#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
AASDH	132949	hgsc.bcm.edu	37	4	57220269	57220269	+	Frame_Shift_Del	DEL	A	A	-	rs148777026		TCGA-25-1632-01	TCGA-25-1632-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr4:57220269delA	ENST00000205214.6	-	8	1499	c.1319delT	c.(1318-1320)ttgfs	p.L440fs	AASDH_ENST00000502617.1_Frame_Shift_Del_p.L440fs|AASDH_ENST00000602986.1_Frame_Shift_Del_p.L287fs|AASDH_ENST00000451613.1_Frame_Shift_Del_p.L440fs|AASDH_ENST00000434343.2_Intron|AASDH_ENST00000510762.1_5'Flank|AASDH_ENST00000513376.1_Frame_Shift_Del_p.L340fs	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	440					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)	p.?(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TTTTCGTCCCAAAAAAAAAAT	0.363																																																1	Unknown(1)	skin(1)	4																																								56915026	SO:0001589	frameshift_variant	132949			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.1319delT	4.37:g.57220269delA	ENSP00000205214:p.Leu440fs		56915026	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Frame_Shift_Del	DEL	ENST00000205214.6	37	CCDS3504.1	DEL	5	Baylor																																																																																				0.363	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806		Frame_Shift_Del
ABT1	29777	hgsc.bcm.edu	37	6	26598254	26598254	+	Silent	SNP	C	C	G			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr6:26598254C>G	ENST00000274849.1	+	2	385	c.354C>G	c.(352-354)gcC>gcG	p.A118A		NM_013375.3	NP_037507.1	Q9ULW3	ABT1_HUMAN	activator of basal transcription 1	118	RRM.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron differentiation (GO:0021522)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.A118A(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11						AGCGCATAGCCAAGCGCGTGG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	6											62.0	56.0	58.0					6																	26598254		2203	4300	6503	26706233	SO:0001819	synonymous_variant	29777			AB027258	CCDS4616.1	6p21.31	2008-07-07			ENSG00000146109	ENSG00000146109			17369	protein-coding gene	gene with protein product						10648625	Standard	NM_013375		Approved		uc003nii.3	Q9ULW3	OTTHUMG00000016319	ENST00000274849.1:c.354C>G	6.37:g.26598254C>G			26706233		Silent	SNP	ENST00000274849.1	37	CCDS4616.1	SNP	21	Baylor																																																																																				0.577	ABT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043698.1			Silent
ADAMTS14	140766	hgsc.bcm.edu	37	10	72520313	72520313	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr10:72520313G>T	ENST00000373207.1	+	22	3376	c.3376G>T	c.(3376-3378)Gac>Tac	p.D1126Y	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.D1129Y	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	1126	Pro-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D1129Y(1)		NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						AGGACCCCAGGACCCTGCAGA	0.637																																																1	Substitution - Missense(1)	ovary(1)	10											50.0	52.0	51.0					10																	72520313		2203	4300	6503	72190319	SO:0001583	missense	140766			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.3376G>T	10.37:g.72520313G>T	ENSP00000362303:p.Asp1126Tyr		72190319	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	6.709	0.499405	0.12762	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.61859	0.07;0.1	4.44	-1.61	0.08399	.	0.924044	0.08843	U	0.885605	T	0.25531	0.0621	N	0.08118	0	0.09310	N	1	B;B	0.22080	0.064;0.064	B;B	0.21546	0.035;0.035	T	0.22730	-1.0208	10	0.02654	T	1	.	1.8721	0.03210	0.187:0.1144:0.2021:0.4965	.	1126;1129	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	Y	1129;1126	ENSP00000362304:D1129Y;ENSP00000362303:D1126Y	ENSP00000362303:D1126Y	D	+	1	0	ADAMTS14	72190319	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.814000	0.04486	-0.430000	0.07318	-0.152000	0.13540	GAC		0.637	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722		Missense_Mutation
AGTPBP1	23287	hgsc.bcm.edu	37	9	88257774	88257774	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr9:88257774G>T	ENST00000357081.3	-	13	1414	c.1270C>A	c.(1270-1272)Cac>Aac	p.H424N	AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000432218.1_Missense_Mutation_p.H262N|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.H384N|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.H436N			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	424					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.H384N(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						GGGAAAAGGTGTTCATACATT	0.303																																																1	Substitution - Missense(1)	ovary(1)	9											141.0	151.0	147.0					9																	88257774		2203	4298	6501	87447594	SO:0001583	missense	23287			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.1270C>A	9.37:g.88257774G>T	ENSP00000349592:p.His424Asn		87447594	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	ENST00000357081.3	37		SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878896	0.33162	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.62	5.62	0.85841	.	0.376195	0.30374	N	0.009780	T	0.40322	0.1112	L	0.40543	1.245	0.80722	D	1	B;P;P;B	0.35174	0.306;0.488;0.481;0.351	B;B;B;B	0.38500	0.1;0.07;0.275;0.146	T	0.10086	-1.0645	10	0.17369	T	0.5	-15.6193	19.6544	0.95831	0.0:0.0:1.0:0.0	.	436;424;262;384	Q9UPW5-3;Q9UPW5;B4DHX2;Q9UPW5-2	.;CBPC1_HUMAN;.;.	N	424;384;436;262	ENSP00000349592:H424N;ENSP00000365251:H384N;ENSP00000365277:H436N;ENSP00000402804:H262N	ENSP00000349592:H424N	H	-	1	0	AGTPBP1	87447594	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.186000	0.65082	2.647000	0.89833	0.467000	0.42956	CAC		0.303	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239		Missense_Mutation
ASAP1	50807	hgsc.bcm.edu	37	8	131165027	131165027	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr8:131165027C>A	ENST00000518721.1	-	13	1262	c.1035G>T	c.(1033-1035)agG>agT	p.R345S	ASAP1_ENST00000357668.1_Missense_Mutation_p.R345S	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	345	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.R345S(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						CTGAACACTTCCTCCTCTGCC	0.428																																																1	Substitution - Missense(1)	ovary(1)	8											205.0	173.0	184.0					8																	131165027		2203	4300	6503	131234209	SO:0001583	missense	50807			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.1035G>T	8.37:g.131165027C>A	ENSP00000429900:p.Arg345Ser		131234209	B2RNV3	Missense_Mutation	SNP	ENST00000518721.1	37	CCDS6362.1	SNP	30	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.9|23.9	4.466941|4.466941	0.84425|0.84425	.|.	.|.	ENSG00000153317|ENSG00000153317	ENST00000524124|ENST00000343135;ENST00000357668;ENST00000518721;ENST00000524367	.|T;T;T	.|0.80653	.|-1.4;-1.4;3.36	5.18|5.18	4.06|4.06	0.47325|0.47325	.|Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.91858	.|0.7423	H|H	0.96691|0.96691	3.865|3.865	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.999;0.993	.|D;D;D	.|0.87578	.|0.998;0.998;0.991	.|D	.|0.92532	.|0.6034	.|10	.|0.87932	.|D	.|0	.|.	9.0912|9.0912	0.36612|0.36612	0.0:0.8618:0.0:0.1382|0.0:0.8618:0.0:0.1382	.|.	.|345;345;348	.|B2RNV3;Q9ULH1;Q9ULH1-2	.|.;ASAP1_HUMAN;.	X|S	166|348;345;345;315	.|ENSP00000350297:R345S;ENSP00000429900:R345S;ENSP00000430588:R315S	.|ENSP00000344591:R348S	E|R	-|-	1|3	0|2	ASAP1|ASAP1	131234209|131234209	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	0.519000|0.519000	0.22862|0.22862	2.572000|2.572000	0.86782|0.86782	0.655000|0.655000	0.94253|0.94253	GAA|AGG		0.428	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482		Missense_Mutation
GPR75-ASB3	100302652	hgsc.bcm.edu	37	2	53956675	53956675	+	Silent	SNP	G	G	A	rs34266611		TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr2:53956675G>A	ENST00000263634.3	-	4	522	c.388C>T	c.(388-390)Ctg>Ttg	p.L130L	GPR75-ASB3_ENST00000406687.1_Silent_p.L57L|GPR75-ASB3_ENST00000482829.1_5'UTR|ASB3_ENST00000498475.2_5'UTR|ASB3_ENST00000406625.2_Silent_p.L165L|GPR75-ASB3_ENST00000352846.3_Silent_p.L168L|GPR75-ASB3_ENST00000394717.2_Silent_p.L57L	NM_016115.4	NP_057199.1			GPR75-ASB3 readthrough									p.L130L(1)									TGAAGCAACAGCCTTAACACA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	2											153.0	138.0	143.0					2																	53956675		2203	4300	6503	53810179	SO:0001819	synonymous_variant	51130				CCDS54361.1	2p16	2013-01-23			ENSG00000115239	ENSG00000115239			40043	other	readthrough							Standard	NM_001164165		Approved				OTTHUMG00000129279	ENST00000263634.3:c.388C>T	2.37:g.53956675G>A			53810179		Silent	SNP	ENST00000263634.3	37	CCDS1846.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	4.947	0.175996	0.09443	.	.	ENSG00000115239	ENST00000406053	.	.	.	5.68	4.78	0.61160	.	.	.	.	.	T	0.54822	0.1882	.	.	.	.	.	.	.	.	.	.	.	.	T	0.64927	-0.6292	3	.	.	.	.	10.7994	0.46480	0.0724:0.1335:0.7941:0.0	.	.	.	.	V	122	.	.	A	-	2	0	ASB3	53810179	1.000000	0.71417	0.994000	0.49952	0.772000	0.43724	1.628000	0.37060	1.367000	0.46095	0.563000	0.77884	GCT		0.393	GPR75-ASB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251402.3			Silent
BRCA1	672	hgsc.bcm.edu	37	17	41243899	41243900	+	Frame_Shift_Ins	INS	-	-	TAAGTTCT	rs273900712|rs80357902		TCGA-25-1632-01	TCGA-25-1632-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr17:41243899_41243900insTAAGTTCT	ENST00000357654.3	-	10	3766_3767	c.3648_3649insAGAACTTA	c.(3646-3651)ttatctfs	p.S1217fs	BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000309486.4_Frame_Shift_Ins_p.S921fs|BRCA1_ENST00000346315.3_Frame_Shift_Ins_p.S1217fs|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000471181.2_Frame_Shift_Ins_p.S1217fs|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000493795.1_Frame_Shift_Ins_p.S1170fs|BRCA1_ENST00000354071.3_Frame_Shift_Ins_p.S1217fs	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1217			S -> Y (in BC and BROVCA1). {ECO:0000269|PubMed:14722926}.		androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S1217fs*21(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCCTCACTAGATAAGTTCTCTT	0.455			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	1	Insertion - Frameshift(1)	ovary(1)	17	GRCh37	CI011224	BRCA1	I	rs80357902																																			38497426	SO:0001589	frameshift_variant	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.3641_3648dupAGAACTTA	17.37:g.41243900_41243907dupTAAGTTCT	ENSP00000350283:p.Ser1217fs		38497425	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Frame_Shift_Ins	INS	ENST00000357654.3	37	CCDS11453.1	INS	12	Baylor																																																																																				0.455	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294		Frame_Shift_Ins
CXCL13	10563	hgsc.bcm.edu	37	4	78528991	78528991	+	Splice_Site	SNP	T	T	G			TCGA-25-1632-01	TCGA-25-1632-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr4:78528991T>G	ENST00000286758.4	+	3	275		c.e3+2			NM_006419.2	NP_006410.1	O43927	CXL13_HUMAN	chemokine (C-X-C motif) ligand 13						activation of Rap GTPase activity (GO:0032861)|B cell chemotaxis (GO:0035754)|B cell chemotaxis across high endothelial venule (GO:0035769)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|chronic inflammatory response (GO:0002544)|defense response to bacterium (GO:0042742)|endothelial cell chemotaxis to fibroblast growth factor (GO:0035768)|germinal center formation (GO:0002467)|immune response (GO:0006955)|lymph node development (GO:0048535)|lymphocyte chemotaxis across high endothelial venule (GO:0002518)|negative regulation of endothelial cell chemotaxis to fibroblast growth factor (GO:2000545)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of integrin activation (GO:0033625)|positive regulation of T cell chemotaxis (GO:0010820)|regulation of angiogenesis (GO:0045765)|regulation of humoral immune response (GO:0002920)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR10 chemokine receptor binding (GO:0031735)|chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|CXCR5 chemokine receptor binding (GO:0031724)|fibroblast growth factor binding (GO:0017134)|heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|receptor agonist activity (GO:0048018)	p.?(1)		large_intestine(1)|ovary(1)|skin(1)|urinary_tract(1)	4						AGAAATCATGTAAGTTTCAAG	0.368																																																1	Unknown(1)	ovary(1)	4											69.0	66.0	67.0					4																	78528991		2203	4300	6503	78748015	SO:0001630	splice_region_variant	10563			AJ002211	CCDS3582.1	4q21	2013-02-25	2008-08-29	2002-08-23	ENSG00000156234	ENSG00000156234		"""Endogenous ligands"""	10639	protein-coding gene	gene with protein product	"""B-cell chemoattractant"""	605149	"""small inducible cytokine B subfamily (Cys-X-Cys motif), member 13 (B-cell chemoattractant)"""	SCYB13		9463416, 9486651	Standard	NM_006419		Approved	BLC, BCA-1, BLR1L, ANGIE, ANGIE2	uc003hkr.3	O43927	OTTHUMG00000130201	ENST00000286758.4:c.197+2T>G	4.37:g.78528991T>G			78748015		Splice_Site_SNP	SNP	ENST00000286758.4	37	CCDS3582.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.62	2.290509	0.40494	.	.	ENSG00000156234	ENST00000286758	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8187	0.46591	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CXCL13	78748015	1.000000	0.71417	1.000000	0.80357	0.541000	0.35023	3.315000	0.51951	2.114000	0.64651	0.460000	0.39030	.		0.368	CXCL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252519.1		Intron	Splice_Site_SNP
CYP2A13	1553	hgsc.bcm.edu	37	19	41601813	41601813	+	Silent	SNP	A	A	G			TCGA-25-1632-01	TCGA-25-1632-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr19:41601813A>G	ENST00000330436.3	+	9	1452	c.1452A>G	c.(1450-1452)ccA>ccG	p.P484P		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	484					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	CCACGATCCCACGAAACTACA	0.627																																																0			19											139.0	124.0	129.0					19																	41601813		2203	4300	6503	46293653	SO:0001819	synonymous_variant	1553			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.1452A>G	19.37:g.41601813A>G			46293653	Q53YR8|Q6R569|Q6R570|Q9H2X2	Silent	SNP	ENST00000330436.3	37	CCDS12571.1	SNP	6	Baylor																																																																																				0.627	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766		Silent
DPY19L2	283417	hgsc.bcm.edu	37	12	63954300	63954300	+	Missense_Mutation	SNP	C	C	T	rs12314553	byFrequency	TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr12:63954300C>T	ENST00000324472.4	-	22	2452	c.2269G>A	c.(2269-2271)Gtt>Att	p.V757I	DPY19L2_ENST00000413230.2_Missense_Mutation_p.V204I	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	757			V -> I (in dbSNP:rs12314553).		multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		TCTCAGTTAACCTTTAATACT	0.408													c|||	672	0.134185	0.2466	0.1239	5008	,	,		16421	0.0099		0.172	False		,,,				2504	0.0787															0			12						C	ILE/VAL	1016,3390	374.6+/-321.3	105,806,1292	86.0	81.0	82.0		2269	2.1	0.4	12	dbSNP_120	82	1320,7280	259.7+/-282.8	101,1118,3081	yes	missense	DPY19L2	NM_173812.4	29	206,1924,4373	TT,TC,CC		15.3488,23.0595,17.9609	benign	757/759	63954300	2336,10670	2203	4300	6503	62240567	SO:0001583	missense	283417				CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.2269G>A	12.37:g.63954300C>T	ENSP00000315988:p.Val757Ile		62240567	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	CCDS31851.1	SNP	18	Baylor	310	0.14194139194139194	129	0.2621951219512195	50	0.13812154696132597	6	0.01048951048951049	125	0.16490765171503957	C	12.42	1.934130	0.34096	0.230595	0.153488	ENSG00000177990	ENST00000324472;ENST00000413230	T;T	0.55588	0.51;0.51	3.0	2.07	0.26955	.	0.063133	0.64402	D	0.000007	T	0.00012	0.0000	L	0.35414	1.06	0.32875	P	0.490194	B	0.31581	0.329	B	0.40375	0.327	T	0.21621	-1.0240	8	.	.	.	.	5.5277	0.16967	0.0:0.8213:0.0:0.1787	rs12314553	757	Q6NUT2	D19L2_HUMAN	I	757;204	ENSP00000315988:V757I;ENSP00000439794:V204I	.	V	-	1	0	DPY19L2	62240567	1.000000	0.71417	0.389000	0.26208	0.194000	0.23727	2.462000	0.45049	0.345000	0.23873	0.162000	0.16502	GTT		0.408	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812		Missense_Mutation
ENAM	10117	hgsc.bcm.edu	37	4	71509258	71509258	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1632-01	TCGA-25-1632-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr4:71509258T>A	ENST00000396073.3	+	9	2396	c.2115T>A	c.(2113-2115)gaT>gaA	p.D705E	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	705					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)		p.D705E(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			ATTCTTTAGATAATCCATCAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	4											72.0	73.0	73.0					4																	71509258		2203	4300	6503	71728122	SO:0001583	missense	10117			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.2115T>A	4.37:g.71509258T>A	ENSP00000379383:p.Asp705Glu		71728122	Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	37	CCDS3544.2	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.77	1.444856	0.25987	.	.	ENSG00000132464	ENST00000396073	T	0.37411	1.2	6.01	2.15	0.27550	.	0.202809	0.35151	N	0.003411	T	0.46268	0.1384	M	0.78456	2.415	0.09310	N	1	P	0.50272	0.933	P	0.53518	0.728	T	0.35276	-0.9795	10	0.40728	T	0.16	-16.2464	5.9703	0.19349	0.1246:0.1478:0.0:0.7276	.	705	Q9NRM1	ENAM_HUMAN	E	705	ENSP00000379383:D705E	ENSP00000379383:D705E	D	+	3	2	ENAM	71728122	0.992000	0.36948	0.818000	0.32626	0.166000	0.22503	0.141000	0.16076	-0.081000	0.12662	-1.139000	0.01908	GAT		0.393	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889		Missense_Mutation
FAM65A	79567	hgsc.bcm.edu	37	16	67576923	67576923	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr16:67576923C>A	ENST00000379312.3	+	13	2367	c.2246C>A	c.(2245-2247)tCa>tAa	p.S749*	FAM65A_ENST00000428437.2_Nonsense_Mutation_p.S759*|FAM65A_ENST00000422602.2_Nonsense_Mutation_p.S765*|FAM65A_ENST00000540839.3_Nonsense_Mutation_p.S765*|CTD-2012K14.2_ENST00000567122.1_RNA|CTD-2012K14.3_ENST00000563083.1_RNA|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000042381.4_Nonsense_Mutation_p.S745*	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	749	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.S745*(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		CCAGATCCCTCAGAGTCTACG	0.602																																																1	Substitution - Nonsense(1)	ovary(1)	16											97.0	107.0	104.0					16																	67576923		2198	4300	6498	66134424	SO:0001587	stop_gained	79567			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.2246C>A	16.37:g.67576923C>A	ENSP00000368614:p.Ser749*		66134424	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Nonsense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	32	5.119447	0.94385	.	.	ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	.	.	.	5.2	2.1	0.27182	.	0.913413	0.09448	N	0.800797	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.3111	5.0332	0.14421	0.1658:0.6548:0.0:0.1794	.	.	.	.	X	749;745;765;759	.	ENSP00000042381:S745X	S	+	2	0	FAM65A	66134424	0.000000	0.05858	0.005000	0.12908	0.019000	0.09904	-0.643000	0.05421	0.198000	0.20407	0.555000	0.69702	TCA		0.602	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519		Nonsense_Mutation
FAT2	2196	hgsc.bcm.edu	37	5	150901462	150901462	+	Silent	SNP	C	C	G			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr5:150901462C>G	ENST00000261800.5	-	18	10704	c.10692G>C	c.(10690-10692)ctG>ctC	p.L3564L		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3564	Cadherin 32. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L3564L(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCTATAGGTCAGCGTGTCCT	0.602																																																1	Substitution - coding silent(1)	ovary(1)	5											94.0	84.0	88.0					5																	150901462		2203	4300	6503	150881655	SO:0001819	synonymous_variant	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.10692G>C	5.37:g.150901462C>G			150881655	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	CCDS4317.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.252	0.045719	0.08196	.	.	ENSG00000086570	ENST00000520200	.	.	.	5.38	1.48	0.22813	.	.	.	.	.	T	0.55545	0.1927	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45056	-0.9287	4	.	.	.	.	8.3389	0.32232	0.0:0.6279:0.2396:0.1325	.	.	.	.	H	423	.	.	D	-	1	0	FAT2	150881655	0.612000	0.27000	0.934000	0.37439	0.664000	0.39144	-0.041000	0.12084	0.047000	0.15862	-0.300000	0.09419	GAC		0.602	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		Silent
FUCA2	2519	hgsc.bcm.edu	37	6	143825326	143825326	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr6:143825326C>T	ENST00000002165.6	-	3	531	c.476G>A	c.(475-477)aGg>aAg	p.R159K	FUCA2_ENST00000438118.2_Intron|RP1-20N2.6_ENST00000593175.1_RNA|FUCA2_ENST00000367585.1_Intron|RP1-20N2.6_ENST00000589563.1_RNA|RP1-20N2.6_ENST00000593045.1_RNA|RP1-20N2.6_ENST00000589489.1_RNA|RP1-20N2.6_ENST00000591189.1_RNA|RP1-20N2.6_ENST00000415586.1_RNA|RP1-20N2.6_ENST00000591892.1_RNA|RP1-20N2.6_ENST00000590703.1_RNA|RP1-20N2.6_ENST00000610068.1_RNA	NM_032020.4	NP_114409.2	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma	159					fucose metabolic process (GO:0006004)|glycoside catabolic process (GO:0016139)|regulation of entry of bacterium into host cell (GO:2000535)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)	p.R159K(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		GACAATGTCCCTCTTGGGCCC	0.443																																																1	Substitution - Missense(1)	ovary(1)	6											110.0	113.0	112.0					6																	143825326		2203	4300	6503	143867019	SO:0001583	missense	2519			BC003060	CCDS5200.1	6q24	2012-10-02			ENSG00000001036	ENSG00000001036	3.2.1.51		4008	protein-coding gene	gene with protein product		136820				6590153	Standard	NM_032020		Approved	MGC1314, dJ20N2.5	uc003qjm.3	Q9BTY2	OTTHUMG00000015728	ENST00000002165.6:c.476G>A	6.37:g.143825326C>T	ENSP00000002165:p.Arg159Lys		143867019	E9PEB6|Q7Z6V1|Q7Z6Y2|Q8NBK4	Missense_Mutation	SNP	ENST00000002165.6	37	CCDS5200.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	34	5.298977	0.95574	.	.	ENSG00000001036	ENST00000002165	T	0.57752	0.38	5.61	4.74	0.60224	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.60038	0.2238	M	0.80028	2.48	0.80722	D	1	P	0.49447	0.924	P	0.56088	0.791	T	0.64782	-0.6326	10	0.45353	T	0.12	-19.406	14.7773	0.69740	0.0:0.9303:0.0:0.0697	.	159	Q9BTY2	FUCO2_HUMAN	K	159	ENSP00000002165:R159K	ENSP00000002165:R159K	R	-	2	0	FUCA2	143867019	1.000000	0.71417	0.991000	0.47740	0.974000	0.67602	5.775000	0.68915	1.359000	0.45940	0.650000	0.86243	AGG		0.443	FUCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042521.2	NM_032020		Missense_Mutation
GART	2618	hgsc.bcm.edu	37	21	34882122	34882122	+	Frame_Shift_Del	DEL	T	T	-			TCGA-25-1632-01	TCGA-25-1632-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr21:34882122delT	ENST00000381831.3	-	18	2683	c.2420delA	c.(2419-2421)aagfs	p.K807fs	GART_ENST00000381815.4_Frame_Shift_Del_p.K807fs|GART_ENST00000543717.1_Frame_Shift_Del_p.K359fs|GART_ENST00000381839.3_Frame_Shift_Del_p.K807fs	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	807	AIRS.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)	p.K807fs*7(2)		NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	CACTCTGGCCTTTTTTTTTTC	0.448																																																2	Deletion - Frameshift(2)	ovary(2)	21							,,	89,4175		15,59,2058	66.0	70.0	68.0		,,	1.6	0.9	21		70	96,8158		13,70,4044	no	frameshift,frameshift,frameshift	GART	NM_001136006.1,NM_001136005.1,NM_000819.4	,,	28,129,6102	A1A1,A1R,RR		1.1631,2.0872,1.4779	,,	,,	34882122	185,12333	2203	4300	6503	33803992	SO:0001589	frameshift_variant	2618			M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.2420delA	21.37:g.34882122delT	ENSP00000371253:p.Lys807fs		33803992	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Frame_Shift_Del	DEL	ENST00000381831.3	37	CCDS13627.1	DEL	56	Baylor																																																																																				0.448	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140626.3	NM_000819		Frame_Shift_Del
GBP6	163351	hgsc.bcm.edu	37	1	89845978	89845978	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr1:89845978C>T	ENST00000370456.4	+	6	752	c.659C>T	c.(658-660)cCc>cTc	p.P220L	GBP6_ENST00000535065.1_Missense_Mutation_p.P90L	NM_198460.2	NP_940862.2	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	220	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cellular response to interferon-gamma (GO:0071346)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.P220L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		TCCAATTTTCCCAGGGAGTGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											82.0	82.0	82.0					1																	89845978		2203	4300	6503	89618566	SO:0001583	missense	163351			BX537949	CCDS723.1	1p22	2008-02-05			ENSG00000183347	ENSG00000183347			25395	protein-coding gene	gene with protein product		612467					Standard	NM_198460		Approved	DKFZp686G0786	uc001dnf.2	Q6ZN66	OTTHUMG00000010123	ENST00000370456.4:c.659C>T	1.37:g.89845978C>T	ENSP00000359485:p.Pro220Leu		89618566	A2RRM3|Q6ZN86|Q7Z3F0	Missense_Mutation	SNP	ENST00000370456.4	37	CCDS723.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.28	1.892042	0.33442	.	.	ENSG00000183347	ENST00000544311;ENST00000370456;ENST00000535065	T;T	0.60424	0.19;0.19	4.54	1.63	0.23807	Guanylate-binding protein, N-terminal (1);	0.322691	0.27294	N	0.020032	T	0.40372	0.1114	M	0.85630	2.765	0.09310	N	1	B	0.30741	0.293	B	0.31686	0.134	T	0.44329	-0.9335	10	0.66056	D	0.02	-0.0168	7.8433	0.29410	0.0:0.7171:0.0:0.2829	.	220	Q6ZN66	GBP6_HUMAN	L	191;220;90	ENSP00000359485:P220L;ENSP00000442530:P90L	ENSP00000359485:P220L	P	+	2	0	GBP6	89618566	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	1.839000	0.39220	0.043000	0.15746	-0.229000	0.12294	CCC		0.403	GBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028001.1	NM_198460		Missense_Mutation
GRIN3A	116443	hgsc.bcm.edu	37	9	104449422	104449422	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr9:104449422C>T	ENST00000361820.3	-	2	1360	c.760G>A	c.(760-762)Gtc>Atc	p.V254I		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	254					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.V254I(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	AGGATTGAGACAGTGACATCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	9											96.0	92.0	94.0					9																	104449422		2203	4300	6503	103489243	SO:0001583	missense	116443				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.760G>A	9.37:g.104449422C>T	ENSP00000355155:p.Val254Ile		103489243	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.53	2.264608	0.40095	.	.	ENSG00000198785	ENST00000361820	D	0.87729	-2.29	5.69	4.79	0.61399	.	0.471093	0.22185	N	0.063452	T	0.81297	0.4793	L	0.43152	1.355	0.25569	N	0.986912	B	0.25521	0.128	B	0.24006	0.05	T	0.73780	-0.3875	10	0.66056	D	0.02	.	7.9582	0.30055	0.2609:0.6594:0.0:0.0797	.	254	Q8TCU5	NMD3A_HUMAN	I	254	ENSP00000355155:V254I	ENSP00000355155:V254I	V	-	1	0	GRIN3A	103489243	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.284000	0.33249	1.406000	0.46857	0.455000	0.32223	GTC		0.383	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1			Missense_Mutation
HERC5	51191	hgsc.bcm.edu	37	4	89397041	89397041	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr4:89397041C>T	ENST00000264350.3	+	12	1595	c.1442C>T	c.(1441-1443)tCt>tTt	p.S481F	HERC5_ENST00000508159.1_Missense_Mutation_p.S119F	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	481					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.S481F(1)		NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		CCATTTCATTCTCCACCCCAA	0.423																																					Esophageal Squamous(39;887 1012 34045 50514)											1	Substitution - Missense(1)	ovary(1)	4											122.0	122.0	122.0					4																	89397041		2203	4300	6503	89616064	SO:0001583	missense	51191			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.1442C>T	4.37:g.89397041C>T	ENSP00000264350:p.Ser481Phe		89616064	B2RTQ1|Q69G20	Missense_Mutation	SNP	ENST00000264350.3	37	CCDS3630.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338426	0.41398	.	.	ENSG00000138646	ENST00000264350;ENST00000508159	T;T	0.38240	1.15;1.2	4.79	3.95	0.45737	.	0.356029	0.23116	N	0.051755	T	0.43545	0.1252	M	0.71036	2.16	0.26675	N	0.971646	P	0.40144	0.704	P	0.45913	0.497	T	0.38757	-0.9646	10	0.54805	T	0.06	.	9.0727	0.36502	0.0:0.8997:0.0:0.1003	.	481	Q9UII4	HERC5_HUMAN	F	481;119	ENSP00000264350:S481F;ENSP00000424129:S119F	ENSP00000264350:S481F	S	+	2	0	HERC5	89616064	1.000000	0.71417	0.989000	0.46669	0.516000	0.34256	3.304000	0.51866	1.385000	0.46445	0.591000	0.81541	TCT		0.423	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323		Missense_Mutation
HNF1B	6928	hgsc.bcm.edu	37	17	36093625	36093625	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1632-01	TCGA-25-1632-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr17:36093625A>G	ENST00000225893.4	-	3	1095	c.734T>C	c.(733-735)aTc>aCc	p.I245T	HNF1B_ENST00000427275.2_Missense_Mutation_p.I219T|HNF1B_ENST00000560016.1_Missense_Mutation_p.I245T|HNF1B_ENST00000561193.1_Missense_Mutation_p.I219T	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	245					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.I245T(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			CTGGTACAAGATTTGCTGGGA	0.582																																					Colon(71;102 1179 9001 27917 43397)											1	Substitution - Missense(1)	ovary(1)	17											135.0	126.0	129.0					17																	36093625		2203	4300	6503	33167738	SO:0001583	missense	6928			BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.734T>C	17.37:g.36093625A>G	ENSP00000225893:p.Ile245Thr		33167738	B4DKM3|E0YMJ9	Missense_Mutation	SNP	ENST00000225893.4	37	CCDS11324.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	19.53	3.845822	0.71603	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000544593;ENST00000539087	D;D	0.96334	-3.98;-3.98	4.88	4.88	0.63580	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.071350	0.85682	D	0.000000	D	0.97489	0.9178	M	0.77103	2.36	0.80722	D	1	P;P;P	0.51537	0.946;0.881;0.72	D;P;B	0.65140	0.932;0.69;0.434	D	0.96769	0.9567	10	0.27785	T	0.31	-5.078	14.0863	0.64959	1.0:0.0:0.0:0.0	.	219;245;245	E0YMJ6;P35680-3;P35680	.;.;HNF1B_HUMAN	T	245;219;245;133	ENSP00000225893:I245T;ENSP00000412212:I219T	ENSP00000225893:I245T	I	-	2	0	HNF1B	33167738	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.709000	0.91379	2.167000	0.68274	0.482000	0.46254	ATC		0.582	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256807.3	NM_000458		Missense_Mutation
IRF2	3660	hgsc.bcm.edu	37	4	185339692	185339692	+	Nonsense_Mutation	SNP	T	T	A			TCGA-25-1632-01	TCGA-25-1632-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr4:185339692T>A	ENST00000393593.3	-	4	565	c.358A>T	c.(358-360)Aag>Tag	p.K120*	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	120					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K120*(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		TTACCTTTCTTAGAAGGCCGT	0.403																																																1	Substitution - Nonsense(1)	ovary(1)	4											133.0	130.0	131.0					4																	185339692		2203	4300	6503	185576686	SO:0001587	stop_gained	3660				CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.358A>T	4.37:g.185339692T>A	ENSP00000377218:p.Lys120*		185576686	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Nonsense_Mutation	SNP	ENST00000393593.3	37	CCDS3835.1	SNP	61	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	37|37	5.992207|5.992207	0.97179|0.97179	.|.	.|.	ENSG00000168310|ENSG00000168310	ENST00000393593;ENST00000502750;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316|ENST00000505067	.|.	.|.	.|.	4.93|4.93	4.93|4.93	0.64822|0.64822	.|.	0.211209|.	0.48286|.	D|.	0.000191|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	-22.2723|-22.2723	15.0337|15.0337	0.71728|0.71728	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	X|L	120;32;120;120;120;120|18	.|.	ENSP00000377218:K120X|.	K|X	-|-	1|2	0|2	IRF2|IRF2	185576686|185576686	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.816000|0.816000	0.46133|0.46133	7.381000|7.381000	0.79718|0.79718	2.209000|2.209000	0.71365|0.71365	0.533000|0.533000	0.62120|0.62120	AAG|TAA		0.403	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1			Nonsense_Mutation
ITGA3	3675	hgsc.bcm.edu	37	17	48148246	48148246	+	Missense_Mutation	SNP	T	T	C	rs539540896		TCGA-25-1632-01	TCGA-25-1632-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr17:48148246T>C	ENST00000320031.8	+	5	1033	c.703T>C	c.(703-705)Tct>Cct	p.S235P	ITGA3_ENST00000544892.1_Missense_Mutation_p.S10P|ITGA3_ENST00000007722.7_Missense_Mutation_p.S235P	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	235					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)	p.S235P(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						GTGGGACTTATCTGAGTATAG	0.493													T|||	1	0.000199681	0.0	0.0	5008	,	,		16516	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	17											205.0	211.0	209.0					17																	48148246		2203	4300	6503	45503245	SO:0001583	missense	3675			M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.703T>C	17.37:g.48148246T>C	ENSP00000315190:p.Ser235Pro		45503245	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	ENST00000320031.8	37	CCDS11558.1	SNP	50	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.49	3.636343	0.67130	.	.	ENSG00000005884	ENST00000544892;ENST00000007722;ENST00000538917;ENST00000320031	T;T;T	0.54071	0.59;0.59;0.59	5.69	5.69	0.88448	.	1.181470	0.05840	N	0.619190	T	0.56543	0.1992	L	0.31526	0.94	0.22017	N	0.999418	D;B	0.56287	0.975;0.004	P;B	0.53450	0.726;0.002	T	0.47484	-0.9114	10	0.30078	T	0.28	.	12.336	0.55067	0.0:0.0:0.0:1.0	.	235;235	P26006-1;P26006	.;ITA3_HUMAN	P	10;235;221;235	ENSP00000446133:S10P;ENSP00000007722:S235P;ENSP00000315190:S235P	ENSP00000007722:S235P	S	+	1	0	ITGA3	45503245	0.702000	0.27816	0.359000	0.25824	0.978000	0.69477	1.912000	0.39946	2.166000	0.68216	0.533000	0.62120	TCT		0.493	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1	NM_005501		Missense_Mutation
VWA8	23078	hgsc.bcm.edu	37	13	42385438	42385438	+	Silent	SNP	C	C	G			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr13:42385438C>G	ENST00000379310.3	-	17	2054	c.1986G>C	c.(1984-1986)ctG>ctC	p.L662L	VWA8_ENST00000281496.6_Silent_p.L662L	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	662						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.L662L(1)									AAATTCGCAACAGTTGTCTGG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	13											128.0	131.0	130.0					13																	42385438		2203	4300	6503	41283438	SO:0001819	synonymous_variant	23078			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.1986G>C	13.37:g.42385438C>G			41283438	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Silent	SNP	ENST00000379310.3	37	CCDS41881.1	SNP	17	Baylor																																																																																				0.398	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058		Silent
CCSER2	54462	hgsc.bcm.edu	37	10	86259652	86259652	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1632-01	TCGA-25-1632-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr10:86259652T>G	ENST00000224756.8	+	10	2532	c.2347T>G	c.(2347-2349)Ttc>Gtc	p.F783V	CCSER2_ENST00000543283.1_Missense_Mutation_p.F210V|CCSER2_ENST00000372088.2_Intron|CCSER2_ENST00000494144.1_Intron	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	783					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)		p.F783V(1)									TGCTCCCTCCTTCTCTCCTTG	0.512																																																1	Substitution - Missense(1)	ovary(1)	10											133.0	118.0	123.0					10																	86259652		2203	4300	6503	86249632	SO:0001583	missense	54462				CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.2347T>G	10.37:g.86259652T>G	ENSP00000224756:p.Phe783Val		86249632	B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Missense_Mutation	SNP	ENST00000224756.8	37	CCDS31235.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.62	3.173097	0.57584	.	.	ENSG00000107771	ENST00000224756;ENST00000543283	T;T	0.22539	2.28;1.95	5.96	5.96	0.96718	.	0.208890	0.41294	D	0.000917	T	0.21509	0.0518	L	0.44542	1.39	0.35247	D	0.778384	P	0.37330	0.59	B	0.38954	0.286	T	0.24621	-1.0155	10	0.25751	T	0.34	.	14.3921	0.66986	0.0:0.0:0.0:1.0	.	783	Q9H7U1	F190B_HUMAN	V	783;210	ENSP00000224756:F783V;ENSP00000439944:F210V	ENSP00000224756:F783V	F	+	1	0	FAM190B	86249632	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.544000	0.60691	2.286000	0.76751	0.454000	0.30748	TTC		0.512	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049132.2	NM_018999		Missense_Mutation
KIF21B	23046	hgsc.bcm.edu	37	1	200956256	200956256	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr1:200956256G>T	ENST00000422435.2	-	25	3798	c.3482C>A	c.(3481-3483)aCc>aAc	p.T1161N	KIF21B_ENST00000461742.2_Missense_Mutation_p.T1161N|KIF21B_ENST00000360529.5_Missense_Mutation_p.T1161N|KIF21B_ENST00000332129.2_Missense_Mutation_p.T1161N	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1161					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T1161N(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						GATGTTCTTGGTGGAGATATC	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											109.0	122.0	118.0					1																	200956256		2203	4300	6503	199222879	SO:0001583	missense	23046			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.3482C>A	1.37:g.200956256G>T	ENSP00000411831:p.Thr1161Asn		199222879	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	CCDS58056.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370310	0.82573	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.72725	-0.34;-0.66;-0.68;-0.37	5.17	5.17	0.71159	.	0.133214	0.52532	D	0.000079	T	0.72374	0.3452	L	0.40543	1.245	0.47374	D	0.999407	P;P;D;P	0.53151	0.651;0.651;0.958;0.763	B;B;P;B	0.51833	0.057;0.122;0.681;0.121	T	0.71334	-0.4624	10	0.35671	T	0.21	.	18.2598	0.90031	0.0:0.0:1.0:0.0	.	1161;1161;1161;1161	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	N	1161	ENSP00000328494:T1161N;ENSP00000353724:T1161N;ENSP00000433808:T1161N;ENSP00000411831:T1161N	ENSP00000328494:T1161N	T	-	2	0	KIF21B	199222879	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.364000	0.97136	2.420000	0.82092	0.655000	0.94253	ACC		0.577	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332		Missense_Mutation
KLK10	5655	hgsc.bcm.edu	37	19	51519365	51519365	+	Missense_Mutation	SNP	C	C	A	rs577311064		TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr19:51519365C>A	ENST00000309958.3	-	4	535	c.317G>T	c.(316-318)gGa>gTa	p.G106V	KLK10_ENST00000358789.3_Missense_Mutation_p.G106V|KLK10_ENST00000391805.1_Missense_Mutation_p.G106V|CTC-518B2.12_ENST00000596286.1_RNA	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	106	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.G106V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		GAGCTGCTCTCCCTGAAGAAG	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											42.0	35.0	37.0					19																	51519365		2200	4295	6495	56211177	SO:0001583	missense	5655			AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.317G>T	19.37:g.51519365C>A	ENSP00000311746:p.Gly106Val		56211177	A6NC12|Q53YL3|Q99920|Q9GZW9	Missense_Mutation	SNP	ENST00000309958.3	37	CCDS12817.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	c	18.24	3.579954	0.65992	.	.	ENSG00000129451	ENST00000391805;ENST00000309958;ENST00000358789	D;D;D	0.90504	-2.68;-2.68;-2.68	4.67	3.6	0.41247	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.685753	0.11990	N	0.509955	D	0.89529	0.6741	L	0.50993	1.605	0.37346	D	0.91058	P	0.38078	0.617	B	0.44133	0.442	D	0.88603	0.3151	10	0.87932	D	0	.	9.529	0.39182	0.0:0.8977:0.0:0.1023	.	106	O43240	KLK10_HUMAN	V	106	ENSP00000375681:G106V;ENSP00000311746:G106V;ENSP00000351640:G106V	ENSP00000311746:G106V	G	-	2	0	KLK10	56211177	0.006000	0.16342	0.752000	0.31206	0.988000	0.76386	0.528000	0.23002	1.046000	0.40249	0.655000	0.94253	GGA		0.602	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464337.2	NM_002776		Missense_Mutation
LGR6	59352	hgsc.bcm.edu	37	1	202279332	202279332	+	Nonsense_Mutation	SNP	G	G	T			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr1:202279332G>T	ENST00000367278.3	+	16	1503	c.1414G>T	c.(1414-1416)Gag>Tag	p.E472*	LGR6_ENST00000439764.2_Nonsense_Mutation_p.E333*|LGR6_ENST00000255432.7_Nonsense_Mutation_p.E420*	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	472					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						CAGGATCCTGGAGGTGCCTTA	0.557																																																0			1											155.0	144.0	148.0					1																	202279332		2203	4300	6503	200545955	SO:0001587	stop_gained	59352			AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.1414G>T	1.37:g.202279332G>T	ENSP00000356247:p.Glu472*		200545955	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Nonsense_Mutation	SNP	ENST00000367278.3	37	CCDS30971.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	38	7.107575	0.98066	.	.	ENSG00000133067	ENST00000367278;ENST00000255432;ENST00000439764	.	.	.	5.71	5.71	0.89125	.	0.052264	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	19.8384	0.96670	0.0:0.0:1.0:0.0	.	.	.	.	X	472;420;333	.	ENSP00000255432:E420X	E	+	1	0	LGR6	200545955	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.753000	0.98904	2.679000	0.91253	0.655000	0.94253	GAG		0.557	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636		Nonsense_Mutation
MAML1	9794	hgsc.bcm.edu	37	5	179193618	179193618	+	Missense_Mutation	SNP	A	A	G	rs376292928		TCGA-25-1632-01	TCGA-25-1632-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr5:179193618A>G	ENST00000292599.3	+	2	1870	c.1607A>G	c.(1606-1608)aAg>aGg	p.K536R	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCCAGAGCAAGCCAGCCCTG	0.537																																																0			5						A	ARG/LYS	0,4406		0,0,2203	63.0	63.0	63.0		1607	5.2	1.0	5		63	2,8598	2.2+/-6.3	0,2,4298	no	missense	MAML1	NM_014757.4	26	0,2,6501	GG,GA,AA		0.0233,0.0,0.0154	probably-damaging	536/1017	179193618	2,13004	2203	4300	6503	179126224	SO:0001583	missense	9794			D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1607A>G	5.37:g.179193618A>G	ENSP00000292599:p.Lys536Arg		179126224		Missense_Mutation	SNP	ENST00000292599.3	37	CCDS34315.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.29	3.351499	0.61183	0.0	2.33E-4	ENSG00000161021	ENST00000292599;ENST00000376951	T	0.33654	1.4	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.59756	0.2217	M	0.77820	2.39	0.48236	D	0.999617	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.59101	-0.7517	10	0.26408	T	0.33	-26.398	14.9577	0.71131	1.0:0.0:0.0:0.0	.	573;536	Q59GH4;Q92585	.;MAML1_HUMAN	R	536;573	ENSP00000292599:K536R	ENSP00000292599:K536R	K	+	2	0	MAML1	179126224	1.000000	0.71417	0.986000	0.45419	0.323000	0.28346	8.380000	0.90149	1.931000	0.55961	0.460000	0.39030	AAG		0.537	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757		Missense_Mutation
TAB3	257397	hgsc.bcm.edu	37	X	30873227	30873227	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chrX:30873227C>T	ENST00000378933.1	-	3	732	c.555G>A	c.(553-555)atG>atA	p.M185I	TAB3_ENST00000378932.2_Missense_Mutation_p.M185I|TAB3-AS2_ENST00000445240.1_RNA|TAB3_ENST00000378928.1_5'Flank|TAB3_ENST00000378930.3_Missense_Mutation_p.M185I|TAB3_ENST00000288422.2_Missense_Mutation_p.M185I	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	185	Pro-rich.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.M185I(1)		NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						GAGGTATGTGCATGTATGAAG	0.468																																					Pancreas(164;1598 1985 29022 43301 49529)											1	Substitution - Missense(1)	ovary(1)	X											179.0	135.0	150.0					X																	30873227		2202	4300	6502	30783148	SO:0001583	missense	257397			AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.555G>A	X.37:g.30873227C>T	ENSP00000368215:p.Met185Ile		30783148	A6NDD9|Q6VQR0	Missense_Mutation	SNP	ENST00000378933.1	37	CCDS14226.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.088	0.384530	0.11524	.	.	ENSG00000157625	ENST00000378933;ENST00000378930;ENST00000288422;ENST00000378932	T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.63	5.01	4.08	0.47627	.	0.095657	0.64402	D	0.000002	T	0.58323	0.2114	L	0.36672	1.1	0.38871	D	0.956697	B;B	0.33103	0.397;0.276	B;B	0.30943	0.122;0.057	T	0.59048	-0.7527	10	0.21014	T	0.42	-3.1236	14.2768	0.66184	0.0:0.8544:0.1456:0.0	.	185;185	Q8N5C8-2;Q8N5C8	.;TAB3_HUMAN	I	185	ENSP00000368215:M185I;ENSP00000368212:M185I;ENSP00000288422:M185I;ENSP00000368214:M185I	ENSP00000288422:M185I	M	-	3	0	TAB3	30783148	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.692000	0.54727	2.219000	0.72066	0.600000	0.82982	ATG		0.468	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056173.1	NM_152787		Missense_Mutation
MDN1	23195	hgsc.bcm.edu	37	6	90358040	90358040	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1632-01	TCGA-25-1632-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr6:90358040A>C	ENST00000369393.3	-	98	16330	c.16215T>G	c.(16213-16215)ttT>ttG	p.F5405L	MDN1_ENST00000428876.1_Missense_Mutation_p.F5405L			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	5405	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.F5405L(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CCAAAGATTCAAATGCAAGCT	0.368																																																1	Substitution - Missense(1)	ovary(1)	6											86.0	85.0	85.0					6																	90358040		2203	4300	6503	90414761	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.16215T>G	6.37:g.90358040A>C	ENSP00000358400:p.Phe5405Leu		90414761	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.05	2.717898	0.48622	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.20069	2.1;2.1	6.06	3.73	0.42828	von Willebrand factor, type A (2);	0.196470	0.45126	D	0.000383	T	0.02807	0.0084	N	0.17312	0.475	0.40165	D	0.977112	P	0.39282	0.666	B	0.31869	0.137	T	0.14896	-1.0456	10	0.02654	T	1	.	9.8345	0.40960	0.8637:0.0:0.1363:0.0	.	5405	Q9NU22	MDN1_HUMAN	L	5405	ENSP00000358400:F5405L;ENSP00000413970:F5405L	ENSP00000358400:F5405L	F	-	3	2	MDN1	90414761	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	3.168000	0.50801	1.119000	0.41883	0.533000	0.62120	TTT		0.368	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			Missense_Mutation
MGAT5	4249	hgsc.bcm.edu	37	2	135012017	135012017	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr2:135012017G>C	ENST00000409645.1	+	2	295	c.43G>C	c.(43-45)Ggc>Cgc	p.G15R	MGAT5_ENST00000281923.2_Missense_Mutation_p.G15R|MGAT5_ENST00000468758.1_3'UTR			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	15					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)	p.G15R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		TCAGAAGCTGGGCTTTTTCCT	0.502																																																1	Substitution - Missense(1)	ovary(1)	2											143.0	122.0	129.0					2																	135012017		2203	4300	6503	134728487	SO:0001583	missense	4249			D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.43G>C	2.37:g.135012017G>C	ENSP00000386377:p.Gly15Arg		134728487	D3DP70	Missense_Mutation	SNP	ENST00000409645.1	37	CCDS2171.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	31	5.073380	0.94000	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.75715	0.3887	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77843	-0.2437	9	0.87932	D	0	-22.0439	18.5677	0.91122	0.0:0.0:1.0:0.0	.	15	Q09328	MGT5A_HUMAN	R	15	.	ENSP00000281923:G15R	G	+	1	0	MGAT5	134728487	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.601000	0.98297	2.677000	0.91161	0.650000	0.86243	GGC		0.502	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	NM_002410		Missense_Mutation
MNS1	55329	hgsc.bcm.edu	37	15	56736697	56736697	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1632-01	TCGA-25-1632-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr15:56736697T>C	ENST00000260453.3	-	5	795	c.631A>G	c.(631-633)Aaa>Gaa	p.K211E	TEX9_ENST00000537232.1_Intron|TEX9_ENST00000352903.2_Intron	NM_018365.2	NP_060835.1	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	211	Glu-rich.				cilium organization (GO:0044782)|left/right axis specification (GO:0070986)|meiotic nuclear division (GO:0007126)	axoneme (GO:0005930)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)|sperm flagellum (GO:0036126)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	20				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		AGTTTCTCTTTTAGCAGCTGC	0.328																																																0			15											122.0	116.0	118.0					15																	56736697		2192	4290	6482	54523989	SO:0001583	missense	55329			AK002084	CCDS10158.1	15q21.3	2013-01-16			ENSG00000138587	ENSG00000138587			29636	protein-coding gene	gene with protein product	"""spermatogenesis associated 40"""	610766				7625268, 8032679	Standard	NM_018365		Approved	FLJ11222, SPATA40	uc002adr.2	Q8NEH6	OTTHUMG00000132034	ENST00000260453.3:c.631A>G	15.37:g.56736697T>C	ENSP00000260453:p.Lys211Glu		54523989	Q8IYT6|Q9NUP4	Missense_Mutation	SNP	ENST00000260453.3	37	CCDS10158.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	19.77	3.890096	0.72524	.	.	ENSG00000138587	ENST00000260453	T	0.09538	2.97	5.54	4.45	0.53987	.	0.095116	0.64402	D	0.000001	T	0.23846	0.0577	M	0.69358	2.11	0.45690	D	0.998609	D	0.64830	0.994	P	0.57283	0.817	T	0.00950	-1.1503	10	0.34782	T	0.22	-20.4789	12.7295	0.57191	0.0:0.0:0.1675:0.8325	.	211	Q8NEH6	MNS1_HUMAN	E	211	ENSP00000260453:K211E	ENSP00000260453:K211E	K	-	1	0	MNS1	54523989	0.991000	0.36638	0.997000	0.53966	0.915000	0.54546	2.041000	0.41213	2.100000	0.63781	0.523000	0.50628	AAA		0.328	MNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255047.2	NM_018365		Missense_Mutation
PRSS38	339501	hgsc.bcm.edu	37	1	228005071	228005071	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr1:228005071C>T	ENST00000366757.3	+	3	497	c.473C>T	c.(472-474)aCc>aTc	p.T158I		NM_183062.2	NP_898885.1	A1L453	PRS38_HUMAN	protease, serine, 38	158	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.T158I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						CAGCTGAAGACCCGCATTGTG	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											186.0	155.0	165.0					1																	228005071		2203	4300	6503	226071694	SO:0001583	missense	339501				CCDS1563.1	1q42.13	2010-05-07			ENSG00000185888	ENSG00000185888		"""Serine peptidases / Serine peptidases"""	29625	protein-coding gene	gene with protein product	"""marapsin 2"""					12838346	Standard	NM_183062		Approved	MPN2	uc001hrh.3	A1L453	OTTHUMG00000037701	ENST00000366757.3:c.473C>T	1.37:g.228005071C>T	ENSP00000355719:p.Thr158Ile		226071694	Q7RTY6	Missense_Mutation	SNP	ENST00000366757.3	37	CCDS1563.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.37	1.332301	0.24167	.	.	ENSG00000185888	ENST00000366757	T	0.61392	0.11	4.34	-8.69	0.00855	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	2.278050	0.02287	N	0.069915	T	0.54759	0.1878	L	0.43598	1.365	0.09310	N	1	P	0.48998	0.918	P	0.49140	0.601	T	0.65619	-0.6124	10	0.62326	D	0.03	.	10.7411	0.46154	0.1132:0.1372:0.6747:0.075	.	158	A1L453	PRS38_HUMAN	I	158	ENSP00000355719:T158I	ENSP00000355719:T158I	T	+	2	0	PRSS38	226071694	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-2.642000	0.00863	-2.042000	0.00914	-0.150000	0.13652	ACC		0.562	PRSS38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091981.1	NM_183062		Missense_Mutation
MTTP	4547	hgsc.bcm.edu	37	4	100516041	100516041	+	Splice_Site	SNP	G	G	T			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr4:100516041G>T	ENST00000265517.5	+	7	1112		c.e7+1		MTTP_ENST00000511045.1_Splice_Site|RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000457717.1_Splice_Site			P55157	MTP_HUMAN	microsomal triglyceride transfer protein						cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)	p.?(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	ATGTCCTTCTGTAAGTGCAGA	0.423																																																1	Unknown(1)	ovary(1)	4											86.0	80.0	82.0					4																	100516041		2203	4300	6503	100735064	SO:0001630	splice_region_variant	4547				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.909+1G>T	4.37:g.100516041G>T			100735064	A8K428|Q08AM4|Q6P5T3	Splice_Site_SNP	SNP	ENST00000265517.5	37	CCDS3651.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.72	2.322699	0.41096	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517;ENST00000538053	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5631	0.91108	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MTTP	100735064	1.000000	0.71417	1.000000	0.80357	0.226000	0.24999	8.269000	0.89878	2.442000	0.82660	0.563000	0.77884	.		0.423	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3		Intron	Splice_Site_SNP
MYH2	4620	hgsc.bcm.edu	37	17	10440647	10440647	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr17:10440647G>T	ENST00000245503.5	-	16	2184	c.1800C>A	c.(1798-1800)aaC>aaA	p.N600K	MYH2_ENST00000532183.2_Missense_Mutation_p.N600K|MYH2_ENST00000397183.2_Missense_Mutation_p.N600K|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	600	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.N600K(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GGGGGTCCTTGTTCTTCTCCA	0.522																																																1	Substitution - Missense(1)	ovary(1)	17											136.0	138.0	137.0					17																	10440647		2203	4300	6503	10381372	SO:0001583	missense	4620				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.1800C>A	17.37:g.10440647G>T	ENSP00000245503:p.Asn600Lys		10381372	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	CCDS11156.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667282	0.47677	.	.	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183	D;D;D	0.93247	-3.19;-3.19;-3.19	5.53	3.36	0.38483	Myosin head, motor domain (2);	0.000000	0.42821	U	0.000653	D	0.98381	0.9462	H	0.99977	5.17	0.48135	D	0.999594	D;B	0.71674	0.998;0.025	D;B	0.87578	0.998;0.15	D	0.97079	0.9783	10	0.87932	D	0	.	10.2968	0.43629	0.2096:0.0:0.7904:0.0	.	600;600	Q567P6;Q9UKX2	.;MYH2_HUMAN	K	600	ENSP00000433944:N600K;ENSP00000245503:N600K;ENSP00000380367:N600K	ENSP00000245503:N600K	N	-	3	2	MYH2	10381372	1.000000	0.71417	1.000000	0.80357	0.035000	0.12851	6.732000	0.74790	1.354000	0.45846	-0.142000	0.14014	AAC		0.522	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		Missense_Mutation
NKAP	79576	hgsc.bcm.edu	37	X	119077253	119077253	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chrX:119077253G>A	ENST00000371410.3	-	1	482	c.316C>T	c.(316-318)Cgc>Tgc	p.R106C		NM_024528.3	NP_078804.2	Q8N5F7	NKAP_HUMAN	NFKB activating protein	106					granulocyte differentiation (GO:0030851)|hematopoietic stem cell proliferation (GO:0071425)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|stem cell maintenance (GO:0019827)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.R106C(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	20						CCGTAGGGGCGCGAGTAGCTG	0.647																																																1	Substitution - Missense(1)	ovary(1)	X											26.0	27.0	27.0					X																	119077253		2203	4291	6494	118961281	SO:0001583	missense	79576			BC012770	CCDS14592.1	Xq24	2010-07-20			ENSG00000101882	ENSG00000101882			29873	protein-coding gene	gene with protein product	"""NF kappaB activating protein"""	300766				14550261	Standard	NM_024528		Approved	FLJ22626	uc004esh.3	Q8N5F7	OTTHUMG00000022284	ENST00000371410.3:c.316C>T	X.37:g.119077253G>A	ENSP00000360464:p.Arg106Cys		118961281	Q6IPW6|Q96BQ2|Q9H638	Missense_Mutation	SNP	ENST00000371410.3	37	CCDS14592.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	g	11.46	1.644058	0.29246	.	.	ENSG00000101882	ENST00000371410	T	0.15834	2.39	3.95	3.06	0.35304	.	0.683791	0.15104	N	0.280366	T	0.13970	0.0338	L	0.38175	1.15	0.52501	D	0.99995	D	0.63880	0.993	B	0.41135	0.348	T	0.04796	-1.0926	10	0.62326	D	0.03	-6.3813	10.3251	0.43787	0.0:0.1969:0.8031:0.0	.	106	Q8N5F7	NKAP_HUMAN	C	106	ENSP00000360464:R106C	ENSP00000360464:R106C	R	-	1	0	NKAP	118961281	1.000000	0.71417	0.926000	0.36857	0.071000	0.16799	4.514000	0.60482	1.014000	0.39417	0.600000	0.82982	CGC		0.647	NKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058072.1	NM_024528		Missense_Mutation
NRP2	8828	hgsc.bcm.edu	37	2	206590770	206590770	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr2:206590770G>A	ENST00000357785.5	+	6	985	c.954G>A	c.(952-954)tgG>tgA	p.W318*	NRP2_ENST00000540841.1_Nonsense_Mutation_p.W318*|NRP2_ENST00000360409.3_Nonsense_Mutation_p.W318*|NRP2_ENST00000357118.4_Nonsense_Mutation_p.W318*|NRP2_ENST00000355117.4_Nonsense_Mutation_p.W318*|NRP2_ENST00000412873.2_Nonsense_Mutation_p.W318*|NRP2_ENST00000272849.3_Nonsense_Mutation_p.W318*|NRP2_ENST00000417189.1_Nonsense_Mutation_p.W318*|NRP2_ENST00000540178.1_Nonsense_Mutation_p.W318*			Q99435	NELL2_HUMAN	neuropilin 2	0	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						ACAATGGCTGGACCCCCAACT	0.522																																																0			2											118.0	101.0	106.0					2																	206590770		2203	4300	6503	206299015	SO:0001587	stop_gained	8828			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.954G>A	2.37:g.206590770G>A	ENSP00000350432:p.Trp318*		206299015	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Nonsense_Mutation	SNP	ENST00000357785.5	37	CCDS46496.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	46	12.454100	0.99669	.	.	ENSG00000118257	ENST00000360409;ENST00000540178;ENST00000540841;ENST00000355117;ENST00000417189;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.6795	20.063	0.97692	0.0:0.0:1.0:0.0	.	.	.	.	X	318	.	ENSP00000272849:W318X	W	+	3	0	NRP2	206299015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.735000	0.93741	0.655000	0.94253	TGG		0.522	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1			Nonsense_Mutation
NUP188	23511	hgsc.bcm.edu	37	9	131745578	131745578	+	Silent	SNP	G	G	A			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr9:131745578G>A	ENST00000372577.2	+	18	1824	c.1803G>A	c.(1801-1803)acG>acA	p.T601T		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	601					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.T601T(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						CCAGGTTAACGACAGTGATCT	0.453																																																1	Substitution - coding silent(1)	ovary(1)	9											196.0	185.0	189.0					9																	131745578		2203	4300	6503	130785399	SO:0001819	synonymous_variant	23511			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.1803G>A	9.37:g.131745578G>A			130785399	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Silent	SNP	ENST00000372577.2	37	CCDS35156.1	SNP	37	Baylor																																																																																				0.453	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			Silent
NVL	4931	hgsc.bcm.edu	37	1	224415342	224415342	+	Missense_Mutation	SNP	A	A	G	rs41271483	byFrequency	TCGA-25-1632-01	TCGA-25-1632-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr1:224415342A>G	ENST00000281701.6	-	23	2816	c.2557T>C	c.(2557-2559)Tcc>Ccc	p.S853P	NVL_ENST00000469075.1_Missense_Mutation_p.S762P|RP11-365O16.6_ENST00000420350.1_RNA|NVL_ENST00000391875.2_Missense_Mutation_p.S747P|NVL_ENST00000340871.4_Missense_Mutation_p.S664P|NVL_ENST00000482491.1_Missense_Mutation_p.S577P	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	853						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.S853P(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		CGGCTGAGGGACTCCTGCAAA	0.547													A|||	38	0.00758786	0.0	0.0058	5008	,	,		16146	0.0		0.0249	False		,,,				2504	0.0092															1	Substitution - Missense(1)	ovary(1)	1						A	PRO/SER,PRO/SER	7,4399	12.9+/-30.5	0,7,2196	66.0	61.0	62.0		2557,2239	3.8	0.3	1	dbSNP_127	62	152,8448	71.0+/-133.6	1,150,4149	yes	missense,missense	NVL	NM_002533.3,NM_206840.2	74,74	1,157,6345	GG,GA,AA		1.7674,0.1589,1.2225	possibly-damaging,possibly-damaging	853/857,747/751	224415342	159,12847	2203	4300	6503	222481965	SO:0001583	missense	4931			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.2557T>C	1.37:g.224415342A>G	ENSP00000281701:p.Ser853Pro		222481965	B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	ENST00000281701.6	37	CCDS1541.1	SNP	10	Baylor	21|21	0.009615384615384616|0.009615384615384616	0|0	0.0|0.0	1|1	0.0027624309392265192|0.0027624309392265192	0|0	0.0|0.0	20|20	0.026385224274406333|0.026385224274406333	A|A	9.895|9.895	1.205298|1.205298	0.22205|0.22205	0.001589|0.001589	0.017674|0.017674	ENSG00000143748|ENSG00000143748	ENST00000281701;ENST00000391875;ENST00000469075;ENST00000482491;ENST00000340871|ENST00000469968	D;D;D;D;D|.	0.94897|.	-3.55;-3.55;-3.54;-3.45;-3.41|.	4.9|4.9	3.75|3.75	0.43078|0.43078	.|.	0.210816|.	0.42053|.	D|.	0.000774|.	T|T	0.31295|0.31295	0.0792|0.0792	L|L	0.46819|0.46819	1.47|1.47	0.80722|0.80722	D|D	1|1	B;B;B|.	0.12013|.	0.002;0.002;0.005|.	B;B;B|.	0.11329|.	0.006;0.004;0.004|.	T|T	0.28808|0.28808	-1.0032|-1.0032	10|5	0.42905|.	T|.	0.14|.	-3.5689|-3.5689	8.9429|8.9429	0.35740|0.35740	0.812:0.188:0.0:0.0|0.812:0.188:0.0:0.0	rs41271483|rs41271483	664;762;853|.	B4DMC4;B4DP98;O15381|.	.;.;NVL_HUMAN|.	P|A	853;747;762;577;664|735	ENSP00000281701:S853P;ENSP00000375747:S747P;ENSP00000417826:S762P;ENSP00000417213:S577P;ENSP00000341362:S664P|.	ENSP00000281701:S853P|.	S|V	-|-	1|2	0|0	NVL|NVL	222481965|222481965	0.973000|0.973000	0.33851|0.33851	0.296000|0.296000	0.24974|0.24974	0.392000|0.392000	0.30506|0.30506	2.697000|2.697000	0.47060|0.47060	0.795000|0.795000	0.33922|0.33922	0.533000|0.533000	0.62120|0.62120	TCC|GTC		0.547	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533		Missense_Mutation
OGT	8473	hgsc.bcm.edu	37	X	70757809	70757809	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chrX:70757809C>T	ENST00000373719.3	+	3	566	c.349C>T	c.(349-351)Cgt>Tgt	p.R117C	OGT_ENST00000373701.3_Missense_Mutation_p.R107C|OGT_ENST00000498566.1_3'UTR	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	117					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)	p.R107C(1)|p.R117C(1)		breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					ACATGCATTGCGTCTCAAACC	0.493																																																2	Substitution - Missense(2)	ovary(2)	X											162.0	130.0	141.0					X																	70757809		2203	4300	6503	70674534	SO:0001583	missense	8473			U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.349C>T	X.37:g.70757809C>T	ENSP00000362824:p.Arg117Cys		70674534	Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	37	CCDS14414.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	c	18.55	3.647248	0.67358	.	.	ENSG00000147162	ENST00000373719;ENST00000373701;ENST00000444774	T;T;T	0.61040	0.14;0.14;0.14	4.86	4.86	0.63082	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.105470	0.64402	D	0.000011	T	0.79257	0.4415	M	0.91768	3.24	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.73708	0.981;0.937;0.941	D	0.83643	0.0151	10	0.72032	D	0.01	-19.0221	12.3845	0.55325	0.1679:0.8321:0.0:0.0	.	117;107;117	B4DTL6;O15294-3;O15294	.;.;OGT1_HUMAN	C	117;107;100	ENSP00000362824:R117C;ENSP00000362805:R107C;ENSP00000399729:R100C	ENSP00000362805:R107C	R	+	1	0	OGT	70674534	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.807000	0.47955	2.259000	0.74868	0.525000	0.51046	CGT		0.493	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3	NM_003605, NM_181672		Missense_Mutation
OMG	4974	hgsc.bcm.edu	37	17	29622674	29622674	+	Silent	SNP	T	T	G			TCGA-25-1632-01	TCGA-25-1632-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr17:29622674T>G	ENST00000247271.4	-	2	937	c.676A>C	c.(676-678)Agg>Cgg	p.R226R	NF1_ENST00000358273.4_Intron|NF1_ENST00000356175.3_Intron	NM_002544.4	NP_002535.3	P23515	OMGP_HUMAN	oligodendrocyte myelin glycoprotein	226					cell adhesion (GO:0007155)|negative regulation of axonogenesis (GO:0050771)|neuron projection regeneration (GO:0031102)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|regulation of collateral sprouting of intact axon in response to injury (GO:0048683)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.0?(8)|p.?(3)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|stomach(1)	13		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;1.81e-13)|Epithelial(4;4.04e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.49e-12)|GBM - Glioblastoma multiforme(4;0.121)		CATGACCACCTGTTATTGTAA	0.388																																																11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	17											161.0	150.0	154.0					17																	29622674		2203	4300	6503	26646800	SO:0001819	synonymous_variant	4974				CCDS11265.1	17q11-q12	2008-07-18			ENSG00000126861	ENSG00000126861			8135	protein-coding gene	gene with protein product		164345				1899288, 2277079	Standard	NM_002544		Approved	OMGP	uc002hgj.3	P23515	OTTHUMG00000132870	ENST00000247271.4:c.676A>C	17.37:g.29622674T>G			26646800	E1P659	Silent	SNP	ENST00000247271.4	37	CCDS11265.1	SNP	55	Baylor																																																																																				0.388	OMG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256350.2	NM_002544		Silent
OR51B5	282763	hgsc.bcm.edu	37	11	5364542	5364558	+	Frame_Shift_Del	DEL	CAGCCCCAGGTCTGTGG	CAGCCCCAGGTCTGTGG	-	rs546965603|rs372207902|rs147062602	byFrequency	TCGA-25-1632-01	TCGA-25-1632-10	CAGCCCCAGGTCTGTGG	CAGCCCCAGGTCTGTGG	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr11:5364542_5364558delCAGCCCCAGGTCTGTGG	ENST00000300773.2	-	1	251_267	c.197_213delCCACAGACCTGGGGCTG	c.(196-213)gccacagacctggggctgfs	p.ATDLGL66fs	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_001005567.2	NP_001005567.2	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B, member 5	66					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A66fs*48(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	28		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGTCAGGGCCAGCCCCAGGTCTGTGGCAGCCAGCAT	0.525														252	0.0503195	0.1377	0.0274	5008	,	,		22155	0.0		0.0457	False		,,,				2504	0.0051															1	Deletion - Frameshift(1)	upper_aerodigestive_tract(1)	11								487,3771		28,431,1670						3.6	0.1		dbSNP_134	48	401,7853		15,371,3741	no	frameshift	OR51B5	NM_001005567.2		43,802,5411	A1A1,A1R,RR		4.8583,11.4373,7.0972				888,11624				5321134	SO:0001589	frameshift_variant	282763			BK004430	CCDS31378.1	11p15.4	2012-08-09			ENSG00000242180	ENSG00000242180		"""GPCR / Class A : Olfactory receptors"""	19599	protein-coding gene	gene with protein product							Standard	NM_001005567		Approved		uc001maq.2	Q9H339	OTTHUMG00000066676	ENST00000300773.2:c.197_213delCCACAGACCTGGGGCTG	11.37:g.5364542_5364558delCAGCCCCAGGTCTGTGG	ENSP00000300773:p.Ala66fs		5321118	B2RN59	Frame_Shift_Del	DEL	ENST00000300773.2	37	CCDS31378.1	DEL	21	Baylor																																																																																				0.525	OR51B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142975.1	NM_001005567		Frame_Shift_Del
OR51I1	390063	hgsc.bcm.edu	37	11	5461952	5461952	+	Missense_Mutation	SNP	G	G	A	rs145392841		TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr11:5461952G>A	ENST00000380211.1	-	1	792	c.793C>T	c.(793-795)Cgc>Tgc	p.R265C	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	265					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R265C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCCAGAAGCGGTGAATCATG	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		21327	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	11											137.0	118.0	124.0					11																	5461952		2201	4297	6498	5418528	SO:0001583	missense	390063			BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.793C>T	11.37:g.5461952G>A	ENSP00000369559:p.Arg265Cys		5418528	B9EKW2|Q6IF33	Missense_Mutation	SNP	ENST00000380211.1	37	CCDS31382.1	SNP	39	Baylor	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	11.89	1.773166	0.31411	.	.	ENSG00000167359	ENST00000321307;ENST00000380211	T	0.37411	1.2	5.47	5.47	0.80525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000030	T	0.45994	0.1370	M	0.93150	3.385	0.39193	D	0.963006	B	0.30973	0.302	B	0.26094	0.066	T	0.59653	-0.7414	10	0.72032	D	0.01	.	7.4889	0.27449	0.0834:0.0:0.7497:0.1669	.	265	Q9H343	O51I1_HUMAN	C	262;265	ENSP00000369559:R265C	ENSP00000439622:R262C	R	-	1	0	OR51I1	5418528	0.263000	0.24083	0.537000	0.28052	0.695000	0.40330	1.221000	0.32503	2.593000	0.87608	0.551000	0.68910	CGC		0.483	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143399.1	NM_001005288		Missense_Mutation
PAN2	9924	hgsc.bcm.edu	37	12	56718841	56718841	+	Silent	SNP	A	A	C			TCGA-25-1632-01	TCGA-25-1632-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr12:56718841A>C	ENST00000425394.2	-	10	1927	c.1551T>G	c.(1549-1551)gcT>gcG	p.A517A	PAN2_ENST00000257931.5_Silent_p.A517A|PAN2_ENST00000548043.1_Silent_p.A517A|PAN2_ENST00000440411.3_Silent_p.A517A	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)	p.A517A(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	GCTCTAATCCAGCAAACAAGG	0.448																																																1	Substitution - coding silent(1)	ovary(1)	12											223.0	213.0	217.0					12																	56718841		2203	4300	6503	55005108	SO:0001819	synonymous_variant	9924			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1551T>G	12.37:g.56718841A>C			55005108		Silent	SNP	ENST00000425394.2	37	CCDS44922.1	SNP	7	Baylor																																																																																				0.448	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871		Silent
PDK1	5163	hgsc.bcm.edu	37	2	173460655	173460655	+	Silent	SNP	C	C	T			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr2:173460655C>T	ENST00000282077.3	+	11	1451	c.1269C>T	c.(1267-1269)ccC>ccT	p.P423P	PDK1_ENST00000392571.2_Silent_p.P443P|PDK1_ENST00000543905.1_Silent_p.P347P|PDK1_ENST00000410055.1_Silent_p.P423P|PDK1_ENST00000544863.1_Silent_p.P268P			Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase, isozyme 1	423					cell proliferation (GO:0008283)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)	p.P423P(1)		central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.12)			GGTGCGTCCCCAGCAGAGAAC	0.473									Autosomal Dominant Polycystic Kidney Disease																																							1	Substitution - coding silent(1)	ovary(1)	2											81.0	65.0	70.0					2																	173460655		2203	4300	6503	173168901	SO:0001819	synonymous_variant	5163	Familial Cancer Database	ADPKD	L42450	CCDS2250.1, CCDS63059.1	2q31.1	2008-05-23	2005-11-16		ENSG00000152256	ENSG00000152256			8809	protein-coding gene	gene with protein product		602524	"""pyruvate dehydrogenase kinase, isoenzyme 1"""			7499431	Standard	NR_103731		Approved		uc002uhs.3	Q15118	OTTHUMG00000132285	ENST00000282077.3:c.1269C>T	2.37:g.173460655C>T			173168901	B2R6T1|B7Z937|D3DPD8|E9PD65|Q308M4	Silent	SNP	ENST00000282077.3	37	CCDS2250.1	SNP	21	Baylor																																																																																				0.473	PDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255380.3	NM_002610		Silent
QARS	5859	hgsc.bcm.edu	37	3	49137481	49137481	+	Missense_Mutation	SNP	C	C	T	rs370681625		TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr3:49137481C>T	ENST00000306125.6	-	14	1545	c.1208G>A	c.(1207-1209)cGg>cAg	p.R403Q	QARS_ENST00000414533.1_Missense_Mutation_p.R392Q|QARS_ENST00000470225.1_5'Flank			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	403			R -> W (in MSCCA; results in loss of glutaminyl-tRNA aminoacylation activity; does not interact with RARS; results in reduced protein solubility). {ECO:0000269|PubMed:24656866}.		brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)	p.R403Q(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	CAGCTTCATCCGTAGTGTGGC	0.537																																																1	Substitution - Missense(1)	ovary(1)	3						C	GLN/ARG	0,4406		0,0,2203	166.0	153.0	157.0		1208	5.1	0.4	3		157	1,8599	1.2+/-3.3	0,1,4299	no	missense	QARS	NM_005051.1	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	403/776	49137481	1,13005	2203	4300	6503	49112485	SO:0001583	missense	5859			X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1208G>A	3.37:g.49137481C>T	ENSP00000307567:p.Arg403Gln		49112485	B4DWJ2	Missense_Mutation	SNP	ENST00000306125.6	37	CCDS2788.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927421	0.73327	0.0	1.16E-4	ENSG00000172053	ENST00000306125;ENST00000414533	T;T	0.61627	0.09;0.09	5.98	5.11	0.69529	Glutamyl/glutaminyl-tRNA synthetase, class Ib, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86936	0.6053	H	0.99682	4.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92675	0.6153	10	0.87932	D	0	-20.8602	14.909	0.70740	0.0:0.9307:0.0:0.0693	.	392;403	B4DWJ2;P47897	.;SYQ_HUMAN	Q	403;392	ENSP00000307567:R403Q;ENSP00000390015:R392Q	ENSP00000307567:R403Q	R	-	2	0	QARS	49112485	1.000000	0.71417	0.424000	0.26647	0.433000	0.31745	7.316000	0.79007	1.538000	0.49270	-0.140000	0.14226	CGG		0.537	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345689.2	NM_005051		Missense_Mutation
SCPEP1	59342	hgsc.bcm.edu	37	17	55065617	55065617	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1632-01	TCGA-25-1632-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr17:55065617A>G	ENST00000262288.3	+	5	567	c.512A>G	c.(511-513)aAa>aGa	p.K171R	SCPEP1_ENST00000571898.1_3'UTR	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1	171					negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					TATGGAGGAAAAATGGCAGCT	0.338																																																0			17											146.0	148.0	147.0					17																	55065617		2203	4300	6503	52420616	SO:0001583	missense	59342			AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.512A>G	17.37:g.55065617A>G	ENSP00000262288:p.Lys171Arg		52420616	Q96A94|Q9H3F0	Missense_Mutation	SNP	ENST00000262288.3	37	CCDS11593.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	28.8	4.954087	0.92726	.	.	ENSG00000121064	ENST00000262288	T	0.42513	0.97	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.69360	0.3102	M	0.87038	2.855	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74194	-0.3744	10	0.52906	T	0.07	-9.9707	15.9688	0.79995	1.0:0.0:0.0:0.0	.	171	Q9HB40	RISC_HUMAN	R	171	ENSP00000262288:K171R	ENSP00000262288:K171R	K	+	2	0	SCPEP1	52420616	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.328000	0.90014	2.231000	0.72958	0.460000	0.39030	AAA		0.338	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440622.1	NM_021626		Missense_Mutation
SECISBP2	79048	hgsc.bcm.edu	37	9	91947874	91947874	+	Missense_Mutation	SNP	G	G	A	rs367986134		TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr9:91947874G>A	ENST00000375807.3	+	6	924	c.853G>A	c.(853-855)Gct>Act	p.A285T	SECISBP2_ENST00000339901.4_Missense_Mutation_p.A212T|SECISBP2_ENST00000534113.2_Missense_Mutation_p.A217T	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	285					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)	p.A285T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						TGCTAATGCCGCTACCAATTC	0.318																																																1	Substitution - Missense(1)	ovary(1)	9						G	THR/ALA	0,4406		0,0,2203	91.0	86.0	88.0		853	0.1	0.0	9		88	3,8597	3.0+/-9.4	0,3,4297	no	missense	SECISBP2	NM_024077.3	58	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	285/855	91947874	3,13003	2203	4300	6503	91137694	SO:0001583	missense	79048			AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.853G>A	9.37:g.91947874G>A	ENSP00000364965:p.Ala285Thr		91137694	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	ENST00000375807.3	37	CCDS6683.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	7.342	0.621061	0.14193	0.0	3.49E-4	ENSG00000187742	ENST00000375807;ENST00000339901;ENST00000534113;ENST00000425851	T;T;T;T	0.73469	-0.73;-0.75;-0.74;0.85	4.19	0.06	0.14334	.	.	.	.	.	T	0.45034	0.1322	N	0.12182	0.205	0.09310	N	1	B;B;B;B	0.27971	0.123;0.196;0.123;0.196	B;B;B;B	0.14578	0.005;0.011;0.005;0.011	T	0.22977	-1.0201	9	0.11485	T	0.65	-0.3552	2.3191	0.04206	0.099:0.1744:0.4081:0.3185	.	284;212;285;217	B4DZC7;Q96T21-2;Q96T21;F8W892	.;.;SEBP2_HUMAN;.	T	285;212;217;120	ENSP00000364965:A285T;ENSP00000364959:A212T;ENSP00000436650:A217T;ENSP00000414288:A120T	ENSP00000364959:A212T	A	+	1	0	SECISBP2	91137694	0.000000	0.05858	0.000000	0.03702	0.220000	0.24768	0.108000	0.15396	0.013000	0.14918	0.650000	0.86243	GCT		0.318	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077		Missense_Mutation
SHROOM2	357	hgsc.bcm.edu	37	X	9841753	9841753	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chrX:9841753G>A	ENST00000380913.3	+	2	317	c.227G>A	c.(226-228)gGc>gAc	p.G76D	Y_RNA_ENST00000384117.1_RNA	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	76	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)	p.G76D(1)		breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				GAGATCGTCGGCATCAATGAC	0.517											OREG0019659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	X											110.0	92.0	98.0					X																	9841753		2203	4300	6503	9801753	SO:0001583	missense	357			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.227G>A	X.37:g.9841753G>A	ENSP00000370299:p.Gly76Asp	660	9801753	B9EIQ7	Missense_Mutation	SNP	ENST00000380913.3	37	CCDS14135.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.227	0.803825	0.16467	.	.	ENSG00000146950	ENST00000380913	T	0.28255	1.62	5.23	2.42	0.29668	PDZ/DHR/GLGF (4);	0.368556	0.27917	N	0.017338	T	0.18551	0.0445	N	0.19112	0.55	0.80722	D	1	P	0.34615	0.459	B	0.36186	0.219	T	0.05007	-1.0912	10	0.52906	T	0.07	-34.1846	6.4756	0.22034	0.156:0.2836:0.5604:0.0	.	76	Q13796	SHRM2_HUMAN	D	76	ENSP00000370299:G76D	ENSP00000370299:G76D	G	+	2	0	SHROOM2	9801753	1.000000	0.71417	0.148000	0.22405	0.001000	0.01503	2.817000	0.48034	0.088000	0.17205	-0.229000	0.12294	GGC		0.517	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	NM_001649		Missense_Mutation
SLAMF1	6504	hgsc.bcm.edu	37	1	160589601	160589601	+	Frame_Shift_Del	DEL	T	T	-			TCGA-25-1632-01	TCGA-25-1632-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr1:160589601delT	ENST00000302035.6	-	5	1178	c.829delA	c.(829-831)agcfs	p.S277fs	SLAMF1_ENST00000538290.1_Intron|SLAMF1_ENST00000235739.5_Frame_Shift_Del_p.S247fs|SLAMF1_ENST00000355199.3_Frame_Shift_Del_p.S277fs	NM_003037.2	NP_003028.1	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family member 1	277					lymphocyte activation (GO:0046649)|positive regulation of cell proliferation (GO:0008284)|regulation of catalytic activity (GO:0050790)|regulation of vesicle fusion (GO:0031338)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|phagocytic vesicle (GO:0045335)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			ATCGTAAGGCTTTTTTTTTCC	0.433																																																0			1											265.0	264.0	264.0					1																	160589601		2203	4300	6503	158856225	SO:0001589	frameshift_variant	6504			U33017	CCDS1207.1	1q23.3	2013-01-11	2003-10-29	2003-10-31	ENSG00000117090	ENSG00000117090		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10903	protein-coding gene	gene with protein product		603492	"""signaling lymphocytic activation molecule"""	SLAM		7617038	Standard	XM_005245456		Approved	CD150	uc001fwl.4	Q13291	OTTHUMG00000024006	ENST00000302035.6:c.829delA	1.37:g.160589601delT	ENSP00000306190:p.Ser277fs		158856225	Q5W172|Q9HBE8	Frame_Shift_Del	DEL	ENST00000302035.6	37	CCDS1207.1	DEL	56	Baylor																																																																																				0.433	SLAMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060454.1			Frame_Shift_Del
SLC18A1	6570	hgsc.bcm.edu	37	8	20031929	20031929	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr8:20031929G>C	ENST00000276373.5	-	5	840	c.574C>G	c.(574-576)Cta>Gta	p.L192V	SLC18A1_ENST00000440926.1_Missense_Mutation_p.L192V|SLC18A1_ENST00000265808.7_Missense_Mutation_p.L192V|SLC18A1_ENST00000524272.1_5'UTR|SLC18A1_ENST00000437980.1_Missense_Mutation_p.L192V|SLC18A1_ENST00000381608.4_Missense_Mutation_p.L192V|SLC18A1_ENST00000519026.1_Missense_Mutation_p.L192V	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	192					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)	p.L192V(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	ACAAAGAGTAGAGTATAGGTC	0.483																																																1	Substitution - Missense(1)	ovary(1)	8											150.0	132.0	138.0					8																	20031929		2203	4300	6503	20076209	SO:0001583	missense	6570				CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.574C>G	8.37:g.20031929G>C	ENSP00000276373:p.Leu192Val		20076209	E9PDJ5|Q9BRE4	Missense_Mutation	SNP	ENST00000276373.5	37	CCDS6013.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	1.158	-0.644685	0.03531	.	.	ENSG00000036565	ENST00000265808;ENST00000276373;ENST00000440926;ENST00000437980;ENST00000519026;ENST00000381608	T;T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2;0.2	5.38	3.52	0.40303	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.064388	0.64402	D	0.000006	T	0.54351	0.1853	N	0.26042	0.785	0.44432	D	0.997358	B;D;D	0.89917	0.047;1.0;1.0	B;D;D	0.91635	0.07;0.998;0.999	T	0.57142	-0.7862	10	0.02654	T	1	-11.0889	7.9134	0.29803	0.27:0.0:0.73:0.0	.	192;192;192	E9PB33;E9PDJ5;P54219	.;.;VMAT1_HUMAN	V	192	ENSP00000265808:L192V;ENSP00000276373:L192V;ENSP00000387549:L192V;ENSP00000413361:L192V;ENSP00000429664:L192V;ENSP00000371021:L192V	ENSP00000265808:L192V	L	-	1	2	SLC18A1	20076209	0.313000	0.24554	0.139000	0.22197	0.007000	0.05969	0.566000	0.23593	0.689000	0.31550	-0.150000	0.13652	CTA		0.483	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214106.1			Missense_Mutation
SLTM	79811	hgsc.bcm.edu	37	15	59189413	59189413	+	Silent	SNP	A	A	G			TCGA-25-1632-01	TCGA-25-1632-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr15:59189413A>G	ENST00000380516.2	-	9	1215	c.1128T>C	c.(1126-1128)agT>agC	p.S376S	SLTM_ENST00000536328.1_5'UTR	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	376					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S376S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CACTGCTACCACTAGTACTAC	0.343																																																1	Substitution - coding silent(1)	ovary(1)	15											83.0	82.0	83.0					15																	59189413		2192	4292	6484	56976705	SO:0001819	synonymous_variant	79811			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.1128T>C	15.37:g.59189413A>G			56976705	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Silent	SNP	ENST00000380516.2	37	CCDS10168.2	SNP	6	Baylor																																																																																				0.343	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755		Silent
SPTBN1	6711	hgsc.bcm.edu	37	2	54874342	54874342	+	Silent	SNP	C	C	T	rs556277064	byFrequency	TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr2:54874342C>T	ENST00000356805.4	+	24	5222	c.4941C>T	c.(4939-4941)acC>acT	p.T1647T	SPTBN1_ENST00000333896.5_Silent_p.T1634T	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1647	Interaction with ANK2.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)	p.T1647T(1)		NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			ATGCAGAGACCGTGCATCAGC	0.552													C|||	2	0.000399361	0.0	0.0	5008	,	,		18473	0.0		0.001	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	2											106.0	99.0	102.0					2																	54874342		2203	4300	6503	54727846	SO:0001819	synonymous_variant	6711				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.4941C>T	2.37:g.54874342C>T			54727846	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	ENST00000356805.4	37	CCDS33198.1	SNP	23	Baylor																																																																																				0.552	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3			Silent
SRPX2	27286	hgsc.bcm.edu	37	X	99925848	99925848	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1632-01	TCGA-25-1632-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chrX:99925848T>A	ENST00000373004.3	+	11	1690	c.1262T>A	c.(1261-1263)aTt>aAt	p.I421N	RP11-524D16__A.3_ENST00000568809.1_RNA	NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2	421					angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)	p.I421N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						ATGGTGTTGATTGACAAGCAG	0.517											OREG0019890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	X											174.0	134.0	148.0					X																	99925848		2203	4300	6503	99812504	SO:0001583	missense	27286			AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.1262T>A	X.37:g.99925848T>A	ENSP00000362095:p.Ile421Asn	1347	99812504	B3KQT3|Q8WW85	Missense_Mutation	SNP	ENST00000373004.3	37	CCDS14471.1	SNP	52	Baylor	.	.	.	.	.	.	.	.	.	.	T	25.2	4.616715	0.87359	.	.	ENSG00000102359	ENST00000373004	T	0.56941	0.43	5.09	5.09	0.68999	.	0.196814	0.45606	D	0.000350	T	0.49321	0.1550	L	0.34521	1.04	0.49915	D	0.99983	P	0.48503	0.911	P	0.48524	0.58	T	0.44081	-0.9351	9	.	.	.	-3.5913	14.0189	0.64541	0.0:0.0:0.0:1.0	.	421	O60687	SRPX2_HUMAN	N	421	ENSP00000362095:I421N	.	I	+	2	0	SRPX2	99812504	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.030000	0.76484	1.885000	0.54596	0.425000	0.28330	ATT		0.517	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057486.1	NM_014467		Missense_Mutation
STYK1	55359	hgsc.bcm.edu	37	12	10783890	10783890	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr12:10783890G>C	ENST00000075503.3	-	5	725	c.205C>G	c.(205-207)Cca>Gca	p.P69A		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.P69A(1)		breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						TCCCTAGGTGGAGGAACAGGG	0.532										HNSCC(73;0.22)																																						1	Substitution - Missense(1)	ovary(1)	12											65.0	71.0	69.0					12																	10783890		2203	4300	6503	10675157	SO:0001583	missense	55359			AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.205C>G	12.37:g.10783890G>C	ENSP00000075503:p.Pro69Ala		10675157	B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Missense_Mutation	SNP	ENST00000075503.3	37	CCDS8629.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	7.254	0.603887	0.14002	.	.	ENSG00000060140	ENST00000075503;ENST00000542562;ENST00000538867	T;T;T	0.77229	-1.08;0.9;0.87	5.43	-8.4	0.00965	.	0.823514	0.11301	N	0.578223	T	0.54791	0.1880	L	0.38838	1.175	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41520	-0.9504	10	0.16896	T	0.51	2.8869	3.2177	0.06705	0.467:0.1872:0.2509:0.0949	.	69	Q6J9G0	STYK1_HUMAN	A	69	ENSP00000075503:P69A;ENSP00000446241:P69A;ENSP00000445391:P69A	ENSP00000075503:P69A	P	-	1	0	STYK1	10675157	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	-1.174000	0.03105	-1.817000	0.01219	-0.140000	0.14226	CCA		0.532	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399622.1	NM_018423		Missense_Mutation
TBL1X	6907	hgsc.bcm.edu	37	X	9673064	9673064	+	Missense_Mutation	SNP	C	C	A	rs367740531		TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chrX:9673064C>A	ENST00000217964.7	+	13	1786	c.1146C>A	c.(1144-1146)aaC>aaA	p.N382K	TBL1X_ENST00000380961.1_Missense_Mutation_p.N331K|TBL1X_ENST00000424279.1_Missense_Mutation_p.N331K|TBL1X_ENST00000536365.1_Missense_Mutation_p.N331K|TBL1X_ENST00000407597.2_Missense_Mutation_p.N382K	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	382					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.N382K(1)		breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				GGCAGAACAACACGACCTTTG	0.527																																																1	Substitution - Missense(1)	ovary(1)	X											230.0	135.0	167.0					X																	9673064		2203	4300	6503	9633064	SO:0001583	missense	6907			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.1146C>A	X.37:g.9673064C>A	ENSP00000217964:p.Asn382Lys		9633064	A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	37	CCDS14133.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.44	3.123256	0.56613	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47	3.75	3.75	0.43078	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84566	0.5500	M	0.66939	2.045	0.58432	D	0.999999	D;P	0.57571	0.98;0.868	P;P	0.59703	0.862;0.752	D	0.84162	0.0429	10	0.46703	T	0.11	.	9.4496	0.38719	0.0:0.8969:0.0:0.103	.	345;382	Q59F53;O60907	.;TBL1X_HUMAN	K	382;331;331;331;382	ENSP00000385988:N382K;ENSP00000394097:N331K;ENSP00000445317:N331K;ENSP00000370348:N331K;ENSP00000217964:N382K	ENSP00000217964:N382K	N	+	3	2	TBL1X	9633064	1.000000	0.71417	1.000000	0.80357	0.272000	0.26649	5.597000	0.67577	1.630000	0.50440	0.600000	0.82982	AAC		0.527	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647		Missense_Mutation
TEX13B	56156	hgsc.bcm.edu	37	X	107225184	107225184	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1632-01	TCGA-25-1632-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chrX:107225184C>A	ENST00000302917.1	-	2	266	c.174G>T	c.(172-174)gaG>gaT	p.E58D		NM_031273.2	NP_112563.1	Q9BXU2	TX13B_HUMAN	testis expressed 13B	58								p.E58D(1)		breast(1)|endometrium(5)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28						CGCTGGGCACCTCGCTGTCCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	X											97.0	89.0	92.0					X																	107225184		2199	4300	6499	107111840	SO:0001583	missense	56156			AF285598	CCDS14534.1	Xq23	2008-02-05	2007-03-13		ENSG00000170925	ENSG00000170925			11736	protein-coding gene	gene with protein product		300313	"""testis expressed sequence 13B"""			11279525	Standard	NM_031273		Approved	TSGA5, TGC3B	uc004enn.1	Q9BXU2	OTTHUMG00000022174	ENST00000302917.1:c.174G>T	X.37:g.107225184C>A	ENSP00000303777:p.Glu58Asp		107111840	Q5JYF6	Missense_Mutation	SNP	ENST00000302917.1	37	CCDS14534.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.04	2.118952	0.37436	.	.	ENSG00000170925	ENST00000302917	.	.	.	2.96	-0.793	0.10922	.	.	.	.	.	T	0.34542	0.0901	L	0.47190	1.495	0.09310	N	1	P	0.52692	0.955	P	0.53861	0.736	T	0.16660	-1.0395	8	0.36615	T	0.2	.	0.6012	0.00745	0.2164:0.3693:0.2095:0.2048	.	58	Q9BXU2	TX13B_HUMAN	D	58	.	ENSP00000303777:E58D	E	-	3	2	TEX13B	107111840	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.899000	0.01600	-0.307000	0.08804	-0.357000	0.07601	GAG		0.607	TEX13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057857.1			Missense_Mutation
TMEM130	222865	hgsc.bcm.edu	37	7	98452934	98452934	+	Silent	SNP	G	G	T			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr7:98452934G>T	ENST00000416379.2	-	5	736	c.732C>A	c.(730-732)ggC>ggA	p.G244G	TMEM130_ENST00000450876.1_Silent_p.G160G|TMEM130_ENST00000546258.1_Silent_p.G225G|TMEM130_ENST00000345589.4_Silent_p.G142G|TMEM130_ENST00000339375.4_Silent_p.G244G			Q8N3G9	TM130_HUMAN	transmembrane protein 130	244						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.G244G(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	25	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			ACACTTGGATGCCTCGAAGGG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	7											112.0	103.0	106.0					7																	98452934		2203	4300	6503	98290870	SO:0001819	synonymous_variant	222865				CCDS5658.1, CCDS47649.1, CCDS47650.1	7q22.1	2006-03-09			ENSG00000166448	ENSG00000166448			25429	protein-coding gene	gene with protein product						12975309	Standard	NM_152913		Approved	DKFZp761L1417, FLJ42643	uc003upo.3	Q8N3G9	OTTHUMG00000154419	ENST00000416379.2:c.732C>A	7.37:g.98452934G>T			98290870	A4D266|B7Z364|Q8IY46|Q8N0W9|Q8N3R2	Silent	SNP	ENST00000416379.2	37	CCDS47650.1	SNP	46	Baylor																																																																																				0.582	TMEM130-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380713.1	NM_152913		Silent
TP53	7157	hgsc.bcm.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	C	rs397516437|rs121912651		TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr17:7577539G>C	ENST00000269305.4	-	7	931	c.742C>G	c.(742-744)Cgg>Ggg	p.R248G	TP53_ENST00000413465.2_Missense_Mutation_p.R248G|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R248G|TP53_ENST00000445888.2_Missense_Mutation_p.R248G|TP53_ENST00000359597.4_Missense_Mutation_p.R248G|TP53_ENST00000455263.2_Missense_Mutation_p.R248G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	17	GRCh37	CM010465|CM900211	TP53	M	rs121912651						151.0	112.0	125.0					17																	7577539		2203	4300	6503	7518264	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>G	17.37:g.7577539G>C	ENSP00000269305:p.Arg248Gly		7518264	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.71	3.197951	0.58126	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99867	-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	D	0.999991	D;D;D;P;P;D	0.89917	0.961;0.973;1.0;0.938;0.59;1.0	P;D;D;P;P;D	0.97110	0.885;0.942;1.0;0.877;0.826;0.999	D	0.98109	1.0419	10	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	G	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248G;ENSP00000352610:R248G;ENSP00000269305:R248G;ENSP00000398846:R248G;ENSP00000391127:R248G;ENSP00000391478:R248G;ENSP00000425104:R116G;ENSP00000423862:R155G	ENSP00000269305:R248G	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
PRSS58	136541	hgsc.bcm.edu	37	7	141954986	141954986	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1632-01	TCGA-25-1632-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr7:141954986T>A	ENST00000552471.1	-	3	644	c.325A>T	c.(325-327)Aca>Tca	p.T109S	PRSS58_ENST00000547058.2_Missense_Mutation_p.T109S			Q8IYP2	PRS58_HUMAN	protease, serine, 58	109	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.T109S(1)		kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						TCAGCCTCTGTTTTCAGCTTG	0.408																																																1	Substitution - Missense(1)	ovary(1)	7											238.0	216.0	223.0					7																	141954986		2203	4300	6503	141601463	SO:0001583	missense	136541				CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.325A>T	7.37:g.141954986T>A	ENSP00000446916:p.Thr109Ser		141601463	B3KVJ6|D3DXD2	Missense_Mutation	SNP	ENST00000552471.1	37	CCDS5871.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	0.188	-1.056035	0.01965	.	.	ENSG00000258223	ENST00000547058;ENST00000552471	D;D	0.87729	-2.29;-2.29	5.04	1.2	0.21068	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.67961	0.2949	N	0.12527	0.23	0.09310	N	1	B	0.20550	0.046	B	0.23716	0.048	T	0.55742	-0.8093	9	0.02654	T	1	.	2.7531	0.05286	0.3211:0.1886:0.0:0.4902	.	109	Q8IYP2	PRS58_HUMAN	S	109	ENSP00000447588:T109S;ENSP00000446916:T109S	ENSP00000307206:T109S	T	-	1	0	PRSS58	141601463	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.147000	0.16202	0.111000	0.17947	0.533000	0.62120	ACA		0.408	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351328.2	NM_001001317		Missense_Mutation
TRPV6	55503	hgsc.bcm.edu	37	7	142583147	142583147	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr7:142583147G>T	ENST00000359396.3	-	1	360	c.115C>A	c.(115-117)Ctg>Atg	p.L39M	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	39					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					TTCTGCTGCAGCAGGTTCTGC	0.602																																																0			7											108.0	109.0	109.0					7																	142583147		2203	4300	6503	142293269	SO:0001583	missense	55503			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.115C>A	7.37:g.142583147G>T	ENSP00000352358:p.Leu39Met		142293269	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	CCDS5874.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.492	0.862290	0.17178	.	.	ENSG00000165125	ENST00000359396	T	0.54866	0.55	3.82	1.96	0.26148	.	0.317706	0.25717	N	0.028774	T	0.41488	0.1161	L	0.54323	1.7	0.35734	D	0.818172	B	0.30021	0.265	B	0.32211	0.142	T	0.34775	-0.9815	10	0.28530	T	0.3	-13.0304	4.6022	0.12359	0.1169:0.0:0.6663:0.2168	.	39	Q9H1D0	TRPV6_HUMAN	M	39	ENSP00000352358:L39M	ENSP00000352358:L39M	L	-	1	2	TRPV6	142293269	0.999000	0.42202	0.997000	0.53966	0.071000	0.16799	2.098000	0.41757	0.402000	0.25451	-0.478000	0.04885	CTG		0.602	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274		Missense_Mutation
XIRP1	165904	hgsc.bcm.edu	37	3	39227664	39227664	+	Silent	SNP	G	G	A	rs61736155	byFrequency	TCGA-25-1632-01	TCGA-25-1632-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-25-1632-01	TCGA-25-1632-10	g.chr3:39227664G>A	ENST00000340369.3	-	2	3501	c.3273C>T	c.(3271-3273)gaC>gaT	p.D1091D	XIRP1_ENST00000396251.1_Silent_p.D1091D|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1091					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TCCGAAGACCGTCCTGGATGG	0.602													G|||	505	0.100839	0.0091	0.1023	5008	,	,		17430	0.0615		0.1988	False		,,,				2504	0.1636															0			3						G	,	187,4219		4,179,2020	58.0	57.0	57.0		3273,3273	-5.2	0.0	3	dbSNP_129	57	1755,6843		176,1403,2720	no	coding-synonymous,coding-synonymous	XIRP1	NM_001198621.1,NM_194293.2	,	180,1582,4740	AA,AG,GG		20.4117,4.2442,14.9339	,	1091/1122,1091/1844	39227664	1942,11062	2203	4299	6502	39202668	SO:0001819	synonymous_variant	165904			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.3273C>T	3.37:g.39227664G>A			39202668	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Silent	SNP	ENST00000340369.3	37	CCDS2683.1	SNP	40	Baylor																																																																																				0.602	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522		Silent
