#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
MACF1	23499	broad.mit.edu	37	1	39797856	39797856	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr1:39797856C>G	ENST00000372915.3	+	36	5698	c.5611C>G	c.(5611-5613)Cta>Gta	p.L1871V	MACF1_ENST00000539005.1_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000289893.4_Missense_Mutation_p.L306V|MACF1_ENST00000567887.1_Missense_Mutation_p.L1903V|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000564288.1_Missense_Mutation_p.L1866V|MACF1_ENST00000361689.2_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1871					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.L306V(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TACAGATGCCCTAGAACAAGG	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											105.0	105.0	105.0					1																	39797856		2203	4300	6503	39570443	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.5611C>G	1.37:g.39797856C>G	ENSP00000362006:p.Leu1871Val		39570443	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	11.31	1.601036	0.28534	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.72282	-0.64;-0.64	5.34	0.0307	0.14168	.	0.000000	0.40385	N	0.001103	T	0.73401	0.3582	L	0.37850	1.14	0.80722	D	1	D	0.63046	0.992	D	0.76071	0.987	T	0.71669	-0.4523	10	0.72032	D	0.01	.	10.4271	0.44385	0.0:0.4831:0.0:0.5169	.	1871	Q9UPN3	MACF1_HUMAN	V	1871;306	ENSP00000362006:L1871V;ENSP00000289893:L306V	ENSP00000289893:L306V	L	+	1	2	MACF1	39570443	0.366000	0.25014	0.991000	0.47740	0.991000	0.79684	0.185000	0.16958	-0.012000	0.14223	-0.266000	0.10368	CTA		0.458	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		Missense_Mutation
PIGK	10026	broad.mit.edu	37	1	77620287	77620287	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr1:77620287C>T	ENST00000370812.3	-	9	856	c.833G>A	c.(832-834)aGt>aAt	p.S278N	PIGK_ENST00000370813.5_Missense_Mutation_p.S202N|PIGK_ENST00000445065.1_Missense_Mutation_p.S184N|PIGK_ENST00000478391.1_5'UTR|PIGK_ENST00000359130.1_Missense_Mutation_p.S278N	NM_005482.2	NP_005473.1	Q92643	GPI8_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class K	278					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	cysteine-type endopeptidase activity (GO:0004197)|GPI-anchor transamidase activity (GO:0003923)|protein disulfide isomerase activity (GO:0003756)	p.S278N(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	19						CACACACAGACTTTTGGGACA	0.348																																																1	Substitution - Missense(1)	ovary(1)	1											59.0	58.0	59.0					1																	77620287		2202	4299	6501	77392875	SO:0001583	missense	10026			AF022913	CCDS674.1	1p31.1	2013-02-26	2006-06-28		ENSG00000142892	ENSG00000142892		"""Phosphatidylinositol glycan anchor biosynthesis"""	8965	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	605087	"""phosphatidylinositol glycan, class K"""			9356492	Standard	NM_005482		Approved	hGPI8, GPI8	uc001dhk.3	Q92643	OTTHUMG00000009686	ENST00000370812.3:c.833G>A	1.37:g.77620287C>T	ENSP00000359848:p.Ser278Asn		77392875	B2R7K3|B4E2M3|O14822|Q5TG77	Missense_Mutation	SNP	ENST00000370812.3	37	CCDS674.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	16.26	3.072306	0.55646	.	.	ENSG00000142892	ENST00000370812;ENST00000445065;ENST00000370813;ENST00000359130	T;T;T;T	0.46451	0.87;0.87;0.87;0.9	5.11	4.2	0.49525	.	0.039287	0.85682	N	0.000000	T	0.32615	0.0835	M	0.63843	1.955	0.58432	D	0.999999	B;B;B;B	0.29188	0.236;0.236;0.018;0.013	B;B;B;B	0.37943	0.261;0.261;0.055;0.065	T	0.28299	-1.0048	10	0.48119	T	0.1	-25.9268	13.7351	0.62813	0.0:0.9252:0.0:0.0748	.	202;184;278;278	B4E2M3;B1AK81;A6NEM5;Q92643	.;.;.;GPI8_HUMAN	N	278;184;202;278	ENSP00000359848:S278N;ENSP00000388854:S184N;ENSP00000359849:S202N;ENSP00000352041:S278N	ENSP00000352041:S278N	S	-	2	0	PIGK	77392875	1.000000	0.71417	0.996000	0.52242	0.905000	0.53344	7.387000	0.79785	1.286000	0.44565	0.591000	0.81541	AGT		0.348	PIGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026687.1	NM_005482		Missense_Mutation
CELSR2	1952	broad.mit.edu	37	1	109794761	109794761	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr1:109794761C>T	ENST00000271332.3	+	1	2121	c.2060C>T	c.(2059-2061)gCc>gTc	p.A687V		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	687	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.A687V(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GCTGTTACCGCCTCCGATGGC	0.557																																					NSCLC(158;1285 2011 34800 34852 42084)											1	Substitution - Missense(1)	ovary(1)	1											111.0	106.0	108.0					1																	109794761		2203	4300	6503	109596284	SO:0001583	missense	1952			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.2060C>T	1.37:g.109794761C>T	ENSP00000271332:p.Ala687Val		109596284	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	N	17.91	3.504009	0.64410	.	.	ENSG00000143126	ENST00000271332	T	0.52295	0.67	4.95	4.95	0.65309	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.64538	0.2607	M	0.74389	2.26	0.54753	D	0.999982	D	0.89917	1.0	D	0.97110	1.0	T	0.66316	-0.5954	9	0.54805	T	0.06	.	18.4313	0.90627	0.0:1.0:0.0:0.0	.	687	Q9HCU4	CELR2_HUMAN	V	687	ENSP00000271332:A687V	ENSP00000271332:A687V	A	+	2	0	CELSR2	109596284	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	7.278000	0.78587	2.600000	0.87896	0.650000	0.86243	GCC		0.557	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408		Missense_Mutation
OR2G6	391211	broad.mit.edu	37	1	248685343	248685343	+	Silent	SNP	C	C	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr1:248685343C>T	ENST00000343414.4	+	1	428	c.396C>T	c.(394-396)taC>taT	p.Y132Y		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y132Y(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CACTGCGCTACATAGCCATTA	0.592																																																1	Substitution - coding silent(1)	ovary(1)	1											65.0	55.0	59.0					1																	248685343		2203	4300	6503	246751966	SO:0001819	synonymous_variant	391211				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.396C>T	1.37:g.248685343C>T			246751966	B2RP33	Silent	SNP	ENST00000343414.4	37	CCDS31119.1	SNP	17	Broad																																																																																				0.592	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842		Silent
OR2G6	391211	broad.mit.edu	37	1	248685715	248685715	+	Silent	SNP	A	A	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr1:248685715A>T	ENST00000343414.4	+	1	800	c.768A>T	c.(766-768)atA>atT	p.I256I		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I256I(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGACCATCATATTCATGTACC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	1											118.0	119.0	119.0					1																	248685715		2203	4300	6503	246752338	SO:0001819	synonymous_variant	391211				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.768A>T	1.37:g.248685715A>T			246752338	B2RP33	Silent	SNP	ENST00000343414.4	37	CCDS31119.1	SNP	16	Broad																																																																																				0.443	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842		Silent
PRKCQ	5588	broad.mit.edu	37	10	6504278	6504278	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr10:6504278C>A	ENST00000263125.5	-	14	1594	c.1495G>T	c.(1495-1497)Gga>Tga	p.G499*	PRKCQ_ENST00000539722.1_Nonsense_Mutation_p.G374*|PRKCQ_ENST00000397176.2_Nonsense_Mutation_p.G499*	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	499	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)	p.G499*(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	TAGACTATTCCTTTGGAATGA	0.408																																					Ovarian(50;572 1126 10530 25349 30594)											1	Substitution - Nonsense(1)	ovary(1)	10											115.0	117.0	116.0					10																	6504278		2203	4300	6503	6544284	SO:0001587	stop_gained	5588			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1495G>T	10.37:g.6504278C>A	ENSP00000263125:p.Gly499*		6544284	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Nonsense_Mutation	SNP	ENST00000263125.5	37	CCDS7079.1	SNP	24	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.805110|5.805110	0.96967|0.96967	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000263125;ENST00000397176;ENST00000539722|ENST00000397178	.|.	.|.	.|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.70465	.|0.3227	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64453	.|-0.6404	.|4	0.87932|0.23891	D|T	0|0.37	.|.	19.2789|19.2789	0.94044|0.94044	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|N	499;499;374|271	.|.	ENSP00000263125:G499X|ENSP00000380363:K271N	G|K	-|-	1|3	0|2	PRKCQ|PRKCQ	6544284|6544284	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.215000|0.215000	0.24574|0.24574	7.513000|7.513000	0.81739|0.81739	2.542000|2.542000	0.85734|0.85734	0.563000|0.563000	0.77884|0.77884	GGA|AAG		0.408	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257		Nonsense_Mutation
DCLRE1C	64421	broad.mit.edu	37	10	14981854	14981854	+	Silent	SNP	G	G	T	rs191086777		TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr10:14981854G>T	ENST00000378278.2	-	4	298	c.261C>A	c.(259-261)atC>atA	p.I87I	DCLRE1C_ENST00000378258.1_5'UTR|DCLRE1C_ENST00000378254.1_5'UTR|DCLRE1C_ENST00000378246.2_5'UTR|DCLRE1C_ENST00000396817.2_5'UTR|DCLRE1C_ENST00000378249.1_5'UTR|DCLRE1C_ENST00000378255.1_5'UTR|DCLRE1C_ENST00000453695.2_5'UTR|DCLRE1C_ENST00000378289.4_Silent_p.I87I|DCLRE1C_ENST00000357717.2_5'UTR			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	87					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.I87I(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						TAGGAGTCTCGATTTCAATAG	0.313								Non-homologous end-joining																																								1	Substitution - coding silent(1)	ovary(1)	10											38.0	41.0	40.0					10																	14981854		2192	4292	6484	15021860	SO:0001819	synonymous_variant	64421			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.261C>A	10.37:g.14981854G>T			15021860	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Silent	SNP	ENST00000378278.2	37	CCDS31149.1	SNP	37	Broad																																																																																				0.313	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046934.1	NM_022487		Silent
JMJD1C	221037	broad.mit.edu	37	10	64950671	64950671	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr10:64950671A>G	ENST00000399262.2	-	17	6492	c.6274T>C	c.(6274-6276)Tat>Cat	p.Y2092H	JMJD1C_ENST00000402544.1_Missense_Mutation_p.Y1855H|JMJD1C_ENST00000542921.1_Missense_Mutation_p.Y1910H|JMJD1C_ENST00000399251.1_3'UTR	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	2092					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)	p.Y1855H(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CCCATTGAATATACTGGGGCA	0.453																																																1	Substitution - Missense(1)	ovary(1)	10											104.0	98.0	100.0					10																	64950671		1880	4120	6000	64620677	SO:0001583	missense	221037			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.6274T>C	10.37:g.64950671A>G	ENSP00000382204:p.Tyr2092His		64620677	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	24.7	4.555162	0.86231	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000542921	T;T;T	0.56776	0.78;0.44;0.78	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.72399	0.3455	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.995	T	0.74990	-0.3475	10	0.56958	D	0.05	-16.4664	15.5839	0.76468	1.0:0.0:0.0:0.0	.	2092;1910	Q15652;A0T124	JHD2C_HUMAN;.	H	2092;1855;1910	ENSP00000382204:Y2092H;ENSP00000384990:Y1855H;ENSP00000444682:Y1910H	ENSP00000382204:Y2092H	Y	-	1	0	JMJD1C	64620677	1.000000	0.71417	0.983000	0.44433	0.989000	0.77384	8.454000	0.90352	2.225000	0.72522	0.528000	0.53228	TAT		0.453	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241		Missense_Mutation
CFAP43	80217	broad.mit.edu	37	10	105990459	105990459	+	Missense_Mutation	SNP	C	C	T	rs551332560		TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr10:105990459C>T	ENST00000357060.3	-	2	323	c.208G>A	c.(208-210)Gtc>Atc	p.V70I	WDR96_ENST00000369719.1_5'UTR|WDR96_ENST00000428666.1_Missense_Mutation_p.V70I|WDR96_ENST00000278064.2_5'UTR|WDR96_ENST00000369720.1_5'UTR	NM_025145.5	NP_079421.5												p.V70I(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GTTGCCATGACGCCCACAATT	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		15274	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	10											144.0	132.0	136.0					10																	105990459		2203	4300	6503	105980449	SO:0001583	missense	80217																														ENST00000357060.3:c.208G>A	10.37:g.105990459C>T	ENSP00000349568:p.Val70Ile		105980449		Missense_Mutation	SNP	ENST00000357060.3	37	CCDS31281.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	13.30	2.196404	0.38806	.	.	ENSG00000197748	ENST00000357060;ENST00000428666	T;T	0.19105	2.17;2.17	4.83	3.92	0.45320	.	0.291378	0.18676	N	0.134302	T	0.17152	0.0412	L	0.40543	1.245	0.31000	N	0.720398	B;B;B	0.28760	0.221;0.098;0.066	B;B;B	0.17098	0.017;0.011;0.009	T	0.06320	-1.0833	10	0.31617	T	0.26	.	13.2535	0.60066	0.0:0.922:0.0:0.078	.	70;70;70	Q8NDM7-5;B4DHB6;Q8NDM7	.;.;WDR96_HUMAN	I	70	ENSP00000349568:V70I;ENSP00000400289:V70I	ENSP00000349568:V70I	V	-	1	0	WDR96	105980449	0.988000	0.35896	1.000000	0.80357	0.935000	0.57460	1.421000	0.34815	1.021000	0.39600	0.491000	0.48974	GTC		0.413	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Missense_Mutation
DNHD1	144132	broad.mit.edu	37	11	6592324	6592324	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr11:6592324C>G	ENST00000527990.2	+	40	13582	c.13582C>G	c.(13582-13584)Ctc>Gtc	p.L4528V	DNHD1_ENST00000254579.6_Missense_Mutation_p.L4528V			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	4528					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)	p.L4528V(1)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GGCCCACGCTCTCTGGACTGG	0.701																																																1	Substitution - Missense(1)	ovary(1)	11											22.0	27.0	25.0					11																	6592324		2057	4185	6242	6548900	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.13582C>G	11.37:g.6592324C>G	ENSP00000436180:p.Leu4528Val		6548900	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	17.21	3.330860	0.60853	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000530197	T;T	0.13778	2.56;2.56	4.25	4.25	0.50352	Dynein heavy chain (1);	0.000000	0.51477	D	0.000088	T	0.32436	0.0829	M	0.62723	1.935	0.27249	N	0.958932	D;D;D	0.76494	0.997;0.999;0.997	D;D;D	0.87578	0.995;0.998;0.995	T	0.02766	-1.1113	10	0.56958	D	0.05	-12.6533	12.327	0.55018	0.0:1.0:0.0:0.0	.	3616;581;4528	B0I1S4;Q9NSW8;Q96M86	.;.;DNHD1_HUMAN	V	4528;4528;796	ENSP00000254579:L4528V;ENSP00000436180:L4528V	ENSP00000254579:L4528V	L	+	1	0	DNHD1	6548900	1.000000	0.71417	0.963000	0.40424	0.522000	0.34438	3.889000	0.56212	2.353000	0.79882	0.557000	0.71058	CTC		0.701	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666		Missense_Mutation
OR5AS1	219447	broad.mit.edu	37	11	55798443	55798443	+	Silent	SNP	T	T	C			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr11:55798443T>C	ENST00000313555.1	+	1	549	c.549T>C	c.(547-549)ccT>ccC	p.P183P		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P183P(1)		endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					ATATCCCACCTCTTCTGGCTT	0.423																																																1	Substitution - coding silent(1)	ovary(1)	11											284.0	281.0	282.0					11																	55798443		2201	4296	6497	55555019	SO:0001819	synonymous_variant	219447			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.549T>C	11.37:g.55798443T>C			55555019	Q6IFB8	Silent	SNP	ENST00000313555.1	37	CCDS31516.1	SNP	54	Broad																																																																																				0.423	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921		Silent
ANO1	55107	broad.mit.edu	37	11	69978061	69978061	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr11:69978061G>A	ENST00000355303.5	+	11	1439	c.1134G>A	c.(1132-1134)atG>atA	p.M378I	ANO1_ENST00000530676.1_Missense_Mutation_p.M262I|ANO1_ENST00000398543.2_Missense_Mutation_p.M262I|ANO1_ENST00000531349.1_Missense_Mutation_p.M113I|ANO1_ENST00000538023.1_Missense_Mutation_p.M378I|RP11-805J14.3_ENST00000530525.1_RNA|ANO1_ENST00000316296.5_Missense_Mutation_p.M350I	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	378					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)	p.M378I(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	ATATCACCATGTGCCCGCTTT	0.612																																																1	Substitution - Missense(1)	ovary(1)	11											40.0	50.0	47.0					11																	69978061		2158	4248	6406	69655709	SO:0001583	missense	55107			BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.1134G>A	11.37:g.69978061G>A	ENSP00000347454:p.Met378Ile		69655709	A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	ENST00000355303.5	37	CCDS44663.1	SNP	48	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.93|19.93	3.918551|3.918551	0.73098|0.73098	.|.	.|.	ENSG00000131620|ENSG00000131620	ENST00000530480|ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000316296;ENST00000530676;ENST00000531349	.|T;T;T;T;T;T	.|0.74526	.|-0.42;-0.52;-0.85;-0.2;-0.85;-0.53	4.51|4.51	4.51|4.51	0.55191|0.55191	.|.	.|0.100480	.|0.64402	.|D	.|0.000003	D|D	0.87577|0.87577	0.6212|0.6212	M|M	0.91920|0.91920	3.255|3.255	0.58432|0.58432	D|D	0.999999|0.999999	.|P;P;D	.|0.54397	.|0.744;0.515;0.966	.|P;B;P	.|0.59643	.|0.582;0.157;0.861	D|D	0.90750|0.90750	0.4656|0.4656	5|9	.|.	.|.	.|.	.|.	17.2887|17.2887	0.87149|0.87149	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|113;350;378	.|E9PNA7;Q5XXA6-3;Q5XXA6	.|.;.;ANO1_HUMAN	Y|I	243|378;378;262;162;350;262;113	.|ENSP00000347454:M378I;ENSP00000444689:M378I;ENSP00000381551:M262I;ENSP00000319477:M350I;ENSP00000435797:M262I;ENSP00000432843:M113I	.|.	C|M	+|+	2|3	0|0	ANO1|ANO1	69655709|69655709	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.801000|0.801000	0.45260|0.45260	9.510000|9.510000	0.98004|0.98004	2.067000|2.067000	0.61834|0.61834	0.555000|0.555000	0.69702|0.69702	TGT|ATG		0.612	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043		Missense_Mutation
CCDC82	79780	broad.mit.edu	37	11	96117863	96117863	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr11:96117863C>T	ENST00000278520.5	-	3	477	c.49G>A	c.(49-51)Gtg>Atg	p.V17M	CCDC82_ENST00000525786.1_5'Flank|CCDC82_ENST00000423339.2_Missense_Mutation_p.V17M|CCDC82_ENST00000542662.1_Missense_Mutation_p.V17M			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	17								p.V17M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		TGCTCAGGCACGTGACTCTTA	0.338																																																1	Substitution - Missense(1)	ovary(1)	11											74.0	71.0	72.0					11																	96117863		2200	4296	6496	95757511	SO:0001583	missense	79780			AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.49G>A	11.37:g.96117863C>T	ENSP00000278520:p.Val17Met		95757511	B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Missense_Mutation	SNP	ENST00000278520.5	37	CCDS8307.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	12.23	1.874879	0.33069	.	.	ENSG00000149231	ENST00000278520;ENST00000542662;ENST00000423339;ENST00000538597;ENST00000530203	T;T;T;T	0.32515	1.83;1.83;1.83;1.45	5.77	1.77	0.24775	.	0.983418	0.08295	N	0.967843	T	0.20170	0.0485	L	0.36672	1.1	0.09310	N	0.999995	P;B	0.42757	0.789;0.226	B;B	0.27500	0.08;0.025	T	0.10847	-1.0612	10	0.52906	T	0.07	1.4465	9.947	0.41616	0.0:0.728:0.0:0.272	.	17;17	Q8N4S0-2;Q8N4S0	.;CCD82_HUMAN	M	17	ENSP00000278520:V17M;ENSP00000444010:V17M;ENSP00000397156:V17M;ENSP00000442723:V17M	ENSP00000278520:V17M	V	-	1	0	CCDC82	95757511	0.000000	0.05858	0.612000	0.29024	0.957000	0.61999	-0.767000	0.04720	0.141000	0.18875	0.655000	0.94253	GTG		0.338	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395542.2	NM_024725		Missense_Mutation
FGD4	121512	broad.mit.edu	37	12	32751500	32751500	+	Nonsense_Mutation	SNP	C	C	T	rs118203972		TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr12:32751500C>T	ENST00000427716.2	+	5	1094	c.670C>T	c.(670-672)Cga>Tga	p.R224*	FGD4_ENST00000546442.1_Nonsense_Mutation_p.R131*|FGD4_ENST00000381025.3_5'UTR|FGD4_ENST00000266482.3_5'UTR|FGD4_ENST00000531134.1_Nonsense_Mutation_p.R309*|FGD4_ENST00000534526.2_Nonsense_Mutation_p.R361*|FGD4_ENST00000525053.1_Nonsense_Mutation_p.R336*	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	224	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.R224*(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					TTATGTCAACCGACTTGACCT	0.299																																																1	Substitution - Nonsense(1)	ovary(1)	12	GRCh37	CM073065	FGD4	M	rs118203972						87.0	86.0	86.0					12																	32751500		2203	4299	6502	32642767	SO:0001587	stop_gained	121512			AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.670C>T	12.37:g.32751500C>T	ENSP00000394487:p.Arg224*		32642767	Q6ULS2|Q8TCP6	Nonsense_Mutation	SNP	ENST00000427716.2	37	CCDS8727.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	29.8	5.037646	0.93630	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000546442;ENST00000525053	.	.	.	4.91	3.95	0.45737	.	0.000000	0.43110	D	0.000613	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.1136	13.1135	0.59288	0.2701:0.7299:0.0:0.0	.	.	.	.	X	361;309;224;131;336	.	ENSP00000379089:R224X	R	+	1	2	FGD4	32642767	0.997000	0.39634	0.999000	0.59377	0.763000	0.43281	2.023000	0.41040	2.426000	0.82243	0.655000	0.94253	CGA		0.299	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241		Nonsense_Mutation
AACS	65985	broad.mit.edu	37	12	125618566	125618566	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr12:125618566G>T	ENST00000316519.6	+	15	1773	c.1567G>T	c.(1567-1569)Gac>Tac	p.D523Y	AACS_ENST00000543665.1_Silent_p.A22A|AACS_ENST00000261686.6_Missense_Mutation_p.D523Y|AACS_ENST00000545511.1_Silent_p.A102A|AACS_ENST00000316543.10_Missense_Mutation_p.D121Y	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	523					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		GGCTCATGGCGACTACTGCAG	0.617																																																0			12											87.0	72.0	77.0					12																	125618566		2203	4300	6503	124184519	SO:0001583	missense	65985			AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.1567G>T	12.37:g.125618566G>T	ENSP00000324842:p.Asp523Tyr		124184519	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Missense_Mutation	SNP	ENST00000316519.6	37	CCDS9263.1	SNP	37	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.4|26.4	4.731325|4.731325	0.89390|0.89390	.|.	.|.	ENSG00000081760|ENSG00000081760	ENST00000316519;ENST00000261686;ENST00000316543;ENST00000538851;ENST00000536118|ENST00000535001	D;D;T;D;T|.	0.87729|.	-2.29;-2.29;0.17;-2.29;0.17|.	5.75|5.75	5.75|5.75	0.90469|0.90469	AMP-dependent synthetase/ligase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88518|0.88518	0.6458|0.6458	H|H	0.96398|0.96398	3.815|3.815	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.91473|0.91473	0.5198|0.5198	10|6	0.87932|0.87932	D|D	0|0	.|.	19.9439|19.9439	0.97175|0.97175	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	523;523|.	Q86V21-2;Q86V21|.	.;AACS_HUMAN|.	Y|L	523;523;121;188;78|236	ENSP00000324842:D523Y;ENSP00000261686:D523Y;ENSP00000324929:D121Y;ENSP00000441686:D188Y;ENSP00000441331:D78Y|.	ENSP00000261686:D523Y|ENSP00000441909:R236L	D|R	+|+	1|2	0|0	AACS|AACS	124184519|124184519	1.000000|1.000000	0.71417|0.71417	0.964000|0.964000	0.40570|0.40570	0.859000|0.859000	0.49053|0.49053	8.963000|8.963000	0.93385|0.93385	2.706000|2.706000	0.92434|0.92434	0.561000|0.561000	0.74099|0.74099	GAC|CGA		0.617	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400202.1	NM_023928		Missense_Mutation
PIWIL1	9271	broad.mit.edu	37	12	130847320	130847320	+	Silent	SNP	A	A	C			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr12:130847320A>C	ENST00000245255.3	+	17	2252	c.1980A>C	c.(1978-1980)tcA>tcC	p.S660S		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	660	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.|RNA-binding. {ECO:0000250}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)	p.S660S(1)		breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		GCTGGTTCTCACGCTGCATAT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	12											110.0	105.0	107.0					12																	130847320		2203	4300	6503	129413273	SO:0001819	synonymous_variant	9271			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1980A>C	12.37:g.130847320A>C			129413273	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Silent	SNP	ENST00000245255.3	37	CCDS9268.1	SNP	6	Broad																																																																																				0.398	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1			Silent
UTP14C	9724	broad.mit.edu	37	13	52604308	52604308	+	Silent	SNP	C	C	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr13:52604308C>T	ENST00000521776.2	+	2	2101	c.1368C>T	c.(1366-1368)tcC>tcT	p.S456S		NM_021645.5	NP_067677.4	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)	456					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|rRNA processing (GO:0006364)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)		p.S456S(1)		breast(4)|cervix(1)|endometrium(1)|large_intestine(10)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	32		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		AGGTGCTGTCCGAATTGAGGG	0.478																																																1	Substitution - coding silent(1)	ovary(1)	13											85.0	89.0	88.0					13																	52604308		2203	4300	6503	51502309	SO:0001819	synonymous_variant	9724			D87455	CCDS31978.1	13q12.2-q13.3	2010-11-23	2004-06-15	2004-06-16	ENSG00000253797	ENSG00000253797			20321	protein-coding gene	gene with protein product		608969	"""KIAA0266"""	KIAA0266		9039502, 16354793	Standard	NM_021645		Approved	2700066J21Rik	uc021rjw.1	Q5TAP6	OTTHUMG00000164353	ENST00000521776.2:c.1368C>T	13.37:g.52604308C>T			51502309	Q5FWG3|Q92555	Silent	SNP	ENST00000521776.2	37	CCDS31978.1	SNP	23	Broad																																																																																				0.478	UTP14C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045049.2	NM_021645		Silent
ZC3H14	79882	broad.mit.edu	37	14	89034472	89034472	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr14:89034472A>T	ENST00000251038.5	+	3	394	c.169A>T	c.(169-171)Aac>Tac	p.N57Y	ZC3H14_ENST00000302216.8_Missense_Mutation_p.N57Y|ZC3H14_ENST00000557607.1_Intron|ZC3H14_ENST00000336693.4_Missense_Mutation_p.N23Y|ZC3H14_ENST00000556945.1_Missense_Mutation_p.N57Y|ZC3H14_ENST00000555755.1_Missense_Mutation_p.N57Y|ZC3H14_ENST00000359301.3_Missense_Mutation_p.N23Y|ZC3H14_ENST00000393514.5_Missense_Mutation_p.N57Y	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	57						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.N57Y(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						GTTTCTAGGGAACAACACAAT	0.408																																																1	Substitution - Missense(1)	ovary(1)	14											147.0	115.0	125.0					14																	89034472		2203	4300	6503	88104225	SO:0001583	missense	79882			AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.169A>T	14.37:g.89034472A>T	ENSP00000251038:p.Asn57Tyr		88104225	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	ENST00000251038.5	37	CCDS32133.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825232	0.71143	.	.	ENSG00000100722	ENST00000251038;ENST00000393530;ENST00000353091;ENST00000359301;ENST00000302216;ENST00000554602;ENST00000380684;ENST00000556945;ENST00000556158;ENST00000555799;ENST00000555755;ENST00000393514;ENST00000336693;ENST00000557693;ENST00000555120	T;T;T;T;T;T;T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68	5.62	5.62	0.85841	.	0.096735	0.64402	D	0.000002	T	0.79587	0.4471	L	0.43152	1.355	0.36656	D	0.877662	D;D;D;D	0.76494	0.999;0.998;0.991;0.998	D;D;P;D	0.80764	0.994;0.952;0.718;0.965	D	0.84486	0.0608	10	0.87932	D	0	-13.8914	15.8303	0.78745	1.0:0.0:0.0:0.0	.	57;57;57;57	G3V5R4;Q6PJT7-2;Q6PJT7-3;Q6PJT7	.;.;.;ZC3HE_HUMAN	Y	57;57;57;23;57;23;57;57;44;23;57;57;23;23;23	ENSP00000251038:N57Y;ENSP00000352250:N23Y;ENSP00000307025:N57Y;ENSP00000451638:N23Y;ENSP00000450474:N57Y;ENSP00000451389:N44Y;ENSP00000451489:N23Y;ENSP00000452475:N57Y;ENSP00000377150:N57Y;ENSP00000338002:N23Y;ENSP00000452210:N23Y;ENSP00000450451:N23Y	ENSP00000251038:N57Y	N	+	1	0	ZC3H14	88104225	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.806000	0.62569	2.133000	0.65898	0.533000	0.62120	AAC		0.408	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410387.1	NM_024824		Missense_Mutation
PLCB2	5330	broad.mit.edu	37	15	40590827	40590827	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr15:40590827G>C	ENST00000260402.3	-	10	1182	c.933C>G	c.(931-933)caC>caG	p.H311Q	PLCB2_ENST00000557821.1_Missense_Mutation_p.H311Q|PLCB2_ENST00000456256.2_Missense_Mutation_p.H311Q|PLCB2-AS1_ENST00000559520.1_RNA	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	311					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.H311Q(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TCATGTCGTGGTGGAGCAGCA	0.562																																																1	Substitution - Missense(1)	ovary(1)	15											107.0	112.0	110.0					15																	40590827		2164	4252	6416	38378119	SO:0001583	missense	5330				CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.933C>G	15.37:g.40590827G>C	ENSP00000260402:p.His311Gln		38378119	A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	37	CCDS42020.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	13.33	2.203653	0.38905	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.21932	1.99;1.98	4.67	3.73	0.42828	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);	0.451802	0.26086	N	0.026431	T	0.18087	0.0434	N	0.19112	0.55	0.80722	D	1	P;B;B	0.37122	0.583;0.158;0.021	P;B;B	0.45428	0.48;0.058;0.071	T	0.04579	-1.0941	10	0.26408	T	0.33	.	11.7245	0.51702	0.1452:0.0:0.8548:0.0	.	311;311;311	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	Q	311	ENSP00000260402:H311Q;ENSP00000411991:H311Q	ENSP00000260402:H311Q	H	-	3	2	PLCB2	38378119	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	1.588000	0.36633	2.438000	0.82558	0.561000	0.74099	CAC		0.562	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1			Missense_Mutation
SCNN1B	6338	broad.mit.edu	37	16	23390080	23390080	+	Silent	SNP	C	C	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr16:23390080C>A	ENST00000343070.2	+	11	1634	c.1458C>A	c.(1456-1458)acC>acA	p.T486T	SCNN1B_ENST00000568923.1_Silent_p.T459T|SCNN1B_ENST00000307331.5_Silent_p.T531T|SCNN1B_ENST00000568085.1_Silent_p.T450T	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	486					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)	p.T486T(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	CCAATATCACCCTGAGCAGGT	0.582																																																1	Substitution - coding silent(1)	ovary(1)	16											98.0	79.0	86.0					16																	23390080		2197	4300	6497	23297581	SO:0001819	synonymous_variant	6338			X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.1458C>A	16.37:g.23390080C>A			23297581	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Silent	SNP	ENST00000343070.2	37	CCDS10609.1	SNP	22	Broad																																																																																				0.582	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2			Silent
NLRC5	84166	broad.mit.edu	37	16	57075470	57075470	+	Missense_Mutation	SNP	G	G	A	rs148873682		TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr16:57075470G>A	ENST00000262510.6	+	18	3238	c.3013G>A	c.(3013-3015)Ggt>Agt	p.G1005S	NLRC5_ENST00000436936.1_Missense_Mutation_p.G1005S|NLRC5_ENST00000308149.7_Missense_Mutation_p.G1005S|NLRC5_ENST00000539144.1_Missense_Mutation_p.G1005S	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1005					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.G1005S(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CTGCCACCTCGGTCACCTCCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	16											78.0	74.0	75.0					16																	57075470		2198	4300	6498	55632971	SO:0001583	missense	84166			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3013G>A	16.37:g.57075470G>A	ENSP00000262510:p.Gly1005Ser		55632971	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	CCDS10773.1	SNP	39	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.695|3.695	-0.062640|-0.062640	0.07273|0.07273	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030|ENST00000538805	T;T;T;T;T;T|.	0.50548|.	0.74;0.74;0.74;0.74;0.74;0.74|.	2.43|2.43	-2.0|-2.0	0.07433|0.07433	.|.	0.899723|.	0.09062|.	N|.	0.854198|.	T|T	0.08133|0.08133	0.0203|0.0203	N|N	0.01267|0.01267	-0.92|-0.92	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.27971|.	0.015;0.086;0.196;0.029|.	B;B;B;B|.	0.17098|.	0.003;0.011;0.017;0.012|.	T|T	0.35773|0.35773	-0.9775|-0.9775	10|5	0.06494|.	T|.	0.89|.	.|.	5.4857|5.4857	0.16749|0.16749	0.1505:0.5427:0.3068:0.0|0.1505:0.5427:0.3068:0.0	.|.	1005;1005;1005;1005|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	S|Q	1005;1005;1005;479;1005;512;304|757	ENSP00000262510:G1005S;ENSP00000308886:G1005S;ENSP00000389739:G1005S;ENSP00000441727:G1005S;ENSP00000441597:G512S;ENSP00000440153:G304S|.	ENSP00000262510:G1005S|.	G|R	+|+	1|2	0|0	NLRC5|NLRC5	55632971|55632971	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.171000|0.171000	0.22731|0.22731	-3.588000|-3.588000	0.00422|0.00422	-0.371000|-0.371000	0.08004|0.08004	0.655000|0.655000	0.94253|0.94253	GGT|CGG		0.532	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578519	7578519	+	Silent	SNP	C	C	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr17:7578519C>A	ENST00000269305.4	-	5	600	c.411G>T	c.(409-411)ctG>ctT	p.L137L	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Silent_p.L137L|TP53_ENST00000420246.2_Silent_p.L137L|TP53_ENST00000445888.2_Silent_p.L137L|TP53_ENST00000413465.2_Silent_p.L137L|TP53_ENST00000359597.4_Silent_p.L137L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	137	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> M (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> Q (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.L137L(4)|p.A138_P142delAKTCP(4)|p.C135fs*9(3)|p.A138fs*11(3)|p.N131fs*27(2)|p.L137_A138insX(1)|p.V73fs*9(1)|p.L137_W146del10(1)|p.C135_T140delCQLAKT(1)|p.Q136_K139delQLAK(1)|p.K132_A138delKMFCQLA(1)|p.F134_T140>S(1)|p.A45_P49delAKTCP(1)|p.A6_P10delAKTCP(1)|p.C3fs*9(1)|p.C42fs*9(1)|p.C135_A138delCQLA(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGTCTTGGCCAGTTGGCAAA	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	36	Deletion - In frame(11)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - coding silent(4)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - deletion inframe(1)	urinary_tract(6)|ovary(5)|central_nervous_system(4)|bone(4)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|soft_tissue(1)|biliary_tract(1)|oesophagus(1)|liver(1)	17											54.0	53.0	54.0					17																	7578519		2203	4300	6503	7519244	SO:0001819	synonymous_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.411G>T	17.37:g.7578519C>A			7519244	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	21	Broad																																																																																				0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Silent
RNF43	54894	broad.mit.edu	37	17	56448295	56448295	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr17:56448295G>T	ENST00000584437.1	-	2	2307	c.352C>A	c.(352-354)Ccc>Acc	p.P118T	RNF43_ENST00000581868.1_5'UTR|RNF43_ENST00000500597.2_Intron|RNF43_ENST00000583753.1_Intron|RNF43_ENST00000577625.1_5'UTR|RNF43_ENST00000577716.1_Missense_Mutation_p.P118T|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000407977.2_Missense_Mutation_p.P118T			Q68DV7	RNF43_HUMAN	ring finger protein 43	118					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P118T(1)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GACAGGCAGGGGCGGGGGGCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	17											54.0	50.0	51.0					17																	56448295		2203	4300	6503	53803294	SO:0001583	missense	54894				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.352C>A	17.37:g.56448295G>T	ENSP00000463069:p.Pro118Thr		53803294	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	37	CCDS11607.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	25.7	4.666789	0.88251	.	.	ENSG00000108375	ENST00000407977	T	0.63096	-0.02	5.45	5.45	0.79879	.	0.089497	0.49305	D	0.000147	T	0.56366	0.1980	L	0.34521	1.04	0.80722	D	1	P	0.47409	0.895	B	0.43508	0.422	T	0.55866	-0.8073	10	0.34782	T	0.22	-4.2268	18.2765	0.90085	0.0:0.0:1.0:0.0	.	118	Q68DV7	RNF43_HUMAN	T	118	ENSP00000385328:P118T	ENSP00000385328:P118T	P	-	1	0	RNF43	53803294	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.605000	0.74155	2.555000	0.86185	0.655000	0.94253	CCC		0.602	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763		Missense_Mutation
ABCA9	10350	broad.mit.edu	37	17	67047175	67047175	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr17:67047175C>G	ENST00000340001.4	-	2	304	c.93G>C	c.(91-93)ttG>ttC	p.L31F	ABCA9_ENST00000453985.2_Missense_Mutation_p.L31F|ABCA9_ENST00000495634.1_Missense_Mutation_p.L31F|ABCA9_ENST00000370732.2_Missense_Mutation_p.L31F	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	31					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.L31F(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					AGCATACCAACAAGGTCTGTC	0.373																																																1	Substitution - Missense(1)	ovary(1)	17											118.0	107.0	111.0					17																	67047175		2203	4300	6503	64558770	SO:0001583	missense	10350			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.93G>C	17.37:g.67047175C>G	ENSP00000342216:p.Leu31Phe		64558770	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	37	CCDS11681.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	3.409	-0.120530	0.06838	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.90676	-2.71;-2.71	4.88	-4.38	0.03622	.	0.830029	0.09461	N	0.799065	D	0.82318	0.5011	L	0.39514	1.22	0.09310	N	1	B;B	0.17667	0.023;0.014	B;B	0.29077	0.05;0.098	T	0.68341	-0.5434	10	0.38643	T	0.18	.	1.2001	0.01883	0.1347:0.2106:0.2815:0.3732	.	31;31	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	F	31;14;31;26	ENSP00000342216:L31F;ENSP00000359767:L31F	ENSP00000342216:L31F	L	-	3	2	ABCA9	64558770	0.000000	0.05858	0.004000	0.12327	0.002000	0.02628	-3.598000	0.00419	-0.595000	0.05828	-0.140000	0.14226	TTG		0.373	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386		Missense_Mutation
ABCA6	23460	broad.mit.edu	37	17	67079029	67079029	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr17:67079029G>A	ENST00000284425.2	-	36	4775	c.4601C>T	c.(4600-4602)gCt>gTt	p.A1534V	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1534					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.A1534V(1)		breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					CTGCCCTGCAGCCTGTGGGAA	0.433																																																1	Substitution - Missense(1)	ovary(1)	17											202.0	205.0	204.0					17																	67079029		2203	4300	6503	64590624	SO:0001583	missense	23460			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4601C>T	17.37:g.67079029G>A	ENSP00000284425:p.Ala1534Val		64590624	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	CCDS11683.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972063	0.74246	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.83419	-1.72	5.03	5.03	0.67393	.	0.000000	0.49305	D	0.000154	D	0.92776	0.7703	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93833	0.7129	10	0.87932	D	0	.	17.8989	0.88897	0.0:0.0:1.0:0.0	.	1534	Q8N139	ABCA6_HUMAN	V	1534;394	ENSP00000284425:A1534V	ENSP00000284425:A1534V	A	-	2	0	ABCA6	64590624	1.000000	0.71417	0.939000	0.37840	0.322000	0.28314	5.629000	0.67798	2.787000	0.95880	0.650000	0.86243	GCT		0.433	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284		Missense_Mutation
TECR	9524	broad.mit.edu	37	19	14675086	14675086	+	Missense_Mutation	SNP	G	G	A	rs367816943		TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr19:14675086G>A	ENST00000215567.5	+	7	613	c.476G>A	c.(475-477)cGc>cAc	p.R159H	TECR_ENST00000436007.2_Missense_Mutation_p.R174H|TECR_ENST00000596073.1_Missense_Mutation_p.R4H|TECR_ENST00000600083.1_Missense_Mutation_p.R4H	NM_138501.5	NP_612510.1	Q9NZ01	TECR_HUMAN	trans-2,3-enoyl-CoA reductase	159					cellular lipid metabolic process (GO:0044255)|fatty acid elongation (GO:0030497)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|nucleus (GO:0005634)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)	p.R159H(1)		endometrium(1)|large_intestine(1)|ovary(1)	3						ATGCCTTTGCGCAACATCTTC	0.652																																																1	Substitution - Missense(1)	ovary(1)	19						G	HIS/ARG	0,4406		0,0,2203	61.0	48.0	52.0		476	3.9	1.0	19		52	1,8597	1.2+/-3.3	0,1,4298	no	missense	TECR	NM_138501.5	29	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	159/309	14675086	1,13003	2203	4299	6502	14536086	SO:0001583	missense	9524			AK001416	CCDS12313.1	19p13.12	2014-05-27	2009-07-21	2009-07-21	ENSG00000099797	ENSG00000099797			4551	protein-coding gene	gene with protein product		610057	"""glycoprotein, synaptic 2"""	SC2, GPSN2		9653160, 12482854	Standard	NM_138501		Approved	TER, MRT14	uc002mza.3	Q9NZ01		ENST00000215567.5:c.476G>A	19.37:g.14675086G>A	ENSP00000215567:p.Arg159His		14536086	B2RD55|O75350|Q6IBB2|Q9BWK3|Q9Y6P0	Missense_Mutation	SNP	ENST00000215567.5	37	CCDS12313.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882476	0.72294	0.0	1.16E-4	ENSG00000099797	ENST00000215567;ENST00000436007	T;T	0.30448	1.53;1.53	3.87	3.87	0.44632	3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.60715	0.2290	M	0.91406	3.205	0.58432	D	0.999996	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.68192	0.956;0.956;0.956	T	0.69698	-0.5075	10	0.49607	T	0.09	-4.2361	13.6808	0.62484	0.0:0.0:1.0:0.0	.	159;174;159	B3KM97;B3KSQ1;Q9NZ01	.;.;TECR_HUMAN	H	159;174	ENSP00000215567:R159H;ENSP00000397206:R174H	ENSP00000215567:R159H	R	+	2	0	TECR	14536086	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.830000	0.69324	1.875000	0.54330	0.455000	0.32223	CGC		0.652	TECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466000.1	NM_138501		Missense_Mutation
ZNF536	9745	broad.mit.edu	37	19	31039137	31039137	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr19:31039137G>C	ENST00000355537.3	+	4	2758	c.2611G>C	c.(2611-2613)Ggg>Cgg	p.G871R		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	871					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.G871R(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGATCACTCGGGGCAGGCCAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	19											70.0	74.0	72.0					19																	31039137		2203	4300	6503	35730977	SO:0001583	missense	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2611G>C	19.37:g.31039137G>C	ENSP00000347730:p.Gly871Arg		35730977	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	1.482	-0.556844	0.03967	.	.	ENSG00000198597	ENST00000355537	T	0.07567	3.18	5.71	5.71	0.89125	.	0.276358	0.41823	N	0.000805	T	0.15003	0.0362	N	0.14661	0.345	0.53005	D	0.999966	D;D	0.71674	0.998;0.998	P;P	0.62649	0.905;0.905	T	0.16305	-1.0407	10	0.36615	T	0.2	-28.5431	19.8413	0.96690	0.0:0.0:1.0:0.0	.	871;871	A7E228;O15090	.;ZN536_HUMAN	R	871	ENSP00000347730:G871R	ENSP00000347730:G871R	G	+	1	0	ZNF536	35730977	1.000000	0.71417	0.270000	0.24601	0.033000	0.12548	4.345000	0.59360	2.705000	0.92388	0.579000	0.79373	GGG		0.582	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		Missense_Mutation
KIAA0355	9710	broad.mit.edu	37	19	34833276	34833276	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr19:34833276C>T	ENST00000299505.6	+	10	3310	c.2437C>T	c.(2437-2439)Cct>Tct	p.P813S		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	813								p.P813S(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					GCCGCAGGGACCTAGAAATAA	0.502																																																1	Substitution - Missense(1)	ovary(1)	19											160.0	168.0	165.0					19																	34833276		2203	4300	6503	39525116	SO:0001583	missense	9710				CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.2437C>T	19.37:g.34833276C>T	ENSP00000299505:p.Pro813Ser		39525116	Q2M3W4	Missense_Mutation	SNP	ENST00000299505.6	37	CCDS12436.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695153	0.88830	.	.	ENSG00000166398	ENST00000299505	T	0.31769	1.48	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.45637	0.1352	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.45673	-0.9245	10	0.87932	D	0	-12.1428	18.4893	0.90841	0.0:1.0:0.0:0.0	.	813	O15063	K0355_HUMAN	S	813	ENSP00000299505:P813S	ENSP00000299505:P813S	P	+	1	0	KIAA0355	39525116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.584000	0.67490	2.614000	0.88457	0.655000	0.94253	CCT		0.502	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686		Missense_Mutation
FCGBP	8857	broad.mit.edu	37	19	40368417	40368417	+	Missense_Mutation	SNP	C	C	T	rs547191912		TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr19:40368417C>T	ENST00000221347.6	-	28	12938	c.12931G>A	c.(12931-12933)Gtc>Atc	p.V4311I		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4311						extracellular vesicular exosome (GO:0070062)		p.V4311I(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCCATGCAGACGTCCAGAACA	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		24316	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19											136.0	139.0	138.0					19																	40368417		2203	4297	6500	45060257	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12931G>A	19.37:g.40368417C>T	ENSP00000221347:p.Val4311Ile		45060257	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	10.61	1.399284	0.25291	.	.	ENSG00000090920	ENST00000221347	T	0.78003	-1.14	4.08	3.02	0.34903	Uncharacterised domain, cysteine-rich (2);	0.260617	0.31167	U	0.008139	T	0.71013	0.3290	M	0.65498	2.005	0.22240	N	0.999265	P	0.38395	0.629	B	0.30401	0.115	T	0.62459	-0.6850	10	0.34782	T	0.22	.	13.1363	0.59411	0.0:0.8378:0.1622:0.0	.	4311	Q9Y6R7	FCGBP_HUMAN	I	4311	ENSP00000221347:V4311I	ENSP00000221347:V4311I	V	-	1	0	FCGBP	45060257	0.000000	0.05858	0.992000	0.48379	0.728000	0.41692	-0.064000	0.11636	1.042000	0.40150	0.305000	0.20034	GTC		0.622	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		Missense_Mutation
FUT1	2523	broad.mit.edu	37	19	49253511	49253511	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr19:49253511G>A	ENST00000310160.3	-	4	2002	c.1028C>T	c.(1027-1029)gCg>gTg	p.A343V	FUT1_ENST00000601931.1_5'Flank	NM_000148.3	NP_000139.1	P19526	FUT1_HUMAN	fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)	343					carbohydrate metabolic process (GO:0005975)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)	p.A343V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(3)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		CAGGAAGGCCGCCTCCGGCTT	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											40.0	38.0	39.0					19																	49253511		2203	4300	6503	53945323	SO:0001583	missense	2523				CCDS12733.1	19q13.33	2014-07-19	2006-01-19		ENSG00000174951	ENSG00000174951	2.4.1.69	"""Blood group antigens"", ""Fucosyltransferases"""	4012	protein-coding gene	gene with protein product		211100	"""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, Bombay phenotype included)"", ""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase)"""	H, HSC			Standard	NM_000148		Approved		uc002pkk.3	P19526		ENST00000310160.3:c.1028C>T	19.37:g.49253511G>A	ENSP00000312021:p.Ala343Val		53945323	O14505|O14506|O14507	Missense_Mutation	SNP	ENST00000310160.3	37	CCDS12733.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	15.93	2.979560	0.53827	.	.	ENSG00000174951	ENST00000310160;ENST00000539428	D	0.97089	-4.24	4.69	4.69	0.59074	.	0.000000	0.64402	D	0.000016	D	0.98488	0.9496	M	0.86740	2.835	0.42134	D	0.991485	D	0.89917	1.0	D	0.91635	0.999	D	0.99470	1.0945	10	0.87932	D	0	-3.8309	15.4994	0.75684	0.0:0.0:1.0:0.0	.	343	P19526	FUT1_HUMAN	V	343;333	ENSP00000312021:A343V	ENSP00000312021:A343V	A	-	2	0	FUT1	53945323	0.999000	0.42202	0.373000	0.26003	0.060000	0.15804	5.751000	0.68720	2.619000	0.88677	0.561000	0.74099	GCG		0.567	FUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466194.1	NM_000148		Missense_Mutation
CCNT2	905	broad.mit.edu	37	2	135711833	135711833	+	Missense_Mutation	SNP	T	T	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr2:135711833T>G	ENST00000264157.5	+	9	1838	c.1808T>G	c.(1807-1809)gTt>gGt	p.V603G	CCNT2_ENST00000295238.6_Missense_Mutation_p.V603G|CCNT2_ENST00000537343.1_Missense_Mutation_p.V428G	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	603					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.V603G(1)		endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		AGGAGTCCTGTTGGCCTGAGC	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											127.0	117.0	120.0					2																	135711833		2203	4300	6503	135428303	SO:0001583	missense	905			AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.1808T>G	2.37:g.135711833T>G	ENSP00000264157:p.Val603Gly		135428303	A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Missense_Mutation	SNP	ENST00000264157.5	37	CCDS2174.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	8.917	0.960094	0.18507	.	.	ENSG00000082258	ENST00000537343;ENST00000295238;ENST00000264157	T;T	0.23147	1.92;1.92	5.58	4.43	0.53597	.	0.378279	0.29972	N	0.010735	T	0.19846	0.0477	L	0.44542	1.39	0.52099	D	0.999945	B;B;B	0.31548	0.161;0.22;0.328	B;B;B	0.31101	0.079;0.054;0.124	T	0.03684	-1.1013	10	0.15499	T	0.54	.	10.9291	0.47207	0.0:0.0728:0.0:0.9272	.	428;603;603	B4DH21;O60583;O60583-2	.;CCNT2_HUMAN;.	G	428;603;603	ENSP00000295238:V603G;ENSP00000264157:V603G	ENSP00000264157:V603G	V	+	2	0	CCNT2	135428303	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	3.587000	0.53957	2.131000	0.65755	0.533000	0.62120	GTT		0.532	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254629.1	NM_058241		Missense_Mutation
SCN2A	6326	broad.mit.edu	37	2	166172150	166172150	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr2:166172150A>G	ENST00000375437.2	+	11	1843	c.1553A>G	c.(1552-1554)gAg>gGg	p.E518G	SCN2A_ENST00000375427.2_Missense_Mutation_p.E518G|SCN2A_ENST00000283256.6_Missense_Mutation_p.E518G|SCN2A_ENST00000357398.3_Missense_Mutation_p.E518G	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	518					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.E518G(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ggagaagaagagaaaaATGAC	0.378																																																1	Substitution - Missense(1)	ovary(1)	2											50.0	52.0	52.0					2																	166172150		2203	4300	6503	165880396	SO:0001583	missense	6326			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1553A>G	2.37:g.166172150A>G	ENSP00000364586:p.Glu518Gly		165880396	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	12.98	2.101054	0.37048	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5	5.9	5.9	0.94986	Domain of unknown function DUF3451 (1);	0.903868	0.09580	N	0.782983	D	0.95733	0.8612	M	0.85373	2.75	0.44946	D	0.997961	B;B	0.22211	0.0;0.066	B;B	0.32928	0.002;0.155	D	0.90640	0.4574	9	.	.	.	.	16.0056	0.80359	1.0:0.0:0.0:0.0	.	518;518	Q99250-2;Q99250	.;SCN2A_HUMAN	G	518	ENSP00000364586:E518G;ENSP00000349973:E518G;ENSP00000283256:E518G;ENSP00000364576:E518G	.	E	+	2	0	SCN2A	165880396	0.979000	0.34478	1.000000	0.80357	0.855000	0.48748	2.335000	0.43929	2.251000	0.74343	0.528000	0.53228	GAG		0.378	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007		Missense_Mutation
SMARCAL1	50485	broad.mit.edu	37	2	217332751	217332751	+	Silent	SNP	G	G	A	rs2271335	byFrequency	TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr2:217332751G>A	ENST00000357276.4	+	14	2556	c.2226G>A	c.(2224-2226)acG>acA	p.T742T	SMARCAL1_ENST00000358207.5_Silent_p.T742T	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	742	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.		T -> M (in dbSNP:rs2271336).		cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)	p.T742T(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		ACGCAATTACGCAAGAGCTTG	0.438									Schimke Immuno-Osseous Dysplasia				G|||	7	0.00139776	0.0	0.0	5008	,	,		19641	0.001		0.0	False		,,,				2504	0.0061															1	Substitution - coding silent(1)	ovary(1)	2											135.0	128.0	131.0					2																	217332751		2203	4300	6503	217040996	SO:0001819	synonymous_variant	50485	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2226G>A	2.37:g.217332751G>A			217040996	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Silent	SNP	ENST00000357276.4	37	CCDS2403.1	SNP	38	Broad																																																																																				0.438	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2			Silent
SLC11A1	6556	broad.mit.edu	37	2	219257824	219257824	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr2:219257824G>A	ENST00000233202.6	+	12	1625	c.1285G>A	c.(1285-1287)Gat>Aat	p.D429N	SLC11A1_ENST00000539932.1_Missense_Mutation_p.D311N	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	429					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)	p.D429N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGCCTCAATGATCTGCTCAA	0.657																																																1	Substitution - Missense(1)	ovary(1)	2											87.0	65.0	73.0					2																	219257824		2203	4300	6503	218966068	SO:0001583	missense	6556			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.1285G>A	2.37:g.219257824G>A	ENSP00000233202:p.Asp429Asn		218966068	C0H5Y3	Missense_Mutation	SNP	ENST00000233202.6	37	CCDS2415.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047902	0.75846	.	.	ENSG00000018280	ENST00000233202;ENST00000539932	T;T	0.69561	-0.41;-0.41	4.6	4.6	0.57074	.	0.000000	0.64402	D	0.000002	T	0.75752	0.3892	L	0.45698	1.435	0.80722	D	1	D;P	0.64830	0.994;0.93	D;P	0.63381	0.914;0.861	T	0.78537	-0.2166	10	0.66056	D	0.02	-29.8657	17.6413	0.88137	0.0:0.0:1.0:0.0	.	311;429	C0H5Y3;P49279	.;NRAM1_HUMAN	N	429;311	ENSP00000233202:D429N;ENSP00000443435:D311N	ENSP00000233202:D429N	D	+	1	0	SLC11A1	218966068	1.000000	0.71417	0.988000	0.46212	0.007000	0.05969	9.193000	0.94954	2.396000	0.81511	0.563000	0.77884	GAT		0.657	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578		Missense_Mutation
COL4A4	1286	broad.mit.edu	37	2	227898182	227898182	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr2:227898182G>A	ENST00000396625.3	-	38	3728	c.3521C>T	c.(3520-3522)cCt>cTt	p.P1174L	COL4A4_ENST00000329662.7_Missense_Mutation_p.P1174L	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1174	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.P1174L(1)		breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		GTTCAGGCCAGGTGATCCGGA	0.532											OREG0015250	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	2											53.0	55.0	54.0					2																	227898182		1948	4158	6106	227606426	SO:0001583	missense	1286				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.3521C>T	2.37:g.227898182G>A	ENSP00000379866:p.Pro1174Leu	2323	227606426	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	CCDS42828.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	14.75	2.627365	0.46944	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.96685	-4.09;-4.09	5.36	5.36	0.76844	.	.	.	.	.	D	0.98009	0.9344	M	0.82323	2.585	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.98450	1.0591	9	0.62326	D	0.03	.	14.5865	0.68328	0.0:0.0:1.0:0.0	.	1174	P53420	CO4A4_HUMAN	L	1174	ENSP00000379866:P1174L;ENSP00000328553:P1174L	ENSP00000328553:P1174L	P	-	2	0	COL4A4	227606426	0.998000	0.40836	0.175000	0.22980	0.008000	0.06430	5.281000	0.65609	2.521000	0.84997	0.650000	0.86243	CCT		0.532	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092		Missense_Mutation
SLC19A3	80704	broad.mit.edu	37	2	228564085	228564085	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr2:228564085C>A	ENST00000258403.3	-	3	417	c.346G>T	c.(346-348)Gtc>Ttc	p.V116F	SLC19A3_ENST00000409287.1_Intron|SLC19A3_ENST00000541617.1_Missense_Mutation_p.V112F	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	116					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.V116F(1)		breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	GCGGCGGTGACCATCCCATAG	0.552																																																1	Substitution - Missense(1)	ovary(1)	2											98.0	97.0	97.0					2																	228564085		2203	4300	6503	228272329	SO:0001583	missense	80704			AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.346G>T	2.37:g.228564085C>A	ENSP00000258403:p.Val116Phe		228272329		Missense_Mutation	SNP	ENST00000258403.3	37	CCDS2468.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	14.94	2.686225	0.47991	.	.	ENSG00000135917	ENST00000258403;ENST00000541617;ENST00000456524	T;T;T	0.80033	-1.33;-1.33;0.38	5.8	5.8	0.92144	Major facilitator superfamily domain, general substrate transporter (1);	0.173169	0.49916	D	0.000121	T	0.74581	0.3735	L	0.38649	1.16	0.80722	D	1	B;B	0.33044	0.092;0.395	B;B	0.40009	0.077;0.316	T	0.68232	-0.5463	10	0.08837	T	0.75	-29.8901	14.8391	0.70209	0.1438:0.8562:0.0:0.0	.	112;116	F5H2M8;Q9BZV2	.;S19A3_HUMAN	F	116;112;116	ENSP00000258403:V116F;ENSP00000445519:V112F;ENSP00000399001:V116F	ENSP00000258403:V116F	V	-	1	0	SLC19A3	228272329	0.987000	0.35691	0.143000	0.22291	0.362000	0.29581	3.138000	0.50570	2.749000	0.94314	0.655000	0.94253	GTC		0.552	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1			Missense_Mutation
SP140	11262	broad.mit.edu	37	2	231110601	231110601	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr2:231110601A>G	ENST00000392045.3	+	7	802	c.688A>G	c.(688-690)Ata>Gta	p.I230V	SP140_ENST00000417495.3_Missense_Mutation_p.I227V|SP140_ENST00000486687.2_Intron|SP140_ENST00000343805.6_Intron|SP140_ENST00000420434.3_Missense_Mutation_p.I230V|SP140_ENST00000350136.5_Missense_Mutation_p.I210V	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	230					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.I230V(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TGCTATACAAATAGATGAAGG	0.383																																																1	Substitution - Missense(1)	ovary(1)	2											126.0	112.0	116.0					2																	231110601		1902	4124	6026	230818845	SO:0001583	missense	11262			U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.688A>G	2.37:g.231110601A>G	ENSP00000375899:p.Ile230Val		230818845	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	37	CCDS42831.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	0.026	-1.371503	0.01225	.	.	ENSG00000079263	ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000420434	T;T;T	0.50813	0.92;0.74;0.73	2.79	-4.69	0.03299	.	.	.	.	.	T	0.18002	0.0432	N	0.08118	0	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.29579	-1.0007	9	0.06494	T	0.89	.	5.264	0.15589	0.3687:0.1773:0.454:0.0	.	230;227;230;230	E7EUR5;E7ESH9;Q13342;E7EX75	.;.;LY10_HUMAN;.	V	230;210;230;227;230	ENSP00000345846:I210V;ENSP00000375899:I230V;ENSP00000398210:I230V	ENSP00000345846:I210V	I	+	1	0	SP140	230818845	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.363000	0.07593	-1.127000	0.02925	-0.400000	0.06385	ATA		0.383	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237		Missense_Mutation
C22orf42	150297	broad.mit.edu	37	22	32545766	32545766	+	Splice_Site	SNP	G	G	C			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr22:32545766G>C	ENST00000382097.3	-	8	728	c.656C>G	c.(655-657)gCa>gGa	p.A219G	C22orf42_ENST00000490640.1_5'UTR	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	219								p.A219G(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						TCTCTCCTTTGCCTGCAATAG	0.353																																																1	Substitution - Missense(1)	ovary(1)	22											33.0	34.0	34.0					22																	32545766		2199	4299	6498	30875766	SO:0001630	splice_region_variant	150297			BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.655-1C>G	22.37:g.32545766G>C			30875766	A4QPH5	Missense_Mutation	SNP	ENST00000382097.3	37	CCDS33639.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	2.644	-0.283462	0.05642	.	.	ENSG00000205856	ENST00000382097	T	0.26373	1.74	0.598	-1.2	0.09554	.	.	.	.	.	T	0.15219	0.0367	N	0.08118	0	0.09310	N	1	P	0.41597	0.756	P	0.48114	0.567	T	0.15578	-1.0432	8	0.87932	D	0	.	.	.	.	.	219	Q6IC83	CV042_HUMAN	G	219	ENSP00000371529:A219G	ENSP00000371529:A219G	A	-	2	0	C22orf42	30875766	0.002000	0.14202	0.001000	0.08648	0.109000	0.19521	-0.362000	0.07602	-1.293000	0.02362	0.064000	0.15345	GCA		0.353	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075268.2	NM_001010859	Missense_Mutation	Missense_Mutation
ARPP21	10777	broad.mit.edu	37	3	35778793	35778793	+	Missense_Mutation	SNP	C	C	T	rs142886822		TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr3:35778793C>T	ENST00000187397.4	+	16	2039	c.1583C>T	c.(1582-1584)cCg>cTg	p.P528L	ARPP21_ENST00000458225.1_Missense_Mutation_p.P494L|ARPP21_ENST00000337271.5_Missense_Mutation_p.P474L|ARPP21_ENST00000444190.1_Missense_Mutation_p.P474L|ARPP21_ENST00000417925.1_Missense_Mutation_p.P494L	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	528	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)	p.P528L(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						CAGCCCTCCCCGCAGCCCCAA	0.647																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	3						C	LEU/PRO	0,4404		0,0,2202	31.0	36.0	34.0		1583	5.0	0.3	3	dbSNP_134	34	2,8590		0,2,4294	no	missense	ARPP21	NM_016300.4	98	0,2,6496	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	528/813	35778793	2,12994	2202	4296	6498	35753797	SO:0001583	missense	10777			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1583C>T	3.37:g.35778793C>T	ENSP00000187397:p.Pro528Leu		35753797	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	CCDS2661.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	14.73	2.623690	0.46840	0.0	2.33E-4	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.81;0.79	5.91	5.04	0.67666	.	0.260094	0.28360	N	0.015626	T	0.37758	0.1015	M	0.62723	1.935	0.51482	D	0.999926	P;P;P;P	0.46621	0.549;0.641;0.881;0.549	B;B;B;B	0.29077	0.077;0.072;0.098;0.052	T	0.35251	-0.9796	10	0.15952	T	0.53	-4.0219	15.1237	0.72465	0.0:0.9324:0.0:0.0676	.	494;16;528;474	Q9UBL0-3;Q9UBL0-5;Q9UBL0;Q9UBL0-4	.;.;ARP21_HUMAN;.	L	494;474;474;528;494	ENSP00000414351:P494L;ENSP00000337792:P474L;ENSP00000405276:P474L;ENSP00000187397:P528L;ENSP00000412326:P494L	ENSP00000187397:P528L	P	+	2	0	ARPP21	35753797	0.344000	0.24827	0.258000	0.24420	0.429000	0.31625	3.849000	0.55910	1.517000	0.48917	-0.140000	0.14226	CCG		0.647	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399		Missense_Mutation
ARL6IP5	10550	broad.mit.edu	37	3	69153673	69153673	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr3:69153673A>C	ENST00000273258.3	+	3	557	c.453A>C	c.(451-453)aaA>aaC	p.K151N	ARL6IP5_ENST00000478935.1_Intron	NM_006407.3	NP_006398.1	O75915	PRAF3_HUMAN	ADP-ribosylation factor-like 6 interacting protein 5	151	Targeting to endoplasmic reticulum membrane. {ECO:0000250}.				intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|L-glutamate transport (GO:0015813)|negative regulation of mitochondrial membrane potential (GO:0010917)|negative regulation of transport (GO:0051051)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of stress-activated MAPK cascade (GO:0032874)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.K151N(1)		biliary_tract(1)|endometrium(1)|large_intestine(2)|ovary(1)|prostate(1)|urinary_tract(1)	7		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.78e-05)|Epithelial(33;0.000818)|LUSC - Lung squamous cell carcinoma(21;0.0118)|Lung(16;0.0189)|KIRC - Kidney renal clear cell carcinoma(39;0.203)|Kidney(39;0.238)		TGGAGAATAAAATGGAAGGAA	0.453																																																1	Substitution - Missense(1)	ovary(1)	3											104.0	96.0	99.0					3																	69153673		2203	4300	6503	69236363	SO:0001583	missense	10550			AF070523	CCDS2912.1	3p14	2014-05-12	2014-05-12		ENSG00000144746	ENSG00000144746			16937	protein-coding gene	gene with protein product	"""PRA1 domain family 3"""	605709				11242046, 11042152	Standard	NM_006407		Approved	PRAF3, JWA, GTRAP3-18, DERP11, HSPC127	uc003dnr.3	O75915	OTTHUMG00000158773	ENST00000273258.3:c.453A>C	3.37:g.69153673A>C	ENSP00000273258:p.Lys151Asn		69236363	B2R6V5|Q53ES3|Q5KU08	Missense_Mutation	SNP	ENST00000273258.3	37	CCDS2912.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	16.46	3.128211	0.56721	.	.	ENSG00000144746	ENST00000273258	T	0.45276	0.9	5.93	0.919	0.19392	.	0.041720	0.85682	D	0.000000	T	0.34571	0.0902	M	0.69463	2.115	0.80722	D	1	P	0.35923	0.528	B	0.35550	0.205	T	0.05053	-1.0909	10	0.33940	T	0.23	-16.7759	5.8647	0.18768	0.4795:0.1401:0.3804:0.0	.	151	O75915	PRAF3_HUMAN	N	151	ENSP00000273258:K151N	ENSP00000273258:K151N	K	+	3	2	ARL6IP5	69236363	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.192000	0.32150	0.140000	0.18849	0.533000	0.62120	AAA		0.453	ARL6IP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352132.1	NM_006407		Missense_Mutation
FILIP1L	11259	broad.mit.edu	37	3	99568055	99568055	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr3:99568055A>G	ENST00000354552.3	-	5	2935	c.2465T>C	c.(2464-2466)gTc>gCc	p.V822A	CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000331335.5_Missense_Mutation_p.V822A|FILIP1L_ENST00000471562.1_Missense_Mutation_p.V582A|CMSS1_ENST00000496116.1_Intron|FILIP1L_ENST00000487087.1_Missense_Mutation_p.V398A|FILIP1L_ENST00000476723.1_Intron|FILIP1L_ENST00000383694.2_Missense_Mutation_p.V582A	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	822						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.V822A(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						ACCATTGATGACTGCACGTTC	0.438																																																1	Substitution - Missense(1)	ovary(1)	3											214.0	198.0	203.0					3																	99568055		1977	4155	6132	101050745	SO:0001583	missense	11259				CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.2465T>C	3.37:g.99568055A>G	ENSP00000346560:p.Val822Ala		101050745	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Missense_Mutation	SNP	ENST00000354552.3	37	CCDS43117.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	1.741	-0.491793	0.04322	.	.	ENSG00000168386	ENST00000354552;ENST00000487087;ENST00000471562;ENST00000331335;ENST00000383694;ENST00000441620;ENST00000495625	T;T;T;T;T;T	0.26373	2.06;1.77;1.75;2.07;1.75;1.74	5.87	5.87	0.94306	.	0.000000	0.47093	D	0.000247	T	0.16128	0.0388	N	0.08118	0	0.35768	D	0.82066	B;B	0.27625	0.183;0.115	B;B	0.26416	0.069;0.031	T	0.18053	-1.0349	10	0.41790	T	0.15	-10.8786	16.2813	0.82687	1.0:0.0:0.0:0.0	.	822;822	Q4L180-2;Q4L180	.;FIL1L_HUMAN	A	822;398;582;822;582;568;582	ENSP00000346560:V822A;ENSP00000417774:V398A;ENSP00000419642:V582A;ENSP00000327880:V822A;ENSP00000373192:V582A;ENSP00000419874:V582A	ENSP00000327880:V822A	V	-	2	0	FILIP1L	101050745	1.000000	0.71417	0.995000	0.50966	0.906000	0.53458	5.287000	0.65645	2.244000	0.73946	0.533000	0.62120	GTC		0.438	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890		Missense_Mutation
TF	7018	broad.mit.edu	37	3	133478059	133478059	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr3:133478059G>T	ENST00000402696.3	+	9	1574	c.1089G>T	c.(1087-1089)tgG>tgT	p.W363C	TF_ENST00000264998.3_Missense_Mutation_p.W236C	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	363	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)	p.W363C(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	CTGTGAAGTGGTGTGCGCTGA	0.502																																																1	Substitution - Missense(1)	ovary(1)	3											170.0	167.0	168.0					3																	133478059		2203	4300	6503	134960749	SO:0001583	missense	7018				CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.1089G>T	3.37:g.133478059G>T	ENSP00000385834:p.Trp363Cys		134960749	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Missense_Mutation	SNP	ENST00000402696.3	37	CCDS3080.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	18.64	3.668124	0.67814	.	.	ENSG00000091513	ENST00000402696;ENST00000264998	T;T	0.57595	0.39;0.39	4.53	4.53	0.55603	.	0.109197	0.64402	D	0.000002	D	0.82692	0.5092	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89466	0.3740	10	0.87932	D	0	-25.4603	16.5466	0.84448	0.0:0.0:1.0:0.0	.	363	P02787	TRFE_HUMAN	C	363;236	ENSP00000385834:W363C;ENSP00000264998:W236C	ENSP00000264998:W236C	W	+	3	0	TF	134960749	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	6.926000	0.75835	2.495000	0.84180	0.462000	0.41574	TGG		0.502	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317775.1	NM_001063		Missense_Mutation
SI	6476	broad.mit.edu	37	3	164709972	164709972	+	Missense_Mutation	SNP	T	T	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr3:164709972T>G	ENST00000264382.3	-	43	5038	c.4976A>C	c.(4975-4977)tAc>tCc	p.Y1659S		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1659	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TACTGTATGGTAGTCAAACCA	0.353										HNSCC(35;0.089)																																						0			3											122.0	129.0	126.0					3																	164709972		2203	4300	6503	166192666	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4976A>C	3.37:g.164709972T>G	ENSP00000264382:p.Tyr1659Ser		166192666	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	16.56	3.156239	0.57259	.	.	ENSG00000090402	ENST00000264382	D	0.91740	-2.9	4.74	2.0	0.26442	.	0.284658	0.35466	N	0.003194	D	0.96116	0.8734	M	0.92691	3.335	0.42989	D	0.994489	D	0.65815	0.995	D	0.77004	0.989	D	0.95472	0.8552	10	0.87932	D	0	.	9.185	0.37165	0.301:0.0:0.0:0.699	.	1659	P14410	SUIS_HUMAN	S	1659	ENSP00000264382:Y1659S	ENSP00000264382:Y1659S	Y	-	2	0	SI	166192666	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	1.449000	0.35123	0.862000	0.35528	0.533000	0.62120	TAC		0.353	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		Missense_Mutation
CSN3	1448	broad.mit.edu	37	4	71114781	71114781	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr4:71114781C>G	ENST00000304954.3	+	4	240	c.154C>G	c.(154-156)Cca>Gca	p.P52A		NM_005212.2	NP_005203.2	Q9UNS2	CSN3_HUMAN	casein kappa	187					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)		p.P52A(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						GTATTATGTGCCAAATAGCTA	0.343																																																1	Substitution - Missense(1)	ovary(1)	4											116.0	115.0	116.0					4																	71114781		2203	4300	6503	71149370	SO:0001583	missense	1448			U51899	CCDS3538.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000171209	ENSG00000171209			2446	protein-coding gene	gene with protein product		601695	"""casein, kappa"""	CSN10		8863730, 9050925	Standard	NM_005212		Approved		uc003hfe.4	P07498	OTTHUMG00000129399	ENST00000304954.3:c.154C>G	4.37:g.71114781C>G	ENSP00000304822:p.Pro52Ala		71149370	B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	ENST00000304954.3	37	CCDS3538.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535973	0.45176	.	.	ENSG00000171209	ENST00000304954	T	0.20881	2.04	4.38	-0.487	0.12060	.	1.189540	0.06263	N	0.694347	T	0.12944	0.0314	N	0.22421	0.69	0.09310	N	1	B	0.27286	0.174	B	0.24006	0.05	T	0.34153	-0.9840	10	0.72032	D	0.01	-19.1112	3.4424	0.07468	0.1926:0.4077:0.0:0.3997	.	52	P07498	CASK_HUMAN	A	52	ENSP00000304822:P52A	ENSP00000304822:P52A	P	+	1	0	CSN3	71149370	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.195000	0.09546	-0.133000	0.11537	0.557000	0.71058	CCA		0.343	CSN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251555.1	NM_005212		Missense_Mutation
HSPA4L	22824	broad.mit.edu	37	4	128751886	128751886	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr4:128751886G>T	ENST00000296464.4	+	18	2671	c.2260G>T	c.(2260-2262)Gca>Tca	p.A754S	HSPA4L_ENST00000508776.1_Missense_Mutation_p.A754S|HSPA4L_ENST00000439123.2_Missense_Mutation_p.A785S|HSPA4L_ENST00000505726.1_Missense_Mutation_p.A728S	NM_014278.2	NP_055093.2	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like	754					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.A754S(1)		central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						TAAGATGAATGCACAGAACAA	0.343																																																1	Substitution - Missense(1)	ovary(1)	4											95.0	95.0	95.0					4																	128751886		2203	4299	6502	128971336	SO:0001583	missense	22824			AB023421	CCDS3734.1	4q28	2011-09-07			ENSG00000164070	ENSG00000164070		"""Heat shock proteins / HSP70"""	17041	protein-coding gene	gene with protein product						10524232	Standard	NM_014278		Approved	APG-1, Osp94, HSPH3	uc003ifm.3	O95757	OTTHUMG00000133302	ENST00000296464.4:c.2260G>T	4.37:g.128751886G>T	ENSP00000296464:p.Ala754Ser		128971336	A2ICT2|Q4W5M5|Q8IWA2	Missense_Mutation	SNP	ENST00000296464.4	37	CCDS3734.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793459	0.50102	.	.	ENSG00000164070	ENST00000508776;ENST00000439123;ENST00000296464;ENST00000505726	T;T;T;T	0.01464	5.0;5.0;5.0;4.86	5.31	5.31	0.75309	.	0.054782	0.64402	D	0.000001	T	0.04998	0.0134	L	0.60957	1.885	0.43334	D	0.995374	B;D	0.63046	0.01;0.992	B;P	0.53006	0.056;0.715	T	0.52411	-0.8579	10	0.30854	T	0.27	.	14.0595	0.64790	0.0:0.0:0.8494:0.1506	.	728;754	E9PDE8;O95757	.;HS74L_HUMAN	S	754;785;754;728	ENSP00000422482:A754S;ENSP00000393926:A785S;ENSP00000296464:A754S;ENSP00000425645:A728S	ENSP00000296464:A754S	A	+	1	0	HSPA4L	128971336	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	3.992000	0.56980	2.763000	0.94921	0.563000	0.77884	GCA		0.343	HSPA4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257096.3	NM_014278		Missense_Mutation
DDO	8528	broad.mit.edu	37	6	110714313	110714313	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr6:110714313C>T	ENST00000368924.3	-	5	790	c.775G>A	c.(775-777)Gta>Ata	p.V259I	DDO_ENST00000368923.3_Missense_Mutation_p.V200I	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	231					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)	p.V259I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		CCTAGGGTTACATGGGATGTA	0.522																																																1	Substitution - Missense(1)	ovary(1)	6											125.0	136.0	132.0					6																	110714313		2203	4300	6503	110821006	SO:0001583	missense	8528			D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.775G>A	6.37:g.110714313C>T	ENSP00000357920:p.Val259Ile		110821006	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Missense_Mutation	SNP	ENST00000368924.3	37	CCDS5082.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	18.88	3.716727	0.68844	.	.	ENSG00000203797	ENST00000368924;ENST00000368923;ENST00000368925	D;D;D	0.82526	-1.62;-1.62;-1.62	5.84	5.84	0.93424	.	0.197986	0.43919	D	0.000504	D	0.86644	0.5982	M	0.64997	1.995	0.58432	D	0.999991	D;D	0.76494	0.999;0.996	D;D	0.69142	0.962;0.922	D	0.86563	0.1842	10	0.51188	T	0.08	-21.8661	13.3587	0.60644	0.0:0.9281:0.0:0.0719	.	200;259	Q99489-4;Q99489-3	.;.	I	259;200;231	ENSP00000357920:V259I;ENSP00000357919:V200I;ENSP00000357921:V231I	ENSP00000357919:V200I	V	-	1	0	DDO	110821006	0.988000	0.35896	0.704000	0.30370	0.463000	0.32649	2.835000	0.48175	2.769000	0.95229	0.563000	0.77884	GTA		0.522	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1			Missense_Mutation
SLC2A12	154091	broad.mit.edu	37	6	134349982	134349982	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr6:134349982C>G	ENST00000275230.5	-	2	1136	c.981G>C	c.(979-981)aaG>aaC	p.K327N		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	327					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.K327N(1)		NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		TGCTAATGACCTTGACGACTC	0.488																																					Melanoma(122;1663 1672 14489 35294 41228)											1	Substitution - Missense(1)	ovary(1)	6											81.0	68.0	73.0					6																	134349982		2203	4300	6503	134391675	SO:0001583	missense	154091			AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.981G>C	6.37:g.134349982C>G	ENSP00000275230:p.Lys327Asn		134391675	B3KV17|Q7Z6U3|Q96MR8	Missense_Mutation	SNP	ENST00000275230.5	37	CCDS5169.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	9.986	1.229537	0.22542	.	.	ENSG00000146411	ENST00000275230	T	0.67698	-0.28	5.16	1.92	0.25849	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.30665	0.0772	N	0.19112	0.55	0.58432	D	0.999993	B	0.27997	0.197	B	0.36464	0.225	T	0.05869	-1.0859	10	0.14252	T	0.57	-20.5346	8.7687	0.34719	0.0:0.6017:0.0:0.3983	.	327	Q8TD20	GTR12_HUMAN	N	327	ENSP00000275230:K327N	ENSP00000275230:K327N	K	-	3	2	SLC2A12	134391675	1.000000	0.71417	1.000000	0.80357	0.286000	0.27126	1.624000	0.37018	0.218000	0.20820	-1.595000	0.00837	AAG		0.488	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042302.1			Missense_Mutation
NXPH1	30010	broad.mit.edu	37	7	8790932	8790932	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr7:8790932A>G	ENST00000405863.1	+	3	1260	c.349A>G	c.(349-351)Aaa>Gaa	p.K117E	NXPH1_ENST00000602349.1_5'UTR|NXPH1_ENST00000497400.1_3'UTR	NM_152745.2	NP_689958.1	P58417	NXPH1_HUMAN	neurexophilin 1	117	III.					extracellular region (GO:0005576)		p.K117E(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|ovary(1)	17		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		CAAGTTTAAGAAAATGTTTGG	0.468																																																1	Substitution - Missense(1)	ovary(1)	7											81.0	78.0	79.0					7																	8790932		1838	4079	5917	8757457	SO:0001583	missense	30010			AB047362	CCDS47540.1	7p22	2003-03-20			ENSG00000122584	ENSG00000122584			20693	protein-coding gene	gene with protein product		604639				9570794	Standard	NM_152745		Approved		uc003srv.3	P58417	OTTHUMG00000151941	ENST00000405863.1:c.349A>G	7.37:g.8790932A>G	ENSP00000384551:p.Lys117Glu		8757457	Q8NB31	Missense_Mutation	SNP	ENST00000405863.1	37	CCDS47540.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	19.35	3.811723	0.70797	.	.	ENSG00000122584	ENST00000405863;ENST00000438764;ENST00000429542	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.81029	0.4738	M	0.83953	2.67	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	D	0.83736	0.0201	9	0.87932	D	0	-15.6341	16.6406	0.85098	1.0:0.0:0.0:0.0	.	117	P58417	NXPH1_HUMAN	E	117	.	ENSP00000384551:K117E	K	+	1	0	NXPH1	8757457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.307000	0.96226	2.326000	0.78906	0.533000	0.62120	AAA		0.468	NXPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324591.1	NM_152745		Missense_Mutation
MCM4	4173	broad.mit.edu	37	8	48883167	48883167	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr8:48883167G>A	ENST00000262105.2	+	11	1740	c.1531G>A	c.(1531-1533)Gac>Aac	p.D511N	MCM4_ENST00000523944.1_Missense_Mutation_p.D511N|MCM4_ENST00000518680.1_3'UTR	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	511	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)	p.D511N(1)		biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				GCTGTGTGGCGACCCTGGTAC	0.552																																																1	Substitution - Missense(1)	ovary(1)	8											112.0	98.0	102.0					8																	48883167		2203	4300	6503	49045720	SO:0001583	missense	4173				CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.1531G>A	8.37:g.48883167G>A	ENSP00000262105:p.Asp511Asn		49045720	Q8NEH1|Q99658	Missense_Mutation	SNP	ENST00000262105.2	37	CCDS6143.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.416122	0.96092	.	.	ENSG00000104738	ENST00000523944;ENST00000262105;ENST00000396826;ENST00000429229;ENST00000520637	T;T;T	0.15139	2.45;2.45;2.45	6.17	6.17	0.99709	ATPase, AAA+ type, core (1);	0.082144	0.85682	D	0.000000	T	0.67230	0.2871	H	0.99682	4.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82037	-0.0656	10	0.87932	D	0	-39.4048	20.8794	0.99867	0.0:0.0:1.0:0.0	.	511;511	B3KMX0;P33991	.;MCM4_HUMAN	N	511;511;498;471;229	ENSP00000430194:D511N;ENSP00000262105:D511N;ENSP00000427875:D229N	ENSP00000262105:D511N	D	+	1	0	MCM4	49045720	1.000000	0.71417	0.995000	0.50966	0.708000	0.40852	9.790000	0.99075	2.941000	0.99782	0.655000	0.94253	GAC		0.552	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377791.1	NM_005914		Missense_Mutation
RB1CC1	9821	broad.mit.edu	37	8	53555086	53555086	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr8:53555086C>A	ENST00000025008.5	-	18	4685	c.4162G>T	c.(4162-4164)Gaa>Taa	p.E1388*	RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Nonsense_Mutation_p.E1388*|RB1CC1_ENST00000435644.2_Nonsense_Mutation_p.E1388*	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1388					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.E1388*(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TTACTGACTTCTTCTTCAAGC	0.408																																					GBM(180;1701 2102 13475 42023 52570)											1	Substitution - Nonsense(1)	ovary(1)	8											109.0	102.0	104.0					8																	53555086		2203	4300	6503	53717639	SO:0001587	stop_gained	9821			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4162G>T	8.37:g.53555086C>A	ENSP00000025008:p.Glu1388*		53717639	Q86YR4|Q8WVU9|Q92601	Nonsense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	48	14.656720	0.99805	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	.	.	.	5.61	4.72	0.59763	.	0.054132	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-10.4334	15.3987	0.74818	0.0:0.8603:0.1397:0.0	.	.	.	.	X	1388	.	ENSP00000025008:E1388X	E	-	1	0	RB1CC1	53717639	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.955000	0.63638	1.321000	0.45227	0.655000	0.94253	GAA		0.408	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781		Nonsense_Mutation
TRPA1	8989	broad.mit.edu	37	8	72973971	72973971	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr8:72973971A>G	ENST00000262209.4	-	7	1040	c.833T>C	c.(832-834)tTt>tCt	p.F278S		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	278					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.F278S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	GGTGGCAGCAAAATGAATGGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	8											152.0	124.0	134.0					8																	72973971		2203	4300	6503	73136525	SO:0001583	missense	8989			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.833T>C	8.37:g.72973971A>G	ENSP00000262209:p.Phe278Ser		73136525	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	25.3	4.619400	0.87460	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.64085	-0.08;-0.08	4.94	4.94	0.65067	Ankyrin repeat-containing domain (4);	0.171885	0.53938	D	0.000057	T	0.78457	0.4286	M	0.84511	2.7	0.80722	D	1	D	0.65815	0.995	D	0.63877	0.919	T	0.78735	-0.2088	10	0.30078	T	0.28	-20.6897	14.7654	0.69634	1.0:0.0:0.0:0.0	.	278	O75762	TRPA1_HUMAN	S	130;278	ENSP00000428151:F130S;ENSP00000262209:F278S	ENSP00000262209:F278S	F	-	2	0	TRPA1	73136525	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.197000	0.89727	2.080000	0.62538	0.533000	0.62120	TTT		0.403	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		Missense_Mutation
TGFBR1	7046	broad.mit.edu	37	9	101900289	101900289	+	Silent	SNP	G	G	T	rs201112150		TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chr9:101900289G>T	ENST00000374994.4	+	4	840	c.723G>T	c.(721-723)tcG>tcT	p.S241S	TGFBR1_ENST00000552516.1_Silent_p.S245S|TGFBR1_ENST00000550253.1_Silent_p.S172S|TGFBR1_ENST00000374990.2_Silent_p.S164S	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	241	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		S -> L (in LDS1). {ECO:0000269|PubMed:16596670, ECO:0000269|PubMed:16791849}.		activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.S241S(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				AAGAACGTTCGTGGTTCCGTG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	9											173.0	168.0	169.0					9																	101900289		2203	4300	6503	100940110	SO:0001819	synonymous_variant	7046				CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.723G>T	9.37:g.101900289G>T			100940110	Q6IR47|Q706C0|Q706C1	Silent	SNP	ENST00000374994.4	37	CCDS6738.1	SNP	40	Broad																																																																																				0.413	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3			Silent
MED12	9968	broad.mit.edu	37	X	70356305	70356305	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chrX:70356305C>T	ENST00000374080.3	+	37	5232	c.5200C>T	c.(5200-5202)Ccc>Tcc	p.P1734S	MED12_ENST00000333646.6_Missense_Mutation_p.P1734S|MED12_ENST00000374102.1_Missense_Mutation_p.P1734S			Q93074	MED12_HUMAN	mediator complex subunit 12	1734	Interaction with CTNNB1 and GLI3.|Pro-rich.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GAGGCCCCGGCCCCGCGCCTA	0.647			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0			X											22.0	27.0	25.0					X																	70356305		1907	4103	6010	70273030	SO:0001583	missense	9968			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.5200C>T	X.37:g.70356305C>T	ENSP00000363193:p.Pro1734Ser		70273030	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	CCDS43970.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	-	16.53	3.149304	0.57151	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072;ENST00000439750	T;T;T;T;T	0.60040	0.23;0.22;0.22;0.22;1.29	4.17	4.17	0.49024	.	0.064020	0.64402	D	0.000005	T	0.59797	0.2220	L	0.49350	1.555	0.80722	D	1	P;P;P;P	0.50156	0.827;0.888;0.932;0.888	B;B;P;B	0.47981	0.424;0.36;0.563;0.36	T	0.66093	-0.6009	10	0.59425	D	0.04	-14.1969	16.2305	0.82341	0.0:1.0:0.0:0.0	.	1734;1581;1734;1734	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	S	1734;1734;1734;1734;1702;479	ENSP00000333125:P1734S;ENSP00000363215:P1734S;ENSP00000363193:P1734S;ENSP00000414203:P1702S;ENSP00000408388:P479S	ENSP00000333125:P1734S	P	+	1	0	MED12	70273030	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.584000	0.82572	2.085000	0.62840	0.529000	0.55759	CCC		0.647	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		Missense_Mutation
TENM1	10178	broad.mit.edu	37	X	124029956	124029956	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chrX:124029956C>G	ENST00000371130.3	-	2	415	c.352G>C	c.(352-354)Gac>Cac	p.D118H	TENM1_ENST00000422452.2_Missense_Mutation_p.D118H	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	118	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.D118H(1)									AGTGCATGGTCAGGTGAGGCA	0.507																																																1	Substitution - Missense(1)	ovary(1)	X											278.0	225.0	243.0					X																	124029956		2203	4300	6503	123857637	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.352G>C	X.37:g.124029956C>G	ENSP00000360171:p.Asp118His		123857637	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	15.53	2.862187	0.51482	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.31510	1.49;1.49	5.56	5.56	0.83823	Teneurin intracellular, N-terminal (2);	0.240686	0.33309	N	0.005054	T	0.30417	0.0764	N	0.22421	0.69	0.47094	D	0.999316	B;B;B	0.32425	0.371;0.371;0.371	B;B;B	0.38985	0.287;0.287;0.287	T	0.14980	-1.0453	10	0.72032	D	0.01	.	18.7885	0.91964	0.0:1.0:0.0:0.0	.	118;118;118	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	H	118	ENSP00000360171:D118H;ENSP00000403954:D118H	ENSP00000360171:D118H	D	-	1	0	ODZ1	123857637	1.000000	0.71417	0.998000	0.56505	0.924000	0.55760	4.575000	0.60908	2.469000	0.83416	0.600000	0.82982	GAC		0.507	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		Missense_Mutation
BCORL1	63035	broad.mit.edu	37	X	129148822	129148822	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chrX:129148822G>A	ENST00000218147.7	+	4	2271	c.2074G>A	c.(2074-2076)Gag>Aag	p.E692K	BCORL1_ENST00000359304.2_Missense_Mutation_p.E692K|BCORL1_ENST00000303743.5_Missense_Mutation_p.E692K|BCORL1_ENST00000540052.1_Missense_Mutation_p.E692K			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	692					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E692K(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CATCTTTCCCGAGATCGTGAG	0.602																																																1	Substitution - Missense(1)	ovary(1)	X											70.0	58.0	62.0					X																	129148822		2203	4300	6503	128976503	SO:0001583	missense	63035			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2074G>A	X.37:g.129148822G>A	ENSP00000218147:p.Glu692Lys		128976503	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	37	CCDS14616.1	SNP	37	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.62|13.62	2.290931|2.290931	0.40494|0.40494	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	T;T;T;T;T|.	0.48522|.	0.83;1.23;0.81;0.83;1.31|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	0.000000|.	0.37178|.	N|.	0.002211|.	T|T	0.44477|0.44477	0.1295|0.1295	N|N	0.24115|0.24115	0.695|0.695	0.30684|0.30684	N|N	0.752011|0.752011	D;D|.	0.76494|.	0.999;0.976|.	P;B|.	0.61201|.	0.885;0.353|.	T|T	0.44832|0.44832	-0.9302|-0.9302	10|5	0.26408|.	T|.	0.33|.	-9.2769|-9.2769	18.0781|18.0781	0.89433|0.89433	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	692;692|.	Q5H9F3-2;Q5H9F3|.	.;BCORL_HUMAN|.	K|Q	692;692;692;692;292|127	ENSP00000218147:E692K;ENSP00000307541:E692K;ENSP00000352253:E692K;ENSP00000437775:E692K;ENSP00000399483:E292K|.	ENSP00000218147:E692K|.	E|R	+|+	1|2	0|0	BCORL1|BCORL1	128976503|128976503	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.333000|0.333000	0.28666|0.28666	4.592000|4.592000	0.61027|0.61027	2.205000|2.205000	0.71048|0.71048	0.436000|0.436000	0.28706|0.28706	GAG|CGA		0.602	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		Missense_Mutation
ATP2B3	492	broad.mit.edu	37	X	152807209	152807209	+	Silent	SNP	C	C	T			TCGA-25-2393-01	TCGA-25-2393-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2393-01	TCGA-25-2393-10	g.chrX:152807209C>T	ENST00000349466.2	+	4	815	c.489C>T	c.(487-489)tcC>tcT	p.S163S	ATP2B3_ENST00000393842.1_Silent_p.S163S|ATP2B3_ENST00000359149.3_Silent_p.S163S|ATP2B3_ENST00000263519.4_Silent_p.S163S|ATP2B3_ENST00000370186.1_Silent_p.S163S|ATP2B3_ENST00000370181.2_Silent_p.S163S			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	163					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.S163S(3)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCTGCTGTCCGTCATCTGTG	0.612																																																3	Substitution - coding silent(3)	ovary(3)	X											122.0	104.0	110.0					X																	152807209		2203	4300	6503	152460403	SO:0001819	synonymous_variant	492			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.489C>T	X.37:g.152807209C>T			152460403	B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	ENST00000349466.2	37	CCDS35440.1	SNP	23	Broad																																																																																				0.612	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949		Silent
