#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
MTOR	2475	broad.mit.edu	37	1	11319346	11319346	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1329-01	TCGA-25-1329-10			C	A	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr1:11319346C>A	ENST00000361445.4	-	2	197	c.121G>T	c.(121-123)Gcc>Tcc	p.A41S		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	41	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.A41S(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	AGCTCCTTGGCGGCTTTGGCC	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											114.0	113.0	114.0					1																	11319346		2203	4300	6503	11241933	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.121G>T	1.37:g.11319346C>A	ENSP00000354558:p.Ala41Ser		11241933	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	27.7	4.857714	0.91433	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.68624	-0.34	5.7	5.7	0.88788	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81987	0.4939	M	0.70275	2.135	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.82508	-0.0422	10	0.62326	D	0.03	-2.9926	19.4425	0.94827	0.0:1.0:0.0:0.0	.	41	P42345	MTOR_HUMAN	S	41	ENSP00000354558:A41S	ENSP00000354558:A41S	A	-	1	0	MTOR	11241933	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	7.444000	0.80532	2.685000	0.91497	0.655000	0.94253	GCC		0.577	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958		Missense_Mutation
ZRANB2	9406	broad.mit.edu	37	1	71532487	71532487	+	Nonsense_Mutation	SNP	T	T	A			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr1:71532487T>A	ENST00000370920.3	-	9	1202	c.901A>T	c.(901-903)Aga>Tga	p.R301*	MIR186_ENST00000384988.1_RNA|ZRANB2_ENST00000254821.6_Nonsense_Mutation_p.R301*|ZRANB2_ENST00000477096.1_5'UTR|ZRANB2-AS1_ENST00000450461.1_RNA|ZRANB2-AS1_ENST00000426999.1_RNA	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2	301	Required for nuclear targeting.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R301*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						CTTGTTCGTCTTTTTTTGCGA	0.383																																																1	Substitution - Nonsense(1)	ovary(1)	1											125.0	121.0	122.0					1																	71532487		2203	4300	6503	71305075	SO:0001587	stop_gained	9406			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.901A>T	1.37:g.71532487T>A	ENSP00000359958:p.Arg301*		71305075	D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	Nonsense_Mutation	SNP	ENST00000370920.3	37	CCDS659.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	40	7.941183	0.98574	.	.	ENSG00000132485	ENST00000370920;ENST00000254821	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3782	0.83418	0.0:0.0:0.0:1.0	.	.	.	.	X	301	.	ENSP00000254821:R301X	R	-	1	2	ZRANB2	71305075	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.277000	0.76020	0.528000	0.53228	AGA		0.383	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026636.1	NM_203350		Nonsense_Mutation
WDR63	126820	broad.mit.edu	37	1	85538768	85538768	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr1:85538768G>C	ENST00000294664.6	+	3	276	c.96G>C	c.(94-96)gaG>gaC	p.E32D	WDR63_ENST00000370596.1_Missense_Mutation_p.E32D|WDR63_ENST00000326813.8_Missense_Mutation_p.E32D	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	32								p.E32D(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		TAAATATGGAGAGCATGGGTA	0.274																																																1	Substitution - Missense(1)	ovary(1)	1											68.0	77.0	74.0					1																	85538768		2200	4297	6497	85311356	SO:0001583	missense	126820				CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.96G>C	1.37:g.85538768G>C	ENSP00000294664:p.Glu32Asp		85311356	A8K988|Q96L72|Q96NU4	Missense_Mutation	SNP	ENST00000294664.6	37	CCDS702.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090669	0.36855	.	.	ENSG00000162643	ENST00000370596;ENST00000326813;ENST00000294664	T;T;T	0.46819	0.86;0.86;0.86	4.5	2.61	0.31194	.	0.831227	0.10448	N	0.673447	T	0.23532	0.0569	L	0.57536	1.79	0.29189	N	0.876014	B;B	0.30973	0.302;0.201	B;B	0.32805	0.153;0.054	T	0.14559	-1.0468	10	0.26408	T	0.33	-17.4017	7.7145	0.28696	0.2028:0.0:0.7972:0.0	.	32;32	Q8IWG1-2;Q8IWG1	.;WDR63_HUMAN	D	32	ENSP00000359628:E32D;ENSP00000317463:E32D;ENSP00000294664:E32D	ENSP00000294664:E32D	E	+	3	2	WDR63	85311356	0.905000	0.30787	0.994000	0.49952	0.916000	0.54674	0.288000	0.18939	1.205000	0.43262	0.585000	0.79938	GAG		0.274	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027565.2	NM_145172		Missense_Mutation
PHGDH	26227	broad.mit.edu	37	1	120284484	120284484	+	Silent	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr1:120284484G>A	ENST00000369409.4	+	10	1309	c.1173G>A	c.(1171-1173)gtG>gtA	p.V391V	PHGDH_ENST00000369407.3_Silent_p.V357V|PHGDH_ENST00000482968.1_3'UTR	NM_006623.3	NP_006614.2	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	391					brain development (GO:0007420)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|G1 to G0 transition (GO:0070314)|gamma-aminobutyric acid metabolic process (GO:0009448)|glial cell development (GO:0021782)|glutamine metabolic process (GO:0006541)|glycine metabolic process (GO:0006544)|L-serine biosynthetic process (GO:0006564)|neural tube development (GO:0021915)|neuron projection development (GO:0031175)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|taurine metabolic process (GO:0019530)|threonine metabolic process (GO:0006566)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|phosphoglycerate dehydrogenase activity (GO:0004617)	p.V391V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	18	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)		TGAACTTGGTGAACGCTAAGC	0.587																																																1	Substitution - coding silent(1)	ovary(1)	1											86.0	74.0	78.0					1																	120284484		2203	4300	6503	120086007	SO:0001819	synonymous_variant	26227			BC011262	CCDS904.1	1p12	2008-02-05			ENSG00000092621	ENSG00000092621	1.1.1.95		8923	protein-coding gene	gene with protein product		606879					Standard	NM_006623		Approved	SERA, PGDH, PDG	uc001ehz.3	O43175	OTTHUMG00000012100	ENST00000369409.4:c.1173G>A	1.37:g.120284484G>A			120086007	B2RD08|Q5SZU3|Q9BQ01	Silent	SNP	ENST00000369409.4	37	CCDS904.1	SNP	45	Broad																																																																																				0.587	PHGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033464.1	NM_006623		Silent
ITGB1	3688	broad.mit.edu	37	10	33209233	33209233	+	Silent	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr10:33209233G>A	ENST00000396033.2	-	10	1344	c.1209C>T	c.(1207-1209)aaC>aaT	p.N403N	ITGB1_ENST00000423113.1_Silent_p.N403N|ITGB1_ENST00000374956.4_Silent_p.N403N|ITGB1_ENST00000302278.3_Silent_p.N403N	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	403					axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)	p.N403N(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	CATTCACCCCGTTCTTGCAGT	0.358																																																1	Substitution - coding silent(1)	ovary(1)	10											152.0	129.0	137.0					10																	33209233		2203	4300	6503	33249239	SO:0001819	synonymous_variant	3688			BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.1209C>T	10.37:g.33209233G>A			33249239	A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Silent	SNP	ENST00000396033.2	37	CCDS7174.1	SNP	40	Broad																																																																																				0.358	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047496.1	NM_002211		Silent
PHRF1	57661	broad.mit.edu	37	11	606502	606502	+	Silent	SNP	G	G	T			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr11:606502G>T	ENST00000264555.5	+	13	1643	c.1515G>T	c.(1513-1515)ctG>ctT	p.L505L	PHRF1_ENST00000533464.1_Silent_p.L501L|PHRF1_ENST00000413872.2_Silent_p.L503L|PHRF1_ENST00000416188.2_Silent_p.L504L	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	505					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)	p.L505L(1)		breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						TGCCTGACCTGCTGGGCAGCA	0.682																																																1	Substitution - coding silent(1)	ovary(1)	11											18.0	23.0	21.0					11																	606502		2085	4201	6286	596502	SO:0001819	synonymous_variant	57661			BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.1515G>T	11.37:g.606502G>T			596502	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Silent	SNP	ENST00000264555.5	37		SNP	46	Broad																																																																																				0.682	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901		Silent
MRGPRE	116534	broad.mit.edu	37	11	3249990	3249990	+	Missense_Mutation	SNP	C	C	T	rs370026011	byFrequency	TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr11:3249990C>T	ENST00000389832.5	-	2	346	c.40G>A	c.(40-42)Gcc>Acc	p.A14T	MRGPRE_ENST00000436689.2_Missense_Mutation_p.A13T|AC109309.4_ENST00000418995.2_RNA			Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A13T(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCGCCGTTGGCGGCCCCCACG	0.672													C|||	9	0.00179712	0.0	0.0	5008	,	,		17642	0.0089		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	11						C	THR/ALA	0,3924		0,0,1962	28.0	31.0	30.0		37	-4.2	0.0	11		30	1,8289		0,1,4144	no	missense	MRGPRE	NM_001039165.2	58	0,1,6106	TT,TC,CC		0.0121,0.0,0.0082	benign	13/312	3249990	1,12213	1962	4145	6107	3206566	SO:0001583	missense	116534			AY255572	CCDS41603.1, CCDS41603.2	11p15.5	2012-08-21	2004-03-25		ENSG00000184350	ENSG00000184350		"""GPCR / Class A : Orphans"""	30694	protein-coding gene	gene with protein product		607232	"""G protein-coupled receptor 167"""	GPR167		11551509	Standard	NM_001039165		Approved	mrgE	uc001lxq.5	Q86SM8	OTTHUMG00000011708	ENST00000389832.5:c.40G>A	11.37:g.3249990C>T	ENSP00000374482:p.Ala14Thr		3206566	Q2M1V7	Missense_Mutation	SNP	ENST00000389832.5	37		SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	0.041	-1.283269	0.01398	0.0	1.21E-4	ENSG00000184350	ENST00000436689;ENST00000389832	T	0.02446	4.29	2.63	-4.22	0.03800	.	3.568200	0.02626	U	0.103755	T	0.01454	0.0047	N	0.08118	0	0.09310	N	1	B	0.19583	0.037	B	0.15484	0.013	T	0.43327	-0.9398	10	0.08381	T	0.77	.	4.329	0.11053	0.3977:0.3632:0.2391:0.0	.	13	Q86SM8	MRGRE_HUMAN	T	14;13	ENSP00000374482:A13T	ENSP00000374482:A13T	A	-	1	0	MRGPRE	3206566	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.307000	0.08167	-0.847000	0.04168	-0.494000	0.04653	GCC		0.672	MRGPRE-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000032346.5	XM_171536		Missense_Mutation
OR5F1	338674	broad.mit.edu	37	11	55762043	55762043	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr11:55762043G>A	ENST00000278409.1	-	1	58	c.59C>T	c.(58-60)aCg>aTg	p.T20M		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	20					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T20M(1)		endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					TAGCTCCAGCGTGTCTGCTAA	0.363																																																1	Substitution - Missense(1)	ovary(1)	11											62.0	63.0	63.0					11																	55762043		2201	4296	6497	55518619	SO:0001583	missense	338674			AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.59C>T	11.37:g.55762043G>A	ENSP00000278409:p.Thr20Met		55518619	Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	CCDS31515.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	11.53	1.665085	0.29604	.	.	ENSG00000149133	ENST00000278409	T	0.01099	5.34	3.03	-0.459	0.12179	.	.	.	.	.	T	0.01489	0.0048	L	0.39898	1.24	0.09310	N	1	D	0.59767	0.986	P	0.47528	0.549	T	0.52132	-0.8616	9	0.52906	T	0.07	.	4.5639	0.12173	0.2347:0.0:0.5879:0.1774	.	20	O95221	OR5F1_HUMAN	M	20	ENSP00000278409:T20M	ENSP00000278409:T20M	T	-	2	0	OR5F1	55518619	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-4.010000	0.00314	0.395000	0.25257	0.297000	0.19635	ACG		0.363	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697		Missense_Mutation
STIP1	10963	broad.mit.edu	37	11	63971532	63971532	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr11:63971532A>T	ENST00000305218.4	+	14	1713	c.1566A>T	c.(1564-1566)ttA>ttT	p.L522F	STIP1_ENST00000358794.5_Missense_Mutation_p.L569F|FERMT3_ENST00000345728.5_5'Flank|FERMT3_ENST00000279227.5_5'Flank|STIP1_ENST00000538945.1_Missense_Mutation_p.L498F	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	522	STI1 2.				response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						GTAGACACTTAAAGAATCCTG	0.463																																																0			11											144.0	134.0	138.0					11																	63971532		2201	4297	6498	63728108	SO:0001583	missense	10963			BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.1566A>T	11.37:g.63971532A>T	ENSP00000305958:p.Leu522Phe		63728108	B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Missense_Mutation	SNP	ENST00000305218.4	37	CCDS8058.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	18.24	3.580340	0.65992	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945	T;T;T	0.16743	2.34;2.59;2.32	5.34	-0.416	0.12351	Heat shock chaperonin-binding (1);	0.000000	0.64402	D	0.000001	T	0.35480	0.0933	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.05402	-1.0887	10	0.72032	D	0.01	-3.5825	7.3493	0.26680	0.3165:0.0:0.5415:0.142	.	498;522	F5H0T1;P31948	.;STIP1_HUMAN	F	569;522;498	ENSP00000351646:L569F;ENSP00000305958:L522F;ENSP00000445957:L498F	ENSP00000305958:L522F	L	+	3	2	STIP1	63728108	0.636000	0.27207	0.996000	0.52242	0.960000	0.62799	-0.157000	0.10085	-0.237000	0.09739	0.459000	0.35465	TTA		0.463	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396289.2	NM_006819		Missense_Mutation
C11orf65	160140	broad.mit.edu	37	11	108277839	108277839	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr11:108277839C>T	ENST00000529391.1	-	3	221	c.212G>A	c.(211-213)cGa>cAa	p.R71Q	C11orf65_ENST00000526725.1_5'Flank|C11orf65_ENST00000525729.1_Intron|C11orf65_ENST00000393084.1_Missense_Mutation_p.R71Q			Q8NCR3	CK065_HUMAN	chromosome 11 open reading frame 65	71								p.R71Q(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(2)	10		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;8.21e-06)|BRCA - Breast invasive adenocarcinoma(274;1.01e-05)|all cancers(92;0.000189)|Colorectal(284;0.114)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		TAATCTGAATCGCACATGAAT	0.294																																																1	Substitution - Missense(1)	ovary(1)	11											45.0	43.0	44.0					11																	108277839		2201	4297	6498	107783049	SO:0001583	missense	160140			BC059411	CCDS8340.1	11q22.3	2012-05-30			ENSG00000166323	ENSG00000166323			28519	protein-coding gene	gene with protein product						12477932	Standard	NM_152587		Approved	MGC33948	uc001pkh.3	Q8NCR3	OTTHUMG00000166489	ENST00000529391.1:c.212G>A	11.37:g.108277839C>T	ENSP00000436400:p.Arg71Gln		107783049	B4DZU4|Q6PCA8	Missense_Mutation	SNP	ENST00000529391.1	37	CCDS8340.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275605	0.80580	.	.	ENSG00000166323	ENST00000529391;ENST00000393084	T;T	0.35236	1.32;1.32	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000004	T	0.58075	0.2097	M	0.79475	2.455	0.37899	D	0.930977	D	0.89917	1.0	D	0.71870	0.975	T	0.65990	-0.6034	10	0.72032	D	0.01	-10.4074	11.1119	0.48237	0.0:0.9126:0.0:0.0874	.	71	Q8NCR3	CK065_HUMAN	Q	71	ENSP00000436400:R71Q;ENSP00000376799:R71Q	ENSP00000376799:R71Q	R	-	2	0	C11orf65	107783049	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.127000	0.57944	2.476000	0.83614	0.650000	0.86243	CGA		0.294	C11orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390010.3	NM_152587		Missense_Mutation
GRIK4	2900	broad.mit.edu	37	11	120776148	120776148	+	Silent	SNP	C	C	T	rs144767530		TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr11:120776148C>T	ENST00000527524.2	+	13	1709	c.1422C>T	c.(1420-1422)ggC>ggT	p.G474G	GRIK4_ENST00000438375.2_Silent_p.G474G	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	474					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.G474G(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		GCGTGTACGGCGTTCCCGAGG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	11											133.0	131.0	132.0					11																	120776148		2203	4299	6502	120281358	SO:0001819	synonymous_variant	2900			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1422C>T	11.37:g.120776148C>T			120281358	A8K9L1	Silent	SNP	ENST00000527524.2	37	CCDS8433.1	SNP	27	Broad																																																																																				0.612	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619		Silent
B4GALNT3	283358	broad.mit.edu	37	12	674564	674564	+	IGR	SNP	C	C	T			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr12:674564C>T	ENST00000266383.5	+	0	5068				NINJ2_ENST00000433832.2_3'UTR|NINJ2_ENST00000397265.3_Missense_Mutation_p.R82Q|NINJ2_ENST00000542920.1_Missense_Mutation_p.R53Q|NINJ2_ENST00000537416.1_5'Flank|NINJ2_ENST00000305108.4_Missense_Mutation_p.R135Q	NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3						metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)	p.R135Q(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			CAGGTTCAGCCGTGCTGCAGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											118.0	108.0	111.0					12																	674564		2203	4300	6503	544825	SO:0001628	intergenic_variant	4815			AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283		12.37:g.674564C>T			544825	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	37	CCDS8504.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	14.27	2.484292	0.44147	.	.	ENSG00000171840	ENST00000305108;ENST00000397265;ENST00000542920	T;T;T	0.41065	1.01;1.01;1.01	4.89	1.97	0.26223	.	0.284575	0.33631	N	0.004713	T	0.35537	0.0935	M	0.62723	1.935	0.19575	N	0.999964	B	0.27316	0.175	B	0.23852	0.049	T	0.19943	-1.0290	10	0.30078	T	0.28	-4.1378	8.9016	0.35499	0.2639:0.6648:0.0:0.0712	.	89	Q9NZG7	NINJ2_HUMAN	Q	135;82;53	ENSP00000307552:R135Q;ENSP00000380435:R82Q;ENSP00000438831:R53Q	ENSP00000307552:R135Q	R	-	2	0	NINJ2	544825	0.000000	0.05858	0.655000	0.29622	0.826000	0.46750	0.416000	0.21198	0.108000	0.17862	0.491000	0.48974	CGG		0.562	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593		Missense_Mutation
CD163L1	283316	broad.mit.edu	37	12	7531634	7531634	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr12:7531634G>A	ENST00000313599.3	-	9	2368	c.2311C>T	c.(2311-2313)Cga>Tga	p.R771*	CD163L1_ENST00000396630.1_Nonsense_Mutation_p.R771*|CD163L1_ENST00000544331.1_5'UTR|CD163L1_ENST00000416109.2_Nonsense_Mutation_p.R781*			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	771	SRCR 7. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.R771*(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CACTCCCATCGTATACAATCC	0.408																																																1	Substitution - Nonsense(1)	ovary(1)	12											72.0	72.0	72.0					12																	7531634		2203	4300	6503	7422901	SO:0001587	stop_gained	283316			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2311C>T	12.37:g.7531634G>A	ENSP00000315945:p.Arg771*		7422901	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Nonsense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.076743	0.94000	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	.	.	.	1.82	-1.31	0.09230	.	3.403600	0.01971	U	0.044106	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	3.6624	0.08244	0.1909:0.0:0.4673:0.3418	.	.	.	.	X	771;781;771	.	ENSP00000315945:R771X	R	-	1	2	CD163L1	7422901	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.284000	0.08422	-0.315000	0.08703	0.455000	0.32223	CGA		0.408	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941		Nonsense_Mutation
LEMD3	23592	broad.mit.edu	37	12	65563516	65563516	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr12:65563516G>A	ENST00000308330.2	+	1	166	c.140G>A	c.(139-141)cGa>cAa	p.R47Q	LEMD3_ENST00000541171.1_3'UTR	NM_001167614.1|NM_014319.4	NP_001161086.1|NP_055134.2	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	47	LEM. {ECO:0000255|PROSITE- ProRule:PRU00313}.				negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of cell cycle (GO:0051726)|skeletal muscle cell differentiation (GO:0035914)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)	p.R47Q(1)		breast(1)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	36			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		AAGAAGCTTCGAGAGGAAGAG	0.617																																																1	Substitution - Missense(1)	ovary(1)	12											11.0	8.0	9.0					12																	65563516		2175	4257	6432	63849783	SO:0001583	missense	23592			AF263918	CCDS8972.1	12q14	2008-02-05			ENSG00000174106	ENSG00000174106			28887	protein-coding gene	gene with protein product		607844				10671519, 15489854	Standard	NM_014319		Approved	MAN1	uc001ssl.2	Q9Y2U8	OTTHUMG00000168840	ENST00000308330.2:c.140G>A	12.37:g.65563516G>A	ENSP00000308369:p.Arg47Gln		63849783	Q9NT47|Q9NYA5	Missense_Mutation	SNP	ENST00000308330.2	37	CCDS8972.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044167	0.75732	.	.	ENSG00000174106	ENST00000308330	T	0.50001	0.76	3.49	1.56	0.23342	LEM-like domain (2);Lamino-associated polypeptide 2/emerin (3);	0.000000	0.64402	D	0.000003	T	0.49541	0.1563	L	0.45352	1.415	0.42460	D	0.992788	D;D	0.71674	0.998;0.998	P;P	0.56216	0.794;0.794	T	0.42447	-0.9451	9	.	.	.	-5.446	11.1845	0.48648	0.0:0.0:0.6671:0.3329	.	47;47	B4E2K7;Q9Y2U8	.;MAN1_HUMAN	Q	47	ENSP00000308369:R47Q	.	R	+	2	0	LEMD3	63849783	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.251000	0.72441	0.420000	0.25954	0.462000	0.41574	CGA		0.617	LEMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401312.2			Missense_Mutation
GLIPR1L2	144321	broad.mit.edu	37	12	75816731	75816731	+	Missense_Mutation	SNP	G	G	A	rs144813686	byFrequency	TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr12:75816731G>A	ENST00000550916.1	+	4	679	c.632G>A	c.(631-633)cGa>cAa	p.R211Q	GLIPR1L2_ENST00000320460.4_Missense_Mutation_p.R211Q|GLIPR1L2_ENST00000441218.1_Missense_Mutation_p.R146Q|GLIPR1L2_ENST00000378692.3_Missense_Mutation_p.R104Q|GLIPR1L2_ENST00000435775.1_3'UTR	NM_001270396.1	NP_001257325.1	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2	211						integral component of membrane (GO:0016021)		p.R211Q(1)		kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16						TTTTGTACTCGATGTGGCAGA	0.328													G|||	3	0.000599042	0.0	0.0	5008	,	,		16761	0.002		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	12						G	GLN/ARG	0,4406		0,0,2203	165.0	162.0	163.0		632	-0.7	0.0	12	dbSNP_134	163	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GLIPR1L2	NM_152436.1	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	211/254	75816731	1,13005	2203	4300	6503	74102998	SO:0001583	missense	144321			BC029557	CCDS9010.1, CCDS58258.1	12q21.1	2014-06-03				ENSG00000180481			28592	protein-coding gene	gene with protein product		610394				12477932	Standard	NM_001270396		Approved	MGC39497	uc001sxr.2	Q4G1C9	OTTHUMG00000169756	ENST00000550916.1:c.632G>A	12.37:g.75816731G>A	ENSP00000448248:p.Arg211Gln		74102998	Q6MZS1|Q8N6N0|Q8NA43	Missense_Mutation	SNP	ENST00000550916.1	37	CCDS58258.1	SNP	37	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	6.745	0.506302	0.12883	0.0	1.16E-4	ENSG00000180481	ENST00000550916;ENST00000378692;ENST00000320460;ENST00000441218	T;T;T;T	0.10860	3.34;2.83;3.32;3.02	4.99	-0.737	0.11129	.	1.368980	0.04721	N	0.419272	T	0.04815	0.0130	N	0.05487	-0.04	0.09310	N	1	B;B	0.13145	0.003;0.007	B;B	0.14578	0.002;0.011	T	0.38908	-0.9639	10	0.11794	T	0.64	.	3.7034	0.08391	0.4952:0.0:0.3406:0.1642	.	211;211	Q4G1C9;Q4G1C9-2	GRPL2_HUMAN;.	Q	211;104;211;146	ENSP00000448248:R211Q;ENSP00000367963:R104Q;ENSP00000317385:R211Q;ENSP00000405273:R146Q	ENSP00000317385:R211Q	R	+	2	0	GLIPR1L2	74102998	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.487000	0.06505	-0.411000	0.07530	-0.913000	0.02753	CGA		0.328	GLIPR1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405718.1	NM_152436		Missense_Mutation
TMEM132D	121256	broad.mit.edu	37	12	129559049	129559049	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr12:129559049G>A	ENST00000422113.2	-	9	2997	c.2671C>T	c.(2671-2673)Cag>Tag	p.Q891*	TMEM132D_ENST00000389441.4_Nonsense_Mutation_p.Q429*	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	891					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.Q891*(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGGTCCACCTGGGCTGGGAAG	0.522																																																1	Substitution - Nonsense(1)	ovary(1)	12											93.0	88.0	90.0					12																	129559049		2203	4300	6503	128125002	SO:0001587	stop_gained	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2671C>T	12.37:g.129559049G>A	ENSP00000408581:p.Gln891*		128125002	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Nonsense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	41	8.950751	0.99014	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	.	.	.	3.85	3.85	0.44370	.	0.097175	0.43919	D	0.000502	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.2427	16.1212	0.81359	0.0:0.0:1.0:0.0	.	.	.	.	X	429;891	.	.	Q	-	1	0	TMEM132D	128125002	0.998000	0.40836	0.072000	0.20136	0.656000	0.38851	3.565000	0.53798	1.849000	0.53698	0.313000	0.20887	CAG		0.522	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		Nonsense_Mutation
PROSER1	80209	broad.mit.edu	37	13	39587390	39587390	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr13:39587390T>C	ENST00000352251.3	-	11	2832	c.1999A>G	c.(1999-2001)Agt>Ggt	p.S667G	PROSER1_ENST00000484434.3_Intron|PROSER1_ENST00000350125.3_Missense_Mutation_p.S645G	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	667	Ser-rich.							p.S667G(1)									AAAGGAGTACTCAAGCTGGAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	13											122.0	114.0	116.0					13																	39587390		2203	4300	6503	38485390	SO:0001583	missense	80209			AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.1999A>G	13.37:g.39587390T>C	ENSP00000332034:p.Ser667Gly		38485390	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	ENST00000352251.3	37	CCDS9368.2	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	15.91	2.971030	0.53614	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.56611	0.45;0.45	5.27	5.27	0.74061	.	.	.	.	.	T	0.38665	0.1049	L	0.29908	0.895	0.37949	D	0.932604	P;P	0.39480	0.675;0.461	B;B	0.34093	0.175;0.145	T	0.40813	-0.9543	8	.	.	.	-13.1738	14.659	0.68855	0.0:0.0:0.0:1.0	.	645;667	A6NJ97;Q86XN7	.;PRSR1_HUMAN	G	667;645	ENSP00000332034:S667G;ENSP00000339123:S645G	.	S	-	1	0	PROSER1	38485390	0.999000	0.42202	0.856000	0.33681	0.659000	0.38960	3.386000	0.52492	2.116000	0.64780	0.459000	0.35465	AGT		0.463	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138		Missense_Mutation
ANGEL1	23357	broad.mit.edu	37	14	77275692	77275692	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr14:77275692G>A	ENST00000251089.2	-	2	471	c.359C>T	c.(358-360)gCa>gTa	p.A120V	ANGEL1_ENST00000554941.1_5'UTR	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	120								p.A120V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		CAGGTTCTCTGCAGCCCGAAG	0.597																																																1	Substitution - Missense(1)	ovary(1)	14											45.0	47.0	46.0					14																	77275692		2203	4300	6503	76345445	SO:0001583	missense	23357			AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.359C>T	14.37:g.77275692G>A	ENSP00000251089:p.Ala120Val		76345445	B4DWL7|O94859|Q8NCS9	Missense_Mutation	SNP	ENST00000251089.2	37	CCDS9852.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	12.80	2.047111	0.36085	.	.	ENSG00000013523	ENST00000251089	T	0.23348	1.91	5.36	2.49	0.30216	.	0.583978	0.16738	N	0.201552	T	0.11707	0.0285	N	0.24115	0.695	0.09310	N	1	B;B	0.14438	0.01;0.0	B;B	0.12156	0.007;0.0	T	0.28299	-1.0048	10	0.10902	T	0.67	-0.0016	1.362	0.02194	0.2209:0.2839:0.3489:0.1464	.	120;120	B4DVG4;Q9UNK9	.;ANGE1_HUMAN	V	120	ENSP00000251089:A120V	ENSP00000251089:A120V	A	-	2	0	ANGEL1	76345445	0.169000	0.23002	0.975000	0.42487	0.751000	0.42716	1.104000	0.31074	0.633000	0.30452	0.655000	0.94253	GCA		0.597	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413712.2	NM_015305		Missense_Mutation
DIO3	1735	broad.mit.edu	37	14	102028297	102028297	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr14:102028297C>T	ENST00000510508.4	+	1	610	c.464C>T	c.(463-465)gCg>gTg	p.A155V	DIO3OS_ENST00000408206.1_lincRNA|DIO3_ENST00000359323.3_Missense_Mutation_p.A129V			P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	155					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|positive regulation of multicellular organism growth (GO:0040018)|small molecule metabolic process (GO:0044281)|thyroid hormone catabolic process (GO:0042404)|thyroid hormone generation (GO:0006590)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thyroxine 5'-deiodinase activity (GO:0004800)|thyroxine 5-deiodinase activity (GO:0033798)	p.A129V(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)|skin(1)	22		all_neural(303;0.185)				CTCGACTACGCGCAAGGGAAC	0.627																																																1	Substitution - Missense(1)	ovary(1)	14											33.0	38.0	36.0					14																	102028297		2063	4201	6264	101098050	SO:0001583	missense	1735			S79854	CCDS41992.1, CCDS41992.2	14q32	2012-10-08			ENSG00000197406	ENSG00000197406			2885	protein-coding gene	gene with protein product		601038		TXDI3		9787088, 7593630	Standard	NM_001362		Approved		uc021sdx.1	P55073	OTTHUMG00000160681	ENST00000510508.4:c.464C>T	14.37:g.102028297C>T	ENSP00000427336:p.Ala155Val		101098050	G3XAM0|Q8WVN5	Missense_Mutation	SNP	ENST00000510508.4	37	CCDS41992.2	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399371	0.42512	.	.	ENSG00000197406;ENSG00000258865	ENST00000359323;ENST00000510508	T;T	0.33865	1.39;1.39	3.51	2.61	0.31194	Thioredoxin-like fold (1);	0.102467	0.37577	U	0.002034	T	0.30448	0.0765	M	0.64997	1.995	0.28516	N	0.913323	P	0.38565	0.637	B	0.33620	0.167	T	0.14587	-1.0467	10	0.30078	T	0.28	.	10.1479	0.42776	0.0:0.8996:0.0:0.1004	.	129	P55073	IOD3_HUMAN	V	129;155	ENSP00000352273:A129V;ENSP00000427336:A155V	ENSP00000352273:A155V	A	+	2	0	DIO3;AL049836.1	101098050	0.988000	0.35896	0.512000	0.27736	0.983000	0.72400	2.452000	0.44961	0.680000	0.31366	0.462000	0.41574	GCG		0.627	DIO3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000361712.4	NM_001362		Missense_Mutation
SRL	6345	broad.mit.edu	37	16	4254547	4254547	+	Silent	SNP	G	G	A	rs186123843	byFrequency	TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr16:4254547G>A	ENST00000399609.3	-	2	162	c.150C>T	c.(148-150)tcC>tcT	p.S50S	SRL_ENST00000537996.1_Silent_p.S8S	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	509	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.S50S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						AGTAGTCATCGGATGGCTTGT	0.602													G|||	8	0.00159744	0.0	0.0	5008	,	,		17599	0.0069		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	16						G		0,3834		0,0,1917	127.0	126.0	126.0		150	-11.2	0.0	16		126	1,8239		0,1,4119	no	coding-synonymous	SRL	NM_001098814.1		0,1,6036	AA,AG,GG		0.0121,0.0,0.0083		50/474	4254547	1,12073	1917	4120	6037	4194548	SO:0001819	synonymous_variant	6345			AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.150C>T	16.37:g.4254547G>A			4194548		Silent	SNP	ENST00000399609.3	37	CCDS42113.1	SNP	39	Broad																																																																																				0.602	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438087.1	XM_064152		Silent
MIB1	57534	broad.mit.edu	37	18	19395664	19395664	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr18:19395664T>G	ENST00000261537.6	+	11	1831	c.1567T>G	c.(1567-1569)Ttg>Gtg	p.L523V	SNORA73_ENST00000363107.1_RNA|MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	523					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L523V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			TAGTGCTGATTTGAATGCTCG	0.418																																																1	Substitution - Missense(1)	ovary(1)	18											108.0	96.0	100.0					18																	19395664		2203	4300	6503	17649662	SO:0001583	missense	57534			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.1567T>G	18.37:g.19395664T>G	ENSP00000261537:p.Leu523Val		17649662	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Missense_Mutation	SNP	ENST00000261537.6	37	CCDS11871.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	10.64	1.408031	0.25378	.	.	ENSG00000101752	ENST00000261537	T	0.63096	-0.02	4.91	-0.839	0.10759	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000002	T	0.46908	0.1417	N	0.02736	-0.51	0.48395	D	0.999644	P	0.44776	0.843	D	0.63957	0.92	T	0.45234	-0.9275	10	0.02654	T	1	-6.853	12.1078	0.53821	0.0:0.5745:0.0:0.4255	.	523	Q86YT6	MIB1_HUMAN	V	523	ENSP00000261537:L523V	ENSP00000261537:L523V	L	+	1	2	MIB1	17649662	0.926000	0.31397	0.965000	0.40720	0.833000	0.47200	0.035000	0.13797	-0.060000	0.13132	-0.250000	0.11733	TTG		0.418	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774		Missense_Mutation
KCNS3	3790	broad.mit.edu	37	2	18112778	18112778	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr2:18112778G>A	ENST00000403915.1	+	3	954	c.503G>A	c.(502-504)cGg>cAg	p.R168Q	KCNS3_ENST00000465292.1_Intron|KCNS3_ENST00000304101.4_Missense_Mutation_p.R168Q	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	168					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)	p.R168Q(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GGTCAGCTCCGGAAGAAAATC	0.507																																																1	Substitution - Missense(1)	ovary(1)	2											59.0	65.0	63.0					2																	18112778		2203	4300	6503	17976259	SO:0001583	missense	3790			AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.503G>A	2.37:g.18112778G>A	ENSP00000385968:p.Arg168Gln		17976259	D6W520|O43651|Q4ZFY1|Q96B56	Missense_Mutation	SNP	ENST00000403915.1	37	CCDS1692.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165400	0.57476	.	.	ENSG00000170745	ENST00000403915;ENST00000304101	D;D	0.97138	-4.26;-4.26	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.97129	0.9062	L	0.34521	1.04	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	D	0.95050	0.8186	10	0.14656	T	0.56	.	20.2422	0.98381	0.0:0.0:1.0:0.0	.	168	Q9BQ31	KCNS3_HUMAN	Q	168	ENSP00000385968:R168Q;ENSP00000305824:R168Q	ENSP00000305824:R168Q	R	+	2	0	KCNS3	17976259	1.000000	0.71417	1.000000	0.80357	0.149000	0.21700	9.869000	0.99810	2.782000	0.95742	0.655000	0.94253	CGG		0.507	KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323808.1	NM_002252		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179641544	179641544	+	Nonsense_Mutation	SNP	G	G	A	rs587780490		TCGA-25-1329-01	TCGA-25-1329-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr2:179641544G>A	ENST00000591111.1	-	28	5271	c.5047C>T	c.(5047-5049)Cga>Tga	p.R1683*	TTN_ENST00000359218.5_Nonsense_Mutation_p.R1637*|TTN_ENST00000589042.1_Nonsense_Mutation_p.R1683*|TTN_ENST00000342992.6_Nonsense_Mutation_p.R1683*|TTN-AS1_ENST00000584485.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000360870.5_Nonsense_Mutation_p.R1683*|TTN_ENST00000342175.6_Nonsense_Mutation_p.R1637*|TTN_ENST00000460472.2_Nonsense_Mutation_p.R1637*|TTN-AS1_ENST00000610005.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12526					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R1683*(2)|p.R1637*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGCCATATCGCAAATGGAGG	0.453																																																3	Substitution - Nonsense(3)	ovary(3)	2											77.0	73.0	74.0					2																	179641544		2203	4300	6503	179349789	SO:0001587	stop_gained	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5047C>T	2.37:g.179641544G>A	ENSP00000465570:p.Arg1683*		179349789	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	46	12.204015	0.99646	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	.	.	.	5.33	3.4	0.38934	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.0786	0.64905	0.0:0.0:0.7184:0.2816	.	.	.	.	X	1683;1637;1637;1637;1637;1683	.	ENSP00000340554:R1637X	R	-	1	2	TTN	179349789	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.544000	0.67231	1.204000	0.43247	0.650000	0.86243	CGA		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Nonsense_Mutation
SULF2	55959	broad.mit.edu	37	20	46301069	46301069	+	Silent	SNP	C	C	T			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr20:46301069C>T	ENST00000359930.4	-	11	2300	c.1449G>A	c.(1447-1449)ctG>ctA	p.L483L	SULF2_ENST00000361612.4_Silent_p.L483L|SULF2_ENST00000484875.1_Silent_p.L483L|SULF2_ENST00000467815.1_Silent_p.L483L	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	483					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.L483L(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						TGCTGCCGCCCAGCCGCATGG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	20											54.0	49.0	51.0					20																	46301069		2203	4300	6503	45734476	SO:0001819	synonymous_variant	55959			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.1449G>A	20.37:g.46301069C>T			45734476	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Silent	SNP	ENST00000359930.4	37	CCDS13408.1	SNP	21	Broad																																																																																				0.657	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837		Silent
ATP9A	10079	broad.mit.edu	37	20	50224099	50224099	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr20:50224099A>C	ENST00000338821.5	-	26	3034	c.2770T>G	c.(2770-2772)Ttc>Gtc	p.F924V	ATP9A_ENST00000311637.5_Missense_Mutation_p.F788V|ATP9A_ENST00000402822.1_Missense_Mutation_p.F803V	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	924					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.F924V(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CATATTAAGAATGTCTTGTAG	0.498																																																1	Substitution - Missense(1)	ovary(1)	20											89.0	68.0	75.0					20																	50224099		2203	4300	6503	49657506	SO:0001583	missense	10079			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.2770T>G	20.37:g.50224099A>C	ENSP00000342481:p.Phe924Val		49657506	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	26.7	4.758857	0.89843	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	T;T;T	0.78364	-1.17;-1.17;-1.17	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.90041	0.6890	M	0.92880	3.355	0.80722	D	1	D;D	0.58268	0.981;0.982	D;P	0.66351	0.943;0.755	D	0.92511	0.6016	10	0.87932	D	0	-36.5768	15.0446	0.71816	1.0:0.0:0.0:0.0	.	803;924	O75110-2;O75110	.;ATP9A_HUMAN	V	788;924;803	ENSP00000309086:F788V;ENSP00000342481:F924V;ENSP00000385875:F803V	ENSP00000309086:F788V	F	-	1	0	ATP9A	49657506	1.000000	0.71417	0.940000	0.37924	0.915000	0.54546	8.754000	0.91642	1.953000	0.56701	0.528000	0.53228	TTC		0.498	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045		Missense_Mutation
EPHB1	2047	broad.mit.edu	37	3	134851574	134851574	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr3:134851574G>A	ENST00000398015.3	+	5	1350	c.980G>A	c.(979-981)cGc>cAc	p.R327H	EPHB1_ENST00000488154.1_3'UTR|EPHB1_ENST00000493838.1_5'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	327	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.R327H(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TCAGGTCCCCGCAATGTTATC	0.547																																																2	Substitution - Missense(2)	ovary(2)	3											51.0	52.0	52.0					3																	134851574		2000	4181	6181	136334264	SO:0001583	missense	2047			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.980G>A	3.37:g.134851574G>A	ENSP00000381097:p.Arg327His		136334264	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468249	0.84533	.	.	ENSG00000154928	ENST00000398015	T	0.58652	0.32	5.69	5.69	0.88448	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73598	0.3607	L	0.55103	1.725	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71244	-0.4650	10	0.44086	T	0.13	.	19.8251	0.96614	0.0:0.0:1.0:0.0	.	327	P54762	EPHB1_HUMAN	H	327	ENSP00000381097:R327H	ENSP00000381097:R327H	R	+	2	0	EPHB1	136334264	1.000000	0.71417	1.000000	0.80357	0.401000	0.30781	7.978000	0.88095	2.692000	0.91855	0.655000	0.94253	CGC		0.547	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441		Missense_Mutation
MFAP3L	9848	broad.mit.edu	37	4	170913402	170913402	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr4:170913402G>T	ENST00000361618.3	-	3	664	c.357C>A	c.(355-357)gaC>gaA	p.D119E	RP11-6E9.4_ENST00000508955.1_RNA|MFAP3L_ENST00000393704.3_Missense_Mutation_p.D16E	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	119	Ig-like C2-type.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D119E(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		ATTTACCTCGGTCTGAGAAGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	4											115.0	100.0	105.0					4																	170913402		2203	4300	6503	171149977	SO:0001583	missense	9848			AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.357C>A	4.37:g.170913402G>T	ENSP00000354583:p.Asp119Glu		171149977	A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Missense_Mutation	SNP	ENST00000361618.3	37	CCDS34103.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	17.65	3.441270	0.63067	.	.	ENSG00000198948	ENST00000393704;ENST00000361618;ENST00000512698;ENST00000502832;ENST00000507601	T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46	5.68	3.95	0.45737	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.91085	0.7194	M	0.93550	3.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91188	0.4981	10	0.87932	D	0	-14.607	10.0887	0.42434	0.2136:0.0:0.7864:0.0	.	119	O75121	MFA3L_HUMAN	E	16;119;16;16;16	ENSP00000377307:D16E;ENSP00000354583:D119E;ENSP00000422791:D16E;ENSP00000423722:D16E;ENSP00000423802:D16E	ENSP00000354583:D119E	D	-	3	2	MFAP3L	171149977	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	3.511000	0.53400	0.751000	0.32900	0.650000	0.86243	GAC		0.507	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363043.2	NM_021647		Missense_Mutation
SLC6A18	348932	broad.mit.edu	37	5	1232360	1232360	+	Missense_Mutation	SNP	G	G	A	rs140475239		TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr5:1232360G>A	ENST00000324642.3	+	2	310	c.187G>A	c.(187-189)Gcg>Acg	p.A63T	SLC6A18_ENST00000296821.4_Missense_Mutation_p.A63T	NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	63					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)	p.A63T(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CTACGTCATCGCGCTGGTCTT	0.701																																																1	Substitution - Missense(1)	ovary(1)	5						G	THR/ALA	0,4406		0,0,2203	45.0	45.0	45.0		187	5.4	0.9	5	dbSNP_134	45	1,8599		0,1,4299	no	missense	SLC6A18	NM_182632.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	63/629	1232360	1,13005	2203	4300	6503	1285360	SO:0001583	missense	348932			AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.187G>A	5.37:g.1232360G>A	ENSP00000323549:p.Ala63Thr		1285360		Missense_Mutation	SNP	ENST00000324642.3	37	CCDS3860.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163485	0.78226	0.0	1.16E-4	ENSG00000164363	ENST00000324642;ENST00000296821	T;T	0.75589	-0.95;-0.95	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.83280	0.5220	L	0.60067	1.865	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.79857	-0.1626	10	0.25106	T	0.35	.	17.0443	0.86498	0.0:0.0:1.0:0.0	.	63	Q96N87	S6A18_HUMAN	T	63	ENSP00000323549:A63T;ENSP00000296821:A63T	ENSP00000296821:A63T	A	+	1	0	SLC6A18	1285360	1.000000	0.71417	0.905000	0.35620	0.004000	0.04260	4.775000	0.62346	2.560000	0.86352	0.491000	0.48974	GCG		0.701	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206728.3	NM_182632		Missense_Mutation
PRDM9	56979	broad.mit.edu	37	5	23526345	23526345	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1329-01	TCGA-25-1329-10			C	G	C	C	Unknown	Valid	Somatic	x	x	454_PCR_WGA			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr5:23526345C>G	ENST00000296682.3	+	11	1330	c.1148C>G	c.(1147-1149)cCa>cGa	p.P383R		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	383					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.P383R(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CTTTCAGAACCAAAGCCAGAG	0.408										HNSCC(3;0.000094)																																						1	Substitution - Missense(1)	ovary(1)	5											93.0	91.0	92.0					5																	23526345		2203	4297	6500	23562102	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1148C>G	5.37:g.23526345C>G	ENSP00000296682:p.Pro383Arg		23562102	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	3.034	-0.198966	0.06219	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.09073	3.02	3.65	0.592	0.17471	.	0.459509	0.16272	N	0.221745	T	0.05273	0.0140	L	0.38838	1.175	0.09310	N	1	P	0.40476	0.718	B	0.39299	0.296	T	0.32587	-0.9901	10	0.12430	T	0.62	0.6291	3.4144	0.07371	0.2004:0.5571:0.0:0.2425	.	383	Q9NQV7	PRDM9_HUMAN	R	383;177	ENSP00000296682:P383R	ENSP00000253473:P177R	P	+	2	0	PRDM9	23562102	0.808000	0.29022	0.001000	0.08648	0.089000	0.18198	-0.057000	0.11768	-0.040000	0.13580	0.505000	0.49811	CCA		0.408	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		Missense_Mutation
MOG	4340	broad.mit.edu	37	6	29640604	29640604	+	IGR	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr6:29640604G>A	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376883.1_Silent_p.V408V|ZFP57_ENST00000488757.1_Silent_p.V428V|ZFP57_ENST00000376881.3_Silent_p.V408V	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V408V(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						GCTGGTGTCTGACCAGCCTGG	0.537																																																2	Substitution - coding silent(2)	ovary(1)|endometrium(1)	6											172.0	181.0	178.0					6																	29640604		1270	2584	3854	29748583	SO:0001628	intergenic_variant	346171				CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29640604G>A			29748583	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Silent	SNP	ENST00000376917.3	37	CCDS34370.1	SNP	45	Broad																																																																																				0.537	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433		Silent
VWA7	80737	broad.mit.edu	37	6	31734090	31734090	+	Silent	SNP	C	C	T	rs144453409		TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr6:31734090C>T	ENST00000375688.4	-	15	2456	c.2256G>A	c.(2254-2256)tcG>tcA	p.S752S	VWA7_ENST00000467576.1_5'UTR|VWA7_ENST00000375686.3_Silent_p.S752S|SAPCD1-AS1_ENST00000419679.1_RNA			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	752						extracellular region (GO:0005576)		p.S752S(1)									CCTGAGGGCCCGAGAAGCTGG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	6						C		0,3020		0,0,1510	36.0	30.0	32.0		2256	-9.1	0.0	6	dbSNP_134	32	1,5417		0,1,2708	no	coding-synonymous	C6orf27	NM_025258.2		0,1,4218	TT,TC,CC		0.0185,0.0,0.0119		752/892	31734090	1,8437	1510	2709	4219	31842069	SO:0001819	synonymous_variant	80737				CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.2256G>A	6.37:g.31734090C>T			31842069	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Silent	SNP	ENST00000375688.4	37	CCDS4721.2	SNP	23	Broad																																																																																				0.612	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258		Silent
CENPQ	55166	broad.mit.edu	37	6	49448716	49448716	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr6:49448716T>G	ENST00000335783.3	+	6	494	c.400T>G	c.(400-402)Tta>Gta	p.L134V		NM_018132.3	NP_060602.2	Q7L2Z9	CENPQ_HUMAN	centromere protein Q	134					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.L134V(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(4)|ovary(2)|prostate(1)	11	Lung NSC(77;0.0128)					GATGGAAGATTTAACTAATGT	0.328																																																1	Substitution - Missense(1)	ovary(1)	6											100.0	104.0	103.0					6																	49448716		2203	4300	6503	49556675	SO:0001583	missense	55166			AK001407	CCDS4925.1	6p12.3	2013-11-05	2006-06-15	2006-06-15	ENSG00000031691	ENSG00000031691			21347	protein-coding gene	gene with protein product		611506	"""chromosome 6 open reading frame 139"""	C6orf139		16622420, 16622419	Standard	NM_018132		Approved	FLJ10545, CENP-Q	uc003ozh.1	Q7L2Z9	OTTHUMG00000014815	ENST00000335783.3:c.400T>G	6.37:g.49448716T>G	ENSP00000337289:p.Leu134Val		49556675	A8KAF1|Q6IN61|Q9NVS5	Missense_Mutation	SNP	ENST00000335783.3	37	CCDS4925.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	13.62	2.291800	0.40594	.	.	ENSG00000031691	ENST00000335783;ENST00000371200	T	0.40476	1.03	5.83	1.69	0.24217	.	0.315538	0.28349	N	0.015673	T	0.38348	0.1037	M	0.76002	2.32	0.31749	N	0.634788	D	0.61080	0.989	P	0.60345	0.873	T	0.28459	-1.0043	10	0.62326	D	0.03	-3.2172	3.5561	0.07865	0.0:0.2282:0.195:0.5767	.	134	Q7L2Z9	CENPQ_HUMAN	V	134	ENSP00000337289:L134V	ENSP00000337289:L134V	L	+	1	2	CENPQ	49556675	0.838000	0.29461	0.941000	0.38009	0.093000	0.18481	0.291000	0.18994	0.525000	0.28522	0.524000	0.50904	TTA		0.328	CENPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040855.2	NM_018132		Missense_Mutation
CHN2	1124	broad.mit.edu	37	7	29546871	29546871	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr7:29546871A>T	ENST00000222792.6	+	11	1549	c.1019A>T	c.(1018-1020)aAt>aTt	p.N340I	CHN2_ENST00000421775.2_Missense_Mutation_p.N146I|CHN2_ENST00000435288.2_Intron|CHN2_ENST00000539389.1_Missense_Mutation_p.N196I|CHN2_ENST00000409041.4_Missense_Mutation_p.N204I|CHN2_ENST00000410098.1_3'UTR|CHN2_ENST00000424025.2_Missense_Mutation_p.N159I|CHN2_ENST00000495789.2_Missense_Mutation_p.N353I|CHN2_ENST00000439711.2_Intron|CHN2_ENST00000539406.1_Missense_Mutation_p.N415I|CHN2_ENST00000546235.1_Missense_Mutation_p.N325I	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	340	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)	p.N340I(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						ATATCTGCCAATGTCTATCCA	0.373																																					Ovarian(1;44 48 13232 18918 31480)											1	Substitution - Missense(1)	ovary(1)	7											109.0	102.0	104.0					7																	29546871		2203	4300	6503	29513396	SO:0001583	missense	1124			L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.1019A>T	7.37:g.29546871A>T	ENSP00000222792:p.Asn340Ile		29513396	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	ENST00000222792.6	37	CCDS5420.1	SNP	4	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.97|12.97	2.097771|2.097771	0.37048|0.37048	.|.	.|.	ENSG00000106069|ENSG00000106069	ENST00000433720|ENST00000539406;ENST00000222792;ENST00000495789;ENST00000539389;ENST00000546235;ENST00000446446;ENST00000409041;ENST00000424025;ENST00000421775	.|T;T;T;T;T;T;T;T;T	.|0.10573	.|2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86	5.41|5.41	1.77|1.77	0.24775|0.24775	.|Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	.|0.362897	.|0.36893	.|N	.|0.002360	T|T	0.12347|0.12347	0.0300|0.0300	M|M	0.63169|0.63169	1.94|1.94	0.46725|0.46725	D|D	0.999177|0.999177	.|B;B;B;B;B;B;B;B;B;B	.|0.27166	.|0.045;0.013;0.029;0.098;0.17;0.001;0.016;0.003;0.17;0.003	.|B;B;B;B;B;B;B;B;B;B	.|0.35182	.|0.025;0.021;0.008;0.029;0.197;0.012;0.017;0.006;0.197;0.006	T|T	0.06006|0.06006	-1.0851|-1.0851	5|10	.|0.38643	.|T	.|0.18	.|.	5.2877|5.2877	0.15710|0.15710	0.5622:0.1446:0.2933:0.0|0.5622:0.1446:0.2933:0.0	.|.	.|133;325;353;415;159;146;196;340;204;340	.|B7Z215;B7Z1W9;B7Z1V0;F5H003;B3VCF1;B3VCF3;B3VCG1;A4D1A2;E9PGE0;P52757	.|.;.;.;.;.;.;.;.;.;CHIO_HUMAN	L|I	19|415;340;353;196;325;165;204;159;146	.|ENSP00000444063:N415I;ENSP00000222792:N340I;ENSP00000438587:N353I;ENSP00000440526:N196I;ENSP00000442812:N325I;ENSP00000396867:N165I;ENSP00000386849:N204I;ENSP00000406337:N159I;ENSP00000394284:N146I	.|ENSP00000222792:N340I	M|N	+|+	1|2	0|0	CHN2|CHN2	29513396|29513396	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.905000|0.905000	0.53344|0.53344	0.877000|0.877000	0.28106|0.28106	0.452000|0.452000	0.26830|0.26830	-0.297000|-0.297000	0.09499|0.09499	ATG|AAT		0.373	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067		Missense_Mutation
RSBN1L	222194	broad.mit.edu	37	7	77325800	77325800	+	Missense_Mutation	SNP	C	C	T	rs375776456		TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr7:77325800C>T	ENST00000334955.8	+	1	41	c.14C>T	c.(13-15)cCg>cTg	p.P5L	RSBN1L_ENST00000445288.1_5'Flank|RSBN1L-AS1_ENST00000440088.1_lincRNA	NM_198467.2	NP_940869.2	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	5						nucleus (GO:0005634)		p.P5L(1)		central_nervous_system(1)|endometrium(12)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCGGAACCGCCGAGCCCCGTG	0.697																																																1	Substitution - Missense(1)	ovary(1)	7											49.0	65.0	60.0					7																	77325800		1883	4097	5980	77163736	SO:0001583	missense	222194			AK124517	CCDS43607.1	7q21.11	2004-08-11			ENSG00000187257	ENSG00000187257			24765	protein-coding gene	gene with protein product						12477932	Standard	NM_198467		Approved	FLJ42526, FLJ45813, MGC71764	uc010ldt.1	Q6PCB5	OTTHUMG00000155517	ENST00000334955.8:c.14C>T	7.37:g.77325800C>T	ENSP00000334040:p.Pro5Leu		77163736	C9K0P1|Q6ZS58|Q6ZVI9|Q86X48	Missense_Mutation	SNP	ENST00000334955.8	37	CCDS43607.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	15.44	2.835138	0.50951	.	.	ENSG00000187257	ENST00000334955	.	.	.	4.16	2.32	0.28847	.	0.000000	0.37437	N	0.002095	T	0.38161	0.1030	N	0.24115	0.695	0.80722	D	1	B	0.22983	0.078	B	0.12837	0.008	T	0.25152	-1.0140	9	0.48119	T	0.1	-6.9048	7.731	0.28788	0.0:0.7863:0.0:0.2137	.	5	Q6PCB5	RSBNL_HUMAN	L	5	.	ENSP00000334040:P5L	P	+	2	0	RSBN1L	77163736	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	0.780000	0.26760	1.076000	0.40961	0.467000	0.42956	CCG		0.697	RSBN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340455.3	NM_198467		Missense_Mutation
TNFRSF10A	8797	broad.mit.edu	37	8	23060238	23060238	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1329-01	TCGA-25-1329-10			C	T	C	C	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr8:23060238C>T	ENST00000221132.3	-	3	504	c.440G>A	c.(439-441)cGg>cAg	p.R147Q		NM_003844.3	NP_003835.3	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily, member 10a	147					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|signal transduction (GO:0007165)|TRAIL-activated apoptotic signaling pathway (GO:0036462)	integral component of membrane (GO:0016021)	death receptor activity (GO:0005035)|protease binding (GO:0002020)|receptor activity (GO:0004872)|TRAIL binding (GO:0045569)|transcription factor binding (GO:0008134)	p.R147Q(1)		NS(2)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|skin(1)	16		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)		CTCTGTGCACCGGTTACAGGC	0.493																																																1	Substitution - Missense(1)	ovary(1)	8											172.0	155.0	161.0					8																	23060238		2203	4300	6503	23116183	SO:0001583	missense	8797			U90875	CCDS6039.1	8p21	2006-02-22			ENSG00000104689	ENSG00000104689		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11904	protein-coding gene	gene with protein product		603611				9311998, 9082980	Standard	NM_003844		Approved	DR4, Apo2, TRAILR-1, CD261	uc003xda.3	O00220	OTTHUMG00000097843	ENST00000221132.3:c.440G>A	8.37:g.23060238C>T	ENSP00000221132:p.Arg147Gln		23116183	A8K5I4|Q53Y72|Q96E62	Missense_Mutation	SNP	ENST00000221132.3	37	CCDS6039.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	c	4.690	0.128217	0.08981	.	.	ENSG00000104689	ENST00000221132	T	0.41065	1.01	3.48	-4.43	0.03568	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.646185	0.14385	N	0.322862	T	0.14270	0.0345	N	0.03608	-0.345	0.09310	N	1	B	0.14805	0.011	B	0.09377	0.004	T	0.07404	-1.0774	10	0.46703	T	0.11	.	3.8322	0.08879	0.0926:0.1255:0.2047:0.5772	.	147	O00220	TR10A_HUMAN	Q	147	ENSP00000221132:R147Q	ENSP00000221132:R147Q	R	-	2	0	TNFRSF10A	23116183	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.595000	0.00896	-0.987000	0.03494	-3.468000	0.00035	CGG		0.493	TNFRSF10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215133.2	NM_003844		Missense_Mutation
SLC25A51	92014	broad.mit.edu	37	9	37888379	37888379	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr9:37888379G>A	ENST00000377716.2	-	3	912	c.169C>T	c.(169-171)Cga>Tga	p.R57*	SLC25A51_ENST00000242275.6_Nonsense_Mutation_p.R57*|SLC25A51_ENST00000380590.3_Nonsense_Mutation_p.R57*|SLC25A51_ENST00000496760.1_Intron|RP11-613M10.9_ENST00000540557.1_Intron			Q9H1U9	S2551_HUMAN	solute carrier family 25, member 51	57					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.R57*(1)									AGCTGTTGTCGAAAGAGGACC	0.438																																																1	Substitution - Nonsense(1)	ovary(1)	9											113.0	103.0	107.0					9																	37888379		2203	4300	6503	37878379	SO:0001587	stop_gained	92014			BC008500	CCDS6614.1	9p13.3-p12	2013-05-22	2012-03-29	2012-03-29	ENSG00000122696	ENSG00000122696		"""Solute carriers"""	23323	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 1"""	MCART1		12477932	Standard	NM_033412		Approved	MGC14836, CG7943	uc004aav.2	Q9H1U9	OTTHUMG00000019935	ENST00000377716.2:c.169C>T	9.37:g.37888379G>A	ENSP00000366945:p.Arg57*		37878379		Nonsense_Mutation	SNP	ENST00000377716.2	37	CCDS6614.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	.	39	7.595383	0.98381	.	.	ENSG00000122696	ENST00000380590;ENST00000377716;ENST00000242275	.	.	.	4.84	1.86	0.25419	.	0.278292	0.29335	N	0.012460	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8855	0.52600	0.0:0.0:0.5431:0.4569	.	.	.	.	X	57	.	ENSP00000242275:R57X	R	-	1	2	MCART1	37878379	1.000000	0.71417	0.820000	0.32676	0.177000	0.22998	5.253000	0.65452	0.089000	0.17243	-0.302000	0.09304	CGA		0.438	SLC25A51-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313746.1	NM_033412		Nonsense_Mutation
PRPF4	9128	broad.mit.edu	37	9	116053834	116053834	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1329-01	TCGA-25-1329-10			T	A	T	T	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr9:116053834T>A	ENST00000374198.4	+	14	1565	c.1463T>A	c.(1462-1464)cTg>cAg	p.L488Q	PRPF4_ENST00000374199.4_Missense_Mutation_p.L487Q	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	488					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)		p.L488Q(1)		NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						CTGAAGACTCTGGCTGGCCAC	0.527																																																1	Substitution - Missense(1)	ovary(1)	9											96.0	91.0	93.0					9																	116053834		2203	4300	6503	115093655	SO:0001583	missense	9128			AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.1463T>A	9.37:g.116053834T>A	ENSP00000363313:p.Leu488Gln		115093655	O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Missense_Mutation	SNP	ENST00000374198.4	37	CCDS6791.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	24.3	4.512013	0.85389	.	.	ENSG00000136875	ENST00000374199;ENST00000374198	T;T	0.68479	-0.33;-0.33	5.95	5.95	0.96441	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.86822	0.6025	H	0.94734	3.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90355	0.4369	10	0.87932	D	0	.	15.6048	0.76658	0.0:0.0:0.0:1.0	.	503;488	Q59EL4;O43172	.;PRP4_HUMAN	Q	487;488	ENSP00000363315:L487Q;ENSP00000363313:L488Q	ENSP00000363313:L488Q	L	+	2	0	PRPF4	115093655	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.375000	0.79646	2.279000	0.76181	0.533000	0.62120	CTG		0.527	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053708.2	NM_004697		Missense_Mutation
COL5A1	1289	broad.mit.edu	37	9	137716496	137716496	+	Silent	SNP	G	G	A			TCGA-25-1329-01	TCGA-25-1329-10			G	A	G	G	Unknown	Valid	Somatic	x	x	Sequenom_PCR_WGA			x	TCGA-25-1329-01	TCGA-25-1329-10	g.chr9:137716496G>A	ENST00000371817.3	+	62	5163	c.4749G>A	c.(4747-4749)acG>acA	p.T1583T		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1583	Nonhelical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.T1583T(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CATCCAGGACGCGGCGGAACA	0.642																																																1	Substitution - coding silent(1)	ovary(1)	9											53.0	46.0	48.0					9																	137716496		2203	4300	6503	136856317	SO:0001819	synonymous_variant	1289			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4749G>A	9.37:g.137716496G>A			136856317	Q15094|Q5SUX4	Silent	SNP	ENST00000371817.3	37	CCDS6982.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	10.47	1.359271	0.24598	.	.	ENSG00000130635	ENST00000371820	.	.	.	4.21	-3.22	0.05125	.	.	.	.	.	T	0.47488	0.1448	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41822	-0.9487	4	.	.	.	.	5.1196	0.14852	0.0909:0.1444:0.5596:0.2051	.	.	.	.	T	3	.	.	A	+	1	0	COL5A1	136856317	0.004000	0.15560	0.235000	0.24058	0.913000	0.54294	-1.368000	0.02580	-0.404000	0.07610	0.442000	0.29010	GCG		0.642	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093		Silent
TP53	7157	broad.mit.edu	37	17	7579547	7579547	+	Frame_Shift_Del	DEL	G	G	-			TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-25-1329-01	TCGA-25-1329-10	g.chr17:7579547delG	ENST00000269305.4	-	4	329	c.140delC	c.(139-141)ccgfs	p.P47fs	TP53_ENST00000420246.2_Frame_Shift_Del_p.P47fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.P47fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.P47fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.P47fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.P47fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	47	Interaction with HRMT1L2.		P -> L (in sporadic cancers; somatic mutation).|P -> S (in dbSNP:rs1800371). {ECO:0000269|Ref.12}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.P47fs*76(5)|p.P47fs*4(2)|p.P47L(2)|p.D48fs*55(1)|p.P13fs*18(1)|p.S46_D49delSPDD(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AATATCGTCCGGGGACAGCAT	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	21	Deletion - Frameshift(10)|Whole gene deletion(8)|Substitution - Missense(2)|Deletion - In frame(1)	lung(5)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)|prostate(1)|liver(1)	17											171.0	169.0	169.0					17																	7579547		2203	4300	6503	7520272	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.140delC	17.37:g.7579547delG	ENSP00000269305:p.Pro47fs		7520272	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	39	Broad																																																																																				0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Del
CEACAM18	729767	broad.mit.edu	37	19	51983818	51983819	+	Frame_Shift_Del	DEL	AC	AC	-	rs374372954		TCGA-25-1329-01	TCGA-25-1329-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-25-1329-01	TCGA-25-1329-10	g.chr19:51983818_51983819delAC	ENST00000396477.4	+	2	305_306	c.284_285delAC	c.(283-285)aacfs	p.N95fs	CEACAM18_ENST00000451626.1_Frame_Shift_Del_p.N156fs	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	95										breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GAGAGAGTGAACAGAGAAGGCA	0.554																																																0			19																																								56675631	SO:0001589	frameshift_variant	729767					19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.284_285delAC	19.37:g.51983818_51983819delAC	ENSP00000379738:p.Asn95fs		56675630	C9JN24	Frame_Shift_Del	DEL	ENST00000396477.4	37		DEL	2	Broad																																																																																				0.554	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000323114.2			Frame_Shift_Del
