.G70G	ABL2_ENST00000512653.1_Silent_p.G55G|ABL2_ENST00000367623.4_Intron|ABL2_ENST00000511413.1_Silent_p.G70G|ABL2_ENST00000408940.3_Intron|ABL2_ENST00000507173.1_Intron|ABL2_ENST00000504405.1_Intron|ABL2_ENST00000392043.3_Intron|ABL2_ENST00000344730.3_Silent_p.G55G	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	70	CAP.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	ctggactactgcctccagtct	0.413			T	ETV6	AML																																		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	0			1											335.0	344.0	341.0					1																	179102457		2203	4300	6503	177369080	SO:0001819	synonymous_variant	0			M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.210C>T	1.37:g.179102457G>A			177369080	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Silent	SNP	ENST00000502732.1	37	CCDS30947.1	SNP	46	Broad																																																																																				0.413	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158		Silent
TUBB8	347688	broad.mit.edu	37	10	93410	93410	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr10:93410C>A	ENST00000309812.4	-	4	984	c.922G>T	c.(922-924)Ggc>Tgc	p.G308C	TUBB8_ENST00000447903.2_Missense_Mutation_p.G236C|TUBB8_ENST00000413237.3_5'Flank	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	308					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G308C(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		AGGTAGCGGCCGTGACGGGGG	0.552																																					Pancreas(192;2041 3010 9013 18103)											1	Substitution - Missense(1)	ovary(1)	10											56.0	69.0	65.0					10																	93410		1897	3753	5650	83410	SO:0001583	missense	347688			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.922G>T	10.37:g.93410C>A	ENSP00000311042:p.Gly308Cys		83410	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	CCDS7051.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293266	0.23564	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	D	0.87334	-2.24	.	.	.	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.64402	U	0.000014	D	0.95843	0.8647	H	0.99919	4.95	0.40961	D	0.984626	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91916	0.5543	9	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	271;308	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	C	236;274;271;308	ENSP00000403895:G236C	ENSP00000272035:G274C	G	-	1	0	RP11-631M21.2	83410	1.000000	0.71417	0.032000	0.17829	0.032000	0.12392	5.268000	0.65536	0.119000	0.18210	0.121000	0.15741	GGC		0.552	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987		Missense_Mutation
SFMBT2	57713	broad.mit.edu	37	10	7409834	7409834	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr10:7409834C>G	ENST00000361972.4	-	4	303	c.213G>C	c.(211-213)caG>caC	p.Q71H	SFMBT2_ENST00000379711.2_Missense_Mutation_p.Q71H|SFMBT2_ENST00000397160.3_Missense_Mutation_p.Q71H|SFMBT2_ENST00000397167.1_Missense_Mutation_p.Q71H|SFMBT2_ENST00000379713.3_Missense_Mutation_p.Q71H	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	71					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.Q71H(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						GGAAGTTGCTCTGAATGCTGA	0.433																																																1	Substitution - Missense(1)	ovary(1)	10											63.0	62.0	62.0					10																	7409834		2203	4300	6503	7449840	SO:0001583	missense	57713			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.213G>C	10.37:g.7409834C>G	ENSP00000355109:p.Gln71His		7449840	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	37	CCDS31138.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	17.44	3.390630	0.62066	.	.	ENSG00000198879	ENST00000361972;ENST00000397167;ENST00000379713;ENST00000379711;ENST00000397160	T;T;T;T;T	0.43294	0.95;0.95;0.95;1.42;1.42	5.17	4.27	0.50696	.	0.186770	0.49305	D	0.000159	T	0.55689	0.1936	M	0.73962	2.25	0.47441	D	0.999425	P;D	0.64830	0.955;0.994	P;D	0.62955	0.62;0.909	T	0.55328	-0.8158	10	0.15066	T	0.55	.	9.9163	0.41436	0.0:0.8417:0.0:0.1583	.	71;71	Q5T981;Q5VUG0	.;SMBT2_HUMAN	H	71	ENSP00000355109:Q71H;ENSP00000380353:Q71H;ENSP00000369035:Q71H;ENSP00000369033:Q71H;ENSP00000380346:Q71H	ENSP00000355109:Q71H	Q	-	3	2	SFMBT2	7449840	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.592000	0.46171	1.315000	0.45114	-0.350000	0.07774	CAG		0.433	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880		Missense_Mutation
ITIH5	80760	broad.mit.edu	37	10	7618952	7618952	+	Missense_Mutation	SNP	G	G	A	rs180863175	byFrequency	TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr10:7618952G>A	ENST00000256861.6	-	10	1520	c.1442C>T	c.(1441-1443)cCg>cTg	p.P481L	ITIH5_ENST00000397145.2_Missense_Mutation_p.P481L|ITIH5_ENST00000446830.2_Missense_Mutation_p.P263L|ITIH5_ENST00000298441.6_Missense_Mutation_p.P267L|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000397146.2_Missense_Mutation_p.P481L	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	481					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P481L(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						AGAGAGGAGCGGGGTCCTGAT	0.567													G|||	7	0.00139776	0.0	0.0029	5008	,	,		18492	0.0		0.003	False		,,,				2504	0.002															1	Substitution - Missense(1)	ovary(1)	10						G	LEU/PRO,LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	57.0	57.0	57.0		1442,1442,800	5.6	0.5	10		57	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	ITIH5	NM_001001851.2,NM_030569.6,NM_032817.5	98,98,98	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,probably-damaging,probably-damaging	481/703,481/943,267/729	7618952	2,13004	2203	4300	6503	7658958	SO:0001583	missense	80760					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1442C>T	10.37:g.7618952G>A	ENSP00000256861:p.Pro481Leu		7658958	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		SNP	39	Broad	4	0.0018315018315018315	0	0.0	1	0.0027624309392265192	0	0.0	3	0.00395778364116095	G	18.66	3.672026	0.67928	2.27E-4	1.16E-4	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.51193	0.1660	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.53760	-0.8393	9	0.87932	D	0	-18.7333	19.5317	0.95231	0.0:0.0:1.0:0.0	.	481;481;267	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	L	481;481;267;263;481	ENSP00000256861:P481L;ENSP00000380333:P481L;ENSP00000298441:P267L;ENSP00000387969:P263L;ENSP00000380332:P481L	ENSP00000256861:P481L	P	-	2	0	ITIH5	7658958	1.000000	0.71417	0.532000	0.27989	0.085000	0.17905	9.338000	0.96553	2.608000	0.88229	0.462000	0.41574	CCG		0.567	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		Missense_Mutation
SLC39A12	221074	broad.mit.edu	37	10	18280230	18280230	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr10:18280230A>G	ENST00000377369.2	+	8	1693	c.1420A>G	c.(1420-1422)Aag>Gag	p.K474E	SLC39A12_ENST00000539911.1_Missense_Mutation_p.K340E|SLC39A12_ENST00000377371.3_Missense_Mutation_p.K474E|SLC39A12_ENST00000377374.4_Missense_Mutation_p.K474E	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	474					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)	p.K474E(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						ACCAAATGACAAGGTATATTT	0.308																																																1	Substitution - Missense(1)	ovary(1)	10											65.0	74.0	71.0					10																	18280230		2203	4300	6503	18320236	SO:0001583	missense	221074				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1420A>G	10.37:g.18280230A>G	ENSP00000366586:p.Lys474Glu		18320236	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	CCDS44362.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	11.57	1.677488	0.29783	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.61980	0.16;0.83;0.86;0.06	5.92	0.633	0.17712	.	1.521360	0.03865	N	0.274636	T	0.45935	0.1367	N	0.21545	0.675	0.29918	N	0.822973	B;B;B	0.13594	0.005;0.003;0.008	B;B;B	0.16289	0.014;0.015;0.014	T	0.29088	-1.0023	10	0.14656	T	0.56	-4.4596	6.7235	0.23342	0.5213:0.1974:0.2813:0.0	.	474;474;474	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	E	474;474;474;340;394	ENSP00000366586:K474E;ENSP00000366591:K474E;ENSP00000366588:K474E;ENSP00000440445:K340E	ENSP00000366586:K474E	K	+	1	0	SLC39A12	18320236	0.001000	0.12720	0.087000	0.20705	0.988000	0.76386	-0.168000	0.09925	-0.125000	0.11703	0.533000	0.62120	AAG		0.308	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		Missense_Mutation
EPC1	80314	broad.mit.edu	37	10	32580213	32580213	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr10:32580213C>G	ENST00000263062.8	-	6	1122	c.853G>C	c.(853-855)Gag>Cag	p.E285Q	EPC1_ENST00000319778.6_Missense_Mutation_p.E285Q|EPC1_ENST00000375110.2_Missense_Mutation_p.E235Q	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	285					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)		p.E285Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				GCCATAACCTCAGACATGATC	0.343																																																1	Substitution - Missense(1)	ovary(1)	10											112.0	106.0	108.0					10																	32580213		2203	4300	6503	32620219	SO:0001583	missense	80314			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.853G>C	10.37:g.32580213C>G	ENSP00000263062:p.Glu285Gln		32620219	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	ENST00000263062.8	37	CCDS7172.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501960	0.85176	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	T;T;T	0.67698	-0.28;-0.28;-0.28	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.80763	0.4685	M	0.65320	2	0.80722	D	1	P;D;D;B	0.89917	0.884;1.0;1.0;0.402	P;D;D;B	0.91635	0.596;0.997;0.999;0.253	T	0.80256	-0.1458	10	0.49607	T	0.09	-14.9341	19.3313	0.94291	0.0:1.0:0.0:0.0	.	285;235;285;285	B8XCX7;Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;.;EPC1_HUMAN	Q	235;285;285	ENSP00000364251:E235Q;ENSP00000318559:E285Q;ENSP00000263062:E285Q	ENSP00000263062:E285Q	E	-	1	0	EPC1	32620219	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.350000	0.79385	2.654000	0.90174	0.467000	0.42956	GAG		0.343	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1			Missense_Mutation
ZNF248	57209	broad.mit.edu	37	10	38120901	38120901	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr10:38120901T>C	ENST00000395867.3	-	6	1932	c.1382A>G	c.(1381-1383)gAg>gGg	p.E461G	AL135791.1_ENST00000583461.1_RNA|ZNF248_ENST00000494133.1_Intron|ZNF248_ENST00000374648.3_Intron|ZNF248_ENST00000357328.4_Missense_Mutation_p.E461G	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	461					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E461G(1)		NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						ATAGGGCTTCTCCCCTGTGTG	0.443																																																1	Substitution - Missense(1)	ovary(1)	10											146.0	139.0	142.0					10																	38120901		2203	4300	6503	38160907	SO:0001583	missense	57209			AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.1382A>G	10.37:g.38120901T>C	ENSP00000379208:p.Glu461Gly		38160907	Q8NDV8|Q9UMP3	Missense_Mutation	SNP	ENST00000395867.3	37	CCDS7194.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	14.29	2.491667	0.44249	.	.	ENSG00000198105	ENST00000395867;ENST00000357328	T;T	0.27557	1.66;1.66	4.44	4.44	0.53790	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000125	T	0.45856	0.1363	L	0.41961	1.31	0.48901	D	0.999725	D	0.89917	1.0	D	0.97110	1.0	T	0.43766	-0.9371	10	0.72032	D	0.01	.	11.9349	0.52868	0.0:0.0:0.0:1.0	.	461	Q8NDW4	ZN248_HUMAN	G	461	ENSP00000379208:E461G;ENSP00000349882:E461G	ENSP00000349882:E461G	E	-	2	0	ZNF248	38160907	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	7.344000	0.79328	1.988000	0.58038	0.528000	0.53228	GAG		0.443	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047609.1	NM_021045		Missense_Mutation
FRMPD2	143162	broad.mit.edu	37	10	49381055	49381055	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr10:49381055G>T	ENST00000374201.3	-	25	3459	c.3157C>A	c.(3157-3159)Cgc>Agc	p.R1053S	FRMPD2_ENST00000305531.3_Missense_Mutation_p.R1028S|FRMPD2_ENST00000474573.1_Missense_Mutation_p.R5S|FRMPD2_ENST00000463706.1_5'UTR|FRMPD2_ENST00000407470.4_Missense_Mutation_p.R1021S	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	1053					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)	p.R1053S(1)		NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		ACAGCCGTGCGTTCATCTCCC	0.507																																																1	Substitution - Missense(1)	ovary(1)	10											46.0	33.0	37.0					10																	49381055		2092	4132	6224	49051061	SO:0001583	missense	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.3157C>A	10.37:g.49381055G>T	ENSP00000363317:p.Arg1053Ser		49051061	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	ENST00000374201.3	37	CCDS31195.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	6.454	0.451993	0.12283	.	.	ENSG00000170324	ENST00000474573;ENST00000374201;ENST00000305531;ENST00000407470	T;T;T;T	0.63744	3.46;-0.02;-0.06;-0.06	4.32	1.75	0.24633	PDZ/DHR/GLGF (1);	.	.	.	.	T	0.38957	0.1060	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B	0.20671	0.047;0.005;0.003;0.047;0.001	B;B;B;B;B	0.22601	0.025;0.006;0.003;0.04;0.008	T	0.20605	-1.0270	9	0.25106	T	0.35	.	4.3268	0.11045	0.6081:0.0:0.3919:0.0	.	5;1028;1053;1021;64	Q68DX3-5;Q68DX3-2;Q68DX3;F8WCT2;Q68DX3-4	.;.;FRPD2_HUMAN;.;.	S	5;1053;1028;1021	ENSP00000422446:R5S;ENSP00000363317:R1053S;ENSP00000307079:R1028S;ENSP00000384339:R1021S	ENSP00000307079:R1028S	R	-	1	0	FRMPD2	49051061	0.000000	0.05858	0.001000	0.08648	0.768000	0.43524	0.645000	0.24782	0.800000	0.34041	0.462000	0.41574	CGC		0.507	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428		Missense_Mutation
NRG3	10718	broad.mit.edu	37	10	83635537	83635537	+	Silent	SNP	C	C	A	rs377125206		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr10:83635537C>A	ENST00000404547.1	+	1	441	c.441C>A	c.(439-441)tcC>tcA	p.S147S	NRG3_ENST00000404576.2_5'Flank|NRG3_ENST00000556918.1_5'Flank|NRG3_ENST00000372142.2_5'Flank|NRG3_ENST00000372141.2_Silent_p.S147S			P56975	NRG3_HUMAN	neuregulin 3	147	Ser/Thr-rich.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.S147S(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		GTGCCGCCTCCTCCAGGACGC	0.711																																																1	Substitution - coding silent(1)	ovary(1)	10											33.0	42.0	39.0					10																	83635537		2199	4298	6497	83625517	SO:0001819	synonymous_variant	10718			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.441C>A	10.37:g.83635537C>A			83625517	A4D7U1|Q0PEH2|Q5VYH3	Silent	SNP	ENST00000404547.1	37	CCDS31233.1	SNP	24	Broad																																																																																				0.711	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086		Silent
CRTAC1	55118	broad.mit.edu	37	10	99655157	99655157	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr10:99655157T>A	ENST00000370597.3	-	11	1686	c.1331A>T	c.(1330-1332)aAc>aTc	p.N444I	CRTAC1_ENST00000370591.2_Missense_Mutation_p.N444I|CRTAC1_ENST00000298819.4_Missense_Mutation_p.N444I	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	444						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.N444I(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		TCGCAGCCAGTTGTTGTTGAA	0.637																																																1	Substitution - Missense(1)	ovary(1)	10											53.0	51.0	51.0					10																	99655157		2203	4300	6503	99645147	SO:0001583	missense	55118			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.1331A>T	10.37:g.99655157T>A	ENSP00000359629:p.Asn444Ile		99645147	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	SNP	ENST00000370597.3	37	CCDS31266.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	18.55	3.648830	0.67358	.	.	ENSG00000095713	ENST00000413387;ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	T;T;T;T;T	0.75704	1.27;-0.96;1.28;-0.11;-0.12	5.06	5.06	0.68205	.	0.196730	0.42964	D	0.000634	T	0.79381	0.4436	M	0.73962	2.25	0.42902	D	0.994234	P;P;P	0.47910	0.887;0.868;0.902	P;B;P	0.48227	0.571;0.289;0.467	T	0.82612	-0.0371	10	0.59425	D	0.04	-29.0781	14.81	0.69989	0.0:0.0:0.0:1.0	.	444;444;340	Q9NQ79-2;Q9NQ79;Q5T4F6	.;CRAC1_HUMAN;.	I	340;444;444;436;444	ENSP00000408445:N340I;ENSP00000359629:N444I;ENSP00000298819:N444I;ENSP00000310810:N436I;ENSP00000359623:N444I	ENSP00000298819:N444I	N	-	2	0	CRTAC1	99645147	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.378000	0.52432	1.896000	0.54893	0.379000	0.24179	AAC		0.637	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1	NM_018058		Missense_Mutation
TACC2	10579	broad.mit.edu	37	10	123903187	123903187	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr10:123903187C>G	ENST00000369005.1	+	7	6140	c.5800C>G	c.(5800-5802)Ccc>Gcc	p.P1934A	TACC2_ENST00000515603.1_Intron|TACC2_ENST00000493951.1_3'UTR|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000369000.1_Intron|TACC2_ENST00000515273.1_Intron|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000334433.3_Missense_Mutation_p.P1934A|TACC2_ENST00000369001.1_Intron|TACC2_ENST00000453444.2_Intron	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1934					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.P1934A(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				AGCTTCCACTCCCTCCTGCCC	0.642																																																1	Substitution - Missense(1)	ovary(1)	10											83.0	71.0	75.0					10																	123903187		2203	4300	6503	123893177	SO:0001583	missense	10579			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.5800C>G	10.37:g.123903187C>G	ENSP00000358001:p.Pro1934Ala		123893177	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	3.814	-0.039129	0.07497	.	.	ENSG00000138162	ENST00000369005;ENST00000334433;ENST00000340076	T;T	0.34472	1.36;1.36	4.56	-3.03	0.05429	.	1.994140	0.03070	N	0.157112	T	0.14056	0.0340	N	0.04508	-0.205	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.28073	-1.0055	10	0.05351	T	0.99	0.6947	6.2393	0.20780	0.0:0.194:0.4363:0.3697	.	1934	O95359	TACC2_HUMAN	A	1934;1934;1924	ENSP00000358001:P1934A;ENSP00000334280:P1934A	ENSP00000334280:P1934A	P	+	1	0	TACC2	123893177	0.000000	0.05858	0.000000	0.03702	0.729000	0.41735	-0.175000	0.09825	-0.420000	0.07427	0.561000	0.74099	CCC		0.642	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			Missense_Mutation
OR4C46	119749	broad.mit.edu	37	11	51516055	51516055	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr11:51516055A>T	ENST00000328188.1	+	1	774	c.774A>T	c.(772-774)agA>agT	p.R258S		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R258S(1)		endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						TGTACATGAGACCTGCAGCTA	0.428																																																1	Substitution - Missense(1)	ovary(1)	11											103.0	87.0	92.0					11																	51516055		2201	4294	6495	51372631	SO:0001583	missense	119749				CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.774A>T	11.37:g.51516055A>T	ENSP00000329056:p.Arg258Ser		51372631		Missense_Mutation	SNP	ENST00000328188.1	37	CCDS31498.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	.	7.769	0.707126	0.15239	.	.	ENSG00000185926	ENST00000328188	T	0.36520	1.25	2.47	1.3	0.21679	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000186	T	0.37892	0.1020	L	0.45744	1.44	0.09310	N	1	P	0.38440	0.631	P	0.49477	0.612	T	0.24297	-1.0164	10	0.87932	D	0	.	5.6072	0.17387	0.849:0.0:0.151:0.0	.	258	A6NHA9	O4C46_HUMAN	S	258	ENSP00000329056:R258S	ENSP00000329056:R258S	R	+	3	2	OR4C46	51372631	0.000000	0.05858	0.208000	0.23602	0.056000	0.15407	0.173000	0.16724	0.231000	0.21079	0.102000	0.15555	AGA		0.428	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703		Missense_Mutation
MYO7A	4647	broad.mit.edu	37	11	76867025	76867025	+	Missense_Mutation	SNP	C	C	A	rs397516302		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr11:76867025C>A	ENST00000409709.3	+	5	630	c.358C>A	c.(358-360)Cgc>Agc	p.R120S	MYO7A_ENST00000458637.2_Missense_Mutation_p.R120S|MYO7A_ENST00000409893.1_Missense_Mutation_p.R120S|MYO7A_ENST00000409619.2_Missense_Mutation_p.R109S	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	120	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AGAGCACATCCGCCAGTATAC	0.562																																																0			11											35.0	39.0	38.0					11																	76867025		2128	4249	6377	76544673	SO:0001583	missense	4647			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.358C>A	11.37:g.76867025C>A	ENSP00000386331:p.Arg120Ser		76544673	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	c	21.8	4.195662	0.78902	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.1	5.1	0.69264	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.86460	0.5938	L	0.42744	1.35	0.80722	D	1	B;B;B	0.19073	0.033;0.007;0.001	B;B;B	0.34093	0.175;0.017;0.007	D	0.83390	0.0017	10	0.59425	D	0.04	.	18.7072	0.91643	0.0:1.0:0.0:0.0	.	120;120;120	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	S	120;120;120;109;119;119;119;119	ENSP00000386331:R120S;ENSP00000386689:R120S;ENSP00000392185:R120S;ENSP00000386635:R109S	ENSP00000345075:R119S	R	+	1	0	MYO7A	76544673	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.911000	0.69939	2.660000	0.90430	0.586000	0.80456	CGC		0.562	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260		Missense_Mutation
GRIA4	2893	broad.mit.edu	37	11	105804496	105804496	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr11:105804496G>C	ENST00000530497.1	+	13	2095	c.2095G>C	c.(2095-2097)Gca>Cca	p.A699P	GRIA4_ENST00000525187.1_Missense_Mutation_p.A699P|GRIA4_ENST00000282499.5_Missense_Mutation_p.A699P|AP000673.1_ENST00000583628.1_RNA|GRIA4_ENST00000393127.2_Missense_Mutation_p.A699P			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	699					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.A699P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		CATGCGATCAGCAGAGCCATC	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											60.0	54.0	56.0					11																	105804496		2202	4299	6501	105309706	SO:0001583	missense	2893			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.2095G>C	11.37:g.105804496G>C	ENSP00000435775:p.Ala699Pro		105309706	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972422	0.74246	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187;ENST00000539249	T;T;T;T	0.38240	1.15;1.15;1.15;1.15	5.27	5.27	0.74061	Ionotropic glutamate receptor (2);	0.000000	0.64402	D	0.000006	T	0.59115	0.2170	M	0.83483	2.645	0.80722	D	1	P;P	0.51240	0.851;0.943	P;P	0.60173	0.87;0.812	T	0.63821	-0.6550	10	0.62326	D	0.03	.	13.2277	0.59924	0.0762:0.0:0.9238:0.0	.	699;699	P48058;G3V164	GRIA4_HUMAN;.	P	699;699;699;699;4	ENSP00000282499:A699P;ENSP00000376835:A699P;ENSP00000435775:A699P;ENSP00000432180:A699P	ENSP00000282499:A699P	A	+	1	0	GRIA4	105309706	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.918000	0.87506	2.479000	0.83701	0.591000	0.81541	GCA		0.413	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1			Missense_Mutation
KMT2A	4297	broad.mit.edu	37	11	118376222	118376222	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr11:118376222C>A	ENST00000389506.5	+	27	9606	c.9606C>A	c.(9604-9606)agC>agA	p.S3202R	KMT2A_ENST00000354520.4_Missense_Mutation_p.S3164R|KMT2A_ENST00000534358.1_Missense_Mutation_p.S3205R			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3202					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.S3202R(1)									CAGAATCCAGCCAGAGGACAG	0.488																																																1	Substitution - Missense(1)	ovary(1)	11											76.0	80.0	79.0					11																	118376222		2200	4295	6495	117881432	SO:0001583	missense	4297			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.9606C>A	11.37:g.118376222C>A	ENSP00000374157:p.Ser3202Arg		117881432	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	4.342	0.062964	0.08388	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.82344	-1.6;-1.6;-1.57	5.55	3.57	0.40892	.	0.199212	0.53938	D	0.000043	T	0.71281	0.3321	N	0.24115	0.695	0.30823	N	0.737578	B;B	0.23735	0.09;0.09	B;B	0.24006	0.05;0.05	T	0.70916	-0.4742	10	0.49607	T	0.09	.	10.3785	0.44096	0.0:0.7864:0.0:0.2136	.	3205;3202	E9PQG7;Q03164	.;MLL1_HUMAN	R	3205;3202;3164;2112	ENSP00000436786:S3205R;ENSP00000374157:S3202R;ENSP00000346516:S3164R	ENSP00000346516:S3164R	S	+	3	2	MLL	117881432	0.999000	0.42202	1.000000	0.80357	0.984000	0.73092	0.604000	0.24164	1.595000	0.50050	-0.229000	0.12294	AGC		0.488	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933		Missense_Mutation
FAM118B	79607	broad.mit.edu	37	11	126126620	126126620	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr11:126126620G>C	ENST00000533050.1	+	7	1348	c.855G>C	c.(853-855)gaG>gaC	p.E285D	FAM118B_ENST00000360194.4_Missense_Mutation_p.E285D|FAM118B_ENST00000529731.1_Missense_Mutation_p.E209D	NM_024556.3	NP_078832.1	Q9BPY3	F118B_HUMAN	family with sequence similarity 118, member B	285								p.E285D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)	13	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0784)		ACGTAGATGAGTTCAAAAAGC	0.448																																																1	Substitution - Missense(1)	ovary(1)	11											129.0	132.0	131.0					11																	126126620		2201	4299	6500	125631830	SO:0001583	missense	79607			BC001340	CCDS8470.1	11q24.2	2014-03-13				ENSG00000197798			26110	protein-coding gene	gene with protein product						24569877	Standard	NM_024556		Approved	FLJ21103	uc001qdf.3	Q9BPY3		ENST00000533050.1:c.855G>C	11.37:g.126126620G>C	ENSP00000433343:p.Glu285Asp		125631830	Q9H7B0	Missense_Mutation	SNP	ENST00000533050.1	37	CCDS8470.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	11.58	1.682321	0.29872	.	.	ENSG00000197798	ENST00000533050;ENST00000528985;ENST00000529731;ENST00000360194;ENST00000525338	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	5.14	-0.232	0.13082	.	0.000000	0.85682	D	0.000000	T	0.11067	0.0270	N	0.03608	-0.345	0.49213	D	0.999762	P;B;B	0.35872	0.525;0.012;0.012	B;B;B	0.32980	0.156;0.017;0.035	T	0.16129	-1.0413	10	0.20519	T	0.43	-15.7877	10.7043	0.45946	0.3791:0.0:0.6208:0.0	.	209;285;285	G3V179;E9PMJ2;Q9BPY3	.;.;F118B_HUMAN	D	285;285;209;285;209	ENSP00000433343:E285D;ENSP00000434952:E285D;ENSP00000432712:E209D;ENSP00000353321:E285D;ENSP00000435754:E209D	ENSP00000353321:E285D	E	+	3	2	FAM118B	125631830	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	1.298000	0.33412	0.066000	0.16515	-0.216000	0.12614	GAG		0.448	FAM118B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386346.1	NM_024556		Missense_Mutation
ETS1	2113	broad.mit.edu	37	11	128354879	128354879	+	Missense_Mutation	SNP	G	G	C	rs540929701		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr11:128354879G>C	ENST00000319397.6	-	5	878	c.569C>G	c.(568-570)cCc>cGc	p.P190R	ETS1_ENST00000392668.4_Missense_Mutation_p.P234R|ETS1_ENST00000535549.1_Intron|ETS1_ENST00000531611.1_Missense_Mutation_p.P190R|ETS1_ENST00000345075.4_Missense_Mutation_p.P190R|ETS1_ENST00000526145.2_Missense_Mutation_p.P190R	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	190	Activation domain; required for transcription activation.				angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.P190R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		CGAGCTGATGGGATGGAGCGT	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	11											163.0	145.0	151.0					11																	128354879		2201	4297	6498	127860089	SO:0001583	missense	2113				CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.569C>G	11.37:g.128354879G>C	ENSP00000324578:p.Pro190Arg		127860089	A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Missense_Mutation	SNP	ENST00000319397.6	37	CCDS8475.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573783	0.86542	.	.	ENSG00000134954	ENST00000345075;ENST00000392668;ENST00000531611;ENST00000319397;ENST00000526145	T;T;T;T;T	0.47177	3.01;2.59;0.85;2.59;3.01	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.60766	0.2294	L	0.50333	1.59	0.80722	D	1	D;D;P	0.59767	0.985;0.986;0.454	P;P;B	0.56343	0.767;0.796;0.14	T	0.59726	-0.7400	10	0.56958	D	0.05	.	20.0731	0.97731	0.0:0.0:1.0:0.0	.	190;190;234	P14921;Q96AC5;Q6N087	ETS1_HUMAN;.;.	R	190;234;190;190;190	ENSP00000340485:P190R;ENSP00000376436:P234R;ENSP00000435666:P190R;ENSP00000324578:P190R;ENSP00000433500:P190R	ENSP00000324578:P190R	P	-	2	0	ETS1	127860089	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.754000	0.85163	2.742000	0.94016	0.655000	0.94253	CCC		0.527	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386269.2	NM_005238		Missense_Mutation
CHD4	1108	broad.mit.edu	37	12	6707211	6707211	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr12:6707211C>G	ENST00000357008.2	-	12	1904	c.1741G>C	c.(1741-1743)Gat>Cat	p.D581H	CHD4_ENST00000544040.1_Missense_Mutation_p.D574H|CHD4_ENST00000544484.1_Missense_Mutation_p.D578H|CHD4_ENST00000309577.6_Missense_Mutation_p.D581H	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	581	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						GGTGGCTCATCCATATCATTC	0.473																																					Colon(32;586 792 4568 16848 45314)											0			12											166.0	166.0	166.0					12																	6707211		2203	4300	6503	6577472	SO:0001583	missense	1108			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.1741G>C	12.37:g.6707211C>G	ENSP00000349508:p.Asp581His		6577472	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179384	0.78564	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	4.21	4.21	0.49690	Chromo domain/shadow (1);	0.000000	0.85682	D	0.000000	T	0.67915	0.2944	M	0.86805	2.84	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.971	D;D;P	0.68621	0.959;0.923;0.823	T	0.74578	-0.3619	10	0.51188	T	0.08	3.0326	16.7682	0.85529	0.0:1.0:0.0:0.0	.	581;581;574	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	H	578;574;581;581;555	ENSP00000440392:D578H;ENSP00000440542:D574H;ENSP00000312419:D581H;ENSP00000349508:D581H	ENSP00000312419:D581H	D	-	1	0	CHD4	6577472	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.625000	0.83145	2.176000	0.68965	0.467000	0.42956	GAT		0.473	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273		Missense_Mutation
EPS8	2059	broad.mit.edu	37	12	15811057	15811057	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr12:15811057T>C	ENST00000281172.5	-	12	1493	c.1057A>G	c.(1057-1059)Agt>Ggt	p.S353G	EPS8_ENST00000543612.1_Missense_Mutation_p.S353G|EPS8_ENST00000543523.1_Missense_Mutation_p.S353G|EPS8_ENST00000542903.1_Missense_Mutation_p.S93G|EPS8_ENST00000540613.1_Missense_Mutation_p.S93G	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	353					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)	p.S353G(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		TCTGCAGCACTAGGATTCTGA	0.343																																																1	Substitution - Missense(1)	ovary(1)	12											77.0	76.0	76.0					12																	15811057		2203	4300	6503	15702324	SO:0001583	missense	2059			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.1057A>G	12.37:g.15811057T>C	ENSP00000281172:p.Ser353Gly		15702324	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	ENST00000281172.5	37	CCDS31753.1	SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	T	26.4	4.730753	0.89390	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000540613;ENST00000542903;ENST00000543223	T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49	5.0	5.0	0.66597	.	0.041736	0.85682	D	0.000000	T	0.73016	0.3533	M	0.84773	2.715	0.54753	D	0.999986	D	0.54964	0.969	P	0.62382	0.901	T	0.78745	-0.2084	10	0.87932	D	0	-18.3671	14.8694	0.70444	0.0:0.0:0.0:1.0	.	353	Q12929	EPS8_HUMAN	G	353;353;353;93;93;353	ENSP00000441867:S353G;ENSP00000281172:S353G;ENSP00000442388:S353G;ENSP00000441888:S93G;ENSP00000437806:S93G	ENSP00000281172:S353G	S	-	1	0	EPS8	15702324	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	7.322000	0.79097	2.108000	0.64289	0.477000	0.44152	AGT		0.343	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1			Missense_Mutation
SLC38A4	55089	broad.mit.edu	37	12	47173445	47173445	+	Silent	SNP	A	A	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr12:47173445A>C	ENST00000447411.1	-	9	872	c.666T>G	c.(664-666)ctT>ctG	p.L222L	SLC38A4_ENST00000266579.4_Silent_p.L222L	NM_001143824.1	NP_001137296.1	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	222					amino acid transport (GO:0006865)|ion transport (GO:0006811)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)	p.L222L(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	21	Lung SC(27;0.192)|Renal(347;0.236)					TGGTATAGCCAAGATAACCTA	0.343																																																1	Substitution - coding silent(1)	ovary(1)	12											117.0	117.0	117.0					12																	47173445		2203	4300	6503	45459712	SO:0001819	synonymous_variant	55089			AF193836	CCDS8750.1	12q13	2013-05-22				ENSG00000139209		"""Solute carriers"""	14679	protein-coding gene	gene with protein product		608065				11414754	Standard	NM_018018		Approved	PAAT, NAT3, ATA3	uc001rpj.2	Q969I6		ENST00000447411.1:c.666T>G	12.37:g.47173445A>C			45459712	A8K553	Silent	SNP	ENST00000447411.1	37	CCDS8750.1	SNP	5	Broad																																																																																				0.343	SLC38A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404574.1			Silent
VDR	7421	broad.mit.edu	37	12	48251304	48251304	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr12:48251304C>A	ENST00000395324.2	-	5	713	c.445G>T	c.(445-447)Gac>Tac	p.D149Y	VDR_ENST00000229022.3_Missense_Mutation_p.D149Y|VDR_ENST00000549336.1_Missense_Mutation_p.D149Y|VDR_ENST00000535672.1_Missense_Mutation_p.D117Y|VDR_ENST00000550325.1_Missense_Mutation_p.D199Y			P11473	VDR_HUMAN	vitamin D (1,25- dihydroxyvitamin D3) receptor	149	Hinge.				bile acid signaling pathway (GO:0038183)|calcium ion transport (GO:0006816)|cell morphogenesis (GO:0000902)|cellular calcium ion homeostasis (GO:0006874)|decidualization (GO:0046697)|gene expression (GO:0010467)|intestinal absorption (GO:0050892)|lactation (GO:0007595)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of calcidiol 1-monooxygenase activity (GO:0060558)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin D receptor signaling pathway (GO:0070561)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcitriol binding (GO:1902098)|calcitriol receptor activity (GO:0008434)|DNA binding (GO:0003677)|lithocholic acid binding (GO:1902121)|lithocholic acid receptor activity (GO:0038186)|retinoid X receptor binding (GO:0046965)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.D149Y(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(3)|skin(2)	22		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Alfacalcidol(DB01436)|Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	TGGCAGAAGTCGGAGTAGGTG	0.612																																																1	Substitution - Missense(1)	ovary(1)	12											104.0	96.0	99.0					12																	48251304		2203	4300	6503	46537571	SO:0001583	missense	7421			J03258	CCDS8757.1, CCDS55820.1	12q12-q14	2014-06-13				ENSG00000111424		"""Nuclear hormone receptors"""	12679	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 163"""	601769				1662663	Standard	NM_001017536		Approved	NR1I1, PPP1R163	uc001rql.3	P11473		ENST00000395324.2:c.445G>T	12.37:g.48251304C>A	ENSP00000378734:p.Asp149Tyr		46537571	B2R5Q1|G3V1V9|Q5PSV3	Missense_Mutation	SNP	ENST00000395324.2	37	CCDS8757.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	19.47	3.833654	0.71258	.	.	ENSG00000111424	ENST00000395324;ENST00000229022;ENST00000549336;ENST00000550325;ENST00000535672;ENST00000546653	D;D;D;D;D;D	0.95554	-3.74;-3.74;-3.74;-3.74;-3.74;-3.74	4.27	4.27	0.50696	Nuclear hormone receptor, ligand-binding (1);	0.165435	0.50627	D	0.000111	D	0.96658	0.8909	L	0.55213	1.73	0.80722	D	1	D;D;D	0.89917	0.97;0.97;1.0	P;P;D	0.85130	0.823;0.773;0.997	D	0.96854	0.9627	10	0.66056	D	0.02	.	14.5768	0.68255	0.0:1.0:0.0:0.0	.	117;149;199	B4DRV7;P11473;G3V1V9	.;VDR_HUMAN;.	Y	149;149;149;199;117;149	ENSP00000378734:D149Y;ENSP00000229022:D149Y;ENSP00000449573:D149Y;ENSP00000447173:D199Y;ENSP00000442145:D117Y;ENSP00000448659:D149Y	ENSP00000229022:D149Y	D	-	1	0	VDR	46537571	1.000000	0.71417	0.927000	0.36925	0.632000	0.37999	4.746000	0.62133	2.378000	0.81104	0.491000	0.48974	GAC		0.612	VDR-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406433.1			Missense_Mutation
GDF11	10220	broad.mit.edu	37	12	56137370	56137370	+	Silent	SNP	G	G	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr12:56137370G>A	ENST00000257868.5	+	1	307	c.270G>A	c.(268-270)aaG>aaA	p.K90K		NM_005811.3	NP_005802.1	O95390	GDF11_HUMAN	growth differentiation factor 11	90					camera-type eye morphogenesis (GO:0048593)|cell maturation (GO:0048469)|growth (GO:0040007)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|palate development (GO:0060021)|pancreas development (GO:0031016)|skeletal system development (GO:0001501)|spinal cord anterior/posterior patterning (GO:0021512)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)|protein complex (GO:0043234)		p.K90K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|urinary_tract(1)	12						TGCGGCTCAAGGAGGCGCCCA	0.672																																																1	Substitution - coding silent(1)	ovary(1)	12											17.0	20.0	19.0					12																	56137370		2178	4248	6426	54423637	SO:0001819	synonymous_variant	10220			AF100907	CCDS8891.1	12q13.13	2008-08-01							4216	protein-coding gene	gene with protein product		603936				15988002	Standard	NM_005811		Approved	BMP-11	uc001shq.3	O95390		ENST00000257868.5:c.270G>A	12.37:g.56137370G>A			54423637	Q9UID1|Q9UID2	Silent	SNP	ENST00000257868.5	37	CCDS8891.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	11.75	1.730373	0.30684	.	.	ENSG00000135414	ENST00000546799	.	.	.	2.74	1.84	0.25277	.	.	.	.	.	T	0.51719	0.1691	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42378	-0.9455	4	.	.	.	-9.4612	4.8999	0.13769	0.2895:0.0:0.7105:0.0	.	.	.	.	K	63	.	.	R	+	2	0	GDF11	54423637	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.106000	0.41835	0.734000	0.32515	0.456000	0.33151	AGG		0.672	GDF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407842.3			Silent
DCTN2	10540	broad.mit.edu	37	12	57929571	57929571	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr12:57929571C>G	ENST00000548249.1	-	3	430	c.163G>C	c.(163-165)Gac>Cac	p.D55H	DCTN2_ENST00000543672.1_Missense_Mutation_p.D60H|DCTN2_ENST00000537439.1_Missense_Mutation_p.D32H|DCTN2_ENST00000434715.3_Missense_Mutation_p.D60H|DCTN2_ENST00000551400.1_5'UTR	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)	55					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.D60H(1)		endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						TTGAACTTGTCATAGGCAGCA	0.507																																																1	Substitution - Missense(1)	ovary(1)	12											70.0	74.0	73.0					12																	57929571		1994	4166	6160	56215838	SO:0001583	missense	10540			U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.163G>C	12.37:g.57929571C>G	ENSP00000447824:p.Asp55His		56215838	B2RBK5|Q86YN2|Q9BW17	Missense_Mutation	SNP	ENST00000548249.1	37	CCDS58245.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	23.4	4.412026	0.83340	.	.	ENSG00000175203	ENST00000548249;ENST00000434715;ENST00000543672;ENST00000537439;ENST00000354743;ENST00000550086;ENST00000550954;ENST00000546670;ENST00000550750	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.73118	0.3546	L	0.56769	1.78	0.80722	D	1	D;D;D	0.60575	0.985;0.985;0.988	P;P;P	0.58391	0.838;0.838;0.837	T	0.72833	-0.4173	9	0.45353	T	0.12	-1.295	18.0377	0.89309	0.0:1.0:0.0:0.0	.	55;60;55	F8WAG8;F5H2S7;Q13561	.;.;DCTN2_HUMAN	H	55;60;60;32;55;20;69;55;32	.	ENSP00000346785:D55H	D	-	1	0	DCTN2	56215838	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.352000	0.79404	2.635000	0.89317	0.650000	0.86243	GAC		0.507	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407393.2	NM_006400		Missense_Mutation
ACTR6	64431	broad.mit.edu	37	12	100598825	100598825	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr12:100598825C>A	ENST00000188312.2	+	2	941	c.176C>A	c.(175-177)cCt>cAt	p.P59H	ACTR6_ENST00000551617.1_5'UTR|ACTR6_ENST00000550813.1_3'UTR|ACTR6_ENST00000546902.1_5'UTR|ACTR6_ENST00000552376.1_Missense_Mutation_p.P59H	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	59						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.P59H(1)		autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						TACATCCTCCCTTTTCAAAAG	0.318																																																1	Substitution - Missense(1)	ovary(1)	12											61.0	65.0	64.0					12																	100598825		2203	4299	6502	99122956	SO:0001583	missense	64431			AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.176C>A	12.37:g.100598825C>A	ENSP00000188312:p.Pro59His		99122956	B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Missense_Mutation	SNP	ENST00000188312.2	37	CCDS9074.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	24.5	4.533749	0.85812	.	.	ENSG00000075089	ENST00000551652;ENST00000188312;ENST00000552376	D;D;D	0.98362	-4.89;-4.89;-4.89	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.99260	0.9742	M	0.93150	3.385	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.995;0.994;0.997	D	0.99075	1.0835	10	0.87932	D	0	.	18.9407	0.92604	0.0:1.0:0.0:0.0	.	59;59;59	B4DLG9;F8W057;Q9GZN1	.;.;ARP6_HUMAN	H	71;59;59	ENSP00000448508:P71H;ENSP00000188312:P59H;ENSP00000447237:P59H	ENSP00000188312:P59H	P	+	2	0	ACTR6	99122956	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.565000	0.82337	2.693000	0.91896	0.655000	0.94253	CCT		0.318	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408159.1	NM_022496		Missense_Mutation
MYBPC1	4604	broad.mit.edu	37	12	102074255	102074255	+	Silent	SNP	A	A	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr12:102074255A>G	ENST00000550270.1	+	28	3360	c.3360A>G	c.(3358-3360)aaA>aaG	p.K1120K	MYBPC1_ENST00000361466.2_Silent_p.K1127K|MYBPC1_ENST00000536007.1_Silent_p.K1083K|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000553190.1_Silent_p.K1102K|MYBPC1_ENST00000392934.3_Silent_p.K1089K|MYBPC1_ENST00000547405.1_Silent_p.K1076K|MYBPC1_ENST00000452455.2_Silent_p.K1120K|MYBPC1_ENST00000549145.1_Silent_p.K1133K|MYBPC1_ENST00000441232.1_Silent_p.K1120K|MYBPC1_ENST00000547509.1_Silent_p.K1088K|MYBPC1_ENST00000545503.2_Silent_p.K1102K|MYBPC1_ENST00000361685.2_Silent_p.K1127K|MYBPC1_ENST00000541119.1_Silent_p.K1090K|MYBPC1_ENST00000551300.1_Silent_p.K1003K|MYBPC1_ENST00000360610.2_Silent_p.K1120K			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	1120	Ig-like C2-type 7.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.K1127K(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						ACTGCTGCAAAGCAGTCAATG	0.448																																																1	Substitution - coding silent(1)	ovary(1)	12											91.0	84.0	86.0					12																	102074255		2203	4300	6503	100598386	SO:0001819	synonymous_variant	4604				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.3360A>G	12.37:g.102074255A>G			100598386	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Silent	SNP	ENST00000550270.1	37	CCDS9085.1	SNP	3	Broad																																																																																				0.448	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1			Silent
SLITRK1	114798	broad.mit.edu	37	13	84454935	84454935	+	Silent	SNP	G	G	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr13:84454935G>A	ENST00000377084.2	-	1	1593	c.708C>T	c.(706-708)atC>atT	p.I236I		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	236	LRRCT 1.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.I236I(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CCACTCGGCCGATCAGGGCAT	0.517																																																1	Substitution - coding silent(1)	ovary(1)	13											57.0	58.0	58.0					13																	84454935		2203	4300	6503	83352936	SO:0001819	synonymous_variant	114798			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.708C>T	13.37:g.84454935G>A			83352936	Q5U5I6|Q96SF9	Silent	SNP	ENST00000377084.2	37	CCDS9464.1	SNP	37	Broad																																																																																				0.517	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		Silent
LIG4	3981	broad.mit.edu	37	13	108862142	108862142	+	Missense_Mutation	SNP	G	G	A	rs373891824		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr13:108862142G>A	ENST00000356922.4	-	2	1747	c.1475C>T	c.(1474-1476)cCt>cTt	p.P492L	LIG4_ENST00000405925.1_Missense_Mutation_p.P492L|LIG4_ENST00000442234.1_Missense_Mutation_p.P492L	NM_002312.3|NM_206937.1	NP_002303.2|NP_996820.1	P49917	DNLI4_HUMAN	ligase IV, DNA, ATP-dependent	492					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|chromosome organization (GO:0051276)|DNA biosynthetic process (GO:0071897)|DNA ligation (GO:0006266)|DNA ligation involved in DNA recombination (GO:0051102)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|lagging strand elongation (GO:0006273)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|single strand break repair (GO:0000012)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|focal adhesion (GO:0005925)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.P492L(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					CTCACCAGGAGGGGGCTTCTC	0.453								Non-homologous end-joining																																								1	Substitution - Missense(1)	ovary(1)	13											143.0	146.0	145.0					13																	108862142		2203	4300	6503	107660143	SO:0001583	missense	3981			X83441	CCDS9508.1	13q33-q34	2014-09-17			ENSG00000174405	ENSG00000174405	6.5.1.1		6601	protein-coding gene	gene with protein product	"""polydeoxyribonucleotide synthase [ATP] 4"", ""polynucleotide ligase"", ""sealase"", ""DNA repair enzyme"", ""DNA joinase"""	601837				7760816	Standard	NM_001098268		Approved		uc001vqo.3	P49917	OTTHUMG00000017328	ENST00000356922.4:c.1475C>T	13.37:g.108862142G>A	ENSP00000349393:p.Pro492Leu		107660143	Q8IY66|Q8TEU5	Missense_Mutation	SNP	ENST00000356922.4	37	CCDS9508.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	9.792	1.178240	0.21787	.	.	ENSG00000174405	ENST00000405925;ENST00000442234;ENST00000356922	T;T;T	0.63096	-0.02;-0.02;-0.02	5.06	4.22	0.49857	DNA ligase, ATP-dependent, C-terminal (1);Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.417878	0.27060	N	0.021127	T	0.43411	0.1246	N	0.11756	0.17	0.31713	N	0.63925	B	0.19935	0.04	B	0.29440	0.102	T	0.48364	-0.9042	10	0.35671	T	0.21	.	8.8072	0.34945	0.0805:0.1497:0.7698:0.0	.	492	P49917	DNLI4_HUMAN	L	492	ENSP00000385955:P492L;ENSP00000402030:P492L;ENSP00000349393:P492L	ENSP00000349393:P492L	P	-	2	0	LIG4	107660143	0.194000	0.23325	0.815000	0.32552	0.990000	0.78478	2.535000	0.45685	1.256000	0.44068	0.551000	0.68910	CCT		0.453	LIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045738.4	NM_002312		Missense_Mutation
OR4K13	390433	broad.mit.edu	37	14	20502095	20502095	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr14:20502095A>G	ENST00000315693.2	-	1	824	c.823T>C	c.(823-825)Tac>Cac	p.Y275H	AL359218.1_ENST00000580563.1_RNA	NM_001004714.1	NP_001004714.1	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K, member 13	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y275H(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)	24	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		AAAATTGTGTAAAACACAGAA	0.348																																																1	Substitution - Missense(1)	ovary(1)	14											41.0	43.0	42.0					14																	20502095		2203	4300	6503	19571935	SO:0001583	missense	390433				CCDS32028.1	14q11.2	2013-09-23			ENSG00000176253	ENSG00000176253		"""GPCR / Class A : Olfactory receptors"""	15351	protein-coding gene	gene with protein product							Standard	NM_001004714		Approved		uc010tkz.2	Q8NH42	OTTHUMG00000170781	ENST00000315693.2:c.823T>C	14.37:g.20502095A>G	ENSP00000319322:p.Tyr275His		19571935	Q6IF13	Missense_Mutation	SNP	ENST00000315693.2	37	CCDS32028.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	.	7.650	0.682718	0.14907	.	.	ENSG00000176253	ENST00000315693	T	0.00321	8.11	3.46	3.46	0.39613	GPCR, rhodopsin-like superfamily (1);	0.231622	0.21923	U	0.067131	T	0.00724	0.0024	M	0.93462	3.42	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.42224	-0.9464	10	0.25751	T	0.34	.	6.7371	0.23415	0.8827:0.0:0.1173:0.0	.	275	Q8NH42	OR4KD_HUMAN	H	275	ENSP00000319322:Y275H	ENSP00000319322:Y275H	Y	-	1	0	OR4K13	19571935	0.014000	0.17966	0.945000	0.38365	0.031000	0.12232	1.347000	0.33975	1.434000	0.47414	0.421000	0.28195	TAC		0.348	OR4K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410344.1			Missense_Mutation
SLC10A1	6554	broad.mit.edu	37	14	70263593	70263593	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr14:70263593A>C	ENST00000216540.4	-	1	413	c.280T>G	c.(280-282)Ttg>Gtg	p.L94V		NM_003049.3	NP_003040.1	Q14973	NTCP_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 1	94					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)	p.L94V(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)	14				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)	Bumetanide(DB00887)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Ethinyl Estradiol(DB00977)|Indomethacin(DB00328)|Liothyronine(DB00279)|Liotrix(DB01583)|Pitavastatin(DB08860)|Probenecid(DB01032)|Progesterone(DB00396)|Testosterone(DB00624)|Ursodeoxycholic acid(DB01586)	CCACAGACCAAGATGGCCAGT	0.597																																																1	Substitution - Missense(1)	ovary(1)	14											86.0	71.0	76.0					14																	70263593		2203	4300	6503	69333346	SO:0001583	missense	6554			L21893	CCDS9797.1	14q24.2	2013-07-18	2013-07-18		ENSG00000100652	ENSG00000100652		"""Solute carriers"""	10905	protein-coding gene	gene with protein product		182396				8132774	Standard	NM_003049		Approved	NTCP	uc001xlr.2	Q14973	OTTHUMG00000171236	ENST00000216540.4:c.280T>G	14.37:g.70263593A>C	ENSP00000216540:p.Leu94Val		69333346	B9EGB6|Q2TU29	Missense_Mutation	SNP	ENST00000216540.4	37	CCDS9797.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	14.74	2.624229	0.46840	.	.	ENSG00000100652	ENST00000216540	T	0.11712	2.75	5.01	0.823	0.18812	.	0.000000	0.85682	D	0.000000	T	0.21307	0.0513	L	0.54323	1.7	0.40216	D	0.977686	D	0.64830	0.994	D	0.63703	0.917	T	0.00880	-1.1529	10	0.42905	T	0.14	-15.3506	10.531	0.44977	0.3691:0.0:0.6309:0.0	.	94	Q14973	NTCP_HUMAN	V	94	ENSP00000216540:L94V	ENSP00000216540:L94V	L	-	1	2	SLC10A1	69333346	1.000000	0.71417	0.990000	0.47175	0.471000	0.32888	3.888000	0.56204	0.289000	0.22422	-0.330000	0.08379	TTG		0.597	SLC10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412464.1			Missense_Mutation
CEP128	145508	broad.mit.edu	37	14	81297520	81297520	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr14:81297520G>T	ENST00000555265.1	-	13	1551	c.1176C>A	c.(1174-1176)gaC>gaA	p.D392E	CEP128_ENST00000216517.6_Missense_Mutation_p.D392E|CEP128_ENST00000281129.3_Missense_Mutation_p.D392E			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	392						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)		p.D392E(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						CTTTCTCCTTGTCTTTTCTCT	0.393																																																1	Substitution - Missense(1)	ovary(1)	14											219.0	197.0	205.0					14																	81297520		2203	4300	6503	80367273	SO:0001583	missense	145508			AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.1176C>A	14.37:g.81297520G>T	ENSP00000451162:p.Asp392Glu		80367273	B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	ENST00000555265.1	37	CCDS32130.1	SNP	48	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.25|13.25	2.181277|2.181277	0.38511|0.38511	.|.	.|.	ENSG00000100629|ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619;ENST00000216517|ENST00000554827	T;T;T|.	0.42513|.	1.57;1.57;0.97|.	5.61|5.61	4.71|4.71	0.59529|0.59529	.|.	0.378139|.	0.26062|.	N|.	0.026566|.	T|T	0.61640|0.61640	0.2363|0.2363	L|L	0.47190|0.47190	1.495|1.495	0.80722|0.80722	D|D	1|1	D;B;P|.	0.69078|.	0.997;0.117;0.884|.	D;B;B|.	0.63957|.	0.92;0.043;0.41|.	T|T	0.59392|0.59392	-0.7463|-0.7463	10|5	0.05436|.	T|.	0.98|.	.|.	14.8163|14.8163	0.70036|0.70036	0.0:0.144:0.856:0.0|0.0:0.144:0.856:0.0	.|.	392;273;392|.	Q6ZU80-3;Q8N3Z7;Q6ZU80|.	.;.;CE128_HUMAN|.	E|K	392|271	ENSP00000281129:D392E;ENSP00000451162:D392E;ENSP00000216517:D392E|.	ENSP00000216517:D392E|.	D|T	-|-	3|2	2|0	CEP128|CEP128	80367273|80367273	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.445000|0.445000	0.32107|0.32107	0.835000|0.835000	0.27531|0.27531	1.490000|1.490000	0.48466|0.48466	0.579000|0.579000	0.79373|0.79373	GAC|ACA		0.393	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446		Missense_Mutation
BTBD7	55727	broad.mit.edu	37	14	93709129	93709129	+	Silent	SNP	G	G	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr14:93709129G>A	ENST00000334746.5	-	11	3196	c.2889C>T	c.(2887-2889)cgC>cgT	p.R963R	BTBD7_ENST00000393170.2_Silent_p.R537R|BTBD7_ENST00000554565.1_Silent_p.R612R	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	963					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)		p.R963R(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GGGAAGGGGTGCGTCTGCTGA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	14											159.0	144.0	149.0					14																	93709129		2203	4300	6503	92778882	SO:0001819	synonymous_variant	55727			AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.2889C>T	14.37:g.93709129G>A			92778882	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Silent	SNP	ENST00000334746.5	37	CCDS32146.1	SNP	46	Broad																																																																																				0.483	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860		Silent
SLC12A6	9990	broad.mit.edu	37	15	34528258	34528258	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr15:34528258G>A	ENST00000354181.3	-	24	3677	c.3185C>T	c.(3184-3186)gCg>gTg	p.A1062V	SLC12A6_ENST00000560164.1_Missense_Mutation_p.A874V|SLC12A6_ENST00000558589.1_Missense_Mutation_p.A1053V|SLC12A6_ENST00000451844.2_Missense_Mutation_p.A874V|SLC12A6_ENST00000290209.5_Missense_Mutation_p.A1011V|SLC12A6_ENST00000397707.2_Missense_Mutation_p.A1047V|SLC12A6_ENST00000558667.1_Missense_Mutation_p.A1062V|SLC12A6_ENST00000397702.2_Missense_Mutation_p.A1003V|SLC12A6_ENST00000458406.2_Missense_Mutation_p.A1003V|SLC12A6_ENST00000560611.1_Missense_Mutation_p.A1062V			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	1062					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)	p.A1011V(1)		central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	CATTGACTTCGCTTTTTGTCC	0.453																																																1	Substitution - Missense(1)	ovary(1)	15											265.0	208.0	227.0					15																	34528258		2201	4298	6499	32315550	SO:0001583	missense	9990			AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.3185C>T	15.37:g.34528258G>A	ENSP00000346112:p.Ala1062Val		32315550	A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	CCDS58352.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	12.90	2.075574	0.36662	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	5.21	4.29	0.51040	.	0.944932	0.08928	N	0.873442	T	0.23370	0.0565	N	0.08118	0	0.28104	N	0.931298	B;B;B;B	0.14012	0.006;0.009;0.003;0.0	B;B;B;B	0.10450	0.005;0.001;0.002;0.0	T	0.22695	-1.0209	10	0.23891	T	0.37	.	7.6465	0.28323	0.089:0.0:0.7472:0.1638	.	1047;1062;1011;874	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	V	1011;1047;1053;1003;1003;874	ENSP00000290209:A1011V;ENSP00000380819:A1047V;ENSP00000380814:A1003V;ENSP00000387725:A1003V;ENSP00000390199:A874V	ENSP00000290209:A1011V	A	-	2	0	SLC12A6	32315550	0.020000	0.18652	0.997000	0.53966	0.978000	0.69477	0.316000	0.19469	1.183000	0.42943	0.557000	0.71058	GCG		0.453	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1	NM_005135		Missense_Mutation
HDC	3067	broad.mit.edu	37	15	50544639	50544639	+	Silent	SNP	G	G	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr15:50544639G>A	ENST00000267845.3	-	9	1431	c.1029C>T	c.(1027-1029)gcC>gcT	p.A343A	HDC_ENST00000543581.1_Silent_p.A343A	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)		p.A343A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		TGAAGTCGGTGGCCACGCCTG	0.592																																					GBM(95;1627 1936 6910 9570)											1	Substitution - coding silent(1)	ovary(1)	15											137.0	111.0	120.0					15																	50544639		2196	4295	6491	48331931	SO:0001819	synonymous_variant	3067				CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1029C>T	15.37:g.50544639G>A			48331931		Silent	SNP	ENST00000267845.3	37	CCDS10134.1	SNP	47	Broad																																																																																				0.592	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1			Silent
ADAMTS7	11173	broad.mit.edu	37	15	79067088	79067088	+	Missense_Mutation	SNP	C	C	T	rs201833956		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr15:79067088C>T	ENST00000388820.4	-	12	1964	c.1754G>A	c.(1753-1755)cGc>cAc	p.R585H	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	585	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R585H(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GTTGCAGAGGCGGAAGCGCTT	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		21132	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	15						C	HIS/ARG	0,4392		0,0,2196	63.0	73.0	69.0		1754	2.5	1.0	15		69	1,8583	1.2+/-3.3	0,1,4291	no	missense	ADAMTS7	NM_014272.3	29	0,1,6487	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	585/1687	79067088	1,12975	2196	4292	6488	76854143	SO:0001583	missense	11173			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1754G>A	15.37:g.79067088C>T	ENSP00000373472:p.Arg585His		76854143	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	15.65	2.894907	0.52121	0.0	1.16E-4	ENSG00000136378	ENST00000388820	T	0.55930	0.49	3.51	2.55	0.30701	.	0.342214	0.27831	N	0.017678	T	0.70596	0.3242	M	0.83223	2.63	0.30868	N	0.732817	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.976	T	0.72683	-0.4219	10	0.87932	D	0	.	10.4045	0.44249	0.0:0.8964:0.0:0.1036	.	585;585	A8MQ00;Q9UKP4	.;ATS7_HUMAN	H	585	ENSP00000373472:R585H	ENSP00000373472:R585H	R	-	2	0	ADAMTS7	76854143	0.988000	0.35896	0.965000	0.40720	0.415000	0.31203	2.652000	0.46682	0.796000	0.33947	0.289000	0.19496	CGC		0.637	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		Missense_Mutation
DNAH3	55567	broad.mit.edu	37	16	21157352	21157352	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr16:21157352G>T	ENST00000261383.3	-	2	174	c.175C>A	c.(175-177)Cct>Act	p.P59T	DNAH3_ENST00000415178.1_Missense_Mutation_p.P59T|DNAH3_ENST00000575491.1_5'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	59	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.P59T(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GGCAGAGGAGGCAGCTCTGGC	0.532																																																2	Substitution - Missense(2)	ovary(2)	16											96.0	88.0	90.0					16																	21157352		2201	4300	6501	21064853	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.175C>A	16.37:g.21157352G>T	ENSP00000261383:p.Pro59Thr		21064853	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724035	0.68959	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.32515	1.45;1.77	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000008	T	0.45836	0.1362	L	0.36672	1.1	0.37895	D	0.93083	D;D	0.89917	0.999;1.0	D;D	0.97110	0.922;1.0	T	0.43245	-0.9403	10	0.46703	T	0.11	.	15.0441	0.71813	0.0:0.0:1.0:0.0	.	59;30	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	T	59;59;30	ENSP00000261383:P59T;ENSP00000394245:P59T	ENSP00000261383:P59T	P	-	1	0	DNAH3	21064853	1.000000	0.71417	1.000000	0.80357	0.549000	0.35272	6.085000	0.71343	2.611000	0.88343	0.555000	0.69702	CCT		0.532	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		Missense_Mutation
SRCAP	10847	broad.mit.edu	37	16	30735266	30735266	+	Silent	SNP	A	A	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr16:30735266A>C	ENST00000262518.4	+	25	4906	c.4521A>C	c.(4519-4521)ctA>ctC	p.L1507L	SRCAP_ENST00000395059.2_Silent_p.L1445L|SRCAP_ENST00000344771.4_Silent_p.L1349L	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1507	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.L1507L(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCTTGACTCTAGGTTTGGCCA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	16											98.0	86.0	90.0					16																	30735266		2197	4300	6497	30642767	SO:0001819	synonymous_variant	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.4521A>C	16.37:g.30735266A>C			30642767	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2	SNP	15	Broad																																																																																				0.577	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662		Silent
TP53	7157	broad.mit.edu	37	17	7577532	7577532	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr17:7577532G>A	ENST00000269305.4	-	7	938	c.749C>T	c.(748-750)cCc>cTc	p.P250L	TP53_ENST00000455263.2_Missense_Mutation_p.P250L|TP53_ENST00000445888.2_Missense_Mutation_p.P250L|TP53_ENST00000359597.4_Missense_Mutation_p.P250L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.P250L|TP53_ENST00000420246.2_Missense_Mutation_p.P250L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	250	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> Q (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P250L(45)|p.0?(8)|p.?(5)|p.P250H(4)|p.P250F(3)|p.P250N(2)|p.M246_P250delMNRRP(2)|p.P250_L252delPIL(2)|p.P250Q(2)|p.R248_P250delRRP(1)|p.P250_T253delPILT(1)|p.N247_P250delNRRP(1)|p.R249_P250delRP(1)|p.R249_T256delRPILTIIT(1)|p.I251fs*94(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGTGAGGATGGGCCTCCGGTT	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	80	Substitution - Missense(56)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(1)	large_intestine(14)|lung(10)|breast(10)|upper_aerodigestive_tract(5)|biliary_tract(5)|skin(5)|ovary(5)|stomach(4)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|oesophagus(3)|liver(2)|urinary_tract(1)|eye(1)|peritoneum(1)|pancreas(1)|thyroid(1)	17	GRCh37	CM973401	TP53	M							154.0	112.0	126.0					17																	7577532		2203	4300	6503	7518257	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.749C>T	17.37:g.7577532G>A	ENSP00000269305:p.Pro250Leu		7518257	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504438	0.85176	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99885	-7.5;-7.5;-7.5;-7.5;-7.5;-7.5;-7.5	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91406	3.205	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.996;0.998;0.998;1.0	D	0.96045	0.9027	10	0.87932	D	0	-1.5308	15.3618	0.74483	0.0:0.0:1.0:0.0	.	250;250;250;250;250	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	L	250;250;250;250;250;250;239;118	ENSP00000410739:P250L;ENSP00000352610:P250L;ENSP00000269305:P250L;ENSP00000398846:P250L;ENSP00000391127:P250L;ENSP00000391478:P250L;ENSP00000425104:P118L	ENSP00000269305:P250L	P	-	2	0	TP53	7518257	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	9.601000	0.98297	2.564000	0.86499	0.462000	0.41574	CCC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
AATF	26574	broad.mit.edu	37	17	35310442	35310442	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr17:35310442G>C	ENST00000225402.5	+	3	791	c.540G>C	c.(538-540)atG>atC	p.M180I		NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor	180	Glu-rich.				apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M180I(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				AGAGTGGCATGGAAGAAGGGG	0.517																																					NSCLC(49;901 1159 19183 41572 46244)											1	Substitution - Missense(1)	ovary(1)	17											200.0	181.0	187.0					17																	35310442		2203	4300	6503	32384555	SO:0001583	missense	26574			AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.540G>C	17.37:g.35310442G>C	ENSP00000225402:p.Met180Ile		32384555	A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	Missense_Mutation	SNP	ENST00000225402.5	37	CCDS32632.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	11.41	1.630765	0.28978	.	.	ENSG00000108270	ENST00000225402	T	0.43688	0.94	5.28	5.28	0.74379	.	0.344184	0.33235	N	0.005132	T	0.29783	0.0744	L	0.29908	0.895	0.31638	N	0.648239	B	0.13145	0.007	B	0.11329	0.006	T	0.18840	-1.0324	10	0.38643	T	0.18	-4.1822	9.3436	0.38096	0.1571:0.0:0.8429:0.0	.	180	Q9NY61	AATF_HUMAN	I	180	ENSP00000225402:M180I	ENSP00000225402:M180I	M	+	3	0	AATF	32384555	0.992000	0.36948	1.000000	0.80357	0.861000	0.49209	1.280000	0.33202	2.745000	0.94114	0.655000	0.94253	ATG		0.517	AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451543.1	NM_012138		Missense_Mutation
NME2	4831	broad.mit.edu	37	17	49245615	49245615	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr17:49245615C>A	ENST00000393193.2	+	6	561	c.484C>A	c.(484-486)Cac>Aac	p.H162N	NME1-NME2_ENST00000503064.1_Missense_Mutation_p.H47N|NME1-NME2_ENST00000608447.1_Missense_Mutation_p.H187N|NME1-NME2_ENST00000513177.1_Missense_Mutation_p.H47N|NME1-NME2_ENST00000393185.1_5'UTR|NME1-NME2_ENST00000514264.2_Missense_Mutation_p.H47N|NME2_ENST00000376392.6_Missense_Mutation_p.H162N|NME1-NME2_ENST00000393183.3_5'UTR|NME2_ENST00000555572.1_Missense_Mutation_p.H187N|NME1-NME2_ENST00000512737.1_Missense_Mutation_p.H47N|NME1-NME2_ENST00000393198.3_Missense_Mutation_p.H162N|NME1-NME2_ENST00000393190.1_Missense_Mutation_p.H47N			P22392	NDKB_HUMAN	NME/NM23 nucleoside diphosphate kinase 2	47					cell adhesion (GO:0007155)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of apoptotic process (GO:0043066)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside triphosphate biosynthetic process (GO:0009142)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|UTP biosynthetic process (GO:0006228)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)|protein histidine kinase activity (GO:0004673)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H162N(1)|p.H47N(1)		endometrium(1)|kidney(1)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	6			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)		Adefovir Dipivoxil(DB00718)|Lamivudine(DB00709)|Tenofovir(DB00300)	CTCTGAAGAACACCTGAAGCA	0.537																																					Esophageal Squamous(49;809 1203 4404 15246)											2	Substitution - Missense(2)	ovary(2)	17											122.0	102.0	109.0					17																	49245615		2203	4300	6503	46600614	SO:0001583	missense	4831			X58965	CCDS11580.1, CCDS74107.1	17q21.33	2013-04-29	2012-05-18		ENSG00000011052	ENSG00000011052			7850	protein-coding gene	gene with protein product		156491	"""non-metastatic cells 2, protein (NM23B) expressed in"""			1988104, 19852809	Standard	NM_001018137		Approved	NM23-H2, NDPKB		P22392	OTTHUMG00000154062	ENST00000393193.2:c.484C>A	17.37:g.49245615C>A	ENSP00000376889:p.His162Asn		46600614	A8MWA3|Q1WM23|Q6LCT6	Missense_Mutation	SNP	ENST00000393193.2	37	CCDS32682.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	c	17.66	3.445089	0.63178	.	.	ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000243678;ENSG00000243678	ENST00000376392;ENST00000555572;ENST00000514264;ENST00000513177;ENST00000512737;ENST00000503064;ENST00000393190;ENST00000393193;ENST00000393198	T;T;T;T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	4.81	4.81	0.61882	.	0.209202	0.28151	U	0.016412	D	0.85652	0.5746	H	0.95679	3.705	0.80722	D	1	B;P	0.43094	0.183;0.799	B;P	0.49683	0.407;0.619	D	0.88966	0.3397	10	0.87932	D	0	-9.4935	11.4186	0.49967	0.0:0.9158:0.0:0.0842	.	47;187	P22392;Q32Q12	NDKB_HUMAN;.	N	162;187;47;47;47;47;47;162;187	ENSP00000365572:H162N;ENSP00000451932:H187N;ENSP00000426976:H47N;ENSP00000425581:H47N;ENSP00000421064:H47N;ENSP00000426901:H47N;ENSP00000376886:H47N;ENSP00000376889:H162N	ENSP00000365572:H47N	H	+	1	0	NME2;NME1-NME2	46600614	0.991000	0.36638	0.948000	0.38648	0.971000	0.66376	4.258000	0.58822	2.374000	0.81015	0.651000	0.88453	CAC		0.537	NME2-001	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000268664.2	NM_002512		Missense_Mutation
MRPL54	116541	broad.mit.edu	37	19	3762782	3762782	+	Silent	SNP	A	A	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr19:3762782A>T	ENST00000330133.4	+	1	121	c.84A>T	c.(82-84)ggA>ggT	p.G28G	APBA3_ENST00000316757.3_5'Flank	NM_172251.2	NP_758455.1	Q6P161	RM54_HUMAN	mitochondrial ribosomal protein L54	28						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)	p.G28G(1)		breast(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACTTCCGGAAGACTCCTGG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	19											31.0	37.0	35.0					19																	3762782		2203	4300	6503	3713782	SO:0001819	synonymous_variant	116541				CCDS12111.1	19p13.3	2012-11-14			ENSG00000183617	ENSG00000183617		"""Mitochondrial ribosomal proteins / large subunits"""	16685	protein-coding gene	gene with protein product		611858				11551941	Standard	NM_172251		Approved		uc002lyq.4	Q6P161	OTTHUMG00000180873	ENST00000330133.4:c.84A>T	19.37:g.3762782A>T			3713782		Silent	SNP	ENST00000330133.4	37	CCDS12111.1	SNP	9	Broad																																																																																				0.627	MRPL54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453443.1	NM_172251		Silent
RANBP3	8498	broad.mit.edu	37	19	5921277	5921277	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr19:5921277C>T	ENST00000340578.6	-	14	1322	c.1265G>A	c.(1264-1266)gGc>gAc	p.G422D	RANBP3_ENST00000591092.1_Missense_Mutation_p.G349D|RANBP3_ENST00000439268.2_Missense_Mutation_p.G417D|RANBP3_ENST00000034275.8_Missense_Mutation_p.G354D|RANBP3_ENST00000541471.1_Missense_Mutation_p.G294D	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	422	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)	p.G422D(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CAGCCCCCGGCCTCTCTCCAC	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											57.0	64.0	62.0					19																	5921277		2001	4169	6170	5872277	SO:0001583	missense	8498			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1265G>A	19.37:g.5921277C>T	ENSP00000341483:p.Gly422Asp		5872277	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	ENST00000340578.6	37	CCDS42478.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	30	5.050610	0.93740	.	.	ENSG00000031823	ENST00000340578;ENST00000439268;ENST00000034275;ENST00000541471	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	5.28	5.28	0.74379	Pleckstrin homology-type (1);Ran binding protein 1 (3);	0.000000	0.85682	D	0.000000	D	0.89849	0.6834	H	0.97635	4.045	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.93296	0.6672	10	0.87932	D	0	-37.497	16.4424	0.83906	0.0:1.0:0.0:0.0	.	294;417;294;349;354;417;422	F5H4C2;Q53GE1;B7Z5P4;B7Z7F3;Q9H6Z4-3;Q9H6Z4-2;Q9H6Z4	.;.;.;.;.;.;RANB3_HUMAN	D	422;417;354;294	ENSP00000341483:G422D;ENSP00000404837:G417D;ENSP00000034275:G354D;ENSP00000445071:G294D	ENSP00000034275:G354D	G	-	2	0	RANBP3	5872277	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.395000	0.79876	2.479000	0.83701	0.655000	0.94253	GGC		0.632	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	NM_007322		Missense_Mutation
CD209	30835	broad.mit.edu	37	19	7807996	7807996	+	Missense_Mutation	SNP	C	C	T	rs11465393		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr19:7807996C>T	ENST00000315599.7	-	7	1166	c.1144G>A	c.(1144-1146)Gcc>Acc	p.A382T	CD209_ENST00000394173.4_Missense_Mutation_p.A221T|CD209_ENST00000315591.8_Missense_Mutation_p.A358T|CD209_ENST00000204801.8_Missense_Mutation_p.A338T|CD209_ENST00000354397.6_Missense_Mutation_p.A376T|CD209_ENST00000601951.1_Missense_Mutation_p.A358T|CD209_ENST00000593660.1_Missense_Mutation_p.A312T|CD209_ENST00000593821.1_Missense_Mutation_p.A246T|CD209_ENST00000301357.8_Missense_Mutation_p.A246T|CD209_ENST00000602261.1_Missense_Mutation_p.A290T|CD209_ENST00000394161.5_Missense_Mutation_p.A146T	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	382			A -> S (in dbSNP:rs11465393).		antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)	p.A382T(2)		endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						GAGCAGGAGGCTGCGGACTTT	0.522																																																2	Substitution - Missense(2)	ovary(2)	19											158.0	156.0	157.0					19																	7807996		2203	4300	6503	7713996	SO:0001583	missense	30835			M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.1144G>A	19.37:g.7807996C>T	ENSP00000315477:p.Ala382Thr		7713996	A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Missense_Mutation	SNP	ENST00000315599.7	37	CCDS12186.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050158	0.36181	.	.	ENSG00000090659	ENST00000315599;ENST00000354397;ENST00000315591;ENST00000204801;ENST00000394173;ENST00000301357;ENST00000394161	T;T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36;2.36	3.45	-4.05	0.03998	C-type lectin fold (1);C-type lectin-like (1);	.	.	.	.	T	0.11239	0.0274	N	0.12663	0.25	0.09310	N	1	B;B;P;P;B;P;B;B;B;B;P	0.47191	0.011;0.104;0.807;0.891;0.018;0.662;0.04;0.018;0.005;0.099;0.728	B;B;B;P;B;B;B;B;B;B;B	0.54706	0.005;0.122;0.185;0.759;0.005;0.082;0.011;0.006;0.005;0.008;0.096	T	0.14227	-1.0480	9	0.15952	T	0.53	.	2.9696	0.05918	0.3176:0.2987:0.0:0.3838	.	382;146;376;338;246;358;290;382;312;358;382	B2R907;Q9NNX6-4;Q9NNX6-2;Q9NNX6-7;Q9NNX6-8;Q9NNX6-6;G5E9C4;Q9NNX6;Q9NNX6-11;Q9NNX6-10;Q9NNX6-5	.;.;.;.;.;.;.;CD209_HUMAN;.;.;.	T	382;376;358;338;290;246;146	ENSP00000315477:A382T;ENSP00000346373:A376T;ENSP00000315407:A358T;ENSP00000204801:A338T;ENSP00000301357:A246T;ENSP00000377716:A146T	ENSP00000204801:A338T	A	-	1	0	CD209	7713996	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-2.673000	0.00842	-0.703000	0.05049	0.455000	0.32223	GCC		0.522	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462241.1	NM_021155		Missense_Mutation
MUC16	94025	broad.mit.edu	37	19	9082391	9082391	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr19:9082391C>T	ENST00000397910.4	-	1	9627	c.9424G>A	c.(9424-9426)Gaa>Aaa	p.E3142K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3143	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.E3142K(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCCCATGTTTCTGGAGAACTC	0.488																																																1	Substitution - Missense(1)	ovary(1)	19											168.0	169.0	169.0					19																	9082391		1913	4127	6040	8943391	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.9424G>A	19.37:g.9082391C>T	ENSP00000381008:p.Glu3142Lys		8943391	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	c	5.393	0.257744	0.10239	.	.	ENSG00000181143	ENST00000397910	T	0.02682	4.2	0.541	0.541	0.17168	.	.	.	.	.	T	0.02119	0.0066	N	0.08118	0	.	.	.	D	0.55172	0.97	P	0.45829	0.494	T	0.48536	-0.9027	7	0.87932	D	0	.	.	.	.	.	3142	B5ME49	.	K	3142	ENSP00000381008:E3142K	ENSP00000381008:E3142K	E	-	1	0	MUC16	8943391	0.001000	0.12720	0.009000	0.14445	0.169000	0.22640	0.137000	0.15995	0.524000	0.28502	0.313000	0.20887	GAA		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Missense_Mutation
ILF3	3609	broad.mit.edu	37	19	10789834	10789834	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr19:10789834C>G	ENST00000590261.1	+	6	713	c.713C>G	c.(712-714)aCt>aGt	p.T238S	ILF3_ENST00000588657.1_Missense_Mutation_p.T238S|ILF3_ENST00000449870.1_Missense_Mutation_p.T238S|ILF3_ENST00000592763.1_Missense_Mutation_p.T238S|ILF3_ENST00000318511.3_Missense_Mutation_p.T238S|ILF3_ENST00000407004.3_Missense_Mutation_p.T238S|ILF3_ENST00000250241.8_Missense_Mutation_p.T238S|ILF3_ENST00000589998.1_Missense_Mutation_p.T238S|ILF3_ENST00000420083.1_Missense_Mutation_p.T238S			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa	238	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.T238S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			GACCTGTGCACTCGCGTGCCC	0.587																																																1	Substitution - Missense(1)	ovary(1)	19											96.0	81.0	86.0					19																	10789834		2203	4300	6503	10650834	SO:0001583	missense	3609			U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.713C>G	19.37:g.10789834C>G	ENSP00000468156:p.Thr238Ser		10650834	A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Missense_Mutation	SNP	ENST00000590261.1	37	CCDS12246.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249785	0.59212	.	.	ENSG00000129351	ENST00000336059;ENST00000449870;ENST00000318511;ENST00000420083;ENST00000407004;ENST00000250241	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.94	4.85	0.62838	DZF (2);	0.054577	0.64402	D	0.000001	T	0.24470	0.0593	N	0.08118	0	0.44685	D	0.997673	B;B;B;B;B;B	0.30326	0.02;0.234;0.276;0.007;0.017;0.018	B;B;B;B;B;B	0.29267	0.013;0.061;0.1;0.018;0.015;0.019	T	0.07809	-1.0753	10	0.25751	T	0.34	.	15.5767	0.76397	0.0:0.8618:0.1382:0.0	.	238;238;238;238;238;238	Q12906-4;G5E9M5;Q12906;Q12906-6;Q12906-2;Q12906-5	.;.;ILF3_HUMAN;.;.;.	S	238	ENSP00000404121:T238S;ENSP00000315205:T238S;ENSP00000405436:T238S;ENSP00000384660:T238S;ENSP00000250241:T238S	ENSP00000250241:T238S	T	+	2	0	ILF3	10650834	0.958000	0.32768	1.000000	0.80357	0.949000	0.60115	2.648000	0.46647	2.820000	0.97059	0.650000	0.86243	ACT		0.587	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452074.1			Missense_Mutation
MAP4K1	11184	broad.mit.edu	37	19	39078422	39078422	+	3'UTR	SNP	G	G	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr19:39078422G>A	ENST00000591517.1	-	0	2558				MAP4K1_ENST00000586296.1_Missense_Mutation_p.P385L|MAP4K1_ENST00000396857.2_Missense_Mutation_p.P811L|MAP4K1_ENST00000589130.1_Missense_Mutation_p.P807L	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1						activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.P811L(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGGAGCAGTAGGATCATCCAC	0.488																																																1	Substitution - Missense(1)	ovary(1)	19											72.0	76.0	75.0					19																	39078422		1988	4146	6134	43770262	SO:0001624	3_prime_UTR_variant	11184			U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.*28C>T	19.37:g.39078422G>A			43770262		Missense_Mutation	SNP	ENST00000591517.1	37	CCDS59385.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168577	0.78339	.	.	ENSG00000104814	ENST00000396857	T	0.78246	-1.16	5.16	4.13	0.48395	.	.	.	.	.	T	0.70263	0.3204	.	.	.	0.80722	D	1	B	0.15930	0.015	B	0.16722	0.016	T	0.68334	-0.5436	8	0.59425	D	0.04	.	11.1371	0.48381	0.0865:0.0:0.9135:0.0	.	811	Q92918-2	.	L	811	ENSP00000380066:P811L	ENSP00000380066:P811L	P	-	2	0	MAP4K1	43770262	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	5.417000	0.66423	1.415000	0.47037	0.650000	0.86243	CCT		0.488	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453390.1	NM_001042600		Missense_Mutation
NLRP13	126204	broad.mit.edu	37	19	56436377	56436377	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr19:56436377T>G	ENST00000342929.3	-	2	343	c.344A>C	c.(343-345)cAa>cCa	p.Q115P	NLRP13_ENST00000588751.1_Missense_Mutation_p.Q115P	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	115							ATP binding (GO:0005524)	p.Q115P(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GGTTGGATCTTGCAGCTCTTG	0.438																																																1	Substitution - Missense(1)	ovary(1)	19											173.0	130.0	145.0					19																	56436377		2203	4300	6503	61128189	SO:0001583	missense	126204			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.344A>C	19.37:g.56436377T>G	ENSP00000343891:p.Gln115Pro		61128189	Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	37	CCDS33119.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	2.734	-0.263775	0.05754	.	.	ENSG00000173572	ENST00000342929	T	0.73469	-0.75	1.65	1.65	0.23941	.	.	.	.	.	T	0.55097	0.1899	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41698	-0.9494	9	0.35671	T	0.21	.	5.3791	0.16181	0.0:0.0:0.0:1.0	.	115	Q86W25	NAL13_HUMAN	P	115	ENSP00000343891:Q115P	ENSP00000343891:Q115P	Q	-	2	0	NLRP13	61128189	0.003000	0.15002	0.024000	0.17045	0.005000	0.04900	0.385000	0.20685	1.037000	0.40024	0.397000	0.26171	CAA		0.438	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810		Missense_Mutation
GEN1	348654	broad.mit.edu	37	2	17942806	17942806	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr2:17942806C>G	ENST00000381254.2	+	3	519	c.305C>G	c.(304-306)tCt>tGt	p.S102C	SMC6_ENST00000402989.1_Intron|GEN1_ENST00000317402.7_Missense_Mutation_p.S102C	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	102					DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S102C(1)		breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AAATCGTGGTCTCAGAAAACA	0.393								Homologous recombination																																								1	Substitution - Missense(1)	ovary(1)	2											83.0	84.0	84.0					2																	17942806		2203	4300	6503	17806287	SO:0001583	missense	348654			AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.305C>G	2.37:g.17942806C>G	ENSP00000370653:p.Ser102Cys		17806287	Q17RS9|Q6ZN37	Missense_Mutation	SNP	ENST00000381254.2	37	CCDS1691.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.43	3.621244	0.66787	.	.	ENSG00000178295	ENST00000317402;ENST00000381254;ENST00000524465	T;T;T	0.47177	0.85;0.85;0.85	5.35	5.35	0.76521	.	0.531595	0.17499	N	0.172080	T	0.65852	0.2731	M	0.74467	2.265	0.36919	D	0.891286	D	0.71674	0.998	P	0.61328	0.887	T	0.71606	-0.4542	10	0.59425	D	0.04	-8.374	14.5216	0.67853	0.0:0.9279:0.0:0.0721	.	102	Q17RS7	GEN_HUMAN	C	102	ENSP00000318977:S102C;ENSP00000370653:S102C;ENSP00000435143:S102C	ENSP00000318977:S102C	S	+	2	0	GEN1	17806287	0.944000	0.32072	0.993000	0.49108	0.928000	0.56348	3.252000	0.51461	2.780000	0.95670	0.655000	0.94253	TCT		0.393	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241661.2	NM_182625		Missense_Mutation
APOB	338	broad.mit.edu	37	2	21224957	21224957	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr2:21224957C>G	ENST00000233242.1	-	29	13464	c.13337G>C	c.(13336-13338)aGa>aCa	p.R4446T	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4446					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.R4446T(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGAATATTTCTGTGCAGAAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											67.0	70.0	69.0					2																	21224957		2203	4300	6503	21078462	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.13337G>C	2.37:g.21224957C>G	ENSP00000233242:p.Arg4446Thr		21078462	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	7.930	0.740511	0.15642	.	.	ENSG00000084674	ENST00000233242	T	0.37411	1.2	5.39	0.249	0.15531	.	0.833358	0.10627	N	0.652683	T	0.17577	0.0422	N	0.14661	0.345	0.09310	N	0.999996	B	0.06786	0.001	B	0.04013	0.001	T	0.20505	-1.0273	10	0.41790	T	0.15	.	2.1873	0.03890	0.1235:0.1751:0.1259:0.5755	.	4446	P04114	APOB_HUMAN	T	4446	ENSP00000233242:R4446T	ENSP00000233242:R4446T	R	-	2	0	APOB	21078462	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.184000	0.09698	0.085000	0.17107	0.491000	0.48974	AGA		0.393	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			Missense_Mutation
APOB	338	broad.mit.edu	37	2	21234782	21234782	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr2:21234782G>T	ENST00000233242.1	-	26	5085	c.4958C>A	c.(4957-4959)tCt>tAt	p.S1653Y		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1653					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.S1653Y(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCACTGGTAGATATTCCATC	0.448																																																1	Substitution - Missense(1)	ovary(1)	2											101.0	94.0	97.0					2																	21234782		2203	4300	6503	21088287	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4958C>A	2.37:g.21234782G>T	ENSP00000233242:p.Ser1653Tyr		21088287	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	11.78	1.741298	0.30865	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00864	5.6	5.97	5.08	0.68730	.	0.108661	0.41712	D	0.000832	T	0.03695	0.0105	L	0.53249	1.67	0.58432	D	0.999999	D	0.71674	0.998	D	0.64042	0.921	T	0.47636	-0.9102	10	0.72032	D	0.01	.	15.4807	0.75524	0.0672:0.0:0.9328:0.0	.	1653	P04114	APOB_HUMAN	Y	1653	ENSP00000233242:S1653Y	ENSP00000233242:S1653Y	S	-	2	0	APOB	21088287	1.000000	0.71417	0.974000	0.42286	0.219000	0.24729	4.608000	0.61141	2.834000	0.97654	0.650000	0.86243	TCT		0.448	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			Missense_Mutation
SULT1C2	6819	broad.mit.edu	37	2	108910252	108910252	+	Silent	SNP	C	C	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr2:108910252C>A	ENST00000437390.2	+	2	306	c.129C>A	c.(127-129)ctC>ctA	p.L43L	SULT1C2_ENST00000492554.1_3'UTR|SULT1C2_ENST00000409880.1_Silent_p.L43L|SULT1C2_ENST00000326853.5_Silent_p.L43L|SULT1C2_ENST00000251481.6_Silent_p.L43L			O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 2	49					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)	p.L43L(1)		NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						ATGATCTCCTCATCTGCACCT	0.527																																																1	Substitution - coding silent(1)	ovary(1)	2											87.0	77.0	81.0					2																	108910252		2203	4300	6503	108276684	SO:0001819	synonymous_variant	6819			U66036, AF186255	CCDS2075.1, CCDS2076.1	2q12.3	2010-09-30	2007-03-16	2007-03-16	ENSG00000198203	ENSG00000198203		"""Sulfotransferases, cytosolic"""	11456	protein-coding gene	gene with protein product		602385	"""sulfotransferase family, cytosolic, 1C, member 1"""	SULT1C1		9169148, 10783263	Standard	NM_001056		Approved	ST1C1	uc002tdx.3	O00338	OTTHUMG00000153215	ENST00000437390.2:c.129C>A	2.37:g.108910252C>A			108276684	Q069I8|Q08AS5|Q53S63	Silent	SNP	ENST00000437390.2	37		SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	7.042	0.562795	0.13498	.	.	ENSG00000198203	ENST00000409067	.	.	.	5.11	3.28	0.37604	.	.	.	.	.	T	0.55545	0.1927	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47674	-0.9099	4	.	.	.	.	6.7496	0.23480	0.0:0.6846:0.1491:0.1663	.	.	.	.	N	40	.	.	H	+	1	0	SULT1C2	108276684	1.000000	0.71417	0.999000	0.59377	0.661000	0.39034	1.511000	0.35801	0.520000	0.28426	0.561000	0.74099	CAT		0.527	SULT1C2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000329969.2	NM_176825		Silent
TANC1	85461	broad.mit.edu	37	2	160086283	160086283	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr2:160086283G>T	ENST00000263635.6	+	27	4583	c.4346G>T	c.(4345-4347)gGc>gTc	p.G1449V	TANC1_ENST00000454300.1_Missense_Mutation_p.G1343V	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1449					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.G1449V(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						CCAACCCCTGGCTTAAGTGAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	2											93.0	106.0	102.0					2																	160086283		2009	4157	6166	159794529	SO:0001583	missense	85461			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4346G>T	2.37:g.160086283G>T	ENSP00000263635:p.Gly1449Val		159794529	C9JD88|Q49AI8	Missense_Mutation	SNP	ENST00000263635.6	37	CCDS42766.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	4.849	0.157888	0.09236	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.70045	-0.45;-0.45	5.92	-0.523	0.11924	.	0.596788	0.18646	N	0.135145	T	0.44350	0.1289	N	0.22421	0.69	0.09310	N	0.999993	B	0.20671	0.047	B	0.21708	0.036	T	0.20672	-1.0268	9	.	.	.	.	6.1362	0.20235	0.2732:0.3374:0.3895:0.0	.	1449	Q9C0D5	TANC1_HUMAN	V	1343;1449	ENSP00000396339:G1343V;ENSP00000263635:G1449V	.	G	+	2	0	TANC1	159794529	0.850000	0.29656	0.000000	0.03702	0.009000	0.06853	2.018000	0.40991	0.112000	0.17975	0.655000	0.94253	GGC		0.537	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			Missense_Mutation
TANC1	85461	broad.mit.edu	37	2	160087413	160087413	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr2:160087413C>G	ENST00000263635.6	+	27	5713	c.5476C>G	c.(5476-5478)Ctg>Gtg	p.L1826V	TANC1_ENST00000454300.1_Missense_Mutation_p.L1720V	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1826					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.L1826V(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						TGTTTCTCATCTGTACCAGGA	0.453																																																1	Substitution - Missense(1)	ovary(1)	2											75.0	77.0	76.0					2																	160087413		1938	4153	6091	159795659	SO:0001583	missense	85461			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.5476C>G	2.37:g.160087413C>G	ENSP00000263635:p.Leu1826Val		159795659	C9JD88|Q49AI8	Missense_Mutation	SNP	ENST00000263635.6	37	CCDS42766.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.544124	0.00142	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.69561	-0.41;-0.41	6.06	1.71	0.24356	.	0.628340	0.16600	N	0.207391	T	0.44435	0.1293	N	0.17474	0.49	0.20975	N	0.999818	B	0.09022	0.002	B	0.04013	0.001	T	0.21177	-1.0253	9	.	.	.	.	8.0273	0.30444	0.0:0.4316:0.4636:0.1047	.	1826	Q9C0D5	TANC1_HUMAN	V	1720;1826	ENSP00000396339:L1720V;ENSP00000263635:L1826V	.	L	+	1	2	TANC1	159795659	0.002000	0.14202	0.003000	0.11579	0.002000	0.02628	0.073000	0.14640	0.857000	0.35407	0.655000	0.94253	CTG		0.453	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			Missense_Mutation
COL5A2	1290	broad.mit.edu	37	2	189927593	189927593	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr2:189927593G>A	ENST00000374866.3	-	29	2249	c.1975C>T	c.(1975-1977)Ccg>Tcg	p.P659S		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	659					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.P659S(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TCACATACCGGCGGGCCCACA	0.403																																																1	Substitution - Missense(1)	ovary(1)	2											66.0	74.0	71.0					2																	189927593		2203	4300	6503	189635838	SO:0001583	missense	1290			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1975C>T	2.37:g.189927593G>A	ENSP00000364000:p.Pro659Ser		189635838	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	11.98	1.800257	0.31869	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.98649	-5.05	4.72	3.57	0.40892	.	0.144257	0.31784	N	0.007063	D	0.95755	0.8619	L	0.33293	1	0.41091	D	0.985598	B;B	0.29341	0.0;0.242	B;B	0.30179	0.0;0.112	D	0.94170	0.7422	9	.	.	.	.	11.6541	0.51306	0.126:0.0:0.874:0.0	.	299;659	Q5PR22;P05997	.;CO5A2_HUMAN	S	659;299	ENSP00000364000:P659S	.	P	-	1	0	COL5A2	189635838	0.918000	0.31147	0.999000	0.59377	0.365000	0.29674	1.267000	0.33050	2.339000	0.79563	0.467000	0.42956	CCG		0.403	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		Missense_Mutation
SPHKAP	80309	broad.mit.edu	37	2	228855721	228855721	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr2:228855721C>G	ENST00000392056.3	-	11	5000	c.4954G>C	c.(4954-4956)Gaa>Caa	p.E1652Q	SPHKAP_ENST00000344657.5_Missense_Mutation_p.E1623Q	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1652						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.E1652*(1)|p.E1671*(1)|p.E1671Q(1)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GATACCTTTTCAATTCTGTTT	0.443																																																3	Substitution - Nonsense(2)|Substitution - Missense(1)	lung(2)|ovary(1)	2											77.0	76.0	76.0					2																	228855721		2203	4300	6503	228563965	SO:0001583	missense	80309				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4954G>C	2.37:g.228855721C>G	ENSP00000375909:p.Glu1652Gln		228563965	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	18.61	3.661744	0.67700	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.13657	2.57;2.57	6.17	6.17	0.99709	A-kinase anchor 110kDa, C-terminal (1);	0.287718	0.39759	N	0.001267	T	0.31857	0.0810	L	0.49126	1.545	0.34159	D	0.668443	D;D	0.76494	0.998;0.999	D;D	0.71656	0.966;0.974	T	0.19386	-1.0307	10	0.62326	D	0.03	.	15.3567	0.74431	0.0:0.8613:0.1387:0.0	.	1652;1623	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	Q	1652;1623	ENSP00000375909:E1652Q;ENSP00000339886:E1623Q	ENSP00000339886:E1623Q	E	-	1	0	SPHKAP	228563965	0.902000	0.30710	1.000000	0.80357	0.995000	0.86356	1.572000	0.36461	2.941000	0.99782	0.655000	0.94253	GAA		0.443	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		Missense_Mutation
COL6A3	1293	broad.mit.edu	37	2	238274364	238274364	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr2:238274364G>C	ENST00000295550.4	-	12	6267	c.5815C>G	c.(5815-5817)Cag>Gag	p.Q1939E	COL6A3_ENST00000409809.1_Missense_Mutation_p.Q1733E|COL6A3_ENST00000472056.1_Missense_Mutation_p.Q1332E|COL6A3_ENST00000353578.4_Missense_Mutation_p.Q1733E|COL6A3_ENST00000346358.4_Missense_Mutation_p.Q1739E|COL6A3_ENST00000347401.3_Missense_Mutation_p.Q1738E	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1939	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGCGAGGACTGTCTGAACTTG	0.567																																																0			2											73.0	72.0	72.0					2																	238274364		2203	4300	6503	237939103	SO:0001583	missense	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5815C>G	2.37:g.238274364G>C	ENSP00000295550:p.Gln1939Glu		237939103	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	4.618	0.114849	0.08831	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23;1.23	5.06	1.67	0.24075	von Willebrand factor, type A (2);	1.468830	0.04333	N	0.352612	T	0.24431	0.0592	L	0.38531	1.155	0.09310	N	1	B;P;B	0.44044	0.442;0.825;0.104	B;B;B	0.40375	0.17;0.327;0.024	T	0.14172	-1.0482	10	0.07644	T	0.81	.	2.553	0.04753	0.0896:0.265:0.2854:0.36	.	1332;1733;1939	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	E	1939;1738;1733;1332;1733;1739	ENSP00000295550:Q1939E;ENSP00000315609:Q1738E;ENSP00000315873:Q1733E;ENSP00000418285:Q1332E;ENSP00000386844:Q1733E;ENSP00000295546:Q1739E	ENSP00000295550:Q1939E	Q	-	1	0	COL6A3	237939103	0.000000	0.05858	0.054000	0.19295	0.501000	0.33797	-0.094000	0.11094	0.634000	0.30469	0.650000	0.86243	CAG		0.567	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		Missense_Mutation
TOP1	7150	broad.mit.edu	37	20	39744959	39744959	+	Silent	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr20:39744959C>G	ENST00000361337.2	+	17	1999	c.1749C>G	c.(1747-1749)ggC>ggG	p.G583G	RP1-1J6.2_ENST00000454626.1_RNA	NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	583					chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)	p.G583G(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	TCATGGAGGGCTTGACAGCCA	0.483			T	NUP98	AML*																																		Dom	yes		20	20q12-q13.1	7150	topoisomerase (DNA) I		L	1	Substitution - coding silent(1)	ovary(1)	20											108.0	90.0	96.0					20																	39744959		2203	4300	6503	39178373	SO:0001819	synonymous_variant	7150				CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.1749C>G	20.37:g.39744959C>G			39178373	A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Silent	SNP	ENST00000361337.2	37	CCDS13312.1	SNP	28	Broad																																																																																				0.483	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080397.2			Silent
PTGIS	5740	broad.mit.edu	37	20	48130883	48130883	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr20:48130883T>C	ENST00000244043.4	-	7	934	c.905A>G	c.(904-906)aAt>aGt	p.N302S	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	302					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)	p.N302S(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	GGCTTCAGGATTCTTGAGAAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	20											46.0	43.0	44.0					20																	48130883		2203	4300	6503	47564290	SO:0001583	missense	5740				CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.905A>G	20.37:g.48130883T>C	ENSP00000244043:p.Asn302Ser		47564290	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Missense_Mutation	SNP	ENST00000244043.4	37	CCDS13419.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	15.05	2.719096	0.48622	.	.	ENSG00000124212	ENST00000244043	T	0.01548	4.78	4.1	1.55	0.23275	.	0.419068	0.21653	N	0.071153	T	0.01421	0.0046	L	0.31664	0.95	0.29609	N	0.847074	P	0.36354	0.549	B	0.28385	0.089	T	0.44847	-0.9301	10	0.39692	T	0.17	-18.9557	9.6118	0.39668	0.0:0.0:0.3283:0.6717	.	302	Q16647	PTGIS_HUMAN	S	302	ENSP00000244043:N302S	ENSP00000244043:N302S	N	-	2	0	PTGIS	47564290	0.998000	0.40836	0.812000	0.32479	0.981000	0.71138	2.915000	0.48805	0.546000	0.28920	0.459000	0.35465	AAT		0.582	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080496.2			Missense_Mutation
ADAMTS1	9510	broad.mit.edu	37	21	28216753	28216753	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr21:28216753C>T	ENST00000284984.3	-	1	975	c.521G>A	c.(520-522)gGg>gAg	p.G174E		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	174					heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G174E(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		CGGCTTCTCCCCTGGGGCGGC	0.746											OREG0026151	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	21											5.0	5.0	5.0					21																	28216753		1946	3881	5827	27138624	SO:0001583	missense	9510			AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.521G>A	21.37:g.28216753C>T	ENSP00000284984:p.Gly174Glu	800	27138624	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	ENST00000284984.3	37	CCDS33524.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	0.450	-0.894056	0.02491	.	.	ENSG00000154734	ENST00000284984	T	0.61158	0.13	3.37	-1.51	0.08664	.	.	.	.	.	T	0.27278	0.0669	N	0.04959	-0.14	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.21965	-1.0230	9	0.11182	T	0.66	.	4.9308	0.13916	0.0:0.2135:0.3013:0.4852	.	174	Q9UHI8	ATS1_HUMAN	E	174	ENSP00000284984:G174E	ENSP00000284984:G174E	G	-	2	0	ADAMTS1	27138624	0.001000	0.12720	0.006000	0.13384	0.214000	0.24535	-1.365000	0.02587	-0.295000	0.08960	0.455000	0.32223	GGG		0.746	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2			Missense_Mutation
NUP210	23225	broad.mit.edu	37	3	13363792	13363792	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:13363792C>G	ENST00000254508.5	-	35	4898	c.4816G>C	c.(4816-4818)Gag>Cag	p.E1606Q		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1606					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.E1606Q(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					ATGAGGGTCTCTGGGTGCAAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	3											116.0	115.0	116.0					3																	13363792		2203	4300	6503	13338792	SO:0001583	missense	23225			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.4816G>C	3.37:g.13363792C>G	ENSP00000254508:p.Glu1606Gln		13338792	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	12.40	1.926862	0.34002	.	.	ENSG00000132182	ENST00000254508	T	0.05382	3.45	4.93	4.93	0.64822	.	0.133482	0.48767	D	0.000170	T	0.08492	0.0211	L	0.52905	1.665	0.18873	N	0.999982	B	0.22080	0.064	B	0.17098	0.017	T	0.14337	-1.0476	10	0.33940	T	0.23	-11.7691	13.6523	0.62318	0.0:1.0:0.0:0.0	.	1606	Q8TEM1	PO210_HUMAN	Q	1606	ENSP00000254508:E1606Q	ENSP00000254508:E1606Q	E	-	1	0	NUP210	13338792	0.987000	0.35691	0.015000	0.15790	0.019000	0.09904	3.953000	0.56699	2.273000	0.75805	0.655000	0.94253	GAG		0.612	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923		Missense_Mutation
UBP1	7342	broad.mit.edu	37	3	33481234	33481234	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:33481234C>A	ENST00000283629.3	-	1	636	c.107G>T	c.(106-108)aGc>aTc	p.S36I	UBP1_ENST00000447368.2_Missense_Mutation_p.S36I|UBP1_ENST00000283628.5_Missense_Mutation_p.S36I	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	36					angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S36I(1)		breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						GTACCTCATGCTGTAAGCGCC	0.662																																																1	Substitution - Missense(1)	ovary(1)	3											41.0	46.0	44.0					3																	33481234		2203	4300	6503	33456238	SO:0001583	missense	7342			AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.107G>T	3.37:g.33481234C>A	ENSP00000283629:p.Ser36Ile		33456238	Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	37	CCDS2659.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	16.13	3.036036	0.54896	.	.	ENSG00000153560	ENST00000283629;ENST00000447368;ENST00000283628;ENST00000456378	T;T;T;T	0.49432	2.16;2.13;2.16;0.78	3.93	3.93	0.45458	.	0.048098	0.85682	N	0.000000	T	0.28067	0.0692	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.06588	-1.0818	10	0.21540	T	0.41	-1.0068	15.746	0.77944	0.0:1.0:0.0:0.0	.	36;36	Q9NZI7-4;Q9NZI7	.;UBIP1_HUMAN	I	36	ENSP00000283629:S36I;ENSP00000395558:S36I;ENSP00000283628:S36I;ENSP00000401614:S36I	ENSP00000283628:S36I	S	-	2	0	UBP1	33456238	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	7.196000	0.77805	2.037000	0.60232	0.555000	0.69702	AGC		0.662	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	NM_014517		Missense_Mutation
ZBTB47	92999	broad.mit.edu	37	3	42705322	42705322	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:42705322C>G	ENST00000232974.6	+	5	2052	c.1771C>G	c.(1771-1773)Ctg>Gtg	p.L591V	ZBTB47_ENST00000505904.1_Missense_Mutation_p.L137V|ZBTB47_ENST00000457842.3_Missense_Mutation_p.L215V			Q9UFB7	ZBT47_HUMAN	zinc finger and BTB domain containing 47	591					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L591V(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.216)		CAAGTACCAGCTGCGGTCACA	0.547																																																1	Substitution - Missense(1)	ovary(1)	3											81.0	85.0	83.0					3																	42705322		2202	4300	6502	42680326	SO:0001583	missense	92999			AB033016	CCDS46805.1, CCDS46805.2	3p22.1	2013-01-08	2006-09-19	2006-09-19	ENSG00000114853	ENSG00000114853		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26955	protein-coding gene	gene with protein product			"""zinc finger protein 651"""	ZNF651		10574461	Standard	NM_145166		Approved	KIAA1190, DKFZp434N0615	uc003clu.2	Q9UFB7	OTTHUMG00000156207	ENST00000232974.6:c.1771C>G	3.37:g.42705322C>G	ENSP00000232974:p.Leu591Val		42680326	H7BXD3|Q6ZSY6|Q8WTY8|Q9ULN0	Missense_Mutation	SNP	ENST00000232974.6	37	CCDS46805.2	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764774	0.69878	.	.	ENSG00000114853	ENST00000232974;ENST00000542870;ENST00000457842;ENST00000505904	T;T;T	0.14766	2.48;2.48;2.48	4.48	4.48	0.54585	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.156175	0.44483	D	0.000451	T	0.42108	0.1188	M	0.83852	2.665	0.58432	D	0.999995	D	0.63880	0.993	D	0.76071	0.987	T	0.50482	-0.8823	10	0.72032	D	0.01	-15.6464	17.2242	0.86965	0.0:1.0:0.0:0.0	.	215	Q9UFB7	ZBT47_HUMAN	V	591;490;215;137	ENSP00000232974:L591V;ENSP00000411491:L215V;ENSP00000420968:L137V	ENSP00000232974:L591V	L	+	1	2	ZBTB47	42680326	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.676000	0.84012	2.061000	0.61500	0.555000	0.69702	CTG		0.547	ZBTB47-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343485.3	NM_145166		Missense_Mutation
COL7A1	1294	broad.mit.edu	37	3	48614332	48614332	+	Silent	SNP	G	G	A	rs201871749		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:48614332G>A	ENST00000328333.8	-	66	5696	c.5589C>T	c.(5587-5589)ggC>ggT	p.G1863G	COL7A1_ENST00000454817.1_Silent_p.G1863G|MIR711_ENST00000390201.1_RNA	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1863	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G1863G(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCCCAGAGGCGCCTGAATCTC	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		19104	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	3											81.0	89.0	87.0					3																	48614332		2203	4300	6503	48589336	SO:0001819	synonymous_variant	1294			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.5589C>T	3.37:g.48614332G>A			48589336	Q14054|Q16507	Silent	SNP	ENST00000328333.8	37	CCDS2773.1	SNP	38	Broad																																																																																				0.547	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		Silent
CELSR3	1951	broad.mit.edu	37	3	48699192	48699192	+	Silent	SNP	C	C	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:48699192C>T	ENST00000164024.4	-	1	1156	c.876G>A	c.(874-876)ggG>ggA	p.G292G	RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Silent_p.G292G	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	292					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.G292G(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGGGACGCGGCCCGGGGCGCT	0.726																																																1	Substitution - coding silent(1)	ovary(1)	3											16.0	21.0	20.0					3																	48699192		2165	4204	6369	48674196	SO:0001819	synonymous_variant	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.876G>A	3.37:g.48699192C>T			48674196	O75092	Silent	SNP	ENST00000164024.4	37	CCDS2775.1	SNP	26	Broad																																																																																				0.726	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		Silent
KIAA2018	205717	broad.mit.edu	37	3	113378850	113378850	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:113378850G>T	ENST00000478658.1	-	5	1696	c.1679C>A	c.(1678-1680)aCc>aAc	p.T560N	KIAA2018_ENST00000316407.4_Missense_Mutation_p.T560N|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	560						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.T560N(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						GCATGGGGTGGTGCTAGGTGG	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											179.0	177.0	178.0					3																	113378850		1985	4153	6138	114861540	SO:0001583	missense	205717			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.1679C>A	3.37:g.113378850G>T	ENSP00000420721:p.Thr560Asn		114861540	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	37	CCDS43133.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	11.39	1.625850	0.28889	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.15952	2.38;2.38	5.09	4.19	0.49359	.	0.282844	0.34133	N	0.004238	T	0.13756	0.0333	L	0.29908	0.895	0.46586	D	0.999112	P	0.35383	0.498	B	0.30572	0.117	T	0.03641	-1.1017	10	0.66056	D	0.02	-5.7351	15.2843	0.73816	0.0:0.141:0.859:0.0	.	560	Q68DE3	K2018_HUMAN	N	560	ENSP00000320794:T560N;ENSP00000420721:T560N	ENSP00000320794:T560N	T	-	2	0	KIAA2018	114861540	1.000000	0.71417	0.991000	0.47740	0.720000	0.41350	6.154000	0.71826	1.080000	0.41073	0.557000	0.71058	ACC		0.443	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		Missense_Mutation
IFT122	55764	broad.mit.edu	37	3	129195645	129195645	+	Splice_Site	SNP	G	G	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:129195645G>T	ENST00000348417.2	+	11	1224		c.e11+1		IFT122_ENST00000349441.2_Splice_Site|IFT122_ENST00000507564.1_Splice_Site|IFT122_ENST00000440957.2_Splice_Site|IFT122_ENST00000347300.2_Splice_Site|IFT122_ENST00000296266.3_Splice_Site|IFT122_ENST00000431818.2_Splice_Site|IFT122_ENST00000504021.1_Splice_Site	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122						camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)		p.?(1)		breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						GAGCAGAAAGGTAAGAGGCAG	0.512																																																1	Unknown(1)	ovary(1)	3											57.0	54.0	55.0					3																	129195645		2203	4300	6503	130678335	SO:0001630	splice_region_variant	55764			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.1147+1G>T	3.37:g.129195645G>T			130678335	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Splice_Site_SNP	SNP	ENST00000348417.2	37	CCDS3061.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717412	0.68844	.	.	ENSG00000163913	ENST00000347300;ENST00000296266;ENST00000507564;ENST00000454840;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957;ENST00000515783	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.27	0.94004	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IFT122	130678335	1.000000	0.71417	0.996000	0.52242	0.691000	0.40173	9.362000	0.97126	2.546000	0.85860	0.591000	0.81541	.		0.512	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262	Intron	Splice_Site_SNP
PLCH1	23007	broad.mit.edu	37	3	155211966	155211966	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:155211966A>C	ENST00000340059.7	-	16	2109	c.2110T>G	c.(2110-2112)Tgt>Ggt	p.C704G	PLCH1_ENST00000460012.1_Missense_Mutation_p.C686G|PLCH1_ENST00000494598.1_Missense_Mutation_p.C704G|PLCH1_ENST00000414191.1_Missense_Mutation_p.C686G|PLCH1_ENST00000447496.2_Missense_Mutation_p.C704G|PLCH1_ENST00000334686.6_Missense_Mutation_p.C686G	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	704	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.C686G(1)		NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			ACATAGCCACAATTGCCATTT	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											226.0	198.0	207.0					3																	155211966		2203	4300	6503	156694660	SO:0001583	missense	23007			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.2110T>G	3.37:g.155211966A>C	ENSP00000345988:p.Cys704Gly		156694660	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	CCDS46939.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	14.84	2.654760	0.47467	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49;0.49	5.09	5.09	0.68999	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.109460	0.64402	D	0.000004	T	0.66557	0.2801	M	0.81112	2.525	0.52501	D	0.999951	P;P;B	0.43701	0.778;0.815;0.074	P;P;B	0.50109	0.498;0.631;0.072	T	0.72776	-0.4191	10	0.87932	D	0	.	15.1962	0.73092	1.0:0.0:0.0:0.0	.	686;704;704	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	G	704;686;704;704;686;686	ENSP00000419100:C704G;ENSP00000417502:C686G;ENSP00000402759:C704G;ENSP00000345988:C704G;ENSP00000335469:C686G;ENSP00000412977:C686G	ENSP00000335469:C686G	C	-	1	0	PLCH1	156694660	1.000000	0.71417	0.902000	0.35471	0.461000	0.32589	4.400000	0.59709	2.054000	0.61138	0.533000	0.62120	TGT		0.398	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996		Missense_Mutation
BCHE	590	broad.mit.edu	37	3	165548495	165548495	+	Missense_Mutation	SNP	C	C	G	rs149045543		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:165548495C>G	ENST00000264381.3	-	2	493	c.327G>C	c.(325-327)atG>atC	p.M109I	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	109					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)	p.M109I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	TTGGGTTCCACATCTCTGATC	0.388																																																1	Substitution - Missense(1)	ovary(1)	3											90.0	95.0	94.0					3																	165548495		2203	4300	6503	167031189	SO:0001583	missense	590			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.327G>C	3.37:g.165548495C>G	ENSP00000264381:p.Met109Ile		167031189	A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	37	CCDS3198.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	18.79	3.699808	0.68501	.	.	ENSG00000114200	ENST00000264381	T	0.68903	-0.36	5.84	5.84	0.93424	Carboxylesterase, type B (1);	0.037330	0.85682	D	0.000000	T	0.75810	0.3900	M	0.64676	1.99	0.80722	D	1	D	0.52996	0.957	P	0.52672	0.706	T	0.77493	-0.2567	10	0.72032	D	0.01	.	19.1188	0.93353	0.0:1.0:0.0:0.0	.	109	P06276	CHLE_HUMAN	I	109	ENSP00000264381:M109I	ENSP00000264381:M109I	M	-	3	0	BCHE	167031189	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	5.843000	0.69424	2.751000	0.94390	0.655000	0.94253	ATG		0.388	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1			Missense_Mutation
MFN1	55669	broad.mit.edu	37	3	179096391	179096391	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:179096391T>C	ENST00000471841.1	+	14	1577	c.1451T>C	c.(1450-1452)cTt>cCt	p.L484P	MFN1_ENST00000263969.5_Missense_Mutation_p.L484P|MFN1_ENST00000280653.7_Intron	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	484					mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L484P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			AAGCCATTACTTCCAGCTGGT	0.308																																																1	Substitution - Missense(1)	ovary(1)	3											42.0	39.0	40.0					3																	179096391		2203	4300	6503	180579085	SO:0001583	missense	55669			AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.1451T>C	3.37:g.179096391T>C	ENSP00000420617:p.Leu484Pro		180579085	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	ENST00000471841.1	37	CCDS3228.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	20.1	3.935798	0.73442	.	.	ENSG00000171109	ENST00000471841;ENST00000263969	D;D	0.86627	-2.15;-2.15	5.16	5.16	0.70880	.	0.057832	0.64402	N	0.000001	D	0.93588	0.7953	M	0.83118	2.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94459	0.7674	10	0.72032	D	0.01	-15.5386	15.0006	0.71469	0.0:0.0:0.0:1.0	.	512;484	Q4AEJ4;Q8IWA4	.;MFN1_HUMAN	P	484	ENSP00000420617:L484P;ENSP00000263969:L484P	ENSP00000263969:L484P	L	+	2	0	MFN1	180579085	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.649000	0.83500	1.948000	0.56530	0.482000	0.46254	CTT		0.308	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927		Missense_Mutation
CCDC39	339829	broad.mit.edu	37	3	180349332	180349332	+	Silent	SNP	T	T	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:180349332T>C	ENST00000442201.2	-	14	2042	c.1923A>G	c.(1921-1923)agA>agG	p.R641R	CCDC39_ENST00000273654.4_Silent_p.R725R	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	641					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.R725R(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GAATTTCATATCTATTCTTCA	0.333																																																1	Substitution - coding silent(1)	ovary(1)	3											96.0	94.0	95.0					3																	180349332		1841	4093	5934	181832026	SO:0001819	synonymous_variant	339829			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1923A>G	3.37:g.180349332T>C			181832026	B4E2H1	Silent	SNP	ENST00000442201.2	37	CCDS46964.1	SNP	50	Broad																																																																																				0.333	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028		Silent
EPHB3	2049	broad.mit.edu	37	3	184290329	184290329	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr3:184290329C>A	ENST00000330394.2	+	3	673	c.221C>A	c.(220-222)cCc>cAc	p.P74H	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	74	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)	p.P74H(1)		breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			GCCATGAATCCCATCCGCACA	0.557																																																1	Substitution - Missense(1)	ovary(1)	3											65.0	60.0	62.0					3																	184290329		2203	4300	6503	185773023	SO:0001583	missense	2049			X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.221C>A	3.37:g.184290329C>A	ENSP00000332118:p.Pro74His		185773023	Q7Z740	Missense_Mutation	SNP	ENST00000330394.2	37	CCDS3268.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	26.0	4.697815	0.88830	.	.	ENSG00000182580	ENST00000330394	T	0.03717	3.83	5.53	5.53	0.82687	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.22126	0.0533	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00335	-1.1808	10	0.87932	D	0	.	18.4651	0.90752	0.0:1.0:0.0:0.0	.	74	P54753	EPHB3_HUMAN	H	74	ENSP00000332118:P74H	ENSP00000332118:P74H	P	+	2	0	EPHB3	185773023	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.783000	0.85696	2.591000	0.87537	0.655000	0.94253	CCC		0.557	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443		Missense_Mutation
HTT	3064	broad.mit.edu	37	4	3221924	3221924	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr4:3221924T>A	ENST00000355072.5	+	53	7403	c.7258T>A	c.(7258-7260)Tgg>Agg	p.W2420R		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2420					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.W2420R(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GAAGCTTGGATGGTCACCCAA	0.512																																																1	Substitution - Missense(1)	ovary(1)	4											131.0	132.0	131.0					4																	3221924		1954	4134	6088	3191722	SO:0001583	missense	3064			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.7258T>A	4.37:g.3221924T>A	ENSP00000347184:p.Trp2420Arg		3191722	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	t	26.0	4.695616	0.88830	.	.	ENSG00000197386	ENST00000355072	T	0.07021	3.23	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.29355	0.0731	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.01448	-1.1352	10	0.87932	D	0	.	15.7964	0.78412	0.0:0.0:0.0:1.0	.	2420	P42858	HD_HUMAN	R	2420	ENSP00000347184:W2420R	ENSP00000347184:W2420R	W	+	1	0	HTT	3191722	1.000000	0.71417	0.966000	0.40874	0.972000	0.66771	7.952000	0.87827	2.135000	0.66039	0.524000	0.50904	TGG		0.512	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111		Missense_Mutation
CNGA1	1259	broad.mit.edu	37	4	47938584	47938584	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr4:47938584G>A	ENST00000514170.1	-	11	2246	c.1927C>T	c.(1927-1929)Cga>Tga	p.R643*	CNGA1_ENST00000358519.4_Nonsense_Mutation_p.R643*|CNGA1_ENST00000402813.3_Nonsense_Mutation_p.R712*|CNGA1_ENST00000544810.1_Nonsense_Mutation_p.R643*|CNGA1_ENST00000420489.2_Nonsense_Mutation_p.R643*			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	643					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.R643*(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						GCCAAGATTCGGGCAAACCTG	0.428																																																1	Substitution - Nonsense(1)	ovary(1)	4											133.0	128.0	129.0					4																	47938584		1888	4112	6000	47633341	SO:0001587	stop_gained	1259			M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.1927C>T	4.37:g.47938584G>A	ENSP00000426862:p.Arg643*		47633341	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Nonsense_Mutation	SNP	ENST00000514170.1	37	CCDS43226.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.318310	0.95682	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489	.	.	.	4.77	3.87	0.44632	.	0.053822	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1109	0.53838	0.0:0.0:0.6899:0.3101	.	.	.	.	X	712;643;643;643;643	.	ENSP00000351320:R643X	R	-	1	2	CNGA1	47633341	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	3.084000	0.50143	2.352000	0.79861	0.491000	0.48974	CGA		0.428	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372070.2	NM_000087		Nonsense_Mutation
KIT	3815	broad.mit.edu	37	4	55570053	55570053	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr4:55570053T>G	ENST00000288135.5	+	5	1017	c.920T>G	c.(919-921)gTa>gGa	p.V307G		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	307	Ig-like C2-type 3.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACCTTGGAAGTAGTAGGTAAA	0.343		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0			4											151.0	148.0	149.0					4																	55570053		2203	4300	6503	55264810	SO:0001583	missense	3815	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.920T>G	4.37:g.55570053T>G	ENSP00000288135:p.Val307Gly		55264810	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	17.67	3.446207	0.63178	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	D;D	0.93763	-3.28;-3.28	5.91	5.91	0.95273	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.110360	0.39985	N	0.001218	D	0.96228	0.8770	M	0.83603	2.65	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.73708	0.981;0.918	D	0.96360	0.9265	10	0.87932	D	0	.	9.5759	0.39457	0.0:0.0843:0.0:0.9157	.	307;307	P10721-2;P10721	.;KIT_HUMAN	G	307	ENSP00000288135:V307G;ENSP00000390987:V307G	ENSP00000288135:V307G	V	+	2	0	KIT	55264810	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.359000	0.52292	2.263000	0.75096	0.528000	0.53228	GTA		0.343	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1			Missense_Mutation
METAP1	23173	broad.mit.edu	37	4	99960564	99960564	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr4:99960564A>C	ENST00000296411.6	+	5	514	c.380A>C	c.(379-381)cAg>cCg	p.Q127P	METAP1_ENST00000544031.1_Missense_Mutation_p.Q77P	NM_015143.2	NP_055958.2	P53582	MAP11_HUMAN	methionyl aminopeptidase 1	127					N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|phototransduction, visible light (GO:0007603)|platelet aggregation (GO:0070527)|protein initiator methionine removal (GO:0070084)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of translation (GO:0006417)|rhodopsin mediated signaling pathway (GO:0016056)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic ribosome (GO:0022626)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metalloaminopeptidase activity (GO:0070006)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(123;3.12e-07)		GGTACTTCTCAGATTAAATTA	0.353																																																0			4											139.0	130.0	133.0					4																	99960564		1815	4081	5896	100179587	SO:0001583	missense	23173			D42084	CCDS47110.1	4q23	2010-08-20			ENSG00000164024	ENSG00000164024	3.4.11.18		15789	protein-coding gene	gene with protein product	"""Peptidase M"""	610151				7788527, 12144506	Standard	NM_015143		Approved	KIAA0094, MetAP1A, MAP1A	uc003huf.4	P53582	OTTHUMG00000161231	ENST00000296411.6:c.380A>C	4.37:g.99960564A>C	ENSP00000296411:p.Gln127Pro		100179587	B4E2E6	Missense_Mutation	SNP	ENST00000296411.6	37	CCDS47110.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	14.64	2.596078	0.46318	.	.	ENSG00000164024	ENST00000296411;ENST00000544031	.	.	.	4.94	4.94	0.65067	Peptidase M24, structural domain (2);	0.000000	0.85682	D	0.000000	T	0.52435	0.1734	L	0.39514	1.22	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47471	-0.9115	8	.	.	.	-19.6124	14.7609	0.69604	1.0:0.0:0.0:0.0	.	127	P53582	AMPM1_HUMAN	P	127;77	.	.	Q	+	2	0	METAP1	100179587	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.270000	0.89880	2.081000	0.62600	0.528000	0.53228	CAG		0.353	METAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364237.1	NM_015143		Missense_Mutation
GUCY1B3	2983	broad.mit.edu	37	4	156723647	156723647	+	Silent	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr4:156723647C>G	ENST00000264424.8	+	10	1411	c.1329C>G	c.(1327-1329)gcC>gcG	p.A443A	GUCY1B3_ENST00000503520.1_Silent_p.A410A|GUCY1B3_ENST00000513437.1_Silent_p.A375A|GUCY1B3_ENST00000505154.1_Silent_p.A375A|GUCY1B3_ENST00000502959.1_Silent_p.A465A|GUCY1B3_ENST00000505764.1_Silent_p.A423A|GUCY1B3_ENST00000507146.1_Silent_p.A418A	NM_000857.2	NP_000848.1	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	443	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)	cytoplasm (GO:0005737)|guanylate cyclase complex, soluble (GO:0008074)|intracellular membrane-bounded organelle (GO:0043231)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.A443A(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		GAGAAGGAGCCATGAAGATCG	0.453																																																1	Substitution - coding silent(1)	ovary(1)	4											87.0	88.0	88.0					4																	156723647		2057	4205	6262	156943097	SO:0001819	synonymous_variant	2983			AF020340	CCDS47154.1, CCDS75203.1	4q31.3-q33	2008-03-18			ENSG00000061918	ENSG00000061918	4.6.1.2		4687	protein-coding gene	gene with protein product		139397		GUC1B3		1352257	Standard	XM_005262959		Approved	GC-SB3, GC-S-beta-1	uc003ipc.3	Q02153	OTTHUMG00000161698	ENST00000264424.8:c.1329C>G	4.37:g.156723647C>G			156943097	B7Z426|Q86WY5	Silent	SNP	ENST00000264424.8	37	CCDS47154.1	SNP	21	Broad																																																																																				0.453	GUCY1B3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365770.2			Silent
SLC45A2	51151	broad.mit.edu	37	5	33963864	33963864	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr5:33963864C>A	ENST00000296589.4	-	3	966	c.820G>T	c.(820-822)Gtt>Ttt	p.V274F	SLC45A2_ENST00000509381.1_Intron|SLC45A2_ENST00000342059.3_Missense_Mutation_p.V215F|SLC45A2_ENST00000345083.5_Intron|SLC45A2_ENST00000382102.3_Missense_Mutation_p.V274F	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	274					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.V274F(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						CCATTTTTAACTTTCTCGATA	0.433																																					Ovarian(31;380 859 8490 22203 49048)											1	Substitution - Missense(1)	ovary(1)	5											160.0	166.0	164.0					5																	33963864		2203	4300	6503	33999621	SO:0001583	missense	51151			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.820G>T	5.37:g.33963864C>A	ENSP00000296589:p.Val274Phe		33999621	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000296589.4	37	CCDS3901.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613037	0.46631	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	T;T;T;D	0.93076	-1.14;2.15;-1.14;-3.16	5.83	4.96	0.65561	Major facilitator superfamily domain, general substrate transporter (1);	0.631404	0.15035	N	0.284259	D	0.92990	0.7769	M	0.62723	1.935	0.80722	D	1	P;B	0.37101	0.582;0.024	B;B	0.41466	0.358;0.103	D	0.90969	0.4818	10	0.36615	T	0.2	-10.9971	15.2018	0.73142	0.1424:0.8576:0.0:0.0	.	274;274	Q9UMX9-4;Q9UMX9	.;S45A2_HUMAN	F	274;215;274;99	ENSP00000296589:V274F;ENSP00000341014:V215F;ENSP00000371534:V274F;ENSP00000424010:V99F	ENSP00000296589:V274F	V	-	1	0	SLC45A2	33999621	0.967000	0.33354	0.998000	0.56505	0.464000	0.32679	3.289000	0.51747	1.452000	0.47756	-0.309000	0.09137	GTT		0.433	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180		Missense_Mutation
NIM1K	167359	broad.mit.edu	37	5	43280291	43280291	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr5:43280291G>C	ENST00000512796.1	+	4	2270	c.771G>C	c.(769-771)ttG>ttC	p.L257F	NIM1_ENST00000326035.2_Missense_Mutation_p.L257F			Q8IY84	NIM1_HUMAN		257	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.L257F(1)									TCTGGGCCTTGGGGGTGCTTT	0.527																																																1	Substitution - Missense(1)	ovary(1)	5											88.0	79.0	82.0					5																	43280291		2203	4300	6503	43316048	SO:0001583	missense	167359																														ENST00000512796.1:c.771G>C	5.37:g.43280291G>C	ENSP00000420849:p.Leu257Phe		43316048	B3KVM1	Missense_Mutation	SNP	ENST00000512796.1	37	CCDS3943.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692650	0.68271	.	.	ENSG00000177453	ENST00000326035;ENST00000512796	T;T	0.27890	1.64;1.64	5.73	2.97	0.34412	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.50837	0.1639	M	0.78801	2.425	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.47018	-0.9149	10	0.87932	D	0	.	6.4503	0.21900	0.2533:0.0:0.6238:0.1229	.	257	Q8IY84	NIM1_HUMAN	F	257	ENSP00000313572:L257F;ENSP00000420849:L257F	ENSP00000313572:L257F	L	+	3	2	AC114947.1	43316048	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.537000	0.45702	0.350000	0.24002	0.655000	0.94253	TTG		0.527	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368017.1			Missense_Mutation
VCAN	1462	broad.mit.edu	37	5	82834549	82834549	+	Silent	SNP	A	A	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr5:82834549A>G	ENST00000265077.3	+	8	6292	c.5727A>G	c.(5725-5727)tcA>tcG	p.S1909S	VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000343200.5_Silent_p.S922S|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1909	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.S1909S(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TAGTGATTTCAGAGCGATTAG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	5											102.0	108.0	106.0					5																	82834549		2199	4299	6498	82870305	SO:0001819	synonymous_variant	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5727A>G	5.37:g.82834549A>G			82870305	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1	SNP	7	Broad																																																																																				0.413	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		Silent
PCDHGB4	8641	broad.mit.edu	37	5	140769422	140769422	+	Silent	SNP	G	G	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr5:140769422G>A	ENST00000519479.1	+	1	1971	c.1971G>A	c.(1969-1971)acG>acA	p.T657T	PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	657	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACTGCCACGTTGCACCTGG	0.662																																																0			5											77.0	83.0	81.0					5																	140769422		2153	4250	6403	140749606	SO:0001819	synonymous_variant	8641			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1971G>A	5.37:g.140769422G>A			140749606	O15099|Q2M267|Q9UN64	Silent	SNP	ENST00000519479.1	37	CCDS54928.1	SNP	40	Broad																																																																																				0.662	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736		Silent
AFAP1L1	134265	broad.mit.edu	37	5	148695844	148695844	+	Silent	SNP	C	C	A	rs375987421		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr5:148695844C>A	ENST00000296721.4	+	11	1343	c.1245C>A	c.(1243-1245)acC>acA	p.T415T	AFAP1L1_ENST00000515000.1_Silent_p.T415T	NM_001146337.1|NM_152406.2	NP_001139809.1|NP_689619.1	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	415						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T415T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTCCTCCACCGAGGAGGAGG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	5											60.0	62.0	62.0					5																	148695844		2203	4300	6503	148676037	SO:0001819	synonymous_variant	134265			AK094067	CCDS34274.1, CCDS54932.1	5q33.1	2013-01-10			ENSG00000157510	ENSG00000157510		"""Pleckstrin homology (PH) domain containing"""	26714	protein-coding gene	gene with protein product		614410					Standard	NM_152406		Approved	FLJ36748	uc003lqh.3	Q8TED9	OTTHUMG00000163441	ENST00000296721.4:c.1245C>A	5.37:g.148695844C>A			148676037	Q08AN4|Q08AN5|Q8IW82|Q8N8Z5|Q8N9Q4	Silent	SNP	ENST00000296721.4	37	CCDS34274.1	SNP	23	Broad																																																																																				0.632	AFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373443.1	NM_152406		Silent
PPARGC1B	133522	broad.mit.edu	37	5	149200070	149200070	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr5:149200070C>A	ENST00000309241.5	+	2	185	c.153C>A	c.(151-153)gaC>gaA	p.D51E	PPARGC1B_ENST00000394320.3_Missense_Mutation_p.D51E|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.D51E|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.D26E	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	51	Abolishes DNA transcriptional activity when missing.				actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.D51E(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			ATGCCAGCGACTTTGACTCGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	5											104.0	100.0	101.0					5																	149200070		2203	4300	6503	149180263	SO:0001583	missense	133522			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.153C>A	5.37:g.149200070C>A	ENSP00000312649:p.Asp51Glu		149180263	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	37	CCDS4298.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	c	22.2	4.251806	0.80135	.	.	ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	T;T;T;T	0.36699	1.4;1.24;1.31;1.53	5.76	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.54679	0.1873	M	0.63843	1.955	0.43000	D	0.994512	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.97110	0.996;0.999;0.999;0.991;1.0	T	0.55471	-0.8136	10	0.62326	D	0.03	-29.2543	11.2454	0.48993	0.0:0.8599:0.0:0.1401	.	30;30;51;51;51	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.;.;.;PRGC2_HUMAN;.	E	51;51;51;26	ENSP00000353638:D51E;ENSP00000377855:D51E;ENSP00000312649:D51E;ENSP00000384403:D26E	ENSP00000312649:D51E	D	+	3	2	PPARGC1B	149180263	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	1.857000	0.39399	2.724000	0.93272	0.651000	0.88453	GAC		0.587	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263		Missense_Mutation
TIGD6	81789	broad.mit.edu	37	5	149375621	149375621	+	Silent	SNP	A	A	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr5:149375621A>G	ENST00000296736.3	-	2	1065	c.291T>C	c.(289-291)acT>acC	p.T97T	TIGD6_ENST00000515406.2_Silent_p.T97T	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	97	HTH CENPB-type. {ECO:0000255|PROSITE- ProRule:PRU00583}.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T97T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TGACAGAACCAGTCACAAGAA	0.438																																																1	Substitution - coding silent(1)	ovary(1)	5											176.0	174.0	175.0					5																	149375621		2203	4300	6503	149355814	SO:0001819	synonymous_variant	81789			AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.291T>C	5.37:g.149375621A>G			149355814	B3KTZ8|Q96MQ4|Q9H0X7	Silent	SNP	ENST00000296736.3	37	CCDS4301.1	SNP	7	Broad																																																																																				0.438	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252324.1	NM_030953		Silent
OR10C1	442194	broad.mit.edu	37	6	29408712	29408712	+	Missense_Mutation	SNP	C	C	T	rs142718527	byFrequency	TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr6:29408712C>T	ENST00000444197.2	+	1	1630	c.920C>T	c.(919-921)aCg>aTg	p.T307M	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T307M(1)		NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						ATCCAGAAAACGGTGCCTATG	0.502																																																1	Substitution - Missense(1)	ovary(1)	6						C	MET/THR	2,3020		0,2,1509	87.0	92.0	91.0		920	2.2	0.4	6	dbSNP_134	91	0,5418		0,0,2709	no	missense	OR10C1	NM_013941.3	81	0,2,4218	TT,TC,CC		0.0,0.0662,0.0237	benign	307/313	29408712	2,8438	1511	2709	4220	29516691	SO:0001583	missense	442194				CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.920C>T	6.37:g.29408712C>T	ENSP00000419119:p.Thr307Met		29516691	Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	37	CCDS34364.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	0.366	-0.936656	0.02340	6.62E-4	0.0	ENSG00000206474	ENST00000444197	T	0.00051	8.81	3.44	2.16	0.27623	.	0.353536	0.20583	N	0.089488	T	0.00039	0.0001	N	0.21282	0.65	0.09310	N	0.999997	B	0.10296	0.003	B	0.04013	0.001	T	0.28427	-1.0044	10	0.39692	T	0.17	.	7.4689	0.27336	0.0:0.11:0.0:0.89	.	307	Q96KK4	O10C1_HUMAN	M	307	ENSP00000419119:T307M	ENSP00000419119:T307M	T	+	2	0	OR10C1	29516691	0.001000	0.12720	0.446000	0.26920	0.022000	0.10575	0.243000	0.18106	0.412000	0.25729	-0.312000	0.09012	ACG		0.502	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2			Missense_Mutation
PSORS1C2	170680	broad.mit.edu	37	6	31105965	31105965	+	Silent	SNP	G	G	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr6:31105965G>C	ENST00000259845.4	-	2	497	c.174C>G	c.(172-174)ccC>ccG	p.P58P	PSORS1C1_ENST00000547221.1_Intron|PSORS1C1_ENST00000259881.9_Intron|PSORS1C1_ENST00000481450.2_5'Flank	NM_014069.2	NP_054788.2	Q9UIG4	PS1C2_HUMAN	psoriasis susceptibility 1 candidate 2	58						extracellular region (GO:0005576)		p.P58P(1)		NS(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CAAAGAGAGGGGGTGCCCCTG	0.667																																																1	Substitution - coding silent(1)	ovary(1)	6											21.0	26.0	24.0					6																	31105965		1465	2674	4139	31213944	SO:0001819	synonymous_variant	170680			AB031480	CCDS4694.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204538	ENSG00000204538			17199	protein-coding gene	gene with protein product		613526	"""chromosome 6 open reading frame 17"""	C6orf17			Standard	NM_014069		Approved	SPR1	uc003nso.4	Q9UIG4	OTTHUMG00000031081	ENST00000259845.4:c.174C>G	6.37:g.31105965G>C			31213944	Q5STD0	Silent	SNP	ENST00000259845.4	37	CCDS4694.1	SNP	43	Broad																																																																																				0.667	PSORS1C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076115.3			Silent
CUL9	23113	broad.mit.edu	37	6	43174224	43174224	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr6:43174224C>T	ENST00000252050.4	+	26	5272	c.5188C>T	c.(5188-5190)Cgt>Tgt	p.R1730C	CUL9_ENST00000372647.2_Missense_Mutation_p.R1730C|CUL9_ENST00000354495.3_Missense_Mutation_p.R1620C|CUL9_ENST00000502937.1_3'UTR	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1730					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)	p.R1730C(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TGCCCTTGACCGTTTCTCCAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	6											98.0	94.0	95.0					6																	43174224		2203	4300	6503	43282202	SO:0001583	missense	23113			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5188C>T	6.37:g.43174224C>T	ENSP00000252050:p.Arg1730Cys		43282202	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	10.87	1.471546	0.26423	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.75367	-0.93;-0.93;-0.93	5.36	-0.618	0.11576	Cullin, N-terminal (1);Cullin homology (2);	0.872028	0.10570	N	0.659275	T	0.34861	0.0912	L	0.29908	0.895	0.35855	D	0.827037	B;B;B	0.18013	0.025;0.004;0.004	B;B;B	0.09377	0.004;0.002;0.002	T	0.04268	-1.0964	10	0.34782	T	0.22	-0.2176	2.1393	0.03771	0.104:0.2745:0.222:0.3994	.	1620;1730;1730	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	C	1730;1620;1730	ENSP00000252050:R1730C;ENSP00000346490:R1620C;ENSP00000361730:R1730C	ENSP00000252050:R1730C	R	+	1	0	CUL9	43282202	0.018000	0.18449	0.939000	0.37840	0.960000	0.62799	-0.163000	0.09997	-0.486000	0.06744	-0.189000	0.12847	CGT		0.542	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		Missense_Mutation
DOPEY1	23033	broad.mit.edu	37	6	83845596	83845596	+	Splice_Site	SNP	T	T	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr6:83845596T>C	ENST00000349129.2	+	20	3389	c.3129T>C	c.(3127-3129)aaT>aaC	p.N1043N	DOPEY1_ENST00000369739.3_Splice_Site_p.N1034N|DOPEY1_ENST00000237163.5_Splice_Site_p.N1024N	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1043					protein transport (GO:0015031)			p.N1043N(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CCTGCAGCAATGGTGAATAAC	0.358																																																1	Substitution - coding silent(1)	ovary(1)	6											54.0	52.0	53.0					6																	83845596		2203	4298	6501	83902315	SO:0001630	splice_region_variant	23033			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.3130+1T>C	6.37:g.83845596T>C			83902315	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Silent	SNP	ENST00000349129.2	37	CCDS4996.1	SNP	51	Broad																																																																																				0.358	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	Silent	Silent
PLEKHG1	57480	broad.mit.edu	37	6	151152657	151152657	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr6:151152657C>A	ENST00000358517.2	+	15	2621	c.2410C>A	c.(2410-2412)Ccc>Acc	p.P804T	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.P804T			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	804							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P804T(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		TCAGGCCACTCCCGATCATGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	6											116.0	113.0	114.0					6																	151152657		2203	4300	6503	151194350	SO:0001583	missense	57480			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.2410C>A	6.37:g.151152657C>A	ENSP00000351318:p.Pro804Thr		151194350	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	37	CCDS34552.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	2.258	-0.369949	0.05069	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.58506	0.33;0.33	5.3	-7.15	0.01521	.	0.986918	0.08310	N	0.965576	T	0.10035	0.0246	N	0.08118	0	0.09310	N	1	B;B;B	0.20887	0.049;0.002;0.002	B;B;B	0.19666	0.026;0.001;0.001	T	0.16689	-1.0394	10	0.27785	T	0.31	.	3.3573	0.07173	0.0977:0.3694:0.2723:0.2606	.	611;804;804	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	T	804	ENSP00000356297:P804T;ENSP00000351318:P804T	ENSP00000351318:P804T	P	+	1	0	PLEKHG1	151194350	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.296000	0.01142	-1.186000	0.02713	-0.320000	0.08662	CCC		0.507	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1			Missense_Mutation
SKAP2	8935	broad.mit.edu	37	7	26709751	26709751	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr7:26709751T>C	ENST00000345317.2	-	12	1361	c.1048A>G	c.(1048-1050)Aaa>Gaa	p.K350E	SKAP2_ENST00000539623.1_Missense_Mutation_p.K178E	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	350	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.K350E(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						ATGTAGGCTTTAGGCACCAAG	0.373																																																1	Substitution - Missense(1)	ovary(1)	7											115.0	103.0	107.0					7																	26709751		2203	4300	6503	26676276	SO:0001583	missense	8935				CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.1048A>G	7.37:g.26709751T>C	ENSP00000005587:p.Lys350Glu		26676276	A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	ENST00000345317.2	37	CCDS5400.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	24.1	4.498443	0.85069	.	.	ENSG00000005020	ENST00000345317;ENST00000539623;ENST00000535331	T;T	0.47869	0.83;0.83	5.34	5.34	0.76211	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.53465	0.1798	N	0.19112	0.55	0.58432	D	0.999999	P;D	0.63046	0.939;0.992	P;D	0.66979	0.735;0.948	T	0.59899	-0.7367	10	0.72032	D	0.01	-17.0857	15.3254	0.74157	0.0:0.0:0.0:1.0	.	335;350	B7Z5N4;O75563	.;SKAP2_HUMAN	E	350;178;335	ENSP00000005587:K350E;ENSP00000443593:K178E	ENSP00000005587:K350E	K	-	1	0	SKAP2	26676276	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.226000	0.72277	2.032000	0.59987	0.533000	0.62120	AAA		0.373	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214128.1			Missense_Mutation
TYW1	55253	broad.mit.edu	37	7	66532332	66532332	+	Missense_Mutation	SNP	C	C	G	rs377758713		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr7:66532332C>G	ENST00000359626.5	+	10	1380	c.1216C>G	c.(1216-1218)Cgc>Ggc	p.R406G		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	406					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)	p.R406G(1)		breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				TGAGAGCCATCGCTGCATGGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											162.0	145.0	151.0					7																	66532332		2203	4300	6503	66169767	SO:0001583	missense	55253			AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.1216C>G	7.37:g.66532332C>G	ENSP00000352645:p.Arg406Gly		66169767	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Missense_Mutation	SNP	ENST00000359626.5	37	CCDS5538.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631161	0.67015	.	.	ENSG00000198874	ENST00000359626	T	0.23552	1.9	4.36	4.36	0.52297	.	0.066845	0.64402	U	0.000009	T	0.41190	0.1148	M	0.88031	2.925	0.53005	D	0.999969	B	0.17852	0.024	B	0.29716	0.106	T	0.50224	-0.8853	10	0.72032	D	0.01	.	14.4239	0.67202	0.0:1.0:0.0:0.0	.	406	Q9NV66	TYW1_HUMAN	G	406	ENSP00000352645:R406G	ENSP00000352645:R406G	R	+	1	0	TYW1	66169767	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.761000	0.62243	1.972000	0.57404	0.508000	0.49915	CGC		0.413	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	NM_018264		Missense_Mutation
RSBN1L	222194	broad.mit.edu	37	7	77407993	77407993	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr7:77407993T>A	ENST00000334955.8	+	8	2076	c.2049T>A	c.(2047-2049)agT>agA	p.S683R	RSBN1L_ENST00000445288.1_Missense_Mutation_p.S413R	NM_198467.2	NP_940869.2	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	683						nucleus (GO:0005634)		p.S683R(1)		central_nervous_system(1)|endometrium(12)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CTGTATGCAGTTTAGCATGGC	0.388																																																1	Substitution - Missense(1)	ovary(1)	7											157.0	146.0	149.0					7																	77407993		1948	4158	6106	77245929	SO:0001583	missense	222194			AK124517	CCDS43607.1	7q21.11	2004-08-11			ENSG00000187257	ENSG00000187257			24765	protein-coding gene	gene with protein product						12477932	Standard	NM_198467		Approved	FLJ42526, FLJ45813, MGC71764	uc010ldt.1	Q6PCB5	OTTHUMG00000155517	ENST00000334955.8:c.2049T>A	7.37:g.77407993T>A	ENSP00000334040:p.Ser683Arg		77245929	C9K0P1|Q6ZS58|Q6ZVI9|Q86X48	Missense_Mutation	SNP	ENST00000334955.8	37	CCDS43607.1	SNP	60	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.41|14.41	2.526240|2.526240	0.44969|0.44969	.|.	.|.	ENSG00000187257|ENSG00000187257	ENST00000441514|ENST00000334955;ENST00000445288	.|.	.|.	.|.	5.84|5.84	3.38|3.38	0.38709|0.38709	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78227|0.78227	0.4250|0.4250	M|M	0.84082|0.84082	2.675|2.675	0.58432|0.58432	D|D	0.999994|0.999994	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.78368|0.78368	-0.2231|-0.2231	6|9	0.66056|0.87932	D|D	0.02|0	-14.2848|-14.2848	10.3105|10.3105	0.43706|0.43706	0.0:0.1949:0.0:0.8051|0.0:0.1949:0.0:0.8051	.|.	.|683	.|Q6PCB5	.|RSBNL_HUMAN	I|R	155|683;413	.|.	ENSP00000405231:F155I|ENSP00000334040:S683R	F|S	+|+	1|3	0|2	RSBN1L|RSBN1L	77245929|77245929	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	1.811000|1.811000	0.38942|0.38942	0.435000|0.435000	0.26365|0.26365	0.482000|0.482000	0.46254|0.46254	TTT|AGT		0.388	RSBN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340455.3	NM_198467		Missense_Mutation
ANKRD7	56311	broad.mit.edu	37	7	117879998	117879998	+	Missense_Mutation	SNP	A	A	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr7:117879998A>C	ENST00000265224.4	+	6	903	c.748A>C	c.(748-750)Aag>Cag	p.K250Q	ANKRD7_ENST00000433239.1_Missense_Mutation_p.K197Q|ANKRD7_ENST00000357099.4_Missense_Mutation_p.K270Q|ANKRD7_ENST00000477532.1_3'UTR|ANKRD7_ENST00000417525.1_Missense_Mutation_p.R195S	NM_019644.3	NP_062618.2	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	250					male gonad development (GO:0008584)	nucleus (GO:0005634)		p.K270Q(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)	29						CCATGGAAAGAAGAAACATGC	0.343																																																1	Substitution - Missense(1)	ovary(1)	7											97.0	92.0	94.0					7																	117879998		1880	4112	5992	117667234	SO:0001583	missense	56311			D78334	CCDS43638.1	7q31	2013-01-10			ENSG00000106013	ENSG00000106013		"""Ankyrin repeat domain containing"""	18588	protein-coding gene	gene with protein product	"""testis-specific ankyrin motif containing protein"""	610731				8812458	Standard	NM_019644		Approved	TSA806	uc003vji.3	Q92527	OTTHUMG00000156960	ENST00000265224.4:c.748A>C	7.37:g.117879998A>C	ENSP00000265224:p.Lys250Gln		117667234	B4DYF5|Q96QN1|Q9UDM3	Missense_Mutation	SNP	ENST00000265224.4	37	CCDS43638.1	SNP	9	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.81|12.81	2.048595|2.048595	0.36181|0.36181	.|.	.|.	ENSG00000106013|ENSG00000106013	ENST00000357099;ENST00000265224;ENST00000433239|ENST00000417525	T;T;T|T	0.42131|0.39406	0.99;1.07;0.98|1.08	4.14|4.14	-8.28|-8.28	0.01013|0.01013	.|.	.|.	.|.	.|.	.|.	T|T	0.29423|0.29423	0.0733|0.0733	L|L	0.46157|0.46157	1.445|1.445	0.09310|0.09310	N|N	1|1	B|.	0.26744|.	0.158|.	B|.	0.14578|.	0.011|.	T|T	0.28267|0.28267	-1.0049|-1.0049	9|7	0.49607|0.11485	T|T	0.09|0.65	0.48|0.48	8.566|8.566	0.33540|0.33540	0.2271:0.2533:0.5196:0.0|0.2271:0.2533:0.5196:0.0	.|.	250|.	Q92527|.	ANKR7_HUMAN|.	Q|S	270;250;197|195	ENSP00000349612:K270Q;ENSP00000265224:K250Q;ENSP00000388473:K197Q|ENSP00000395595:R195S	ENSP00000265224:K250Q|ENSP00000395595:R195S	K|R	+|+	1|3	0|2	ANKRD7|ANKRD7	117667234|117667234	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.034000|0.034000	0.12701|0.12701	-1.169000|-1.169000	0.03120|0.03120	-1.723000|-1.723000	0.01375|0.01375	0.454000|0.454000	0.30748|0.30748	AAG|AGA		0.343	ANKRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346826.1	NM_001077708		Missense_Mutation
SSMEM1	136263	broad.mit.edu	37	7	129856049	129856049	+	Silent	SNP	A	A	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr7:129856049A>G	ENST00000297819.3	+	3	525	c.474A>G	c.(472-474)gaA>gaG	p.E158E		NM_145268.3	NP_660311.1	Q8WWF3	SSMM1_HUMAN	serine-rich single-pass membrane protein 1	158						integral component of membrane (GO:0016021)		p.E158E(1)									CTAACTCAGAAGCCTCCTCGT	0.483																																																1	Substitution - coding silent(1)	ovary(1)	7											103.0	103.0	103.0					7																	129856049		2203	4300	6503	129643285	SO:0001819	synonymous_variant	136263			AK097635	CCDS5816.1	7q32.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000165120	ENSG00000165120			29580	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 45"""	C7orf45		12477932	Standard	NM_145268		Approved	FLJ40316	uc003vpp.3	Q8WWF3	OTTHUMG00000157844	ENST00000297819.3:c.474A>G	7.37:g.129856049A>G			129643285		Silent	SNP	ENST00000297819.3	37	CCDS5816.1	SNP	3	Broad																																																																																				0.483	SSMEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349768.1	NM_145268		Silent
CHPF2	54480	broad.mit.edu	37	7	150934848	150934848	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr7:150934848G>C	ENST00000035307.2	+	4	2913	c.1400G>C	c.(1399-1401)aGc>aCc	p.S467T	CHPF2_ENST00000495645.1_Missense_Mutation_p.S459T|MIR671_ENST00000390183.1_RNA|RP4-548D19.3_ENST00000607902.1_RNA	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	467					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.S467T(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						CGCAGGGTCAGCCTGCTGCGG	0.657																																																1	Substitution - Missense(1)	ovary(1)	7											30.0	35.0	33.0					7																	150934848		2198	4292	6490	150565781	SO:0001583	missense	54480			AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.1400G>C	7.37:g.150934848G>C	ENSP00000035307:p.Ser467Thr		150565781	B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	ENST00000035307.2	37	CCDS34779.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735437	0.49045	.	.	ENSG00000033100	ENST00000495645;ENST00000035307;ENST00000377851	T;T	0.15603	2.41;2.41	4.97	4.97	0.65823	.	0.040176	0.85682	D	0.000000	T	0.16811	0.0404	L	0.29908	0.895	0.45250	D	0.998254	P;P	0.42518	0.514;0.782	B;B	0.43301	0.415;0.242	T	0.03555	-1.1025	10	0.23302	T	0.38	-19.5202	17.4366	0.87554	0.0:0.0:1.0:0.0	.	467;459	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	T	459;467;467	ENSP00000418914:S459T;ENSP00000035307:S467T	ENSP00000035307:S467T	S	+	2	0	CHPF2	150565781	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.113000	0.64640	2.584000	0.87258	0.563000	0.77884	AGC		0.657	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348648.2	NM_019015		Missense_Mutation
GSR	2936	broad.mit.edu	37	8	30550572	30550572	+	Splice_Site	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr8:30550572C>G	ENST00000221130.5	-	8	886	c.796G>C	c.(796-798)Gta>Cta	p.V266L	GSR_ENST00000541648.1_Splice_Site_p.V266L|GSR_ENST00000546342.1_Intron|GSR_ENST00000537535.1_Intron|GSR_ENST00000414019.1_Splice_Site_p.V223L	NM_000637.3|NM_001195102.1|NM_001195103.1	NP_000628.2|NP_001182031.1|NP_001182032.1	P00390	GSHR_HUMAN	glutathione reductase	266					cell redox homeostasis (GO:0045454)|glutathione metabolic process (GO:0006749)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|glutathione-disulfide reductase activity (GO:0004362)|NADP binding (GO:0050661)	p.V266L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	23				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Flavin adenine dinucleotide(DB03147)|Glutathione(DB00143)	CTTCTAAGTACCTGCATATCA	0.488																																																1	Substitution - Missense(1)	ovary(1)	8											121.0	100.0	107.0					8																	30550572		2203	4300	6503	30670114	SO:0001630	splice_region_variant	2936				CCDS34877.1, CCDS56530.1, CCDS56531.1, CCDS56532.1	8p21.1	2012-10-02			ENSG00000104687	ENSG00000104687	1.8.1.7		4623	protein-coding gene	gene with protein product		138300					Standard	NM_000637		Approved		uc003xih.2	P00390	OTTHUMG00000163946	ENST00000221130.5:c.796-1G>C	8.37:g.30550572C>G			30670114	C8KIL8|C8KIL9|C8KIM0|D3DSV3|Q7Z5C9|Q9NP63	Missense_Mutation	SNP	ENST00000221130.5	37	CCDS34877.1	SNP	18	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.784|8.784	0.928991|0.928991	0.18131|0.18131	.|.	.|.	ENSG00000104687|ENSG00000104687	ENST00000520888|ENST00000221130;ENST00000414019;ENST00000541648	.|T;T;T	.|0.51574	.|0.7;0.7;0.7	4.72|4.72	4.72|4.72	0.59763|0.59763	.|Pyridine nucleotide-disulphide oxidoreductase, NAD-binding domain (1);Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.42404|0.42404	0.1201|0.1201	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|P	.|0.41131	.|0.739	.|P	.|0.47402	.|0.546	T|T	0.19353|0.19353	-1.0308|-1.0308	5|10	.|0.22109	.|T	.|0.4	-14.6704|-14.6704	15.168|15.168	0.72842|0.72842	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|266	.|P00390	.|GSHR_HUMAN	A|L	219|266;223;266	.|ENSP00000221130:V266L;ENSP00000390065:V223L;ENSP00000444559:V266L	.|ENSP00000221130:V266L	G|V	-|-	2|1	0|0	GSR|GSR	30670114|30670114	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.049000|0.049000	0.14656|0.14656	6.127000|6.127000	0.71642|0.71642	2.168000|2.168000	0.68352|0.68352	0.462000|0.462000	0.41574|0.41574	GGT|GTA		0.488	GSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376519.1		Missense_Mutation	Missense_Mutation
WHSC1L1	54904	broad.mit.edu	37	8	38194909	38194909	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr8:38194909C>G	ENST00000317025.8	-	4	1341	c.824G>C	c.(823-825)tGg>tCg	p.W275S	WHSC1L1_ENST00000433384.2_Missense_Mutation_p.W275S|WHSC1L1_ENST00000316985.3_Missense_Mutation_p.W275S|RP11-513D5.2_ENST00000527912.1_RNA|WHSC1L1_ENST00000527502.1_Missense_Mutation_p.W275S	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	275	PWWP 1. {ECO:0000255|PROSITE- ProRule:PRU00162}.				histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.W275S(1)		NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			CACCTTGGACCACACAAGATC	0.438			T	NUP98	AML																																		Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	1	Substitution - Missense(1)	ovary(1)	8											118.0	100.0	106.0					8																	38194909		2203	4300	6503	38314066	SO:0001583	missense	54904			AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.824G>C	8.37:g.38194909C>G	ENSP00000313983:p.Trp275Ser		38314066	B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Missense_Mutation	SNP	ENST00000317025.8	37	CCDS43729.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	20.6	4.009652	0.75046	.	.	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502;ENST00000316985;ENST00000529223	D;D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02;-2.02	5.71	5.71	0.89125	PWWP (3);	0.000000	0.45867	U	0.000328	D	0.94059	0.8096	M	0.92880	3.355	0.80722	D	1	D;D;P;D	0.62365	0.987;0.991;0.765;0.987	P;D;P;P	0.63381	0.867;0.914;0.545;0.878	D	0.94869	0.8028	10	0.87932	D	0	.	19.8635	0.96793	0.0:1.0:0.0:0.0	.	275;275;275;275	B7ZL11;Q9BZ95-2;Q9BZ95-3;Q9BZ95	.;.;.;NSD3_HUMAN	S	275;275;212;275;275;275	ENSP00000393284:W275S;ENSP00000313983:W275S;ENSP00000434730:W275S;ENSP00000313410:W275S;ENSP00000435422:W275S	ENSP00000313410:W275S	W	-	2	0	WHSC1L1	38314066	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.267000	0.78462	2.700000	0.92200	0.650000	0.86243	TGG		0.438	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381924.3	NM_023034		Missense_Mutation
PXDNL	137902	broad.mit.edu	37	8	52252182	52252182	+	Splice_Site	SNP	A	A	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr8:52252182A>G	ENST00000356297.4	-	21	4247		c.e21+1		PXDNL_ENST00000543296.1_Intron	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like						hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.?(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GAGAAAACAAACCTGCTCTCT	0.393																																																1	Unknown(1)	ovary(1)	8											126.0	122.0	123.0					8																	52252182		1888	4103	5991	52414735	SO:0001630	splice_region_variant	137902				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.4146+1T>C	8.37:g.52252182A>G			52414735	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Splice_Site_SNP	SNP	ENST00000356297.4	37	CCDS47855.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	5.997	0.367863	0.11352	.	.	ENSG00000147485	ENST00000522933;ENST00000356297	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0759	0.48032	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PXDNL	52414735	0.866000	0.29940	0.056000	0.19401	0.010000	0.07245	2.494000	0.45329	1.871000	0.54225	0.482000	0.46254	.		0.393	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	Intron	Splice_Site_SNP
CSMD3	114788	broad.mit.edu	37	8	113569127	113569127	+	Missense_Mutation	SNP	T	T	A			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr8:113569127T>A	ENST00000297405.5	-	25	4343	c.4099A>T	c.(4099-4101)Agt>Tgt	p.S1367C	CSMD3_ENST00000455883.2_Missense_Mutation_p.S1263C|CSMD3_ENST00000343508.3_Missense_Mutation_p.S1327C|CSMD3_ENST00000352409.3_Missense_Mutation_p.S1367C	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1367	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1367C(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCTTGGTCACTGATCTTGTAT	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - Missense(1)	ovary(1)	8											97.0	88.0	91.0					8																	113569127		2203	4299	6502	113638303	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4099A>T	8.37:g.113569127T>A	ENSP00000297405:p.Ser1367Cys		113638303	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	19.56	3.851247	0.71719	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24	4.97	4.97	0.65823	Complement control module (2);Sushi/SCR/CCP (3);	0.058585	0.64402	D	0.000003	T	0.72922	0.3521	L	0.38649	1.16	0.27244	N	0.959064	D;D;D	0.71674	0.998;0.998;0.998	D;D;P	0.67231	0.917;0.95;0.887	T	0.67409	-0.5678	10	0.49607	T	0.09	.	14.803	0.69929	0.0:0.0:0.0:1.0	.	1263;1367;1327	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	C	1327;1367;707;1263;1367	ENSP00000345799:S1327C;ENSP00000297405:S1367C;ENSP00000341558:S707C;ENSP00000412263:S1263C;ENSP00000343124:S1367C	ENSP00000297405:S1367C	S	-	1	0	CSMD3	113638303	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.215000	0.51169	2.085000	0.62840	0.533000	0.62120	AGT		0.438	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		Missense_Mutation
FREM1	158326	broad.mit.edu	37	9	14851551	14851551	+	Missense_Mutation	SNP	G	G	C	rs373156235		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr9:14851551G>C	ENST00000380880.3	-	6	1666	c.883C>G	c.(883-885)Cca>Gca	p.P295A	FREM1_ENST00000380881.4_Missense_Mutation_p.P296A|FREM1_ENST00000422223.2_Missense_Mutation_p.P295A|RNU6-1260P_ENST00000362944.1_RNA			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	295					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.P296A(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		GCAGCCTTTGGAATCTGATTC	0.433																																																1	Substitution - Missense(1)	ovary(1)	9											117.0	116.0	116.0					9																	14851551		1928	4132	6060	14841551	SO:0001583	missense	158326			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.883C>G	9.37:g.14851551G>C	ENSP00000370262:p.Pro295Ala		14841551	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.103182	0.94245	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.61742	0.08;0.12;0.12	6.11	6.11	0.99139	.	0.000000	0.85682	D	0.000000	D	0.82273	0.5001	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84225	0.0463	10	0.87932	D	0	-12.3082	20.7342	0.99715	0.0:0.0:1.0:0.0	.	295	Q5H8C1	FREM1_HUMAN	A	296;295;295	ENSP00000370263:P296A;ENSP00000412940:P295A;ENSP00000370262:P295A	ENSP00000370257:P298A	P	-	1	0	FREM1	14841551	1.000000	0.71417	0.981000	0.43875	0.968000	0.65278	9.476000	0.97823	2.906000	0.99361	0.655000	0.94253	CCA		0.433	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966		Missense_Mutation
PMPCA	23203	broad.mit.edu	37	9	139309088	139309088	+	Missense_Mutation	SNP	C	C	T	rs200013425		TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chr9:139309088C>T	ENST00000371717.3	+	5	530	c.521C>T	c.(520-522)cCc>cTc	p.P174L	PMPCA_ENST00000371720.1_Intron|PMPCA_ENST00000399219.3_Intron	NM_001282946.1|NM_015160.1	NP_001269875.1|NP_055975.1	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	174					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.P174L(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	14		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		GTTCTGCAGCCCCGGCTAACA	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		17753	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9											123.0	109.0	114.0					9																	139309088		2203	4300	6503	138428909	SO:0001583	missense	23203			D21064	CCDS35180.1, CCDS65192.1	9q34.3	2008-02-05	2003-06-13	2003-06-20	ENSG00000165688	ENSG00000165688			18667	protein-coding gene	gene with protein product		613036	"""inositol polyphosphate-5-phosphatase, 72 kD"""	INPP5E		8590280, 7788527	Standard	NM_015160		Approved	KIAA0123, Alpha-MPP	uc004chl.3	Q10713	OTTHUMG00000020926	ENST00000371717.3:c.521C>T	9.37:g.139309088C>T	ENSP00000360782:p.Pro174Leu		138428909	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	ENST00000371717.3	37	CCDS35180.1	SNP	22	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	33	5.230312	0.95207	.	.	ENSG00000165688	ENST00000371717	T	0.53206	0.63	5.67	5.67	0.87782	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.72220	0.3433	M	0.79805	2.47	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.75320	-0.3359	10	0.87932	D	0	.	18.7653	0.91869	0.0:1.0:0.0:0.0	.	174;174;174	B4DRK5;Q5SXM9;Q10713	.;.;MPPA_HUMAN	L	174	ENSP00000360782:P174L	ENSP00000360782:P174L	P	+	2	0	PMPCA	138428909	1.000000	0.71417	0.995000	0.50966	0.920000	0.55202	7.478000	0.81082	2.666000	0.90696	0.650000	0.86243	CCC		0.552	PMPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055054.1	NM_015160		Missense_Mutation
LONRF3	79836	broad.mit.edu	37	X	118109468	118109468	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chrX:118109468G>C	ENST00000371628.3	+	1	756	c.725G>C	c.(724-726)cGa>cCa	p.R242P	LONRF3_ENST00000422289.2_5'Flank|LONRF3_ENST00000304778.7_Missense_Mutation_p.R242P	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	242							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.R242P(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						GGCCCAGCGCGAGCGTCGCAA	0.692																																																1	Substitution - Missense(1)	ovary(1)	X											14.0	11.0	12.0					X																	118109468		2173	4245	6418	117993496	SO:0001583	missense	79836			AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.725G>C	X.37:g.118109468G>C	ENSP00000360690:p.Arg242Pro		117993496	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	ENST00000371628.3	37	CCDS35374.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521497	0.44866	.	.	ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628	T;T;T	0.59772	0.24;0.24;0.24	4.26	3.39	0.38822	Tetratricopeptide-like helical (1);	0.084010	0.48286	D	0.000182	T	0.64148	0.2572	L	0.55743	1.74	0.54753	D	0.999987	D;D	0.71674	0.998;0.994	P;D	0.64144	0.886;0.922	T	0.65352	-0.6189	10	0.62326	D	0.03	-3.9097	6.6626	0.23022	0.2826:0.0:0.7174:0.0	.	242;242	Q496Y0-2;Q496Y0	.;LONF3_HUMAN	P	242	ENSP00000360691:R242P;ENSP00000307732:R242P;ENSP00000360690:R242P	ENSP00000307732:R242P	R	+	2	0	LONRF3	117993496	0.477000	0.25909	0.612000	0.29024	0.476000	0.33039	0.560000	0.23500	2.122000	0.65172	0.529000	0.55759	CGA		0.692	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778		Missense_Mutation
Unknown	0	broad.mit.edu	37	X	0	0	+	IGR	SNP	C	C	T			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Invalid:failed_liftOver	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chrX:0C>T								None (None upstream) : PLCXD1 (192988 downstream)																							NNNNNNNNNN	0.0																																																0			X																																								148576687	SO:0001628	intergenic_variant	4110																															X.37:g.0C>T			148576687		Missense_Mutation	SNP		37		SNP	28	Broad																																																																																			0	0.000									Missense_Mutation
SLITRK4	139065	broad.mit.edu	37	X	142716610	142716610	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chrX:142716610A>G	ENST00000381779.4	-	2	2540	c.2315T>C	c.(2314-2316)aTa>aCa	p.I772T	SLITRK4_ENST00000356928.1_Missense_Mutation_p.I772T|SLITRK4_ENST00000338017.4_Missense_Mutation_p.I772T	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	772						integral component of membrane (GO:0016021)		p.I772T(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					ACTGACACCTATGCTATTATA	0.383																																																1	Substitution - Missense(1)	ovary(1)	X											135.0	127.0	130.0					X																	142716610		2203	4300	6503	142544276	SO:0001583	missense	139065			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.2315T>C	X.37:g.142716610A>G	ENSP00000371198:p.Ile772Thr		142544276	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	CCDS14679.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	7.932	0.740847	0.15642	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.52754	0.65;0.65;0.65	5.49	5.49	0.81192	.	0.126247	0.49916	U	0.000132	T	0.34483	0.0899	N	0.25647	0.755	0.51482	D	0.999924	B	0.06786	0.001	B	0.06405	0.002	T	0.12344	-1.0551	10	0.21014	T	0.42	-6.8707	13.3335	0.60503	1.0:0.0:0.0:0.0	.	772	Q8IW52	SLIK4_HUMAN	T	772	ENSP00000371198:I772T;ENSP00000349400:I772T;ENSP00000336627:I772T	ENSP00000336627:I772T	I	-	2	0	SLITRK4	142544276	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.146000	0.77373	1.831000	0.53308	0.486000	0.48141	ATA		0.383	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078		Missense_Mutation
MAMLD1	10046	broad.mit.edu	37	X	149639007	149639007	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-24-2288-01	TCGA-24-2288-10	g.chrX:149639007C>G	ENST00000370401.2	+	4	1472	c.1162C>G	c.(1162-1164)Ctg>Gtg	p.L388V	MAMLD1_ENST00000262858.5_Missense_Mutation_p.L388V|MAMLD1_ENST00000426613.2_Missense_Mutation_p.L363V|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000432680.2_Missense_Mutation_p.L363V			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	388					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.L315V(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					CAATGCCTTACTGTCAAGCAT	0.607																																																1	Substitution - Missense(1)	ovary(1)	X											115.0	109.0	111.0					X																	149639007		2203	4300	6503	149389665	SO:0001583	missense	10046			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1162C>G	X.37:g.149639007C>G	ENSP00000359428:p.Leu388Val		149389665	B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	CCDS14693.2	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	10.35	1.325428	0.24080	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613	T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95	5.62	1.82	0.25136	.	0.089033	0.48286	D	0.000183	T	0.80105	0.4562	M	0.66939	2.045	0.37590	D	0.920143	D;D;P;D	0.71674	0.998;0.998;0.465;0.998	D;D;B;D	0.77557	0.99;0.99;0.096;0.99	T	0.76626	-0.2890	9	.	.	.	-17.2232	4.8352	0.13460	0.1238:0.6233:0.1169:0.1359	.	350;363;363;388	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	V	350;388;363;388;363	ENSP00000359428:L388V;ENSP00000414517:L363V;ENSP00000262858:L388V;ENSP00000397438:L363V	.	L	+	1	2	MAMLD1	149389665	1.000000	0.71417	0.022000	0.16811	0.050000	0.14768	1.754000	0.38369	-0.056000	0.13221	0.600000	0.82982	CTG		0.607	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		Missense_Mutation
MSH2	4436	broad.mit.edu	37	2	47705450	47705450	+	Frame_Shift_Del	DEL	G	G	-			TCGA-24-2288-01	TCGA-24-2288-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-24-2288-01	TCGA-24-2288-10	g.chr2:47705450delG	ENST00000233146.2	+	14	2473	c.2250delG	c.(2248-2250)ttgfs	p.L750fs	MSH2_ENST00000543555.1_Frame_Shift_Del_p.L684fs|MSH2_ENST00000406134.1_Frame_Shift_Del_p.L750fs	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	750					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(2)|p.G751fs*12(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TAGATGAATTGGGAAGAGGAA	0.358			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	5	Whole gene deletion(2)|Unknown(2)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(3)|ovary(1)|prostate(1)	2											132.0	132.0	132.0					2																	47705450		2203	4300	6503	47558954	SO:0001589	frameshift_variant	4436	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.2250delG	2.37:g.47705450delG	ENSP00000233146:p.Leu750fs		47558954	B4E2Z2|O75488	Frame_Shift_Del	DEL	ENST00000233146.2	37	CCDS1834.1	DEL	47	Broad																																																																																				0.358	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250805.3			Frame_Shift_Del
