#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
GABRD	2563	broad.mit.edu	37	1	1961430	1961430	+	Silent	SNP	G	G	C			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr1:1961430G>C	ENST00000378585.4	+	9	1151	c.1068G>C	c.(1066-1068)gtG>gtC	p.V356V		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	356					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.V356V(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGATGGACGTGAGGAACGCCA	0.701																																																1	Substitution - coding silent(1)	ovary(1)	1											51.0	50.0	50.0					1																	1961430		2199	4286	6485	1951290	SO:0001819	synonymous_variant	2563			BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.1068G>C	1.37:g.1961430G>C			1951290	Q8N4N9	Silent	SNP	ENST00000378585.4	37	CCDS36.1	SNP	45	Broad																																																																																				0.701	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098493.1	NM_000815		Silent
NES	10763	broad.mit.edu	37	1	156640107	156640107	+	Silent	SNP	G	G	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr1:156640107G>A	ENST00000368223.3	-	4	4005	c.3873C>T	c.(3871-3873)ctC>ctT	p.L1291L		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1291	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)	p.L1291L(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGGTCTCCCCGAGCTCATCCT	0.652																																																1	Substitution - coding silent(1)	ovary(1)	1											74.0	87.0	83.0					1																	156640107		2203	4300	6503	154906731	SO:0001819	synonymous_variant	10763			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3873C>T	1.37:g.156640107G>A			154906731	O00552|Q3LIF5|Q5SYZ6	Silent	SNP	ENST00000368223.3	37	CCDS1151.1	SNP	37	Broad																																																																																				0.652	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		Silent
RC3H1	149041	broad.mit.edu	37	1	173962095	173962095	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr1:173962095T>A	ENST00000367696.2	-	2	380	c.29A>T	c.(28-30)gAt>gTt	p.D10V	RC3H1_ENST00000367694.2_Missense_Mutation_p.D10V|RC3H1_ENST00000258349.4_Missense_Mutation_p.D10V			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	10					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D10V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						GGAGAGGAAATCCGTCCATTG	0.443																																																1	Substitution - Missense(1)	ovary(1)	1											119.0	114.0	116.0					1																	173962095		2203	4300	6503	172228718	SO:0001583	missense	149041			AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.29A>T	1.37:g.173962095T>A	ENSP00000356669:p.Asp10Val		172228718	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	37	CCDS30940.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	25.4	4.635733	0.87760	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	D;D;D	0.94758	-3.51;-3.51;-3.51	5.78	5.78	0.91487	Zinc finger, RING/FYVE/PHD-type (1);	0.043794	0.85682	D	0.000000	D	0.96386	0.8821	L	0.60957	1.885	0.80722	D	1	D;D;D;D	0.71674	0.994;0.994;0.993;0.998	P;P;P;D	0.70935	0.892;0.892;0.827;0.971	D	0.96894	0.9655	10	0.87932	D	0	-18.6941	16.1138	0.81283	0.0:0.0:0.0:1.0	.	10;10;10;10	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	V	10	ENSP00000356669:D10V;ENSP00000258349:D10V;ENSP00000356667:D10V	ENSP00000258349:D10V	D	-	2	0	RC3H1	172228718	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.599000	0.82757	2.220000	0.72140	0.533000	0.62120	GAT		0.443	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071		Missense_Mutation
ACBD6	84320	broad.mit.edu	37	1	180257597	180257597	+	Silent	SNP	G	G	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr1:180257597G>A	ENST00000367595.3	-	8	1437	c.750C>T	c.(748-750)gaC>gaT	p.D250D	ACBD6_ENST00000475338.2_5'UTR	NM_032360.3	NP_115736.1	Q9BR61	ACBD6_HUMAN	acyl-CoA binding domain containing 6	250						cytoplasm (GO:0005737)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)	p.D250D(1)	ACBD6/RRP15(2)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	7						GGAGAGTGGGGTCAGCACCAG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	1											48.0	45.0	46.0					1																	180257597		2203	4300	6503	178524220	SO:0001819	synonymous_variant	84320			BC006505	CCDS1339.1	1q25.1	2013-10-11	2010-04-30		ENSG00000135847			"""Ankyrin repeat domain containing"""	23339	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 6"""			18268358	Standard	NM_032360		Approved	MGC2404	uc001gog.3	Q9BR61	OTTHUMG00000035117	ENST00000367595.3:c.750C>T	1.37:g.180257597G>A			178524220		Silent	SNP	ENST00000367595.3	37	CCDS1339.1	SNP	44	Broad																																																																																				0.502	ACBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084998.1	NM_032360		Silent
CENPF	1063	broad.mit.edu	37	1	214813547	214813547	+	Nonsense_Mutation	SNP	G	G	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr1:214813547G>A	ENST00000366955.3	+	12	2034	c.1866G>A	c.(1864-1866)tgG>tgA	p.W622*		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.W622*(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TTTCTTGTTGGAAAAGTGAAA	0.338																																					Colon(80;575 1284 11000 14801 43496)											1	Substitution - Nonsense(1)	ovary(1)	1											32.0	37.0	36.0					1																	214813547		2198	4298	6496	212880170	SO:0001587	stop_gained	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.1866G>A	1.37:g.214813547G>A	ENSP00000355922:p.Trp622*		212880170	Q13171|Q13246|Q5VVM7	Nonsense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	40	7.913806	0.98557	.	.	ENSG00000117724	ENST00000366955	.	.	.	5.6	4.68	0.58851	.	0.233777	0.22434	N	0.060111	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	15.8899	0.79291	0.0:0.0:0.8634:0.1366	.	.	.	.	X	622	.	ENSP00000355922:W622X	W	+	3	0	CENPF	212880170	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	6.396000	0.73234	1.349000	0.45751	0.543000	0.68304	TGG		0.338	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		Nonsense_Mutation
OPTN	10133	broad.mit.edu	37	10	13167990	13167990	+	Missense_Mutation	SNP	A	A	C			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr10:13167990A>C	ENST00000378748.3	+	12	1555	c.1193A>C	c.(1192-1194)cAa>cCa	p.Q398P	OPTN_ENST00000378764.2_Missense_Mutation_p.Q392P|OPTN_ENST00000263036.5_Missense_Mutation_p.Q398P|OPTN_ENST00000378747.3_Missense_Mutation_p.Q398P|OPTN_ENST00000378752.3_Missense_Mutation_p.Q392P|OPTN_ENST00000378757.2_Missense_Mutation_p.Q398P	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	398					cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)	p.Q398P(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						AAGCTTCTTCAAGAACATAAT	0.303																																																1	Substitution - Missense(1)	ovary(1)	10											80.0	79.0	79.0					10																	13167990		2203	4298	6501	13207996	SO:0001583	missense	10133			AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.1193A>C	10.37:g.13167990A>C	ENSP00000368022:p.Gln398Pro		13207996	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Missense_Mutation	SNP	ENST00000378748.3	37	CCDS7094.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	5.924	0.354587	0.11239	.	.	ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000378747	D;D;D;D;D;D	0.87650	-2.28;-2.27;-2.28;-2.27;-2.28;-2.28	5.42	4.16	0.48862	.	0.392641	0.29653	N	0.011557	T	0.81375	0.4809	L	0.57536	1.79	0.34602	D	0.716644	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.78991	-0.1985	10	0.34782	T	0.22	-11.4733	5.1526	0.15017	0.6198:0.1582:0.0:0.222	.	392;398	Q96CV9-2;Q96CV9	.;OPTN_HUMAN	P	398;392;398;392;398;398	ENSP00000263036:Q398P;ENSP00000368040:Q392P;ENSP00000368032:Q398P;ENSP00000368027:Q392P;ENSP00000368022:Q398P;ENSP00000368021:Q398P	ENSP00000263036:Q398P	Q	+	2	0	OPTN	13207996	1.000000	0.71417	0.993000	0.49108	0.133000	0.20885	1.795000	0.38784	2.167000	0.68274	0.528000	0.53228	CAA		0.303	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046834.1	NM_021980		Missense_Mutation
TTC17	55761	broad.mit.edu	37	11	43418911	43418911	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr11:43418911T>A	ENST00000039989.4	+	7	802	c.788T>A	c.(787-789)aTt>aAt	p.I263N	TTC17_ENST00000526774.1_3'UTR|TTC17_ENST00000299240.6_Missense_Mutation_p.I263N|RP11-484D2.4_ENST00000394183.2_RNA	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	263					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.I263N(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						AATAAAGACATTGCCCTGGTC	0.448																																																1	Substitution - Missense(1)	ovary(1)	11											174.0	143.0	154.0					11																	43418911		2203	4300	6503	43375487	SO:0001583	missense	55761			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.788T>A	11.37:g.43418911T>A	ENSP00000039989:p.Ile263Asn		43375487	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	CCDS31466.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	31	5.066589	0.93898	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.53423	0.62;0.62	5.92	5.92	0.95590	Tetratricopeptide-like helical (1);	0.197519	0.53938	D	0.000042	T	0.63768	0.2539	M	0.69358	2.11	0.50632	D	0.999884	D;P;D	0.65815	0.993;0.938;0.995	P;P;P	0.59889	0.794;0.548;0.865	T	0.63269	-0.6675	10	0.41790	T	0.15	-8.6293	16.3631	0.83280	0.0:0.0:0.0:1.0	.	263;263;263	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	N	263	ENSP00000299240:I263N;ENSP00000039989:I263N	ENSP00000039989:I263N	I	+	2	0	TTC17	43375487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.266000	0.75297	0.533000	0.62120	ATT		0.448	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259		Missense_Mutation
NOP2	4839	broad.mit.edu	37	12	6673072	6673072	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr12:6673072C>T	ENST00000322166.5	-	6	636	c.515G>A	c.(514-516)cGg>cAg	p.R172Q	NOP2_ENST00000542015.1_Intron|NOP2_ENST00000537442.1_Missense_Mutation_p.R172Q|NOP2_ENST00000545200.1_Missense_Mutation_p.R168Q|NOP2_ENST00000399466.2_Missense_Mutation_p.R168Q|NOP2_ENST00000541778.1_Missense_Mutation_p.R168Q|NOP2_ENST00000382421.3_Missense_Mutation_p.R205Q	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	172					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.R168Q(1)		breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						AGCAGCTTCCCGGGCCTTCTG	0.537											OREG0021630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	12											48.0	48.0	48.0					12																	6673072		1886	4117	6003	6543333	SO:0001583	missense	4839				CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.515G>A	12.37:g.6673072C>T	ENSP00000313272:p.Arg172Gln	635	6543333	A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Missense_Mutation	SNP	ENST00000322166.5	37	CCDS58203.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	11.14	1.551450	0.27739	.	.	ENSG00000111641	ENST00000537442;ENST00000382421;ENST00000545200;ENST00000399466;ENST00000322166;ENST00000541778;ENST00000542944;ENST00000542867;ENST00000536124	T;T;T;T;T;T;T;T;T	0.42131	2.55;2.6;2.56;2.56;2.55;2.56;0.98;1.03;1.01	5.83	0.32	0.15878	.	0.486350	0.22640	N	0.057469	T	0.10551	0.0258	N	0.01289	-0.905	0.80722	D	1	B;B	0.12013	0.005;0.002	B;B	0.04013	0.001;0.001	T	0.18745	-1.0327	10	0.07030	T	0.85	-9.5423	3.657	0.08225	0.159:0.3013:0.0:0.5396	.	205;168	Q3KQS4;P46087-2	.;.	Q	172;205;168;168;172;168;48;168;172	ENSP00000444437:R172Q;ENSP00000371858:R205Q;ENSP00000439422:R168Q;ENSP00000382392:R168Q;ENSP00000313272:R172Q;ENSP00000443150:R168Q;ENSP00000440754:R48Q;ENSP00000443035:R168Q;ENSP00000442895:R172Q	ENSP00000313272:R172Q	R	-	2	0	NOP2	6543333	0.990000	0.36364	0.992000	0.48379	0.943000	0.58893	-0.046000	0.11983	0.031000	0.15407	-0.262000	0.10625	CGG		0.537	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402614.1	NM_006170		Missense_Mutation
LOH12CR1	118426	broad.mit.edu	37	12	12514215	12514215	+	Missense_Mutation	SNP	G	G	A	rs144877374	byFrequency	TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr12:12514215G>A	ENST00000314565.4	+	2	465	c.134G>A	c.(133-135)cGg>cAg	p.R45Q	LOH12CR1_ENST00000542728.1_Missense_Mutation_p.R26Q|LOH12CR1_ENST00000298571.6_Intron	NM_058169.3	NP_477517.1	Q969J3	L12R1_HUMAN	loss of heterozygosity, 12, chromosomal region 1	45								p.R45Q(1)		kidney(1)|large_intestine(1)|lung(1)|ovary(1)	4		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.0205)		CAGGCCTCACGGAACGTCAGC	0.458																																																1	Substitution - Missense(1)	ovary(1)	12						G	GLN/ARG	0,4406		0,0,2203	190.0	172.0	178.0		134	6.0	1.0	12	dbSNP_134	178	1,8599	1.2+/-3.3	0,1,4299	no	missense	LOH12CR1	NM_058169.3	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	45/197	12514215	1,13005	2203	4300	6503	12405482	SO:0001583	missense	118426			AY037865	CCDS8649.1, CCDS73448.1	12p12	2008-07-03			ENSG00000165714	ENSG00000165714			17950	protein-coding gene	gene with protein product						11896457, 15284860	Standard	XR_242885		Approved	LOH1CR12	uc001ral.2	Q969J3	OTTHUMG00000168542	ENST00000314565.4:c.134G>A	12.37:g.12514215G>A	ENSP00000321546:p.Arg45Gln		12405482	Q96QS5	Missense_Mutation	SNP	ENST00000314565.4	37	CCDS8649.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	g	15.16	2.752380	0.49362	0.0	1.16E-4	ENSG00000165714	ENST00000542728;ENST00000314565	T;T	0.30448	1.53;1.53	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	T	0.46328	0.1387	L	0.41710	1.295	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	T	0.06770	-1.0808	10	0.12766	T	0.61	-22.113	20.1362	0.98031	0.0:0.0:1.0:0.0	.	45	Q969J3	L12R1_HUMAN	Q	26;45	ENSP00000443023:R26Q;ENSP00000321546:R45Q	ENSP00000321546:R45Q	R	+	2	0	LOH12CR1	12405482	1.000000	0.71417	0.981000	0.43875	0.997000	0.91878	9.353000	0.97080	2.861000	0.98227	0.651000	0.88453	CGG		0.458	LOH12CR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400150.1			Missense_Mutation
C12orf60	144608	broad.mit.edu	37	12	14976540	14976540	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr12:14976540T>G	ENST00000330828.2	+	2	875	c.671T>G	c.(670-672)aTc>aGc	p.I224S	C12orf60_ENST00000527783.1_Intron	NM_175874.3	NP_787070.2	Q5U649	CL060_HUMAN	chromosome 12 open reading frame 60	224								p.I224S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	9						ATCTTAGAGATCCTCCAAAAA	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											44.0	43.0	44.0					12																	14976540		2193	4295	6488	14867807	SO:0001583	missense	144608			BC038836	CCDS8667.1	12p12.3	2012-08-16			ENSG00000182993	ENSG00000182993			28726	protein-coding gene	gene with protein product						12477932	Standard	NM_175874		Approved	MGC47869	uc001rcj.4	Q5U649	OTTHUMG00000167473	ENST00000330828.2:c.671T>G	12.37:g.14976540T>G	ENSP00000331691:p.Ile224Ser		14867807	A8K1M7|Q5XKK8|Q8IXY2	Missense_Mutation	SNP	ENST00000330828.2	37	CCDS8667.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	9.482	1.098475	0.20552	.	.	ENSG00000182993	ENST00000330828	T	0.16073	2.37	4.36	1.83	0.25207	.	0.959313	0.08505	N	0.935751	T	0.12135	0.0295	N	0.24115	0.695	0.09310	N	1	B	0.32829	0.386	B	0.36766	0.232	T	0.35251	-0.9796	10	0.72032	D	0.01	-18.764	3.33	0.07080	0.2008:0.1086:0.0:0.6905	.	224	Q5U649	CL060_HUMAN	S	224	ENSP00000331691:I224S	ENSP00000331691:I224S	I	+	2	0	C12orf60	14867807	0.009000	0.17119	0.152000	0.22495	0.317000	0.28152	1.219000	0.32479	0.829000	0.34733	0.459000	0.35465	ATC		0.383	C12orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394735.1	NM_175874		Missense_Mutation
AHNAK2	113146	broad.mit.edu	37	14	105408700	105408700	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr14:105408700T>A	ENST00000333244.5	-	7	13207	c.13088A>T	c.(13087-13089)gAt>gTt	p.D4363V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4363						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.D4363V(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAGTTTCACATCCTCTTGGCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	14											98.0	104.0	102.0					14																	105408700		1932	4147	6079	104479745	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.13088A>T	14.37:g.105408700T>A	ENSP00000353114:p.Asp4363Val		104479745	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	t	13.81	2.349267	0.41599	.	.	ENSG00000185567	ENST00000333244	T	0.02177	4.41	3.24	-4.42	0.03579	.	0.878477	0.08940	U	0.871726	T	0.09468	0.0233	M	0.90309	3.105	0.09310	N	1	D	0.65815	0.995	D	0.63957	0.92	T	0.10245	-1.0638	10	0.27082	T	0.32	.	5.6149	0.17426	0.0:0.1678:0.3914:0.4408	.	4363	Q8IVF2	AHNK2_HUMAN	V	4363	ENSP00000353114:D4363V	ENSP00000353114:D4363V	D	-	2	0	AHNAK2	104479745	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.613000	0.05610	-0.504000	0.06577	0.254000	0.18369	GAT		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Missense_Mutation
MYZAP	100820829	broad.mit.edu	37	15	57910380	57910380	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr15:57910380C>G	ENST00000267853.5	+	3	406	c.312C>G	c.(310-312)atC>atG	p.I104M	GCOM1_ENST00000380561.2_Missense_Mutation_p.I104M|GCOM1_ENST00000572390.1_Missense_Mutation_p.I104M|MYZAP_ENST00000380565.4_Missense_Mutation_p.I104M|GCOM1_ENST00000587652.1_Missense_Mutation_p.I104M|GCOM1_ENST00000574161.1_Missense_Mutation_p.I104M|GCOM1_ENST00000380569.2_Missense_Mutation_p.I104M|GCOM1_ENST00000380560.2_Missense_Mutation_p.I104M|GCOM1_ENST00000396180.1_Missense_Mutation_p.I104M|POLR2M_ENST00000380563.2_5'UTR|GCOM1_ENST00000380568.3_Missense_Mutation_p.I104M			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	104					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)		p.I104M(1)									TGAACTACATCAAAGATGTGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	15											160.0	144.0	149.0					15																	57910380		2192	4292	6484	55697672	SO:0001583	missense	145781			FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.312C>G	15.37:g.57910380C>G	ENSP00000267853:p.Ile104Met		55697672	D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	ENST00000267853.5	37	CCDS10162.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600610	0.66332	.	.	ENSG00000137878	ENST00000380569;ENST00000380561;ENST00000396180;ENST00000380560;ENST00000267853;ENST00000380565;ENST00000380568	T;T;T;T;T;T;T	0.36699	1.24;1.35;1.41;1.58;1.24;1.24;1.24	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.57784	0.2077	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.54289	-0.8316	10	0.52906	T	0.07	-21.5521	15.0783	0.72093	0.1424:0.8576:0.0:0.0	.	104;104;104;104	P0CAP1-2;P0CAP1-11;P0CAP1-4;P0CAP1	.;.;.;GCOM1_HUMAN	M	104	ENSP00000369943:I104M;ENSP00000369935:I104M;ENSP00000379483:I104M;ENSP00000369933:I104M;ENSP00000267853:I104M;ENSP00000369939:I104M;ENSP00000369942:I104M	ENSP00000267853:I104M	I	+	3	3	GCOM1	55697672	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	1.715000	0.37971	2.941000	0.99782	0.655000	0.94253	ATC		0.418	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255716.2	NM_001018100		Missense_Mutation
CDH15	1013	broad.mit.edu	37	16	89256814	89256814	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr16:89256814G>A	ENST00000289746.2	+	8	1207	c.1142G>A	c.(1141-1143)cGg>cAg	p.R381Q		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	381	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R381Q(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		AACCCACTTCGGACCAGCCTA	0.687																																																1	Substitution - Missense(1)	ovary(1)	16											30.0	30.0	30.0					16																	89256814		2196	4298	6494	87784315	SO:0001583	missense	1013			D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.1142G>A	16.37:g.89256814G>A	ENSP00000289746:p.Arg381Gln		87784315		Missense_Mutation	SNP	ENST00000289746.2	37	CCDS10976.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	8.902	0.956635	0.18507	.	.	ENSG00000129910	ENST00000289746	T	0.61158	0.13	4.37	4.37	0.52481	Cadherin (2);Cadherin-like (1);	0.332761	0.20912	U	0.083451	T	0.38295	0.1035	L	0.38649	1.16	0.19300	N	0.999974	P	0.35433	0.501	B	0.27262	0.078	T	0.18398	-1.0338	10	0.27082	T	0.32	.	5.6651	0.17690	0.1014:0.0:0.7019:0.1966	.	381	P55291	CAD15_HUMAN	Q	381	ENSP00000289746:R381Q	ENSP00000289746:R381Q	R	+	2	0	CDH15	87784315	0.000000	0.05858	0.996000	0.52242	0.511000	0.34104	0.180000	0.16860	1.991000	0.58162	0.555000	0.69702	CGG		0.687	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1	NM_004933		Missense_Mutation
TCF25	22980	broad.mit.edu	37	16	89958627	89958628	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr16:89958627_89958628CC>TT	ENST00000263346.8	+	6	697_698	c.641_642CC>TT	c.(640-642)cCC>cTT	p.P214L	TCF25_ENST00000263347.7_5'UTR	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	214					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P214L(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		CGTGTGTACCCCAAGTGCACAT	0.619																																																1	Substitution - Missense(1)	ovary(1)	16																																								88486129	SO:0001583	missense	22980			AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	Exception_encountered	16.37:g.89958627_89958628delinsTT	ENSP00000263346:p.Pro214Leu		88486128	Q2MK75|Q9UPV3	Missense_Mutation	DNP	ENST00000263346.8	37	CCDS10987.1	DNP	22	Broad																																																																																				0.619	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272875.2	NM_014972		Missense_Mutation
NEURL4	84461	broad.mit.edu	37	17	7228646	7228646	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr17:7228646C>T	ENST00000399464.2	-	8	1528	c.1513G>A	c.(1513-1515)Ggt>Agt	p.G505S	NEURL4_ENST00000570460.1_Missense_Mutation_p.G483S|NEURL4_ENST00000315614.7_Missense_Mutation_p.G505S	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	505						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G505S(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CGGAGAGCACCCTCGGGGGAC	0.647																																																2	Substitution - Missense(2)	ovary(2)	17											82.0	91.0	88.0					17																	7228646		2095	4215	6310	7169370	SO:0001583	missense	84461				CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.1513G>A	17.37:g.7228646C>T	ENSP00000382390:p.Gly505Ser		7169370	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	37	CCDS42251.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	14.77	2.636040	0.47049	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.29397	1.57;1.57	5.14	5.14	0.70334	Concanavalin A-like lectin/glucanase (1);	0.183456	0.48767	D	0.000173	T	0.21841	0.0526	N	0.08118	0	0.39863	D	0.973409	B;P	0.50819	0.014;0.939	B;P	0.48952	0.006;0.596	T	0.03728	-1.1009	10	0.10377	T	0.69	-17.7363	15.9874	0.80168	0.0:1.0:0.0:0.0	.	505;505	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	S	505	ENSP00000319826:G505S;ENSP00000382390:G505S	ENSP00000319826:G505S	G	-	1	0	NEURL4	7169370	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.107000	0.50329	2.837000	0.97791	0.655000	0.94253	GGT		0.647	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577547	7577547	+	Missense_Mutation	SNP	C	C	T	rs121912656|rs397516437		TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr17:7577547C>T	ENST00000269305.4	-	7	923	c.734G>A	c.(733-735)gGc>gAc	p.G245D	TP53_ENST00000445888.2_Missense_Mutation_p.G245D|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G245D|TP53_ENST00000420246.2_Missense_Mutation_p.G245D|TP53_ENST00000413465.2_Missense_Mutation_p.G245D|TP53_ENST00000455263.2_Missense_Mutation_p.G245D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245D(104)|p.G245V(66)|p.G245A(8)|p.0?(8)|p.?(5)|p.G152V(4)|p.G244_M246>V(3)|p.G152D(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.G245fs*2(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.C238_M246delCNSSCMGGM(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTTCATGCCGCCCATGCA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	219	Substitution - Missense(191)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	large_intestine(37)|lung(32)|oesophagus(23)|breast(22)|ovary(18)|upper_aerodigestive_tract(16)|haematopoietic_and_lymphoid_tissue(15)|liver(9)|prostate(7)|stomach(6)|central_nervous_system(6)|skin(6)|biliary_tract(5)|urinary_tract(5)|bone(5)|pancreas(4)|cervix(1)|vulva(1)|endometrium(1)	17	GRCh37	CM010464|CM900209	TP53	M	rs121912656						151.0	113.0	126.0					17																	7577547		2203	4300	6503	7518272	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.734G>A	17.37:g.7577547C>T	ENSP00000269305:p.Gly245Asp		7518272	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838149	0.91117	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	A	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;1.0;1.0	D	0.96045	0.9027	9	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	D	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245D;ENSP00000352610:G245D;ENSP00000269305:G245D;ENSP00000398846:G245D;ENSP00000391127:G245D;ENSP00000391478:G245D;ENSP00000425104:G113D;ENSP00000423862:G152D	ENSP00000269305:G245D	G	-	2	0	TP53	7518272	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
ANGPTL4	51129	broad.mit.edu	37	19	8436379	8436379	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr19:8436379G>T	ENST00000301455.2	+	6	1183	c.1012G>T	c.(1012-1014)Gac>Tac	p.D338Y	RAB11B-AS1_ENST00000597407.1_RNA|RAB11B-AS1_ENST00000593581.1_RNA|RAB11B-AS1_ENST00000597785.1_RNA|ANGPTL4_ENST00000393962.2_Missense_Mutation_p.D300Y|ANGPTL4_ENST00000541807.1_Missense_Mutation_p.D171Y	NM_139314.1	NP_647475.1	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4	338	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.		D -> E. {ECO:0000269|PubMed:17322881}.		angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular lipid metabolic process (GO:0044255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of lipoprotein lipase activity (GO:0051005)|positive regulation of angiogenesis (GO:0045766)|protein homooligomerization (GO:0051260)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	enzyme inhibitor activity (GO:0004857)	p.D338Y(1)		large_intestine(1)|lung(1)|ovary(2)|skin(2)	6						CCTCCGCAGGGACAAGAACTG	0.652																																																1	Substitution - Missense(1)	ovary(1)	19											34.0	32.0	33.0					19																	8436379		2203	4297	6500	8342379	SO:0001583	missense	51129			AF202636	CCDS12200.1, CCDS42493.1	19p13.3	2013-10-07				ENSG00000167772		"""Fibrinogen C domain containing"""	16039	protein-coding gene	gene with protein product	"""fasting-induced adipose factor"", ""hepatic angiopoietin-related protein"", ""PPARG angiopoietin related protein"", ""hepatic fibrinogen/angiopoietin-related protein"", ""peroxisome proliferator-activated receptor (PPAR) gamma induced angiopoietin-related protein"", ""angiopoietin-related protein 4"""	605910				10698685, 10866690, 23960078	Standard	NM_139314		Approved	pp1158, PGAR, ARP4, HFARP, FIAF, NL2	uc002mjq.1	Q9BY76		ENST00000301455.2:c.1012G>T	19.37:g.8436379G>T	ENSP00000301455:p.Asp338Tyr		8342379	A8MY84|B4E089|D6W670|F5H0I2|Q53HQ6|Q53HU1|Q6UXN0|Q9HBV4|Q9NZU4|Q9Y5B3	Missense_Mutation	SNP	ENST00000301455.2	37	CCDS12200.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	18.53	3.643875	0.67244	.	.	ENSG00000167772	ENST00000301455;ENST00000393962;ENST00000541807	T;T;T	0.77750	-1.12;-1.12;-1.12	4.94	2.82	0.32997	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.84534	0.5493	M	0.66560	2.04	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83447	0.0046	10	0.66056	D	0.02	.	9.6443	0.39857	0.1709:0.0:0.8291:0.0	.	300;338	A8MY84;Q9BY76	.;ANGL4_HUMAN	Y	338;300;171	ENSP00000301455:D338Y;ENSP00000377534:D300Y;ENSP00000439833:D171Y	ENSP00000301455:D338Y	D	+	1	0	ANGPTL4	8342379	1.000000	0.71417	0.530000	0.27963	0.848000	0.48234	6.209000	0.72171	0.501000	0.28013	0.555000	0.69702	GAC		0.652	ANGPTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460322.1	NM_139314		Missense_Mutation
SPTBN4	57731	broad.mit.edu	37	19	41038617	41038617	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr19:41038617G>A	ENST00000352632.3	+	19	4120	c.4034G>A	c.(4033-4035)cGg>cAg	p.R1345Q	SPTBN4_ENST00000392023.1_Missense_Mutation_p.R21Q|SPTBN4_ENST00000392025.1_Missense_Mutation_p.R88Q|SPTBN4_ENST00000595535.1_Missense_Mutation_p.R1345Q|SPTBN4_ENST00000598249.1_Missense_Mutation_p.R1345Q|SPTBN4_ENST00000338932.3_Missense_Mutation_p.R1345Q			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1345					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R1345Q(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGATGGCTCCGGCACCAGGCA	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											64.0	53.0	57.0					19																	41038617		2203	4300	6503	45730457	SO:0001583	missense	57731			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.4034G>A	19.37:g.41038617G>A	ENSP00000263373:p.Arg1345Gln		45730457	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.076301	0.94000	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025;ENST00000392023	T;T;T;T	0.67523	0.79;0.79;-0.27;0.79	4.86	4.86	0.63082	.	0.204266	0.32175	N	0.006477	T	0.72061	0.3414	L	0.41492	1.28	0.37052	D	0.897641	D;D;D;D;D;D	0.76494	0.979;0.981;0.996;0.998;0.992;0.999	P;P;P;P;P;D	0.68943	0.788;0.535;0.709;0.905;0.709;0.961	T	0.76884	-0.2794	10	0.66056	D	0.02	.	10.4908	0.44750	0.0898:0.0:0.9102:0.0	.	1345;88;88;21;1345;1345	E9PDB1;Q9H254-3;C9JY79;E9PGQ5;Q9H254;Q71S06	.;.;.;.;SPTN4_HUMAN;.	Q	1345;1345;1345;88;21	ENSP00000263373:R1345Q;ENSP00000340345:R1345Q;ENSP00000375879:R88Q;ENSP00000375877:R21Q	ENSP00000340345:R1345Q	R	+	2	0	SPTBN4	45730457	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.304000	0.59104	2.499000	0.84300	0.561000	0.74099	CGG		0.602	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2			Missense_Mutation
ZNF749	388567	broad.mit.edu	37	19	57955798	57955798	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr19:57955798C>G	ENST00000334181.4	+	3	1532	c.1282C>G	c.(1282-1284)Cat>Gat	p.H428D	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H341D(1)		breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		TGTTGTTCAGCATCTGAAAAT	0.438																																																1	Substitution - Missense(1)	ovary(1)	19											90.0	88.0	89.0					19																	57955798		2203	4300	6503	62647610	SO:0001583	missense	388567			AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.1282C>G	19.37:g.57955798C>G	ENSP00000333980:p.His428Asp		62647610		Missense_Mutation	SNP	ENST00000334181.4	37	CCDS33132.2	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	14.78	2.637860	0.47049	.	.	ENSG00000186230	ENST00000334181	D	0.86769	-2.17	1.96	0.9	0.19278	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94079	0.8102	H	0.94847	3.59	0.20403	N	0.999909	D	0.89917	1.0	D	0.76575	0.988	D	0.84862	0.0820	9	0.87932	D	0	.	7.9891	0.30229	0.0:0.8592:0.0:0.1408	.	428	O43361	ZN749_HUMAN	D	428	ENSP00000333980:H428D	ENSP00000333980:H428D	H	+	1	0	ZNF749	62647610	0.970000	0.33590	0.002000	0.10522	0.310000	0.27922	6.083000	0.71326	0.388000	0.25054	0.460000	0.39030	CAT		0.438	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561		Missense_Mutation
KIDINS220	57498	broad.mit.edu	37	2	8940569	8940569	+	Silent	SNP	C	C	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr2:8940569C>T	ENST00000256707.3	-	9	1042	c.861G>A	c.(859-861)gcG>gcA	p.A287A	KIDINS220_ENST00000319688.5_Silent_p.A288A|KIDINS220_ENST00000427284.1_Silent_p.A287A|KIDINS220_ENST00000418530.1_Silent_p.A245A|KIDINS220_ENST00000473731.1_Silent_p.A287A	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	287					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)	p.A287A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTTGGAGAAGCGCTCGAACAA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	2											188.0	195.0	193.0					2																	8940569		1917	4133	6050	8858020	SO:0001819	synonymous_variant	57498			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.861G>A	2.37:g.8940569C>T			8858020	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Silent	SNP	ENST00000256707.3	37	CCDS42650.1	SNP	27	Broad																																																																																				0.378	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738		Silent
LRRTM4	80059	broad.mit.edu	37	2	77745898	77745898	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr2:77745898A>G	ENST00000409093.1	-	3	1433	c.1097T>C	c.(1096-1098)gTc>gCc	p.V366A	LRRTM4_ENST00000409884.1_Missense_Mutation_p.V366A|LRRTM4_ENST00000409911.1_Missense_Mutation_p.V367A|LRRTM4_ENST00000409282.1_Missense_Mutation_p.V367A|LRRTM4_ENST00000409088.3_Missense_Mutation_p.V366A			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	366					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.V366A(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		TTCTGTGTTGACCACCTGGAC	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											122.0	117.0	118.0					2																	77745898		1902	4119	6021	77599406	SO:0001583	missense	80059			AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1097T>C	2.37:g.77745898A>G	ENSP00000386357:p.Val366Ala		77599406	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	CCDS46346.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	0.016	-1.521119	0.00967	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.51817	0.69;0.72;0.72;0.79;0.8	5.68	3.15	0.36227	.	0.586840	0.18395	N	0.142557	T	0.27900	0.0687	N	0.22421	0.69	0.09310	N	1	B;B;B	0.11235	0.002;0.004;0.002	B;B;B	0.14023	0.004;0.01;0.004	T	0.20472	-1.0274	10	0.09843	T	0.71	.	7.7264	0.28763	0.7949:0.0:0.2051:0.0	.	367;366;366	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	A	367;366;366;366;367	ENSP00000387228:V367A;ENSP00000387297:V366A;ENSP00000386357:V366A;ENSP00000386236:V366A;ENSP00000386286:V367A	ENSP00000386236:V366A	V	-	2	0	LRRTM4	77599406	1.000000	0.71417	0.999000	0.59377	0.882000	0.50991	3.073000	0.50057	0.844000	0.35094	0.533000	0.62120	GTC		0.468	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993		Missense_Mutation
ORC4	5000	broad.mit.edu	37	2	148693163	148693163	+	Silent	SNP	A	A	G			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr2:148693163A>G	ENST00000392857.5	-	14	1334	c.1227T>C	c.(1225-1227)acT>acC	p.T409T	ORC4_ENST00000536575.1_Silent_p.T325T|ORC4_ENST00000392858.1_Silent_p.T409T|ORC4_ENST00000488761.1_5'Flank|ORC4_ENST00000542387.1_Silent_p.T192T|ORC4_ENST00000540442.1_Silent_p.T335T|ORC4_ENST00000535373.1_Silent_p.T409T|ORC4_ENST00000264169.2_Silent_p.T409T	NM_001190879.2|NM_001190882.2|NM_002552.4|NM_181741.3	NP_001177808.1|NP_001177811.1|NP_002543.2|NP_859525.1	O43929	ORC4_HUMAN	origin recognition complex, subunit 4	409					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)	p.T409T(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	14						TCATAATTTGAGTATTATCCA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	2											112.0	111.0	111.0					2																	148693163		2203	4300	6503	148409633	SO:0001819	synonymous_variant	5000			AF022108	CCDS2187.1, CCDS54404.1, CCDS54405.1	2q22-q23	2010-10-12	2010-10-12	2010-10-12	ENSG00000115947	ENSG00000115947		"""ATPases / AAA-type"""	8490	protein-coding gene	gene with protein product		603056	"""origin recognition complex, subunit 4 (yeast homolog)-like"", ""origin recognition complex, subunit 4-like (yeast)"", ""origin recognition complex, subunit 4-like (S. cerevisiae)"", ""origin recognition complex, subunit 4 homolog (S. cerevisiae)"""	ORC4L		9353276, 9691185	Standard	NM_181742		Approved	HsORC4, Orc4p	uc002twk.3	O43929	OTTHUMG00000131849	ENST00000392857.5:c.1227T>C	2.37:g.148693163A>G			148409633	B7Z3D0|B7Z5F1|D3DP86|F5H069|Q96C42	Silent	SNP	ENST00000392857.5	37	CCDS2187.1	SNP	11	Broad																																																																																				0.393	ORC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254797.3	NM_181742		Silent
ITGB6	3694	broad.mit.edu	37	2	160994038	160994038	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr2:160994038T>C	ENST00000283249.2	-	10	1804	c.1567A>G	c.(1567-1569)Atc>Gtc	p.I523V	ITGB6_ENST00000409967.2_Missense_Mutation_p.I523V|ITGB6_ENST00000409872.1_Missense_Mutation_p.I523V|ITGB6_ENST00000428609.2_Missense_Mutation_p.I481V	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	523	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)	p.I523V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						AAGTGGCAGATACACTGCCCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	2											93.0	85.0	88.0					2																	160994038		2203	4300	6503	160702284	SO:0001583	missense	3694				CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.1567A>G	2.37:g.160994038T>C	ENSP00000283249:p.Ile523Val		160702284	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	37	CCDS2212.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	0.686	-0.796317	0.02862	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07	5.39	-1.25	0.09405	.	0.624964	0.16462	N	0.213389	T	0.73505	0.3595	N	0.02685	-0.53	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.64210	-0.6461	10	0.02654	T	1	.	8.3703	0.32410	0.0:0.4822:0.1231:0.3947	.	481;523	E9PEE8;P18564	.;ITB6_HUMAN	V	523;481;523;523	ENSP00000283249:I523V;ENSP00000408024:I481V;ENSP00000386828:I523V;ENSP00000386367:I523V	ENSP00000283249:I523V	I	-	1	0	ITGB6	160702284	0.005000	0.15991	0.928000	0.36995	0.996000	0.88848	-0.152000	0.10159	-0.134000	0.11516	0.533000	0.62120	ATC		0.552	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888		Missense_Mutation
UBOX5	22888	broad.mit.edu	37	20	3090781	3090781	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr20:3090781T>C	ENST00000217173.2	-	5	2068	c.1597A>G	c.(1597-1599)Agc>Ggc	p.S533G	UBOX5-AS1_ENST00000446537.1_RNA|UBOX5-AS1_ENST00000454019.1_RNA|UBOX5_ENST00000348031.2_Missense_Mutation_p.S479G	NM_001267584.1|NM_014948.3	NP_001254513.1|NP_055763.1			U-box domain containing 5									p.S533G(1)		endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	20						ACGTCTTGGCTAGCAACCGGC	0.657																																																1	Substitution - Missense(1)	ovary(1)	20											50.0	49.0	49.0					20																	3090781		2203	4300	6503	3038781	SO:0001583	missense	22888			AB020667	CCDS13046.1, CCDS13047.1	20p13	2013-01-28			ENSG00000185019	ENSG00000185019		"""RING-type (C3HC4) zinc fingers"", ""U-box domain containing"""	17777	protein-coding gene	gene with protein product						11274149	Standard	NM_014948		Approved	UIP5, KIAA0860, Ubce7ip5, RNF37	uc002whw.4	O94941	OTTHUMG00000031731	ENST00000217173.2:c.1597A>G	20.37:g.3090781T>C	ENSP00000217173:p.Ser533Gly		3038781		Missense_Mutation	SNP	ENST00000217173.2	37	CCDS13046.1	SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	T	14.58	2.579264	0.46006	.	.	ENSG00000185019	ENST00000217173;ENST00000348031	T;T	0.68025	-0.27;-0.3	5.18	5.18	0.71444	Zinc finger, RING/FYVE/PHD-type (1);	0.261971	0.35936	U	0.002882	T	0.64011	0.2560	L	0.57536	1.79	0.33243	D	0.557505	P;P	0.41080	0.737;0.737	B;B	0.37731	0.24;0.257	T	0.78242	-0.2280	10	0.87932	D	0	-11.578	15.3304	0.74203	0.0:0.0:0.0:1.0	.	479;533	Q86X87;O94941	.;RNF37_HUMAN	G	533;479	ENSP00000217173:S533G;ENSP00000311726:S479G	ENSP00000217173:S533G	S	-	1	0	UBOX5	3038781	1.000000	0.71417	1.000000	0.80357	0.218000	0.24690	3.360000	0.52299	2.089000	0.63090	0.459000	0.35465	AGC		0.657	UBOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077706.2	NM_014948		Missense_Mutation
RBL1	5933	broad.mit.edu	37	20	35635838	35635838	+	Silent	SNP	G	G	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr20:35635838G>A	ENST00000373664.3	-	20	2913	c.2847C>T	c.(2845-2847)taC>taT	p.Y949Y	RBL1_ENST00000344359.3_Silent_p.Y949Y	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	949	Domain B.|Pocket; binds T and E1A.				chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)	p.Y949Y(1)		NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				TCGCCAAGTCGTATTTCAGTG	0.328																																																1	Substitution - coding silent(1)	ovary(1)	20											141.0	136.0	138.0					20																	35635838		2203	4300	6503	35069252	SO:0001819	synonymous_variant	5933			L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.2847C>T	20.37:g.35635838G>A			35069252	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Silent	SNP	ENST00000373664.3	37	CCDS13289.1	SNP	40	Broad																																																																																				0.328	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079067.2	NM_002895		Silent
FAM83D	81610	broad.mit.edu	37	20	37580954	37580954	+	Nonsense_Mutation	SNP	G	G	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr20:37580954G>T	ENST00000217429.4	+	4	1680	c.1639G>T	c.(1639-1641)Gaa>Taa	p.E547*		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	517					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.E547*(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				CCCCCACCTGGAACTGTACTT	0.542																																																1	Substitution - Nonsense(1)	ovary(1)	20											52.0	54.0	54.0					20																	37580954		1893	4120	6013	37014368	SO:0001587	stop_gained	81610			AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.1639G>T	20.37:g.37580954G>T	ENSP00000217429:p.Glu547*		37014368	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Nonsense_Mutation	SNP	ENST00000217429.4	37	CCDS42872.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.662267	0.96734	.	.	ENSG00000101447	ENST00000217429;ENST00000424027	.	.	.	5.89	5.89	0.94794	.	0.761042	0.12662	N	0.449503	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	12.6578	0.56797	0.0:0.0:0.835:0.165	.	.	.	.	X	547;501	.	ENSP00000217429:E547X	E	+	1	0	FAM83D	37014368	0.877000	0.30153	0.993000	0.49108	0.904000	0.53231	2.355000	0.44107	2.763000	0.94921	0.655000	0.94253	GAA		0.542	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1			Nonsense_Mutation
BCAS1	8537	broad.mit.edu	37	20	52591931	52591931	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr20:52591931C>A	ENST00000395961.3	-	8	1345	c.1179G>T	c.(1177-1179)gaG>gaT	p.E393D	BCAS1_ENST00000371435.2_Missense_Mutation_p.E393D|BCAS1_ENST00000434986.2_Intron|BCAS1_ENST00000371440.3_Intron	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	393						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.E393D(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			AACTTACATTCTCCTCCGCAC	0.413																																																1	Substitution - Missense(1)	ovary(1)	20											107.0	97.0	100.0					20																	52591931		2203	4300	6503	52025338	SO:0001583	missense	8537			AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.1179G>T	20.37:g.52591931C>A	ENSP00000379290:p.Glu393Asp		52025338	A0AVG5|Q68CZ3	Missense_Mutation	SNP	ENST00000395961.3	37	CCDS13444.1	SNP	32	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.71|18.71	3.681822|3.681822	0.68042|0.68042	.|.	.|.	ENSG00000064787|ENSG00000064787	ENST00000448710;ENST00000395961;ENST00000371435|ENST00000422805	T;T|.	0.08282|.	3.11;3.33|.	5.83|5.83	3.59|3.59	0.41128|0.41128	.|.	.|.	.|.	.|.	.|.	T|T	0.61899|0.61899	0.2384|0.2384	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.999;0.998;0.986|.	D;D;P|.	0.80764|.	0.994;0.91;0.689|.	T|T	0.60357|0.60357	-0.7279|-0.7279	9|5	0.56958|.	D|.	0.05|.	.|.	8.9833|8.9833	0.35979|0.35979	0.0:0.8068:0.0:0.1932|0.0:0.8068:0.0:0.1932	.|.	393;393;393|.	B2RCQ5;G3XAF7;O75363|.	.;.;BCAS1_HUMAN|.	D|I	271;393;393|112	ENSP00000379290:E393D;ENSP00000360490:E393D|.	ENSP00000360490:E393D|.	E|R	-|-	3|2	2|0	BCAS1|BCAS1	52025338|52025338	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.928000|0.928000	0.56348|0.56348	0.450000|0.450000	0.21762|0.21762	1.478000|1.478000	0.48253|0.48253	0.561000|0.561000	0.74099|0.74099	GAG|AGA		0.413	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2	NM_003657		Missense_Mutation
PRDM15	63977	broad.mit.edu	37	21	43221763	43221763	+	Silent	SNP	C	C	T	rs147459914		TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr21:43221763C>T	ENST00000269844.3	-	31	4271	c.4161G>A	c.(4159-4161)ccG>ccA	p.P1387P	PRDM15_ENST00000538201.1_Silent_p.P1041P|PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000422911.1_Silent_p.P1078P|PRDM15_ENST00000447207.2_Silent_p.P1021P|PRDM15_ENST00000398548.1_Silent_p.P1058P	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1387					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.P1387P(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CCACGGCCACCGGCTGGAGAT	0.582													c|||	1	0.000199681	0.0	0.0014	5008	,	,		18860	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	21							,	1,4405	2.1+/-5.4	0,1,2202	43.0	44.0	44.0		3174,4161	-8.9	0.5	21	dbSNP_134	44	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous	PRDM15	NM_001040424.1,NM_022115.3	,	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	,	1058/1179,1387/1508	43221763	4,13002	2203	4300	6503	42094832	SO:0001819	synonymous_variant	63977			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.4161G>A	21.37:g.43221763C>T			42094832	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	ENST00000269844.3	37	CCDS13676.1	SNP	23	Broad																																																																																				0.582	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115		Silent
TMPRSS3	64699	broad.mit.edu	37	21	43795840	43795840	+	Silent	SNP	G	G	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr21:43795840G>A	ENST00000291532.3	-	12	2287	c.1332C>T	c.(1330-1332)atC>atT	p.I444I	TMPRSS3_ENST00000474596.1_5'UTR|TMPRSS3_ENST00000433957.2_Silent_p.I443I|TMPRSS3_ENST00000380399.1_Silent_p.I528I|TMPRSS3_ENST00000398405.1_Silent_p.I441I	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	444	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)	p.I444I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						TCTGCTCGTGGATCCAGTCCA	0.587																																																1	Substitution - coding silent(1)	ovary(1)	21											91.0	85.0	87.0					21																	43795840		2203	4300	6503	42668909	SO:0001819	synonymous_variant	64699			AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.1332C>T	21.37:g.43795840G>A			42668909	D3DSJ6|Q5USC7|Q6ZMC3	Silent	SNP	ENST00000291532.3	37	CCDS13686.1	SNP	41	Broad																																																																																				0.587	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1			Silent
SBF1	6305	broad.mit.edu	37	22	50899659	50899659	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr22:50899659G>T	ENST00000390679.3	-	23	3080	c.2896C>A	c.(2896-2898)Cgc>Agc	p.R966S	SBF1_ENST00000348911.6_Missense_Mutation_p.R967S|SBF1_ENST00000380817.3_Missense_Mutation_p.R966S			O95248	MTMR5_HUMAN	SET binding factor 1	966	GRAM.				cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R966S(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		ACGCTGATGCGCTTCTCCTTG	0.667																																																1	Substitution - Missense(1)	ovary(1)	22											43.0	55.0	51.0					22																	50899659		2047	4194	6241	49246525	SO:0001583	missense	6305			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.2896C>A	22.37:g.50899659G>T	ENSP00000375097:p.Arg966Ser		49246525	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	37		SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772651	0.49680	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000337034;ENST00000390679	D;D;D	0.87887	-2.31;-2.31;-2.31	3.31	3.31	0.37934	GRAM (2);	0.433201	0.17545	N	0.170364	D	0.82889	0.5135	L	0.42245	1.32	0.51767	D	0.999937	B;B;P	0.47191	0.446;0.397;0.891	P;B;B	0.44597	0.454;0.147;0.28	D	0.83599	0.0127	10	0.87932	D	0	.	8.7787	0.34778	0.0:0.0:0.6016:0.3984	.	966;967;966	O95248;G5E933;O95248-4	MTMR5_HUMAN;.;.	S	966;967;976;966	ENSP00000370196:R966S;ENSP00000252027:R967S;ENSP00000375097:R966S	ENSP00000336522:R976S	R	-	1	0	SBF1	49246525	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.930000	0.48924	1.840000	0.53500	0.467000	0.42956	CGC		0.667	SBF1-201	KNOWN	basic	protein_coding	protein_coding				Missense_Mutation
TBC1D23	55773	broad.mit.edu	37	3	100021074	100021074	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr3:100021074T>G	ENST00000394144.4	+	11	1263	c.1256T>G	c.(1255-1257)tTt>tGt	p.F419C	TBC1D23_ENST00000344949.5_Missense_Mutation_p.F419C|TBC1D23_ENST00000486274.1_3'UTR|TBC1D23_ENST00000475134.1_Missense_Mutation_p.F282C	NM_001199198.2	NP_001186127.1	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	419	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				positive regulation of interleukin-6 production (GO:0032755)|regulation of inflammatory response (GO:0050727)|regulation of tumor necrosis factor production (GO:0032680)		Rab GTPase activator activity (GO:0005097)	p.F419C(1)		breast(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(10)|ovary(1)|prostate(2)|skin(2)	25						CTGGCACACTTTTTACAGGTA	0.383																																																1	Substitution - Missense(1)	ovary(1)	3											80.0	72.0	75.0					3																	100021074		2203	4300	6503	101503764	SO:0001583	missense	55773			AK001908	CCDS2936.1, CCDS56265.1	3q12.2	2013-07-10			ENSG00000036054	ENSG00000036054			25622	protein-coding gene	gene with protein product						22312129	Standard	NM_001199198		Approved	FLJ11046	uc003dtt.4	Q9NUY8	OTTHUMG00000159067	ENST00000394144.4:c.1256T>G	3.37:g.100021074T>G	ENSP00000377700:p.Phe419Cys		101503764	B9A6M5|Q8TCN8|Q8WUB7|Q96D90|Q9NV75	Missense_Mutation	SNP	ENST00000394144.4	37	CCDS56265.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	22.9	4.347375	0.82022	.	.	ENSG00000036054	ENST00000344949;ENST00000394144;ENST00000475134	T;T;T	0.44083	0.93;0.93;0.93	5.96	5.96	0.96718	Rhodanese-like (4);	0.000000	0.85682	D	0.000000	T	0.65533	0.2700	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.66200	-0.5983	9	.	.	.	.	16.4293	0.83835	0.0:0.0:0.0:1.0	.	419;419	Q9NUY8;Q9NUY8-2	TBC23_HUMAN;.	C	419;419;282	ENSP00000340693:F419C;ENSP00000377700:F419C;ENSP00000418059:F282C	.	F	+	2	0	TBC1D23	101503764	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.375000	0.79646	2.271000	0.75665	0.528000	0.53228	TTT		0.383	TBC1D23-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353150.1	NM_018309		Missense_Mutation
COPG1	22820	broad.mit.edu	37	3	128979574	128979574	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr3:128979574C>T	ENST00000314797.6	+	12	1156	c.1052C>T	c.(1051-1053)aCg>aTg	p.T351M		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	351					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)	p.T351M(1)									CTCCTTAAGACGGGCAGCGAG	0.547																																																1	Substitution - Missense(1)	ovary(1)	3											97.0	86.0	90.0					3																	128979574		2203	4300	6503	130462264	SO:0001583	missense	22820			AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.1052C>T	3.37:g.128979574C>T	ENSP00000325002:p.Thr351Met		130462264	A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	ENST00000314797.6	37	CCDS33851.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	18.26	3.585571	0.66105	.	.	ENSG00000181789	ENST00000314797	T	0.25085	1.82	5.88	5.88	0.94601	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.065842	0.64402	D	0.000007	T	0.66257	0.2771	H	0.96015	3.755	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.76788	-0.2830	10	0.87932	D	0	-6.5643	17.7893	0.88547	0.0:1.0:0.0:0.0	.	351	Q9Y678	COPG_HUMAN	M	351	ENSP00000325002:T351M	ENSP00000325002:T351M	T	+	2	0	COPG	130462264	1.000000	0.71417	0.918000	0.36340	0.083000	0.17756	7.618000	0.83043	2.805000	0.96524	0.460000	0.39030	ACG		0.547	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355456.1	NM_016128		Missense_Mutation
COPG1	22820	broad.mit.edu	37	3	128986812	128986812	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr3:128986812A>G	ENST00000314797.6	+	16	1681	c.1577A>G	c.(1576-1578)gAc>gGc	p.D526G		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	526					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)	p.D526G(1)									GAAGTAAGGGACCGAGCCACC	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											162.0	132.0	142.0					3																	128986812		2203	4300	6503	130469502	SO:0001583	missense	22820			AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.1577A>G	3.37:g.128986812A>G	ENSP00000325002:p.Asp526Gly		130469502	A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	ENST00000314797.6	37	CCDS33851.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	21.0	4.074489	0.76415	.	.	ENSG00000181789	ENST00000314797	T	0.33438	1.41	6.17	6.17	0.99709	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.063072	0.64402	D	0.000005	T	0.65984	0.2744	M	0.93638	3.44	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.75342	-0.3351	10	0.87932	D	0	-6.4079	14.7743	0.69713	1.0:0.0:0.0:0.0	.	526	Q9Y678	COPG_HUMAN	G	526	ENSP00000325002:D526G	ENSP00000325002:D526G	D	+	2	0	COPG	130469502	1.000000	0.71417	1.000000	0.80357	0.404000	0.30871	9.136000	0.94489	2.371000	0.80710	0.533000	0.62120	GAC		0.537	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355456.1	NM_016128		Missense_Mutation
C4orf29	80167	broad.mit.edu	37	4	128941248	128941248	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr4:128941248C>T	ENST00000444616.1	+	9	870	c.623C>T	c.(622-624)gCg>gTg	p.A208V	C4orf29_ENST00000398965.1_Missense_Mutation_p.A208V|C4orf29_ENST00000388795.5_Missense_Mutation_p.A126V			Q0P651	CD029_HUMAN	chromosome 4 open reading frame 29	208						extracellular region (GO:0005576)		p.A208V(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						GCTTCCTTAGCGGTATCCAAC	0.358																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	4											53.0	52.0	53.0					4																	128941248		1847	4080	5927	129160698	SO:0001583	missense	80167			AK024759	CCDS47131.1	4q28.2	2008-02-05			ENSG00000164074	ENSG00000164074			26111	protein-coding gene	gene with protein product						12477932	Standard	XM_006714318		Approved	FLJ21106	uc021xrt.1	Q0P651	OTTHUMG00000133304	ENST00000444616.1:c.623C>T	4.37:g.128941248C>T	ENSP00000397229:p.Ala208Val		129160698	A1A4W8|A1A4W9|Q9H7A7	Missense_Mutation	SNP	ENST00000444616.1	37		SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	34	5.360807	0.95877	.	.	ENSG00000164074	ENST00000454347;ENST00000398961;ENST00000398965;ENST00000444616;ENST00000388795;ENST00000545758;ENST00000437077	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.75258	0.3825	L	0.49350	1.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72701	-0.4214	9	0.35671	T	0.21	-15.5728	18.9776	0.92743	0.0:1.0:0.0:0.0	.	126;208	B7WP89;Q0P651	.;CD029_HUMAN	V	208;5;208;208;126;126;81	.	ENSP00000373447:A126V	A	+	2	0	C4orf29	129160698	1.000000	0.71417	0.991000	0.47740	0.936000	0.57629	7.425000	0.80255	2.486000	0.83907	0.558000	0.71614	GCG		0.358	C4orf29-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257098.1	NM_001039717		Missense_Mutation
RICTOR	253260	broad.mit.edu	37	5	38947495	38947495	+	Silent	SNP	C	C	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr5:38947495C>T	ENST00000357387.3	-	32	4215	c.4185G>A	c.(4183-4185)ttG>ttA	p.L1395L	RICTOR_ENST00000296782.5_Silent_p.L1419L	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2									p.L1395L(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TAATAGGACTCAATAAATCTT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	5											91.0	83.0	86.0					5																	38947495		2203	4300	6503	38983252	SO:0001819	synonymous_variant	253260				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.4185G>A	5.37:g.38947495C>T			38983252		Silent	SNP	ENST00000357387.3	37	CCDS34148.1	SNP	29	Broad																																																																																				0.373	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756		Silent
PCDHB10	56126	broad.mit.edu	37	5	140573514	140573514	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr5:140573514C>A	ENST00000239446.4	+	1	1573	c.1389C>A	c.(1387-1389)aaC>aaA	p.N463K		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	463	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N463K(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCGCGAGAACAACAGCCCCG	0.637																																																1	Substitution - Missense(1)	ovary(1)	5											42.0	48.0	46.0					5																	140573514		2202	4290	6492	140553698	SO:0001583	missense	56126			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1389C>A	5.37:g.140573514C>A	ENSP00000239446:p.Asn463Lys		140553698	Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	CCDS4252.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	c	16.51	3.142811	0.57044	.	.	ENSG00000120324	ENST00000239446	T	0.01685	4.69	3.22	3.22	0.36961	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.15349	0.0370	H	0.97415	4	0.37713	D	0.92464	D	0.76494	0.999	D	0.71656	0.974	T	0.07731	-1.0757	9	0.87932	D	0	.	9.6543	0.39917	0.0:0.8925:0.0:0.1075	.	463	Q9UN67	PCDBA_HUMAN	K	463	ENSP00000239446:N463K	ENSP00000239446:N463K	N	+	3	2	PCDHB10	140553698	0.288000	0.24324	1.000000	0.80357	0.839000	0.47603	0.428000	0.21395	1.819000	0.53055	0.549000	0.68633	AAC		0.637	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		Missense_Mutation
SQSTM1	8878	broad.mit.edu	37	5	179251006	179251006	+	Silent	SNP	G	G	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr5:179251006G>A	ENST00000389805.4	+	3	628	c.450G>A	c.(448-450)ttG>ttA	p.L150L	SQSTM1_ENST00000510187.1_Silent_p.L150L|SQSTM1_ENST00000376929.3_Silent_p.L66L|SQSTM1_ENST00000360718.5_Silent_p.L66L|SQSTM1_ENST00000402874.3_Silent_p.L66L	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	150	Interaction with GABRR3. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)	p.L150L(1)	SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACTACGACTTGTGTAGCGTCT	0.632																																																1	Substitution - coding silent(1)	ovary(1)	5											81.0	73.0	75.0					5																	179251006		2203	4300	6503	179183612	SO:0001819	synonymous_variant	8878			U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.450G>A	5.37:g.179251006G>A			179183612	A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Silent	SNP	ENST00000389805.4	37	CCDS34317.1	SNP	48	Broad																																																																																				0.632	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319344.1			Silent
SLC22A23	63027	broad.mit.edu	37	6	3273559	3273559	+	Silent	SNP	G	G	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr6:3273559G>A	ENST00000406686.3	-	10	1790	c.1791C>T	c.(1789-1791)taC>taT	p.Y597Y	SLC22A23_ENST00000436008.2_Silent_p.Y605Y|SLC22A23_ENST00000490273.1_Silent_p.Y316Y|SLC22A23_ENST00000380302.4_Silent_p.Y316Y|PSMG4_ENST00000451246.2_Intron	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	597					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.Y316Y(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				ggtgcaggaagtagcctttct	0.617																																																1	Substitution - coding silent(1)	ovary(1)	6											117.0	86.0	96.0					6																	3273559		2203	4300	6503	3218558	SO:0001819	synonymous_variant	63027			AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.1791C>T	6.37:g.3273559G>A			3218558	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Silent	SNP	ENST00000406686.3	37	CCDS47363.1	SNP	36	Broad																																																																																				0.617	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945		Silent
DHX16	8449	broad.mit.edu	37	6	30633303	30633303	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr6:30633303G>T	ENST00000376442.3	-	5	1069	c.874C>A	c.(874-876)Ctg>Atg	p.L292M		NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	292					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.L292M(1)		kidney(2)|ovary(2)	4						GTGGCCTCCAGCTTCTCCTGC	0.637																																																1	Substitution - Missense(1)	ovary(1)	6											107.0	91.0	97.0					6																	30633303		1509	2708	4217	30741282	SO:0001583	missense	8449			AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.874C>A	6.37:g.30633303G>T	ENSP00000365625:p.Leu292Met		30741282	O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	ENST00000376442.3	37	CCDS4685.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	g	12.23	1.875894	0.33162	.	.	ENSG00000204560	ENST00000376442;ENST00000415603	T;T	0.64618	-0.11;0.85	5.12	3.28	0.37604	.	0.267749	0.36101	N	0.002783	T	0.26919	0.0659	L	0.34521	1.04	0.80722	D	1	B;B	0.24533	0.105;0.028	B;B	0.17979	0.02;0.004	T	0.14699	-1.0463	10	0.32370	T	0.25	.	5.0044	0.14280	0.1695:0.0:0.5821:0.2484	.	232;292	B4DZ28;O60231	.;DHX16_HUMAN	M	292;232	ENSP00000365625:L292M;ENSP00000399101:L232M	ENSP00000365625:L292M	L	-	1	2	DHX16	30741282	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.584000	0.36589	1.353000	0.45828	0.586000	0.80456	CTG		0.637	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587		Missense_Mutation
DHX16	8449	broad.mit.edu	37	6	30633415	30633415	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr6:30633415C>A	ENST00000376442.3	-	5	957	c.762G>T	c.(760-762)gaG>gaT	p.E254D		NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	254					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.E254D(1)		kidney(2)|ovary(2)	4						CAAAAAGGAACTCCTCATCAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	6											84.0	82.0	82.0					6																	30633415		1511	2708	4219	30741394	SO:0001583	missense	8449			AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.762G>T	6.37:g.30633415C>A	ENSP00000365625:p.Glu254Asp		30741394	O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	ENST00000376442.3	37	CCDS4685.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	c	20.8	4.044687	0.75732	.	.	ENSG00000204560	ENST00000376442;ENST00000415603	T;T	0.50001	0.76;0.76	5.12	2.33	0.28932	.	0.162750	0.53938	D	0.000053	T	0.39226	0.1070	M	0.72479	2.2	0.80722	D	1	P;B	0.48911	0.917;0.024	P;B	0.49140	0.601;0.066	T	0.37244	-0.9714	10	0.59425	D	0.04	.	8.6283	0.33904	0.0:0.6771:0.0:0.3229	.	194;254	B4DZ28;O60231	.;DHX16_HUMAN	D	254;194	ENSP00000365625:E254D;ENSP00000399101:E194D	ENSP00000365625:E254D	E	-	3	2	DHX16	30741394	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.878000	0.28126	0.738000	0.32606	0.586000	0.80456	GAG		0.632	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587		Missense_Mutation
ENPP4	22875	broad.mit.edu	37	6	46111285	46111285	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr6:46111285C>T	ENST00000321037.4	+	4	1500	c.1270C>T	c.(1270-1272)Ctc>Ttc	p.L424F		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	424					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)	p.L424F(1)		central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						GCTAACATGCCTCATAATAAT	0.413																																																1	Substitution - Missense(1)	ovary(1)	6											241.0	209.0	220.0					6																	46111285		2203	4300	6503	46219244	SO:0001583	missense	22875			AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.1270C>T	6.37:g.46111285C>T	ENSP00000318066:p.Leu424Phe		46219244	A8K5G1|Q7L2N1	Missense_Mutation	SNP	ENST00000321037.4	37	CCDS34468.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097480	0.56075	.	.	ENSG00000001561	ENST00000321037;ENST00000371401	T	0.73681	-0.77	5.91	5.91	0.95273	.	0.244295	0.42053	D	0.000766	T	0.68641	0.3023	L	0.56769	1.78	0.49915	D	0.999833	D	0.59767	0.986	P	0.58660	0.843	T	0.66925	-0.5800	10	0.13470	T	0.59	-12.9193	7.9409	0.29957	0.2665:0.6581:0.0:0.0753	.	424	Q9Y6X5	ENPP4_HUMAN	F	424	ENSP00000318066:L424F	ENSP00000318066:L424F	L	+	1	0	ENPP4	46219244	1.000000	0.71417	0.998000	0.56505	0.665000	0.39181	1.832000	0.39151	2.793000	0.96121	0.655000	0.94253	CTC		0.413	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040777.2			Missense_Mutation
RNF216	54476	broad.mit.edu	37	7	5760731	5760731	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr7:5760731C>T	ENST00000425013.2	-	9	1630	c.1406G>A	c.(1405-1407)cGt>cAt	p.R469H	RNF216_ENST00000389902.3_Missense_Mutation_p.R526H	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	469					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R526H(2)	FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		AAGGAGAGCACGTCGGTCATA	0.433																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	7											189.0	186.0	187.0					7																	5760731		2203	4300	6503	5727257	SO:0001583	missense	54476			AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.1406G>A	7.37:g.5760731C>T	ENSP00000404602:p.Arg469His		5727257	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	37	CCDS34595.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	11.33	1.608380	0.28623	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	T;T	0.29397	1.57;1.57	5.61	2.78	0.32641	.	0.630453	0.16645	N	0.205474	T	0.13798	0.0334	N	0.08118	0	0.21841	N	0.999519	B;B	0.14805	0.011;0.002	B;B	0.09377	0.004;0.002	T	0.15065	-1.0450	10	0.52906	T	0.07	-1.025	4.4702	0.11708	0.154:0.5222:0.0:0.3238	.	469;526	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	H	469;526;281	ENSP00000404602:R469H;ENSP00000374552:R526H	ENSP00000374552:R526H	R	-	2	0	RNF216	5727257	0.001000	0.12720	0.997000	0.53966	0.965000	0.64279	-0.778000	0.04664	0.716000	0.32124	0.491000	0.48974	CGT		0.433	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111		Missense_Mutation
SEMA3E	9723	broad.mit.edu	37	7	83119472	83119472	+	Silent	SNP	T	T	C			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr7:83119472T>C	ENST00000307792.3	-	2	701	c.234A>G	c.(232-234)gtA>gtG	p.V78V	SEMA3E_ENST00000427262.1_Silent_p.V18V	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	78	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.V78V(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				TGAGGGAATATACAAGGTCCC	0.408																																																1	Substitution - coding silent(1)	ovary(1)	7											87.0	81.0	83.0					7																	83119472		2203	4300	6503	82957408	SO:0001819	synonymous_variant	9723			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.234A>G	7.37:g.83119472T>C			82957408	B4E1P1|Q75M94|Q75M97	Silent	SNP	ENST00000307792.3	37	CCDS34674.1	SNP	49	Broad																																																																																				0.408	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431		Silent
ZKSCAN1	7586	broad.mit.edu	37	7	99630969	99630969	+	Missense_Mutation	SNP	G	G	T	rs144801167		TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr7:99630969G>T	ENST00000324306.6	+	6	1075	c.841G>T	c.(841-843)Gct>Tct	p.A281S	ZKSCAN1_ENST00000535170.1_Missense_Mutation_p.A68S|ZKSCAN1_ENST00000426572.1_Missense_Mutation_p.A245S	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	281	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A281S(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			AACCTCAAAGGCTGAAACCTC	0.443																																																1	Substitution - Missense(1)	ovary(1)	7						G	SER/ALA	0,4406		0,0,2203	54.0	56.0	56.0		841	2.8	0.5	7	dbSNP_134	56	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZKSCAN1	NM_003439.1	99	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign	281/564	99630969	1,13005	2203	4300	6503	99468905	SO:0001583	missense	7586			X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.841G>T	7.37:g.99630969G>T	ENSP00000323148:p.Ala281Ser		99468905	A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	ENST00000324306.6	37	CCDS34698.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	5.703	0.314289	0.10789	0.0	1.16E-4	ENSG00000106261	ENST00000324306;ENST00000426572;ENST00000535170	T;T;T	0.06768	3.36;3.31;3.26	5.64	2.78	0.32641	Krueppel-associated box (3);	0.431641	0.20207	N	0.096969	T	0.03564	0.0102	N	0.11427	0.14	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.46693	-0.9173	10	0.08381	T	0.77	.	6.6428	0.22919	0.3995:0.0:0.6005:0.0	.	281	P17029	ZKSC1_HUMAN	S	281;245;68	ENSP00000323148:A281S;ENSP00000409172:A245S;ENSP00000443508:A68S	ENSP00000323148:A281S	A	+	1	0	ZKSCAN1	99468905	0.003000	0.15002	0.509000	0.27700	0.042000	0.13812	0.235000	0.17948	0.425000	0.26087	0.650000	0.86243	GCT		0.443	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439		Missense_Mutation
RECK	8434	broad.mit.edu	37	9	36102105	36102105	+	Missense_Mutation	SNP	A	A	T			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-30-1853-01	TCGA-30-1853-10	g.chr9:36102105A>T	ENST00000377966.3	+	12	1879	c.1313A>T	c.(1312-1314)gAg>gTg	p.E438V		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	438					blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.E438V(1)		cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			GATTGTGTGGAGATTCTTAAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	9											102.0	103.0	103.0					9																	36102105		2203	4300	6503	36092105	SO:0001583	missense	8434			E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.1313A>T	9.37:g.36102105A>T	ENSP00000367202:p.Glu438Val		36092105	B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	ENST00000377966.3	37	CCDS6597.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	16.99	3.274766	0.59649	.	.	ENSG00000122707	ENST00000377966	T	0.50277	0.75	5.46	5.46	0.80206	.	0.047856	0.85682	D	0.000000	T	0.43344	0.1243	L	0.55213	1.73	0.47659	D	0.999482	P;P	0.50528	0.936;0.936	B;B	0.39258	0.295;0.295	T	0.51865	-0.8651	10	0.87932	D	0	-19.737	13.7874	0.63119	1.0:0.0:0.0:0.0	.	438;438	A8K9D8;O95980	.;RECK_HUMAN	V	438	ENSP00000367202:E438V	ENSP00000367202:E438V	E	+	2	0	RECK	36092105	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.103000	0.77014	2.202000	0.70862	0.533000	0.62120	GAG		0.393	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052409.1			Missense_Mutation
GFPT2	9945	broad.mit.edu	37	5	179763577	179763577	+	Splice_Site	DEL	C	C	-			TCGA-30-1853-01	TCGA-30-1853-10							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-30-1853-01	TCGA-30-1853-10	g.chr5:179763577delC	ENST00000253778.8	-	3	285	c.116delG	c.(115-117)ggt>gt	p.G39fs		NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	39	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)	p.G39fs*40(1)		breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	GATCGCCACACCTGTGATGTA	0.488																																																1	Deletion - Frameshift(1)	ovary(1)	5											181.0	187.0	185.0					5																	179763577		2035	4193	6228	179696183	SO:0001630	splice_region_variant	9945			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.116-1G>-	5.37:g.179763577delC			179696183	Q53XM2|Q9BWS4	Frame_Shift_Del	DEL	ENST00000253778.8	37	CCDS43411.1	DEL	18	Broad																																																																																				0.488	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373444.4	NM_005110	Frame_Shift_Del	Frame_Shift_Del
