#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
BRICD5	283870	hgsc.bcm.edu	37	16	2259693	2259693	+	Missense_Mutation	SNP	C	C	A			TCGA-36-1576-01	TCGA-36-1576-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr16:2259693C>A	ENST00000562360.1	-	5	452	c.453G>T	c.(451-453)tgG>tgT	p.W151C	BRICD5_ENST00000328540.3_Missense_Mutation_p.W151C|RP11-304L19.8_ENST00000561544.1_lincRNA			Q6PL45	BRID5_HUMAN	BRICHOS domain containing 5	151	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.					integral component of membrane (GO:0016021)		p.W151C(1)									GGCTGGGGACCCAAGCCTCTT	0.692																																																1	Substitution - Missense(1)	ovary(1)	16											51.0	65.0	60.0					16																	2259693		2198	4300	6498	2199694	SO:0001583	missense	283870			BC039154	CCDS10463.1	16p13.3	2012-10-10	2012-10-10	2012-10-10	ENSG00000182685	ENSG00000182685		"""BRICHOS domain containing"""	28309	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 79"""	C16orf79		12477932	Standard	NM_182563		Approved	MGC21830	uc002cpi.2	Q6PL45	OTTHUMG00000128831	ENST00000562360.1:c.453G>T	16.37:g.2259693C>A	ENSP00000455052:p.Trp151Cys		2199694	C9J7K2|Q8IXU9	Missense_Mutation	SNP	ENST00000562360.1	37	CCDS10463.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.831	1.188439	0.21954	.	.	ENSG00000182685	ENST00000328540	T	0.78595	-1.19	5.82	-11.6	0.00059	BRICHOS (2);	2.571080	0.00744	N	0.001031	T	0.55081	0.1898	.	.	.	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39210	-0.9625	9	0.38643	T	0.18	-0.9675	2.1204	0.03724	0.4285:0.282:0.1199:0.1696	.	151;151	Q6PL45;Q6PL45-2	CP079_HUMAN;.	C	151	ENSP00000332389:W151C	ENSP00000332389:W151C	W	-	3	0	C16orf79	2199694	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.324000	0.01116	-1.727000	0.01368	-1.083000	0.02208	TGG		0.692	BRICD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435091.1	NM_182563		Missense_Mutation
CATSPER1	117144	hgsc.bcm.edu	37	11	65793355	65793355	+	Missense_Mutation	SNP	C	C	T	rs543744984		TCGA-36-1576-01	TCGA-36-1576-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr11:65793355C>T	ENST00000312106.5	-	1	633	c.496G>A	c.(496-498)Gtg>Atg	p.V166M		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	166	His-rich.				calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.V166M(2)		breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						TGGTGGGGCACGCCAGAGGAA	0.582																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	11											57.0	53.0	54.0					11																	65793355		2201	4296	6497	65549931	SO:0001583	missense	117144			AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.496G>A	11.37:g.65793355C>T	ENSP00000309052:p.Val166Met		65549931	Q96P76	Missense_Mutation	SNP	ENST00000312106.5	37	CCDS8127.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.959	0.178073	0.09443	.	.	ENSG00000175294	ENST00000312106	D	0.96940	-4.18	3.43	1.5	0.22942	.	.	.	.	.	D	0.84556	0.5498	N	0.03115	-0.41	0.09310	N	1	D	0.56287	0.975	B	0.32090	0.14	T	0.79339	-0.1844	9	0.22706	T	0.39	2.3962	8.0048	0.30319	0.0:0.7774:0.0:0.2226	.	166	Q8NEC5	CTSR1_HUMAN	M	166	ENSP00000309052:V166M	ENSP00000309052:V166M	V	-	1	0	CATSPER1	65549931	0.996000	0.38824	0.000000	0.03702	0.049000	0.14656	0.009000	0.13219	0.228000	0.21019	-0.657000	0.03884	GTG		0.582	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054		Missense_Mutation
ENTPD1	953	hgsc.bcm.edu	37	10	97599541	97599541	+	Nonsense_Mutation	SNP	C	C	T			TCGA-36-1576-01	TCGA-36-1576-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr10:97599541C>T	ENST00000371205.4	+	3	521	c.238C>T	c.(238-240)Caa>Taa	p.Q80*	ENTPD1_ENST00000543964.1_5'UTR|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1_ENST00000371207.3_Nonsense_Mutation_p.Q92*|RP11-429G19.3_ENST00000433113.1_RNA|ENTPD1_ENST00000371203.5_5'UTR|ENTPD1_ENST00000453258.2_Nonsense_Mutation_p.Q87*|ENTPD1_ENST00000490659.1_3'UTR|ENTPD1_ENST00000539125.1_Intron			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	80					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)	p.Q80E(1)|p.Q80*(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		CGTGGTGCATCAAGTAGAAGA	0.473																																																2	Substitution - Missense(1)|Substitution - Nonsense(1)	ovary(1)|lung(1)	10											160.0	150.0	153.0					10																	97599541		2203	4300	6503	97589531	SO:0001587	stop_gained	953			S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.238C>T	10.37:g.97599541C>T	ENSP00000360248:p.Gln80*		97589531	A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Nonsense_Mutation	SNP	ENST00000371205.4	37	CCDS7444.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.2	4.813843	0.90790	.	.	ENSG00000138185	ENST00000453258;ENST00000371206;ENST00000371207;ENST00000371205	.	.	.	5.51	4.61	0.57282	.	0.105503	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-11.3167	13.6343	0.62213	0.0:0.8236:0.1764:0.0	.	.	.	.	X	87;87;92;80	.	ENSP00000360248:Q80X	Q	+	1	0	ENTPD1	97589531	0.998000	0.40836	0.127000	0.21898	0.766000	0.43426	3.808000	0.55598	1.555000	0.49500	0.557000	0.71058	CAA		0.473	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049566.1	NM_001776		Nonsense_Mutation
ILF3	3609	hgsc.bcm.edu	37	19	10792682	10792683	+	Frame_Shift_Ins	INS	-	-	C			TCGA-36-1576-01	TCGA-36-1576-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr19:10792682_10792683insC	ENST00000590261.1	+	11	1194_1195	c.1194_1195insC	c.(1195-1197)cccfs	p.P399fs	ILF3_ENST00000592763.1_Frame_Shift_Ins_p.P399fs|ILF3_ENST00000449870.1_Frame_Shift_Ins_p.P399fs|ILF3_ENST00000318511.3_Frame_Shift_Ins_p.P399fs|ILF3_ENST00000250241.8_Frame_Shift_Ins_p.P399fs|ILF3_ENST00000589998.1_Frame_Shift_Ins_p.P399fs|ILF3_ENST00000420083.1_Frame_Shift_Ins_p.P399fs|ILF3_ENST00000588657.1_Frame_Shift_Ins_p.P399fs|ILF3_ENST00000407004.3_Frame_Shift_Ins_p.P399fs			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa	399	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.Q401fs*39(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			AGAAGGCAGAGCCCCCCCAGGC	0.604																																																1	Insertion - Frameshift(1)	ovary(1)	19																																								10653683	SO:0001589	frameshift_variant	3609			U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.1201dupC	19.37:g.10792689_10792689dupC	ENSP00000468156:p.Pro399fs		10653682	A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Frame_Shift_Ins	INS	ENST00000590261.1	37	CCDS12246.1	INS	34	Baylor																																																																																				0.604	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452074.1			Frame_Shift_Ins
L1TD1	54596	hgsc.bcm.edu	37	1	62676612	62676612	+	Silent	SNP	A	A	G	rs66958136	byFrequency	TCGA-36-1576-01	TCGA-36-1576-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr1:62676612A>G	ENST00000498273.1	+	4	2461	c.2166A>G	c.(2164-2166)aaA>aaG	p.K722K	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	722								p.K722K(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						acataattaaagaaataattg	0.358													G|||	792	0.158147	0.0825	0.3199	5008	,	,		20205	0.0704		0.2922	False		,,,				2504	0.0982															2	Substitution - coding silent(2)	ovary(1)|stomach(1)	1						G	,	314,2912		19,276,1318	36.0	38.0	37.0		2166,2166	-4.0	0.0	1	dbSNP_130	37	1482,4316		190,1102,1607	no	coding-synonymous,coding-synonymous	L1TD1	NM_001164835.1,NM_019079.4	,	209,1378,2925	GG,GA,AA		25.5605,9.7334,19.9025	,	722/866,722/866	62676612	1796,7228	1613	2899	4512	62449200	SO:0001819	synonymous_variant	54596			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.2166A>G	1.37:g.62676612A>G			62449200	Q8NDA1|Q9NUV8|Q9NV78	Silent	SNP	ENST00000498273.1	37	CCDS619.1	SNP	3	Baylor																																																																																				0.358	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024688.1	NM_019079		Silent
MED19	219541	hgsc.bcm.edu	37	11	57472563	57472563	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1576-01	TCGA-36-1576-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr11:57472563G>A	ENST00000431606.2	-	2	385	c.356C>T	c.(355-357)cCt>cTt	p.P119L	MED19_ENST00000337672.2_Missense_Mutation_p.P119L			A0JLT2	MED19_HUMAN	mediator complex subunit 19	119						mediator complex (GO:0016592)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.P119L(1)		cervix(1)|large_intestine(1)|lung(1)|ovary(2)	5						ATGGGAACCAGGCAGATCAAT	0.493																																																1	Substitution - Missense(1)	ovary(1)	11											107.0	104.0	105.0					11																	57472563		2201	4296	6497	57229139	SO:0001583	missense	219541			AY148462	CCDS7966.1	11q12.1	2008-02-05	2007-07-30		ENSG00000156603	ENSG00000156603			29600	protein-coding gene	gene with protein product		612385	"""mediator of RNA polymerase II transcription, subunit 19 homolog (S. cerevisiae)"""			9417904	Standard	NM_153450		Approved	LCMR1	uc001nlb.3	A0JLT2	OTTHUMG00000167199	ENST00000431606.2:c.356C>T	11.37:g.57472563G>A	ENSP00000416227:p.Pro119Leu		57229139	Q8IV02|Q8IZD1	Missense_Mutation	SNP	ENST00000431606.2	37		SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	27.4	4.832068	0.91036	.	.	ENSG00000156603	ENST00000337672;ENST00000431606	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.83797	0.5332	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	0.975;1.0	P;D	0.91635	0.487;0.999	D	0.85618	0.1262	9	0.66056	D	0.02	-11.3221	18.8972	0.92429	0.0:0.0:1.0:0.0	.	119;119	A0JLT2-2;A0JLT2	.;MED19_HUMAN	L	119	.	ENSP00000337340:P119L	P	-	2	0	MED19	57229139	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.094000	0.94168	2.639000	0.89480	0.561000	0.74099	CCT		0.493	MED19-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000393702.1	NM_153450		Missense_Mutation
PIGK	10026	hgsc.bcm.edu	37	1	77627339	77627339	+	Silent	SNP	T	T	G			TCGA-36-1576-01	TCGA-36-1576-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr1:77627339T>G	ENST00000370812.3	-	7	665	c.642A>C	c.(640-642)cgA>cgC	p.R214R	PIGK_ENST00000478391.1_5'UTR|PIGK_ENST00000359130.1_Silent_p.R214R|PIGK_ENST00000370813.5_Silent_p.R138R|PIGK_ENST00000445065.1_Silent_p.R120R	NM_005482.2	NP_005473.1	Q92643	GPI8_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class K	214					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	cysteine-type endopeptidase activity (GO:0004197)|GPI-anchor transamidase activity (GO:0003923)|protein disulfide isomerase activity (GO:0003756)	p.R214R(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	19						GAGAATAAAATCGTTCATACA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	1											109.0	101.0	104.0					1																	77627339		2203	4300	6503	77399927	SO:0001819	synonymous_variant	10026			AF022913	CCDS674.1	1p31.1	2013-02-26	2006-06-28		ENSG00000142892	ENSG00000142892		"""Phosphatidylinositol glycan anchor biosynthesis"""	8965	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	605087	"""phosphatidylinositol glycan, class K"""			9356492	Standard	NM_005482		Approved	hGPI8, GPI8	uc001dhk.3	Q92643	OTTHUMG00000009686	ENST00000370812.3:c.642A>C	1.37:g.77627339T>G			77399927	B2R7K3|B4E2M3|O14822|Q5TG77	Silent	SNP	ENST00000370812.3	37	CCDS674.1	SNP	50	Baylor																																																																																				0.373	PIGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026687.1	NM_005482		Silent
RFC1	5981	hgsc.bcm.edu	37	4	39301643	39301643	+	Nonsense_Mutation	SNP	G	G	A			TCGA-36-1576-01	TCGA-36-1576-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr4:39301643G>A	ENST00000381897.1	-	21	2942	c.2809C>T	c.(2809-2811)Cag>Tag	p.Q937*	RFC1_ENST00000349703.2_Nonsense_Mutation_p.Q936*|RNU6-32P_ENST00000383948.1_RNA	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	937					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)	p.Q936*(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						CTGCTCACCTGCGCAGGCAGA	0.453																																					Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)											1	Substitution - Nonsense(1)	ovary(1)	4											71.0	67.0	69.0					4																	39301643		2203	4300	6503	38978038	SO:0001587	stop_gained	5981			L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.2809C>T	4.37:g.39301643G>A	ENSP00000371321:p.Gln937*		38978038	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Nonsense_Mutation	SNP	ENST00000381897.1	37	CCDS56329.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	39	7.569013	0.98365	.	.	ENSG00000035928	ENST00000381897;ENST00000349703	.	.	.	6.01	6.01	0.97437	.	0.056486	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-18.8493	20.5109	0.99210	0.0:0.0:1.0:0.0	.	.	.	.	X	937;936	.	ENSP00000261424:Q936X	Q	-	1	0	RFC1	38978038	1.000000	0.71417	0.998000	0.56505	0.328000	0.28507	7.847000	0.86896	2.851000	0.98039	0.609000	0.83330	CAG		0.453	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913		Nonsense_Mutation
RRN3	54700	hgsc.bcm.edu	37	16	15159135	15159135	+	Frame_Shift_Del	DEL	C	C	-			TCGA-36-1576-01	TCGA-36-1576-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr16:15159135delC	ENST00000198767.6	-	16	1730	c.1647delG	c.(1645-1647)gtgfs	p.V549fs	RRN3_ENST00000540462.1_Frame_Shift_Del_p.V367fs|RRN3_ENST00000327307.7_Frame_Shift_Del_p.V516fs|RRN3_ENST00000563559.1_Frame_Shift_Del_p.V549fs|PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000429751.2_Frame_Shift_Del_p.V519fs	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	549	Interaction with TWISTNB.				cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.Q550fs*18(1)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						TGCAGATCTGCACTGAGTCTC	0.502																																																1	Deletion - Frameshift(1)	ovary(1)	16											133.0	118.0	123.0					16																	15159135		2197	4300	6497	15066636	SO:0001589	frameshift_variant	54700			AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.1647delG	16.37:g.15159135delC	ENSP00000198767:p.Val549fs		15066636	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Frame_Shift_Del	DEL	ENST00000198767.6	37	CCDS10559.1	DEL	25	Baylor																																																																																				0.502	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427		Frame_Shift_Del
SACS	26278	hgsc.bcm.edu	37	13	23904819	23904819	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1576-01	TCGA-36-1576-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr13:23904819G>C	ENST00000382292.3	-	9	13469	c.13196C>G	c.(13195-13197)aCt>aGt	p.T4399S	SACS_ENST00000402364.1_Missense_Mutation_p.T3649S|SACS_ENST00000382298.3_Missense_Mutation_p.T4399S			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	4399					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.T4252S(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ATTCCATGAAGTATAGAATCT	0.428																																																1	Substitution - Missense(1)	ovary(1)	13											80.0	83.0	82.0					13																	23904819		2203	4300	6503	22802819	SO:0001583	missense	26278			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.13196C>G	13.37:g.23904819G>C	ENSP00000371729:p.Thr4399Ser		22802819	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.03	1.238264	0.22711	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87029	-2.05;-2.2;-2.05	5.8	5.8	0.92144	.	0.050187	0.85682	D	0.000000	T	0.79335	0.4428	N	0.16478	0.41	0.38573	D	0.950008	B	0.14438	0.01	B	0.14023	0.01	T	0.73720	-0.3894	10	0.14252	T	0.57	.	20.062	0.97678	0.0:0.0:1.0:0.0	.	4399	Q9NZJ4	SACS_HUMAN	S	4399;3649;4399	ENSP00000371729:T4399S;ENSP00000385844:T3649S;ENSP00000371735:T4399S	ENSP00000371729:T4399S	T	-	2	0	SACS	22802819	1.000000	0.71417	0.998000	0.56505	0.907000	0.53573	7.863000	0.87023	2.730000	0.93505	0.563000	0.77884	ACT		0.428	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		Missense_Mutation
SLC24A3	57419	hgsc.bcm.edu	37	20	19261705	19261705	+	Missense_Mutation	SNP	G	G	A	rs376513919		TCGA-36-1576-01	TCGA-36-1576-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr20:19261705G>A	ENST00000328041.6	+	2	442	c.245G>A	c.(244-246)cGg>cAg	p.R82Q	RP5-1027G4.3_ENST00000319682.2_RNA	NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3	82					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.R82Q(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GCCGGACTCCGGAACAGCAAG	0.542																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	20						G	GLN/ARG	0,4406		0,0,2203	135.0	113.0	120.0		245	-2.4	0.0	20		120	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC24A3	NM_020689.3	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	82/645	19261705	1,13005	2203	4300	6503	19209705	SO:0001583	missense	57419			AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.245G>A	20.37:g.19261705G>A	ENSP00000333519:p.Arg82Gln		19209705	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Missense_Mutation	SNP	ENST00000328041.6	37	CCDS13140.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.682034	0.00745	0.0	1.16E-4	ENSG00000185052	ENST00000328041	T	0.60299	0.2	5.15	-2.38	0.06622	.	0.979057	0.08337	N	0.961507	T	0.25680	0.0625	N	0.03608	-0.345	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.16305	-1.0407	9	.	.	.	.	3.6965	0.08367	0.2599:0.0:0.2911:0.4491	.	82	Q9HC58	NCKX3_HUMAN	Q	82	ENSP00000333519:R82Q	.	R	+	2	0	SLC24A3	19209705	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	0.132000	0.15891	-0.162000	0.10964	-0.182000	0.12963	CGG		0.542	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078207.4	NM_020689		Missense_Mutation
SON	6651	hgsc.bcm.edu	37	21	34948696	34948696	+	Frame_Shift_Del	DEL	G	G	-	rs201284665|rs34373121		TCGA-36-1576-01	TCGA-36-1576-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr21:34948696delG	ENST00000356577.4	+	12	7722	c.7247delG	c.(7246-7248)agafs	p.R2416fs	SON_ENST00000290239.6_3'UTR|DONSON_ENST00000303113.6_Intron|SON_ENST00000381692.2_Frame_Shift_Del_p.R444fs|AP000304.1_ENST00000595468.1_5'Flank|SON_ENST00000470533.1_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	2416	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.			ALTR -> SPYQ (in Ref. 2; AAK07692). {ECO:0000305}.	cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GCCCTTACCAGACCCAATTGT	0.363																																																0			21											45.0	46.0	46.0					21																	34948696		2202	4291	6493	33870566	SO:0001589	frameshift_variant	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.7247delG	21.37:g.34948696delG	ENSP00000348984:p.Arg2416fs		33870566	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Frame_Shift_Del	DEL	ENST00000356577.4	37	CCDS13629.1	DEL	33	Baylor																																																																																				0.363	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927		Frame_Shift_Del
TSHR	7253	hgsc.bcm.edu	37	14	81609347	81609347	+	Silent	SNP	G	G	C			TCGA-36-1576-01	TCGA-36-1576-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr14:81609347G>C	ENST00000541158.2	+	11	1267	c.945G>C	c.(943-945)gtG>gtC	p.V315V	TSHR_ENST00000298171.2_Silent_p.V315V|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	315					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)	p.V315V(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	GAAAATCTGTGAATGCCTTGA	0.473			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																															yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	1	Substitution - coding silent(1)	ovary(1)	14											132.0	128.0	129.0					14																	81609347		2203	4300	6503	80679100	SO:0001819	synonymous_variant	7253			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.945G>C	14.37:g.81609347G>C			80679100	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Silent	SNP	ENST00000541158.2	37	CCDS9872.1	SNP	45	Baylor																																																																																				0.473	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369		Silent
TSHR	7253	hgsc.bcm.edu	37	14	81609409	81609409	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1576-01	TCGA-36-1576-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr14:81609409G>A	ENST00000541158.2	+	11	1329	c.1007G>A	c.(1006-1008)gGg>gAg	p.G336E	TSHR_ENST00000298171.2_Missense_Mutation_p.G336E|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	336					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)	p.G336E(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	AGCATTGTTGGGTACAAGGAA	0.453			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																															yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	1	Substitution - Missense(1)	ovary(1)	14											175.0	162.0	166.0					14																	81609409		2203	4300	6503	80679162	SO:0001583	missense	7253			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.1007G>A	14.37:g.81609409G>A	ENSP00000441235:p.Gly336Glu		80679162	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Missense_Mutation	SNP	ENST00000541158.2	37	CCDS9872.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	7.202	0.593624	0.13875	.	.	ENSG00000165409	ENST00000541158;ENST00000298171	T;T	0.73897	-0.79;-0.79	5.78	2.74	0.32292	.	0.448378	0.26891	N	0.021976	T	0.61652	0.2364	L	0.29908	0.895	0.39566	D	0.969205	P	0.44429	0.835	P	0.45138	0.471	T	0.56565	-0.7958	10	0.27785	T	0.31	.	6.3546	0.21395	0.1514:0.0:0.4983:0.3504	.	336	F5GYU5	.	E	336	ENSP00000441235:G336E;ENSP00000298171:G336E	ENSP00000298171:G336E	G	+	2	0	TSHR	80679162	0.143000	0.22626	0.987000	0.45799	0.491000	0.33493	1.063000	0.30567	0.862000	0.35528	0.655000	0.94253	GGG		0.453	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369		Missense_Mutation
TSHR	7253	hgsc.bcm.edu	37	14	81609546	81609546	+	Missense_Mutation	SNP	G	G	C			TCGA-36-1576-01	TCGA-36-1576-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr14:81609546G>C	ENST00000541158.2	+	11	1466	c.1144G>C	c.(1144-1146)Gac>Cac	p.D382H	TSHR_ENST00000298171.2_Missense_Mutation_p.D382H|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	382					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)	p.D382H(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	ACAAGCTTTTGACAGCCATTA	0.458			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																															yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	1	Substitution - Missense(1)	ovary(1)	14											469.0	402.0	425.0					14																	81609546		2203	4300	6503	80679299	SO:0001583	missense	7253			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.1144G>C	14.37:g.81609546G>C	ENSP00000441235:p.Asp382His		80679299	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Missense_Mutation	SNP	ENST00000541158.2	37	CCDS9872.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.94	3.510847	0.64522	.	.	ENSG00000165409	ENST00000541158;ENST00000298171	T;T	0.76060	-0.99;-0.99	5.58	5.58	0.84498	.	0.135090	0.64402	D	0.000003	D	0.84206	0.5421	L	0.57536	1.79	0.80722	D	1	D	0.71674	0.998	D	0.65684	0.937	D	0.84374	0.0545	10	0.62326	D	0.03	.	19.9261	0.97102	0.0:0.0:1.0:0.0	.	382	F5GYU5	.	H	382	ENSP00000441235:D382H;ENSP00000298171:D382H	ENSP00000298171:D382H	D	+	1	0	TSHR	80679299	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.956000	0.87863	2.789000	0.95967	0.655000	0.94253	GAC		0.458	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369		Missense_Mutation
TSHR	7253	hgsc.bcm.edu	37	14	81609585	81609585	+	Missense_Mutation	SNP	G	G	A			TCGA-36-1576-01	TCGA-36-1576-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr14:81609585G>A	ENST00000541158.2	+	11	1505	c.1183G>A	c.(1183-1185)Gac>Aac	p.D395N	TSHR_ENST00000298171.2_Missense_Mutation_p.D395N|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	395					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)	p.D395N(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	GGACAGTGAAGACATGGTGTG	0.483			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																															yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	1	Substitution - Missense(1)	ovary(1)	14											707.0	593.0	632.0					14																	81609585		2203	4300	6503	80679338	SO:0001583	missense	7253			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.1183G>A	14.37:g.81609585G>A	ENSP00000441235:p.Asp395Asn		80679338	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Missense_Mutation	SNP	ENST00000541158.2	37	CCDS9872.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.79	2.341239	0.41498	.	.	ENSG00000165409	ENST00000541158;ENST00000298171	T;T	0.75938	-0.98;-0.98	5.37	3.52	0.40303	.	0.184070	0.64402	D	0.000014	T	0.60907	0.2305	N	0.25890	0.77	0.52501	D	0.999952	B	0.18166	0.026	B	0.17098	0.017	T	0.56341	-0.7995	10	0.52906	T	0.07	.	10.5629	0.45156	0.0693:0.0:0.7974:0.1333	.	395	F5GYU5	.	N	395	ENSP00000441235:D395N;ENSP00000298171:D395N	ENSP00000298171:D395N	D	+	1	0	TSHR	80679338	1.000000	0.71417	0.979000	0.43373	0.938000	0.57974	6.585000	0.74062	0.736000	0.32559	0.655000	0.94253	GAC		0.483	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369		Missense_Mutation
TSHR	7253	hgsc.bcm.edu	37	14	81609653	81609653	+	Silent	SNP	G	G	C			TCGA-36-1576-01	TCGA-36-1576-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_III	Capture	Unknown	.	.	SOLID	TCGA-36-1576-01	TCGA-36-1576-10	g.chr14:81609653G>C	ENST00000541158.2	+	11	1573	c.1251G>C	c.(1249-1251)ctG>ctC	p.L417L	TSHR_ENST00000298171.2_Silent_p.L417L|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	417					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)	p.L417L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	ACAAGTTCCTGAGAATTGTGG	0.498			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																															yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	1	Substitution - coding silent(1)	ovary(1)	14											901.0	749.0	800.0					14																	81609653		2203	4300	6503	80679406	SO:0001819	synonymous_variant	7253			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.1251G>C	14.37:g.81609653G>C			80679406	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Silent	SNP	ENST00000541158.2	37	CCDS9872.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	6.006	0.369588	0.11352	.	.	ENSG00000165409	ENST00000412429	.	.	.	5.88	1.8	0.24995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4579	0.11652	0.2032:0.1041:0.5764:0.1163	.	.	.	.	.	-1	.	.	.	+	.	.	TSHR	80679406	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.615000	0.36922	0.847000	0.35167	0.655000	0.94253	.		0.498	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369		Silent
