#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ADAM9	8754	hgsc.bcm.edu	37	8	38928859	38928859	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr8:38928859C>A	ENST00000487273.2	+	15	1712	c.1634C>A	c.(1633-1635)tCt>tAt	p.S545Y		NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	545	Cys-rich.				activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.S545Y(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			GAAGTGAATTCTAAAGGTGAC	0.363																																																1	Substitution - Missense(1)	ovary(1)	8											122.0	118.0	119.0					8																	38928859		2203	4300	6503	39048016	SO:0001583	missense	8754			U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.1634C>A	8.37:g.38928859C>A	ENSP00000419446:p.Ser545Tyr		39048016	B7ZLN7|Q10718|Q8NFM6	Missense_Mutation	SNP	ENST00000487273.2	37	CCDS6112.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.48	3.632655	0.67015	.	.	ENSG00000168615	ENST00000487273	T	0.24538	1.85	5.09	5.09	0.68999	ADAM, cysteine-rich (2);	0.173729	0.50627	D	0.000109	T	0.55210	0.1906	M	0.81802	2.56	0.53688	D	0.999979	D	0.71674	0.998	D	0.72982	0.979	T	0.60495	-0.7252	10	0.66056	D	0.02	.	18.8756	0.92334	0.0:1.0:0.0:0.0	.	545	Q13443	ADAM9_HUMAN	Y	545	ENSP00000419446:S545Y	ENSP00000369249:S545Y	S	+	2	0	ADAM9	39048016	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.617000	0.54181	2.533000	0.85409	0.650000	0.86243	TCT		0.363	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357291.2			Missense_Mutation
AOC2	314	hgsc.bcm.edu	37	17	40997689	40997690	+	Frame_Shift_Ins	INS	-	-	G			TCGA-36-1575-01	TCGA-36-1575-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr17:40997689_40997690insG	ENST00000253799.3	+	1	1073_1074	c.1046_1047insG	c.(1045-1050)cagggtfs	p.QG349fs	AOC2_ENST00000452774.2_Frame_Shift_Ins_p.QG349fs	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	349					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)	p.E351fs*1(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		GTTCGGTTCCAGGGTGAGCGAA	0.505																																																1	Insertion - Frameshift(1)	ovary(1)	17																																								38251216	SO:0001589	frameshift_variant	314			AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.1049dupG	17.37:g.40997692_40997692dupG	ENSP00000253799:p.Gln349fs		38251215	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Frame_Shift_Ins	INS	ENST00000253799.3	37	CCDS11443.1	INS	7	Baylor																																																																																				0.505	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158		Frame_Shift_Ins
AP1G1	164	hgsc.bcm.edu	37	16	71772879	71772879	+	Missense_Mutation	SNP	A	A	G			TCGA-36-1575-01	TCGA-36-1575-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr16:71772879A>G	ENST00000299980.4	-	21	2675	c.2234T>C	c.(2233-2235)aTg>aCg	p.M745T	AP1G1_ENST00000393512.3_Missense_Mutation_p.M748T|AP1G1_ENST00000569748.1_Missense_Mutation_p.M745T|AP1G1_ENST00000433195.2_Missense_Mutation_p.M768T|AP1G1_ENST00000423132.2_Missense_Mutation_p.M748T|AP1G1_ENST00000564155.1_Missense_Mutation_p.M170T	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	745	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)	p.M745T(1)		breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				AAAGTCCGTCATATCTAGCTC	0.398																																																1	Substitution - Missense(1)	ovary(1)	16											193.0	170.0	178.0					16																	71772879		2198	4300	6498	70330380	SO:0001583	missense	164			Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.2234T>C	16.37:g.71772879A>G	ENSP00000299980:p.Met745Thr		70330380	O75709|O75842|Q9UG09|Q9Y3U4	Missense_Mutation	SNP	ENST00000299980.4	37	CCDS32480.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.6	4.314170	0.81358	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.29	5.29	0.74685	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Clathrin adaptor, gamma-adaptin, appendage (2);Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (2);	0.000000	0.85682	D	0.000000	T	0.59459	0.2195	L	0.56769	1.78	0.80722	D	1	P;P;B	0.41265	0.744;0.744;0.202	P;P;B	0.52066	0.689;0.689;0.44	T	0.62859	-0.6765	10	0.72032	D	0.01	-13.6756	15.2262	0.73354	1.0:0.0:0.0:0.0	.	745;768;748	O43747;B3KXW5;O43747-2	AP1G1_HUMAN;.;.	T	745;748;748;768	ENSP00000299980:M745T;ENSP00000377148:M748T;ENSP00000409153:M748T;ENSP00000403259:M768T	ENSP00000299980:M745T	M	-	2	0	AP1G1	70330380	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	1.996000	0.58369	0.528000	0.53228	ATG		0.398	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1			Missense_Mutation
ATP6V1C2	245973	hgsc.bcm.edu	37	2	10904525	10904525	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr2:10904525G>A	ENST00000272238.4	+	5	461	c.352G>A	c.(352-354)Gtg>Atg	p.V118M	ATP6V1C2_ENST00000381661.3_Missense_Mutation_p.V118M	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	118					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)	p.V118M(1)|p.V118L(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		GCAGCCGCTCGTGAGTGTGGT	0.522																																					NSCLC(188;1042 2136 10807 16813 47705)											2	Substitution - Missense(2)	ovary(2)	2											134.0	121.0	125.0					2																	10904525		2203	4300	6503	10821976	SO:0001583	missense	245973			AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.352G>A	2.37:g.10904525G>A	ENSP00000272238:p.Val118Met		10821976	Q96EL8	Missense_Mutation	SNP	ENST00000272238.4	37	CCDS42653.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050141	0.36181	.	.	ENSG00000143882	ENST00000272238;ENST00000381661	T;T	0.42513	0.97;0.97	5.71	3.9	0.45041	.	0.415587	0.24229	N	0.040376	T	0.30479	0.0766	L	0.38531	1.155	0.23150	N	0.998214	B;B	0.16166	0.016;0.006	B;B	0.20384	0.017;0.029	T	0.28038	-1.0056	10	0.66056	D	0.02	-9.111	5.2725	0.15632	0.2287:0.1527:0.6186:0.0	.	118;118	Q8NEY4-2;Q8NEY4	.;VATC2_HUMAN	M	118	ENSP00000272238:V118M;ENSP00000371077:V118M	ENSP00000272238:V118M	V	+	1	0	ATP6V1C2	10821976	1.000000	0.71417	0.836000	0.33094	0.795000	0.44927	3.260000	0.51523	0.747000	0.32809	0.655000	0.94253	GTG		0.522	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323555.1	NM_144583		Missense_Mutation
LDLRAD4	753	hgsc.bcm.edu	37	18	13621197	13621197	+	Missense_Mutation	SNP	A	A	G			TCGA-36-1575-01	TCGA-36-1575-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr18:13621197A>G	ENST00000359446.5	+	4	731	c.263A>G	c.(262-264)cAc>cGc	p.H88R	LDLRAD4_ENST00000399848.3_Missense_Mutation_p.H88R|LDLRAD4_ENST00000361205.4_Missense_Mutation_p.H88R|LDLRAD4_ENST00000586765.1_Missense_Mutation_p.H51R|LDLRAD4_ENST00000587757.1_Missense_Mutation_p.H51R|LDLRAD4_ENST00000585931.1_Missense_Mutation_p.H11R	NM_001276251.1	NP_001263180.1	O15165	LRAD4_HUMAN	low density lipoprotein receptor class A domain containing 4	88					negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	early endosome membrane (GO:0031901)|endosome (GO:0005768)|integral component of membrane (GO:0016021)	R-SMAD binding (GO:0070412)	p.H88R(1)									CTGCTGAACCACTACAAAGTC	0.632																																																1	Substitution - Missense(1)	ovary(1)	18											180.0	135.0	150.0					18																	13621197		2203	4300	6503	13611197	SO:0001583	missense	753			AF009424, AF009428	CCDS32793.1, CCDS32794.1, CCDS32795.1, CCDS42415.1, CCDS62392.1, CCDS62393.1	18p11.21	2014-04-29	2012-10-24	2012-10-24	ENSG00000168675	ENSG00000168675			1224	protein-coding gene	gene with protein product	"""clone 22"""	606571	"""chromosome 18 open reading frame 1"""	C18orf1		9479497, 9129712, 24627487	Standard	NM_181482		Approved		uc002ksb.3	O15165	OTTHUMG00000181925	ENST00000359446.5:c.263A>G	18.37:g.13621197A>G	ENSP00000352420:p.His88Arg		13611197	B3KNT9|E9PAY9|K7EN38|O15166|O15167|O15168|Q5U646|Q6NXP3	Missense_Mutation	SNP	ENST00000359446.5	37	CCDS32793.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	31	5.093675	0.94149	.	.	ENSG00000168675	ENST00000361205;ENST00000399848;ENST00000359446;ENST00000399847;ENST00000361303;ENST00000435606	T;T	0.29917	1.55;1.67	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.58133	0.2101	M	0.80746	2.51	0.80722	D	1	D;D;D;D;B;B	0.71674	0.996;0.998;0.996;0.998;0.027;0.034	D;D;D;D;B;B	0.81914	0.99;0.995;0.99;0.995;0.04;0.025	T	0.62305	-0.6882	10	0.54805	T	0.06	0.3969	15.4034	0.74858	1.0:0.0:0.0:0.0	.	30;30;51;51;88;88	O15165-4;O15165-3;E9PAY9;B3KNT9;O15165-2;O15165	.;.;.;.;.;CR001_HUMAN	R	88;88;51;51;30;30	ENSP00000354753:H88R;ENSP00000382741:H88R	ENSP00000352420:H51R	H	+	2	0	C18orf1	13611197	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.947000	0.75959	2.137000	0.66172	0.533000	0.62120	CAC		0.632	LDLRAD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458326.1	NM_181481		Missense_Mutation
CLDN11	5010	hgsc.bcm.edu	37	3	170136894	170136894	+	Missense_Mutation	SNP	A	A	T			TCGA-36-1575-01	TCGA-36-1575-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr3:170136894A>T	ENST00000064724.3	+	1	242	c.40A>T	c.(40-42)Agc>Tgc	p.S14C	CLDN11_ENST00000486975.1_Missense_Mutation_p.S14C|RP11-469J4.3_ENST00000468232.1_lincRNA|CLDN11_ENST00000451576.1_Missense_Mutation_p.S14C	NM_005602.5	NP_005593.2	O75508	CLD11_HUMAN	claudin 11	14					axon ensheathment (GO:0008366)|calcium-independent cell-cell adhesion (GO:0016338)|spermatogenesis (GO:0007283)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.S14C(1)		central_nervous_system(2)|endometrium(2)|large_intestine(1)|liver(2)|lung(3)|ovary(2)	12	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			CTTCGTCACGAGCTTCGTGGG	0.672																																																1	Substitution - Missense(1)	ovary(1)	3											37.0	35.0	36.0					3																	170136894		2131	4135	6266	171619588	SO:0001583	missense	5010			AF068863	CCDS3213.1	3q26.2-q26.3	2008-08-01	2008-08-01		ENSG00000013297	ENSG00000013297		"""Claudins"""	8514	protein-coding gene	gene with protein product		601326	"""oligodendrocyte transmembrane protein"""	OTM		8661061, 8797478	Standard	NM_005602		Approved	OSP	uc003fgx.3	O75508	OTTHUMG00000158940	ENST00000064724.3:c.40A>T	3.37:g.170136894A>T	ENSP00000064724:p.Ser14Cys		171619588	B2R7C1|D3DNQ5|Q5U0P3	Missense_Mutation	SNP	ENST00000064724.3	37	CCDS3213.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	25.9	4.689300	0.88735	.	.	ENSG00000013297	ENST00000064724;ENST00000486975;ENST00000451576	D;D;D	0.89050	-2.46;-2.46;-2.46	5.15	3.98	0.46160	.	0.080020	0.85682	D	0.000000	D	0.92001	0.7466	L	0.59436	1.845	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.81914	0.946;0.995	D	0.90366	0.4377	10	0.42905	T	0.14	.	11.0109	0.47663	0.9262:0.0:0.0738:0.0	.	14;14	B4DFI2;O75508	.;CLD11_HUMAN	C	14	ENSP00000064724:S14C;ENSP00000417434:S14C;ENSP00000410185:S14C	ENSP00000064724:S14C	S	+	1	0	CLDN11	171619588	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.839000	0.75364	0.791000	0.33826	0.455000	0.32223	AGC		0.672	CLDN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352403.1	NM_005602		Missense_Mutation
CSRP1	1465	hgsc.bcm.edu	37	1	201459309	201459309	+	Missense_Mutation	SNP	G	G	C	rs143052124	byFrequency	TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr1:201459309G>C	ENST00000367306.1	-	4	639	c.276C>G	c.(274-276)caC>caG	p.H92Q	CSRP1_ENST00000531916.1_Missense_Mutation_p.H92Q|CSRP1_ENST00000340006.2_Missense_Mutation_p.H92Q|CSRP1_ENST00000526723.1_Missense_Mutation_p.H59Q|CSRP1_ENST00000458271.2_5'UTR|CSRP1_ENST00000533432.1_Missense_Mutation_p.H92Q|CSRP1_ENST00000532460.1_Missense_Mutation_p.H92Q			P21291	CSRP1_HUMAN	cysteine and glycine-rich protein 1	92					platelet aggregation (GO:0070527)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.H92Q(1)		large_intestine(3)|lung(2)|ovary(1)	6						CTCACTCCTCGTGCTTGATAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											76.0	69.0	71.0					1																	201459309		2203	4300	6503	199725932	SO:0001583	missense	1465			M33146	CCDS1413.1	1q32	2008-02-05			ENSG00000159176	ENSG00000159176			2469	protein-coding gene	gene with protein product		123876		CYRP		2115670, 9925910	Standard	NM_004078		Approved	CSRP, D1S181E	uc021phh.1	P21291	OTTHUMG00000035773	ENST00000367306.1:c.276C>G	1.37:g.201459309G>C	ENSP00000356275:p.His92Gln		199725932	A8K268|Q5U0J2	Missense_Mutation	SNP	ENST00000367306.1	37	CCDS1413.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.145	0.786049	0.16189	.	.	ENSG00000159176	ENST00000367306;ENST00000340006;ENST00000531916;ENST00000532460;ENST00000533432;ENST00000526723;ENST00000524951	T;T;T;T;T;T;T	0.70869	-0.01;-0.01;-0.52;-0.01;-0.01;-0.2;-0.25	5.19	-6.42	0.01932	.	0.538222	0.20433	N	0.092437	T	0.47040	0.1424	L	0.40543	1.245	0.38311	D	0.94325	B;B;B	0.24768	0.111;0.007;0.0	B;B;B	0.28139	0.086;0.031;0.001	T	0.30475	-0.9977	10	0.14656	T	0.56	0.0282	1.9818	0.03428	0.3656:0.2231:0.3027:0.1086	.	92;92;92	B4E2T4;B4DY28;P21291	.;.;CSRP1_HUMAN	Q	92;92;92;92;92;59;55	ENSP00000356275:H92Q;ENSP00000345079:H92Q;ENSP00000432110:H92Q;ENSP00000434147:H92Q;ENSP00000436792:H92Q;ENSP00000436491:H59Q;ENSP00000437218:H55Q	ENSP00000345079:H92Q	H	-	3	2	CSRP1	199725932	0.000000	0.05858	0.443000	0.26883	0.530000	0.34684	-2.506000	0.00962	-1.513000	0.01789	-0.781000	0.03364	CAC		0.537	CSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087027.1	NM_004078		Missense_Mutation
DUSP19	142679	hgsc.bcm.edu	37	2	183960270	183960270	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr2:183960270G>C	ENST00000354221.4	+	4	713	c.538G>C	c.(538-540)Gtg>Ctg	p.V180L	AC064871.3_ENST00000413954.1_RNA|DUSP19_ENST00000469344.1_3'UTR|DUSP19_ENST00000342619.6_Missense_Mutation_p.V129L|AC064871.3_ENST00000444562.1_RNA	NM_080876.3	NP_543152.1	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19	180	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase activity (GO:0045860)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	JUN kinase phosphatase activity (GO:0008579)|MAP-kinase scaffold activity (GO:0005078)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase activator activity (GO:0030295)|protein kinase inhibitor activity (GO:0004860)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/threonine phosphatase activity (GO:0008330)	p.V180L(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(4)|pancreas(1)	17						TTTTTCTTTGGTGAAAAATGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	2											133.0	135.0	135.0					2																	183960270		2203	4300	6503	183668515	SO:0001583	missense	142679			AB038770	CCDS2289.1, CCDS46469.1	2q32.1	2011-06-09			ENSG00000162999	ENSG00000162999		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18894	protein-coding gene	gene with protein product		611437					Standard	NM_080876		Approved	SKRP1, DUSP17	uc002upd.3	Q8WTR2	OTTHUMG00000132622	ENST00000354221.4:c.538G>C	2.37:g.183960270G>C	ENSP00000346160:p.Val180Leu		183668515	B2RA79|Q547H4|Q8WYN4	Missense_Mutation	SNP	ENST00000354221.4	37	CCDS2289.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	34	5.301912	0.95601	.	.	ENSG00000162999	ENST00000342619;ENST00000354221	D;D	0.85629	-2.01;-2.01	5.74	5.74	0.90152	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.107189	0.64402	D	0.000005	D	0.89160	0.6636	L	0.49256	1.55	0.80722	D	1	P;P	0.46578	0.778;0.88	P;P	0.55087	0.55;0.768	D	0.88804	0.3287	10	0.56958	D	0.05	.	19.9092	0.97021	0.0:0.0:1.0:0.0	.	129;180	Q8WTR2-2;Q8WTR2	.;DUS19_HUMAN	L	129;180	ENSP00000343905:V129L;ENSP00000346160:V180L	ENSP00000343905:V129L	V	+	1	0	DUSP19	183668515	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	8.835000	0.92100	2.711000	0.92665	0.591000	0.81541	GTG		0.403	DUSP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255866.1			Missense_Mutation
FAM171A1	221061	hgsc.bcm.edu	37	10	15256063	15256063	+	Silent	SNP	G	G	A			TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr10:15256063G>A	ENST00000378116.4	-	8	1530	c.1524C>T	c.(1522-1524)tcC>tcT	p.S508S	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	508						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TGCTTCCCGTGGAGGCTGGAC	0.517																																																0			10											150.0	131.0	138.0					10																	15256063		2203	4300	6503	15296069	SO:0001819	synonymous_variant	221061			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1524C>T	10.37:g.15256063G>A			15296069	D3DRT9|Q32M49|Q8N4I0	Silent	SNP	ENST00000378116.4	37	CCDS31154.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.170770	0.00315	.	.	ENSG00000148468	ENST00000396781	.	.	.	5.25	-1.6	0.08426	.	.	.	.	.	T	0.36496	0.0969	.	.	.	0.50632	D	0.999888	.	.	.	.	.	.	T	0.23084	-1.0198	5	0.26408	T	0.33	-6.4775	0.3892	0.00408	0.2661:0.2245:0.2828:0.2266	.	.	.	.	L	508	.	ENSP00000380001:P508L	P	-	2	0	FAM171A1	15296069	0.598000	0.26882	0.000000	0.03702	0.000000	0.00434	0.491000	0.22419	-0.382000	0.07870	-2.010000	0.00438	CCA		0.517	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		Silent
FBXO31	79791	hgsc.bcm.edu	37	16	87393970	87393970	+	Missense_Mutation	SNP	A	A	G			TCGA-36-1575-01	TCGA-36-1575-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr16:87393970A>G	ENST00000311635.7	-	2	355	c.343T>C	c.(343-345)Tat>Cat	p.Y115H	RP11-178L8.9_ENST00000602779.1_RNA	NM_001282683.1|NM_024735.3	NP_001269612.1|NP_079011.3	Q5XUX0	FBX31_HUMAN	F-box protein 31	115					cellular response to DNA damage stimulus (GO:0006974)|cyclin catabolic process (GO:0008054)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)	p.Y115H(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0272)		CAAACACCATACTCTGTAACA	0.483																																																1	Substitution - Missense(1)	ovary(1)	16											103.0	92.0	96.0					16																	87393970		2198	4300	6498	85951471	SO:0001583	missense	79791			BC002985	CCDS32501.1, CCDS73922.1	16q24	2008-12-18	2004-05-27			ENSG00000103264		"""F-boxes /  ""other"""""	16510	protein-coding gene	gene with protein product		609102	"""F-box only protein 31"""				Standard	NM_024735		Approved	FBX14, FBXO14, Fbx31, MGC15419	uc002fjw.3	Q5XUX0		ENST00000311635.7:c.343T>C	16.37:g.87393970A>G	ENSP00000310841:p.Tyr115His		85951471	Q5K680|Q8WYV1|Q96D73|Q9UFV4	Missense_Mutation	SNP	ENST00000311635.7	37	CCDS32501.1	SNP	14	Baylor	.	.	.	.	.	.	.	.	.	.	A	25.3	4.626959	0.87560	.	.	ENSG00000103264	ENST00000311635	T	0.55760	0.5	5.64	5.64	0.86602	F-box domain, Skp2-like (1);	0.056883	0.64402	D	0.000001	T	0.55545	0.1927	N	0.14661	0.345	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.63877	0.897;0.919	T	0.63603	-0.6600	10	0.87932	D	0	-22.1402	15.8578	0.78994	1.0:0.0:0.0:0.0	.	115;7	Q5XUX0;Q5XUX0-2	FBX31_HUMAN;.	H	115	ENSP00000310841:Y115H	ENSP00000310841:Y115H	Y	-	1	0	FBXO31	85951471	1.000000	0.71417	0.998000	0.56505	0.955000	0.61496	7.536000	0.82023	2.147000	0.66899	0.533000	0.62120	TAT		0.483	FBXO31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430799.2	NM_024735		Missense_Mutation
GC	2638	hgsc.bcm.edu	37	4	72629165	72629165	+	Missense_Mutation	SNP	A	A	T			TCGA-36-1575-01	TCGA-36-1575-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr4:72629165A>T	ENST00000273951.8	-	6	1004	c.661T>A	c.(661-663)Tca>Aca	p.S221T	GC_ENST00000504199.1_Missense_Mutation_p.S240T|GC_ENST00000513476.1_Missense_Mutation_p.S221T|GC_ENST00000503472.1_5'UTR	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	221	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)	p.S221T(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	GCATATTGTGAGCAGACTCTA	0.368																																																1	Substitution - Missense(1)	ovary(1)	4											116.0	109.0	111.0					4																	72629165		2203	4300	6503	72848029	SO:0001583	missense	2638			L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.661T>A	4.37:g.72629165A>T	ENSP00000273951:p.Ser221Thr		72848029	B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Missense_Mutation	SNP	ENST00000273951.8	37	CCDS3550.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.8	4.342174	0.81911	.	.	ENSG00000145321	ENST00000273951;ENST00000504199;ENST00000513476	T;T;T	0.73152	-0.72;-0.72;-0.72	5.72	5.72	0.89469	.	0.341929	0.28273	N	0.015948	T	0.82107	0.4965	M	0.72894	2.215	0.36621	D	0.87576	D;D	0.71674	0.959;0.998	P;D	0.87578	0.874;0.998	D	0.86353	0.1712	10	0.66056	D	0.02	.	11.6415	0.51235	0.8516:0.1483:0.0:0.0	.	240;221	D6RAK8;D6RF35	.;.	T	221;240;221	ENSP00000273951:S221T;ENSP00000421725:S240T;ENSP00000426683:S221T	ENSP00000273951:S221T	S	-	1	0	GC	72848029	0.998000	0.40836	0.982000	0.44146	0.978000	0.69477	4.005000	0.57075	2.176000	0.68965	0.533000	0.62120	TCA		0.368	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252167.2			Missense_Mutation
GCC2	9648	hgsc.bcm.edu	37	2	109102154	109102154	+	Missense_Mutation	SNP	G	G	T	rs369363942		TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr2:109102154G>T	ENST00000309863.6	+	14	4390	c.3676G>T	c.(3676-3678)Gtg>Ttg	p.V1226L		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1226					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						GCAATTGCTTGTGAAAACCAA	0.289																																																0			2											60.0	59.0	59.0					2																	109102154		2203	4297	6500	108468586	SO:0001583	missense	9648			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.3676G>T	2.37:g.109102154G>T	ENSP00000307939:p.Val1226Leu		108468586	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	ENST00000309863.6	37	CCDS33268.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.51	2.853604	0.51270	.	.	ENSG00000135968	ENST00000309863	T	0.34275	1.37	5.64	4.76	0.60689	.	0.072022	0.56097	D	0.000039	T	0.38665	0.1049	M	0.69823	2.125	0.49915	D	0.999837	B	0.22276	0.067	B	0.17722	0.019	T	0.20638	-1.0269	10	0.27785	T	0.31	.	14.8908	0.70606	0.0691:0.0:0.9309:0.0	.	1226	Q8IWJ2	GCC2_HUMAN	L	1226	ENSP00000307939:V1226L	ENSP00000307939:V1226L	V	+	1	0	GCC2	108468586	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.617000	0.74210	1.519000	0.48950	0.563000	0.77884	GTG		0.289	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358516.3	NM_014635		Missense_Mutation
GCNT2	2651	hgsc.bcm.edu	37	6	10557283	10557283	+	Intron	SNP	A	A	G			TCGA-36-1575-01	TCGA-36-1575-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr6:10557283A>G	ENST00000379597.3	+	1	1481				GCNT2_ENST00000316170.3_Silent_p.K209K|GCNT2_ENST00000495262.1_Intron|GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000410107.1_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)						maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)	p.K209K(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		AAGGATTTAAAGGTAAAAATA	0.473																																																1	Substitution - coding silent(1)	ovary(1)	6											63.0	64.0	64.0					6																	10557283		2203	4300	6503	10665269	SO:0001627	intron_variant	2651			L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.925+27214A>G	6.37:g.10557283A>G			10665269		Silent	SNP	ENST00000379597.3	37	CCDS34338.1	SNP	3	Baylor																																																																																				0.473	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327912.3	NM_145649		Silent
GOLGA4	2803	hgsc.bcm.edu	37	3	37323463	37323463	+	Missense_Mutation	SNP	G	G	T			TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr3:37323463G>T	ENST00000361924.2	+	3	551	c.177G>T	c.(175-177)caG>caT	p.Q59H	GOLGA4_ENST00000444882.1_Missense_Mutation_p.Q59H|GOLGA4_ENST00000435830.2_Intron|GOLGA4_ENST00000356847.4_Missense_Mutation_p.Q81H	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	59					Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)	p.Q59H(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GTGACACACAGTCTTTTGCAC	0.428																																																1	Substitution - Missense(1)	ovary(1)	3											79.0	89.0	86.0					3																	37323463		2203	4300	6503	37298467	SO:0001583	missense	2803			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.177G>T	3.37:g.37323463G>T	ENSP00000354486:p.Gln59His		37298467	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	37	CCDS2666.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031671	0.75504	.	.	ENSG00000144674	ENST00000361924;ENST00000444882;ENST00000356847;ENST00000450863;ENST00000431105	T;T	0.31510	1.57;1.49	5.68	4.8	0.61643	.	0.000000	0.34555	N	0.003880	T	0.48857	0.1523	L	0.52573	1.65	0.43195	D	0.995035	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.91635	0.964;0.997;0.997;0.999	T	0.49643	-0.8918	10	0.72032	D	0.01	.	12.8313	0.57748	0.1362:0.0:0.8638:0.0	.	59;81;59;81	Q86W71;F8W8Q7;Q13439;E7EVX2	.;.;GOGA4_HUMAN;.	H	59;59;81;81;114	ENSP00000354486:Q59H;ENSP00000349305:Q81H	ENSP00000349305:Q81H	Q	+	3	2	GOLGA4	37298467	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	1.332000	0.33805	1.399000	0.46721	0.563000	0.77884	CAG		0.428	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078		Missense_Mutation
HS1BP3	64342	hgsc.bcm.edu	37	2	20818991	20818991	+	Nonsense_Mutation	SNP	A	A	T			TCGA-36-1575-01	TCGA-36-1575-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr2:20818991A>T	ENST00000304031.3	-	7	960	c.935T>A	c.(934-936)tTg>tAg	p.L312*		NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	312							phosphatidylinositol binding (GO:0035091)	p.L312*(1)		endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATCTGGTCCAAGTCCTCTTC	0.577																																																1	Substitution - Nonsense(1)	ovary(1)	2											38.0	37.0	37.0					2																	20818991		2203	4300	6503	20682472	SO:0001587	stop_gained	64342				CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.935T>A	2.37:g.20818991A>T	ENSP00000305193:p.Leu312*		20682472	B2RAW2|D6W529|Q86VC2|Q8N367	Nonsense_Mutation	SNP	ENST00000304031.3	37	CCDS1700.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	37	6.069711	0.97256	.	.	ENSG00000118960	ENST00000304031	.	.	.	5.4	5.4	0.78164	.	0.233630	0.29307	N	0.012526	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5984	11.8233	0.52252	1.0:0.0:0.0:0.0	.	.	.	.	X	312	.	ENSP00000305193:L312X	L	-	2	0	HS1BP3	20682472	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.262000	0.51538	2.067000	0.61834	0.496000	0.49642	TTG		0.577	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242863.1	NM_022460		Nonsense_Mutation
HDAC4	9759	hgsc.bcm.edu	37	2	240085532	240085532	+	Missense_Mutation	SNP	T	T	G			TCGA-36-1575-01	TCGA-36-1575-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr2:240085532T>G	ENST00000345617.3	-	6	1369	c.578A>C	c.(577-579)cAc>cCc	p.H193P	AC017028.1_ENST00000396489.1_5'Flank|HDAC4_ENST00000541256.1_Missense_Mutation_p.H162P	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	193	Interaction with MEF2A.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.H193P(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GGAAATGCAGTGGTTCAGATT	0.587																																																1	Substitution - Missense(1)	ovary(1)	2											129.0	131.0	130.0					2																	240085532		2203	4300	6503	239750469	SO:0001583	missense	9759			AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.578A>C	2.37:g.240085532T>G	ENSP00000264606:p.His193Pro		239750469	Q9UND6	Missense_Mutation	SNP	ENST00000345617.3	37	CCDS2529.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	11.41	1.631355	0.28978	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000541256;ENST00000393621;ENST00000454542	T;T;T	0.57273	1.01;1.01;0.41	4.31	3.14	0.36123	.	0.181791	0.47093	N	0.000250	T	0.52741	0.1753	L	0.49778	1.585	0.80722	D	1	B;B;B;P;P;P	0.43578	0.0;0.04;0.023;0.811;0.661;0.661	B;B;B;P;B;B	0.48627	0.001;0.029;0.043;0.584;0.333;0.333	T	0.46303	-0.9201	9	.	.	.	.	11.0097	0.47654	0.0:0.0:0.1707:0.8293	.	188;76;162;162;161;193	B7Z8G5;F5H0Q9;F5H5W4;B7Z8I2;Q53SM2;P56524	.;.;.;.;.;HDAC4_HUMAN	P	193;76;162;76;162	ENSP00000264606:H193P;ENSP00000443057:H162P;ENSP00000405226:H162P	.	H	-	2	0	HDAC4	239750469	1.000000	0.71417	1.000000	0.80357	0.256000	0.26092	5.558000	0.67319	0.628000	0.30357	-0.331000	0.08364	CAC		0.587	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037		Missense_Mutation
HTR2A	3356	hgsc.bcm.edu	37	13	47409726	47409726	+	Missense_Mutation	SNP	A	A	G			TCGA-36-1575-01	TCGA-36-1575-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr13:47409726A>G	ENST00000378688.4	-	3	793	c.662T>C	c.(661-663)gTc>gCc	p.V221A	HTR2A_ENST00000542664.1_Missense_Mutation_p.V221A|HTR2A_ENST00000543956.1_Missense_Mutation_p.V137A			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	221					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.V221A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CTCCTTAAAGACCTTCGAATC	0.403																																																1	Substitution - Missense(1)	ovary(1)	13											68.0	67.0	67.0					13																	47409726		2203	4300	6503	46307727	SO:0001583	missense	3356			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.662T>C	13.37:g.47409726A>G	ENSP00000367959:p.Val221Ala		46307727	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	ENST00000378688.4	37	CCDS9405.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	24.6	4.550057	0.86127	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.65364	-0.15;-0.15;-0.15	6.08	6.08	0.98989	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.60919	0.2306	L	0.39467	1.215	0.80722	D	1	P;P	0.50528	0.936;0.866	P;P	0.49528	0.614;0.507	T	0.56019	-0.8048	10	0.16896	T	0.51	.	15.8323	0.78764	1.0:0.0:0.0:0.0	.	137;221	F5GWE8;P28223	.;5HT2A_HUMAN	A	221;137;221	ENSP00000367959:V221A;ENSP00000441861:V137A;ENSP00000437737:V221A	ENSP00000367959:V221A	V	-	2	0	HTR2A	46307727	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.339000	0.96797	2.333000	0.79357	0.482000	0.46254	GTC		0.403	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621		Missense_Mutation
KDM5C	8242	hgsc.bcm.edu	37	X	53246446	53246446	+	Missense_Mutation	SNP	C	C	T	rs201805773		TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chrX:53246446C>T	ENST00000375401.3	-	5	1068	c.536G>A	c.(535-537)cGt>cAt	p.R179H	KDM5C_ENST00000375379.3_Missense_Mutation_p.R179H|KDM5C_ENST00000452825.3_Missense_Mutation_p.R112H|KDM5C_ENST00000375383.3_Missense_Mutation_p.R138H|KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000404049.3_Missense_Mutation_p.R178H	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	179					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.R179H(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						ATCAAATGGACGTGTGTTACA	0.537			"""N, F, S"""		clear cell renal carcinoma																																		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	1	Substitution - Missense(1)	ovary(1)	X						C	HIS/ARG,HIS/ARG	0,3835		0,0,0,1632,571	158.0	101.0	120.0		335,536	5.3	1.0	X		120	3,6725		0,2,1,2426,1871	yes	missense,missense	KDM5C	NM_001146702.1,NM_004187.3	29,29	0,2,1,4058,2442	TT,TC,T,CC,C		0.0446,0.0,0.0284	benign,benign	112/1380,179/1561	53246446	3,10560	2203	4300	6503	53263171	SO:0001583	missense	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.536G>A	X.37:g.53246446C>T	ENSP00000364550:p.Arg179His		53263171	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135536	0.37728	0.0	4.46E-4	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;D;T;T	0.84070	-0.01;-0.01;-1.8;-0.01;-0.01	5.32	5.32	0.75619	ARID/BRIGHT DNA-binding domain (2);	0.634787	0.15016	N	0.285270	T	0.72479	0.3465	N	0.17674	0.51	0.41923	D	0.990528	B;B;B	0.13145	0.007;0.001;0.001	B;B;B	0.08055	0.003;0.001;0.001	T	0.66606	-0.5881	10	0.31617	T	0.26	-4.9324	13.3961	0.60853	0.0:1.0:0.0:0.0	.	112;178;179	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	H	112;179;178;179;138	ENSP00000445176:R112H;ENSP00000364550:R179H;ENSP00000385394:R178H;ENSP00000364528:R179H;ENSP00000364532:R138H	ENSP00000364528:R179H	R	-	2	0	KDM5C	53263171	0.996000	0.38824	1.000000	0.80357	0.991000	0.79684	2.140000	0.42159	2.226000	0.72624	0.529000	0.55759	CGT		0.537	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187		Missense_Mutation
KHDRBS2	202559	hgsc.bcm.edu	37	6	62995810	62995810	+	Missense_Mutation	SNP	T	T	G			TCGA-36-1575-01	TCGA-36-1575-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr6:62995810T>G	ENST00000281156.4	-	1	322	c.44A>C	c.(43-45)gAt>gCt	p.D15A		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	15					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)	p.D15A(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		ATCCAGGCTATCTTTCTCTGC	0.587																																																1	Substitution - Missense(1)	ovary(1)	6											140.0	104.0	116.0					6																	62995810		2203	4300	6503	63053769	SO:0001583	missense	202559			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.44A>C	6.37:g.62995810T>G	ENSP00000281156:p.Asp15Ala		63053769	A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	ENST00000281156.4	37	CCDS4963.1	SNP	50	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.04	3.009996	0.54361	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.45668	0.89	5.41	5.41	0.78517	.	0.150212	0.64402	D	0.000014	T	0.25158	0.0611	L	0.60455	1.87	0.41976	D	0.990777	B	0.30406	0.278	B	0.24974	0.057	T	0.20538	-1.0272	10	0.62326	D	0.03	.	11.8551	0.52433	0.0:0.0:0.0:1.0	.	15	Q5VWX1	KHDR2_HUMAN	A	15	ENSP00000281156:D15A	ENSP00000281156:D15A	D	-	2	0	KHDRBS2	63053769	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.196000	0.72094	2.057000	0.61298	0.454000	0.30748	GAT		0.587	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041066.2	NM_152688		Missense_Mutation
MAD2L2	10459	hgsc.bcm.edu	37	1	11736164	11736164	+	Frame_Shift_Del	DEL	C	C	-			TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr1:11736164delC	ENST00000235310.3	-	8	1294	c.366delG	c.(364-366)ctgfs	p.L123fs	MAD2L2_ENST00000376667.3_Frame_Shift_Del_p.L123fs|MAD2L2_ENST00000376669.5_Frame_Shift_Del_p.L136fs|MAD2L2_ENST00000376692.4_Frame_Shift_Del_p.L123fs|MAD2L2_ENST00000376672.1_Frame_Shift_Del_p.L136fs			Q9UI95	MD2L2_HUMAN	MAD2 mitotic arrest deficient-like 2 (yeast)	123	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.|Mediates interaction with REV1 and REV3L and homodimerization.				actin filament organization (GO:0007015)|DNA damage response, signal transduction resulting in transcription (GO:0042772)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|zeta DNA polymerase complex (GO:0016035)	JUN kinase binding (GO:0008432)|RNA polymerase II activating transcription factor binding (GO:0001102)	p.L123fs*6(1)		kidney(1)|large_intestine(1)|lung(2)|ovary(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCCCGGAGCAGCTGCTCCA	0.617								DNA polymerases (catalytic subunits)																																								1	Deletion - Frameshift(1)	ovary(1)	1											77.0	68.0	71.0					1																	11736164		2203	4300	6503	11658751	SO:0001589	frameshift_variant	10459			AF139365	CCDS134.1	1p36	2013-01-17	2001-11-28		ENSG00000116670	ENSG00000116670		"""DNA polymerases"""	6764	protein-coding gene	gene with protein product	"""mitotic arrest deficient homolog-like 2"", ""polymerase (DNA-directed), zeta 2, accessory subunit"""	604094	"""MAD2 (mitotic arrest deficient, yeast, homolog)-like 2"""			10366450	Standard	NM_006341		Approved	MAD2B, REV7, POLZ2	uc009vnc.3	Q9UI95	OTTHUMG00000002231	ENST00000235310.3:c.366delG	1.37:g.11736164delC	ENSP00000235310:p.Leu123fs		11658751	B3KNE3|Q5TGW7|Q9UNA7|Q9Y6I6	Frame_Shift_Del	DEL	ENST00000235310.3	37	CCDS134.1	DEL	25	Baylor																																																																																				0.617	MAD2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006344.2	NM_006341		Frame_Shift_Del
KIF17	57576	hgsc.bcm.edu	37	1	21014310	21014310	+	Silent	SNP	C	C	T	rs540680062		TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr1:21014310C>T	ENST00000247986.2	-	8	1819	c.1509G>A	c.(1507-1509)acG>acA	p.T503T	KIF17_ENST00000375044.1_Silent_p.T403T|KIF17_ENST00000490034.1_Intron|KIF17_ENST00000400463.3_Silent_p.T503T			Q9P2E2	KIF17_HUMAN	kinesin family member 17	503					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.T503T(1)		NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GAGTGTCAGTCGTGGAGAAGA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	1											88.0	82.0	84.0					1																	21014310		2203	4300	6503	20886897	SO:0001819	synonymous_variant	57576			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1509G>A	1.37:g.21014310C>T			20886897	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	ENST00000247986.2	37	CCDS213.1	SNP	31	Baylor																																																																																				0.547	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816		Silent
MC2R	4158	hgsc.bcm.edu	37	18	13884979	13884979	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr18:13884979G>A	ENST00000327606.3	-	2	719	c.539C>T	c.(538-540)tCg>tTg	p.S180L		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	180					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)	p.S180L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	CGGGAACAGCGACGTGAAGGT	0.572																																					Colon(141;1584 1782 35999 48227 48692)											1	Substitution - Missense(1)	ovary(1)	18	GRCh37	CM057717	MC2R	M							156.0	129.0	138.0					18																	13884979		2203	4300	6503	13874979	SO:0001583	missense	4158				CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.539C>T	18.37:g.13884979G>A	ENSP00000333821:p.Ser180Leu		13874979	A8K016|Q3MI45|Q504X6	Missense_Mutation	SNP	ENST00000327606.3	37	CCDS11869.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.77	2.038010	0.35989	.	.	ENSG00000185231	ENST00000327606;ENST00000399821	T	0.31510	1.49	5.28	4.38	0.52667	GPCR, rhodopsin-like superfamily (1);	0.362753	0.26875	N	0.022060	T	0.27384	0.0672	M	0.67700	2.07	0.09310	N	1	B	0.33940	0.433	B	0.27608	0.081	T	0.36114	-0.9761	10	0.72032	D	0.01	.	6.26	0.20895	0.3436:0.0:0.6564:0.0	.	180	Q01718	ACTHR_HUMAN	L	180	ENSP00000333821:S180L	ENSP00000333821:S180L	S	-	2	0	MC2R	13874979	0.012000	0.17670	0.006000	0.13384	0.827000	0.46813	1.989000	0.40707	1.160000	0.42584	0.655000	0.94253	TCG		0.572	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254639.2			Missense_Mutation
NPC1L1	29881	hgsc.bcm.edu	37	7	44560365	44560365	+	Splice_Site	SNP	T	T	C			TCGA-36-1575-01	TCGA-36-1575-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr7:44560365T>C	ENST00000289547.4	-	14	3190	c.3135A>G	c.(3133-3135)ttA>ttG	p.L1045L	NPC1L1_ENST00000546276.1_Splice_Site_p.L999L|NPC1L1_ENST00000381160.3_Splice_Site_p.L1045L	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1045					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)	p.L1045L(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CATGCTTACCTAAAACCTGGC	0.562																																																1	Substitution - coding silent(1)	ovary(1)	7											89.0	79.0	82.0					7																	44560365		2203	4300	6503	44526890	SO:0001630	splice_region_variant	29881				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3136+1A>G	7.37:g.44560365T>C			44526890	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	37	CCDS5491.1	SNP	53	Baylor																																																																																				0.562	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	Silent	Silent
NR2C2AP	126382	hgsc.bcm.edu	37	19	19313199	19313199	+	Missense_Mutation	SNP	C	C	T	rs189316493		TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr19:19313199C>T	ENST00000331552.7	-	4	607	c.244G>A	c.(244-246)Ggc>Agc	p.G82S	NR2C2AP_ENST00000538165.2_Missense_Mutation_p.G82S|NR2C2AP_ENST00000544883.1_Silent_p.R46R|NR2C2AP_ENST00000420605.3_Missense_Mutation_p.G82S	NM_176880.4	NP_795361.1	Q86WQ0	NR2CA_HUMAN	nuclear receptor 2C2-associated protein	82					cell adhesion (GO:0007155)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)		p.G82S(1)		breast(1)|cervix(1)|kidney(2)|ovary(1)	5			Epithelial(12;0.00235)			GCCTGAGTGCCCTGTGAACCT	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18954	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19											160.0	163.0	162.0					19																	19313199		2203	4300	6503	19174199	SO:0001583	missense	126382			AY101377	CCDS32967.1, CCDS74316.1	19p13.11	2008-01-10				ENSG00000184162			30763	protein-coding gene	gene with protein product	"""TR4 orphan receptor associated protein TRA16"""	608719				12486131	Standard	XM_005259740		Approved	TRA16	uc002nlx.3	Q86WQ0		ENST00000331552.7:c.244G>A	19.37:g.19313199C>T	ENSP00000332823:p.Gly82Ser		19174199	A6NGP7|B4DW92	Missense_Mutation	SNP	ENST00000331552.7	37	CCDS32967.1	SNP	22	Baylor	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	11.97	1.797728	0.31777	.	.	ENSG00000184162	ENST00000331552;ENST00000420605	D;D	0.98178	-4.77;-4.77	5.16	0.272	0.15645	Coagulation factor 5/8 C-terminal type domain (1);Galactose-binding domain-like (1);	0.325064	0.32593	N	0.005898	D	0.94479	0.8223	L	0.44542	1.39	0.80722	D	1	B	0.11235	0.004	B	0.17433	0.018	D	0.87020	0.2128	10	0.29301	T	0.29	-18.2012	4.5983	0.12341	0.0:0.4499:0.3463:0.2038	.	82	Q86WQ0	NR2CA_HUMAN	S	82	ENSP00000332823:G82S;ENSP00000402756:G82S	ENSP00000332823:G82S	G	-	1	0	NR2C2AP	19174199	0.000000	0.05858	0.003000	0.11579	0.059000	0.15707	0.427000	0.21379	0.300000	0.22699	0.462000	0.41574	GGC		0.582	NR2C2AP-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402936.4	NM_176880		Missense_Mutation
NPHS1	4868	hgsc.bcm.edu	37	19	36333305	36333305	+	Missense_Mutation	SNP	G	G	A	rs142956465		TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr19:36333305G>A	ENST00000378910.5	-	18	2481	c.2482C>T	c.(2482-2484)Cgg>Tgg	p.R828W	NPHS1_ENST00000353632.6_Missense_Mutation_p.R828W	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	828	Ig-like C2-type 7.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.R828W(1)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGGAGCAGCCGTCGTGCTGGA	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											70.0	63.0	65.0					19																	36333305		2203	4300	6503	41025145	SO:0001583	missense	4868				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2482C>T	19.37:g.36333305G>A	ENSP00000368190:p.Arg828Trp		41025145	A6NDH2|C3RX61	Missense_Mutation	SNP	ENST00000378910.5	37	CCDS32996.1	SNP	40	Baylor	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	14.70	2.613337	0.46631	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.13657	2.57;2.57	4.24	2.12	0.27331	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.389589	0.25361	N	0.031234	T	0.11452	0.0279	L	0.34521	1.04	0.22996	N	0.998451	P	0.47762	0.9	P	0.45946	0.498	T	0.09840	-1.0656	10	0.66056	D	0.02	-17.0327	5.413	0.16358	0.0:0.6779:0.2114:0.1108	.	828	O60500	NPHN_HUMAN	W	828	ENSP00000368190:R828W;ENSP00000343634:R828W	ENSP00000343634:R828W	R	-	1	2	NPHS1	41025145	0.988000	0.35896	1.000000	0.80357	0.595000	0.36748	1.647000	0.37260	1.167000	0.42706	-0.241000	0.12123	CGG		0.592	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1			Missense_Mutation
PDE4DIP	9659	hgsc.bcm.edu	37	1	144866597	144866597	+	Missense_Mutation	SNP	C	C	G			TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr1:144866597C>G	ENST00000369354.3	-	34	5834	c.5645G>C	c.(5644-5646)gGa>gCa	p.G1882A	PDE4DIP_ENST00000313382.9_Missense_Mutation_p.G1776A|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.G2018A|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.G1967A|RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.G1882A			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1882					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.G1882A(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCTACCCCTTCCACGAGCAGT	0.532			T	PDGFRB	MPD																																		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	1	Substitution - Missense(1)	ovary(1)	1											227.0	243.0	237.0					1																	144866597		2203	4296	6499	143577954	SO:0001583	missense	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.5645G>C	1.37:g.144866597C>G	ENSP00000358360:p.Gly1882Ala		143577954	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	SNP	30	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.01|11.01	1.513071|1.513071	0.27123|0.27123	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000530130|ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	.|T;T;T;T;T	.|0.01505	.|4.82;4.92;4.92;4.92;4.92	5.13|5.13	-3.1|-3.1	0.05315|0.05315	.|.	.|.	.|.	.|.	.|.	T|T	0.00637|0.00637	0.0021|0.0021	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B	.|0.12013	.|0.003;0.005	.|B;B	.|0.11329	.|0.004;0.006	T|T	0.43261|0.43261	-0.9402|-0.9402	5|9	.|0.44086	.|T	.|0.13	.|.	6.019|6.019	0.19618|0.19618	0.0:0.3276:0.3549:0.3175|0.0:0.3276:0.3549:0.3175	.|.	.|1776;1882	.|Q5VU43-3;Q5VU43	.|.;MYOME_HUMAN	Q|A	39|1776;1882;1882;1967;2018	.|ENSP00000327209:G1776A;ENSP00000358360:G1882A;ENSP00000358363:G1882A;ENSP00000435654:G1967A;ENSP00000358366:G2018A	.|ENSP00000327209:G1776A	E|G	-|-	1|2	0|0	PDE4DIP|PDE4DIP	143577954|143577954	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.069000|0.069000	0.16628|0.16628	-0.140000|-0.140000	0.10342|0.10342	-0.180000|-0.180000	0.10637|0.10637	0.650000|0.650000	0.86243|0.86243	GAA|GGA		0.532	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359		Missense_Mutation
OPTC	26254	hgsc.bcm.edu	37	1	203467841	203467841	+	Missense_Mutation	SNP	G	G	C	rs373783155		TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr1:203467841G>C	ENST00000367222.2	+	4	519	c.403G>C	c.(403-405)Ggt>Cgt	p.G135R		NM_014359.3	NP_055174.1	Q9UBM4	OPT_HUMAN	opticin	135	Cys-rich.|LRRNT.				negative regulation of angiogenesis (GO:0016525)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			breast(1)|cervix(1)|kidney(5)|large_intestine(3)|lung(8)|pancreas(1)|stomach(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.109)			CGTGTGCCTCGGTTCCTCTGT	0.577																																																0			1						G	ARG/GLY	0,4406		0,0,2203	159.0	123.0	135.0		403	2.9	0.0	1		135	1,8599	1.2+/-3.3	0,1,4299	no	missense	OPTC	NM_014359.3	125	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	possibly-damaging	135/333	203467841	1,13005	2203	4300	6503	201734464	SO:0001583	missense	26254			AF161702	CCDS1439.1	1q31	2008-02-05			ENSG00000188770	ENSG00000188770			8158	protein-coding gene	gene with protein product	"""oculoglycan"""	605127				10636917	Standard	NM_014359		Approved		uc001gzu.1	Q9UBM4	OTTHUMG00000036100	ENST00000367222.2:c.403G>C	1.37:g.203467841G>C	ENSP00000356191:p.Gly135Arg		201734464	Q5T2G4	Missense_Mutation	SNP	ENST00000367222.2	37	CCDS1439.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.04	2.416425	0.42918	0.0	1.16E-4	ENSG00000188770	ENST00000367222	T	0.02446	4.29	4.85	2.94	0.34122	Leucine-rich repeat-containing N-terminal (1);	0.235968	0.36303	N	0.002678	T	0.04227	0.0117	L	0.58669	1.825	0.09310	N	1	P	0.45957	0.869	P	0.45071	0.468	T	0.36625	-0.9740	10	0.24483	T	0.36	-13.4203	6.3659	0.21455	0.1708:0.1547:0.6745:0.0	.	135	Q9UBM4	OPT_HUMAN	R	135	ENSP00000356191:G135R	ENSP00000356191:G135R	G	+	1	0	OPTC	201734464	0.910000	0.30920	0.001000	0.08648	0.850000	0.48378	1.304000	0.33482	0.614000	0.30107	0.561000	0.74099	GGT		0.577	OPTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087964.1	NM_014359		Missense_Mutation
PLXDC2	84898	hgsc.bcm.edu	37	10	20432305	20432305	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr10:20432305C>T	ENST00000377252.4	+	5	1464	c.623C>T	c.(622-624)cCc>cTc	p.P208L	PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_Missense_Mutation_p.P159L	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	208					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.P208L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						AATTTCGATCCCAGTGTATCC	0.358																																																1	Substitution - Missense(1)	ovary(1)	10											153.0	147.0	149.0					10																	20432305		2203	4300	6503	20472311	SO:0001583	missense	84898			AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.623C>T	10.37:g.20432305C>T	ENSP00000366460:p.Pro208Leu		20472311	Q96E59|Q96PD9|Q96SU9	Missense_Mutation	SNP	ENST00000377252.4	37	CCDS7132.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	25.9	4.687288	0.88639	.	.	ENSG00000120594	ENST00000377252;ENST00000377242;ENST00000377238;ENST00000536022	D;D	0.82081	-1.57;-1.57	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.85150	0.5631	L	0.48362	1.52	0.80722	D	1	D;P	0.52996	0.957;0.818	P;P	0.51229	0.663;0.485	D	0.84070	0.0379	10	0.42905	T	0.14	.	20.1086	0.97902	0.0:1.0:0.0:0.0	.	159;208	Q6UX71-2;Q6UX71	.;PXDC2_HUMAN	L	208;159;71;194	ENSP00000366460:P208L;ENSP00000366450:P159L	ENSP00000366446:P71L	P	+	2	0	PLXDC2	20472311	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.760000	0.85248	2.756000	0.94617	0.563000	0.77884	CCC		0.358	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812		Missense_Mutation
RALGPS1	9649	hgsc.bcm.edu	37	9	129957370	129957370	+	Splice_Site	SNP	G	G	T			TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr9:129957370G>T	ENST00000259351.5	+	12	1178	c.911G>T	c.(910-912)gGt>gTt	p.G304V	RALGPS1_ENST00000373434.1_Splice_Site_p.G304V|RALGPS1_ENST00000424082.2_Splice_Site_p.G304V	NM_014636.2	NP_055451.1	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1	304					intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ral GTPase activity (GO:0032852)|regulation of Ral protein signal transduction (GO:0032485)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.G304V(1)		kidney(2)|large_intestine(6)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						CTGTTTGCAGGTCCCTCTGCT	0.632																																																1	Substitution - Missense(1)	ovary(1)	9											128.0	122.0	124.0					9																	129957370		2203	4300	6503	128997191	SO:0001630	splice_region_variant	9649			AB002349	CCDS35143.1, CCDS55344.1, CCDS55345.1, CCDS55346.1	9q33.3	2013-01-10			ENSG00000136828	ENSG00000136828		"""Pleckstrin homology (PH) domain containing"""	16851	protein-coding gene	gene with protein product		614444				9205841, 10747847	Standard	NM_001190728		Approved	RALGPS1A, RALGEF2, KIAA0351	uc004bqo.2	Q5JS13	OTTHUMG00000020696	ENST00000259351.5:c.911-1G>T	9.37:g.129957370G>T			128997191	B4DR86|E9PBQ5|O15059|Q5JT60|Q5JT65|Q5JUG5|Q8N4S6|Q8N5H4|Q8WUV7|Q9NZ16	Missense_Mutation	SNP	ENST00000259351.5	37	CCDS35143.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.59	2.581293	0.46006	.	.	ENSG00000136828	ENST00000259351;ENST00000424082;ENST00000373434	T;T;T	0.32988	1.43;1.43;1.43	4.82	2.97	0.34412	Ras guanine nucleotide exchange factor, domain (1);	0.107097	0.64402	D	0.000006	T	0.46112	0.1376	L	0.56769	1.78	0.80722	D	1	P;D;D	0.89917	0.945;0.998;1.0	P;D;D	0.71414	0.459;0.962;0.973	T	0.24764	-1.0151	9	.	.	.	.	9.6484	0.39881	0.08:0.142:0.778:0.0	.	304;304;304	E9PBQ5;Q5JS13-2;Q5JS13	.;.;RGPS1_HUMAN	V	304	ENSP00000259351:G304V;ENSP00000415630:G304V;ENSP00000362533:G304V	.	G	+	2	0	RALGPS1	128997191	1.000000	0.71417	0.993000	0.49108	0.400000	0.30750	4.830000	0.62745	0.563000	0.29222	0.555000	0.69702	GGT		0.632	RALGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054133.1	NM_014636	Missense_Mutation	Missense_Mutation
SEC14L3	266629	hgsc.bcm.edu	37	22	30866228	30866228	+	Silent	SNP	A	A	G			TCGA-36-1575-01	TCGA-36-1575-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr22:30866228A>G	ENST00000215812.4	-	3	235	c.145T>C	c.(145-147)Ttg>Ctg	p.L49L	SEC14L3_ENST00000401751.1_5'UTR|SEC14L3_ENST00000403066.1_5'UTR|SEC14L3_ENST00000540910.1_5'UTR|SEC14L3_ENST00000402286.1_5'UTR|SEC14L3_ENST00000415957.2_5'UTR|SEC14L3_ENST00000539629.1_5'UTR	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	49						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	GACTTCTGCAAGTCAAAATTC	0.532																																					Esophageal Squamous(108;290 1516 3584 23771 37333)											0			22											58.0	63.0	61.0					22																	30866228		2203	4300	6503	29196228	SO:0001819	synonymous_variant	266629			AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.145T>C	22.37:g.30866228A>G			29196228	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Silent	SNP	ENST00000215812.4	37	CCDS13877.1	SNP	3	Baylor																																																																																				0.532	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975		Silent
SMOC2	64094	hgsc.bcm.edu	37	6	169051444	169051444	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr6:169051444C>A	ENST00000356284.2	+	10	1211	c.991C>A	c.(991-993)Ccc>Acc	p.P331T	SMOC2_ENST00000354536.5_Missense_Mutation_p.P342T	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	331					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.P342T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CGCCTCCGACCCCTCCTCCTC	0.552																																																1	Substitution - Missense(1)	ovary(1)	6											50.0	40.0	44.0					6																	169051444		2203	4300	6503	168793369	SO:0001583	missense	64094			AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.991C>A	6.37:g.169051444C>A	ENSP00000348630:p.Pro331Thr		168793369	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Missense_Mutation	SNP	ENST00000356284.2	37	CCDS55076.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.25	1.881561	0.33255	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793;ENST00000392101;ENST00000538593	T;T	0.35605	1.31;1.3	4.11	4.11	0.48088	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.000000	0.64402	D	0.000002	T	0.32645	0.0836	L	0.34521	1.04	0.44579	D	0.997543	B;D	0.76494	0.408;0.999	P;D	0.73380	0.561;0.98	T	0.04140	-1.0974	10	0.25751	T	0.34	-9.7604	11.7229	0.51693	0.0:0.8214:0.1786:0.0	.	331;342	Q9H3U7;Q9H3U7-2	SMOC2_HUMAN;.	T	331;342;331;8;8	ENSP00000348630:P331T;ENSP00000346537:P342T	ENSP00000346537:P342T	P	+	1	0	SMOC2	168793369	1.000000	0.71417	0.563000	0.28383	0.243000	0.25628	4.196000	0.58407	1.995000	0.58328	0.455000	0.32223	CCC		0.552	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1			Missense_Mutation
SMTN	6525	hgsc.bcm.edu	37	22	31487798	31487799	+	Frame_Shift_Ins	INS	-	-	C			TCGA-36-1575-01	TCGA-36-1575-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr22:31487798_31487799insC	ENST00000347557.2	+	11	1815_1816	c.1597_1598insC	c.(1597-1599)gccfs	p.A533fs	SMTN_ENST00000333137.7_Frame_Shift_Ins_p.A533fs|SMTN_ENST00000358743.1_Frame_Shift_Ins_p.A533fs|SMTN_ENST00000404574.1_5'Flank	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	533					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)	p.S536fs*2(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						CTTCAGCCATGCCCCCCCCAGT	0.629																																																1	Insertion - Frameshift(1)	ovary(1)	22							,,,,	39,4217		2,35,2091					,,,,	3.4	1.0			43	90,8154		1,88,4033	no	frameshift,frameshift,frameshift,frameshift,frameshift	SMTN	NM_134270.2,NM_134269.2,NM_006932.4,NM_001207018.1,NM_001207017.1	,,,,	3,123,6124	A1A1,A1R,RR		1.0917,0.9164,1.032	,,,,	,,,,		129,12371				29817799	SO:0001589	frameshift_variant	6525			AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.1605dupC	22.37:g.31487806_31487806dupC	ENSP00000328635:p.Ala533fs		29817798	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Frame_Shift_Ins	INS	ENST00000347557.2	37	CCDS13886.1	INS	46	Baylor																																																																																				0.629	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270		Frame_Shift_Ins
STK10	6793	hgsc.bcm.edu	37	5	171491796	171491796	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr5:171491796C>A	ENST00000176763.5	-	13	2353	c.2010G>T	c.(2008-2010)aaG>aaT	p.K670N		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	670					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.K670N(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GTCGGGGGAGCTTCTCCACCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	5											158.0	136.0	143.0					5																	171491796		2203	4300	6503	171424401	SO:0001583	missense	6793			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.2010G>T	5.37:g.171491796C>A	ENSP00000176763:p.Lys670Asn		171424401	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	ENST00000176763.5	37	CCDS34290.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618410	0.66787	.	.	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.36699	1.24	5.06	2.97	0.34412	.	0.112312	0.64402	D	0.000018	T	0.45256	0.1333	M	0.70275	2.135	0.49915	D	0.999835	P	0.42620	0.785	P	0.53360	0.724	T	0.37842	-0.9688	10	0.46703	T	0.11	.	4.5307	0.12004	0.0:0.5914:0.0:0.4086	.	670	O94804	STK10_HUMAN	N	670	ENSP00000176763:K670N	ENSP00000176763:K670N	K	-	3	2	STK10	171424401	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.033000	0.30191	1.114000	0.41781	0.650000	0.86243	AAG		0.562	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990		Missense_Mutation
TAS2R42	353164	hgsc.bcm.edu	37	12	11338877	11338877	+	Missense_Mutation	SNP	C	C	G			TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr12:11338877C>G	ENST00000334266.1	-	1	666	c.667G>C	c.(667-669)Gac>Cac	p.D223H		NM_181429.1	NP_852094.1	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	223					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D223H(1)		breast(1)|kidney(2)|lung(4)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			GTGCTGGAGTCTCTAGAGCCC	0.423																																					Melanoma(15;352 722 10077 19546 48810)											1	Substitution - Missense(1)	ovary(1)	12											68.0	72.0	71.0					12																	11338877		2203	4298	6501	11230144	SO:0001583	missense	353164			AX097739, AB199241	CCDS31747.1	12p13	2012-08-22			ENSG00000186136	ENSG00000186136		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18888	protein-coding gene	gene with protein product		613966				12679530	Standard	NM_181429		Approved	T2R24, T2R55, hT2R55, TAS2R55	uc001qzr.1	Q7RTR8	OTTHUMG00000168567	ENST00000334266.1:c.667G>C	12.37:g.11338877C>G	ENSP00000334050:p.Asp223His		11230144	A2RRP4|Q645X0	Missense_Mutation	SNP	ENST00000334266.1	37	CCDS31747.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	7.323	0.617399	0.14129	.	.	ENSG00000186136	ENST00000334266	T	0.01126	5.3	3.47	2.55	0.30701	GPCR, rhodopsin-like superfamily (1);	0.471226	0.19520	N	0.112294	T	0.08935	0.0221	H	0.94734	3.575	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.04216	-1.0968	10	0.87932	D	0	.	8.7384	0.34543	0.0:0.7661:0.2339:0.0	.	223	Q7RTR8	T2R42_HUMAN	H	223	ENSP00000334050:D223H	ENSP00000334050:D223H	D	-	1	0	TAS2R42	11230144	0.157000	0.22836	0.016000	0.15963	0.045000	0.14185	2.064000	0.41432	0.809000	0.34255	-0.302000	0.09304	GAC		0.423	TAS2R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400243.1	NM_181429		Missense_Mutation
TIPRL	261726	hgsc.bcm.edu	37	1	168165880	168165880	+	Splice_Site	SNP	G	G	A			TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr1:168165880G>A	ENST00000367833.2	+	5	757	c.612G>A	c.(610-612)gaG>gaA	p.E204E		NM_152902.3	NP_690866.1	O75663	TIPRL_HUMAN	TOR signaling pathway regulator	204	Interaction with PPP2CA.				DNA damage checkpoint (GO:0000077)|negative regulation of protein phosphatase type 2A activity (GO:0034048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.E204E(1)		breast(1)|kidney(1)|large_intestine(1)|ovary(2)|skin(1)	6	all_hematologic(923;0.215)					TTTACCATGAGGTATTTATTG	0.328																																																1	Substitution - coding silent(1)	ovary(1)	1											104.0	106.0	106.0					1																	168165880		2203	4300	6503	166432504	SO:0001630	splice_region_variant	261726			AB097034	CCDS1270.1, CCDS30935.1	1q23.2	2014-03-07	2014-03-07		ENSG00000143155	ENSG00000143155			30231	protein-coding gene	gene with protein product		611807	"""TIP41, TOR signaling pathway regulator-like (S. cerevisiae)"""			12761501	Standard	NM_001031800		Approved	MGC3794, dJ69E11.3, TIP41	uc001gfg.3	O75663	OTTHUMG00000034646	ENST00000367833.2:c.612+1G>A	1.37:g.168165880G>A			166432504	B2R8V3|Q5HYB2|Q8IZ86	Silent	SNP	ENST00000367833.2	37	CCDS1270.1	SNP	35	Baylor																																																																																				0.328	TIPRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083822.1	NM_152902	Silent	Silent
TP53	7157	hgsc.bcm.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	17	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	7517845	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His		7517845	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	19	Baylor	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TSPAN15	23555	hgsc.bcm.edu	37	10	71266732	71266732	+	Nonstop_Mutation	SNP	T	T	A			TCGA-36-1575-01	TCGA-36-1575-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr10:71266732T>A	ENST00000373290.2	+	8	1005	c.883T>A	c.(883-885)Tag>Aag	p.*295K	TSPAN15_ENST00000459981.1_3'UTR	NM_012339.3	NP_036471.1	O95858	TSN15_HUMAN	tetraspanin 15	0					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	9						CTACCCCAATTAGGGCCCAGC	0.647																																																0			10											20.0	19.0	19.0					10																	71266732		2202	4299	6501	70936738	SO:0001578	stop_lost	23555			AY358934	CCDS7294.1	10q22.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000099282	ENSG00000099282		"""Tetraspanins"""	23298	protein-coding gene	gene with protein product		613140	"""transmembrane 4 superfamily member 15"""	TM4SF15		11739647, 10719184	Standard	NM_012339		Approved	NET-7	uc001jpo.1	O95858	OTTHUMG00000018381	ENST00000373290.2:c.883T>A	10.37:g.71266732T>A	ENSP00000362387:p.*295Lysext*15		70936738	Q6UW79	Missense_Mutation	SNP	ENST00000373290.2	37	CCDS7294.1	SNP	61	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.99	2.400645	0.42613	.	.	ENSG00000099282	ENST00000373290	.	.	.	5.27	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6366	0.45569	0.0:0.0:0.1593:0.8407	.	.	.	.	K	295	.	.	X	+	1	0	TSPAN15	70936738	0.995000	0.38212	0.701000	0.30321	0.023000	0.10783	3.738000	0.55067	2.112000	0.64535	0.533000	0.62120	TAG		0.647	TSPAN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048444.1	NM_012339		Missense_Mutation
UNC5CL	222643	hgsc.bcm.edu	37	6	40998183	40998183	+	Silent	SNP	G	G	C	rs150256944		TCGA-36-1575-01	TCGA-36-1575-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr6:40998183G>C	ENST00000373164.1	-	7	1338	c.1278C>G	c.(1276-1278)acC>acG	p.T426T	UNC5CL_ENST00000470102.1_5'UTR|UNC5CL_ENST00000244565.3_Silent_p.T426T			Q8IV45	UN5CL_HUMAN	unc-5 homolog C (C. elegans)-like	426	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|proteolysis (GO:0006508)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	peptidase activity (GO:0008233)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGTCATTGCCGGTGATGCTGT	0.577																																																0			6											83.0	78.0	80.0					6																	40998183		2203	4300	6503	41106161	SO:0001819	synonymous_variant	222643			BC035284	CCDS4847.1	6p21.1	2013-10-15			ENSG00000124602	ENSG00000124602			21203	protein-coding gene	gene with protein product	"""ZU5 and death domain containing"""					14769797	Standard	NM_173561		Approved	MGC34763, ZUD	uc003opi.3	Q8IV45	OTTHUMG00000014665	ENST00000373164.1:c.1278C>G	6.37:g.40998183G>C			41106161	Q5TGU1	Silent	SNP	ENST00000373164.1	37	CCDS4847.1	SNP	39	Baylor																																																																																				0.577	UNC5CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040491.1	NM_173561		Silent
WNT11	7481	hgsc.bcm.edu	37	11	75898143	75898143	+	Missense_Mutation	SNP	C	C	T			TCGA-36-1575-01	TCGA-36-1575-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr11:75898143C>T	ENST00000322563.3	-	5	1155	c.1031G>A	c.(1030-1032)tGt>tAt	p.C344Y		NM_004626.2	NP_004617.2	O96014	WNT11_HUMAN	wingless-type MMTV integration site family, member 11	344					adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|bone mineralization (GO:0030282)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cloacal septation (GO:0060197)|embryonic skeletal system development (GO:0048706)|lung-associated mesenchyme development (GO:0060484)|mesonephric duct development (GO:0072177)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroendocrine cell differentiation (GO:0061101)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway (GO:0035567)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta2 production (GO:0032915)|protein localization to cell surface (GO:0034394)|protein phosphorylation (GO:0006468)|response to nutrient levels (GO:0031667)|tight junction assembly (GO:0070830)|ureteric bud morphogenesis (GO:0060675)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|protein kinase activator activity (GO:0030295)|Ras GTPase activator activity (GO:0005099)|transcription regulatory region DNA binding (GO:0044212)	p.C344Y(2)		breast(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20						GGTACGCTCACACCTGCGGCA	0.642																																																2	Substitution - Missense(2)	ovary(2)	11											123.0	90.0	101.0					11																	75898143		2200	4292	6492	75575791	SO:0001583	missense	7481			Y12692	CCDS8242.1	11q13.5	2008-02-05			ENSG00000085741	ENSG00000085741		"""Wingless-type MMTV integration sites"""	12776	protein-coding gene	gene with protein product		603699				9757009	Standard	NM_004626		Approved		uc001oxe.3	O96014	OTTHUMG00000165264	ENST00000322563.3:c.1031G>A	11.37:g.75898143C>T	ENSP00000325526:p.Cys344Tyr		75575791	B2R8Z6|Q14DE8|Q8WZ98	Missense_Mutation	SNP	ENST00000322563.3	37	CCDS8242.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.1	4.371850	0.82573	.	.	ENSG00000085741	ENST00000322563	D	0.84146	-1.81	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	D	0.94735	0.8301	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96231	0.9168	10	0.87932	D	0	.	17.3486	0.87316	0.0:1.0:0.0:0.0	.	344	O96014	WNT11_HUMAN	Y	344	ENSP00000325526:C344Y	ENSP00000325526:C344Y	C	-	2	0	WNT11	75575791	1.000000	0.71417	0.898000	0.35279	0.925000	0.55904	7.705000	0.84606	2.515000	0.84797	0.305000	0.20034	TGT		0.642	WNT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383083.1	NM_004626		Missense_Mutation
ZNF33A	7581	hgsc.bcm.edu	37	10	38344533	38344533	+	Missense_Mutation	SNP	A	A	G			TCGA-36-1575-01	TCGA-36-1575-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1575-01	TCGA-36-1575-10	g.chr10:38344533A>G	ENST00000458705.2	+	5	1636	c.1478A>G	c.(1477-1479)gAt>gGt	p.D493G	ZNF33A_ENST00000432900.2_Missense_Mutation_p.D500G|ZNF33A_ENST00000307441.9_Missense_Mutation_p.D493G|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000374618.3_Missense_Mutation_p.D494G			Q06730	ZN33A_HUMAN	zinc finger protein 33A	493					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D493G(1)		cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						CACATAGGAGATAAATCTTAT	0.373																																																1	Substitution - Missense(1)	ovary(1)	10											64.0	64.0	64.0					10																	38344533		2203	4299	6502	38384539	SO:0001583	missense	7581			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.1478A>G	10.37:g.38344533A>G	ENSP00000387713:p.Asp493Gly		38384539	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	ENST00000458705.2	37	CCDS31182.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.18	2.755960	0.49362	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	2.05	2.05	0.26809	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.554730	0.13595	N	0.376320	T	0.13927	0.0337	N	0.20445	0.575	0.31763	N	0.633067	P;P;P	0.44946	0.775;0.846;0.818	B;P;B	0.46389	0.306;0.515;0.311	T	0.14090	-1.0485	10	0.87932	D	0	.	7.6648	0.28423	1.0:0.0:0.0:0.0	.	500;493;494	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	G	494;500;493;493	ENSP00000363747:D494G;ENSP00000402467:D500G;ENSP00000387713:D493G;ENSP00000304268:D493G	ENSP00000304268:D493G	D	+	2	0	ZNF33A	38384539	1.000000	0.71417	0.931000	0.37212	0.946000	0.59487	5.937000	0.70162	0.923000	0.37045	0.377000	0.23210	GAT		0.373	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974		Missense_Mutation
