#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ATP8B3	148229	hgsc.bcm.edu	37	19	1783118	1783118	+	Missense_Mutation	SNP	C	C	A	rs537116654		TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr19:1783118C>A	ENST00000310127.6	-	29	4050	c.3812G>T	c.(3811-3813)cGg>cTg	p.R1271L	ATP8B3_ENST00000525591.1_Missense_Mutation_p.R1234L|ATP8B3_ENST00000539485.1_Missense_Mutation_p.R1281L	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1271					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTCCCCTCCGCAGAATTGT	0.557																																																0			19											73.0	73.0	73.0					19																	1783118		2049	4189	6238	1734118	SO:0001583	missense	148229			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3812G>T	19.37:g.1783118C>A	ENSP00000311336:p.Arg1271Leu		1734118	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	37	CCDS45901.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.71	2.318814	0.41096	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.60299	0.2;0.32;0.29	4.59	2.44	0.29823	.	0.331541	0.23830	N	0.044152	T	0.67646	0.2915	M	0.74467	2.265	0.32892	D	0.511954	D;D	0.61697	0.99;0.983	P;P	0.59357	0.856;0.699	T	0.73914	-0.3832	10	0.87932	D	0	.	7.5829	0.27976	0.0:0.7351:0.0:0.2649	.	1271;1234	O60423;Q7Z485	AT8B3_HUMAN;.	L	1271;1281;1234	ENSP00000311336:R1271L;ENSP00000443574:R1281L;ENSP00000437115:R1234L	ENSP00000311336:R1271L	R	-	2	0	ATP8B3	1734118	0.942000	0.31987	0.012000	0.15200	0.082000	0.17680	4.051000	0.57412	0.377000	0.24735	-0.291000	0.09656	CGG		0.557	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813		Missense_Mutation
ATP8B4	79895	hgsc.bcm.edu	37	15	50223422	50223422	+	Silent	SNP	G	G	A			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr15:50223422G>A	ENST00000284509.6	-	16	1677	c.1536C>T	c.(1534-1536)tcC>tcT	p.S512S	ATP8B4_ENST00000559829.1_Silent_p.S512S	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	512						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.S512S(1)		breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CTGGGGTCCGGGATTTAAAAA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	15											110.0	114.0	113.0					15																	50223422		2196	4295	6491	48010714	SO:0001819	synonymous_variant	79895			AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1536C>T	15.37:g.50223422G>A			48010714	Q9H727	Silent	SNP	ENST00000284509.6	37	CCDS32238.1	SNP	43	Baylor																																																																																				0.398	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		Silent
BIRC6	57448	hgsc.bcm.edu	37	2	32693060	32693060	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-1324-01	TCGA-25-1324-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr2:32693060G>A	ENST00000421745.2	+	28	5795	c.5661G>A	c.(5659-5661)tgG>tgA	p.W1887*		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1887					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.W1859*(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TCTTGCCTTGGGAAAGTGAAC	0.418																																					Pancreas(94;175 1509 16028 18060 45422)											1	Substitution - Nonsense(1)	ovary(1)	2											70.0	71.0	70.0					2																	32693060		2203	4300	6503	32546564	SO:0001587	stop_gained	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.5661G>A	2.37:g.32693060G>A	ENSP00000393596:p.Trp1887*		32546564	Q9ULD1	Nonsense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	47	13.049340	0.99715	.	.	ENSG00000115760	ENST00000421745	.	.	.	5.9	5.9	0.94986	.	0.341664	0.33092	N	0.005281	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	15.9683	0.79991	0.0:0.0:0.8573:0.1427	.	.	.	.	X	1887	.	ENSP00000393596:W1887X	W	+	3	0	BIRC6	32546564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.403000	0.79983	2.822000	0.97130	0.650000	0.86243	TGG		0.418	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		Nonsense_Mutation
LSMEM1	286006	hgsc.bcm.edu	37	7	112127076	112127076	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr7:112127076G>A	ENST00000312849.4	+	3	587	c.226G>A	c.(226-228)Gca>Aca	p.A76T	LSMEM1_ENST00000439068.2_Missense_Mutation_p.A76T|LSMEM1_ENST00000486022.1_3'UTR	NM_182597.2	NP_872403.1	Q8N8F7	LSME1_HUMAN	leucine-rich single-pass membrane protein 1	76						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.A76T(1)									TGTCAGCCTGGCACTGGTTTT	0.418																																																1	Substitution - Missense(1)	ovary(1)	7											175.0	166.0	169.0					7																	112127076		2203	4300	6503	111914312	SO:0001583	missense	286006			AK096894	CCDS5756.1	7q31.1	2013-03-08	2013-03-08	2013-03-08	ENSG00000181016	ENSG00000181016			22036	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 53"""	C7orf53			Standard	NM_182597		Approved	FLJ39575	uc011kmq.2	Q8N8F7	OTTHUMG00000155190	ENST00000312849.4:c.226G>A	7.37:g.112127076G>A	ENSP00000323304:p.Ala76Thr		111914312	Q49AR6	Missense_Mutation	SNP	ENST00000312849.4	37	CCDS5756.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.93	1.489672	0.26686	.	.	ENSG00000181016	ENST00000439068;ENST00000312849	.	.	.	4.97	3.01	0.34805	.	0.397620	0.24384	N	0.038993	T	0.31389	0.0795	N	0.17082	0.46	0.80722	D	1	B	0.10296	0.003	B	0.09377	0.004	T	0.10730	-1.0617	9	0.39692	T	0.17	-31.811	5.9935	0.19480	0.2345:0.0:0.7655:0.0	.	76	Q8N8F7	CG053_HUMAN	T	76	.	ENSP00000323304:A76T	A	+	1	0	C7orf53	111914312	0.977000	0.34250	0.885000	0.34714	0.575000	0.36095	1.821000	0.39041	1.324000	0.45282	0.655000	0.94253	GCA		0.418	LSMEM1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338716.2	NM_182597		Missense_Mutation
STKLD1	169436	hgsc.bcm.edu	37	9	136265635	136265635	+	Frame_Shift_Del	DEL	G	G	-			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr9:136265635delG	ENST00000371957.3	+	12	1283	c.1176delG	c.(1174-1176)ctgfs	p.L394fs	C9orf96_ENST00000371955.1_Frame_Shift_Del_p.L19fs	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		394							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.L437fs*11(1)		autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CCTGCTCCCTGCTGCTGCACC	0.667																																																1	Deletion - Frameshift(1)	ovary(1)	9											129.0	88.0	102.0					9																	136265635		2203	4300	6503	135255456	SO:0001589	frameshift_variant	169436																														ENST00000371957.3:c.1176delG	9.37:g.136265635delG	ENSP00000361025:p.Leu394fs		135255456	Q5T8U8|Q6ZMP6|Q6ZMQ5	Frame_Shift_Del	DEL	ENST00000371957.3	37	CCDS35169.1	DEL	46	Baylor																																																																																				0.667	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054855.1			Frame_Shift_Del
CAD	790	hgsc.bcm.edu	37	2	27459284	27459284	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr2:27459284C>T	ENST00000403525.1	+	25	4162	c.4018C>T	c.(4018-4020)Cgg>Tgg	p.R1340W	CAD_ENST00000264705.4_Missense_Mutation_p.R1403W			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.R1403W(1)		NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCTGGGGGCCGGCGTCTCTC	0.562																																																1	Substitution - Missense(1)	ovary(1)	2											81.0	79.0	79.0					2																	27459284		2203	4300	6503	27312788	SO:0001583	missense	790			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4018C>T	2.37:g.27459284C>T	ENSP00000384510:p.Arg1340Trp		27312788	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098321	0.76870	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.82344	-1.6;-1.6	5.03	4.14	0.48551	Methylglyoxal synthase-like domain (4);	0.054658	0.64402	D	0.000001	D	0.91768	0.7396	M	0.88704	2.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.982;0.987	D	0.93063	0.6476	10	0.87932	D	0	0.1163	13.7869	0.63115	0.1549:0.8451:0.0:0.0	.	1340;1403	F8VPD4;P27708	.;PYR1_HUMAN	W	1403;1340	ENSP00000264705:R1403W;ENSP00000384510:R1340W	ENSP00000264705:R1403W	R	+	1	2	CAD	27312788	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	4.197000	0.58413	1.216000	0.43427	-0.314000	0.08810	CGG		0.562	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1			Missense_Mutation
DPP4	1803	hgsc.bcm.edu	37	2	162851863	162851863	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr2:162851863C>A	ENST00000360534.3	-	24	2632	c.2072G>T	c.(2071-2073)aGa>aTa	p.R691I	DPP4_ENST00000491591.1_5'UTR	NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	691					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R691I(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	ATTTTCAGCTCTGCTCATGAC	0.333																																																1	Substitution - Missense(1)	ovary(1)	2											127.0	127.0	127.0					2																	162851863		2203	4300	6503	162560109	SO:0001583	missense	1803			M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.2072G>T	2.37:g.162851863C>A	ENSP00000353731:p.Arg691Ile		162560109	Q53TN1	Missense_Mutation	SNP	ENST00000360534.3	37	CCDS2216.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.25	3.583392	0.65992	.	.	ENSG00000197635	ENST00000360534	T	0.30448	1.53	5.74	5.74	0.90152	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.57007	0.2024	M	0.81179	2.53	0.80722	D	1	D	0.71674	0.998	D	0.70487	0.969	T	0.61058	-0.7139	10	0.87932	D	0	-19.6276	14.1223	0.65198	0.0:0.9285:0.0:0.0715	.	691	P27487	DPP4_HUMAN	I	691	ENSP00000353731:R691I	ENSP00000353731:R691I	R	-	2	0	DPP4	162560109	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.434000	0.59935	2.683000	0.91414	0.655000	0.94253	AGA		0.333	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255079.2			Missense_Mutation
EBF4	57593	hgsc.bcm.edu	37	20	2686893	2686893	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr20:2686893G>A	ENST00000609451.1	+	4	469	c.397G>A	c.(397-399)Gac>Aac	p.D133N	EBF4_ENST00000380648.4_Missense_Mutation_p.D129N			Q9BQW3	COE4_HUMAN	early B-cell factor 4	133					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D133N(1)									GCGTCTCATCGACTCCATGTC	0.597																																																1	Substitution - Missense(1)	ovary(1)	20											157.0	130.0	139.0					20																	2686893		692	1591	2283	2634893	SO:0001583	missense	57593			BC019106	CCDS46573.1	20p13	2008-10-23			ENSG00000088881	ENSG00000088881			29278	protein-coding gene	gene with protein product		609935				10718198	Standard	NM_001110514		Approved	KIAA1442, COE4, RP5-860F19.3, O/E-4	uc002wgt.4	Q9BQW3	OTTHUMG00000031709	ENST00000609451.1:c.397G>A	20.37:g.2686893G>A	ENSP00000477023:p.Asp133Asn		2634893	Q1MTP7|Q5JY53|Q9NUB6|Q9P2A6	Missense_Mutation	SNP	ENST00000609451.1	37		SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	33	5.287952	0.95517	.	.	ENSG00000088881	ENST00000380648;ENST00000342725	T;T	0.59224	0.28;0.28	4.86	4.86	0.63082	.	0.000000	0.53938	D	0.000057	T	0.76392	0.3981	M	0.78344	2.41	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.80034	-0.1551	10	0.87932	D	0	-16.6338	15.8433	0.78868	0.0:0.0:1.0:0.0	.	129	E9PEI2	.	N	129;133	ENSP00000370022:D129N;ENSP00000345030:D133N	ENSP00000345030:D133N	D	+	1	0	EBF4	2634893	1.000000	0.71417	0.971000	0.41717	0.954000	0.61252	9.869000	0.99810	2.399000	0.81585	0.591000	0.81541	GAC		0.597	EBF4-011	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471930.1	XM_938882		Missense_Mutation
FAAH	2166	hgsc.bcm.edu	37	1	46871724	46871724	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1324-01	TCGA-25-1324-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr1:46871724A>T	ENST00000243167.8	+	6	884	c.800A>T	c.(799-801)aAg>aTg	p.K267M	FAAH_ENST00000493735.1_3'UTR	NM_001441.2	NP_001432.2	O00519	FAAH1_HUMAN	fatty acid amide hydrolase	267					fatty acid catabolic process (GO:0009062)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)	acylglycerol lipase activity (GO:0047372)|carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|fatty acid amide hydrolase activity (GO:0017064)	p.K267M(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	22	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	AGTGGCCTGAAGGGCTGTGTC	0.612											OREG0013458	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											78.0	80.0	79.0					1																	46871724		2203	4300	6503	46644311	SO:0001583	missense	2166			U82535	CCDS535.1	1p35-p34	2008-02-05			ENSG00000117480	ENSG00000117480			3553	protein-coding gene	gene with protein product		602935				9122178	Standard	NM_001441		Approved	FAAH-1	uc001cpu.2	O00519	OTTHUMG00000007811	ENST00000243167.8:c.800A>T	1.37:g.46871724A>T	ENSP00000243167:p.Lys267Met	942	46644311	D3DQ19|Q52M86|Q5TDF8	Missense_Mutation	SNP	ENST00000243167.8	37	CCDS535.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.82	2.650914	0.47362	.	.	ENSG00000117480	ENST00000243167	T	0.53423	0.62	4.5	4.5	0.54988	Amidase signature domain (2);	0.898946	0.09739	N	0.762154	T	0.45135	0.1327	L	0.46157	1.445	0.42082	D	0.991253	B	0.23806	0.091	B	0.30029	0.11	T	0.36672	-0.9738	10	0.48119	T	0.1	-9.9131	10.1427	0.42744	1.0:0.0:0.0:0.0	.	267	O00519	FAAH1_HUMAN	M	267	ENSP00000243167:K267M	ENSP00000243167:K267M	K	+	2	0	FAAH	46644311	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.794000	0.38774	1.894000	0.54839	0.533000	0.62120	AAG		0.612	FAAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021443.1	NM_001441		Missense_Mutation
GABRA6	2559	hgsc.bcm.edu	37	5	161128737	161128737	+	Silent	SNP	T	T	C			TCGA-25-1324-01	TCGA-25-1324-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr5:161128737T>C	ENST00000274545.5	+	9	1753	c.1320T>C	c.(1318-1320)taT>taC	p.Y440Y	GABRA6_ENST00000523217.1_Silent_p.Y430Y			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	440					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.Y440Y(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	GGGTAGTTTATCTTTCCAAAG	0.418										TCGA Ovarian(5;0.080)																																						1	Substitution - coding silent(1)	ovary(1)	5											107.0	96.0	100.0					5																	161128737		2203	4300	6503	161061315	SO:0001819	synonymous_variant	2559				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.1320T>C	5.37:g.161128737T>C			161061315	A8K096|Q4VAV2	Silent	SNP	ENST00000274545.5	37	CCDS4356.1	SNP	50	Baylor																																																																																				0.418	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2			Silent
GK2	2712	hgsc.bcm.edu	37	4	80327979	80327979	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr4:80327979G>T	ENST00000358842.3	-	1	1393	c.1376C>A	c.(1375-1377)gCt>gAt	p.A459D		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)	p.A459D(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						TGCCATGGCAGCTCCTAGTGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	4											88.0	91.0	90.0					4																	80327979		2203	4300	6503	80547003	SO:0001583	missense	2712			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.1376C>A	4.37:g.80327979G>T	ENSP00000351706:p.Ala459Asp		80547003	Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	CCDS3585.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.39	2.522585	0.44866	.	.	ENSG00000196475	ENST00000358842	D	0.94862	-3.54	4.11	3.27	0.37495	Carbohydrate kinase, FGGY, C-terminal (1);	0.000000	0.85682	U	0.000000	D	0.97648	0.9229	H	0.96015	3.755	0.80722	D	1	D	0.67145	0.996	D	0.67231	0.95	D	0.97665	1.0163	10	0.87932	D	0	-28.0422	10.2311	0.43256	0.0996:0.0:0.9004:0.0	.	459	Q14410	GLPK2_HUMAN	D	459	ENSP00000351706:A459D	ENSP00000351706:A459D	A	-	2	0	GK2	80547003	1.000000	0.71417	1.000000	0.80357	0.397000	0.30659	3.303000	0.51858	1.322000	0.45245	0.585000	0.79938	GCT		0.473	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214		Missense_Mutation
GPR162	27239	hgsc.bcm.edu	37	12	6934716	6934716	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr12:6934716G>A	ENST00000311268.3	+	3	1722	c.935G>A	c.(934-936)tGc>tAc	p.C312Y	LEPREL2_ENST00000396725.2_RNA|LEPREL2_ENST00000251761.8_RNA|GPR162_ENST00000382315.3_Missense_Mutation_p.C8Y|GPR162_ENST00000428545.2_Missense_Mutation_p.C28Y|LEPREL2_ENST00000606935.1_RNA	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.C312Y(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						GTGCTGTGGTGCTCCATGGCA	0.667											OREG0021636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	12											50.0	38.0	42.0					12																	6934716		2202	4299	6501	6804977	SO:0001583	missense	27239			U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.935G>A	12.37:g.6934716G>A	ENSP00000311528:p.Cys312Tyr	637	6804977	Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	ENST00000311268.3	37	CCDS8563.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	29.5	5.015217	0.93404	.	.	ENSG00000250510	ENST00000311268;ENST00000428545;ENST00000382315	T;T;T	0.75260	1.38;-0.85;-0.92	4.89	4.89	0.63831	.	.	.	.	.	T	0.81034	0.4739	L	0.34521	1.04	0.58432	D	0.999994	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.996;0.998;0.998	D	0.83402	0.0023	9	0.87932	D	0	.	18.2545	0.90015	0.0:0.0:1.0:0.0	.	96;28;312	Q13513;Q16538-2;Q16538	.;.;GP162_HUMAN	Y	312;28;8	ENSP00000311528:C312Y;ENSP00000399670:C28Y;ENSP00000371752:C8Y	ENSP00000311528:C312Y	C	+	2	0	GPR162	6804977	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.538000	0.85594	0.462000	0.41574	TGC		0.667	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399478.1	NM_019858		Missense_Mutation
GPR50	9248	hgsc.bcm.edu	37	X	150349558	150349569	+	In_Frame_Del	DEL	CACCACTGGCCA	CACCACTGGCCA	-	rs377556761|rs199797606|rs68058591|rs200787393		TCGA-25-1324-01	TCGA-25-1324-10	CACCACTGGCCA	CACCACTGGCCA	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chrX:150349558_150349569delCACCACTGGCCA	ENST00000218316.3	+	2	1572_1583	c.1503_1514delCACCACTGGCCA	c.(1501-1515)cccaccactggccac>ccc	p.TTGH502del	AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	502	Pro-rich.		Missing (lower fasting circulating triglyceride levels). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8647286, ECO:0000269|Ref.2}.		cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)	p.T502_H505delTTGH(1)		breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					ACCCTAAACCCACCACTGGCCACATCAAGCCA	0.608																																																1	Deletion - In frame(1)	ovary(1)	X								1488,2015		315,617,241,554,290						2.6	0.0		dbSNP_130	100	2487,3842		404,1011,668,899,1033	no	coding	GPR50	NM_004224.3		719,1628,909,1453,1323	A1A1,A1R,A1,RR,R		39.2953,42.4779,40.4292				3975,5857				150100227	SO:0001651	inframe_deletion	9248			U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1503_1514delCACCACTGGCCA	X.37:g.150349558_150349569delCACCACTGGCCA	ENSP00000218316:p.Thr502_His505del		150100216	Q0VGG3|Q3ZAR0	In_Frame_Del	DEL	ENST00000218316.3	37	CCDS44012.1	DEL	21	Baylor																																																																																				0.608	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224		In_Frame_Del
GREB1	9687	hgsc.bcm.edu	37	2	11777870	11777870	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr2:11777870C>T	ENST00000381486.2	+	31	5675	c.5375C>T	c.(5374-5376)cCg>cTg	p.P1792L	GREB1_ENST00000234142.5_Missense_Mutation_p.P1792L|GREB1_ENST00000396123.1_Missense_Mutation_p.P790L	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1792						integral component of membrane (GO:0016021)		p.P1792L(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GCGGTCGTGCCGGCCCAGTAC	0.662																																					Ovarian(39;850 945 2785 23371 33093)											1	Substitution - Missense(1)	ovary(1)	2											51.0	58.0	55.0					2																	11777870		2110	4214	6324	11695321	SO:0001583	missense	9687				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.5375C>T	2.37:g.11777870C>T	ENSP00000370896:p.Pro1792Leu		11695321	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	CCDS42655.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671618	0.88348	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.25749	3.09;3.09;1.78	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.45994	0.1370	M	0.71036	2.16	0.80722	D	1	D	0.64830	0.994	P	0.56163	0.793	T	0.52668	-0.8545	10	0.87932	D	0	-29.308	17.7654	0.88476	0.0:1.0:0.0:0.0	.	1792	Q4ZG55	GREB1_HUMAN	L	1792;1792;790	ENSP00000370896:P1792L;ENSP00000234142:P1792L;ENSP00000379429:P790L	ENSP00000234142:P1792L	P	+	2	0	GREB1	11695321	1.000000	0.71417	0.949000	0.38748	0.748000	0.42578	7.328000	0.79160	2.186000	0.69663	0.557000	0.71058	CCG		0.662	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		Missense_Mutation
GRTP1	79774	hgsc.bcm.edu	37	13	114009663	114009663	+	Silent	SNP	G	G	A			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr13:114009663G>A	ENST00000375431.4	-	3	389	c.315C>T	c.(313-315)ccC>ccT	p.P105P	GRTP1-AS1_ENST00000419199.1_RNA|GRTP1_ENST00000326039.3_Silent_p.P27P|GRTP1-AS1_ENST00000423246.1_RNA|GRTP1_ENST00000375430.4_Silent_p.P105P	NM_024719.2	NP_078995.2	Q5TC63	GRTP1_HUMAN	growth hormone regulated TBC protein 1	105	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.P105P(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	14	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			CCTCCAGCCTGGGGTTTCTCT	0.667																																																1	Substitution - coding silent(1)	ovary(1)	13											85.0	77.0	79.0					13																	114009663		2203	4300	6503	113057664	SO:0001819	synonymous_variant	79774			AK026127	CCDS9534.2, CCDS66591.1, CCDS73606.1	13q34	2011-11-30			ENSG00000139835	ENSG00000139835			20310	protein-coding gene	gene with protein product						11564724	Standard	NM_001286732		Approved	FLJ22474, TBC1D6	uc001vtn.3	Q5TC63	OTTHUMG00000017381	ENST00000375431.4:c.315C>T	13.37:g.114009663G>A			113057664	B9A6K2|Q2M232|Q5TC64|Q66K26|Q6P659|Q8N528|Q9H695	Silent	SNP	ENST00000375431.4	37	CCDS9534.2	SNP	47	Baylor																																																																																				0.667	GRTP1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000045882.5	NM_024719		Silent
KCNA5	3741	hgsc.bcm.edu	37	12	5154733	5154734	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-25-1324-01	TCGA-25-1324-10	GC	GC	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr12:5154733_5154734delGC	ENST00000252321.3	+	1	1649_1650	c.1420_1421delGC	c.(1420-1422)gcafs	p.A474fs		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	474					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)	p.A474fs*62(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CTTCTGGTGGGCAGTGGTCACC	0.609																																																1	Deletion - Frameshift(1)	ovary(1)	12																																								5024995	SO:0001589	frameshift_variant	3741			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1420_1421delGC	12.37:g.5154733_5154734delGC	ENSP00000252321:p.Ala474fs		5024994	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Frame_Shift_Del	DEL	ENST00000252321.3	37	CCDS8536.1	DEL	42	Baylor																																																																																				0.609	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234		Frame_Shift_Del
CCDC180	100499483	hgsc.bcm.edu	37	9	100071845	100071845	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr9:100071845C>A	ENST00000357054.1	+	17	1703	c.768C>A	c.(766-768)agC>agA	p.S256R	CCDC180_ENST00000529487.1_Missense_Mutation_p.S117R|CCDC180_ENST00000395220.1_Missense_Mutation_p.S256R|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Missense_Mutation_p.S117R|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000411667.2_Missense_Mutation_p.S117R			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	256						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.S256R(1)									GGATGCACAGCCTCCCCAACG	0.547																																																1	Substitution - Missense(1)	ovary(1)	9											99.0	77.0	84.0					9																	100071845		2203	4300	6503	99111666	SO:0001583	missense	57653			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.768C>A	9.37:g.100071845C>A	ENSP00000349562:p.Ser256Arg		99111666	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	37		SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.28	1.591394	0.28357	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T;T	0.24908	2.62;1.83;2.65;2.27;2.65	4.71	1.64	0.23874	.	0.000000	0.45606	D	0.000347	T	0.26991	0.0661	L	0.60455	1.87	0.31405	N	0.676238	D;P;D;P	0.54397	0.966;0.911;0.966;0.911	P;P;P;P	0.51833	0.681;0.681;0.681;0.681	T	0.16719	-1.0393	10	0.21540	T	0.41	-16.4152	4.064	0.09851	0.0:0.59:0.1967:0.2133	.	117;256;117;256	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	R	256;256;117;117;140;117	ENSP00000349562:S256R;ENSP00000378646:S256R;ENSP00000364348:S117R;ENSP00000414000:S117R;ENSP00000434727:S117R	ENSP00000349562:S256R	S	+	3	2	C9orf174	99111666	1.000000	0.71417	0.996000	0.52242	0.187000	0.23431	0.713000	0.25794	1.127000	0.42034	0.561000	0.74099	AGC		0.547	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893		Missense_Mutation
KIR3DL3	115653	hgsc.bcm.edu	37	19	55239242	55239242	+	Missense_Mutation	SNP	C	C	T	rs367886097		TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr19:55239242C>T	ENST00000291860.1	+	4	539	c.521C>T	c.(520-522)gCg>gTg	p.A174V	KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000538269.1_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000402254.2_Intron	NM_153443.3	NP_703144.2	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3	174	Ig-like C2-type 2. {ECO:0000305}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A174V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(3)|prostate(1)|skin(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		CTCCACGATGCGGGTTCCCAG	0.547																																																1	Substitution - Missense(1)	ovary(1)	19						C	VAL/ALA	1,3955		0,1,1977	105.0	88.0	95.0		521	-2.8	0.0	19		95	0,6878		0,0,3439	no	missense	KIR3DL3	NM_153443.3	64	0,1,5416	TT,TC,CC		0.0,0.0253,0.0092	possibly-damaging	174/411	55239242	1,10833	1978	3439	5417	59931054	SO:0001583	missense	115653			AF352324	CCDS12903.1	19q13.4	2014-05-22			ENSG00000242019	ENSG00000242019		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16312	protein-coding gene	gene with protein product		610095				11513144	Standard	NM_153443		Approved	KIRC1, KIR3DL7, KIR44, CD158z	uc002qgu.1	Q8N743	OTTHUMG00000065884	ENST00000291860.1:c.521C>T	19.37:g.55239242C>T	ENSP00000291860:p.Ala174Val		59931054	A9PL62|A9PL64|A9PL65|A9PL66|A9PL67|A9PL68|A9PZV4|A9PZV7|A9PZV8|A9Q066|A9Q0R5|A9Q242|A9Q250|A9Q251|O95056|Q1X775|Q1X777|Q1X778|Q1X779|Q1X780|Q1X781|Q1X782|Q1X783|Q7Z7N4|Q8NHI2|Q8NHI3|Q9UEI4	Missense_Mutation	SNP	ENST00000291860.1	37	CCDS12903.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	N	10.75	1.439250	0.25900	2.53E-4	0.0	ENSG00000242019	ENST00000291860	T	0.02787	4.16	1.38	-2.75	0.05914	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.02807	0.0084	L	0.31664	0.95	0.09310	N	1	D	0.57571	0.98	P	0.46389	0.515	T	0.36407	-0.9749	9	0.87932	D	0	.	4.6375	0.12531	0.1785:0.2293:0.5921:0.0	.	174	Q8N743	KI3L3_HUMAN	V	174	ENSP00000291860:A174V	ENSP00000291860:A174V	A	+	2	0	KIR3DL3	59931054	0.007000	0.16637	0.000000	0.03702	0.000000	0.00434	-0.073000	0.11468	-0.758000	0.04690	-2.628000	0.00155	GCG		0.547	KIR3DL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141147.1	NM_153443		Missense_Mutation
KIR3DL1	3811	hgsc.bcm.edu	37	19	55315144	55315144	+	Intron	SNP	T	T	A			TCGA-25-1324-01	TCGA-25-1324-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr19:55315144T>A	ENST00000538269.1	+	2	61				KIR2DL4_ENST00000346587.4_Missense_Mutation_p.L13H|KIR3DL1_ENST00000541392.1_Intron|KIR2DL4_ENST00000357494.4_Missense_Mutation_p.L13H|KIR2DL4_ENST00000359085.4_Missense_Mutation_p.L13H|KIR2DL4_ENST00000345540.5_Missense_Mutation_p.L13H|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000463062.1_3'UTR|KIR2DL4_ENST00000396293.1_Missense_Mutation_p.L13H			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.L13H(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CTGGCATGTCTTGGTGAGTCC	0.577											OREG0003678	type=REGULATORY REGION|Gene=KIR2DL4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				1	Substitution - Missense(1)	ovary(1)	19											7.0	7.0	7.0					19																	55315144		1663	3606	5269	60006956	SO:0001627	intron_variant	3805			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-13845T>A	19.37:g.55315144T>A		1007	60006956	O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000538269.1	37		SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	11.80	1.746762	0.30955	.	.	ENSG00000189013	ENST00000359085;ENST00000345540;ENST00000357494;ENST00000396293;ENST00000346587;ENST00000396289	T;T;T;T;T;T	0.00569	6.56;6.58;6.52;6.63;6.75;6.59	1.07	-0.0402	0.13872	.	.	.	.	.	T	0.01765	0.0056	M	0.88105	2.93	0.23933	N	0.996425	D;D;D;D;P;D;P	0.71674	0.998;0.981;0.993;0.993;0.517;0.998;0.61	P;P;D;D;B;D;B	0.65987	0.77;0.765;0.93;0.919;0.004;0.94;0.018	T	0.42565	-0.9444	9	0.87932	D	0	.	2.9547	0.05872	0.0:0.3071:0.0:0.6929	.	13;13;13;13;13;13;13	Q99706;Q8N741;Q99706-4;Q99706-2;Q8N736;Q99706-3;Q8N738	KI2L4_HUMAN;.;.;.;.;.;.	H	13;13;13;13;13;11	ENSP00000351988:L13H;ENSP00000339634:L13H;ENSP00000350088:L13H;ENSP00000379588:L13H;ENSP00000345331:L13H;ENSP00000379584:L11H	ENSP00000339634:L13H	L	+	2	0	KIR2DL4	60006956	0.990000	0.36364	0.386000	0.26170	0.133000	0.20885	0.443000	0.21644	-0.045000	0.13468	0.113000	0.15668	CTT		0.577	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289		Missense_Mutation
KNTC1	9735	hgsc.bcm.edu	37	12	123057772	123057773	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-25-1324-01	TCGA-25-1324-10	AA	AA	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr12:123057772_123057773delAA	ENST00000333479.7	+	26	2400_2401	c.2223_2224delAA	c.(2221-2226)ataagafs	p.IR741fs	KNTC1_ENST00000450485.2_Frame_Shift_Del_p.IR704fs	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	741					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.I741fs*8(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AGAAGTTTATAAGAGTTTACAT	0.386																																																1	Deletion - Frameshift(1)	ovary(1)	12																																								121623726	SO:0001589	frameshift_variant	9735				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.2223_2224delAA	12.37:g.123057772_123057773delAA	ENSP00000328236:p.Ile741fs		121623725	A7E2C4|B3KSG2	Frame_Shift_Del	DEL	ENST00000333479.7	37	CCDS45002.1	DEL	13	Baylor																																																																																				0.386	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2			Frame_Shift_Del
MFSD11	79157	hgsc.bcm.edu	37	17	74763467	74763467	+	Splice_Site	SNP	G	G	C			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr17:74763467G>C	ENST00000588460.1	+	9	2724		c.e9-1		MFSD11_ENST00000590514.1_Splice_Site|MFSD11_ENST00000355954.3_Splice_Site|MFSD11_ENST00000336509.4_Splice_Site|MFSD11_ENST00000593181.1_Splice_Site|MFSD11_ENST00000586622.1_Splice_Site	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11							integral component of membrane (GO:0016021)		p.?(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						TGTGTTTACAGAAAAGTCTTT	0.308																																																1	Unknown(1)	ovary(1)	17											83.0	81.0	82.0					17																	74763467		2203	4300	6503	72275062	SO:0001630	splice_region_variant	79157			BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.683-1G>C	17.37:g.74763467G>C			72275062	O43442|Q9NXI5	Splice_Site_SNP	SNP	ENST00000588460.1	37	CCDS11750.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.2	4.113875	0.77210	.	.	ENSG00000092931	ENST00000336509;ENST00000355954	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1849	0.89790	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MFSD11	72275062	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	8.515000	0.90548	2.301000	0.77427	0.591000	0.81541	.		0.308	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451516.1	NM_024311	Intron	Splice_Site_SNP
MGA	23269	hgsc.bcm.edu	37	15	42052633	42052633	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1324-01	TCGA-25-1324-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr15:42052633G>A	ENST00000570161.1	+	19	7304	c.7304G>A	c.(7303-7305)cGg>cAg	p.R2435Q	MGA_ENST00000566586.1_Missense_Mutation_p.R2226Q|MGA_ENST00000219905.7_Missense_Mutation_p.R2435Q|MGA_ENST00000389936.4_Missense_Mutation_p.R2396Q|MGA_ENST00000545763.1_Missense_Mutation_p.R2226Q			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.R2484Q(4)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GAGCGGCGGCGGCGTGGTGAA	0.438																																																4	Substitution - Missense(4)	ovary(2)|large_intestine(1)|central_nervous_system(1)	15											109.0	111.0	110.0					15																	42052633		1900	4109	6009	39839925	SO:0001583	missense	23269			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7304G>A	15.37:g.42052633G>A	ENSP00000457035:p.Arg2435Gln		39839925	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	34	5.296335	0.95574	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.99722	-6.53;-6.53;-6.53	5.53	5.53	0.82687	.	0.000000	0.49305	D	0.000156	D	0.99711	0.9889	M	0.83223	2.63	0.31601	N	0.652706	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.997;0.978	D	0.97541	1.0086	10	0.87932	D	0	.	19.4485	0.94857	0.0:0.0:1.0:0.0	.	1051;2226;2435	B4DVS1;F5H7K2;E7ENI0	.;.;.	Q	2435;2396;2226	ENSP00000219905:R2435Q;ENSP00000374586:R2396Q;ENSP00000442467:R2226Q	ENSP00000219905:R2435Q	R	+	2	0	MGA	39839925	0.999000	0.42202	0.998000	0.56505	0.992000	0.81027	7.159000	0.77483	2.583000	0.87209	0.655000	0.94253	CGG		0.438	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		Missense_Mutation
MORC3	23515	hgsc.bcm.edu	37	21	37744777	37744777	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr21:37744777G>A	ENST00000400485.1	+	16	2690	c.2614G>A	c.(2614-2616)Gtt>Att	p.V872I	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	872					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)	p.V872I(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						GGCAACAGATGTTTCAACATC	0.368																																																1	Substitution - Missense(1)	ovary(1)	21											143.0	132.0	135.0					21																	37744777		1848	4103	5951	36666647	SO:0001583	missense	23515			AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.2614G>A	21.37:g.37744777G>A	ENSP00000383333:p.Val872Ile		36666647	A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	37	CCDS42924.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724388	0.68959	.	.	ENSG00000159256	ENST00000400485	D	0.87334	-2.24	5.6	4.71	0.59529	.	0.639196	0.16071	N	0.231017	T	0.81744	0.4887	L	0.47716	1.5	0.24601	N	0.993779	B	0.31435	0.323	B	0.25884	0.064	T	0.72975	-0.4128	10	0.37606	T	0.19	-9.8741	12.2016	0.54328	0.0784:0.0:0.9216:0.0	.	872	Q14149	MORC3_HUMAN	I	872	ENSP00000383333:V872I	ENSP00000383333:V872I	V	+	1	0	MORC3	36666647	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.333000	0.52090	2.629000	0.89072	0.491000	0.48974	GTT		0.368	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358		Missense_Mutation
MTMR3	8897	hgsc.bcm.edu	37	22	30416336	30416338	+	In_Frame_Del	DEL	GTC	GTC	-			TCGA-25-1324-01	TCGA-25-1324-10	GTC	GTC	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr22:30416336_30416338delGTC	ENST00000401950.2	+	17	3030_3032	c.2688_2690delGTC	c.(2686-2691)gggtct>ggt	p.S897del	MTMR3_ENST00000351488.3_In_Frame_Del_p.S897del|CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000323630.5_In_Frame_Del_p.S761del|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000406629.1_In_Frame_Del_p.S897del|MTMR3_ENST00000333027.3_In_Frame_Del_p.S897del	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	897					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.S897delS(2)		breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CCCAAGTGGGGTCTGTGGTGCAT	0.542																																																2	Deletion - In frame(2)	ovary(2)	22																																								28746338	SO:0001651	inframe_deletion	8897			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.2688_2690delGTC	22.37:g.30416336_30416338delGTC	ENSP00000384651:p.Ser897del		28746336	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	In_Frame_Del	DEL	ENST00000401950.2	37	CCDS13870.1	DEL	44	Baylor																																																																																				0.542	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090		In_Frame_Del
MTTP	4547	hgsc.bcm.edu	37	4	100540209	100540209	+	Nonsense_Mutation	SNP	G	G	T			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr4:100540209G>T	ENST00000265517.5	+	16	2499	c.2296G>T	c.(2296-2298)Gag>Tag	p.E766*	MTTP_ENST00000511045.1_Nonsense_Mutation_p.E793*|RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000457717.1_Nonsense_Mutation_p.E766*			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	766					cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)	p.E766*(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	AGGTGCAATGGAGTTTAGCTT	0.343																																																1	Substitution - Nonsense(1)	ovary(1)	4											179.0	182.0	181.0					4																	100540209		2203	4300	6503	100759232	SO:0001587	stop_gained	4547				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.2296G>T	4.37:g.100540209G>T	ENSP00000265517:p.Glu766*		100759232	A8K428|Q08AM4|Q6P5T3	Nonsense_Mutation	SNP	ENST00000265517.5	37	CCDS3651.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	42	9.794835	0.99266	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517	.	.	.	5.84	5.84	0.93424	.	0.051994	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-25.536	20.1346	0.98019	0.0:0.0:1.0:0.0	.	.	.	.	X	793;766;766	.	ENSP00000265517:E766X	E	+	1	0	MTTP	100759232	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.694000	0.91293	2.765000	0.95021	0.655000	0.94253	GAG		0.343	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3			Nonsense_Mutation
MYH8	4626	hgsc.bcm.edu	37	17	10300030	10300030	+	Silent	SNP	T	T	A			TCGA-25-1324-01	TCGA-25-1324-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr17:10300030T>A	ENST00000403437.2	-	32	4462	c.4368A>T	c.(4366-4368)ctA>ctT	p.L1456L	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1456					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TCCATTCTGATAGGACCTGAA	0.443									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																							0			17											104.0	107.0	106.0					17																	10300030		2203	4300	6503	10240755	SO:0001819	synonymous_variant	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4368A>T	17.37:g.10300030T>A			10240755	Q14910	Silent	SNP	ENST00000403437.2	37	CCDS11153.1	SNP	49	Baylor																																																																																				0.443	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		Silent
PCDH20	64881	hgsc.bcm.edu	37	13	61987446	61987446	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr13:61987446C>A	ENST00000409186.1	-	5	2891	c.786G>T	c.(784-786)gaG>gaT	p.E262D	PCDH20_ENST00000409204.4_Missense_Mutation_p.E262D			Q8N6Y1	PCD20_HUMAN	protocadherin 20	262	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.E235D(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		CATTCTCATTCTCCTCCACGT	0.522																																																1	Substitution - Missense(1)	ovary(1)	13											102.0	88.0	93.0					13																	61987446		2203	4300	6503	60885447	SO:0001583	missense	64881			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.786G>T	13.37:g.61987446C>A	ENSP00000386653:p.Glu262Asp		60885447	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	ENST00000409186.1	37	CCDS9442.2	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.79	2.044495	0.36085	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.51071	0.72;0.72	5.91	3.25	0.37280	.	0.000000	0.64402	D	0.000003	T	0.49966	0.1588	N	0.16368	0.405	0.53005	D	0.999969	D	0.76494	0.999	D	0.72625	0.978	T	0.36672	-0.9738	10	0.31617	T	0.26	.	13.7917	0.63146	0.0:0.8137:0.0:0.1863	.	262	A8K1K9	.	D	262;262;8	ENSP00000387250:E262D;ENSP00000386653:E262D	ENSP00000351500:E8D	E	-	3	2	PCDH20	60885447	1.000000	0.71417	0.999000	0.59377	0.964000	0.63967	1.553000	0.36255	0.133000	0.18654	-0.797000	0.03246	GAG		0.522	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843		Missense_Mutation
PDGFRB	5159	hgsc.bcm.edu	37	5	149512412	149512412	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1324-01	TCGA-25-1324-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr5:149512412T>G	ENST00000261799.4	-	7	1497	c.1028A>C	c.(1027-1029)tAc>tCc	p.Y343S		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	343	Ig-like C2-type 4.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)	p.Y343S(1)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGGCGGTGGGTAGGCCTCGAA	0.637			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	1	Substitution - Missense(1)	ovary(1)	5											53.0	41.0	45.0					5																	149512412		2203	4300	6503	149492605	SO:0001583	missense	5159			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.1028A>C	5.37:g.149512412T>G	ENSP00000261799:p.Tyr343Ser		149492605	B5A957|Q8N5L4	Missense_Mutation	SNP	ENST00000261799.4	37	CCDS4303.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	19.99	3.929415	0.73327	.	.	ENSG00000113721	ENST00000261799	T	0.64991	-0.13	5.7	5.7	0.88788	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.49305	D	0.000153	T	0.81522	0.4840	M	0.85373	2.75	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.84776	0.0770	10	0.87932	D	0	.	15.9765	0.80071	0.0:0.0:0.0:1.0	.	343;343	A8KAM8;P09619	.;PGFRB_HUMAN	S	343	ENSP00000261799:Y343S	ENSP00000261799:Y343S	Y	-	2	0	PDGFRB	149492605	1.000000	0.71417	1.000000	0.80357	0.272000	0.26649	6.954000	0.76001	2.172000	0.68678	0.533000	0.62120	TAC		0.637	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609		Missense_Mutation
PLA2G4F	255189	hgsc.bcm.edu	37	15	42442311	42442311	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1324-01	TCGA-25-1324-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr15:42442311A>G	ENST00000382396.4	-	10	1000	c.914T>C	c.(913-915)gTg>gCg	p.V305A	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.V305A			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	305					arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CCTCATTTCCACCTTCATGCT	0.597																																																0			15											89.0	79.0	83.0					15																	42442311		2203	4299	6502	40229603	SO:0001583	missense	255189				CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.914T>C	15.37:g.42442311A>G	ENSP00000371833:p.Val305Ala		40229603	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	37	CCDS32204.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	0.850	-0.739070	0.03088	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000357924;ENST00000443825	T;T	0.01397	4.94;4.98	4.7	2.79	0.32731	Lysophospholipase, catalytic domain (1);	0.463174	0.17642	N	0.167006	T	0.00666	0.0022	N	0.02916	-0.46	0.21740	N	0.999561	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47433	-0.9118	10	0.02654	T	1	-0.9438	8.4231	0.32712	0.1773:0.0:0.8227:0.0	.	92;305	A2RRC4;Q68DD2	.;PA24F_HUMAN	A	301;305;305;305;305	ENSP00000380442:V305A;ENSP00000371833:V305A	ENSP00000290497:V301A	V	-	2	0	PLA2G4F	40229603	1.000000	0.71417	0.998000	0.56505	0.644000	0.38419	3.457000	0.53007	0.503000	0.28060	-0.912000	0.02778	GTG		0.597	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600		Missense_Mutation
PROCR	10544	hgsc.bcm.edu	37	20	33764593	33764593	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1324-01	TCGA-25-1324-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr20:33764593T>C	ENST00000216968.4	+	4	776	c.694T>C	c.(694-696)Tgc>Cgc	p.C232R	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	232					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	CATCTTCCTGTGCACAGGTGG	0.567																																																0			20											111.0	87.0	95.0					20																	33764593		2203	4300	6503	33228254	SO:0001583	missense	10544			L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.694T>C	20.37:g.33764593T>C	ENSP00000216968:p.Cys232Arg		33228254	B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Missense_Mutation	SNP	ENST00000216968.4	37	CCDS13248.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	21.8	4.200931	0.79015	.	.	ENSG00000101000	ENST00000374477;ENST00000216968	T	0.08102	3.13	5.75	5.75	0.90469	.	0.398051	0.27258	N	0.020182	T	0.15652	0.0377	L	0.29908	0.895	0.58432	D	0.999998	D	0.71674	0.998	P	0.60789	0.879	T	0.00936	-1.1508	10	0.87932	D	0	-5.7026	12.4582	0.55716	0.0:0.0:0.0:1.0	.	232	Q9UNN8	EPCR_HUMAN	R	232	ENSP00000216968:C232R	ENSP00000216968:C232R	C	+	1	0	PROCR	33228254	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.094000	0.57721	2.201000	0.70794	0.533000	0.62120	TGC		0.567	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078843.3			Missense_Mutation
PTPRE	5791	hgsc.bcm.edu	37	10	129871627	129871627	+	Silent	SNP	C	C	T			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr10:129871627C>T	ENST00000254667.3	+	17	1770	c.1491C>T	c.(1489-1491)atC>atT	p.I497I	PTPRE_ENST00000419012.2_Silent_p.I497I|PTPRE_ENST00000306042.5_Silent_p.I439I	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	497	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.I497I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	ACTATTTCATCGCCACCCAGG	0.537																																					Colon(52;977 1184 20575 41685)											1	Substitution - coding silent(1)	ovary(1)	10											124.0	112.0	116.0					10																	129871627		2203	4300	6503	129761617	SO:0001819	synonymous_variant	5791			AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.1491C>T	10.37:g.129871627C>T			129761617	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Silent	SNP	ENST00000254667.3	37	CCDS7657.1	SNP	31	Baylor																																																																																				0.537	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050990.1			Silent
RELN	5649	hgsc.bcm.edu	37	7	103124188	103124188	+	Missense_Mutation	SNP	C	C	T	rs115035120	byFrequency	TCGA-25-1324-01	TCGA-25-1324-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr7:103124188C>T	ENST00000428762.1	-	62	10252	c.10093G>A	c.(10093-10095)Gtc>Atc	p.V3365I	RELN_ENST00000424685.2_Missense_Mutation_p.V3365I|RELN_ENST00000343529.5_Missense_Mutation_p.V3365I|RELN_ENST00000473945.1_5'UTR|RN7SKP86_ENST00000410454.1_RNA|CTB-107G13.1_ENST00000422488.1_RNA	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3365					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.V3365I(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCGTTGTTGACGCTGTATTGC	0.552													C|||	7	0.00139776	0.0008	0.0	5008	,	,		18342	0.0		0.001	False		,,,				2504	0.0051				NSCLC(146;835 1944 15585 22231 52158)											1	Substitution - Missense(1)	ovary(1)	7						C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	230.0	192.0	205.0		10093,10093	3.1	0.8	7	dbSNP_132	205	8,8592	6.4+/-24.3	0,8,4292	yes	missense,missense	RELN	NM_005045.3,NM_173054.2	29,29	0,8,6495	TT,TC,CC		0.093,0.0,0.0615	probably-damaging,probably-damaging	3365/3461,3365/3459	103124188	8,12998	2203	4300	6503	102911424	SO:0001583	missense	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.10093G>A	7.37:g.103124188C>T	ENSP00000392423:p.Val3365Ile		102911424	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	SNP	19	Baylor	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	13.12	2.142400	0.37825	0.0	9.3E-4	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	T;T;T	0.21932	1.98;1.98;1.98	5.87	3.1	0.35709	.	0.145479	0.45606	N	0.000351	T	0.28400	0.0702	L	0.43152	1.355	0.39557	D	0.969078	B;D	0.67145	0.347;0.996	B;P	0.60415	0.054;0.874	T	0.03597	-1.1021	10	0.22706	T	0.39	.	8.8648	0.35280	0.1229:0.7486:0.0:0.1285	.	3365;3365	P78509-2;P78509	.;RELN_HUMAN	I	3365;3365;3365;882;3365	ENSP00000392423:V3365I;ENSP00000345694:V3365I;ENSP00000388446:V3365I	ENSP00000345694:V3365I	V	-	1	0	RELN	102911424	0.747000	0.28283	0.782000	0.31804	0.737000	0.42083	1.384000	0.34396	0.393000	0.25203	0.655000	0.94253	GTC		0.552	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		Missense_Mutation
SCARF1	8578	hgsc.bcm.edu	37	17	1551754	1551754	+	5'Flank	SNP	C	C	G			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr17:1551754C>G	ENST00000263071.4	-	0	0				SCARF1_ENST00000348987.3_5'Flank|RILP_ENST00000301336.6_Missense_Mutation_p.E237D|SCARF1_ENST00000571272.1_5'Flank	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1						cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)	p.E237D(1)		cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		ACTGCCCTGCCTCCGAGGGGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	17											37.0	35.0	36.0					17																	1551754		2203	4300	6503	1498504	SO:0001631	upstream_gene_variant	83547			D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555		17.37:g.1551754C>G	Exception_encountered		1498504	A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	SNP	ENST00000263071.4	37	CCDS11007.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069212	0.36470	.	.	ENSG00000167705	ENST00000301336	T	0.24908	1.83	5.71	1.38	0.22167	.	0.567183	0.19103	N	0.122642	T	0.07638	0.0192	N	0.02916	-0.46	0.09310	N	1	B	0.17852	0.024	B	0.15870	0.014	T	0.38308	-0.9667	10	0.06625	T	0.88	-1.1488	5.7603	0.18196	0.1319:0.5431:0.2547:0.0704	.	237	Q96NA2	RILP_HUMAN	D	237	ENSP00000301336:E237D	ENSP00000301336:E237D	E	-	3	2	RILP	1498504	0.013000	0.17824	0.009000	0.14445	0.224000	0.24922	1.009000	0.29886	0.057000	0.16193	-0.165000	0.13383	GAG		0.647	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693		Missense_Mutation
RP1L1	94137	hgsc.bcm.edu	37	8	10464476	10464476	+	Missense_Mutation	SNP	G	G	C	rs554228490		TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr8:10464476G>C	ENST00000382483.3	-	4	7355	c.7132C>G	c.(7132-7134)Ctc>Gtc	p.L2378V		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2458					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.L2378V(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		AGACTTCCGAGTGCCTGGTCC	0.537																																																1	Substitution - Missense(1)	ovary(1)	8											109.0	114.0	113.0					8																	10464476		1922	4116	6038	10501886	SO:0001583	missense	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.7132C>G	8.37:g.10464476G>C	ENSP00000371923:p.Leu2378Val		10501886	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.029	-1.348080	0.01266	.	.	ENSG00000183638	ENST00000382483	T	0.04049	3.72	4.57	0.731	0.18277	.	1.356770	0.05761	N	0.604974	T	0.03263	0.0095	N	0.14661	0.345	0.09310	N	1	B	0.18741	0.03	B	0.11329	0.006	T	0.47898	-0.9081	10	0.21014	T	0.42	0.6952	5.9205	0.19080	0.0:0.4627:0.2905:0.2468	.	2378	A6NKC6	.	V	2378	ENSP00000371923:L2378V	ENSP00000371923:L2378V	L	-	1	0	RP1L1	10501886	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.277000	0.18734	0.023000	0.15187	-0.321000	0.08615	CTC		0.537	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			Missense_Mutation
RPA1	6117	hgsc.bcm.edu	37	17	1787116	1787116	+	Frame_Shift_Del	DEL	G	G	-			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr17:1787116delG	ENST00000254719.5	+	13	1362	c.1252delG	c.(1252-1254)gaafs	p.E418fs		NM_002945.3	NP_002936.1	P27694	RFA1_HUMAN	replication protein A1, 70kDa	418					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of cell proliferation (GO:0008284)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|DNA replication factor A complex (GO:0005662)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|single-stranded DNA binding (GO:0003697)	p.E418fs*5(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)	10						GTTTGACGCAGAAGGACAAGC	0.488								Nucleotide excision repair (NER)																																								1	Deletion - Frameshift(1)	ovary(1)	17											184.0	160.0	168.0					17																	1787116		2203	4300	6503	1733866	SO:0001589	frameshift_variant	6117			M63488	CCDS11014.1	17p13.3	2008-02-05	2002-08-29		ENSG00000132383	ENSG00000132383			10289	protein-coding gene	gene with protein product		179835	"""replication protein A1 (70kD)"""			8454588	Standard	NM_002945		Approved	REPA1, RPA70, HSSB, RF-A, RP-A	uc002fto.2	P27694	OTTHUMG00000090579	ENST00000254719.5:c.1252delG	17.37:g.1787116delG	ENSP00000254719:p.Glu418fs		1733866	A8K0Y9|Q59ES9	Frame_Shift_Del	DEL	ENST00000254719.5	37	CCDS11014.1	DEL	33	Baylor																																																																																				0.488	RPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207118.2	NM_002945		Frame_Shift_Del
SERPINA6	866	hgsc.bcm.edu	37	14	94780518	94780518	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr14:94780518C>G	ENST00000341584.3	-	2	614	c.468G>C	c.(466-468)ttG>ttC	p.L156F		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	156					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)	p.L156F(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	AATTCATAGCCAAGACCTCTG	0.473																																																1	Substitution - Missense(1)	ovary(1)	14											129.0	127.0	127.0					14																	94780518		2203	4300	6503	93850271	SO:0001583	missense	866			J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.468G>C	14.37:g.94780518C>G	ENSP00000342850:p.Leu156Phe		93850271	A8K456|Q7Z2Q9	Missense_Mutation	SNP	ENST00000341584.3	37	CCDS9924.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.402281	0.00195	.	.	ENSG00000170099	ENST00000341584	D	0.84146	-1.81	5.05	2.05	0.26809	Serpin domain (3);	0.707310	0.12662	N	0.449505	T	0.65101	0.2659	N	0.16567	0.415	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.52503	-0.8567	10	0.02654	T	1	.	2.0711	0.03614	0.3061:0.4231:0.112:0.1588	.	156	P08185	CBG_HUMAN	F	156	ENSP00000342850:L156F	ENSP00000342850:L156F	L	-	3	2	SERPINA6	93850271	0.002000	0.14202	0.002000	0.10522	0.004000	0.04260	0.081000	0.14823	0.699000	0.31761	0.655000	0.94253	TTG		0.473	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413065.1	NM_001756		Missense_Mutation
SLC25A46	91137	hgsc.bcm.edu	37	5	110097160	110097160	+	Missense_Mutation	SNP	C	C	A	rs374899270		TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr5:110097160C>A	ENST00000355943.3	+	8	1061	c.935C>A	c.(934-936)gCt>gAt	p.A312D	SLC25A46_ENST00000509432.1_Missense_Mutation_p.A99D|SLC25A46_ENST00000513807.1_Missense_Mutation_p.A150D|SLC25A46_ENST00000509442.2_Missense_Mutation_p.A221D|SLC25A46_ENST00000513706.1_3'UTR|SLC25A46_ENST00000504098.1_Missense_Mutation_p.A166D|SLC25A46_ENST00000447245.2_Missense_Mutation_p.A231D	NM_138773.1	NP_620128.1	Q96AG3	S2546_HUMAN	solute carrier family 25, member 46	312					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10		all_cancers(142;0.00203)|all_epithelial(76;4.52e-05)|Prostate(80;0.0115)|Colorectal(57;0.0676)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;2.58e-09)|Epithelial(69;7.29e-08)|all cancers(49;9.35e-06)|COAD - Colon adenocarcinoma(37;0.211)		ATGTTGGATGCTTATTTTCCA	0.408																																																0			5											272.0	265.0	268.0					5																	110097160		2202	4300	6502	110125059	SO:0001583	missense	91137			BC017169	CCDS4100.1	5q22.1	2013-05-22			ENSG00000164209	ENSG00000164209		"""Solute carriers"""	25198	protein-coding gene	gene with protein product		610826				1651562, 1651563, 16949250	Standard	NM_138773		Approved		uc003koz.3	Q96AG3	OTTHUMG00000128794	ENST00000355943.3:c.935C>A	5.37:g.110097160C>A	ENSP00000348211:p.Ala312Asp		110125059	A8K2F2|B3KRE6|B4DTA3|D3DSZ6|D6R9W7|Q04197	Missense_Mutation	SNP	ENST00000355943.3	37	CCDS4100.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.43	1.347455	0.24426	.	.	ENSG00000164209	ENST00000513807;ENST00000509442;ENST00000355943;ENST00000514046;ENST00000447245;ENST00000504098;ENST00000509432	T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	5.87	5.87	0.94306	Mitochondrial carrier domain (2);	0.144445	0.64402	D	0.000008	T	0.61261	0.2333	N	0.12182	0.205	0.58432	D	0.999994	B;B	0.21688	0.059;0.016	B;B	0.23275	0.045;0.027	T	0.57481	-0.7804	10	0.13470	T	0.59	-10.7916	14.9748	0.71264	0.1426:0.8574:0.0:0.0	.	221;312	B4DY98;Q96AG3	.;S2546_HUMAN	D	150;221;312;166;231;166;99	ENSP00000421134:A150D;ENSP00000424136:A221D;ENSP00000348211:A312D;ENSP00000399717:A231D;ENSP00000425708:A166D;ENSP00000426604:A99D	ENSP00000348211:A312D	A	+	2	0	SLC25A46	110125059	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.200000	0.65158	2.775000	0.95449	0.650000	0.86243	GCT		0.408	SLC25A46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250721.5	NM_138773		Missense_Mutation
SVIL	6840	hgsc.bcm.edu	37	10	29822372	29822372	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1324-01	TCGA-25-1324-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr10:29822372T>G	ENST00000355867.4	-	8	1676	c.924A>C	c.(922-924)gaA>gaC	p.E308D	SVIL_ENST00000375400.3_Intron|SVIL_ENST00000375398.2_Missense_Mutation_p.E308D	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	308					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TCACCAATTTTTCTCTAACTT	0.453																																																0			10											41.0	40.0	41.0					10																	29822372		2203	4300	6503	29862378	SO:0001583	missense	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.924A>C	10.37:g.29822372T>G	ENSP00000348128:p.Glu308Asp		29862378	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	CCDS7164.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	22.6	4.314822	0.81358	.	.	ENSG00000197321	ENST00000375398;ENST00000355867	T;T	0.50813	0.73;0.73	5.85	-0.407	0.12385	.	0.062087	0.64402	D	0.000009	T	0.61311	0.2337	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.59204	-0.7498	9	.	.	.	-24.302	10.5768	0.45231	0.0:0.6934:0.0:0.3066	.	308	O95425	SVIL_HUMAN	D	308	ENSP00000364547:E308D;ENSP00000348128:E308D	.	E	-	3	2	SVIL	29862378	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	1.036000	0.30228	-0.050000	0.13356	0.533000	0.62120	GAA		0.453	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1			Missense_Mutation
TAF6	6878	hgsc.bcm.edu	37	7	99709614	99709614	+	Silent	SNP	C	C	A			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr7:99709614C>A	ENST00000344095.4	-	8	1254	c.729G>T	c.(727-729)ctG>ctT	p.L243L	TAF6_ENST00000418432.2_Silent_p.L167L|TAF6_ENST00000472509.1_Silent_p.L300L|TAF6_ENST00000497233.1_5'Flank|TAF6_ENST00000437822.2_Silent_p.L280L|TAF6_ENST00000452041.1_Silent_p.L243L|TAF6_ENST00000453269.2_Silent_p.L243L	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	243					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAATGCTTTGCAGGGCTTCCT	0.612																																																0			7											55.0	48.0	50.0					7																	99709614		2203	4300	6503	99547550	SO:0001819	synonymous_variant	6878				CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.729G>T	7.37:g.99709614C>A			99547550	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Silent	SNP	ENST00000344095.4	37	CCDS5686.1	SNP	25	Baylor																																																																																				0.612	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641		Silent
TFCP2L1	29842	hgsc.bcm.edu	37	2	122038813	122038813	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr2:122038813C>T	ENST00000263707.5	-	2	194	c.97G>A	c.(97-99)Gaa>Aaa	p.E33K		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	33	Mediate transcriptional repression.				cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.E33K(1)		cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					AGCTGGGGTTCCTCCTGCTTG	0.637																																																1	Substitution - Missense(1)	ovary(1)	2											80.0	86.0	84.0					2																	122038813		2203	4300	6503	121755283	SO:0001583	missense	29842			AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.97G>A	2.37:g.122038813C>T	ENSP00000263707:p.Glu33Lys		121755283	Q4ZG43	Missense_Mutation	SNP	ENST00000263707.5	37	CCDS2134.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030814	0.93575	.	.	ENSG00000115112	ENST00000263707	T	0.20200	2.09	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.30541	0.0768	L	0.55834	1.745	0.80722	D	1	B;B	0.31318	0.046;0.319	B;B	0.39935	0.098;0.314	T	0.04723	-1.0931	10	0.41790	T	0.15	.	18.7572	0.91837	0.0:1.0:0.0:0.0	.	33;33	Q5JV87;Q9NZI6	.;TF2L1_HUMAN	K	33	ENSP00000263707:E33K	ENSP00000263707:E33K	E	-	1	0	TFCP2L1	121755283	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.023000	0.70848	2.429000	0.82318	0.655000	0.94253	GAA		0.637	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338539.1	NM_014553		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578555	7578555	+	Splice_Site	SNP	C	C	T			TCGA-25-1324-01	TCGA-25-1324-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	Capture	Sanger_PCR_WGA	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr17:7578555C>T	ENST00000269305.4	-	5	565		c.e5-1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(39)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGGGAGTACTGTAGGAAGA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Unknown(39)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	ovary(9)|pancreas(6)|bone(5)|upper_aerodigestive_tract(4)|liver(4)|lung(4)|breast(4)|large_intestine(3)|central_nervous_system(3)|oesophagus(3)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|endometrium(1)|urinary_tract(1)|autonomic_ganglia(1)	17											42.0	42.0	42.0					17																	7578555		2203	4300	6503	7519280	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-1G>A	17.37:g.7578555C>T			7519280	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.60	3.431133	0.62844	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	.	.	.	4.87	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4246	0.50003	0.0:0.9094:0.0:0.0906	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519280	1.000000	0.71417	0.999000	0.59377	0.918000	0.54935	7.639000	0.83342	1.359000	0.45940	0.655000	0.94253	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
UBE2M	9040	hgsc.bcm.edu	37	19	59068073	59068073	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr19:59068073C>T	ENST00000253023.3	-	4	906	c.328G>A	c.(328-330)Gtc>Atc	p.V110I	AC016629.8_ENST00000600534.1_RNA|CHMP2A_ENST00000312547.2_5'Flank|AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|CHMP2A_ENST00000600118.1_5'Flank|CHMP2A_ENST00000601220.1_5'Flank	NM_003969.3	NP_003960.1	P61081	UBC12_HUMAN	ubiquitin-conjugating enzyme E2M	110					cellular protein modification process (GO:0006464)|positive regulation of neuron apoptotic process (GO:0043525)|protein neddylation (GO:0045116)|protein ubiquitination (GO:0016567)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|NEDD8 ligase activity (GO:0019788)|ribosomal S6-glutamic acid ligase activity (GO:0018169)|ubiquitin-protein transferase activity (GO:0004842)	p.V110I(1)		large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	5		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		TTGAGGCAGACGTTGCCCTCG	0.587																																																1	Substitution - Missense(1)	ovary(1)	19											88.0	78.0	81.0					19																	59068073		2203	4300	6503	63759885	SO:0001583	missense	9040			AB012191	CCDS12987.1	19q13.43	2011-05-19	2011-05-19		ENSG00000130725	ENSG00000130725		"""Ubiquitin-conjugating enzymes E2"""	12491	protein-coding gene	gene with protein product		603173	"""ubiquitin-conjugating enzyme E2M (homologous to yeast UBC12)"", ""ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)"""			9694792	Standard	NM_003969		Approved	hUbc12, UBC12	uc002qtl.4	P61081		ENST00000253023.3:c.328G>A	19.37:g.59068073C>T	ENSP00000253023:p.Val110Ile		63759885	O76069|Q8VC50	Missense_Mutation	SNP	ENST00000253023.3	37	CCDS12987.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.23	2.473574	0.43942	.	.	ENSG00000130725	ENST00000253023	T	0.72835	-0.69	4.77	3.73	0.42828	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.64402	D	0.000017	T	0.56396	0.1982	L	0.31065	0.9	0.48511	D	0.999669	P	0.44090	0.826	B	0.41646	0.362	T	0.51616	-0.8683	10	0.19147	T	0.46	-28.0597	10.9527	0.47339	0.0:0.9085:0.0:0.0915	.	110	P61081	UBC12_HUMAN	I	110	ENSP00000253023:V110I	ENSP00000253023:V110I	V	-	1	0	UBE2M	63759885	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.783000	0.62403	1.384000	0.46424	0.655000	0.94253	GTC		0.587	UBE2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467097.1	NM_003969		Missense_Mutation
WDR63	126820	hgsc.bcm.edu	37	1	85564236	85564236	+	Missense_Mutation	SNP	G	G	C	rs374225786	byFrequency	TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr1:85564236G>C	ENST00000294664.6	+	13	1554	c.1374G>C	c.(1372-1374)gaG>gaC	p.E458D	WDR63_ENST00000326813.8_Missense_Mutation_p.E419D|WDR63_ENST00000370596.1_Missense_Mutation_p.E419D	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	458								p.E458D(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		TTGAACCGGAGAGTAATAAAG	0.343																																																1	Substitution - Missense(1)	ovary(1)	1											97.0	103.0	101.0					1																	85564236		2203	4299	6502	85336824	SO:0001583	missense	126820				CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.1374G>C	1.37:g.85564236G>C	ENSP00000294664:p.Glu458Asp		85336824	A8K988|Q96L72|Q96NU4	Missense_Mutation	SNP	ENST00000294664.6	37	CCDS702.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	2.807	-0.247941	0.05867	.	.	ENSG00000162643	ENST00000370596;ENST00000326813;ENST00000294664	T;T;T	0.62364	0.03;0.03;0.03	6.02	-12.0	0.00017	WD40 repeat-like-containing domain (1);	0.844937	0.11324	N	0.575708	T	0.05686	0.0149	N	0.01576	-0.805	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.001	T	0.12268	-1.0554	10	0.09338	T	0.73	-1.3575	6.2269	0.20714	0.1217:0.0805:0.3933:0.4045	.	419;458	Q8IWG1-2;Q8IWG1	.;WDR63_HUMAN	D	419;419;458	ENSP00000359628:E419D;ENSP00000317463:E419D;ENSP00000294664:E458D	ENSP00000294664:E458D	E	+	3	2	WDR63	85336824	0.000000	0.05858	0.001000	0.08648	0.775000	0.43874	-5.208000	0.00141	-3.338000	0.00184	-0.884000	0.02946	GAG		0.343	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027565.2	NM_145172		Missense_Mutation
ZBTB7C	201501	hgsc.bcm.edu	37	18	45567396	45567396	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr18:45567396C>T	ENST00000588982.1	-	3	584	c.83G>A	c.(82-84)cGg>cAg	p.R28Q	ZBTB7C_ENST00000590800.1_Missense_Mutation_p.R28Q|ZBTB7C_ENST00000535628.2_Missense_Mutation_p.R28Q|ZBTB7C_ENST00000586438.1_Missense_Mutation_p.R28Q|ZBTB7C_ENST00000332053.2_Missense_Mutation_p.R28Q			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	28							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.R28Q(1)		endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						GCCATCGTGCCGTTGCTCATT	0.582																																																1	Substitution - Missense(1)	ovary(1)	18											84.0	77.0	79.0					18																	45567396		2203	4300	6503	43821394	SO:0001583	missense	201501			Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.83G>A	18.37:g.45567396C>T	ENSP00000468782:p.Arg28Gln		43821394	O73453	Missense_Mutation	SNP	ENST00000588982.1	37	CCDS32830.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.3	4.908657	0.92107	.	.	ENSG00000184828	ENST00000535628;ENST00000332053	T;T	0.73152	-0.72;-0.72	5.04	5.04	0.67666	BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.87414	0.6171	M	0.90019	3.08	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.996	D	0.90252	0.4294	10	0.87932	D	0	.	18.3518	0.90340	0.0:1.0:0.0:0.0	.	28;28;28	B4DKU0;B2RG49;A1YPR0	.;.;ZBT7C_HUMAN	Q	28	ENSP00000439781:R28Q;ENSP00000328732:R28Q	ENSP00000328732:R28Q	R	-	2	0	ZBTB7C	43821394	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.332000	0.79248	0.561000	0.74099	CGG		0.582	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360		Missense_Mutation
ZC3H3	23144	hgsc.bcm.edu	37	8	144590049	144590049	+	Missense_Mutation	SNP	G	G	A	rs116930274	byFrequency	TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr8:144590049G>A	ENST00000262577.5	-	4	1613	c.1582C>T	c.(1582-1584)Cgg>Tgg	p.R528W		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	528					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.R528W(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			GGTGCAGTCCGCACGGCATGC	0.647													G|||	9	0.00179712	0.0008	0.0043	5008	,	,		17038	0.0		0.003	False		,,,				2504	0.002															1	Substitution - Missense(1)	ovary(1)	8						G	TRP/ARG	8,4398	14.3+/-33.2	0,8,2195	80.0	87.0	85.0		1582	3.9	0.0	8	dbSNP_132	85	35,8565	23.4+/-69.3	0,35,4265	yes	missense	ZC3H3	NM_015117.2	101	0,43,6460	AA,AG,GG		0.407,0.1816,0.3306	possibly-damaging	528/949	144590049	43,12963	2203	4300	6503	144661192	SO:0001583	missense	23144			D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.1582C>T	8.37:g.144590049G>A	ENSP00000262577:p.Arg528Trp		144661192	Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	37	CCDS6402.1	SNP	38	Baylor	4	0.0018315018315018315	1	0.0020325203252032522	2	0.0055248618784530384	0	0.0	1	0.0013192612137203166	G	11.85	1.762597	0.31228	0.001816	0.00407	ENSG00000014164	ENST00000262577	T	0.05855	3.38	5.73	3.87	0.44632	.	0.452368	0.19517	N	0.112379	T	0.12603	0.0306	M	0.63843	1.955	0.09310	N	1	D	0.62365	0.991	D	0.63488	0.915	T	0.02909	-1.1095	10	0.66056	D	0.02	-5.0859	8.9316	0.35675	0.0:0.1446:0.5567:0.2987	.	528	Q8IXZ2	ZC3H3_HUMAN	W	528	ENSP00000262577:R528W	ENSP00000262577:R528W	R	-	1	2	ZC3H3	144661192	0.963000	0.33076	0.005000	0.12908	0.009000	0.06853	1.629000	0.37071	0.695000	0.31675	0.563000	0.77884	CGG		0.647	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117		Missense_Mutation
ZC3H7B	23264	hgsc.bcm.edu	37	22	41735146	41735146	+	Nonsense_Mutation	SNP	C	C	G			TCGA-25-1324-01	TCGA-25-1324-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr22:41735146C>G	ENST00000352645.4	+	9	1024	c.767C>G	c.(766-768)tCa>tGa	p.S256*	ZC3H7B_ENST00000351589.4_Nonsense_Mutation_p.S256*	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	272					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.S256*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						GATGACTTCTCAGACGGGGAT	0.657																																																1	Substitution - Nonsense(1)	ovary(1)	22											99.0	83.0	88.0					22																	41735146		2203	4300	6503	40065092	SO:0001587	stop_gained	23264				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.767C>G	22.37:g.41735146C>G	ENSP00000345793:p.Ser256*		40065092	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Nonsense_Mutation	SNP	ENST00000352645.4	37	CCDS14013.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	38	6.996453	0.97990	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	.	.	.	4.98	4.98	0.66077	.	0.202184	0.34156	N	0.004213	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-16.0155	18.2407	0.89967	0.0:1.0:0.0:0.0	.	.	.	.	X	256	.	ENSP00000263243:S256X	S	+	2	0	ZC3H7B	40065092	0.999000	0.42202	0.955000	0.39395	0.925000	0.55904	5.280000	0.65603	2.286000	0.76751	0.561000	0.74099	TCA		0.657	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590		Nonsense_Mutation
ZCWPW1	55063	hgsc.bcm.edu	37	7	100014692	100014692	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1324-01	TCGA-25-1324-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	Capture	454_PCR_WGA	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr7:100014692T>G	ENST00000398027.2	-	6	723	c.476A>C	c.(475-477)aAt>aCt	p.N159T	ZCWPW1_ENST00000324725.6_Missense_Mutation_p.N38T|ZCWPW1_ENST00000490721.1_Missense_Mutation_p.N38T|ZCWPW1_ENST00000360951.4_Missense_Mutation_p.N159T	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	159							zinc ion binding (GO:0008270)	p.N159T(1)		breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AACTTACCCATTAGCATTATC	0.418																																																1	Substitution - Missense(1)	ovary(1)	7											151.0	141.0	144.0					7																	100014692		1928	4135	6063	99852628	SO:0001583	missense	55063			AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.476A>C	7.37:g.100014692T>G	ENSP00000381109:p.Asn159Thr		99852628	A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Missense_Mutation	SNP	ENST00000398027.2	37	CCDS43623.1	SNP	52	Baylor	.	.	.	.	.	.	.	.	.	.	T	6.214	0.407588	0.11754	.	.	ENSG00000078487	ENST00000398027;ENST00000490721;ENST00000360951;ENST00000324725;ENST00000379559	T;T;T;T	0.45668	0.92;0.93;0.89;0.93	4.48	2.03	0.26663	.	0.296500	0.24307	N	0.039669	T	0.17280	0.0415	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.14012	0.005;0.005;0.005;0.005;0.009	B;B;B;B;B	0.15870	0.006;0.006;0.006;0.006;0.014	T	0.15435	-1.0437	9	.	.	.	.	3.7077	0.08407	0.19:0.104:0.0:0.7059	.	159;119;160;159;38	B4DUQ2;B4DXS7;C9J435;Q9H0M4;Q9H0M4-4	.;.;.;ZCPW1_HUMAN;.	T	159;38;159;38;160	ENSP00000381109:N159T;ENSP00000419187:N38T;ENSP00000354210:N159T;ENSP00000314880:N38T	.	N	-	2	0	ZCWPW1	99852628	0.989000	0.36119	0.507000	0.27676	0.097000	0.18754	0.741000	0.26202	0.313000	0.23062	0.523000	0.50628	AAT		0.418	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356083.1	NM_017984		Missense_Mutation
ZFHX4	79776	hgsc.bcm.edu	37	8	77618212	77618212	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1324-01	TCGA-25-1324-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr8:77618212G>T	ENST00000521891.2	+	2	2337	c.1889G>T	c.(1888-1890)gGt>gTt	p.G630V	ZFHX4_ENST00000518282.1_Missense_Mutation_p.G630V|ZFHX4_ENST00000050961.6_Missense_Mutation_p.G630V|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000455469.2_Missense_Mutation_p.G630V	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	630					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G630V(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCTCTTGGTGGTCATATGACT	0.532										HNSCC(33;0.089)																																						1	Substitution - Missense(1)	ovary(1)	8											87.0	91.0	90.0					8																	77618212		2008	4199	6207	77780767	SO:0001583	missense	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1889G>T	8.37:g.77618212G>T	ENSP00000430497:p.Gly630Val		77780767	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726383	0.48833	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.53423	0.65;0.66;0.63;0.62	5.3	5.3	0.74995	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.45361	U	0.000367	T	0.60971	0.2310	L	0.33668	1.02	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.979	D;D;D;P	0.97110	0.999;1.0;1.0;0.882	T	0.63120	-0.6708	10	0.72032	D	0.01	.	19.15	0.93483	0.0:0.0:1.0:0.0	.	630;630;630;630	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	V	630	ENSP00000430497:G630V;ENSP00000399605:G630V;ENSP00000050961:G630V;ENSP00000430848:G630V	ENSP00000050961:G630V	G	+	2	0	ZFHX4	77780767	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.750000	0.94351	0.655000	0.94253	GGT		0.532	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		Missense_Mutation
ZBTB21	49854	hgsc.bcm.edu	37	21	43411551	43411551	+	Missense_Mutation	SNP	T	T	G	rs377515144|rs140397626|rs199778808	byFrequency	TCGA-25-1324-01	TCGA-25-1324-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_IV	Capture	Unknown	.	.	SOLID	TCGA-25-1324-01	TCGA-25-1324-10	g.chr21:43411551T>G	ENST00000310826.5	-	3	2837	c.2654A>C	c.(2653-2655)gAg>gCg	p.E885A	ZBTB21_ENST00000398505.3_Missense_Mutation_p.E684A|ZBTB21_ENST00000398499.1_Missense_Mutation_p.E885A|ZBTB21_ENST00000398511.3_Missense_Mutation_p.E885A|ZBTB21_ENST00000465968.1_5'UTR	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	885					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)	p.E885A(2)									TTCTTCAGCCTCCTCCACAGG	0.532																																																2	Substitution - Missense(2)	ovary(2)	21											58.0	63.0	61.0					21																	43411551		2200	4298	6498	42284620	SO:0001583	missense	49854			AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.2654A>C	21.37:g.43411551T>G	ENSP00000308759:p.Glu885Ala		42284620	Q5R2W1|Q5R2W2|Q6P4R0	Missense_Mutation	SNP	ENST00000310826.5	37	CCDS13678.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.56	1.976130	0.34848	.	.	ENSG00000173276	ENST00000398505;ENST00000310826;ENST00000398499;ENST00000398511	T;T;T;T	0.09163	3.31;3.01;3.01;3.01	5.86	4.71	0.59529	.	0.138874	0.47455	D	0.000237	T	0.13415	0.0325	L	0.50333	1.59	0.42072	D	0.991218	P;P	0.49559	0.925;0.829	B;B	0.44163	0.443;0.325	T	0.02411	-1.1163	10	0.41790	T	0.15	-11.1205	12.0707	0.53616	0.0:0.0672:0.0:0.9327	.	684;885	Q9ULJ3-2;Q9ULJ3	.;ZN295_HUMAN	A	684;885;885;885	ENSP00000381517:E684A;ENSP00000308759:E885A;ENSP00000381512:E885A;ENSP00000381523:E885A	ENSP00000308759:E885A	E	-	2	0	ZNF295	42284620	1.000000	0.71417	0.314000	0.25224	0.344000	0.29017	4.545000	0.60698	1.039000	0.40074	0.528000	0.53228	GAG		0.532	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727		Missense_Mutation
