#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ZBTB48	3104	broad.mit.edu	37	1	6647318	6647318	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr1:6647318G>A	ENST00000377674.4	+	6	1349	c.1191G>A	c.(1189-1191)atG>atA	p.M397I		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	397					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M397I(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		AGAGCCACATGATCAAACTTC	0.567																																					Esophageal Squamous(125;1449 1657 4031 29866 49542)											1	Substitution - Missense(1)	ovary(1)	1											78.0	76.0	77.0					1																	6647318		2203	4300	6503	6569905	SO:0001583	missense	3104			BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.1191G>A	1.37:g.6647318G>A	ENSP00000366902:p.Met397Ile		6569905	Q5SY19	Missense_Mutation	SNP	ENST00000377674.4	37	CCDS84.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	15.62	2.888682	0.52014	.	.	ENSG00000204859	ENST00000377674	T	0.15256	2.44	5.21	5.21	0.72293	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.186485	0.64402	D	0.000003	T	0.17066	0.0410	L	0.41492	1.28	0.42886	D	0.99418	B	0.06786	0.001	B	0.17433	0.018	T	0.02444	-1.1158	10	0.87932	D	0	-19.2791	13.8234	0.63336	0.0:0.1531:0.8469:0.0	.	397	P10074	ZBT48_HUMAN	I	397	ENSP00000366902:M397I	ENSP00000366902:M397I	M	+	3	0	ZBTB48	6569905	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.207000	0.77899	2.590000	0.87494	0.561000	0.74099	ATG		0.567	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004193.1	NM_005341		Missense_Mutation
BAI2	576	broad.mit.edu	37	1	32196563	32196563	+	Silent	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr1:32196563C>T	ENST00000373658.3	-	29	4559	c.4218G>A	c.(4216-4218)ctG>ctA	p.L1406L	BAI2_ENST00000257070.4_Silent_p.L1373L|BAI2_ENST00000398542.1_Silent_p.L1306L|BAI2_ENST00000373655.2_Silent_p.L1406L|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000527361.1_Silent_p.L1373L|BAI2_ENST00000398538.1_Silent_p.L1394L|BAI2_ENST00000398556.3_Silent_p.L1321L|BAI2_ENST00000440175.2_Silent_p.L1015L|BAI2_ENST00000398547.1_Silent_p.L1339L	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1406					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L1406L(1)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GGCCCAGCCCCAGGCCCGAGT	0.701																																																1	Substitution - coding silent(1)	ovary(1)	1											27.0	38.0	34.0					1																	32196563		2203	4300	6503	31969150	SO:0001819	synonymous_variant	576			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.4218G>A	1.37:g.32196563C>T			31969150	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Silent	SNP	ENST00000373658.3	37	CCDS346.2	SNP	21	Broad																																																																																				0.701	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703		Silent
RABGGTB	5876	broad.mit.edu	37	1	76260326	76260326	+	Silent	SNP	A	A	G			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr1:76260326A>G	ENST00000319942.3	+	9	1058	c.987A>G	c.(985-987)ctA>ctG	p.L329L	RABGGTB_ENST00000496055.1_3'UTR|MSH4_ENST00000263187.3_5'Flank|RABGGTB_ENST00000535300.1_Silent_p.L155L	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit	329					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)	p.L329L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						AGCCTGAGCTAGTGAGCTAGA	0.368																																																1	Substitution - coding silent(1)	ovary(1)	1											115.0	112.0	113.0					1																	76260326		2203	4300	6503	76032914	SO:0001819	synonymous_variant	5876			U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.987A>G	1.37:g.76260326A>G			76032914	Q92697	Silent	SNP	ENST00000319942.3	37	CCDS669.1	SNP	15	Broad																																																																																				0.368	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026972.1	NM_004582		Silent
ARHGAP29	9411	broad.mit.edu	37	1	94645387	94645387	+	Missense_Mutation	SNP	T	T	C	rs138781972		TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr1:94645387T>C	ENST00000260526.6	-	20	2556	c.2374A>G	c.(2374-2376)Atg>Gtg	p.M792V	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	792	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)	p.M792V(1)		NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCTATACACATATTTGGCCAT	0.308																																																1	Substitution - Missense(1)	ovary(1)	1						T	VAL/MET	2,4404	4.2+/-10.8	0,2,2201	155.0	151.0	152.0		2374	-2.6	0.0	1	dbSNP_134	152	0,8590		0,0,4295	no	missense	ARHGAP29	NM_004815.3	21	0,2,6496	CC,CT,TT		0.0,0.0454,0.0154	benign	792/1262	94645387	2,12994	2203	4295	6498	94417975	SO:0001583	missense	9411				CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.2374A>G	1.37:g.94645387T>C	ENSP00000260526:p.Met792Val		94417975	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	ENST00000260526.6	37	CCDS748.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	6.623	0.483285	0.12581	4.54E-4	0.0	ENSG00000137962	ENST00000260526	T	0.19938	2.11	5.48	-2.57	0.06248	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.873453	0.09480	N	0.796497	T	0.01454	0.0047	N	0.05124	-0.11	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43702	-0.9375	10	0.05959	T	0.93	0.0157	1.5426	0.02558	0.2868:0.3293:0.1001:0.2838	.	792;792	F8VWZ8;Q52LW3	.;RHG29_HUMAN	V	792	ENSP00000260526:M792V	ENSP00000260526:M792V	M	-	1	0	ARHGAP29	94417975	0.000000	0.05858	0.000000	0.03702	0.984000	0.73092	-0.025000	0.12413	-0.090000	0.12462	0.528000	0.53228	ATG		0.308	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815		Missense_Mutation
RABGAP1L	9910	broad.mit.edu	37	1	174927031	174927031	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr1:174927031G>C	ENST00000251507.4	+	21	2611	c.2437G>C	c.(2437-2439)Gta>Cta	p.V813L	RABGAP1L_ENST00000489615.1_Intron|RABGAP1L_ENST00000367686.3_3'UTR|RABGAP1L_ENST00000486220.1_Missense_Mutation_p.V70L|RABGAP1L_ENST00000347255.2_Intron|RABGAP1L_ENST00000367687.1_Intron|RABGAP1L_ENST00000392064.2_Intron|RABGAP1L_ENST00000325589.5_Intron|RABGAP1L_ENST00000478442.1_Missense_Mutation_p.V70L	NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0								p.V813L(1)		NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						CTTTCAGTTTGTATATTTGTA	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											118.0	112.0	114.0					1																	174927031		2203	4300	6503	173193654	SO:0001583	missense	9910			AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000251507.4:c.2437G>C	1.37:g.174927031G>C	ENSP00000251507:p.Val813Leu		173193654	B7ZAA4	Missense_Mutation	SNP	ENST00000251507.4	37	CCDS1314.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544820	0.45280	.	.	ENSG00000152061	ENST00000251507;ENST00000478442;ENST00000486220	T	0.04654	3.58	5.91	5.0	0.66597	.	0.243896	0.39146	N	0.001453	T	0.02571	0.0078	N	0.08118	0	0.80722	D	1	B;B	0.25312	0.002;0.123	B;B	0.18263	0.002;0.021	T	0.54655	-0.8261	10	0.26408	T	0.33	.	7.8181	0.29271	0.215:0.0:0.785:0.0	.	120;813	Q9Y3L8;Q5R372	.;RBG1L_HUMAN	L	813;70;70	ENSP00000251507:V813L	ENSP00000251507:V813L	V	+	1	0	RABGAP1L	173193654	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.492000	0.45311	1.500000	0.48636	0.655000	0.94253	GTA		0.363	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084497.1	NM_001243765		Missense_Mutation
ZBTB18	10472	broad.mit.edu	37	1	244218520	244218520	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr1:244218520C>T	ENST00000358704.4	+	2	1593	c.1444C>T	c.(1444-1446)Cgc>Tgc	p.R482C		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	473					cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R473C(1)									GTGGTGCGAGCGCAGGTTCAC	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											64.0	63.0	64.0					1																	244218520		2203	4300	6503	242285143	SO:0001583	missense	10472			U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1444C>T	1.37:g.244218520C>T	ENSP00000351539:p.Arg482Cys		242285143	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Missense_Mutation	SNP	ENST00000358704.4	37	CCDS1622.1	SNP	27	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.14|17.14	3.313961|3.313961	0.60414|0.60414	.|.	.|.	ENSG00000179456|ENSG00000179456	ENST00000366538|ENST00000358704	.|T	.|0.19806	.|2.12	5.78|5.78	5.78|5.78	0.91487|0.91487	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.43545|0.43545	0.1252|0.1252	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.83275	.|0.996;0.994	T|T	0.20739|0.20739	-1.0266|-1.0266	6|10	0.41790|0.87932	T|D	0.15|0	.|.	14.8071|14.8071	0.69965|0.69965	0.144:0.856:0.0:0.0|0.144:0.856:0.0:0.0	.|.	.|473;482	.|Q99592;Q99592-2	.|ZN238_HUMAN;.	V|C	470|482	.|ENSP00000351539:R482C	ENSP00000355496:A470V|ENSP00000351539:R482C	A|R	+|+	2|1	0|0	ZNF238|ZNF238	242285143|242285143	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.810000|3.810000	0.55613|0.55613	2.749000|2.749000	0.94314|0.94314	0.655000|0.655000	0.94253|0.94253	GCG|CGC		0.602	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768		Missense_Mutation
ANKRD30A	91074	broad.mit.edu	37	10	37430974	37430974	+	Silent	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr10:37430974C>T	ENST00000602533.1	+	7	1080	c.981C>T	c.(979-981)atC>atT	p.I327I	ANKRD30A_ENST00000361713.1_Silent_p.I327I|ANKRD30A_ENST00000374660.1_Silent_p.I327I			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	383					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I327I(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CTAGGAAGATCGCATGGGAGA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	10											113.0	112.0	112.0					10																	37430974		1840	4092	5932	37470980	SO:0001819	synonymous_variant	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.981C>T	10.37:g.37430974C>T			37470980	Q5W025	Silent	SNP	ENST00000602533.1	37		SNP	31	Broad																																																																																				0.433	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		Silent
MADD	8567	broad.mit.edu	37	11	47333346	47333346	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr11:47333346G>C	ENST00000311027.5	+	29	4387	c.4222G>C	c.(4222-4224)Gtg>Ctg	p.V1408L	MADD_ENST00000349238.3_Missense_Mutation_p.V1369L|MADD_ENST00000395336.3_Missense_Mutation_p.V1408L|MADD_ENST00000395344.3_Missense_Mutation_p.V1302L|MADD_ENST00000402799.1_Missense_Mutation_p.V1306L|MADD_ENST00000406482.1_Missense_Mutation_p.V1306L|MADD_ENST00000342922.4_Missense_Mutation_p.V1349L|MADD_ENST00000405573.2_Missense_Mutation_p.V218L|MADD_ENST00000402192.2_Missense_Mutation_p.V1348L|MADD_ENST00000407859.3_Missense_Mutation_p.V1326L	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.V1408L(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		CATTGGGCTTGTGTACAGCCA	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											107.0	94.0	99.0					11																	47333346		2201	4298	6499	47289922	SO:0001583	missense	8567			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4222G>C	11.37:g.47333346G>C	ENSP00000310933:p.Val1408Leu		47289922		Missense_Mutation	SNP	ENST00000311027.5	37	CCDS7930.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.79	2.640834	0.47153	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.46063	3.45;3.31;3.32;3.44;3.45;3.32;3.32;3.45;3.45;0.88	5.14	4.23	0.50019	.	0.348813	0.29745	N	0.011313	T	0.29556	0.0737	L	0.27053	0.805	0.44956	D	0.997979	B;B;B;B;B;B;B;B;B;B;B	0.10296	0.003;0.001;0.001;0.0;0.0;0.001;0.002;0.0;0.001;0.0;0.0	B;B;B;B;B;B;B;B;B;B;B	0.14578	0.011;0.003;0.003;0.003;0.002;0.006;0.006;0.003;0.006;0.001;0.002	T	0.06303	-1.0834	10	0.41790	T	0.15	-8.9646	10.2108	0.43138	0.0724:0.0:0.7926:0.135	.	218;1302;1302;1408;1306;1306;1306;1369;1326;1408;1349	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	L	1349;1306;1306;1306;1369;1408;1326;1302;1408;1348;218	ENSP00000343902:V1349L;ENSP00000385585:V1306L;ENSP00000384435:V1306L;ENSP00000304505:V1369L;ENSP00000310933:V1408L;ENSP00000384204:V1326L;ENSP00000378753:V1302L;ENSP00000378745:V1408L;ENSP00000384287:V1348L;ENSP00000384483:V218L	ENSP00000310933:V1408L	V	+	1	0	MADD	47289922	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.857000	0.48349	1.149000	0.42402	0.563000	0.77884	GTG		0.498	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1			Missense_Mutation
OR4C15	81309	broad.mit.edu	37	11	55322677	55322677	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr11:55322677G>C	ENST00000314644.2	+	1	895	c.895G>C	c.(895-897)Gtt>Ctt	p.V299L		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V299L(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TCACATTGCTGTTGTGATTTT	0.423										HNSCC(20;0.049)																																						1	Substitution - Missense(1)	ovary(1)	11											243.0	234.0	237.0					11																	55322677		2201	4296	6497	55079253	SO:0001583	missense	81309			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.895G>C	11.37:g.55322677G>C	ENSP00000324958:p.Val299Leu		55079253	Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	CCDS31501.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026795	0.54683	.	.	ENSG00000181939	ENST00000314644	T	0.00216	8.53	5.02	3.1	0.35709	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00724	0.0024	H	0.96748	3.875	0.22521	N	0.999025	P	0.51537	0.946	P	0.59595	0.86	T	0.22417	-1.0217	9	0.87932	D	0	.	8.7055	0.34351	0.1942:0.0:0.8058:0.0	.	245	Q8NGM1	OR4CF_HUMAN	L	299	ENSP00000324958:V299L	ENSP00000324958:V299L	V	+	1	0	OR4C15	55079253	0.000000	0.05858	0.698000	0.30274	0.649000	0.38597	0.692000	0.25482	0.662000	0.31006	0.385000	0.25706	GTT		0.423	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		Missense_Mutation
MTA2	9219	broad.mit.edu	37	11	62365832	62365832	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr11:62365832C>A	ENST00000278823.2	-	5	728	c.339G>T	c.(337-339)gaG>gaT	p.E113D	MTA2_ENST00000527204.1_5'UTR|MTA2_ENST00000524902.1_5'UTR	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	113	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.E113D(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						AGATATCTGTCTCATTCAAGA	0.522																																																1	Substitution - Missense(1)	ovary(1)	11											324.0	351.0	342.0					11																	62365832		2202	4299	6501	62122408	SO:0001583	missense	9219			AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.339G>T	11.37:g.62365832C>A	ENSP00000278823:p.Glu113Asp		62122408	Q68DB1|Q9UQB5	Missense_Mutation	SNP	ENST00000278823.2	37	CCDS8022.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158001	0.78114	.	.	ENSG00000149480	ENST00000278823	D	0.84730	-1.89	5.73	2.75	0.32379	Bromo adjacent homology (BAH) domain (3);	0.000000	0.85682	D	0.000000	D	0.88514	0.6457	M	0.66506	2.035	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	D	0.84732	0.0746	10	0.28530	T	0.3	-24.407	7.4762	0.27378	0.0:0.6357:0.0:0.3643	.	113	O94776	MTA2_HUMAN	D	113	ENSP00000278823:E113D	ENSP00000278823:E113D	E	-	3	2	MTA2	62122408	0.999000	0.42202	1.000000	0.80357	0.991000	0.79684	0.626000	0.24492	0.727000	0.32360	0.655000	0.94253	GAG		0.522	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395578.1	NM_004739		Missense_Mutation
CDC42BPG	55561	broad.mit.edu	37	11	64609296	64609296	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr11:64609296C>G	ENST00000342711.5	-	2	240	c.241G>C	c.(241-243)Gcc>Ccc	p.A81P		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)									p.A81P(1)		central_nervous_system(1)|lung(3)	4						TCCCCAAAGGCTCCTCGGCCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	11											85.0	79.0	81.0					11																	64609296		2201	4297	6498	64365872	SO:0001583	missense	55561			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.241G>C	11.37:g.64609296C>G	ENSP00000345133:p.Ala81Pro		64365872		Missense_Mutation	SNP	ENST00000342711.5	37	CCDS31601.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	25.8	4.674311	0.88445	.	.	ENSG00000171219	ENST00000342711	T	0.27256	1.68	4.46	4.46	0.54185	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000047	T	0.60051	0.2239	M	0.92122	3.275	0.58432	D	0.999997	D	0.71674	0.998	D	0.79108	0.992	T	0.71504	-0.4573	10	0.87932	D	0	.	15.4095	0.74905	0.0:1.0:0.0:0.0	.	81	Q6DT37	MRCKG_HUMAN	P	81	ENSP00000345133:A81P	ENSP00000345133:A81P	A	-	1	0	CDC42BPG	64365872	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.711000	0.68400	2.429000	0.82318	0.555000	0.69702	GCC		0.622	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516		Missense_Mutation
FDXACB1	91893	broad.mit.edu	37	11	111749785	111749785	+	Silent	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr11:111749785C>T	ENST00000260257.4	-	1	119	c.72G>A	c.(70-72)ctG>ctA	p.L24L	FDXACB1_ENST00000542429.1_5'UTR|C11orf1_ENST00000529270.1_5'Flank|C11orf1_ENST00000530214.1_5'Flank|ALG9_ENST00000527377.1_5'Flank|ALG9_ENST00000524880.1_Silent_p.L24L|C11orf1_ENST00000260276.3_5'Flank|C11orf1_ENST00000528125.1_Intron	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1	24					phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)	p.E40E(1)|p.L24L(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						TGCTCTGATCCAGGGTTTCGC	0.667											OREG0021330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				2	Substitution - coding silent(2)	ovary(2)	11											30.0	39.0	36.0					11																	111749785		1983	4174	6157	111254995	SO:0001819	synonymous_variant	91893				CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795	ENST00000260257.4:c.72G>A	11.37:g.111749785C>T		1437	111254995	A0PJW7|B4DUU2	Silent	SNP	ENST00000260257.4	37	CCDS44729.1	SNP	21	Broad																																																																																				0.667	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391497.1	NM_138378		Silent
GALNT6	11226	broad.mit.edu	37	12	51748228	51748228	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr12:51748228C>T	ENST00000543196.2	-	11	2009	c.1804G>A	c.(1804-1806)Gac>Aac	p.D602N	GALNT6_ENST00000356317.3_Missense_Mutation_p.D602N			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	602	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.D602N(1)		endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GGCTTTTTGTCCTGGGATGTC	0.542																																																1	Substitution - Missense(1)	ovary(1)	12											91.0	84.0	87.0					12																	51748228		2203	4300	6503	50034495	SO:0001583	missense	11226			Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.1804G>A	12.37:g.51748228C>T	ENSP00000444171:p.Asp602Asn		50034495	Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	SNP	ENST00000543196.2	37	CCDS8813.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	8.594	0.885237	0.17540	.	.	ENSG00000139629	ENST00000543196;ENST00000356317;ENST00000546163	T;T	0.26373	1.74;1.74	4.18	1.35	0.21983	Ricin B-related lectin (1);Ricin B lectin (3);	0.343051	0.32868	N	0.005554	T	0.11410	0.0278	N	0.14661	0.345	0.09310	N	1	P	0.36086	0.536	B	0.36608	0.229	T	0.22208	-1.0223	10	0.17369	T	0.5	.	5.0895	0.14700	0.1663:0.6506:0.0:0.1831	.	602	Q8NCL4	GALT6_HUMAN	N	602;602;583	ENSP00000444171:D602N;ENSP00000348668:D602N	ENSP00000348668:D602N	D	-	1	0	GALNT6	50034495	0.000000	0.05858	0.024000	0.17045	0.487000	0.33371	0.410000	0.21098	0.306000	0.22856	0.561000	0.74099	GAC		0.542	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210		Missense_Mutation
SMARCC2	6601	broad.mit.edu	37	12	56568498	56568498	+	Missense_Mutation	SNP	T	T	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr12:56568498T>A	ENST00000267064.4	-	16	1519	c.1433A>T	c.(1432-1434)cAa>cTa	p.Q478L	SMARCC2_ENST00000550164.1_Missense_Mutation_p.Q478L|SMARCC2_ENST00000394023.3_Missense_Mutation_p.Q478L|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000347471.4_Missense_Mutation_p.Q478L	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	478	SWIRM. {ECO:0000255|PROSITE- ProRule:PRU00247}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.Q478L(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			AAGATACTCTTGGGGGTTCAG	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											124.0	124.0	124.0					12																	56568498		2203	4300	6503	54854765	SO:0001583	missense	6601			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.1433A>T	12.37:g.56568498T>A	ENSP00000267064:p.Gln478Leu		54854765	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	37	CCDS8907.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	22.7	4.330146	0.81690	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T	0.46819	0.88;0.89;0.86	4.15	4.15	0.48705	Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);SWIRM (2);	0.063541	0.64402	D	0.000006	T	0.54967	0.1891	L	0.33485	1.01	0.58432	D	0.999991	P;P;P;P;P	0.49559	0.925;0.908;0.925;0.925;0.908	D;P;D;D;P	0.65140	0.932;0.888;0.932;0.932;0.888	T	0.56872	-0.7907	10	0.54805	T	0.06	-4.2271	13.1349	0.59403	0.0:0.0:0.0:1.0	.	367;478;483;478;478	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	L	478	ENSP00000449396:Q478L;ENSP00000302919:Q478L;ENSP00000267064:Q478L	ENSP00000267064:Q478L	Q	-	2	0	SMARCC2	54854765	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	7.828000	0.86729	2.109000	0.64355	0.460000	0.39030	CAA		0.478	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1			Missense_Mutation
HCAR3	8843	broad.mit.edu	37	12	123200237	123200237	+	Missense_Mutation	SNP	C	C	T	rs201835480	byFrequency	TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr12:123200237C>T	ENST00000528880.2	-	1	1202	c.1048G>A	c.(1048-1050)Ggt>Agt	p.G350S	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	350			G -> S.		G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G350S(1)		endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	CATGGCTCACCGGAGTTGGCG	0.542													c|||	17	0.00339457	0.0129	0.0	5008	,	,		14630	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	12						C	SER/GLY	27,4379	33.5+/-64.1	0,27,2176	65.0	73.0	70.0		1048	-6.0	0.0	12		70	1,8599	1.2+/-3.3	0,1,4299	no	missense	HCAR3	NM_006018.2	56	0,28,6475	TT,TC,CC		0.0116,0.6128,0.2153	benign	350/388	123200237	28,12978	2203	4300	6503	121766190	SO:0001583	missense	8843			D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.1048G>A	12.37:g.123200237C>T	ENSP00000436714:p.Gly350Ser		121766190	A8K4G5|B2R830|E9PI97|Q8NGE4	Missense_Mutation	SNP	ENST00000528880.2	37	CCDS53842.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	c	2.124	-0.400665	0.04865	0.006128	1.16E-4	ENSG00000255398	ENST00000528880	T	0.61274	0.12	2.99	-5.98	0.02220	.	.	.	.	.	T	0.21347	0.0514	N	0.12182	0.205	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.11743	-1.0575	9	0.11794	T	0.64	.	5.9683	0.19338	0.2171:0.195:0.0:0.5878	.	350	E9PI97	.	S	350	ENSP00000436714:G350S	ENSP00000436714:G350S	G	-	1	0	HCAR3	121766190	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	-3.613000	0.00414	-3.183000	0.00221	-1.206000	0.01644	GGT		0.542	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387549.2	NM_006018		Missense_Mutation
SPERT	220082	broad.mit.edu	37	13	46287930	46287930	+	Missense_Mutation	SNP	T	T	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr13:46287930T>A	ENST00000310521.1	+	3	850	c.770T>A	c.(769-771)cTg>cAg	p.L257Q	SPERT_ENST00000378966.3_Missense_Mutation_p.L221Q	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	257						cytoplasmic membrane-bounded vesicle (GO:0016023)		p.L257Q(1)		NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		AATCGCGCGCTGCAGCAGCTG	0.692																																																1	Substitution - Missense(1)	ovary(1)	13											18.0	15.0	16.0					13																	46287930		2188	4287	6475	45185931	SO:0001583	missense	220082			AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.770T>A	13.37:g.46287930T>A	ENSP00000309189:p.Leu257Gln		45185931	A8K8I5|Q8NHV2	Missense_Mutation	SNP	ENST00000310521.1	37	CCDS9399.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	19.62	3.862575	0.71949	.	.	ENSG00000174015	ENST00000310521;ENST00000378966	T;T	0.67171	-0.25;-0.17	5.27	5.27	0.74061	.	0.149785	0.31031	N	0.008391	T	0.72875	0.3515	L	0.32530	0.975	0.31444	N	0.671603	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.76361	-0.2987	10	0.87932	D	0	.	12.6638	0.56830	0.0:0.0:0.0:1.0	.	221;257	Q8NA61-2;Q8NA61	.;SPERT_HUMAN	Q	257;221	ENSP00000309189:L257Q;ENSP00000368249:L221Q	ENSP00000309189:L257Q	L	+	2	0	SPERT	45185931	0.950000	0.32346	1.000000	0.80357	0.874000	0.50279	2.712000	0.47186	2.208000	0.71279	0.533000	0.62120	CTG		0.692	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044786.2	NM_152719		Missense_Mutation
NFATC4	4776	broad.mit.edu	37	14	24838789	24838789	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr14:24838789C>A	ENST00000250373.4	+	2	326	c.185C>A	c.(184-186)cCc>cAc	p.P62H	NFATC4_ENST00000555453.1_Missense_Mutation_p.P50H|NFATC4_ENST00000557451.1_5'UTR|NFATC4_ENST00000422617.3_Missense_Mutation_p.P50H|NFATC4_ENST00000554050.1_Missense_Mutation_p.P62H|NFATC4_ENST00000424781.2_Missense_Mutation_p.P75H|NFATC4_ENST00000554966.1_Missense_Mutation_p.P75H|NFATC4_ENST00000440487.2_3'UTR|NFATC4_ENST00000553879.1_5'UTR|NFATC4_ENST00000554591.1_Missense_Mutation_p.P125H|NFATC4_ENST00000539237.2_Missense_Mutation_p.P94H|NFATC4_ENST00000553469.1_Missense_Mutation_p.P94H|NFATC4_ENST00000554661.1_5'UTR|NFATC4_ENST00000556279.1_Missense_Mutation_p.P94H|NFATC4_ENST00000556169.1_Missense_Mutation_p.P50H|NFATC4_ENST00000413692.2_Missense_Mutation_p.P125H|NFATC4_ENST00000554344.1_5'UTR|NFATC4_ENST00000553708.1_Missense_Mutation_p.P62H|NFATC4_ENST00000555590.1_Missense_Mutation_p.P75H	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	62	Pro-rich.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)	p.P62H(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		ATCGGTATTCCCCGACCTCCA	0.672																																																1	Substitution - Missense(1)	ovary(1)	14											86.0	95.0	92.0					14																	24838789		2203	4300	6503	23908629	SO:0001583	missense	4776			BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.185C>A	14.37:g.24838789C>A	ENSP00000250373:p.Pro62His		23908629	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Missense_Mutation	SNP	ENST00000250373.4	37	CCDS9629.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	16.83	3.230355	0.58777	.	.	ENSG00000100968	ENST00000413692;ENST00000554591;ENST00000555590;ENST00000554966;ENST00000424781;ENST00000539237;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000554903;ENST00000554779;ENST00000250373;ENST00000553708;ENST00000557674;ENST00000556169;ENST00000422617;ENST00000555453	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.77489	2.92;2.98;2.97;3.0;2.95;2.94;2.95;2.99;3.01;-1.1;2.98;2.96;1.65;2.77;2.71;2.75	3.62	3.62	0.41486	.	0.315475	0.25494	N	0.030284	T	0.72938	0.3523	L	0.57536	1.79	0.80722	D	1	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.16603	0.006;0.018;0.018;0.018;0.018;0.018;0.018;0.018;0.018;0.018;0.018;0.01;0.018;0.01	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.20184	0.015;0.028;0.015;0.028;0.015;0.028;0.028;0.028;0.028;0.028;0.028;0.007;0.015;0.012	T	0.73965	-0.3816	10	0.87932	D	0	-4.5924	10.629	0.45525	0.0:1.0:0.0:0.0	.	50;50;94;94;75;75;75;125;125;50;94;39;125;62	Q14934-17;Q14934-9;Q14934-14;Q14934-4;Q14934-15;Q14934-6;Q14934-7;Q14934-2;Q14934-3;Q14934-10;Q14934-5;B4DU09;Q14934-11;Q14934	.;.;.;.;.;.;.;.;.;.;.;.;.;NFAC4_HUMAN	H	125;125;75;75;75;94;94;94;62;62;62;62;62;39;50;50;50	ENSP00000388910:P125H;ENSP00000452039:P125H;ENSP00000451224:P75H;ENSP00000450644:P75H;ENSP00000388668:P75H;ENSP00000439350:P94H;ENSP00000452270:P94H;ENSP00000451502:P94H;ENSP00000451151:P62H;ENSP00000451992:P62H;ENSP00000250373:P62H;ENSP00000450590:P62H;ENSP00000452352:P39H;ENSP00000451454:P50H;ENSP00000396788:P50H;ENSP00000450686:P50H	ENSP00000250373:P62H	P	+	2	0	NFATC4	23908629	0.988000	0.35896	1.000000	0.80357	0.993000	0.82548	4.359000	0.59449	1.851000	0.53745	0.655000	0.94253	CCC		0.672	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073206.6	NM_004554		Missense_Mutation
VRTN	55237	broad.mit.edu	37	14	74823799	74823799	+	Missense_Mutation	SNP	C	C	T	rs150151126		TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr14:74823799C>T	ENST00000256362.4	+	2	554	c.313C>T	c.(313-315)Cgg>Tgg	p.R105W		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	105					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)	p.R105W(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						CCTGGAGCTGCGGGCCCGCAC	0.642																																																1	Substitution - Missense(1)	ovary(1)	14						C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	43.0	42.0	42.0		313	4.0	1.0	14	dbSNP_134	42	0,8600		0,0,4300	no	missense	VRTN	NM_018228.2	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	105/703	74823799	1,13005	2203	4300	6503	73893552	SO:0001583	missense	55237			AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.313C>T	14.37:g.74823799C>T	ENSP00000256362:p.Arg105Trp		73893552	Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	37	CCDS9830.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	16.63	3.176093	0.57692	2.27E-4	0.0	ENSG00000133980	ENST00000256362	T	0.48836	0.8	4.91	4.02	0.46733	.	0.164709	0.41823	D	0.000817	T	0.43322	0.1242	N	0.24115	0.695	0.34704	D	0.727001	D	0.76494	0.999	P	0.51806	0.68	T	0.60026	-0.7343	10	0.87932	D	0	0.1631	11.5818	0.50896	0.0:0.9172:0.0:0.0828	.	105	Q9H8Y1	VRTN_HUMAN	W	105	ENSP00000256362:R105W	ENSP00000256362:R105W	R	+	1	2	VRTN	73893552	1.000000	0.71417	0.998000	0.56505	0.644000	0.38419	5.206000	0.65192	1.292000	0.44672	0.561000	0.74099	CGG		0.642	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228		Missense_Mutation
MGA	23269	broad.mit.edu	37	15	42052633	42052633	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr15:42052633G>A	ENST00000570161.1	+	19	7304	c.7304G>A	c.(7303-7305)cGg>cAg	p.R2435Q	MGA_ENST00000566586.1_Missense_Mutation_p.R2226Q|MGA_ENST00000219905.7_Missense_Mutation_p.R2435Q|MGA_ENST00000389936.4_Missense_Mutation_p.R2396Q|MGA_ENST00000545763.1_Missense_Mutation_p.R2226Q			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.R2484Q(4)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GAGCGGCGGCGGCGTGGTGAA	0.438																																																4	Substitution - Missense(4)	ovary(2)|large_intestine(1)|central_nervous_system(1)	15											109.0	111.0	110.0					15																	42052633		1900	4109	6009	39839925	SO:0001583	missense	23269			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7304G>A	15.37:g.42052633G>A	ENSP00000457035:p.Arg2435Gln		39839925	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.296335	0.95574	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.99722	-6.53;-6.53;-6.53	5.53	5.53	0.82687	.	0.000000	0.49305	D	0.000156	D	0.99711	0.9889	M	0.83223	2.63	0.31601	N	0.652706	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.997;0.978	D	0.97541	1.0086	10	0.87932	D	0	.	19.4485	0.94857	0.0:0.0:1.0:0.0	.	1051;2226;2435	B4DVS1;F5H7K2;E7ENI0	.;.;.	Q	2435;2396;2226	ENSP00000219905:R2435Q;ENSP00000374586:R2396Q;ENSP00000442467:R2226Q	ENSP00000219905:R2435Q	R	+	2	0	MGA	39839925	0.999000	0.42202	0.998000	0.56505	0.992000	0.81027	7.159000	0.77483	2.583000	0.87209	0.655000	0.94253	CGG		0.438	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		Missense_Mutation
DENND4A	10260	broad.mit.edu	37	15	66044814	66044814	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr15:66044814G>A	ENST00000431932.2	-	4	672	c.464C>T	c.(463-465)aCg>aTg	p.T155M	DENND4A_ENST00000443035.3_Missense_Mutation_p.T155M	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	155	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.T155M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						GACAGCCAACGTATTCTGAGT	0.423																																																1	Substitution - Missense(1)	ovary(1)	15											102.0	93.0	96.0					15																	66044814		1876	4102	5978	63831868	SO:0001583	missense	10260			AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.464C>T	15.37:g.66044814G>A	ENSP00000396830:p.Thr155Met		63831868	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	ENST00000431932.2	37	CCDS45285.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	24.6	4.545356	0.86022	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.22743	1.94;1.94	5.05	5.05	0.67936	MABP domain (1);	0.244653	0.41500	D	0.000868	T	0.34890	0.0913	L	0.34521	1.04	0.80722	D	1	B;D;D	0.89917	0.054;1.0;0.997	B;P;P	0.61592	0.018;0.891;0.714	T	0.10776	-1.0615	10	0.72032	D	0.01	.	18.7679	0.91880	0.0:0.0:1.0:0.0	.	155;155;155	B7Z5Y3;E7EPL3;Q7Z401	.;.;MYCPP_HUMAN	M	155	ENSP00000391167:T155M;ENSP00000396830:T155M	ENSP00000396830:T155M	T	-	2	0	DENND4A	63831868	1.000000	0.71417	0.698000	0.30274	0.746000	0.42486	7.928000	0.87587	2.479000	0.83701	0.655000	0.94253	ACG		0.423	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848		Missense_Mutation
CACNA1H	8912	broad.mit.edu	37	16	1260486	1260486	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr16:1260486G>T	ENST00000348261.5	+	19	4210	c.3962G>T	c.(3961-3963)gGc>gTc	p.G1321V	CACNA1H_ENST00000358590.4_Missense_Mutation_p.G1321V|CACNA1H_ENST00000565831.1_Missense_Mutation_p.G1321V	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1321					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)	p.G1321V(1)		breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	ATTGATCCCGGCAGCACCGTG	0.627																																																1	Substitution - Missense(1)	ovary(1)	16											41.0	44.0	43.0					16																	1260486		2173	4272	6445	1200487	SO:0001583	missense	8912			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.3962G>T	16.37:g.1260486G>T	ENSP00000334198:p.Gly1321Val		1200487	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	6.244	0.413080	0.11812	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.97529	-4.42;-4.42	3.77	1.78	0.24846	.	0.597435	0.16624	N	0.206373	D	0.93749	0.8002	L	0.54323	1.7	0.25721	N	0.985375	B;B;B;B;B	0.26935	0.164;0.093;0.149;0.008;0.015	B;B;B;B;B	0.30029	0.11;0.028;0.028;0.043;0.045	D	0.87983	0.2744	10	0.54805	T	0.06	.	2.378	0.04346	0.3857:0.0:0.3931:0.2212	.	62;62;62;1321;1321	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	V	1321	ENSP00000334198:G1321V;ENSP00000351401:G1321V	ENSP00000334198:G1321V	G	+	2	0	CACNA1H	1200487	0.007000	0.16637	0.868000	0.34077	0.680000	0.39746	1.393000	0.34497	0.922000	0.37019	0.543000	0.68304	GGC		0.627	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407		Missense_Mutation
ZNF646	9726	broad.mit.edu	37	16	31088802	31088802	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr16:31088802C>G	ENST00000394979.2	+	1	1580	c.1157C>G	c.(1156-1158)gCt>gGt	p.A386G	ZNF646_ENST00000300850.5_Missense_Mutation_p.A386G			O15015	ZN646_HUMAN	zinc finger protein 646	386					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A386G(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						TACCGCCATGCTGGGAGCCTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	16											37.0	33.0	34.0					16																	31088802		2197	4300	6497	30996303	SO:0001583	missense	9726			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.1157C>G	16.37:g.31088802C>G	ENSP00000378429:p.Ala386Gly		30996303	Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37		SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258252	0.59321	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.52526	0.66;0.66	5.44	5.44	0.79542	.	.	.	.	.	T	0.59101	0.2169	L	0.33245	0.995	0.32768	N	0.504236	D	0.76494	0.999	D	0.83275	0.996	T	0.61362	-0.7078	9	0.28530	T	0.3	-9.8061	18.0235	0.89262	0.0:1.0:0.0:0.0	.	386	O15015-2	.	G	386	ENSP00000300850:A386G;ENSP00000378429:A386G	ENSP00000300850:A386G	A	+	2	0	ZNF646	30996303	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	4.324000	0.59228	2.557000	0.86248	0.655000	0.94253	GCT		0.592	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699		Missense_Mutation
MYLK3	91807	broad.mit.edu	37	16	46781884	46781884	+	Silent	SNP	G	G	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr16:46781884G>T	ENST00000394809.4	-	1	337	c.222C>A	c.(220-222)ggC>ggA	p.G74G	MYLK3_ENST00000536476.1_Intron	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	74					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.G74G(2)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CCCCGCCCGGGCCCGGTGCCC	0.677																																																2	Substitution - coding silent(2)	ovary(2)	16											19.0	23.0	21.0					16																	46781884		2199	4295	6494	45339385	SO:0001819	synonymous_variant	91807			AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.222C>A	16.37:g.46781884G>T			45339385	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Silent	SNP	ENST00000394809.4	37	CCDS10723.2	SNP	42	Broad																																																																																				0.677	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493		Silent
PLEKHG4	25894	broad.mit.edu	37	16	67314682	67314682	+	Silent	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr16:67314682C>T	ENST00000360461.5	+	2	3103	c.568C>T	c.(568-570)Ctg>Ttg	p.L190L	PLEKHG4_ENST00000427155.2_Silent_p.L190L|PLEKHG4_ENST00000450733.1_Intron|PLEKHG4_ENST00000379344.3_Silent_p.L190L	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	190							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L190L(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		TTGGGAGCTGCTGGCCAGTGG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	16											56.0	62.0	60.0					16																	67314682		2198	4300	6498	65872183	SO:0001819	synonymous_variant	25894			AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.568C>T	16.37:g.67314682C>T			65872183	Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Silent	SNP	ENST00000360461.5	37	CCDS32466.1	SNP	28	Broad																																																																																				0.637	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432		Silent
SPAG7	9552	broad.mit.edu	37	17	4862933	4862933	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr17:4862933C>T	ENST00000206020.3	-	7	647	c.580G>A	c.(580-582)Gtg>Atg	p.V194M	SPAG7_ENST00000573366.1_Missense_Mutation_p.V143M|SPAG7_ENST00000575142.1_3'UTR	NM_004890.2	NP_004881.2	O75391	SPAG7_HUMAN	sperm associated antigen 7	194						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.V194M(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|lung(3)|ovary(2)|urinary_tract(1)	10						TTATTGGCCACGGGCACTAGG	0.607																																																1	Substitution - Missense(1)	ovary(1)	17											68.0	72.0	71.0					17																	4862933		2002	4170	6172	4803656	SO:0001583	missense	9552			AF047437	CCDS42240.1	17p13.2	2008-07-18				ENSG00000091640			11216	protein-coding gene	gene with protein product		610056				9653160	Standard	NM_004890		Approved	FSA-1, ACRP, MGC20134	uc002gae.3	O75391		ENST00000206020.3:c.580G>A	17.37:g.4862933C>T	ENSP00000206020:p.Val194Met		4803656	Q96EU5	Missense_Mutation	SNP	ENST00000206020.3	37	CCDS42240.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	17.66	3.443921	0.63067	.	.	ENSG00000091640	ENST00000206020	.	.	.	5.26	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.52917	0.1764	L	0.51422	1.61	0.47276	D	0.999377	D	0.60575	0.988	P	0.48795	0.59	T	0.56086	-0.8037	9	0.52906	T	0.07	-9.3422	11.8753	0.52544	0.0:0.9156:0.0:0.0844	.	194	O75391	SPAG7_HUMAN	M	194	.	ENSP00000206020:V194M	V	-	1	0	SPAG7	4803656	0.998000	0.40836	0.934000	0.37439	0.967000	0.64934	3.849000	0.55910	1.464000	0.47987	0.650000	0.86243	GTG		0.607	SPAG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438747.1	NM_004890		Missense_Mutation
TXNDC17	84817	broad.mit.edu	37	17	6546273	6546273	+	Silent	SNP	T	T	G			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr17:6546273T>G	ENST00000250101.5	+	4	631	c.306T>G	c.(304-306)ccT>ccG	p.P102P	TXNDC17_ENST00000577146.1_3'UTR|TXNDC17_ENST00000570330.1_Silent_p.P77P|TXNDC17_ENST00000574838.1_Missense_Mutation_p.L77R|KIAA0753_ENST00000572370.1_5'Flank|KIAA0753_ENST00000361413.3_5'Flank	NM_032731.3	NP_116120.1	Q9BRA2	TXD17_HUMAN	thioredoxin domain containing 17	102	Thioredoxin.				oxidation-reduction process (GO:0055114)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|peroxidase activity (GO:0004601)|protein-disulfide reductase activity (GO:0047134)	p.P102P(1)		endometrium(1)|kidney(1)|ovary(1)	3						TCTTACAGCCTCAAAAACTGG	0.388																																																1	Substitution - coding silent(1)	ovary(1)	17											139.0	125.0	129.0					17																	6546273		2203	4300	6503	6486997	SO:0001819	synonymous_variant	84817			BC006405	CCDS11077.1	17p13.2	2007-08-16	2007-08-16	2007-08-16	ENSG00000129235	ENSG00000129235			28218	protein-coding gene	gene with protein product	"""thioredoxin (Trx)-related protein, 14 kDa"""		"""thioredoxin-like 5"""	TXNL5		14607844, 14607843	Standard	NM_032731		Approved	MGC14353, TRP14	uc002gdf.4	Q9BRA2	OTTHUMG00000102053	ENST00000250101.5:c.306T>G	17.37:g.6546273T>G			6486997	A8K7E8	Silent	SNP	ENST00000250101.5	37	CCDS11077.1	SNP	54	Broad																																																																																				0.388	TXNDC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219854.2	NM_032731		Silent
TP53	7157	broad.mit.edu	37	17	7578176	7578176	+	Splice_Site	SNP	C	C	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr17:7578176C>A	ENST00000269305.4	-	6	862		c.e6+1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(56)|p.0?(8)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAAACCAGACCTCAGGCGGC	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	66	Unknown(56)|Whole gene deletion(8)|Insertion - In frame(1)|Insertion - Frameshift(1)	ovary(12)|upper_aerodigestive_tract(10)|lung(8)|biliary_tract(5)|endometrium(5)|large_intestine(4)|oesophagus(4)|bone(4)|stomach(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|cervix(1)|soft_tissue(1)|skin(1)|pancreas(1)	17	GRCh37	CS071266	TP53	S							80.0	75.0	77.0					17																	7578176		2203	4300	6503	7518901	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.672+1G>T	17.37:g.7578176C>A			7518901	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964220	0.74131	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	5.28	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.205	0.59790	0.1605:0.8394:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518901	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.775000	0.85489	1.321000	0.45227	0.563000	0.77884	.		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
MKS1	54903	broad.mit.edu	37	17	56283478	56283478	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr17:56283478G>A	ENST00000393119.2	-	18	1716	c.1642C>T	c.(1642-1644)Cag>Tag	p.Q548*	MKS1_ENST00000337050.7_Intron|MKS1_ENST00000546108.1_Nonsense_Mutation_p.Q345*|MKS1_ENST00000537529.2_Nonsense_Mutation_p.Q538*|MKS1_ENST00000313863.6_3'UTR	NM_017777.3	NP_060247.2	Q9NXB0	MKS1_HUMAN	Meckel syndrome, type 1	548					branching morphogenesis of an epithelial tube (GO:0048754)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)		p.Q548*(1)		endometrium(5)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						ACTAGGTCCTGCGGGAGGCTT	0.597																																																1	Substitution - Nonsense(1)	ovary(1)	17											24.0	28.0	27.0					17																	56283478		1912	4125	6037	53638477	SO:0001587	stop_gained	54903			DQ185029	CCDS11603.2, CCDS54148.1	17q21-q24	2014-09-17			ENSG00000011143	ENSG00000011143			7121	protein-coding gene	gene with protein product	"""POC12 centriolar protein homolog (Chlamydomonas)"""	609883		MKS		7550354, 16415886, 18327255	Standard	NM_017777		Approved	FLJ20345, POC12, BBS13	uc002ivr.2	Q9NXB0	OTTHUMG00000133714	ENST00000393119.2:c.1642C>T	17.37:g.56283478G>A	ENSP00000376827:p.Gln548*		53638477	B7WNX4|F5H885|Q284T0|Q96G13	Nonsense_Mutation	SNP	ENST00000393119.2	37	CCDS11603.2	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784931	0.90282	.	.	ENSG00000011143	ENST00000537529;ENST00000393119;ENST00000546108	.	.	.	5.35	5.35	0.76521	.	0.181110	0.49305	D	0.000148	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-31.1611	17.8134	0.88623	0.0:0.0:1.0:0.0	.	.	.	.	X	538;548;345	.	ENSP00000376827:Q548X	Q	-	1	0	MKS1	53638477	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	2.918000	0.48829	2.788000	0.95919	0.555000	0.69702	CAG		0.597	MKS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258015.2	NM_017777		Nonsense_Mutation
ENPP7	339221	broad.mit.edu	37	17	77710977	77710977	+	Silent	SNP	C	C	T	rs141362079	byFrequency	TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr17:77710977C>T	ENST00000328313.5	+	4	1385	c.1164C>T	c.(1162-1164)taC>taT	p.Y388Y		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7									p.Y388Y(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TCCACGTGTACGAGCTCATGT	0.632																																																1	Substitution - coding silent(1)	ovary(1)	17											71.0	59.0	63.0					17																	77710977		2203	4300	6503	75325572	SO:0001819	synonymous_variant	339221			AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.1164C>T	17.37:g.77710977C>T			75325572		Silent	SNP	ENST00000328313.5	37	CCDS11763.1	SNP	19	Broad																																																																																				0.632	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543		Silent
LAMA3	3909	broad.mit.edu	37	18	21402273	21402273	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr18:21402273A>C	ENST00000313654.9	+	20	2603	c.2362A>C	c.(2362-2364)Att>Ctt	p.I788L	LAMA3_ENST00000399516.3_Missense_Mutation_p.I788L	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	788					cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.I788L(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GTTTCGTGTTATTCTGAGATA	0.383																																																1	Substitution - Missense(1)	ovary(1)	18											127.0	118.0	121.0					18																	21402273		1886	4110	5996	19656271	SO:0001583	missense	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.2362A>C	18.37:g.21402273A>C	ENSP00000324532:p.Ile788Leu		19656271	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	15.36	2.811762	0.50527	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.17854	2.26;2.25	5.7	-1.41	0.08941	.	.	.	.	.	T	0.16642	0.0400	M	0.73598	2.24	0.80722	D	1	P;B	0.35433	0.501;0.441	B;B	0.30572	0.117;0.087	T	0.12889	-1.0530	9	0.27082	T	0.32	.	10.6457	0.45619	0.6546:0.0:0.3454:0.0	.	788;788	Q6VU67;Q16787	.;LAMA3_HUMAN	L	788;788;786	ENSP00000324532:I788L;ENSP00000382432:I788L	ENSP00000324532:I788L	I	+	1	0	LAMA3	19656271	1.000000	0.71417	0.314000	0.25224	0.792000	0.44763	1.123000	0.31308	-0.159000	0.11021	0.529000	0.55759	ATT		0.383	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		Missense_Mutation
PSPN	5623	broad.mit.edu	37	19	6375765	6375765	+	Silent	SNP	G	G	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr19:6375765G>A	ENST00000245810.1	-	1	95	c.96C>T	c.(94-96)gcC>gcT	p.A32A	PSPN_ENST00000597721.1_Silent_p.A32A	NM_004158.2	NP_004149.1	O60542	PSPN_HUMAN	persephin	32					axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|central nervous system development (GO:0007417)|nervous system development (GO:0007399)	extracellular space (GO:0005615)	receptor binding (GO:0005102)	p.A32A(1)		lung(1)|ovary(1)|skin(1)	3						ACTCTCCATCGGCCACGGGAA	0.642																																																1	Substitution - coding silent(1)	ovary(1)	19											51.0	45.0	47.0					19																	6375765		2203	4300	6503	6326765	SO:0001819	synonymous_variant	5623			AF040962	CCDS12164.1	19p13.3	2014-01-30				ENSG00000125650		"""Endogenous ligands"""	9579	protein-coding gene	gene with protein product		602921				10072588	Standard	NM_004158		Approved	PSP	uc010xja.2	O60542		ENST00000245810.1:c.96C>T	19.37:g.6375765G>A			6326765		Silent	SNP	ENST00000245810.1	37	CCDS12164.1	SNP	39	Broad																																																																																				0.642	PSPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398032.1	NM_004158		Silent
SCN1B	6324	broad.mit.edu	37	19	35524605	35524605	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr19:35524605G>A	ENST00000262631.5	+	3	547	c.410G>A	c.(409-411)aGc>aAc	p.S137N	SCN1B_ENST00000596348.1_3'UTR|SCN1B_ENST00000595652.1_Intron|CTD-2527I21.9_ENST00000601692.1_RNA|SCN1B_ENST00000415950.3_Missense_Mutation_p.S137N	NM_001037.4	NP_001028.1	Q07699	SCN1B_HUMAN	sodium channel, voltage-gated, type I, beta subunit	137	Ig-like C2-type.				axon guidance (GO:0007411)|cardiac conduction (GO:0061337)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|corticospinal neuron axon guidance (GO:0021966)|locomotion (GO:0040011)|membrane depolarization (GO:0051899)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during Purkinje myocyte cell action potential (GO:0086047)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|intercalated disc (GO:0014704)|node of Ranvier (GO:0033268)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)|voltage-gated sodium channel activity involved in Purkinje myocyte action potential (GO:0086062)	p.S137N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	11	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Valproic Acid(DB00313)|Zonisamide(DB00909)	CACAACACCAGCGTCGTCAAG	0.552																																																1	Substitution - Missense(1)	ovary(1)	19											142.0	110.0	121.0					19																	35524605		2203	4300	6503	40216445	SO:0001583	missense	6324				CCDS12441.1, CCDS46047.1	19q13.12	2014-09-17	2012-02-28		ENSG00000105711	ENSG00000105711		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10586	protein-coding gene	gene with protein product		600235	"""sodium channel, voltage-gated, type I, beta polypeptide"", ""sodium channel, voltage-gated, type I, beta"""			8394762	Standard	NM_001037		Approved		uc002nxo.2	Q07699	OTTHUMG00000182472	ENST00000262631.5:c.410G>A	19.37:g.35524605G>A	ENSP00000262631:p.Ser137Asn		40216445	Q5TZZ4|Q6TN97	Missense_Mutation	SNP	ENST00000262631.5	37	CCDS12441.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906473	0.33628	.	.	ENSG00000105711	ENST00000262631;ENST00000415950	D;D	0.97959	-4.63;-2.25	4.22	3.14	0.36123	.	0.367235	0.28766	N	0.014203	D	0.92146	0.7510	N	0.05124	-0.11	0.28869	N	0.895048	B;B	0.32573	0.005;0.376	B;B	0.38755	0.001;0.281	D	0.86986	0.2107	10	0.15952	T	0.53	-43.5882	9.9562	0.41668	0.0:0.2069:0.7931:0.0	.	137;137	Q07699;Q07699-2	SCN1B_HUMAN;.	N	137	ENSP00000262631:S137N;ENSP00000396915:S137N	ENSP00000262631:S137N	S	+	2	0	SCN1B	40216445	0.993000	0.37304	1.000000	0.80357	0.979000	0.70002	0.276000	0.18716	1.087000	0.41251	0.484000	0.47621	AGC		0.552	SCN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461567.1			Missense_Mutation
SBSN	374897	broad.mit.edu	37	19	36017693	36017693	+	Silent	SNP	C	C	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr19:36017693C>A	ENST00000452271.2	-	1	1519	c.1491G>T	c.(1489-1491)ggG>ggT	p.G497G	SBSN_ENST00000518157.1_Silent_p.G154G	NM_001166034.1	NP_001159506.1	Q6UWP8	SBSN_HUMAN	suprabasin	497	Ala/Gly/His-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.G154G(1)		large_intestine(5)|lung(6)|ovary(1)|prostate(2)	14	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CATGGTTGACCCCTTGGCCAA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	19											122.0	100.0	108.0					19																	36017693		2203	4300	6503	40709533	SO:0001819	synonymous_variant	374897			AY358701	CCDS12464.1, CCDS54253.1	19q13.13	2008-02-05							24950	protein-coding gene	gene with protein product		609969				12228223	Standard	NM_198538		Approved	UNQ698, HLAR698	uc002oad.2	Q6UWP8		ENST00000452271.2:c.1491G>T	19.37:g.36017693C>A			40709533	A8K5J0|E9PBV3	Silent	SNP	ENST00000452271.2	37	CCDS54253.1	SNP	22	Broad																																																																																				0.597	SBSN-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109463.3	NM_198538		Silent
FOXA3	3171	broad.mit.edu	37	19	46375897	46375897	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr19:46375897C>T	ENST00000302177.2	+	2	831	c.634C>T	c.(634-636)Cgc>Tgc	p.R212C		NM_004497.2	NP_004488.2	P55318	FOXA3_HUMAN	forkhead box A3	212					cell differentiation (GO:0030154)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|chromatin modification (GO:0016568)|endocrine pancreas development (GO:0031018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R212C(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	13		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00453)|GBM - Glioblastoma multiforme(486;0.0518)|Epithelial(262;0.236)		CCGCCAGAAACGCTTCAAGCT	0.647																																																1	Substitution - Missense(1)	ovary(1)	19											16.0	18.0	17.0					19																	46375897		2203	4297	6500	51067737	SO:0001583	missense	3171			L12141	CCDS12677.1	19q13.32	2014-09-11		2002-09-20	ENSG00000170608	ENSG00000170608		"""Forkhead boxes"""	5023	protein-coding gene	gene with protein product		602295	"""hepatocyte nuclear factor 3, gamma"""	HNF3G		9119385	Standard	NM_004497		Approved		uc002pdr.3	P55318	OTTHUMG00000182484	ENST00000302177.2:c.634C>T	19.37:g.46375897C>T	ENSP00000304004:p.Arg212Cys		51067737	A9LYI5|Q53F16|Q9UMW9	Missense_Mutation	SNP	ENST00000302177.2	37	CCDS12677.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	19.26	3.794312	0.70452	.	.	ENSG00000170608	ENST00000302177	D	0.96104	-3.91	4.13	4.13	0.48395	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (1);	0.000000	0.85682	D	0.000000	D	0.98356	0.9454	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99146	1.0857	10	0.87932	D	0	.	14.2619	0.66090	0.0:1.0:0.0:0.0	.	212	P55318	FOXA3_HUMAN	C	212	ENSP00000304004:R212C	ENSP00000304004:R212C	R	+	1	0	FOXA3	51067737	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.669000	0.61575	2.278000	0.76064	0.453000	0.30009	CGC		0.647	FOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461682.1			Missense_Mutation
NKG7	4818	broad.mit.edu	37	19	51875203	51875203	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr19:51875203G>T	ENST00000221978.5	-	3	609	c.430C>A	c.(430-432)Ctc>Atc	p.L144I	CLDND2_ENST00000601435.1_5'Flank|NKG7_ENST00000595217.1_Nonsense_Mutation_p.C137*|NKG7_ENST00000600427.1_Intron|CLDND2_ENST00000291715.1_5'Flank	NM_005601.3	NP_005592.1	Q16617	NKG7_HUMAN	natural killer cell granule protein 7	144						integral component of plasma membrane (GO:0005887)		p.L144I(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000211)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CCTGTACAGAGCAAGAGGATA	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											89.0	97.0	94.0					19																	51875203		2203	4300	6503	56567015	SO:0001583	missense	4818				CCDS12830.1	19q13.41	2014-03-07	2014-03-07		ENSG00000105374	ENSG00000105374			7830	protein-coding gene	gene with protein product	"""granule membrane protein 17"""	606008	"""natural killer cell group 7 sequence"""			8458737	Standard	NM_005601		Approved	GIG1, GMP-17	uc002pwj.3	Q16617	OTTHUMG00000182898	ENST00000221978.5:c.430C>A	19.37:g.51875203G>T	ENSP00000221978:p.Leu144Ile		56567015		Missense_Mutation	SNP	ENST00000221978.5	37	CCDS12830.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	g	17.82	3.482783	0.63962	.	.	ENSG00000105374	ENST00000221978	D	0.88975	-2.45	5.47	2.11	0.27256	.	0.571719	0.14718	N	0.302511	D	0.86293	0.5898	M	0.61703	1.905	0.09310	N	1	P	0.47253	0.892	P	0.45428	0.48	T	0.75769	-0.3201	10	0.34782	T	0.22	1.3049	6.2006	0.20573	0.1714:0.1521:0.6764:0.0	.	144	Q16617	NKG7_HUMAN	I	144	ENSP00000221978:L144I	ENSP00000221978:L144I	L	-	1	0	NKG7	56567015	0.007000	0.16637	0.006000	0.13384	0.250000	0.25880	0.290000	0.18975	0.685000	0.31468	0.486000	0.48141	CTC		0.602	NKG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464260.2	NM_005601		Missense_Mutation
ZFP28	140612	broad.mit.edu	37	19	57059204	57059204	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr19:57059204C>G	ENST00000301318.3	+	4	527	c.456C>G	c.(454-456)atC>atG	p.I152M	AC007228.11_ENST00000596587.1_RNA|ZFP28_ENST00000591844.1_Missense_Mutation_p.I152M	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	152	KRAB 1. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I152M(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		CCGATGTGATCTCCTCGTTGG	0.512																																					Ovarian(124;554 1662 19430 21141 52494)											1	Substitution - Missense(1)	ovary(1)	19											206.0	191.0	196.0					19																	57059204		2203	4300	6503	61751016	SO:0001583	missense	140612				CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.456C>G	19.37:g.57059204C>G	ENSP00000301318:p.Ile152Met		61751016	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	37	CCDS12946.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	14.47	2.543653	0.45280	.	.	ENSG00000196867	ENST00000301318	T	0.00912	5.55	4.01	1.79	0.24919	Krueppel-associated box (3);	0.000000	0.40064	N	0.001188	T	0.05914	0.0154	M	0.93016	3.37	0.20196	N	0.999929	D;D	0.89917	0.997;1.0	D;D	0.91635	0.916;0.999	T	0.07770	-1.0755	10	0.66056	D	0.02	.	6.7212	0.23330	0.0:0.7756:0.0:0.2244	.	152;152	Q8NHY6;A8K0L8	ZFP28_HUMAN;.	M	152	ENSP00000301318:I152M	ENSP00000301318:I152M	I	+	3	3	ZFP28	61751016	0.769000	0.28531	0.369000	0.25952	0.855000	0.48748	0.642000	0.24735	0.442000	0.26555	-0.251000	0.11542	ATC		0.512	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828		Missense_Mutation
SOS1	6654	broad.mit.edu	37	2	39213419	39213419	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr2:39213419G>C	ENST00000426016.1	-	24	3634	c.3548C>G	c.(3547-3549)cCt>cGt	p.P1183R	SOS1_ENST00000402219.2_Missense_Mutation_p.P1183R|SOS1_ENST00000395038.2_Missense_Mutation_p.P1168R			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	1183					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P1183R(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				TTGCCTAGGAGGAATGGCTGG	0.383									Noonan syndrome																																							1	Substitution - Missense(1)	ovary(1)	2											71.0	77.0	75.0					2																	39213419		2203	4300	6503	39066923	SO:0001583	missense	6654	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.3548C>G	2.37:g.39213419G>C	ENSP00000387784:p.Pro1183Arg		39066923	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	CCDS1802.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	17.44	3.390531	0.62066	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038	T;T;D	0.84146	-1.24;-1.24;-1.81	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.90875	0.7133	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90151	0.4221	10	0.48119	T	0.1	.	19.559	0.95364	0.0:0.0:1.0:0.0	.	1183	Q07889	SOS1_HUMAN	R	1183;1183;900;1168	ENSP00000387784:P1183R;ENSP00000384675:P1183R;ENSP00000378479:P1168R	ENSP00000378479:P1168R	P	-	2	0	SOS1	39066923	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.554000	0.90689	2.706000	0.92434	0.650000	0.86243	CCT		0.383	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633		Missense_Mutation
MAP3K2	10746	broad.mit.edu	37	2	128083320	128083320	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr2:128083320C>G	ENST00000409947.1	-	9	943	c.661G>C	c.(661-663)Gat>Cat	p.D221H	MAP3K2_ENST00000344908.5_Missense_Mutation_p.D221H			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	221					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.D221H(1)		central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	AAAGGACTATCAAGTGATGGA	0.423																																																1	Substitution - Missense(1)	ovary(1)	2											130.0	119.0	122.0					2																	128083320		1834	4098	5932	127799790	SO:0001583	missense	10746			AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.661G>C	2.37:g.128083320C>G	ENSP00000387246:p.Asp221His		127799790	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Missense_Mutation	SNP	ENST00000409947.1	37	CCDS46404.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	22.8	4.337879	0.81911	.	.	ENSG00000169967	ENST00000409947;ENST00000344908	T;T	0.55413	0.52;0.52	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.71409	0.3336	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.72110	-0.4389	10	0.62326	D	0.03	.	19.4782	0.94998	0.0:1.0:0.0:0.0	.	221	Q9Y2U5	M3K2_HUMAN	H	221	ENSP00000387246:D221H;ENSP00000343463:D221H	ENSP00000343463:D221H	D	-	1	0	MAP3K2	127799790	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.233000	0.78125	2.838000	0.97847	0.655000	0.94253	GAT		0.423	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331014.1	NM_006609		Missense_Mutation
LRP1B	53353	broad.mit.edu	37	2	141130630	141130630	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr2:141130630C>T	ENST00000389484.3	-	69	11686	c.10715G>A	c.(10714-10716)tGt>tAt	p.C3572Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3572	LDL-receptor class A 27. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.C3572Y(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATGGCCATCACATTTCCATTT	0.363										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											1	Substitution - Missense(1)	ovary(1)	2											198.0	190.0	193.0					2																	141130630		2203	4300	6503	140847100	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10715G>A	2.37:g.141130630C>T	ENSP00000374135:p.Cys3572Tyr		140847100	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	29.4	5.002343	0.93227	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.99755	-6.64	5.67	5.67	0.87782	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	U	0.000000	D	0.99889	0.9947	H	0.98178	4.165	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96461	0.9341	10	0.87932	D	0	.	19.7612	0.96319	0.0:1.0:0.0:0.0	.	3572	Q9NZR2	LRP1B_HUMAN	Y	3572;3510	ENSP00000374135:C3572Y	ENSP00000374135:C3572Y	C	-	2	0	LRP1B	140847100	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.484000	0.81180	2.679000	0.91253	0.655000	0.94253	TGT		0.363	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		Missense_Mutation
SCN7A	6332	broad.mit.edu	37	2	167328943	167328943	+	Silent	SNP	A	A	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr2:167328943A>T	ENST00000409855.1	-	5	582	c.456T>A	c.(454-456)ctT>ctA	p.L152L		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	152					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.L152L(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TGTAAATTCCAAGCAAAGTAT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	2											41.0	40.0	40.0					2																	167328943		1826	4093	5919	167037189	SO:0001819	synonymous_variant	6332			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.456T>A	2.37:g.167328943A>T			167037189		Silent	SNP	ENST00000409855.1	37	CCDS46442.1	SNP	5	Broad																																																																																				0.348	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1			Silent
XIRP2	129446	broad.mit.edu	37	2	168103651	168103651	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr2:168103651C>A	ENST00000409195.1	+	9	5838	c.5749C>A	c.(5749-5751)Ctt>Att	p.L1917I	XIRP2_ENST00000409273.1_Missense_Mutation_p.L1695I|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.L1917I|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1742					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.L1917I(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GAAAAAGGAGCTTCTCAAAGA	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											54.0	50.0	52.0					2																	168103651		1830	4085	5915	167811897	SO:0001583	missense	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5749C>A	2.37:g.168103651C>A	ENSP00000386840:p.Leu1917Ile		167811897	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	5.205	0.223411	0.09863	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.03035	4.07;4.07;4.07	5.46	3.53	0.40419	.	0.345738	0.27981	N	0.017063	T	0.06325	0.0163	M	0.65975	2.015	0.39800	D	0.972552	P;D;B	0.57571	0.921;0.98;0.36	B;P;B	0.45310	0.284;0.476;0.09	T	0.43686	-0.9376	10	0.30078	T	0.28	-14.2685	9.2845	0.37749	0.1336:0.5509:0.3155:0.0	.	1742;1742;1695	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	I	1917;1917;1695	ENSP00000386840:L1917I;ENSP00000295237:L1917I;ENSP00000387255:L1695I	ENSP00000295237:L1917I	L	+	1	0	XIRP2	167811897	1.000000	0.71417	0.961000	0.40146	0.130000	0.20726	2.423000	0.44705	1.429000	0.47314	-0.175000	0.13238	CTT		0.348	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		Missense_Mutation
ZNF804A	91752	broad.mit.edu	37	2	185800759	185800759	+	Silent	SNP	C	C	A	rs546038601	byFrequency	TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr2:185800759C>A	ENST00000302277.6	+	4	1230	c.636C>A	c.(634-636)atC>atA	p.I212I		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	212							metal ion binding (GO:0046872)	p.I212I(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GACACAAAATCGGCTTTTCTT	0.438																																																1	Substitution - coding silent(1)	ovary(1)	2											67.0	68.0	68.0					2																	185800759		2203	4300	6503	185509004	SO:0001819	synonymous_variant	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.636C>A	2.37:g.185800759C>A			185509004	A7E253|Q6ZN26	Silent	SNP	ENST00000302277.6	37	CCDS2291.1	SNP	31	Broad																																																																																				0.438	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		Silent
ABCA12	26154	broad.mit.edu	37	2	215852505	215852505	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr2:215852505A>G	ENST00000272895.7	-	27	4061	c.3842T>C	c.(3841-3843)aTg>aCg	p.M1281T	ABCA12_ENST00000389661.4_Missense_Mutation_p.M963T	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1281					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.M1281T(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GGGAGCTGCCATACCGTATGT	0.408																																					Ovarian(66;664 1488 5121 34295)											1	Substitution - Missense(1)	ovary(1)	2											39.0	37.0	38.0					2																	215852505		2203	4299	6502	215560750	SO:0001583	missense	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3842T>C	2.37:g.215852505A>G	ENSP00000272895:p.Met1281Thr		215560750	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	13.91	2.377948	0.42105	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.74002	-0.8;-0.8	5.26	5.26	0.73747	.	0.131998	0.53938	D	0.000060	T	0.59404	0.2191	N	0.11724	0.165	0.80722	D	1	B;B	0.21309	0.054;0.017	B;B	0.22152	0.021;0.038	T	0.56679	-0.7939	10	0.38643	T	0.18	.	15.1562	0.72743	1.0:0.0:0.0:0.0	.	1281;963	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	T	1281;963	ENSP00000272895:M1281T;ENSP00000374312:M963T	ENSP00000272895:M1281T	M	-	2	0	ABCA12	215560750	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	8.169000	0.89672	1.993000	0.58246	0.459000	0.35465	ATG		0.408	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		Missense_Mutation
ZNF142	7701	broad.mit.edu	37	2	219513879	219513879	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr2:219513879T>C	ENST00000449707.1	-	6	1173	c.752A>G	c.(751-753)gAc>gGc	p.D251G	ZNF142_ENST00000411696.2_Missense_Mutation_p.D251G	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	251					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D88G(1)		breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGCATAGGTGTCTGAGTAGAA	0.577											OREG0015202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(170;867 1942 8995 15834 18053)											1	Substitution - Missense(1)	ovary(1)	2											53.0	55.0	54.0					2																	219513879		2095	4228	6323	219222123	SO:0001583	missense	7701			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.752A>G	2.37:g.219513879T>C	ENSP00000408643:p.Asp251Gly	2259	219222123	Q92510	Missense_Mutation	SNP	ENST00000449707.1	37	CCDS42817.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	16.28	3.077599	0.55753	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.14766	2.48;2.48	5.22	5.22	0.72569	.	0.155036	0.56097	D	0.000023	T	0.17577	0.0422	L	0.39898	1.24	0.46654	D	0.999143	P;P	0.43857	0.819;0.752	B;P	0.46208	0.334;0.507	T	0.01440	-1.1354	10	0.33141	T	0.24	-22.5412	15.5563	0.76196	0.0:0.0:0.0:1.0	.	251;88	P52746;A8MWU9	ZN142_HUMAN;.	G	251	ENSP00000408643:D251G;ENSP00000398798:D251G	ENSP00000398798:D251G	D	-	2	0	ZNF142	219222123	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.338000	0.52128	2.317000	0.78254	0.460000	0.39030	GAC		0.577	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081		Missense_Mutation
ADA	100	broad.mit.edu	37	20	43251493	43251493	+	Missense_Mutation	SNP	G	G	A	rs201944717		TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr20:43251493G>A	ENST00000372874.4	-	8	891	c.757C>T	c.(757-759)Cgg>Tgg	p.R253W	PKIG_ENST00000372882.3_Intron|ADA_ENST00000464097.1_5'UTR|PKIG_ENST00000372887.1_Intron|ADA_ENST00000537820.1_Missense_Mutation_p.R229W	NM_000022.2	NP_000013.2	P00813	ADA_HUMAN	adenosine deaminase	253					adenosine catabolic process (GO:0006154)|aging (GO:0007568)|cell adhesion (GO:0007155)|dATP catabolic process (GO:0046061)|deoxyadenosine catabolic process (GO:0006157)|embryonic digestive tract development (GO:0048566)|germinal center B cell differentiation (GO:0002314)|histamine secretion (GO:0001821)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|negative regulation of adenosine receptor signaling pathway (GO:0060169)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of mucus secretion (GO:0070256)|negative regulation of penile erection (GO:0060407)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleobase-containing small molecule metabolic process (GO:0055086)|Peyer's patch development (GO:0048541)|placenta development (GO:0001890)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of germinal center formation (GO:0002636)|positive regulation of heart rate (GO:0010460)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide salvage (GO:0032261)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|purine-containing compound salvage (GO:0043101)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to morphine (GO:0043278)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|trophectodermal cell differentiation (GO:0001829)|xanthine biosynthetic process (GO:0046111)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|lysosome (GO:0005764)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenosine deaminase activity (GO:0004000)|purine nucleoside binding (GO:0001883)|zinc ion binding (GO:0008270)	p.R253W(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(2)|prostate(3)|skin(2)|urinary_tract(1)	18		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Dipyridamole(DB00975)|Edetic Acid(DB00974)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	TTTTCCTGCCGCAGCCTGTTA	0.577									Adenosine Deaminase Deficiency				G|||	1	0.000199681	0.0	0.0	5008	,	,		19292	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	20											117.0	123.0	121.0					20																	43251493		2203	4300	6503	42684907	SO:0001583	missense	100	Familial Cancer Database	Severe Combined Immunodeficiency (SCID) due to ADA-deficiency	X02994	CCDS13335.1	20q13.12	2014-09-17			ENSG00000196839	ENSG00000196839	3.5.4.4		186	protein-coding gene	gene with protein product		608958				6198240, 6090454	Standard	NM_000022		Approved		uc002xmj.3	P00813	OTTHUMG00000033081	ENST00000372874.4:c.757C>T	20.37:g.43251493G>A	ENSP00000361965:p.Arg253Trp		42684907	Q53F92|Q6LA59	Missense_Mutation	SNP	ENST00000372874.4	37	CCDS13335.1	SNP	38	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	19.16	3.774231	0.69992	.	.	ENSG00000196839	ENST00000372874;ENST00000537820	D;D	0.96745	-4.11;-4.11	5.18	3.05	0.35203	Adenosine/AMP deaminase (1);	0.605679	0.17470	N	0.173133	D	0.96358	0.8812	M	0.81942	2.565	0.27523	N	0.951321	D	0.71674	0.998	P	0.51999	0.687	D	0.91818	0.5465	10	0.62326	D	0.03	-20.6714	7.4687	0.27336	0.0795:0.0:0.5231:0.3974	.	253	P00813	ADA_HUMAN	W	253;229	ENSP00000361965:R253W;ENSP00000441818:R229W	ENSP00000361965:R253W	R	-	1	2	ADA	42684907	0.075000	0.21258	0.576000	0.28549	0.856000	0.48823	0.754000	0.26390	1.144000	0.42321	0.462000	0.41574	CGG		0.577	ADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080509.2	NM_000022		Missense_Mutation
CECR5	27440	broad.mit.edu	37	22	17619025	17619025	+	Silent	SNP	G	G	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr22:17619025G>A	ENST00000336737.4	-	8	1183	c.1158C>T	c.(1156-1158)caC>caT	p.H386H	CECR5_ENST00000399852.3_Silent_p.H186H|CECR5_ENST00000155674.5_Silent_p.H356H	NM_033070.2	NP_149061.1	Q9BXW7	CECR5_HUMAN	cat eye syndrome chromosome region, candidate 5	386						mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(10)|pancreas(1)|prostate(1)	21		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)				CTCGGTGCCCGTGGAATGGAG	0.602																																																0			22											106.0	91.0	96.0					22																	17619025		2203	4300	6503	15999025	SO:0001819	synonymous_variant	27440			AF273270	CCDS13741.1, CCDS33595.1	22q11.2	2008-06-12			ENSG00000069998	ENSG00000069998			1843	protein-coding gene	gene with protein product						11381032	Standard	NM_017829		Approved		uc002zmf.3	Q9BXW7	OTTHUMG00000150071	ENST00000336737.4:c.1158C>T	22.37:g.17619025G>A			15999025	B2RCK5|Q9BXW8|Q9NWA8|Q9NX41	Silent	SNP	ENST00000336737.4	37	CCDS33595.1	SNP	40	Broad																																																																																				0.602	CECR5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316100.1	NM_017829		Silent
IL5RA	3568	broad.mit.edu	37	3	3137080	3137080	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr3:3137080C>T	ENST00000446632.2	-	8	1332	c.758G>A	c.(757-759)cGt>cAt	p.R253H	IL5RA_ENST00000456302.1_Missense_Mutation_p.R253H|IL5RA_ENST00000256452.3_Missense_Mutation_p.R253H|IL5RA_ENST00000438560.1_Missense_Mutation_p.R253H|IL5RA_ENST00000418488.2_Intron|IL5RA_ENST00000445864.2_Intron|IL5RA_ENST00000430514.2_Missense_Mutation_p.R253H|IL5RA_ENST00000383846.1_Missense_Mutation_p.R253H|IL5RA_ENST00000311981.8_Missense_Mutation_p.R253H	NM_175726.3	NP_783853.1	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha	253	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-5-mediated signaling pathway (GO:0038043)|regulation of interleukin-5 production (GO:0032674)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-5 receptor activity (GO:0004914)	p.R253H(1)		cervix(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	24				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		GATAGAGAGACGAGTTCCTTC	0.358																																					GBM(169;430 2801 24955 28528)											1	Substitution - Missense(1)	ovary(1)	3											102.0	100.0	101.0					3																	3137080		2203	4300	6503	3112080	SO:0001583	missense	3568			M96652	CCDS2559.1, CCDS2560.1, CCDS46739.1, CCDS58813.1	3p26-p24	2008-01-11			ENSG00000091181	ENSG00000091181		"""Interleukins and interleukin receptors"", ""CD molecules"""	6017	protein-coding gene	gene with protein product		147851		IL5R		1732409	Standard	NM_175727		Approved	CDw125, CD125	uc010hbs.3	Q01344	OTTHUMG00000090245	ENST00000446632.2:c.758G>A	3.37:g.3137080C>T	ENSP00000412209:p.Arg253His		3112080	B3IU77|B4E2G0|Q14633|Q15469|Q6ISX9	Missense_Mutation	SNP	ENST00000446632.2	37	CCDS2559.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	8.755	0.922304	0.17982	.	.	ENSG00000091181	ENST00000446632;ENST00000438560;ENST00000256452;ENST00000383846;ENST00000311981;ENST00000430514;ENST00000456302	D;D;D;D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02	5.0	-4.37	0.03633	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.674050	0.02815	N	0.124883	T	0.73241	0.3562	N	0.25647	0.755	0.22754	N	0.998777	B;B;B;B	0.20459	0.045;0.015;0.018;0.008	B;B;B;B	0.11329	0.005;0.003;0.006;0.001	T	0.57516	-0.7798	10	0.22109	T	0.4	0.7631	6.4765	0.22039	0.0:0.218:0.3584:0.4236	.	253;253;253;253	B4E2G0;Q01344-3;Q01344-2;Q01344	.;.;.;IL5RA_HUMAN	H	253	ENSP00000412209:R253H;ENSP00000390753:R253H;ENSP00000256452:R253H;ENSP00000373358:R253H;ENSP00000309196:R253H;ENSP00000400400:R253H;ENSP00000392059:R253H	ENSP00000256452:R253H	R	-	2	0	IL5RA	3112080	0.000000	0.05858	0.001000	0.08648	0.696000	0.40369	-0.391000	0.07323	-0.752000	0.04728	-0.150000	0.13652	CGT		0.358	IL5RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337537.2			Missense_Mutation
NBEAL2	23218	broad.mit.edu	37	3	47038837	47038837	+	Missense_Mutation	SNP	C	C	G	rs200616995	byFrequency	TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr3:47038837C>G	ENST00000450053.3	+	19	2917	c.2738C>G	c.(2737-2739)cCa>cGa	p.P913R	NBEAL2_ENST00000383740.2_5'UTR|NBEAL2_ENST00000292309.5_Missense_Mutation_p.P913R	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	913					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.P474R(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GAAGCAGGTCCAGCTGAAACG	0.587																																																1	Substitution - Missense(1)	ovary(1)	3											42.0	46.0	45.0					3																	47038837		2051	4208	6259	47013841	SO:0001583	missense	23218			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.2738C>G	3.37:g.47038837C>G	ENSP00000415034:p.Pro913Arg		47013841	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	SNP	21	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.978|8.978	0.974551|0.974551	0.18736|0.18736	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000450053|ENST00000416683	T;T|.	0.56611|.	0.45;0.45|.	5.41|5.41	4.48|4.48	0.54585|0.54585	.|.	0.131761|.	0.50627|.	D|.	0.000102|.	T|T	0.57431|0.57431	0.2053|0.2053	L|L	0.43923|0.43923	1.385|1.385	0.53688|0.53688	D|D	0.999979|0.999979	B|.	0.31910|.	0.346|.	B|.	0.27170|.	0.077|.	T|T	0.50833|0.50833	-0.8781|-0.8781	10|5	0.72032|.	D|.	0.01|.	.|.	10.974|10.974	0.47454|0.47454	0.302:0.698:0.0:0.0|0.302:0.698:0.0:0.0	.|.	913|.	Q6ZNJ1|.	NBEL2_HUMAN|.	R|E	913|385	ENSP00000292309:P913R;ENSP00000415034:P913R|.	ENSP00000292309:P913R|.	P|Q	+|+	2|1	0|0	NBEAL2|NBEAL2	47013841|47013841	1.000000|1.000000	0.71417|0.71417	0.203000|0.203000	0.23512|0.23512	0.005000|0.005000	0.04900|0.04900	5.388000|5.388000	0.66249|0.66249	2.826000|2.826000	0.97356|0.97356	0.561000|0.561000	0.74099|0.74099	CCA|CAG		0.587	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064		Missense_Mutation
UBA7	7318	broad.mit.edu	37	3	49851033	49851033	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr3:49851033A>T	ENST00000333486.3	-	2	262	c.104T>A	c.(103-105)gTc>gAc	p.V35D	UBA7_ENST00000494212.1_5'UTR	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	35	2 approximate repeats.				cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)	p.V35D(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		TGACACCAGGACCCTGGCTCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	3											65.0	60.0	62.0					3																	49851033		2203	4300	6503	49826037	SO:0001583	missense	7318			BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.104T>A	3.37:g.49851033A>T	ENSP00000333266:p.Val35Asp		49826037	Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	37	CCDS2805.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	28.8	4.949741	0.92660	.	.	ENSG00000182179	ENST00000333486	T	0.60920	0.15	4.95	4.95	0.65309	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.069946	0.56097	D	0.000029	T	0.82222	0.4990	H	0.95079	3.62	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.87604	0.2499	10	0.87932	D	0	-31.5927	13.9466	0.64089	1.0:0.0:0.0:0.0	.	35	P41226	UBA7_HUMAN	D	35	ENSP00000333266:V35D	ENSP00000333266:V35D	V	-	2	0	UBA7	49826037	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.209000	0.89751	2.076000	0.62316	0.379000	0.24179	GTC		0.602	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335		Missense_Mutation
HTR1F	3355	broad.mit.edu	37	3	88040588	88040588	+	Missense_Mutation	SNP	T	T	A	rs200867459		TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr3:88040588T>A	ENST00000319595.4	+	1	743	c.689T>A	c.(688-690)cTt>cAt	p.L230H		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	230					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.L230H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	GGCCAAGTCCTTTTGGAGAGT	0.373																																																1	Substitution - Missense(1)	ovary(1)	3											69.0	70.0	69.0					3																	88040588		2203	4300	6503	88123278	SO:0001583	missense	3355			L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.689T>A	3.37:g.88040588T>A	ENSP00000322924:p.Leu230His		88123278		Missense_Mutation	SNP	ENST00000319595.4	37	CCDS2920.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	12.54	1.967220	0.34754	.	.	ENSG00000179097	ENST00000319595	T	0.72394	-0.65	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	0.139707	0.48767	D	0.000172	T	0.74543	0.3730	L	0.35414	1.06	0.19575	N	0.999963	D	0.89917	1.0	D	0.69142	0.962	T	0.66464	-0.5917	10	0.40728	T	0.16	.	12.7021	0.57038	0.0:0.0:0.0:1.0	.	230	P30939	5HT1F_HUMAN	H	230	ENSP00000322924:L230H	ENSP00000322924:L230H	L	+	2	0	HTR1F	88123278	0.915000	0.31059	0.542000	0.28115	0.899000	0.52679	2.919000	0.48836	1.897000	0.54924	0.377000	0.23210	CTT		0.373	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352890.1	NM_000866		Missense_Mutation
ZNF718	255403	broad.mit.edu	37	4	155481	155481	+	lincRNA	SNP	G	G	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr4:155481G>C	ENST00000510175.1	+	0	916							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		TCATACAGGAGAGAAACCCTA	0.403																																																0			4											22.0	25.0	24.0					4																	155481		2130	4266	6396	145481			255403			AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155481G>C			145481	Q3SXZ4|Q3SXZ5	Missense_Mutation	SNP	ENST00000510175.1	37		SNP	33	Broad																																																																																				0.403	ZNF718-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000357865.3	NM_001039127		Missense_Mutation
FAM193A	8603	broad.mit.edu	37	4	2648498	2648498	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr4:2648498G>A	ENST00000324666.5	+	5	728	c.377G>A	c.(376-378)cGc>cAc	p.R126H	FAM193A_ENST00000505311.1_Missense_Mutation_p.R126H|FAM193A_ENST00000382839.3_Missense_Mutation_p.R126H|FAM193A_ENST00000502458.1_Missense_Mutation_p.R126H|FAM193A_ENST00000545951.1_Missense_Mutation_p.R126H	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	126								p.R126H(1)		NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GAGGAGCTGCGCAGAGTCGCC	0.622																																																1	Substitution - Missense(1)	ovary(1)	4											120.0	110.0	114.0					4																	2648498		2203	4300	6503	2618296	SO:0001583	missense	8603			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.377G>A	4.37:g.2648498G>A	ENSP00000324587:p.Arg126His		2618296	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	37	CCDS58875.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	g	3.219	-0.159987	0.06502	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458	T;T;T;T	0.31769	1.5;1.91;1.49;1.48	5.09	-0.491	0.12045	.	0.764153	0.12717	N	0.444987	T	0.20861	0.0502	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B	0.10296	0.003;0.003;0.003;0.001;0.001	B;B;B;B;B	0.08055	0.003;0.002;0.003;0.002;0.002	T	0.18116	-1.0347	10	0.41790	T	0.15	-12.9664	10.319	0.43753	0.4636:0.0:0.5364:0.0	.	126;126;126;126;126	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	H	126	ENSP00000372290:R126H;ENSP00000324587:R126H;ENSP00000443617:R126H;ENSP00000427505:R126H	ENSP00000324587:R126H	R	+	2	0	FAM193A	2618296	0.281000	0.24258	0.112000	0.21494	0.140000	0.21249	0.661000	0.25023	-0.355000	0.08199	-3.193000	0.00055	CGC		0.622	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704		Missense_Mutation
SKP2	6502	broad.mit.edu	37	5	36177066	36177066	+	Splice_Site	SNP	G	G	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr5:36177066G>C	ENST00000274255.6	+	8	1097		c.e8-1		SKP2_ENST00000546211.1_Splice_Site|SKP2_ENST00000508514.1_Splice_Site|SKP2_ENST00000274254.5_Splice_Site	NM_005983.3	NP_005974.2	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2, E3 ubiquitin protein ligase						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|cellular response to cell-matrix adhesion (GO:0071460)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	identical protein binding (GO:0042802)|ubiquitin-protein transferase activity (GO:0004842)	p.?(1)		breast(1)|central_nervous_system(2)|ovary(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCTTTTCCTAGATCTCTCTAC	0.313																																																1	Unknown(1)	ovary(1)	5											190.0	173.0	179.0					5																	36177066		2202	4299	6501	36212823	SO:0001630	splice_region_variant	6502			U33761	CCDS3915.1, CCDS3916.1, CCDS58944.1	5p13	2012-02-23	2012-02-23		ENSG00000145604	ENSG00000145604		"""F-boxes / Leucine-rich repeats"""	10901	protein-coding gene	gene with protein product		601436	"""S-phase kinase-associated protein 2 (p45)"""			8646875	Standard	NM_005983		Approved	FBXL1, FBL1, p45	uc003jkc.2	Q13309	OTTHUMG00000131106	ENST00000274255.6:c.902-1G>C	5.37:g.36177066G>C			36212823	A8K5E0|B4DJT4|Q8TDZ0|Q8TDZ1|Q9BV69	Splice_Site_SNP	SNP	ENST00000274255.6	37	CCDS3916.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	17.50	3.403984	0.62288	.	.	ENSG00000145604	ENST00000274254;ENST00000274255;ENST00000308927;ENST00000508514;ENST00000546211	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9787	0.80089	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SKP2	36212823	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	5.936000	0.70153	2.504000	0.84457	0.557000	0.71058	.		0.313	SKP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253769.2	NM_005983	Intron	Splice_Site_SNP
CMYA5	202333	broad.mit.edu	37	5	79033753	79033753	+	Silent	SNP	A	A	G			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr5:79033753A>G	ENST00000446378.2	+	2	9196	c.9165A>G	c.(9163-9165)aaA>aaG	p.K3055K		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3055					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.K3055K(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ATTTTGAAAAATATACTTTGA	0.338																																																1	Substitution - coding silent(1)	ovary(1)	5											56.0	54.0	54.0					5																	79033753		1793	4055	5848	79069509	SO:0001819	synonymous_variant	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.9165A>G	5.37:g.79033753A>G			79069509	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	37	CCDS47238.1	SNP	4	Broad																																																																																				0.338	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610		Silent
EDIL3	10085	broad.mit.edu	37	5	83402634	83402634	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr5:83402634G>T	ENST00000296591.5	-	6	902	c.484C>A	c.(484-486)Ctg>Atg	p.L162M	EDIL3_ENST00000380138.3_Missense_Mutation_p.L152M	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	162	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)	p.L162M(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		TCAATTCCCAGTGGGCCTGAG	0.378																																																1	Substitution - Missense(1)	ovary(1)	5											128.0	136.0	133.0					5																	83402634		2203	4299	6502	83438390	SO:0001583	missense	10085			U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.484C>A	5.37:g.83402634G>T	ENSP00000296591:p.Leu162Met		83438390	B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	37	CCDS4062.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	A	9.716	1.158368	0.21454	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.99270	-5.66;-5.66	5.86	0.768	0.18487	Coagulation factor 5/8 C-terminal type domain (2);Galactose-binding domain-like (1);	0.075219	0.56097	D	0.000033	D	0.99190	0.9719	M	0.80332	2.49	0.36018	D	0.838573	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.947	D	0.99899	1.1156	10	0.37606	T	0.19	-13.5878	12.4726	0.55795	0.4876:0.0:0.5124:0.0	.	152;162	O43854-2;O43854	.;EDIL3_HUMAN	M	162;152	ENSP00000296591:L162M;ENSP00000369483:L152M	ENSP00000296591:L162M	L	-	1	2	EDIL3	83438390	0.320000	0.24616	0.229000	0.23960	0.226000	0.24999	0.726000	0.25984	-0.333000	0.08476	-1.007000	0.02485	CTG		0.378	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711		Missense_Mutation
ADAMTS19	171019	broad.mit.edu	37	5	129019833	129019833	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr5:129019833G>C	ENST00000274487.4	+	18	2812	c.2667G>C	c.(2665-2667)caG>caC	p.Q889H	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	889	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Q889H(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TTCAGGATCAGAATTATGGTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	5											150.0	144.0	146.0					5																	129019833		2203	4300	6503	129047732	SO:0001583	missense	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2667G>C	5.37:g.129019833G>C	ENSP00000274487:p.Gln889His		129047732		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248602	0.59103	.	.	ENSG00000145808	ENST00000274487	T	0.52526	0.66	4.42	2.57	0.30868	ADAM-TS Spacer 1 (1);	0.078771	0.51477	N	0.000098	T	0.57475	0.2056	L	0.52266	1.64	0.44862	D	0.997879	D	0.89917	1.0	D	0.74348	0.983	T	0.53746	-0.8395	9	.	.	.	.	10.018	0.42027	0.0768:0.1393:0.7839:0.0	.	889	Q8TE59	ATS19_HUMAN	H	889	ENSP00000274487:Q889H	.	Q	+	3	2	ADAMTS19	129047732	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	2.858000	0.48356	0.762000	0.33152	0.650000	0.86243	CAG		0.408	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638		Missense_Mutation
MGAT1	4245	broad.mit.edu	37	5	180219292	180219292	+	Missense_Mutation	SNP	G	G	A	rs149151044	byFrequency	TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr5:180219292G>A	ENST00000446023.2	-	3	1430	c.680C>T	c.(679-681)cCg>cTg	p.P227L	MGAT1_ENST00000333055.3_Missense_Mutation_p.P227L|MGAT1_ENST00000307826.4_Missense_Mutation_p.P227L|MGAT1_ENST00000427865.2_Missense_Mutation_p.P227L|MGAT1_ENST00000393340.3_Missense_Mutation_p.P227L	NM_001114617.1|NM_001114618.1	NP_001108089.1|NP_001108090.1	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	227					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine catabolic process (GO:0006049)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	acetylglucosaminyltransferase activity (GO:0008375)|alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0003827)|metal ion binding (GO:0046872)	p.P227L(1)		endometrium(1)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	13	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTCAGCAGCGGATAGGTGGC	0.657													G|||	2	0.000399361	0.0008	0.0	5008	,	,		17082	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5						G	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	2,4382		0,2,2190	37.0	39.0	38.0		680,680,680,680,680	5.6	1.0	5	dbSNP_134	38	0,8560		0,0,4280	no	missense,missense,missense,missense,missense	MGAT1	NM_001114617.1,NM_001114618.1,NM_001114619.1,NM_001114620.1,NM_002406.3	98,98,98,98,98	0,2,6470	AA,AG,GG		0.0,0.0456,0.0155	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	227/446,227/446,227/446,227/446,227/446	180219292	2,12942	2192	4280	6472	180151898	SO:0001583	missense	4245			M61829	CCDS4458.1	5q35.3	2013-02-25			ENSG00000131446	ENSG00000131446	2.4.1.101	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7044	protein-coding gene	gene with protein product		160995		MGAT, GLYT1		1827260	Standard	NM_002406		Approved	GNT-1, GLCNAC-TI	uc003mmg.4	P26572	OTTHUMG00000130937	ENST00000446023.2:c.680C>T	5.37:g.180219292G>A	ENSP00000404718:p.Pro227Leu		180151898	A8K404|B3KRU8|D3DWR1|Q6IBE3	Missense_Mutation	SNP	ENST00000446023.2	37	CCDS4458.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	17.65	3.441180	0.63067	4.56E-4	0.0	ENSG00000131446	ENST00000333055;ENST00000307826;ENST00000446023;ENST00000393340;ENST00000452920;ENST00000427865	D;D;D;D;D	0.84944	-1.92;-1.92;-1.92;-1.92;-1.92	5.56	5.56	0.83823	.	0.126969	0.53938	D	0.000059	D	0.91246	0.7241	M	0.85630	2.765	0.80722	D	1	D	0.76494	0.999	P	0.59221	0.854	D	0.91912	0.5540	10	0.66056	D	0.02	-31.5115	13.0354	0.58867	0.0:0.1618:0.8382:0.0	.	227	P26572	MGAT1_HUMAN	L	227;227;227;227;84;227	ENSP00000332073:P227L;ENSP00000311888:P227L;ENSP00000404718:P227L;ENSP00000377010:P227L;ENSP00000402838:P227L	ENSP00000311888:P227L	P	-	2	0	MGAT1	180151898	1.000000	0.71417	0.979000	0.43373	0.661000	0.39034	7.014000	0.76380	2.777000	0.95525	0.655000	0.94253	CCG		0.657	MGAT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368189.1	NM_001114618		Missense_Mutation
GFOD1	54438	broad.mit.edu	37	6	13365742	13365742	+	Missense_Mutation	SNP	C	C	T	rs369826547		TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr6:13365742C>T	ENST00000379287.3	-	2	1070	c.406G>A	c.(406-408)Gag>Aag	p.E136K	GFOD1_ENST00000379284.1_Missense_Mutation_p.E33K	NM_018988.3	NP_061861.1	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain containing 1	136						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)	p.E136K(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)	18	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			TAGCCCTCCTCGATCAGCTGC	0.637																																																1	Substitution - Missense(1)	ovary(1)	6						C	LYS/GLU,LYS/GLU,LYS/GLU	0,4406		0,0,2203	51.0	47.0	49.0		97,97,406	4.3	1.0	6		49	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	GFOD1	NM_001242628.1,NM_001242630.1,NM_018988.3	56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	33/288,33/288,136/391	13365742	1,13005	2203	4300	6503	13473721	SO:0001583	missense	54438			AK000337	CCDS4524.1, CCDS56397.1, CCDS64351.1	6p24.1-p23	2013-09-19			ENSG00000145990	ENSG00000145990			21096	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 114"""	C6orf114			Standard	NM_018988		Approved	FLJ20330, ADG-90	uc003nat.2	Q9NXC2	OTTHUMG00000014276	ENST00000379287.3:c.406G>A	6.37:g.13365742C>T	ENSP00000368589:p.Glu136Lys		13473721	A8E4L6|Q5T058|Q96JD4|Q9H5K2	Missense_Mutation	SNP	ENST00000379287.3	37	CCDS4524.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	11.51	1.659788	0.29515	0.0	1.16E-4	ENSG00000145990	ENST00000379287;ENST00000379284	T;T	0.44482	0.92;0.92	5.15	4.26	0.50523	Oxidoreductase, C-terminal (1);NAD(P)-binding domain (1);	0.107977	0.64402	D	0.000006	T	0.22627	0.0546	L	0.59436	1.845	0.48632	D	0.99968	B	0.12630	0.006	B	0.14023	0.01	T	0.05784	-1.0864	10	0.23302	T	0.38	-18.4433	11.6855	0.51483	0.0:0.6028:0.3972:0.0	.	136	Q9NXC2	GFOD1_HUMAN	K	136;33	ENSP00000368589:E136K;ENSP00000368586:E33K	ENSP00000368586:E33K	E	-	1	0	GFOD1	13473721	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.025000	0.49681	2.377000	0.81083	0.650000	0.86243	GAG		0.637	GFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039902.1	NM_018988		Missense_Mutation
RPL10A	4736	broad.mit.edu	37	6	35436212	35436212	+	Start_Codon_SNP	SNP	A	A	G	rs138610837	byFrequency	TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr6:35436212A>G	ENST00000322203.6	+	1	28	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a	1					anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.M1V(1)		breast(1)|large_intestine(2)|ovary(1)	4						GTGAGAAGCCATGAGGTGAGT	0.612											OREG0017378	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	6											106.0	95.0	99.0					6																	35436212		2203	4300	6503	35544190	SO:0001582	initiator_codon_variant	4736			U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.1A>G	6.37:g.35436212A>G	ENSP00000363018:p.Met1Val	855	35544190	B2R801|P52859|P53025|Q5TZT6|Q8J013	Missense_Mutation	SNP	ENST00000322203.6	37	CCDS4806.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	12.61	1.989220	0.35131	.	.	ENSG00000198755	ENST00000322203	T	0.41758	0.99	4.64	4.64	0.57946	.	0.338403	0.25200	N	0.032400	T	0.29190	0.0726	.	.	.	0.80722	D	1	P	0.34743	0.466	B	0.40477	0.33	T	0.30504	-0.9976	9	0.87932	D	0	.	10.625	0.45502	1.0:0.0:0.0:0.0	.	1	P62906	RL10A_HUMAN	V	1	ENSP00000363018:M1V	ENSP00000363018:M1V	M	+	1	0	RPL10A	35544190	0.986000	0.35501	0.939000	0.37840	0.331000	0.28603	2.848000	0.48278	2.071000	0.62044	0.402000	0.26972	ATG		0.612	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040283.1	NM_007104	Missense_Mutation	Missense_Mutation
IBTK	25998	broad.mit.edu	37	6	82924180	82924180	+	Silent	SNP	G	G	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr6:82924180G>A	ENST00000306270.7	-	12	2517	c.1968C>T	c.(1966-1968)aaC>aaT	p.N656N	IBTK_ENST00000503631.1_Intron|IBTK_ENST00000510291.1_Silent_p.N656N	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	656					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)	p.N656N(1)		central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		ATTCTTCTGGGTTTTTGTTTA	0.313																																																1	Substitution - coding silent(1)	ovary(1)	6											83.0	82.0	82.0					6																	82924180		2203	4299	6502	82980899	SO:0001819	synonymous_variant	25998			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.1968C>T	6.37:g.82924180G>A			82980899	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Silent	SNP	ENST00000306270.7	37	CCDS34490.1	SNP	44	Broad																																																																																				0.313	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525		Silent
EPHA7	2045	broad.mit.edu	37	6	93979277	93979277	+	Silent	SNP	A	A	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr6:93979277A>T	ENST00000369303.4	-	7	1735	c.1551T>A	c.(1549-1551)gcT>gcA	p.A517A		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	517	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.A517A(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CAGCAGTAAAAGCCCGAATCT	0.403																																																1	Substitution - coding silent(1)	ovary(1)	6											148.0	143.0	145.0					6																	93979277		2203	4299	6502	94035998	SO:0001819	synonymous_variant	2045			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1551T>A	6.37:g.93979277A>T			94035998	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Silent	SNP	ENST00000369303.4	37	CCDS5031.1	SNP	3	Broad																																																																																				0.403	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			Silent
POPDC3	64208	broad.mit.edu	37	6	105606438	105606438	+	Silent	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr6:105606438C>T	ENST00000254765.3	-	4	1061	c.783G>A	c.(781-783)cgG>cgA	p.R261R	BVES-AS1_ENST00000369122.3_RNA|BVES-AS1_ENST00000580854.1_RNA|POPDC3_ENST00000474760.1_5'UTR|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000369120.2_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3	261					regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)		p.R261R(1)		NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				AGTTGGGTAGCCGAATATCAT	0.388																																																1	Substitution - coding silent(1)	ovary(1)	6											134.0	133.0	133.0					6																	105606438		2203	4300	6503	105713131	SO:0001819	synonymous_variant	64208			BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.783G>A	6.37:g.105606438C>T			105713131	B2RA98|Q5T3Y8|Q8TBW6	Silent	SNP	ENST00000254765.3	37	CCDS5052.1	SNP	26	Broad																																																																																				0.388	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041651.1	NM_022361		Silent
GJA1	2697	broad.mit.edu	37	6	121769073	121769073	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr6:121769073C>A	ENST00000282561.3	+	2	1237	c.1080C>A	c.(1078-1080)gaC>gaA	p.D360E		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	360					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)	p.D360E(1)		autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	CCATTGTGGACCAGCGACCTT	0.493																																																1	Substitution - Missense(1)	ovary(1)	6											64.0	69.0	68.0					6																	121769073		2200	4295	6495	121810772	SO:0001583	missense	2697			BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.1080C>A	6.37:g.121769073C>A	ENSP00000282561:p.Asp360Glu		121810772	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	CCDS5123.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	15.91	2.973415	0.53614	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	D	0.86769	-2.17	4.75	1.95	0.26073	.	0.000000	0.64402	D	0.000001	T	0.81302	0.4794	L	0.27053	0.805	0.45580	D	0.998528	P	0.38767	0.646	P	0.56216	0.794	T	0.80623	-0.1300	10	0.54805	T	0.06	.	9.905	0.41370	0.0:0.7757:0.0:0.2243	.	360	P17302	CXA1_HUMAN	E	344;360	ENSP00000282561:D360E	ENSP00000282561:D360E	D	+	3	2	GJA1	121810772	0.998000	0.40836	1.000000	0.80357	0.960000	0.62799	0.553000	0.23391	0.302000	0.22762	0.484000	0.47621	GAC		0.493	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165		Missense_Mutation
STX11	8676	broad.mit.edu	37	6	144508227	144508227	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr6:144508227G>A	ENST00000367568.4	+	2	646	c.463G>A	c.(463-465)Gac>Aac	p.D155N		NM_003764.3	NP_003755.2	O75558	STX11_HUMAN	syntaxin 11	155					cytotoxic T cell degranulation (GO:0043316)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|natural killer cell degranulation (GO:0043320)|neutrophil degranulation (GO:0043312)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	SNAP receptor activity (GO:0005484)	p.D155N(2)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	12				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)		GAAGCAGCGCGACAACTGCAA	0.622									Familial Hemophagocytic Lymphohistiocytosis																																							2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	6											47.0	45.0	46.0					6																	144508227		2203	4300	6503	144549920	SO:0001583	missense	8676	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AF044309	CCDS5205.1	6q24.1	2014-09-17			ENSG00000135604	ENSG00000135604			11429	protein-coding gene	gene with protein product		605014				9553086	Standard	NM_003764		Approved		uc003qks.4	O75558	OTTHUMG00000015739	ENST00000367568.4:c.463G>A	6.37:g.144508227G>A	ENSP00000356540:p.Asp155Asn		144549920	E1P598|O75378|O95148|Q5TCL6	Missense_Mutation	SNP	ENST00000367568.4	37	CCDS5205.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	19.58	3.853927	0.71719	.	.	ENSG00000135604	ENST00000367568	T	0.22336	1.96	5.61	4.71	0.59529	t-SNARE (1);Syntaxin, N-terminal (1);	0.452872	0.26311	N	0.025117	T	0.10035	0.0246	L	0.46157	1.445	0.53005	D	0.999967	B	0.33238	0.403	B	0.20384	0.029	T	0.03278	-1.1053	10	0.72032	D	0.01	-10.834	15.8989	0.79356	0.0:0.1359:0.8641:0.0	.	155	O75558	STX11_HUMAN	N	155	ENSP00000356540:D155N	ENSP00000356540:D155N	D	+	1	0	STX11	144549920	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.641000	0.67881	1.310000	0.45006	0.655000	0.94253	GAC		0.622	STX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042544.1			Missense_Mutation
GRM1	2911	broad.mit.edu	37	6	146350887	146350887	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr6:146350887G>T	ENST00000282753.1	+	1	469	c.234G>T	c.(232-234)agG>agT	p.R78S	GRM1_ENST00000492807.2_Missense_Mutation_p.R78S|GRM1_ENST00000361719.2_Missense_Mutation_p.R78S|GRM1_ENST00000392299.2_Missense_Mutation_p.R78S|GRM1_ENST00000507907.1_Missense_Mutation_p.R78S|GRM1_ENST00000355289.4_Missense_Mutation_p.R78S			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	78					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.R78S(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GCATCCAGAGGGTGGAGGCCA	0.597																																																1	Substitution - Missense(1)	ovary(1)	6											74.0	64.0	67.0					6																	146350887		2203	4300	6503	146392580	SO:0001583	missense	2911			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.234G>T	6.37:g.146350887G>T	ENSP00000282753:p.Arg78Ser		146392580	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	17.45	3.391481	0.62066	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	T;T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14	5.57	2.34	0.29019	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.75606	0.3872	M	0.90705	3.14	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;1.0	T	0.80542	-0.1336	10	0.87932	D	0	.	11.6644	0.51366	0.3185:0.0:0.6815:0.0	.	78;78;73;78	F8W805;Q13255;Q59HC2;Q13255-2	.;GRM1_HUMAN;.;.	S	78	ENSP00000354896:R78S;ENSP00000376119:R78S;ENSP00000424095:R78S;ENSP00000282753:R78S;ENSP00000347437:R78S;ENSP00000425599:R78S	ENSP00000282753:R78S	R	+	3	2	GRM1	146392580	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	0.439000	0.21575	0.697000	0.31718	0.561000	0.74099	AGG		0.597	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		Missense_Mutation
PKD1L1	168507	broad.mit.edu	37	7	47944083	47944083	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr7:47944083A>C	ENST00000289672.2	-	12	1873	c.1823T>G	c.(1822-1824)gTg>gGg	p.V608G		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	608	PKD 2. {ECO:0000255|PROSITE- ProRule:PRU00151}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.V608G(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CTCAAAGGCCACACTGGCATT	0.572																																																1	Substitution - Missense(1)	ovary(1)	7											104.0	81.0	88.0					7																	47944083		2203	4300	6503	47910608	SO:0001583	missense	168507			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1823T>G	7.37:g.47944083A>C	ENSP00000289672:p.Val608Gly		47910608	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	20.4	3.990972	0.74703	.	.	ENSG00000158683	ENST00000289672	T	0.70282	-0.47	5.12	5.12	0.69794	PKD/Chitinase domain (1);PKD domain (3);	0.633137	0.14598	N	0.309817	D	0.84880	0.5570	M	0.83953	2.67	0.53005	D	0.999966	D	0.89917	1.0	D	0.83275	0.996	D	0.85837	0.1395	10	0.87932	D	0	-25.2109	13.2066	0.59800	1.0:0.0:0.0:0.0	.	608	Q8TDX9	PK1L1_HUMAN	G	608	ENSP00000289672:V608G	ENSP00000289672:V608G	V	-	2	0	PKD1L1	47910608	0.994000	0.37717	0.497000	0.27552	0.881000	0.50899	4.162000	0.58177	2.082000	0.62665	0.477000	0.44152	GTG		0.572	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		Missense_Mutation
SAMD9L	219285	broad.mit.edu	37	7	92761213	92761213	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr7:92761213C>A	ENST00000318238.4	-	5	5288	c.4072G>T	c.(4072-4074)Gaa>Taa	p.E1358*	SAMD9L_ENST00000411955.1_Nonsense_Mutation_p.E1358*|SAMD9L_ENST00000437805.1_Nonsense_Mutation_p.E1358*	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1358					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.E1358*(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			ACTATACTTTCCATGGTGGTA	0.393																																																1	Substitution - Nonsense(1)	ovary(1)	7											136.0	134.0	135.0					7																	92761213		2203	4300	6503	92599149	SO:0001587	stop_gained	219285			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.4072G>T	7.37:g.92761213C>A	ENSP00000326247:p.Glu1358*		92599149	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Nonsense_Mutation	SNP	ENST00000318238.4	37	CCDS34681.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	49	15.501581	0.99836	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805;ENST00000394472	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-20.342	18.5581	0.91091	0.0:1.0:0.0:0.0	.	.	.	.	X	1358;1358;1358;180	.	ENSP00000326247:E1358X	E	-	1	0	SAMD9L	92599149	0.998000	0.40836	0.998000	0.56505	0.103000	0.19146	0.934000	0.28910	2.716000	0.92895	0.467000	0.42956	GAA		0.393	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		Nonsense_Mutation
COL26A1	136227	broad.mit.edu	37	7	101196625	101196625	+	RNA	SNP	G	G	T	rs370309900		TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr7:101196625G>T	ENST00000397927.3	+	0	1261				COL26A1_ENST00000313669.7_RNA|COL26A1_ENST00000528707.1_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.G350W(1)									TGGCGTGAAGGGGGAAGAAGG	0.622																																																1	Substitution - Missense(1)	ovary(1)	7											74.0	95.0	88.0					7																	101196625		2151	4249	6400	100983345			136227			AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101196625G>T			100983345	Q32M90	Missense_Mutation	SNP	ENST00000397927.3	37		SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633655	0.47049	.	.	ENSG00000160963	ENST00000313669	D	0.99637	-6.29	3.44	2.5	0.30297	.	0.981377	0.08269	N	0.971707	D	0.99711	0.9889	H	0.98199	4.17	0.09310	N	1	D;D	0.56287	0.975;0.975	P;P	0.59948	0.866;0.866	D	0.96294	0.9216	10	0.87932	D	0	.	7.92	0.29839	0.0:0.0:0.7536:0.2464	.	350;350	Q96A83;C9JPW4	EMID2_HUMAN;.	W	350	ENSP00000318234:G350W	ENSP00000318234:G350W	G	+	1	0	EMID2	100983345	0.989000	0.36119	0.023000	0.16930	0.301000	0.27625	2.321000	0.43805	0.504000	0.28082	0.655000	0.94253	GGG		0.622	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000315898.2	NM_133457		Missense_Mutation
HR	55806	broad.mit.edu	37	8	21985072	21985072	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr8:21985072C>A	ENST00000381418.4	-	3	2363	c.883G>T	c.(883-885)Gct>Tct	p.A295S	HR_ENST00000518377.1_5'Flank|HR_ENST00000312841.8_Missense_Mutation_p.A295S	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	295					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.A295S(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		CCTGGCCCAGCCCAGACGTTG	0.657																																																1	Substitution - Missense(1)	ovary(1)	8											33.0	36.0	35.0					8																	21985072		2203	4299	6502	22041017	SO:0001583	missense	55806			AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.883G>T	8.37:g.21985072C>A	ENSP00000370826:p.Ala295Ser		22041017	Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	ENST00000381418.4	37	CCDS6022.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	12.39	1.924682	0.34002	.	.	ENSG00000168453	ENST00000381418;ENST00000312841	T;T	0.72725	-0.68;-0.68	5.8	-0.537	0.11872	.	0.546471	0.17940	N	0.156882	T	0.50769	0.1635	L	0.32530	0.975	0.19775	N	0.999957	P;B	0.34724	0.465;0.335	B;B	0.31101	0.124;0.058	T	0.40421	-0.9564	10	0.52906	T	0.07	-0.0612	5.1593	0.15053	0.0:0.3631:0.1663:0.4706	.	295;295	O43593-2;O43593	.;HAIR_HUMAN	S	295	ENSP00000370826:A295S;ENSP00000326765:A295S	ENSP00000326765:A295S	A	-	1	0	HR	22041017	0.001000	0.12720	0.669000	0.29828	0.427000	0.31564	-0.985000	0.03751	-0.169000	0.10834	0.462000	0.41574	GCT		0.657	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214213.1			Missense_Mutation
ST18	9705	broad.mit.edu	37	8	53071594	53071594	+	Missense_Mutation	SNP	C	C	T	rs144331817	byFrequency	TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr8:53071594C>T	ENST00000276480.7	-	15	2353	c.1670G>A	c.(1669-1671)cGt>cAt	p.R557H		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	557					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R557H(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				AGAGCTGGCACGGCCAGGGCT	0.522													C|||	20	0.00399361	0.0	0.0	5008	,	,		16719	0.0198		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	8						C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	97.0	103.0	101.0		1670	4.1	1.0	8	dbSNP_134	101	0,8600		0,0,4300	yes	missense	ST18	NM_014682.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	557/1048	53071594	1,13005	2203	4300	6503	53234147	SO:0001583	missense	9705			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1670G>A	8.37:g.53071594C>T	ENSP00000276480:p.Arg557His		53234147	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	SNP	19	Broad	15	0.006868131868131868	0	0.0	0	0.0	15	0.026223776223776224	0	0.0	C	13.13	2.145494	0.37825	2.27E-4	0.0	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.48522	0.81;0.81	6.08	4.05	0.47172	Myelin transcription factor 1 (1);	0.212625	0.48767	N	0.000170	T	0.08223	0.0205	N	0.12471	0.22	0.33350	D	0.570999	B;B	0.19583	0.037;0.002	B;B	0.12837	0.008;0.002	T	0.15292	-1.0442	10	0.11794	T	0.64	-5.9118	5.4498	0.16556	0.0:0.571:0.0:0.429	.	557;557	E5RHS3;O60284	.;ST18_HUMAN	H	557	ENSP00000276480:R557H;ENSP00000428521:R557H	ENSP00000276480:R557H	R	-	2	0	ST18	53234147	1.000000	0.71417	0.986000	0.45419	0.962000	0.63368	0.743000	0.26231	1.328000	0.45358	0.655000	0.94253	CGT		0.522	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1			Missense_Mutation
BICD2	23299	broad.mit.edu	37	9	95481277	95481277	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr9:95481277G>T	ENST00000375512.3	-	5	1717	c.1650C>A	c.(1648-1650)aaC>aaA	p.N550K	BICD2_ENST00000356884.6_Missense_Mutation_p.N550K	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	550					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						GCATGACACGGTTGGGTGTCT	0.677																																																0			9											89.0	71.0	77.0					9																	95481277		2203	4300	6503	94521098	SO:0001583	missense	23299			AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.1650C>A	9.37:g.95481277G>T	ENSP00000364662:p.Asn550Lys		94521098	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	ENST00000375512.3	37	CCDS6700.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	14.70	2.612539	0.46631	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.44881	0.91;0.91	5.39	2.47	0.30058	.	0.192203	0.52532	D	0.000061	T	0.37046	0.0989	M	0.66297	2.02	0.50632	D	0.999885	B;B	0.20780	0.039;0.048	B;B	0.25987	0.039;0.065	T	0.09640	-1.0665	10	0.21540	T	0.41	-30.4448	7.0899	0.25277	0.1608:0.1422:0.697:0.0	.	550;550	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	K	550	ENSP00000349351:N550K;ENSP00000364662:N550K	ENSP00000349351:N550K	N	-	3	2	BICD2	94521098	1.000000	0.71417	0.992000	0.48379	0.976000	0.68499	1.853000	0.39358	0.324000	0.23333	0.561000	0.74099	AAC		0.677	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055508.1	NM_015250		Missense_Mutation
SLC34A3	142680	broad.mit.edu	37	9	140126594	140126594	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chr9:140126594C>A	ENST00000538474.1	+	3	380	c.156C>A	c.(154-156)gaC>gaA	p.D52E	SLC34A3_ENST00000361134.2_Missense_Mutation_p.D52E	NM_001177316.1|NM_001177317.1	NP_001170787|NP_001170788	Q8N130	NPT2C_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 3	52					cellular phosphate ion homeostasis (GO:0030643)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)	p.D52E(1)		kidney(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		AGCTGAAGGACACAAGCCAGC	0.632																																																1	Substitution - Missense(1)	ovary(1)	9											93.0	98.0	96.0					9																	140126594		2203	4300	6503	139246415	SO:0001583	missense	142680			AB055000	CCDS7038.1	9q34.3	2013-07-17	2013-07-17		ENSG00000198569	ENSG00000198569		"""Solute carriers"""	20305	protein-coding gene	gene with protein product		609826	"""solute carrier family 34 (sodium phosphate), member 3"""			11880379, 16358215, 16358214	Standard	NM_080877		Approved	NPTIIc, FLJ38680	uc004cmf.1	Q8N130	OTTHUMG00000131780	ENST00000538474.1:c.156C>A	9.37:g.140126594C>A	ENSP00000442397:p.Asp52Glu		139246415	A2BFA1	Missense_Mutation	SNP	ENST00000538474.1	37	CCDS7038.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	c	9.372	1.070817	0.20147	.	.	ENSG00000198569	ENST00000538474;ENST00000361134	T;T	0.33654	1.4;1.4	3.58	1.38	0.22167	.	0.726571	0.11600	U	0.547882	T	0.28067	0.0692	M	0.71036	2.16	0.09310	N	1	B	0.30482	0.281	B	0.19946	0.027	T	0.21381	-1.0247	10	0.25106	T	0.35	-12.8465	1.8216	0.03112	0.2123:0.4802:0.1812:0.1262	.	52	Q8N130	NPT2C_HUMAN	E	52	ENSP00000442397:D52E;ENSP00000355353:D52E	ENSP00000355353:D52E	D	+	3	2	SLC34A3	139246415	0.000000	0.05858	0.495000	0.27527	0.650000	0.38633	-0.563000	0.05943	0.666000	0.31087	0.306000	0.20318	GAC		0.632	SLC34A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254712.1	NM_080877		Missense_Mutation
CTPS2	56474	broad.mit.edu	37	X	16696534	16696534	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chrX:16696534C>T	ENST00000443824.1	-	10	1788	c.1045G>A	c.(1045-1047)Gag>Aag	p.E349K	CTPS2_ENST00000359276.4_Missense_Mutation_p.E349K|CTPS2_ENST00000380241.3_Missense_Mutation_p.E349K	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	349	Glutamine amidotransferase type-1. {ECO:0000255|PROSITE-ProRule:PRU00605}.				'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)	p.E349K(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					ACAGGGTCCTCGGTTTCAGTG	0.403																																																1	Substitution - Missense(1)	ovary(1)	X											117.0	90.0	99.0					X																	16696534		2203	4300	6503	16606455	SO:0001583	missense	56474			AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.1045G>A	X.37:g.16696534C>T	ENSP00000401264:p.Glu349Lys		16606455	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Missense_Mutation	SNP	ENST00000443824.1	37	CCDS14175.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	9.753	1.168074	0.21621	.	.	ENSG00000047230	ENST00000443824;ENST00000380241;ENST00000359276;ENST00000380207	T;T;T	0.43688	0.94;0.94;0.94	5.86	1.73	0.24493	Glutamine amidotransferase type 1 (2);	0.295685	0.32671	N	0.005789	T	0.31482	0.0798	L	0.39566	1.225	0.53688	D	0.999975	B	0.16603	0.018	B	0.13407	0.009	T	0.07790	-1.0754	10	0.38643	T	0.18	-12.9396	10.3428	0.43889	0.0:0.5578:0.3702:0.072	.	349	Q9NRF8	PYRG2_HUMAN	K	349;349;349;15	ENSP00000401264:E349K;ENSP00000369590:E349K;ENSP00000352222:E349K	ENSP00000352222:E349K	E	-	1	0	CTPS2	16606455	0.997000	0.39634	0.376000	0.26042	0.152000	0.21847	3.600000	0.54052	0.193000	0.20303	0.594000	0.82650	GAG		0.403	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055906.1	NM_019857		Missense_Mutation
WAS	7454	broad.mit.edu	37	X	48547366	48547366	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chrX:48547366C>T	ENST00000376701.4	+	10	1324	c.1249C>T	c.(1249-1251)Cct>Tct	p.P417S		NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	417					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)	p.P417S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				CCCACTCCCTCCTGCTCTGGT	0.697			"""Mis, N, F, S"""			lymphoma																																	X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Wiskott-Aldrich syndrome		L	1	Substitution - Missense(1)	ovary(1)	X											5.0	5.0	5.0					X																	48547366		2058	3987	6045	48432310	SO:0001583	missense	7454			AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.1249C>T	X.37:g.48547366C>T	ENSP00000365891:p.Pro417Ser		48432310	Q9BU11|Q9UNJ9	Missense_Mutation	SNP	ENST00000376701.4	37	CCDS14303.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	9.344	1.063771	0.20067	.	.	ENSG00000015285	ENST00000376701	D	0.99771	-6.71	4.7	3.84	0.44239	.	0.000000	0.53938	D	0.000049	D	0.97763	0.9266	N	0.08118	0	0.34550	D	0.711205	B	0.12013	0.005	B	0.10450	0.005	D	0.99976	1.2200	10	0.19590	T	0.45	-1.5963	10.0883	0.42432	0.0:0.897:0.0:0.103	.	417	P42768	WASP_HUMAN	S	417	ENSP00000365891:P417S	ENSP00000365891:P417S	P	+	1	0	WAS	48432310	0.038000	0.19896	0.453000	0.27007	0.175000	0.22909	1.413000	0.34725	0.911000	0.36747	0.464000	0.42555	CCT		0.697	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083379.1	NM_000377		Missense_Mutation
LAS1L	81887	broad.mit.edu	37	X	64749507	64749507	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chrX:64749507A>C	ENST00000374811.3	-	5	806	c.766T>G	c.(766-768)Tgc>Ggc	p.C256G	LAS1L_ENST00000374804.5_Missense_Mutation_p.C214G|LAS1L_ENST00000374807.5_Missense_Mutation_p.C256G|LAS1L_ENST00000312391.8_Missense_Mutation_p.C256G	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	256					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.C256G(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						GCCTTTTTGCAATGAGAATCC	0.507																																																1	Substitution - Missense(1)	ovary(1)	X											134.0	100.0	112.0					X																	64749507		2203	4300	6503	64666232	SO:0001583	missense	81887			BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.766T>G	X.37:g.64749507A>C	ENSP00000363944:p.Cys256Gly		64666232	A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Missense_Mutation	SNP	ENST00000374811.3	37	CCDS14381.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	4.341	0.062754	0.08388	.	.	ENSG00000001497	ENST00000374807;ENST00000374811;ENST00000374804;ENST00000312391	.	.	.	5.18	1.42	0.22433	.	1.579610	0.03274	N	0.185162	T	0.28101	0.0693	N	0.22421	0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.11155	-1.0599	9	0.23302	T	0.38	.	3.7666	0.08624	0.6004:0.1875:0.2121:0.0	.	214;256;256	Q9Y4W2-3;Q9Y4W2-2;Q9Y4W2	.;.;LAS1L_HUMAN	G	256;256;214;256	.	ENSP00000308649:C256G	C	-	1	0	LAS1L	64666232	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	0.770000	0.26618	0.032000	0.15435	0.486000	0.48141	TGC		0.507	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056974.1	NM_031206		Missense_Mutation
EFNB1	1947	broad.mit.edu	37	X	68060252	68060252	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chrX:68060252C>T	ENST00000204961.4	+	5	1576	c.796C>T	c.(796-798)Cgc>Tgc	p.R266C		NM_004429.4	NP_004420.1	P98172	EFNB1_HUMAN	ephrin-B1	266					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|embryonic pattern specification (GO:0009880)|ephrin receptor signaling pathway (GO:0048013)|neural crest cell migration (GO:0001755)|positive regulation of T cell proliferation (GO:0042102)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ephrin receptor binding (GO:0046875)	p.R266C(2)		breast(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	22						ACTGAAGCTACGCAAGCGGCA	0.627																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	X											47.0	42.0	44.0					X																	68060252		2203	4300	6503	67976977	SO:0001583	missense	1947			U09303	CCDS14391.1	Xq12	2011-03-09			ENSG00000090776	ENSG00000090776		"""Ephrins"""	3226	protein-coding gene	gene with protein product		300035	"""craniofrontonasal syndrome (craniofrontonasal dysplasia)"""	EPLG2, CFNS		7774950, 16526919	Standard	NM_004429		Approved	LERK2, Elk-L	uc004dxd.4	P98172	OTTHUMG00000021751	ENST00000204961.4:c.796C>T	X.37:g.68060252C>T	ENSP00000204961:p.Arg266Cys		67976977	D3DVU0	Missense_Mutation	SNP	ENST00000204961.4	37	CCDS14391.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074672	0.76415	.	.	ENSG00000090776	ENST00000204961	D	0.92699	-3.09	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.95674	0.8593	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.96106	0.9073	10	0.87932	D	0	-23.9897	14.6783	0.68998	0.0:1.0:0.0:0.0	.	266	P98172	EFNB1_HUMAN	C	266	ENSP00000204961:R266C	ENSP00000204961:R266C	R	+	1	0	EFNB1	67976977	1.000000	0.71417	0.997000	0.53966	0.963000	0.63663	4.349000	0.59385	2.343000	0.79666	0.529000	0.55759	CGC		0.627	EFNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057029.1	NM_004429		Missense_Mutation
NONO	4841	broad.mit.edu	37	X	70514365	70514365	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chrX:70514365T>C	ENST00000276079.8	+	5	842	c.637T>C	c.(637-639)Ttc>Ctc	p.F213L	NONO_ENST00000490044.1_3'UTR|NONO_ENST00000373841.1_Missense_Mutation_p.F213L|NONO_ENST00000535149.1_Missense_Mutation_p.F124L|NONO_ENST00000373856.3_Missense_Mutation_p.F213L	NM_007363.4	NP_031389.3	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	213	DBHS.|RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian rhythm (GO:0007623)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mRNA processing (GO:0006397)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.F213L(1)	NONO/TFE3(2)	endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	19	Renal(35;0.156)					TGAAGGCTCCTTCCTGCTAAC	0.488			T	TFE3	papillary renal cancer																																		Dom	yes		X	Xq13.1	4841	"""non-POU domain containing, octamer-binding"""		E	1	Substitution - Missense(1)	ovary(1)	X											42.0	35.0	37.0					X																	70514365		2203	4300	6503	70431090	SO:0001583	missense	4841			L14599	CCDS14410.1, CCDS55445.1	Xq13.1	2014-06-13	2002-01-14		ENSG00000147140	ENSG00000147140		"""RNA binding motif (RRM) containing"""	7871	protein-coding gene	gene with protein product	"""Nuclear RNA-binding protein, 54-kD"", ""non-Pou domain-containing octamer (ATGCAAAT) binding protein"", ""protein phosphatase 1, regulatory subunit 114"""	300084	"""non-POU-domain-containing, octamer-binding"""			8371983, 9360842	Standard	NM_007363		Approved	NRB54, NMT55, P54NRB, P54, PPP1R114	uc004dzp.3	Q15233	OTTHUMG00000021798	ENST00000276079.8:c.637T>C	X.37:g.70514365T>C	ENSP00000276079:p.Phe213Leu		70431090	B7Z4C2|D3DVV4|F5GYZ3|O00201|P30807|Q12786|Q9BQC5	Missense_Mutation	SNP	ENST00000276079.8	37	CCDS14410.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	t	18.37	3.609526	0.66558	.	.	ENSG00000147140	ENST00000535149;ENST00000276079;ENST00000373856;ENST00000373841	T;T;T;T	0.21031	2.04;2.03;2.03;2.03	4.87	4.87	0.63330	RNA recognition motif domain (2);	0.109449	0.64402	D	0.000005	T	0.18964	0.0455	N	0.25890	0.77	0.80722	D	1	B	0.26672	0.156	B	0.33799	0.17	T	0.05920	-1.0856	10	0.49607	T	0.09	-4.7764	13.7303	0.62783	0.0:0.0:0.0:1.0	.	213	Q15233	NONO_HUMAN	L	124;213;213;213	ENSP00000441364:F124L;ENSP00000276079:F213L;ENSP00000362963:F213L;ENSP00000362947:F213L	ENSP00000276079:F213L	F	+	1	0	NONO	70431090	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.939000	0.70179	1.816000	0.52996	0.430000	0.28490	TTC		0.488	NONO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057138.1	NM_007363		Missense_Mutation
DACH2	117154	broad.mit.edu	37	X	85950139	85950139	+	Silent	SNP	T	T	A			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chrX:85950139T>A	ENST00000373125.4	+	5	888	c.888T>A	c.(886-888)gcT>gcA	p.A296A	DACH2_ENST00000510272.1_Silent_p.A77A|DACH2_ENST00000508860.1_Silent_p.A129A|DACH2_ENST00000373131.1_Silent_p.A283A	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	296					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A296A(1)|p.A283A(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						TTGGGGGTGCTCCAACCCTCA	0.498																																																2	Substitution - coding silent(2)	ovary(2)	X											63.0	47.0	52.0					X																	85950139		2203	4300	6503	85836795	SO:0001819	synonymous_variant	117154			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.888T>A	X.37:g.85950139T>A			85836795	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Silent	SNP	ENST00000373125.4	37	CCDS14455.1	SNP	54	Broad																																																																																				0.498	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281		Silent
FMR1NB	158521	broad.mit.edu	37	X	147090191	147090191	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-25-2400-01	TCGA-25-2400-10	g.chrX:147090191G>C	ENST00000370467.3	+	4	666	c.592G>C	c.(592-594)Gta>Cta	p.V198L	5S_rRNA_ENST00000364415.1_RNA	NM_152578.2	NP_689791.1	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	198						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)		p.V198L(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(7)|lung(10)|ovary(1)|skin(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					CCTTATCCTGGTATGTCTGCC	0.393																																																1	Substitution - Missense(1)	ovary(1)	X											238.0	175.0	196.0					X																	147090191		2203	4300	6503	146897883	SO:0001583	missense	158521				CCDS14683.1	Xq28	2009-03-25			ENSG00000176988	ENSG00000176988			26372	protein-coding gene	gene with protein product	"""cancer/testis antigen 37"""					12601173	Standard	NM_152578		Approved	FLJ25736, NY-SAR-35, CT37	uc004fcm.3	Q8N0W7	OTTHUMG00000022608	ENST00000370467.3:c.592G>C	X.37:g.147090191G>C	ENSP00000359498:p.Val198Leu		146897883	D3DWT3	Missense_Mutation	SNP	ENST00000370467.3	37	CCDS14683.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	0.141	-1.102304	0.01828	.	.	ENSG00000176988	ENST00000370467	T	0.29142	1.58	5.64	5.64	0.86602	.	0.380104	0.19337	N	0.116742	T	0.14227	0.0344	N	0.08118	0	0.26795	N	0.969317	B	0.31290	0.318	B	0.28638	0.092	T	0.11591	-1.0581	10	0.02654	T	1	-8.9887	13.9726	0.64250	0.0:0.0:1.0:0.0	.	198	Q8N0W7	FMR1N_HUMAN	L	198	ENSP00000359498:V198L	ENSP00000359498:V198L	V	+	1	0	FMR1NB	146897883	1.000000	0.71417	1.000000	0.80357	0.043000	0.13939	4.686000	0.61700	2.371000	0.80710	0.544000	0.68410	GTA		0.393	FMR1NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058667.1	NM_152578		Missense_Mutation
NBPF15	284565	broad.mit.edu	37	1	148753330	148753336	+	Frame_Shift_Del	DEL	TTATCTT	TTATCTT	-			TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-25-2400-01	TCGA-25-2400-10	g.chr1:148753330_148753336delTTATCTT	ENST00000417839.1	+	12	1537_1543	c.1347_1353delTTATCTT	c.(1345-1353)gattatcttfs	p.DYL449fs		NM_001102663.1	NP_001096133	Q5SXJ2	NBPFG_HUMAN		449	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4	all_hematologic(923;0.032)					CTCCTTCAGATTATCTTGAACTGCCTG	0.488																																																0			1								52,918		24,4,457						0.1	0.0			1	124,1206		55,14,596	no	frameshift	NBPF16	NM_001102663.1		79,18,1053	A1A1,A1R,RR		9.3233,5.3608,7.6522				176,2124				147019960	SO:0001589	frameshift_variant	728936																														ENST00000417839.1:c.1347_1353delTTATCTT	1.37:g.148753330_148753336delTTATCTT	ENSP00000395369:p.Asp449fs		147019954	A8MPT6	Frame_Shift_Del	DEL	ENST00000417839.1	37	CCDS41384.1	DEL	52	Broad																																																																																				0.488	NBPF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097693.1			Frame_Shift_Del
KRTAP5-5	439915	broad.mit.edu	37	11	1651586	1651615	+	In_Frame_Del	DEL	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	-	rs71025765|rs138562325|rs377326691|rs576867883|rs74396270|rs373726678|rs76143925|rs200516743	byFrequency	TCGA-25-2400-01	TCGA-25-2400-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-25-2400-01	TCGA-25-2400-10	g.chr11:1651586_1651615delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	ENST00000399676.2	+	1	554_583	c.516_545delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	c.(514-546)tcctgctgccagtccagctgctgtaagccttac>tcc	p.CCQSSCCKPY183del		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	183	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.Y182_P191delYCCQSSCCKP(1)|p.Y192_P201delYCCQSSCCKP(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GTGGGTCATCCTGCTGCCAGTCCAGCTGCTGTAAGCCTTACTGCTGCCAG	0.613																																																2	Deletion - In frame(2)	urinary_tract(1)|ovary(1)	11																																								1608191	SO:0001651	inframe_deletion	439915			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.516_545delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	11.37:g.1651586_1651615delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	ENSP00000382584:p.Cys183_Tyr192del		1608162	A8MWN2	In_Frame_Del	DEL	ENST00000399676.2	37	CCDS41592.1	DEL	24	Broad																																																																																				0.613	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1			In_Frame_Del
