#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACSL4	2182	hgsc.bcm.edu	37	X	108924290	108924290	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1630-01	TCGA-25-1630-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chrX:108924290G>T	ENST00000469796.2	-	6	1111	c.715C>A	c.(715-717)Cct>Act	p.P239T	ACSL4_ENST00000348502.6_Missense_Mutation_p.P198T|ACSL4_ENST00000340800.2_Missense_Mutation_p.P239T			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	239					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.P239T(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	AATCCTTCAGGGTACTCTGCT	0.333																																					Pancreas(188;358 2127 38547 41466 45492)											1	Substitution - Missense(1)	ovary(1)	X											127.0	114.0	118.0					X																	108924290		2203	4300	6503	108810946	SO:0001583	missense	2182			BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.715C>A	X.37:g.108924290G>T	ENSP00000419171:p.Pro239Thr		108810946	D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	ENST00000469796.2	37	CCDS14548.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889018	0.72524	.	.	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800	T;T;T	0.10192	2.9;2.9;2.9	6.04	5.15	0.70609	AMP-dependent synthetase/ligase (1);	0.096948	0.64402	D	0.000001	T	0.27134	0.0665	L	0.48935	1.535	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00270	-1.1860	10	0.45353	T	0.12	-14.3553	16.3784	0.83418	0.0:0.1275:0.8725:0.0	.	239	O60488	ACSL4_HUMAN	T	198;239;239	ENSP00000262835:P198T;ENSP00000419171:P239T;ENSP00000339787:P239T	ENSP00000339787:P239T	P	-	1	0	ACSL4	108810946	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	9.476000	0.97823	2.555000	0.86185	0.513000	0.50165	CCT		0.333	ACSL4-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358155.2	NM_004458		Missense_Mutation
ADCY2	108	hgsc.bcm.edu	37	5	7712980	7712980	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1630-01	TCGA-25-1630-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr5:7712980G>T	ENST00000338316.4	+	11	1679	c.1590G>T	c.(1588-1590)atG>atT	p.M530I	ADCY2_ENST00000537121.1_Missense_Mutation_p.M350I|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	530					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.M530I(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						ATGTACCCATGGGTCAGCATA	0.299																																																1	Substitution - Missense(1)	ovary(1)	5											121.0	117.0	118.0					5																	7712980		2203	4300	6503	7765980	SO:0001583	missense	108			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1590G>T	5.37:g.7712980G>T	ENSP00000342952:p.Met530Ile		7765980	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035832	0.54896	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;T	0.76316	-1.01;-1.01	5.88	5.88	0.94601	.	0.134749	0.64402	D	0.000003	T	0.70842	0.3270	L	0.34521	1.04	0.50632	D	0.999883	B;B	0.06786	0.0;0.001	B;B	0.11329	0.006;0.004	T	0.63310	-0.6666	10	0.33940	T	0.23	.	18.4219	0.90594	0.0:0.0:1.0:0.0	.	350;530	B7Z2C1;Q08462	.;ADCY2_HUMAN	I	530;363;350	ENSP00000342952:M530I;ENSP00000444803:M350I	ENSP00000342952:M530I	M	+	3	0	ADCY2	7765980	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.535000	0.67173	2.777000	0.95525	0.551000	0.68910	ATG		0.299	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		Missense_Mutation
APEX1	328	hgsc.bcm.edu	37	14	20925434	20925434	+	Nonsense_Mutation	SNP	G	G	T			TCGA-25-1630-01	TCGA-25-1630-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr14:20925434G>T	ENST00000216714.3	+	5	992	c.724G>T	c.(724-726)Gaa>Taa	p.E242*	APEX1_ENST00000398030.4_Nonsense_Mutation_p.E242*|OSGEP_ENST00000556252.1_5'Flank|APEX1_ENST00000557054.1_3'UTR|OSGEP_ENST00000206542.4_5'Flank|APEX1_ENST00000557365.1_3'UTR|APEX1_ENST00000555414.1_Nonsense_Mutation_p.E242*	NM_001244249.1|NM_001641.3	NP_001231178.1|NP_001632.2	P27695	APEX1_HUMAN	APEX nuclease (multifunctional DNA repair enzyme) 1	242					aging (GO:0007568)|base-excision repair (GO:0006284)|cell redox homeostasis (GO:0045454)|cellular response to cAMP (GO:0071320)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to peptide hormone stimulus (GO:0071375)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA demethylation (GO:0080111)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|negative regulation of smooth muscle cell migration (GO:0014912)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oxidation-reduction process (GO:0055114)|positive regulation of DNA repair (GO:0045739)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribosome (GO:0005840)|transcription factor complex (GO:0005667)	3'-5' exonuclease activity (GO:0008408)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|phosphodiesterase I activity (GO:0004528)|phosphoric diester hydrolase activity (GO:0008081)|poly(A) RNA binding (GO:0044822)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|uracil DNA N-glycosylase activity (GO:0004844)	p.E242*(1)		breast(2)|endometrium(1)|large_intestine(4)|ovary(2)	9	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)	Lucanthone(DB04967)	AGGCTTCGGGGAATTACTGCA	0.512								Other BER factors																																								1	Substitution - Nonsense(1)	ovary(1)	14											129.0	115.0	120.0					14																	20925434		2203	4300	6503	19995274	SO:0001587	stop_gained	328			X59764	CCDS9550.1	14q11.2	2008-02-05	2002-09-11	2002-09-13	ENSG00000100823	ENSG00000100823	4.2.99.18		587	protein-coding gene	gene with protein product		107748	"""APEX nuclease (multifunctional DNA repair enzyme)"""	APEX			Standard	NM_001641		Approved	APE, REF1, HAP1, APX, APEN, REF-1, APE-1	uc021rnr.1	P27695	OTTHUMG00000029544	ENST00000216714.3:c.724G>T	14.37:g.20925434G>T	ENSP00000216714:p.Glu242*		19995274	Q969L5|Q99775	Nonsense_Mutation	SNP	ENST00000216714.3	37	CCDS9550.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	33	5.195055	0.94960	.	.	ENSG00000100823	ENST00000555414;ENST00000216714;ENST00000553681;ENST00000398030;ENST00000555839	.	.	.	5.79	4.9	0.64082	.	0.051090	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	10.6645	0.45721	0.1536:0.0:0.8464:0.0	.	.	.	.	X	242;242;242;242;213	.	ENSP00000216714:E242X	E	+	1	0	APEX1	19995274	1.000000	0.71417	0.967000	0.41034	0.994000	0.84299	2.625000	0.46452	1.457000	0.47850	0.655000	0.94253	GAA		0.512	APEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073641.3	NM_001641		Nonsense_Mutation
APLF	200558	hgsc.bcm.edu	37	2	68740805	68740805	+	Silent	SNP	C	C	T			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr2:68740805C>T	ENST00000303795.4	+	5	786	c.615C>T	c.(613-615)atC>atT	p.I205I		NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	205					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.I205I(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						TACCAGCAATCAGTGGAGGTA	0.358																																																1	Substitution - coding silent(1)	ovary(1)	2											85.0	86.0	86.0					2																	68740805		2203	4299	6502	68594309	SO:0001819	synonymous_variant	200558			BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.615C>T	2.37:g.68740805C>T			68594309	A8K476|Q53P47|Q53PB9|Q53QU0	Silent	SNP	ENST00000303795.4	37	CCDS1888.1	SNP	29	Baylor																																																																																				0.358	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1	NM_173545		Silent
ATG3	64422	hgsc.bcm.edu	37	3	112269052	112269052	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr3:112269052C>G	ENST00000283290.5	-	4	656	c.222G>C	c.(220-222)ttG>ttC	p.L74F	ATG3_ENST00000495756.1_5'UTR|ATG3_ENST00000402314.2_Missense_Mutation_p.L74F	NM_022488.3	NP_071933.2	Q9NT62	ATG3_HUMAN	autophagy related 3	74					autophagic vacuole assembly (GO:0000045)|cellular protein modification process (GO:0006464)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)|protein targeting to membrane (GO:0006612)|protein ubiquitination (GO:0016567)|regulation of cilium assembly (GO:1902017)	cytoplasmic ubiquitin ligase complex (GO:0000153)|cytosol (GO:0005829)	Atg12 ligase activity (GO:0019777)|Atg8 ligase activity (GO:0019776)|enzyme binding (GO:0019899)|small conjugating protein ligase activity (GO:0019787)	p.L74F(1)		breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(3)	9						TTTTGGTTACCAAAAATTGTT	0.308																																																1	Substitution - Missense(1)	ovary(1)	3											119.0	116.0	117.0					3																	112269052		2203	4298	6501	113751742	SO:0001583	missense	64422				CCDS2966.1, CCDS63721.1	3q13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000144848	ENSG00000144848			20962	protein-coding gene	gene with protein product		609606	"""APG3 autophagy 3-like (S. cerevisiae)"", ""ATG3 autophagy related 3 homolog (S. cerevisiae)"""	APG3L		11825910	Standard	NM_022488		Approved	PC3-96, FLJ22125, MGC15201, DKFZp564M1178	uc003dzd.3	Q9NT62	OTTHUMG00000159260	ENST00000283290.5:c.222G>C	3.37:g.112269052C>G	ENSP00000283290:p.Leu74Phe		113751742	Q6PKC5|Q9H6L9	Missense_Mutation	SNP	ENST00000283290.5	37	CCDS2966.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.98	2.398046	0.42512	.	.	ENSG00000144848	ENST00000283290;ENST00000402314	.	.	.	5.93	5.93	0.95920	Autophagy-related protein 3, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85448	0.5699	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88162	0.2858	9	0.87932	D	0	-17.4034	12.4449	0.55645	0.0:0.9227:0.0:0.0773	.	74;74	Q9NT62;Q9NT62-2	ATG3_HUMAN;.	F	74	.	ENSP00000283290:L74F	L	-	3	2	ATG3	113751742	1.000000	0.71417	1.000000	0.80357	0.102000	0.19082	1.372000	0.34261	2.815000	0.96918	0.561000	0.74099	TTG		0.308	ATG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354147.1	NM_022488		Missense_Mutation
BEND3	57673	hgsc.bcm.edu	37	6	107390067	107390067	+	Silent	SNP	C	C	T			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr6:107390067C>T	ENST00000369042.1	-	4	2518	c.2328G>A	c.(2326-2328)cgG>cgA	p.R776R	BEND3_ENST00000429433.2_Silent_p.R776R			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	776	BEN 4. {ECO:0000255|PROSITE- ProRule:PRU00784}.							p.R776R(1)		central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						TGAGCCGCAGCCGCGTGGGGT	0.607																																																1	Substitution - coding silent(1)	ovary(1)	6											52.0	52.0	52.0					6																	107390067		2202	4300	6502	107496760	SO:0001819	synonymous_variant	57673			AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.2328G>A	6.37:g.107390067C>T			107496760	A2RRH2|Q9HCL9	Silent	SNP	ENST00000369042.1	37	CCDS34507.1	SNP	26	Baylor																																																																																				0.607	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	NM_020913		Silent
BRCA1	672	hgsc.bcm.edu	37	17	41245991	41245991	+	Frame_Shift_Del	DEL	C	C	-	rs80357662		TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr17:41245991delC	ENST00000357654.3	-	10	1675	c.1557delG	c.(1555-1557)aagfs	p.K520fs	BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000471181.2_Frame_Shift_Del_p.K520fs|BRCA1_ENST00000493795.1_Frame_Shift_Del_p.K473fs|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000309486.4_Frame_Shift_Del_p.K224fs|BRCA1_ENST00000346315.3_Frame_Shift_Del_p.K520fs|BRCA1_ENST00000354071.3_Frame_Shift_Del_p.K520fs	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	520					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A521fs*11(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AATCTGCTTTCTTGATAAAAT	0.393			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	1	Deletion - Frameshift(1)	ovary(1)	17											66.0	62.0	63.0					17																	41245991		2203	4300	6503	38499517	SO:0001589	frameshift_variant	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.1557delG	17.37:g.41245991delC	ENSP00000350283:p.Lys520fs		38499517	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Frame_Shift_Del	DEL	ENST00000357654.3	37	CCDS11453.1	DEL	32	Baylor																																																																																				0.393	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294		Frame_Shift_Del
CAT	847	hgsc.bcm.edu	37	11	34482828	34482828	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr11:34482828C>T	ENST00000241052.4	+	9	1176	c.1087C>T	c.(1087-1089)Cgc>Tgc	p.R363C		NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase	363					aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R363C(1)		breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	TGACACTCACCGCCATCGCCT	0.502																																																1	Substitution - Missense(1)	ovary(1)	11											143.0	138.0	139.0					11																	34482828		2202	4298	6500	34439404	SO:0001583	missense	847			AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.1087C>T	11.37:g.34482828C>T	ENSP00000241052:p.Arg363Cys		34439404	A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	Missense_Mutation	SNP	ENST00000241052.4	37	CCDS7891.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.7	4.181182	0.78677	.	.	ENSG00000121691	ENST00000241052	D	0.93189	-3.18	4.98	4.07	0.47477	Catalase domain (1);Catalase, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.97964	0.9330	H	0.99590	4.645	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96868	0.9637	10	0.87932	D	0	-17.2675	8.345	0.32268	0.1931:0.7232:0.0:0.0836	.	363	P04040	CATA_HUMAN	C	363	ENSP00000241052:R363C	ENSP00000241052:R363C	R	+	1	0	CAT	34439404	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.965000	0.56788	1.104000	0.41587	0.557000	0.71058	CGC		0.502	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103197.2	NM_001752		Missense_Mutation
C11orf63	79864	hgsc.bcm.edu	37	11	122756572	122756572	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1630-01	TCGA-25-1630-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr11:122756572A>T	ENST00000531316.1	+	1	107	c.15A>T	c.(13-15)aaA>aaT	p.K5N	C11orf63_ENST00000307257.6_Missense_Mutation_p.K5N|C11orf63_ENST00000227349.2_Missense_Mutation_p.K5N			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	5					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)			p.K5N(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		GTAAACGTAAACTAATTCCCA	0.388																																																1	Substitution - Missense(1)	ovary(1)	11											72.0	75.0	74.0					11																	122756572		2202	4299	6501	122261782	SO:0001583	missense	79864			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.15A>T	11.37:g.122756572A>T	ENSP00000431669:p.Lys5Asn		122261782	A8K6G0|Q96GB5|Q9H5D6	Missense_Mutation	SNP	ENST00000531316.1	37	CCDS8438.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.09	1.833551	0.32421	.	.	ENSG00000109944	ENST00000307257;ENST00000227349;ENST00000531316	T;T	0.59906	0.23;0.23	5.91	2.31	0.28768	.	0.369558	0.23455	N	0.047999	T	0.66645	0.2810	M	0.65975	2.015	0.09310	N	1	D;D	0.63046	0.992;0.992	P;P	0.62298	0.859;0.9	T	0.57631	-0.7778	10	0.72032	D	0.01	-14.1772	7.0596	0.25119	0.7212:0.0:0.2788:0.0	.	5;5	Q6NUN7;Q6NUN7-2	CK063_HUMAN;.	N	5	ENSP00000227349:K5N;ENSP00000431669:K5N	ENSP00000227349:K5N	K	+	3	2	C11orf63	122261782	0.000000	0.05858	0.024000	0.17045	0.190000	0.23558	0.295000	0.19065	0.142000	0.18901	0.533000	0.62120	AAA		0.388	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806		Missense_Mutation
CCNH	902	hgsc.bcm.edu	37	5	86700747	86700747	+	Silent	SNP	C	C	T	rs371391295		TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr5:86700747C>T	ENST00000256897.4	-	5	827	c.603G>A	c.(601-603)acG>acA	p.T201T	CCNH_ENST00000504878.1_Silent_p.T127T|CCNH_ENST00000508855.1_Silent_p.T127T|CCNH_ENST00000513499.1_5'UTR	NM_001239.3	NP_001230.1	P51946	CCNH_HUMAN	cyclin H	201					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cyclin-dependent protein kinase activating kinase holoenzyme complex (GO:0019907)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|TFIIK complex (GO:0070985)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)	p.T201T(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(2)	15		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		GGTAAGCATCCGTCAATGCAA	0.388								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																																								1	Substitution - coding silent(1)	ovary(1)	5											94.0	95.0	94.0					5																	86700747		2203	4300	6503	86736503	SO:0001819	synonymous_variant	902			U12685	CCDS4064.1	5q13.3-q14	2014-03-28			ENSG00000134480	ENSG00000134480		"""General transcription factor IIH complex subunits"""	1594	protein-coding gene	gene with protein product	"""CDK-activating kinase complex subunit"", ""cyclin-dependent kinase-activating kinase complex subunit"", ""MO15-associated protein"", ""CAK complex subunit"""	601953				9465303	Standard	NM_001239		Approved	p34, p37, CycH	uc003kjb.3	P51946	OTTHUMG00000119077	ENST00000256897.4:c.603G>A	5.37:g.86700747C>T			86736503	Q53X72|Q8TBL9	Silent	SNP	ENST00000256897.4	37	CCDS4064.1	SNP	23	Baylor																																																																																				0.388	CCNH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239291.3	NM_001239		Silent
CHD1L	9557	hgsc.bcm.edu	37	1	146756124	146756124	+	Silent	SNP	T	T	C			TCGA-25-1630-01	TCGA-25-1630-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr1:146756124T>C	ENST00000369258.4	+	16	1826	c.1806T>C	c.(1804-1806)ctT>ctC	p.L602L	CHD1L_ENST00000369259.3_Silent_p.L398L|CHD1L_ENST00000361293.5_Silent_p.L321L|CHD1L_ENST00000431239.1_Silent_p.L508L|CHD1L_ENST00000467213.1_3'UTR	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	602					ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)	p.L602L(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					AGAAAACCCTTTTGGAGAAAG	0.338																																																1	Substitution - coding silent(1)	ovary(1)	1											95.0	98.0	97.0					1																	146756124		2203	4300	6503	145222748	SO:0001819	synonymous_variant	9557			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.1806T>C	1.37:g.146756124T>C			145222748	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Silent	SNP	ENST00000369258.4	37	CCDS927.1	SNP	64	Baylor																																																																																				0.338	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284		Silent
CORO2A	7464	hgsc.bcm.edu	37	9	100888858	100888858	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1630-01	TCGA-25-1630-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr9:100888858T>A	ENST00000343933.5	-	11	1676	c.1419A>T	c.(1417-1419)gaA>gaT	p.E473D	CORO2A_ENST00000375077.4_Missense_Mutation_p.E473D	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	473					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)	p.E473D(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				GTGGGGGGCATTCGAAAACGT	0.567																																																1	Substitution - Missense(1)	ovary(1)	9											116.0	120.0	119.0					9																	100888858		2203	4300	6503	99928679	SO:0001583	missense	7464			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.1419A>T	9.37:g.100888858T>A	ENSP00000343746:p.Glu473Asp		99928679	Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	ENST00000343933.5	37	CCDS6735.1	SNP	52	Baylor	.	.	.	.	.	.	.	.	.	.	T	21.2	4.118916	0.77323	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	T;T	0.73897	-0.79;-0.79	5.23	2.88	0.33553	.	0.386521	0.28209	N	0.016195	T	0.72195	0.3430	L	0.58810	1.83	0.34866	D	0.743108	P;P	0.51449	0.945;0.945	P;P	0.50537	0.643;0.643	T	0.74928	-0.3497	10	0.36615	T	0.2	-8.4159	5.9167	0.19059	0.0:0.3796:0.0:0.6204	.	473;473	Q92828;A8K9S3	COR2A_HUMAN;.	D	473	ENSP00000343746:E473D;ENSP00000364218:E473D	ENSP00000343746:E473D	E	-	3	2	CORO2A	99928679	0.709000	0.27886	0.996000	0.52242	0.991000	0.79684	-0.326000	0.07965	0.816000	0.34421	0.459000	0.35465	GAA		0.567	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053357.1	NM_003389		Missense_Mutation
EPS8L3	79574	hgsc.bcm.edu	37	1	110301725	110301725	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr1:110301725C>A	ENST00000361965.4	-	6	526	c.420G>T	c.(418-420)aaG>aaT	p.K140N	EPS8L3_ENST00000494151.1_5'UTR|EPS8L3_ENST00000361852.4_Missense_Mutation_p.K140N|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000369805.3_Missense_Mutation_p.K140N	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	140						cytoplasm (GO:0005737)		p.K140N(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		GCAGGCTGGTCTTCAGTCGCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											31.0	30.0	30.0					1																	110301725		2203	4300	6503	110103248	SO:0001583	missense	79574			AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.420G>T	1.37:g.110301725C>A	ENSP00000355255:p.Lys140Asn		110103248	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	CCDS814.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611788	0.66558	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.31247	1.5;1.5;1.5	5.24	5.24	0.73138	Tensin phosphotyrosine-binding domain (1);	1.138310	0.06029	N	0.652726	T	0.20129	0.0484	L	0.40543	1.245	0.09310	N	0.999994	B;P;B;B	0.39759	0.42;0.687;0.42;0.441	B;B;P;B	0.45610	0.329;0.432;0.487;0.307	T	0.28364	-1.0046	10	0.17369	T	0.5	-6.5598	14.6737	0.68964	0.0:1.0:0.0:0.0	.	140;140;140;140	A8K2J6;Q8TE67-2;Q8TE67;Q8TE67-3	.;.;ES8L3_HUMAN;.	N	140	ENSP00000354551:K140N;ENSP00000358820:K140N;ENSP00000355255:K140N	ENSP00000354551:K140N	K	-	3	2	EPS8L3	110103248	0.004000	0.15560	0.661000	0.29709	0.781000	0.44180	1.871000	0.39539	2.606000	0.88127	0.655000	0.94253	AAG		0.607	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526		Missense_Mutation
FCGBP	8857	hgsc.bcm.edu	37	19	40408821	40408821	+	Missense_Mutation	SNP	C	C	G	rs11083543	byFrequency	TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr19:40408821C>G	ENST00000221347.6	-	8	4025	c.4018G>C	c.(4018-4020)Gtg>Ctg	p.V1340L		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1340	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.		V -> L (in dbSNP:rs11083543).			extracellular vesicular exosome (GO:0070062)		p.V1340L(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCCAGCACCACGGGCAGCTTC	0.577													C|||	1291	0.257788	0.121	0.4092	5008	,	,		19419	0.2173		0.3608	False		,,,				2504	0.271															1	Substitution - Missense(1)	ovary(1)	19						C	LEU/VAL	611,3795		45,521,1637	23.0	20.0	21.0		4018	-0.1	0.0	19	dbSNP_120	21	2976,5622		523,1930,1846	yes	missense	FCGBP	NM_003890.2	32	568,2451,3483	GG,GC,CC		34.6127,13.8675,27.5838	probably-damaging	1340/5406	40408821	3587,9417	2203	4299	6502	45100661	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4018G>C	19.37:g.40408821C>G	ENSP00000221347:p.Val1340Leu		45100661	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	SNP	19	Baylor	624	0.2857142857142857	76	0.15447154471544716	148	0.4088397790055249	125	0.21853146853146854	275	0.3627968337730871	C	12.27	1.888760	0.33348	0.138675	0.346127	ENSG00000090920	ENST00000221347	T	0.58797	0.31	4.95	-0.14	0.13456	von Willebrand factor, type D domain (3);	0.451564	0.18780	N	0.131345	T	0.00012	0.0000	N	0.25031	0.7	0.80722	P	0.0	B	0.25235	0.121	B	0.21151	0.033	T	0.40232	-0.9574	9	0.11485	T	0.65	.	2.6779	0.05085	0.1375:0.4356:0.268:0.1589	rs11083543;rs11083543	1340	Q9Y6R7	FCGBP_HUMAN	L	1340	ENSP00000221347:V1340L	ENSP00000221347:V1340L	V	-	1	0	FCGBP	45100661	0.000000	0.05858	0.015000	0.15790	0.023000	0.10783	-0.881000	0.04179	0.120000	0.18254	-0.182000	0.12963	GTG		0.577	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		Missense_Mutation
FCRL3	115352	hgsc.bcm.edu	37	1	157665981	157665981	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1630-01	TCGA-25-1630-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr1:157665981T>A	ENST00000368184.3	-	7	1272	c.981A>T	c.(979-981)agA>agT	p.R327S	FCRL3_ENST00000368186.5_Missense_Mutation_p.R327S|FCRL3_ENST00000473231.1_5'UTR|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	327	Ig-like C2-type 4.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R327S(1)		autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					GGCTTCTTACTCTTCCTTCTT	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											127.0	117.0	120.0					1																	157665981		2203	4300	6503	155932605	SO:0001583	missense	115352			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.981A>T	1.37:g.157665981T>A	ENSP00000357167:p.Arg327Ser		155932605	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	ENST00000368184.3	37	CCDS1167.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	8.146	0.786355	0.16189	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.11277	2.79;2.79	4.63	-1.8	0.07907	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	1.504280	0.04331	N	0.352372	T	0.01124	0.0037	N	0.04260	-0.245	0.09310	N	1	B;B;B	0.15141	0.012;0.004;0.01	B;B;B	0.19666	0.026;0.017;0.022	T	0.45071	-0.9286	10	0.13108	T	0.6	.	4.5447	0.12074	0.4516:0.0959:0.0:0.4525	.	327;232;327	Q96P31;D3DVD1;Q96P31-6	FCRL3_HUMAN;.;.	S	327	ENSP00000357169:R327S;ENSP00000357167:R327S	ENSP00000292392:R327S	R	-	3	2	FCRL3	155932605	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.719000	0.01873	-0.122000	0.11766	0.383000	0.25322	AGA		0.522	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939		Missense_Mutation
FOSB	2354	hgsc.bcm.edu	37	19	45973937	45973937	+	Silent	SNP	C	C	G			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr19:45973937C>G	ENST00000353609.3	+	2	769	c.177C>G	c.(175-177)acC>acG	p.T59T	FOSB_ENST00000443841.2_Intron|FOSB_ENST00000417353.2_Silent_p.T59T|ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000590335.1_Silent_p.T59T|FOSB_ENST00000592811.1_Silent_p.T10T|FOSB_ENST00000586615.1_Silent_p.T10T|FOSB_ENST00000592436.1_Silent_p.T59T|FOSB_ENST00000585836.1_Intron|FOSB_ENST00000591858.1_Intron	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	59					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.T59T(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		CCACGGTCACCGCGATCACAA	0.632																																																1	Substitution - coding silent(1)	ovary(1)	19											121.0	132.0	128.0					19																	45973937		2203	4300	6503	50665777	SO:0001819	synonymous_variant	2354				CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.177C>G	19.37:g.45973937C>G			50665777	A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Silent	SNP	ENST00000353609.3	37	CCDS12664.1	SNP	23	Baylor																																																																																				0.632	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459561.1	NM_006732		Silent
GCKR	2646	hgsc.bcm.edu	37	2	27730117	27730117	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1630-01	TCGA-25-1630-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr2:27730117G>A	ENST00000264717.2	+	13	1145	c.1082G>A	c.(1081-1083)cGt>cAt	p.R361H	GCKR_ENST00000424318.2_Missense_Mutation_p.R171H	NM_001486.3	NP_001477.2	Q14397	GCKR_HUMAN	glucokinase (hexokinase 4) regulator	361	SIS 2. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|negative regulation of glucokinase activity (GO:0033132)|positive regulation of glucokinase activity (GO:0033133)|protein import into nucleus, translocation (GO:0000060)|regulation of glucose transport (GO:0010827)|response to fructose (GO:0009750)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	carbohydrate binding (GO:0030246)|enzyme inhibitor activity (GO:0004857)|fructose-6-phosphate binding (GO:0070095)	p.R361H(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(2)	29	Acute lymphoblastic leukemia(172;0.155)					CGAGATGTCCGTGGCTTTCTC	0.493																																																1	Substitution - Missense(1)	ovary(1)	2											238.0	247.0	244.0					2																	27730117		2203	4300	6503	27583621	SO:0001583	missense	2646			Z48475	CCDS1757.1	2p23	2008-05-21	2004-05-20		ENSG00000084734	ENSG00000084734			4196	protein-coding gene	gene with protein product		600842	"""glucokinase (hexokinase 4) regulatory protein"""			9570959, 8662230	Standard	NM_001486		Approved		uc002rky.3	Q14397	OTTHUMG00000128426	ENST00000264717.2:c.1082G>A	2.37:g.27730117G>A	ENSP00000264717:p.Arg361His		27583621	A1L4C2|B4DPQ2|Q53RY6|Q99522	Missense_Mutation	SNP	ENST00000264717.2	37	CCDS1757.1	SNP	40	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.05|15.05	2.718956|2.718956	0.48622|0.48622	.|.	.|.	ENSG00000084734|ENSG00000084734	ENST00000264717;ENST00000424318|ENST00000411584	D;D|.	0.83914|.	-1.78;-1.78|.	4.8|4.8	3.01|3.01	0.34805|0.34805	Sugar isomerase (SIS) (1);|.	0.230299|.	0.36034|.	N|.	0.002836|.	T|T	0.48040|0.48040	0.1478|0.1478	L|L	0.45051|0.45051	1.395|1.395	0.34531|0.34531	D|D	0.709184|0.709184	D;D;D|.	0.65815|.	0.995;0.965;0.965|.	P;P;P|.	0.55508|.	0.777;0.467;0.697|.	T|T	0.54649|0.54649	-0.8262|-0.8262	10|5	0.72032|.	D|.	0.01|.	0.0093|0.0093	7.281|7.281	0.26312|0.26312	0.2003:0.0:0.7997:0.0|0.2003:0.0:0.7997:0.0	.|.	171;359;361|.	F5H1P6;A8K731;Q14397|.	.;.;GCKR_HUMAN|.	H|M	361;171|62	ENSP00000264717:R361H;ENSP00000409109:R171H|.	ENSP00000264717:R361H|.	R|V	+|+	2|1	0|0	GCKR|GCKR	27583621|27583621	0.901000|0.901000	0.30685|0.30685	0.919000|0.919000	0.36401|0.36401	0.926000|0.926000	0.56050|0.56050	0.550000|0.550000	0.23345|0.23345	0.613000|0.613000	0.30089|0.30089	0.655000|0.655000	0.94253|0.94253	CGT|GTG		0.493	GCKR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250214.1	NM_001486		Missense_Mutation
GPRIN3	285513	hgsc.bcm.edu	37	4	90169233	90169233	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1630-01	TCGA-25-1630-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr4:90169233G>C	ENST00000609438.1	-	2	2547	c.2029C>G	c.(2029-2031)Cag>Gag	p.Q677E	GPRIN3_ENST00000333209.4_Missense_Mutation_p.Q677E	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	677								p.Q677E(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		CGCTTGGACTGTTTCAGCTGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	4											62.0	59.0	61.0					4																	90169233		2203	4300	6503	90388256	SO:0001583	missense	285513			AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.2029C>G	4.37:g.90169233G>C	ENSP00000476603:p.Gln677Glu		90388256	Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	CCDS34030.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658030	0.67586	.	.	ENSG00000185477	ENST00000333209	T	0.21734	1.99	5.55	4.68	0.58851	.	0.000000	0.31221	N	0.008033	T	0.35158	0.0922	L	0.29908	0.895	0.34711	D	0.727781	D	0.89917	1.0	D	0.74348	0.983	T	0.51529	-0.8694	10	0.72032	D	0.01	-10.5257	16.164	0.81739	0.0:0.1336:0.8664:0.0	.	677	Q6ZVF9	GRIN3_HUMAN	E	677	ENSP00000328672:Q677E	ENSP00000328672:Q677E	Q	-	1	0	GPRIN3	90388256	1.000000	0.71417	0.988000	0.46212	0.801000	0.45260	3.223000	0.51231	1.272000	0.44329	0.655000	0.94253	CAG		0.542	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281		Missense_Mutation
HMCN1	83872	hgsc.bcm.edu	37	1	185878523	185878523	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1630-01	TCGA-25-1630-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr1:185878523A>G	ENST00000271588.4	+	5	905	c.676A>G	c.(676-678)Aca>Gca	p.T226A	HMCN1_ENST00000367492.2_Missense_Mutation_p.T226A	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	226					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.T226A(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CCTTTTATCCACAGATCATTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											105.0	99.0	101.0					1																	185878523		2203	4300	6503	184145146	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.676A>G	1.37:g.185878523A>G	ENSP00000271588:p.Thr226Ala		184145146	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.4	4.285296	0.80803	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.64085	-0.08;-0.08	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.67618	0.2912	L	0.47716	1.5	0.58432	D	0.999998	D	0.58620	0.983	P	0.53313	0.723	T	0.66654	-0.5869	10	0.40728	T	0.16	.	16.635	0.85050	1.0:0.0:0.0:0.0	.	226	Q96RW7	HMCN1_HUMAN	A	226	ENSP00000271588:T226A;ENSP00000356462:T226A	ENSP00000271588:T226A	T	+	1	0	HMCN1	184145146	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.185000	0.72013	2.330000	0.79161	0.477000	0.44152	ACA		0.408	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		Missense_Mutation
HEATR1	55127	hgsc.bcm.edu	37	1	236757341	236757341	+	Silent	SNP	C	C	A			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr1:236757341C>A	ENST00000366582.3	-	9	1278	c.1164G>T	c.(1162-1164)ctG>ctT	p.L388L	HEATR1_ENST00000483073.1_5'Flank|HEATR1_ENST00000366581.2_Silent_p.L388L	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	388					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.L388L(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			AGTTGTTCTTCAGTGATATTT	0.299																																																1	Substitution - coding silent(1)	ovary(1)	1											145.0	143.0	144.0					1																	236757341		2203	4299	6502	234823964	SO:0001819	synonymous_variant	55127			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1164G>T	1.37:g.236757341C>A			234823964	Q5T3Q8|Q6P197|Q9NW23	Silent	SNP	ENST00000366582.3	37	CCDS31066.1	SNP	29	Baylor																																																																																				0.299	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853		Silent
HS6ST3	266722	hgsc.bcm.edu	37	13	97484994	97484994	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1630-01	TCGA-25-1630-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr13:97484994G>A	ENST00000376705.2	+	2	982	c.958G>A	c.(958-960)Gtg>Atg	p.V320M		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	320					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)	p.V320M(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					CCTCAGCCTGGTGGGCTGCTA	0.517																																																1	Substitution - Missense(1)	ovary(1)	13											79.0	78.0	78.0					13																	97484994		2203	4300	6503	96282995	SO:0001583	missense	266722			AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.958G>A	13.37:g.97484994G>A	ENSP00000365895:p.Val320Met		96282995	Q5W0L0|Q68CW6	Missense_Mutation	SNP	ENST00000376705.2	37	CCDS9481.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717779	0.89205	.	.	ENSG00000185352	ENST00000376705	D	0.82526	-1.62	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.92596	0.7648	M	0.88570	2.965	0.80722	D	1	D	0.71674	0.998	D	0.66497	0.944	D	0.93170	0.6565	10	0.87932	D	0	-25.6691	20.1935	0.98237	0.0:0.0:1.0:0.0	.	320	Q8IZP7	H6ST3_HUMAN	M	320	ENSP00000365895:V320M	ENSP00000365895:V320M	V	+	1	0	HS6ST3	96282995	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.864000	0.99589	2.763000	0.94921	0.655000	0.94253	GTG		0.517	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045517.2	NM_153456		Missense_Mutation
HUWE1	10075	hgsc.bcm.edu	37	X	53655545	53655545	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1630-01	TCGA-25-1630-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chrX:53655545G>T	ENST00000342160.3	-	14	1598	c.1141C>A	c.(1141-1143)Cag>Aag	p.Q381K	HUWE1_ENST00000218328.8_Missense_Mutation_p.Q381K|HUWE1_ENST00000262854.6_Missense_Mutation_p.Q381K			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	381					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.Q381K(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GTGGCAAACTGGTGAGGGTAT	0.463																																																1	Substitution - Missense(1)	ovary(1)	X											53.0	45.0	48.0					X																	53655545		2164	4183	6347	53672270	SO:0001583	missense	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.1141C>A	X.37:g.53655545G>T	ENSP00000340648:p.Gln381Lys		53672270	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	g	15.46	2.839554	0.51057	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328;ENST00000396323	T;T;T	0.65549	-0.07;-0.07;-0.16	5.72	4.85	0.62838	Armadillo-like helical (1);Armadillo-type fold (1);	0.499568	0.20871	N	0.084166	T	0.44705	0.1306	N	0.14661	0.345	0.52501	D	0.999959	P	0.46395	0.877	B	0.40134	0.32	T	0.38067	-0.9678	10	0.34782	T	0.22	.	12.8806	0.58014	0.0818:0.0:0.9182:0.0	.	381	Q7Z6Z7	HUWE1_HUMAN	K	381;381;381;7	ENSP00000340648:Q381K;ENSP00000262854:Q381K;ENSP00000218328:Q381K	ENSP00000218328:Q381K	Q	-	1	0	HUWE1	53672270	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.518000	0.98022	1.182000	0.42928	0.597000	0.82753	CAG		0.463	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		Missense_Mutation
DCAF6	55827	hgsc.bcm.edu	37	1	168032995	168032995	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1630-01	TCGA-25-1630-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr1:168032995A>G	ENST00000312263.6	+	15	2368	c.2164A>G	c.(2164-2166)Atg>Gtg	p.M722V	DCAF6_ENST00000432587.2_Missense_Mutation_p.M782V|DCAF6_ENST00000367843.3_Missense_Mutation_p.M742V|DCAF6_ENST00000367840.3_Missense_Mutation_p.M813V	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	722					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)	p.M742V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						CTCCAGGACAATGGTACCAAA	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											94.0	93.0	93.0					1																	168032995		2203	4300	6503	166299619	SO:0001583	missense	55827			AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.2164A>G	1.37:g.168032995A>G	ENSP00000311949:p.Met722Val		166299619	A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Missense_Mutation	SNP	ENST00000312263.6	37	CCDS30933.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.86	3.238902	0.58995	.	.	ENSG00000143164	ENST00000367843;ENST00000432587;ENST00000312263;ENST00000367840	T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.084494	0.85682	D	0.000000	T	0.77718	0.4172	L	0.36672	1.1	0.46260	D	0.998956	B;B;B;P;P	0.51653	0.011;0.402;0.019;0.656;0.947	B;B;B;P;D	0.65684	0.015;0.171;0.107;0.558;0.937	T	0.75025	-0.3463	9	0.13108	T	0.6	.	15.8679	0.79080	1.0:0.0:0.0:0.0	.	782;395;813;722;742	B4DNB8;Q9P0U0;Q58WW2-3;Q58WW2;Q58WW2-2	.;.;.;DCAF6_HUMAN;.	V	742;782;722;813	ENSP00000356817:M742V;ENSP00000396238:M782V;ENSP00000311949:M722V;ENSP00000356814:M813V	ENSP00000311949:M722V	M	+	1	0	DCAF6	166299619	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	8.792000	0.91856	2.166000	0.68216	0.459000	0.35465	ATG		0.363	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083661.2	NM_018442		Missense_Mutation
KDELC1	79070	hgsc.bcm.edu	37	13	103441515	103441515	+	Silent	SNP	C	C	T			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr13:103441515C>T	ENST00000376004.4	-	7	1476	c.1140G>A	c.(1138-1140)ttG>ttA	p.L380L	KDELC1_ENST00000460338.1_5'UTR	NM_024089.2	NP_076994.2	Q6UW63	KDEL1_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 1	380						endoplasmic reticulum lumen (GO:0005788)		p.L380L(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CACCAACTAGCAAATATGGCA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	13											129.0	120.0	123.0					13																	103441515		2203	4300	6503	102239516	SO:0001819	synonymous_variant	79070			BC001297	CCDS9504.1	13q33	2010-11-18			ENSG00000134901	ENSG00000134901			19350	protein-coding gene	gene with protein product		611613					Standard	NM_024089		Approved	MGC5302, EP58	uc001vpq.4	Q6UW63	OTTHUMG00000017307	ENST00000376004.4:c.1140G>A	13.37:g.103441515C>T			102239516	Q53HL3|Q9BVD2	Silent	SNP	ENST00000376004.4	37	CCDS9504.1	SNP	25	Baylor																																																																																				0.398	KDELC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045699.1			Silent
KIF7	374654	hgsc.bcm.edu	37	15	90188643	90188643	+	Silent	SNP	G	G	A			TCGA-25-1630-01	TCGA-25-1630-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr15:90188643G>A	ENST00000394412.3	-	9	2038	c.1962C>T	c.(1960-1962)cgC>cgT	p.R654R		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	654	Sufficient for interaction with NPHP1.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R141R(1)		central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GACTCCCTGGGCGTGCCCCCG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	15											76.0	64.0	68.0					15																	90188643		2200	4299	6499	87989647	SO:0001819	synonymous_variant	374654			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.1962C>T	15.37:g.90188643G>A			87989647	Q3SXY0|Q6UXE9|Q8IW72	Silent	SNP	ENST00000394412.3	37	CCDS32325.2	SNP	42	Baylor																																																																																				0.632	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525		Silent
MEOX2	4223	hgsc.bcm.edu	37	7	15652115	15652115	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1630-01	TCGA-25-1630-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr7:15652115T>G	ENST00000262041.5	-	3	1221	c.812A>C	c.(811-813)gAg>gCg	p.E271A		NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	271					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)	p.E271A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		TCCCGACAGCTCTGATGGGAG	0.532																																					Esophageal Squamous(140;197 1769 16409 18257 29929)											1	Substitution - Missense(1)	ovary(1)	7											189.0	178.0	182.0					7																	15652115		2203	4300	6503	15618640	SO:0001583	missense	4223				CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.812A>C	7.37:g.15652115T>G	ENSP00000262041:p.Glu271Ala		15618640	B2R8I7|O75263|Q9UPL6	Missense_Mutation	SNP	ENST00000262041.5	37	CCDS34605.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.89	2.074578	0.36566	.	.	ENSG00000106511	ENST00000262041	D	0.90261	-2.64	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.91143	0.7211	L	0.27053	0.805	0.58432	D	0.999999	D	0.63880	0.993	D	0.68192	0.956	D	0.89582	0.3821	10	0.24483	T	0.36	-19.0188	15.636	0.76953	0.0:0.0:0.0:1.0	.	271	P50222	MEOX2_HUMAN	A	271	ENSP00000262041:E271A	ENSP00000262041:E271A	E	-	2	0	MEOX2	15618640	1.000000	0.71417	0.991000	0.47740	0.150000	0.21749	7.665000	0.83852	2.098000	0.63641	0.460000	0.39030	GAG		0.532	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924		Missense_Mutation
NALCN	259232	hgsc.bcm.edu	37	13	102029076	102029076	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1630-01	TCGA-25-1630-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr13:102029076A>G	ENST00000251127.6	-	6	700	c.619T>C	c.(619-621)Tgt>Cgt	p.C207R	NALCN_ENST00000376196.3_Missense_Mutation_p.C207R|NALCN_ENST00000376200.5_Missense_Mutation_p.C207R|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	207					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.C207R(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTTACAACACAGTGATAAGTA	0.303																																																1	Substitution - Missense(1)	ovary(1)	13											104.0	116.0	112.0					13																	102029076		2203	4298	6501	100827077	SO:0001583	missense	259232			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.619T>C	13.37:g.102029076A>G	ENSP00000251127:p.Cys207Arg		100827077	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.55	3.648590	0.67358	.	.	ENSG00000102452	ENST00000251127;ENST00000376196;ENST00000376200;ENST00000449582	D;D;D	0.98455	-4.94;-4.94;-4.94	4.92	4.92	0.64577	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99199	0.9722	H	0.94222	3.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99120	1.0849	10	0.87932	D	0	.	14.2674	0.66129	1.0:0.0:0.0:0.0	.	207;207	F2Z323;Q8IZF0	.;NALCN_HUMAN	R	207	ENSP00000251127:C207R;ENSP00000365367:C207R;ENSP00000365373:C207R	ENSP00000251127:C207R	C	-	1	0	NALCN	100827077	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.962000	0.93254	1.853000	0.53794	0.528000	0.53228	TGT		0.303	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		Missense_Mutation
PAMR1	25891	hgsc.bcm.edu	37	11	35457458	35457458	+	Nonsense_Mutation	SNP	G	G	T			TCGA-25-1630-01	TCGA-25-1630-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr11:35457458G>T	ENST00000378880.2	-	9	1771	c.1326C>A	c.(1324-1326)tgC>tgA	p.C442*	PAMR1_ENST00000278360.3_Nonsense_Mutation_p.C459*|PAMR1_ENST00000532848.1_Nonsense_Mutation_p.C402*|PAMR1_ENST00000378878.3_Nonsense_Mutation_p.C331*	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	442	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.C459*(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						CACTAGGGATGCAGGATGGTG	0.537																																																1	Substitution - Nonsense(1)	ovary(1)	11											74.0	68.0	70.0					11																	35457458		2202	4298	6500	35414034	SO:0001587	stop_gained	25891				CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.1326C>A	11.37:g.35457458G>T	ENSP00000368158:p.Cys442*		35414034	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Nonsense_Mutation	SNP	ENST00000378880.2	37	CCDS31460.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	43	10.023918	0.99319	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605	.	.	.	5.54	0.421	0.16451	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.3424	0.43887	0.4273:0.0:0.5727:0.0	.	.	.	.	X	459;442;331;402;419	.	ENSP00000278360:C459X	C	-	3	2	PAMR1	35414034	0.990000	0.36364	0.996000	0.52242	0.992000	0.81027	0.332000	0.19751	0.293000	0.22520	0.561000	0.74099	TGC		0.537	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430		Nonsense_Mutation
PDZD7	79955	hgsc.bcm.edu	37	10	102780434	102780434	+	Splice_Site	SNP	T	T	C			TCGA-25-1630-01	TCGA-25-1630-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr10:102780434T>C	ENST00000370215.3	-	7	1094	c.869A>G	c.(868-870)gAg>gGg	p.E290G		NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	290	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.E290G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CCGGCCGGTCTCCTGGGGAGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	10											46.0	44.0	45.0					10																	102780434		2203	4300	6503	102770424	SO:0001630	splice_region_variant	79955			AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.868-1A>G	10.37:g.102780434T>C			102770424	D5FJ77|Q8N321	Missense_Mutation	SNP	ENST00000370215.3	37	CCDS31269.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.28	3.080134	0.55753	.	.	ENSG00000186862	ENST00000393462;ENST00000370215	T	0.16897	2.31	5.69	5.69	0.88448	PDZ/DHR/GLGF (2);	0.000000	0.85682	D	0.000000	T	0.12347	0.0300	N	0.17723	0.515	0.58432	D	0.999993	B;B	0.12013	0.004;0.005	B;B	0.17098	0.005;0.017	T	0.05989	-1.0852	10	0.54805	T	0.06	.	11.051	0.47889	0.0:0.072:0.0:0.928	.	290;290	Q9H5P4;Q9H5P4-2	PDZD7_HUMAN;.	G	290	ENSP00000359234:E290G	ENSP00000359234:E290G	E	-	2	0	PDZD7	102770424	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	5.924000	0.70054	2.170000	0.68504	0.379000	0.24179	GAG		0.587	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895	Missense_Mutation	Missense_Mutation
PGAP3	93210	hgsc.bcm.edu	37	17	37844105	37844105	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1630-01	TCGA-25-1630-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr17:37844105T>C	ENST00000300658.4	-	1	255	c.163A>G	c.(163-165)Atc>Gtc	p.I55V	ERBB2_ENST00000578199.1_5'Flank|ERBB2_ENST00000584601.1_5'Flank|ERBB2_ENST00000406381.2_5'Flank|PGAP3_ENST00000579146.1_Missense_Mutation_p.I55V|PGAP3_ENST00000429199.2_Missense_Mutation_p.I55V|PGAP3_ENST00000378011.4_Missense_Mutation_p.I55V	NM_033419.3	NP_219487.3	Q96FM1	PGAP3_HUMAN	post-GPI attachment to proteins 3	55					GPI anchor biosynthetic process (GO:0006506)|GPI anchor metabolic process (GO:0006505)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	hydrolase activity, acting on ester bonds (GO:0016788)	p.I55V(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12						CTCATGTAGATTGGCTGGCGG	0.642																																																1	Substitution - Missense(1)	ovary(1)	17											21.0	20.0	20.0					17																	37844105		2202	4297	6499	35097631	SO:0001583	missense	93210			AB088396	CCDS32641.1	17q21.2	2009-06-02	2009-06-02	2009-06-02		ENSG00000161395			23719	protein-coding gene	gene with protein product	"""post-GPI attachment to proteins 3"""	611801	"""per1-like domain containing 1"""	PERLD1		15010812, 17021251, 17314402	Standard	NM_001291728		Approved	MGC9753, CAB2, PP1498, PER1	uc002hsj.3	Q96FM1		ENST00000300658.4:c.163A>G	17.37:g.37844105T>C	ENSP00000300658:p.Ile55Val		35097631	B4DGK7|Q86Z03|Q8NBJ8	Missense_Mutation	SNP	ENST00000300658.4	37	CCDS32641.1	SNP	52	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.06	2.123840	0.37436	.	.	ENSG00000161395	ENST00000300658;ENST00000378011;ENST00000429199	.	.	.	4.81	4.81	0.61882	.	0.336486	0.31809	N	0.007024	T	0.42381	0.1200	L	0.43152	1.355	0.35304	D	0.783323	B;B;B	0.27192	0.108;0.141;0.171	B;B;B	0.27796	0.076;0.046;0.083	T	0.51576	-0.8688	9	0.30854	T	0.27	-35.2917	9.2157	0.37346	0.0:0.0:0.305:0.6949	.	55;55;55	B4DGK7;Q96FM1-2;Q96FM1	.;.;PGAP3_HUMAN	V	55	.	ENSP00000300658:I55V	I	-	1	0	PGAP3	35097631	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.642000	0.61383	2.037000	0.60232	0.459000	0.35465	ATC		0.642	PGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444825.2	NM_033419		Missense_Mutation
PGR	5241	hgsc.bcm.edu	37	11	100922261	100922261	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1630-01	TCGA-25-1630-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr11:100922261T>A	ENST00000325455.5	-	5	3704	c.2251A>T	c.(2251-2253)Att>Ttt	p.I751F	PGR_ENST00000263463.5_Missense_Mutation_p.I649F|PGR_ENST00000534013.1_Missense_Mutation_p.I157F	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	751	Steroid-binding.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.I751F(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	GAATACTGAATGAGAGTTATC	0.348																																					Pancreas(124;2271 2354 21954 22882)											1	Substitution - Missense(1)	ovary(1)	11											108.0	106.0	107.0					11																	100922261		2203	4300	6503	100427471	SO:0001583	missense	5241			M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.2251A>T	11.37:g.100922261T>A	ENSP00000325120:p.Ile751Phe		100427471	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	37	CCDS8310.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	21.2	4.114971	0.77210	.	.	ENSG00000082175	ENST00000325455;ENST00000534013;ENST00000263463;ENST00000537623	T;T;D	0.99771	1.04;1.04;-6.71	5.24	5.24	0.73138	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.072545	0.64402	D	0.000003	D	0.99711	0.9889	M	0.87971	2.92	0.45216	D	0.998227	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.76575	0.986;0.988;0.953	D	0.97815	1.0253	10	0.51188	T	0.08	.	10.4033	0.44241	0.1458:0.0:0.0:0.8542	.	649;751;132	Q8TDS3;P06401;A7LQ08	.;PRGR_HUMAN;.	F	751;157;649;649	ENSP00000325120:I751F;ENSP00000436561:I157F;ENSP00000263463:I649F	ENSP00000263463:I649F	I	-	1	0	PGR	100427471	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.149000	0.71795	1.972000	0.57404	0.528000	0.53228	ATT		0.348	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1			Missense_Mutation
PIGT	51604	hgsc.bcm.edu	37	20	44054403	44054403	+	Silent	SNP	A	A	C			TCGA-25-1630-01	TCGA-25-1630-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr20:44054403A>C	ENST00000279036.6	+	12	1754	c.1674A>C	c.(1672-1674)acA>acC	p.T558T	PIGT_ENST00000535404.1_Silent_p.T403T|PIGT_ENST00000543458.2_Silent_p.T502T|PIGT_ENST00000372689.5_Silent_p.T491T|PIGT_ENST00000279035.9_Silent_p.T456T|PIGT_ENST00000545755.1_Silent_p.T296T|PIGT_ENST00000341555.5_Silent_p.T364T	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	558					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)	p.T558T(1)		breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				AGCCCCGCACAGGTGGCCTGG	0.622																																																1	Substitution - coding silent(1)	large_intestine(1)	20											38.0	33.0	34.0					20																	44054403		2203	4300	6503	43487817	SO:0001819	synonymous_variant	51604				CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.1674A>C	20.37:g.44054403A>C			43487817	B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Silent	SNP	ENST00000279036.6	37	CCDS13353.1	SNP	7	Baylor																																																																																				0.622	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079434.2	NM_015937		Silent
PRSS27	83886	hgsc.bcm.edu	37	16	2763551	2763551	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr16:2763551C>G	ENST00000302641.3	-	5	711	c.657G>C	c.(655-657)gaG>gaC	p.E219D	AC092117.1_ENST00000410123.1_RNA	NM_031948.3	NP_114154.1	Q9BQR3	PRS27_HUMAN	protease, serine 27	219	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.E219D(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8						CCTTCTTGCCCTCCTCGAAGC	0.592																																																1	Substitution - Missense(1)	ovary(1)	16											229.0	164.0	186.0					16																	2763551		2198	4300	6498	2703552	SO:0001583	missense	83886			AB056161	CCDS10476.1	16p13.3	2010-05-07			ENSG00000172382	ENSG00000172382		"""Serine peptidases / Serine peptidases"""	15475	protein-coding gene	gene with protein product		608018					Standard	NM_031948		Approved	MPN, pancreasin, CAPH2, marapsin	uc002crf.3	Q9BQR3	OTTHUMG00000128929	ENST00000302641.3:c.657G>C	16.37:g.2763551C>G	ENSP00000306390:p.Glu219Asp		2703552		Missense_Mutation	SNP	ENST00000302641.3	37	CCDS10476.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	.	13.68	2.308476	0.40895	.	.	ENSG00000172382	ENST00000302641;ENST00000543965	D	0.81499	-1.5	5.26	5.26	0.73747	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.53938	D	0.000046	T	0.76842	0.4044	N	0.12611	0.24	0.38870	D	0.956678	D;D	0.69078	0.98;0.997	P;P	0.61722	0.818;0.893	T	0.77466	-0.2577	10	0.33940	T	0.23	.	11.4577	0.50191	0.1799:0.8201:0.0:0.0	.	219;183	Q9BQR3;B3KP25	PRS27_HUMAN;.	D	219;183	ENSP00000306390:E219D	ENSP00000306390:E219D	E	-	3	2	PRSS27	2703552	1.000000	0.71417	1.000000	0.80357	0.158000	0.22134	1.551000	0.36233	2.460000	0.83146	0.442000	0.29010	GAG		0.592	PRSS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250908.1	NM_031948		Missense_Mutation
SLAMF7	57823	hgsc.bcm.edu	37	1	160718118	160718118	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr1:160718118C>A	ENST00000368043.3	+	2	227	c.190C>A	c.(190-192)Cag>Aag	p.Q64K	SLAMF7_ENST00000458104.2_Intron|SLAMF7_ENST00000444090.2_Missense_Mutation_p.Q64K|SLAMF7_ENST00000359331.4_Missense_Mutation_p.Q64K|SLAMF7_ENST00000458602.2_Intron|SLAMF7_ENST00000368042.3_Intron|SLAMF7_ENST00000488819.1_3'UTR|SLAMF7_ENST00000441662.2_Missense_Mutation_p.Q64K	NM_001282595.1|NM_021181.3	NP_001269524.1|NP_067004.3	Q9NQ25	SLAF7_HUMAN	SLAM family member 7	64	Ig-like V-type.				cell adhesion (GO:0007155)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of natural killer cell activation (GO:0032814)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.Q64K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(4)	24	all_cancers(52;2.63e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			TGTCACCATACAGCCAGAAGG	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											67.0	65.0	66.0					1																	160718118		2203	4300	6503	158984742	SO:0001583	missense	57823			AB027233	CCDS1209.1, CCDS60321.1, CCDS60322.1, CCDS60323.1, CCDS60324.1, CCDS60325.1, CCDS72956.1, CCDS72957.1	1q23.1-q24.1	2013-01-11			ENSG00000026751	ENSG00000026751		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	21394	protein-coding gene	gene with protein product		606625				11802771, 11220635	Standard	XM_005245386		Approved	CRACC, 19A, CS1, CD319	uc001fwq.3	Q9NQ25	OTTHUMG00000024008	ENST00000368043.3:c.190C>A	1.37:g.160718118C>A	ENSP00000357022:p.Gln64Lys		158984742	A8K3U1|B4DPU4|B4DPY3|B4DWA3|Q8N6Y8|Q8ND32|Q9NY08|Q9NY23	Missense_Mutation	SNP	ENST00000368043.3	37	CCDS1209.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.894	0.166125	0.09339	.	.	ENSG00000026751	ENST00000444090;ENST00000441662;ENST00000368043;ENST00000359331	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	4.72	-1.3	0.09259	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.487974	0.22887	N	0.054423	T	0.23410	0.0566	L	0.50333	1.59	0.21604	N	0.999629	B;B;B;B	0.30634	0.114;0.114;0.288;0.134	B;B;B;B	0.31614	0.079;0.079;0.1;0.133	T	0.45991	-0.9223	10	0.02654	T	1	-1.4593	9.4609	0.38785	0.1937:0.2727:0.5336:0.0	.	64;64;64;64	B4DPY3;B4DPU4;A8K3U1;Q9NQ25	.;.;.;SLAF7_HUMAN	K	64	ENSP00000416592:Q64K;ENSP00000405605:Q64K;ENSP00000357022:Q64K;ENSP00000352281:Q64K	ENSP00000352281:Q64K	Q	+	1	0	SLAMF7	158984742	0.000000	0.05858	0.002000	0.10522	0.025000	0.11179	-1.439000	0.02414	-0.038000	0.13624	0.650000	0.86243	CAG		0.502	SLAMF7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060464.1	NM_021181		Missense_Mutation
SPATA18	132671	hgsc.bcm.edu	37	4	52936032	52936032	+	Silent	SNP	G	G	C			TCGA-25-1630-01	TCGA-25-1630-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr4:52936032G>C	ENST00000295213.4	+	5	842	c.468G>C	c.(466-468)tcG>tcC	p.S156S	SPATA18_ENST00000419395.2_Intron|SPATA18_ENST00000506829.1_Intron	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	156					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)		p.S156S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			AGAACAGATCGGCCATATCCC	0.338																																																1	Substitution - coding silent(1)	ovary(1)	4											58.0	58.0	58.0					4																	52936032		2203	4300	6503	52630789	SO:0001819	synonymous_variant	132671			BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.468G>C	4.37:g.52936032G>C			52630789	B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Silent	SNP	ENST00000295213.4	37	CCDS3489.1	SNP	39	Baylor																																																																																				0.338	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263		Silent
SPRED1	161742	hgsc.bcm.edu	37	15	38643351	38643351	+	Missense_Mutation	SNP	A	A	C	rs111363743		TCGA-25-1630-01	TCGA-25-1630-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr15:38643351A>C	ENST00000299084.4	+	7	1681	c.821A>C	c.(820-822)gAt>gCt	p.D274A		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	274	KBD. {ECO:0000255|PROSITE- ProRule:PRU00821}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)	p.D274A(1)		kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		TTGGAAAGAGATGATGCTGAT	0.393									Legius syndrome																												Melanoma(196;2146 2959 7698 16532)											1	Substitution - Missense(1)	ovary(1)	15											92.0	90.0	91.0					15																	38643351		2200	4297	6497	36430643	SO:0001583	missense	161742	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.821A>C	15.37:g.38643351A>C	ENSP00000299084:p.Asp274Ala		36430643	B2RPJ8|Q05D53|Q8N256	Missense_Mutation	SNP	ENST00000299084.4	37	CCDS32193.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.07	2.128713	0.37533	.	.	ENSG00000166068	ENST00000299084	D	0.86097	-2.07	5.97	5.97	0.96955	c-Kit-binding domain (1);	0.362178	0.34986	N	0.003532	T	0.77572	0.4150	L	0.42245	1.32	0.47511	D	0.999441	P	0.38922	0.651	B	0.27887	0.084	T	0.76421	-0.2965	10	0.21540	T	0.41	-9.043	16.4461	0.83932	1.0:0.0:0.0:0.0	.	274	Q7Z699	SPRE1_HUMAN	A	274	ENSP00000299084:D274A	ENSP00000299084:D274A	D	+	2	0	SPRED1	36430643	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	6.134000	0.71689	2.285000	0.76669	0.528000	0.53228	GAT		0.393	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418217.1			Missense_Mutation
STX5	6811	hgsc.bcm.edu	37	11	62598584	62598585	+	Frame_Shift_Ins	INS	-	-	G			TCGA-25-1630-01	TCGA-25-1630-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr11:62598584_62598585insG	ENST00000294179.3	-	2	284_285	c.131_132insC	c.(130-132)ccafs	p.P44fs	STX5_ENST00000377897.4_Frame_Shift_Ins_p.P44fs|STX5_ENST00000541317.1_Intron|RP11-727F15.9_ENST00000535817.1_RNA|RP11-727F15.9_ENST00000535867.1_RNA|STX5_ENST00000394690.1_Splice_Site	NM_001244666.1|NM_003164.4	NP_001231595.1|NP_003155.2	Q13190	STX5_HUMAN	syntaxin 5	44					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle targeting (GO:0006903)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|SNARE complex (GO:0031201)	protein N-terminus binding (GO:0047485)|SNAP receptor activity (GO:0005484)	p.V45fs*38(1)		breast(2)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	18						CGAGGGTCACTGGGGGGGGCAG	0.629																																																1	Insertion - Frameshift(1)	ovary(1)	11																																								62355161	SO:0001589	frameshift_variant	6811			U26648	CCDS8038.2, CCDS58140.1	11q12.3	2008-02-05	2006-04-25	2006-04-25	ENSG00000162236	ENSG00000162236			11440	protein-coding gene	gene with protein product		603189	"""syntaxin 5A"""	STX5A		9188044, 11959998	Standard	NM_003164		Approved	SED5	uc001nvh.3	Q13190	OTTHUMG00000143864	ENST00000294179.3:c.132dupC	11.37:g.62598592_62598592dupG	ENSP00000294179:p.Pro44fs		62355160	B2R8T2|F8W8Q9|Q5U0D4|Q7Z3T6|Q9BUG1	Frame_Shift_Ins	INS	ENST00000294179.3	37	CCDS8038.2	INS	55	Baylor																																																																																				0.629	STX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290113.1	NM_003164		Frame_Shift_Ins
TEX15	56154	hgsc.bcm.edu	37	8	30703199	30703199	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr8:30703199C>G	ENST00000256246.2	-	1	3409	c.3335G>C	c.(3334-3336)aGt>aCt	p.S1112T		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1112	Ser-rich.				fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.S1112T(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TTTTGAGACACTGCTAGCCAT	0.393																																																1	Substitution - Missense(1)	ovary(1)	8											88.0	79.0	82.0					8																	30703199		2202	4300	6502	30822741	SO:0001583	missense	56154			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.3335G>C	8.37:g.30703199C>G	ENSP00000256246:p.Ser1112Thr		30822741		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.234	0.042288	0.08196	.	.	ENSG00000133863	ENST00000256246	T	0.10288	2.89	5.58	-1.95	0.07548	.	1.091340	0.06848	N	0.796874	T	0.08492	0.0211	L	0.44542	1.39	0.09310	N	1	B	0.12630	0.006	B	0.13407	0.009	T	0.45702	-0.9243	10	0.87932	D	0	.	1.1815	0.01846	0.1508:0.2902:0.1479:0.4112	.	1112	Q9BXT5	TEX15_HUMAN	T	1112	ENSP00000256246:S1112T	ENSP00000256246:S1112T	S	-	2	0	TEX15	30822741	0.000000	0.05858	0.004000	0.12327	0.174000	0.22865	-0.089000	0.11180	0.011000	0.14865	0.563000	0.77884	AGT		0.393	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			Missense_Mutation
TINAG	27283	hgsc.bcm.edu	37	6	54191632	54191632	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1630-01	TCGA-25-1630-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr6:54191632G>A	ENST00000259782.4	+	4	638	c.542G>A	c.(541-543)gGa>gAa	p.G181E	TINAG_ENST00000370864.3_Missense_Mutation_p.G163E|TINAG_ENST00000486436.1_3'UTR|TINAG_ENST00000370869.3_Missense_Mutation_p.G177E	NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	181					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.G181E(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			CAATTTTGGGGAATGACTTTA	0.358																																																1	Substitution - Missense(1)	ovary(1)	6											147.0	135.0	139.0					6																	54191632		2203	4300	6503	54299591	SO:0001583	missense	27283			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.542G>A	6.37:g.54191632G>A	ENSP00000259782:p.Gly181Glu		54299591	Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	ENST00000259782.4	37	CCDS4955.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.2	4.390760	0.82902	.	.	ENSG00000137251	ENST00000370869;ENST00000339741;ENST00000259782;ENST00000370864	T;T;T	0.62498	0.02;0.02;0.02	5.82	5.82	0.92795	.	0.183056	0.38897	N	0.001538	T	0.76579	0.4007	M	0.81341	2.54	0.53688	D	0.999977	D	0.89917	1.0	D	0.91635	0.999	T	0.78463	-0.2194	10	0.62326	D	0.03	.	15.6145	0.76753	0.0:0.0:1.0:0.0	.	181	Q9UJW2	TINAG_HUMAN	E	177;131;181;163	ENSP00000359906:G177E;ENSP00000259782:G181E;ENSP00000359901:G163E	ENSP00000259782:G181E	G	+	2	0	TINAG	54299591	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.846000	0.55888	2.751000	0.94390	0.643000	0.83706	GGA		0.358	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464		Missense_Mutation
TOR1AIP1	26092	hgsc.bcm.edu	37	1	179886684	179886684	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr1:179886684C>A	ENST00000606911.2	+	10	1253	c.1062C>A	c.(1060-1062)ttC>ttA	p.F354L	TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.F355L|TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.F370L|TOR1AIP1_ENST00000435319.4_Missense_Mutation_p.F233L|TOR1AIP1_ENST00000474875.1_3'UTR			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	354					positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)	p.F354L(2)|p.F354F(1)		breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						GTTTTTGGTTCTTTAGTACTC	0.448																																																3	Substitution - Missense(2)|Substitution - coding silent(1)	ovary(1)|large_intestine(1)|central_nervous_system(1)	1											115.0	124.0	121.0					1																	179886684		2203	4300	6503	178153307	SO:0001583	missense	26092				CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.1062C>A	1.37:g.179886684C>A	ENSP00000476687:p.Phe354Leu		178153307	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Missense_Mutation	SNP	ENST00000606911.2	37	CCDS1335.1	SNP	32	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.32|13.32	2.201182|2.201182	0.38905|0.38905	.|.	.|.	ENSG00000143337|ENSG00000143337	ENST00000528443;ENST00000271583;ENST00000435319|ENST00000447964	T;T;T|.	0.29142|.	1.58;1.58;1.58|.	5.96|5.96	2.95|2.95	0.34219|0.34219	.|.	1.146510|.	0.06179|.	N|.	0.679180|.	T|T	0.33000|0.33000	0.0848|0.0848	L|L	0.35723|0.35723	1.085|1.085	0.09310|0.09310	N|N	1|1	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|T	0.20075|0.20075	-1.0286|-1.0286	9|5	.|.	.|.	.|.	0.8852|0.8852	5.4225|5.4225	0.16407|0.16407	0.0:0.502:0.2835:0.2145|0.0:0.502:0.2835:0.2145	.|.	354|.	Q5JTV8|.	TOIP1_HUMAN|.	L|Y	355;370;354|89	ENSP00000435365:F355L;ENSP00000271583:F370L;ENSP00000393292:F354L|.	.|.	F|S	+|+	3|2	2|0	TOR1AIP1|TOR1AIP1	178153307|178153307	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.402000|0.402000	0.30811|0.30811	1.464000|1.464000	0.35288|0.35288	0.834000|0.834000	0.34852|0.34852	0.655000|0.655000	0.94253|0.94253	TTC|TCT		0.448	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000100313.4	NM_015602		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578413	7578413	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr17:7578413C>A	ENST00000269305.4	-	5	706	c.517G>T	c.(517-519)Gtg>Ttg	p.V173L	TP53_ENST00000455263.2_Missense_Mutation_p.V173L|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.V173L|TP53_ENST00000413465.2_Missense_Mutation_p.V173L|TP53_ENST00000445888.2_Missense_Mutation_p.V173L|TP53_ENST00000420246.2_Missense_Mutation_p.V173L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	173	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V173L(68)|p.V173M(46)|p.0?(8)|p.V80L(6)|p.V41L(6)|p.V173fs*1(4)|p.V80M(3)|p.V41M(3)|p.V173fs*59(2)|p.V157_C176del20(1)|p.V172_R174delVVR(1)|p.V173fs*69(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.E171fs*1(1)|p.V173W(1)|p.V173fs*8(1)|p.H168fs*69(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCGCCTCACAACCTCCGTC	0.662		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	159	Substitution - Missense(133)|Deletion - Frameshift(12)|Whole gene deletion(8)|Deletion - In frame(5)|Insertion - Frameshift(1)	upper_aerodigestive_tract(29)|large_intestine(25)|lung(17)|stomach(16)|ovary(14)|breast(11)|oesophagus(9)|central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(6)|skin(6)|bone(5)|liver(4)|vulva(3)|soft_tissue(2)|kidney(1)|biliary_tract(1)|urinary_tract(1)|pancreas(1)|autonomic_ganglia(1)	17	GRCh37	CM070299	TP53	M							51.0	51.0	51.0					17																	7578413		2203	4300	6503	7519138	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.517G>T	17.37:g.7578413C>A	ENSP00000269305:p.Val173Leu		7519138	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743630	0.89663	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99846	-7.13;-7.13;-7.13;-7.13;-7.13;-7.13;-7.13;-7.13	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99866	0.9937	M	0.92459	3.31	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.987;0.996;1.0;0.979;0.989;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.922;0.957;0.999;0.916;0.953;0.998	D	0.96814	0.9599	10	0.87932	D	0	-25.5548	17.4784	0.87667	0.0:1.0:0.0:0.0	.	134;173;173;80;173;173;173	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	173;173;173;173;173;173;162;80;41;80;41	ENSP00000410739:V173L;ENSP00000352610:V173L;ENSP00000269305:V173L;ENSP00000398846:V173L;ENSP00000391127:V173L;ENSP00000391478:V173L;ENSP00000425104:V41L;ENSP00000423862:V80L	ENSP00000269305:V173L	V	-	1	0	TP53	7519138	1.000000	0.71417	0.150000	0.22450	0.458000	0.32498	7.775000	0.85489	2.804000	0.96469	0.655000	0.94253	GTG		0.662	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578467	7578467	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1630-01	TCGA-25-1630-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr17:7578467T>C	ENST00000269305.4	-	5	652	c.463A>G	c.(463-465)Acc>Gcc	p.T155A	TP53_ENST00000455263.2_Missense_Mutation_p.T155A|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.T155A|TP53_ENST00000413465.2_Missense_Mutation_p.T155A|TP53_ENST00000445888.2_Missense_Mutation_p.T155A|TP53_ENST00000420246.2_Missense_Mutation_p.T155A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	155	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1868473}.|T -> I (in sporadic cancers; somatic mutation).|T -> M (in a sporadic cancer; somatic mutation).|T -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation). {ECO:0000269|PubMed:14660794}.|T -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T155P(17)|p.T155A(10)|p.0?(8)|p.?(5)|p.P152fs*14(5)|p.G154fs*14(2)|p.T155fs*23(2)|p.P153fs*22(2)|p.P151_V173del23(1)|p.G154_R156delGTR(1)|p.T155fs*26(1)|p.T155fs*25(1)|p.D148_T155delDSTPPPGT(1)|p.T62P(1)|p.T23P(1)|p.D148fs*23(1)|p.T62A(1)|p.T23A(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.T155fs*15(1)|p.T155_R156delTR(1)|p.T155S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGACGCGGGTGCCGGGCGGG	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	67	Substitution - Missense(32)|Deletion - Frameshift(16)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)|Insertion - Frameshift(1)	lung(18)|ovary(9)|oesophagus(7)|skin(6)|bone(5)|stomach(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|breast(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|pancreas(2)|urinary_tract(1)|liver(1)|prostate(1)	17											50.0	52.0	51.0					17																	7578467		2203	4300	6503	7519192	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.463A>G	17.37:g.7578467T>C	ENSP00000269305:p.Thr155Ala		7519192	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	3.177	-0.168719	0.06461	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99722	-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53	5.59	0.31	0.15825	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.718085	0.14119	N	0.340173	D	0.97371	0.9140	L	0.32530	0.975	0.09310	N	1	B;B;B;B;B;B;B	0.25169	0.119;0.0;0.0;0.026;0.0;0.002;0.08	B;B;B;B;B;B;B	0.25291	0.059;0.005;0.001;0.017;0.009;0.028;0.02	D	0.95348	0.8444	10	0.05351	T	0.99	-6.4954	2.9983	0.06005	0.3258:0.3217:0.0:0.3525	.	116;155;155;62;155;155;155	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	A	155;155;155;155;155;155;144;62;23;62;23;155	ENSP00000410739:T155A;ENSP00000352610:T155A;ENSP00000269305:T155A;ENSP00000398846:T155A;ENSP00000391127:T155A;ENSP00000391478:T155A;ENSP00000425104:T23A;ENSP00000423862:T62A;ENSP00000424104:T155A	ENSP00000269305:T155A	T	-	1	0	TP53	7519192	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.301000	0.08232	0.124000	0.18369	0.533000	0.62120	ACC		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TRIM40	135644	hgsc.bcm.edu	37	6	30115574	30115574	+	Silent	SNP	C	C	G			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr6:30115574C>G	ENST00000396581.1	+	6	1148	c.762C>G	c.(760-762)ccC>ccG	p.P254P	TRIM40_ENST00000307859.4_Silent_p.P225P|TRIM40_ENST00000376724.2_Silent_p.P254P			Q6P9F5	TRI40_HUMAN	tripartite motif containing 40	254					negative regulation of cell growth (GO:0030308)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein localization to nucleus (GO:1900181)|protein neddylation (GO:0045116)	IkappaB kinase complex (GO:0008385)	zinc ion binding (GO:0008270)	p.P225P(1)		ovary(1)	1						TTCTTCAGCCCCCTCAGAAGC	0.502																																																1	Substitution - coding silent(1)	ovary(1)	6											82.0	85.0	84.0					6																	30115574		2203	4300	6503	30223553	SO:0001819	synonymous_variant	135644			AF489517	CCDS4675.1, CCDS69069.1	6p21.31	2013-01-09	2011-01-25		ENSG00000204614	ENSG00000204614		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18736	protein-coding gene	gene with protein product			"""tripartite motif-containing 40"""				Standard	NM_138700		Approved	RNF35	uc003npm.2	Q6P9F5	OTTHUMG00000031083	ENST00000396581.1:c.762C>G	6.37:g.30115574C>G			30223553	Q5SRJ6|Q5SS36|Q8TD96	Silent	SNP	ENST00000396581.1	37		SNP	22	Baylor																																																																																				0.502	TRIM40-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000076117.2			Silent
TRIO	7204	hgsc.bcm.edu	37	5	14482753	14482753	+	Missense_Mutation	SNP	T	T	A	rs377179966		TCGA-25-1630-01	TCGA-25-1630-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr5:14482753T>A	ENST00000344204.4	+	46	6552	c.6528T>A	c.(6526-6528)gaT>gaA	p.D2176E	TRIO_ENST00000537187.1_Missense_Mutation_p.D2176E	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2176	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D2176E(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CAGACCAAGATGCAGGACTTC	0.483																																																1	Substitution - Missense(1)	ovary(1)	5											95.0	88.0	90.0					5																	14482753		2203	4300	6503	14535753	SO:0001583	missense	7204			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.6528T>A	5.37:g.14482753T>A	ENSP00000339299:p.Asp2176Glu		14535753	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.32	2.202663	0.38905	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206	T;T	0.11063	2.81;2.81	5.0	-2.56	0.06268	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.053268	0.64402	D	0.000001	T	0.06142	0.0159	N	0.17723	0.515	0.25929	N	0.983011	B;B	0.14805	0.011;0.002	B;B	0.15870	0.014;0.005	T	0.37407	-0.9707	10	0.15952	T	0.53	.	14.3711	0.66840	0.0:0.5801:0.0:0.4199	.	2176;2176	O75962-5;O75962	.;TRIO_HUMAN	E	2176;2176;1863	ENSP00000339299:D2176E;ENSP00000446348:D2176E	ENSP00000339299:D2176E	D	+	3	2	TRIO	14535753	0.225000	0.23685	0.019000	0.16419	0.975000	0.68041	0.017000	0.13399	-0.451000	0.07097	0.459000	0.35465	GAT		0.483	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		Missense_Mutation
WDR13	64743	hgsc.bcm.edu	37	X	48457322	48457322	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chrX:48457322C>T	ENST00000218056.5	+	2	764	c.259C>T	c.(259-261)Cgc>Tgc	p.R87C	WDR13_ENST00000376729.5_Missense_Mutation_p.R87C|WDR13_ENST00000492715.1_3'UTR	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	87						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R87C(1)		endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						CCGCAGTAGCCGCACTACTCT	0.617																																																1	Substitution - Missense(1)	ovary(1)	X											43.0	30.0	34.0					X																	48457322		2203	4300	6503	48342266	SO:0001583	missense	64743			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.259C>T	X.37:g.48457322C>T	ENSP00000218056:p.Arg87Cys		48342266	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	ENST00000218056.5	37	CCDS14302.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.7	4.184477	0.78677	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.73469	-0.75;-0.75	4.53	3.63	0.41609	.	0.000000	0.85682	D	0.000000	T	0.65439	0.2691	L	0.56769	1.78	0.80722	D	1	B	0.31054	0.306	B	0.18871	0.023	T	0.61720	-0.7005	10	0.36615	T	0.2	-8.7178	10.3396	0.43870	0.1976:0.8024:0.0:0.0	.	87	Q9H1Z4	WDR13_HUMAN	C	87	ENSP00000365919:R87C;ENSP00000218056:R87C	ENSP00000218056:R87C	R	+	1	0	WDR13	48342266	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	5.281000	0.65609	0.850000	0.35239	0.523000	0.50628	CGC		0.617	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2			Missense_Mutation
YY1AP1	55249	hgsc.bcm.edu	37	1	155629630	155629630	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1630-01	TCGA-25-1630-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr1:155629630C>G	ENST00000295566.4	-	11	2232	c.2209G>C	c.(2209-2211)Gga>Cga	p.G737R	YY1AP1_ENST00000359205.5_Missense_Mutation_p.G680R|YY1AP1_ENST00000535662.1_Missense_Mutation_p.G537R|MSTO1_ENST00000452804.2_Intron|MSTO1_ENST00000538143.1_Intron|YY1AP1_ENST00000368339.5_Missense_Mutation_p.G829R|YY1AP1_ENST00000404643.1_Missense_Mutation_p.G671R|YY1AP1_ENST00000355499.4_Missense_Mutation_p.G691R|YY1AP1_ENST00000347088.5_Missense_Mutation_p.G691R|YY1AP1_ENST00000407221.1_Missense_Mutation_p.G660R|YY1AP1_ENST00000361831.5_Missense_Mutation_p.G680R|YY1AP1_ENST00000368330.2_Missense_Mutation_p.G691R|YY1AP1_ENST00000311573.5_Missense_Mutation_p.G660R|YY1AP1_ENST00000368340.5_Missense_Mutation_p.G809R	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1	737					regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.G737R(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					TCTGACAATCCTTCTTGGCAC	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											151.0	135.0	141.0					1																	155629630		2203	4300	6503	153896254	SO:0001583	missense	55249			BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.2209G>C	1.37:g.155629630C>G	ENSP00000295566:p.Gly737Arg		153896254	B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Missense_Mutation	SNP	ENST00000295566.4	37	CCDS1115.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	c	13.01	2.108138	0.37242	.	.	ENSG00000163374	ENST00000359205;ENST00000355499;ENST00000311573;ENST00000347088;ENST00000361831;ENST00000368340;ENST00000295566;ENST00000368330;ENST00000407221;ENST00000404643;ENST00000368339;ENST00000535662	T;T;T;T;T;T;T;T;T;T;T;T	0.23754	1.93;1.93;1.94;1.93;1.93;1.91;1.92;1.93;1.94;1.94;1.89;1.94	2.57	1.6	0.23607	.	.	.	.	.	T	0.20700	0.0498	L	0.43152	1.355	0.09310	N	0.999997	B;B;D;B;P	0.76494	0.049;0.383;0.999;0.376;0.617	B;B;D;B;B	0.83275	0.06;0.216;0.996;0.234;0.226	T	0.04360	-1.0957	9	0.56958	D	0.05	.	3.8477	0.08942	0.0:0.5902:0.2583:0.1514	.	829;671;737;691;809	B4DMP2;Q9H869-4;Q9H869;Q9H869-2;Q5VYZ1	.;.;YYAP1_HUMAN;.;.	R	680;691;660;691;680;809;737;691;660;671;829;537	ENSP00000352134:G680R;ENSP00000347686:G691R;ENSP00000311138:G660R;ENSP00000316079:G691R;ENSP00000355298:G680R;ENSP00000357324:G809R;ENSP00000295566:G737R;ENSP00000357314:G691R;ENSP00000385791:G660R;ENSP00000385390:G671R;ENSP00000357323:G829R;ENSP00000437926:G537R	ENSP00000295566:G737R	G	-	1	0	YY1AP1	153896254	0.000000	0.05858	0.254000	0.24359	0.773000	0.43773	0.110000	0.15437	0.373000	0.24621	0.313000	0.20887	GGA		0.527	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086027.1	NM_139118		Missense_Mutation
ZNF277	11179	hgsc.bcm.edu	37	7	111958284	111958284	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1630-01	TCGA-25-1630-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1630-01	TCGA-25-1630-10	g.chr7:111958284T>G	ENST00000361822.3	+	5	642	c.513T>G	c.(511-513)ttT>ttG	p.F171L	ZNF277_ENST00000450657.1_Missense_Mutation_p.F171L	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	171					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.F171L(1)		breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						ATACCAATTTTCATGGCGTTT	0.328																																																1	Substitution - Missense(1)	ovary(1)	7											119.0	112.0	114.0					7																	111958284		2203	4300	6503	111745520	SO:0001583	missense	11179			AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.513T>G	7.37:g.111958284T>G	ENSP00000354501:p.Phe171Leu		111745520	Q75MZ2|Q75MZ3|Q8WY14	Missense_Mutation	SNP	ENST00000361822.3	37	CCDS5755.2	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.67	2.902174	0.52227	.	.	ENSG00000198839	ENST00000361822;ENST00000450657	T;T	0.34859	1.34;1.38	6.03	-0.455	0.12193	.	0.046796	0.85682	D	0.000000	T	0.32852	0.0843	L	0.61218	1.895	0.58432	D	0.999997	B;P	0.39404	0.073;0.672	B;B	0.41988	0.039;0.372	T	0.06250	-1.0837	10	0.49607	T	0.09	-22.8162	6.375	0.21503	0.1589:0.5253:0.0:0.3158	.	171;171	Q9NRM2;G5E9M4	ZN277_HUMAN;.	L	171	ENSP00000354501:F171L;ENSP00000402292:F171L	ENSP00000354501:F171L	F	+	3	2	ZNF277	111745520	0.998000	0.40836	0.406000	0.26421	0.741000	0.42261	0.369000	0.20416	-0.043000	0.13513	-0.256000	0.11100	TTT		0.328	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316843.2	NM_021994		Missense_Mutation
