#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
SPRR3	6707	broad.mit.edu	37	1	152975530	152975530	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr1:152975530C>G	ENST00000295367.4	+	2	76	c.34C>G	c.(34-36)Cca>Gca	p.P12A	SPRR3_ENST00000542696.1_Missense_Mutation_p.P12A|SPRR3_ENST00000331860.3_Missense_Mutation_p.P12A	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	12					epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)	p.P12A(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GACCTTTACCCCACCACCTCA	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											92.0	87.0	89.0					1																	152975530		2203	4300	6503	151242154	SO:0001583	missense	6707			AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.34C>G	1.37:g.152975530C>G	ENSP00000295367:p.Pro12Ala		151242154	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Missense_Mutation	SNP	ENST00000295367.4	37	CCDS1033.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	3.715	-0.058757	0.07317	.	.	ENSG00000163209	ENST00000331860;ENST00000443178;ENST00000295367;ENST00000542696	T;T;T;T	0.14516	2.74;2.5;2.74;2.78	4.49	2.42	0.29668	.	.	.	.	.	T	0.02807	0.0084	L	0.41710	1.295	0.09310	N	1	B;B	0.27882	0.192;0.121	B;B	0.27262	0.078;0.036	T	0.42999	-0.9418	9	0.08179	T	0.78	.	7.1098	0.25384	0.196:0.6142:0.1898:0.0	.	12;12	F5GZ12;Q9UBC9	.;SPRR3_HUMAN	A	12	ENSP00000330391:P12A;ENSP00000402016:P12A;ENSP00000295367:P12A;ENSP00000441477:P12A	ENSP00000295367:P12A	P	+	1	0	SPRR3	151242154	0.004000	0.15560	0.253000	0.24343	0.752000	0.42762	0.523000	0.22925	1.186000	0.42985	0.563000	0.77884	CCA		0.478	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416		Missense_Mutation
PLXNA2	5362	broad.mit.edu	37	1	208216443	208216443	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr1:208216443G>A	ENST00000367033.3	-	21	4737	c.3980C>T	c.(3979-3981)cCg>cTg	p.P1327L		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1327					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.P1327L(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CTCGATGCCCGGGAACAGGAC	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											77.0	72.0	74.0					1																	208216443		2203	4300	6503	206283066	SO:0001583	missense	5362			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3980C>T	1.37:g.208216443G>A	ENSP00000356000:p.Pro1327Leu		206283066	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.481655	0.96307	.	.	ENSG00000076356	ENST00000367033	T	0.12147	2.71	5.42	5.42	0.78866	Plexin, cytoplasmic RasGAP domain (1);	0.000000	0.85682	D	0.000000	T	0.44180	0.1281	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.46721	-0.9171	10	0.87932	D	0	.	19.2386	0.93873	0.0:0.0:1.0:0.0	.	1327	O75051	PLXA2_HUMAN	L	1327	ENSP00000356000:P1327L	ENSP00000356000:P1327L	P	-	2	0	PLXNA2	206283066	1.000000	0.71417	0.954000	0.39281	0.950000	0.60333	9.398000	0.97281	2.543000	0.85770	0.650000	0.86243	CCG		0.607	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179		Missense_Mutation
USH2A	7399	broad.mit.edu	37	1	216256830	216256830	+	Missense_Mutation	SNP	C	C	T	rs143208990		TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr1:216256830C>T	ENST00000307340.3	-	26	5652	c.5266G>A	c.(5266-5268)Gtt>Att	p.V1756I	RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000442606.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.V1756I|RP11-22M7.2_ENST00000446411.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1756	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.V1756I(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTGTTATAAACGAAAAGAAGC	0.303										HNSCC(13;0.011)			C|||	1	0.000199681	0.0	0.0	5008	,	,		15339	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1						C	ILE/VAL	1,4403	2.1+/-5.4	0,1,2201	96.0	100.0	99.0		5266	-1.9	0.4	1	dbSNP_134	99	0,8598		0,0,4299	no	missense	USH2A	NM_206933.2	29	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	benign	1756/5203	216256830	1,13001	2202	4299	6501	214323453	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5266G>A	1.37:g.216256830C>T	ENSP00000305941:p.Val1756Ile		214323453	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	6.896	0.534809	0.13188	2.27E-4	0.0	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.77750	-1.12;-1.12	4.38	-1.89	0.07689	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.783880	0.10646	N	0.650406	T	0.55862	0.1947	N	0.12471	0.22	0.09310	N	0.999998	B	0.10296	0.003	B	0.10450	0.005	T	0.37911	-0.9685	10	0.10377	T	0.69	.	11.0688	0.47991	0.0:0.2969:0.0:0.7031	.	1756	O75445	USH2A_HUMAN	I	1756	ENSP00000305941:V1756I;ENSP00000355910:V1756I	ENSP00000305941:V1756I	V	-	1	0	USH2A	214323453	0.008000	0.16893	0.367000	0.25926	0.938000	0.57974	-0.574000	0.05868	-0.673000	0.05259	-0.136000	0.14681	GTT		0.303	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Missense_Mutation
EDRF1	26098	broad.mit.edu	37	10	127424275	127424275	+	Silent	SNP	A	A	G			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr10:127424275A>G	ENST00000356792.4	+	13	1792	c.1560A>G	c.(1558-1560)gaA>gaG	p.E520E	C10orf137_ENST00000337623.3_Silent_p.E486E	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		520					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.E486E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CTAAAAAGGAAGAAAATTCAG	0.343																																																1	Substitution - coding silent(1)	ovary(1)	10											43.0	48.0	46.0					10																	127424275		2202	4300	6502	127414265	SO:0001819	synonymous_variant	26098																														ENST00000356792.4:c.1560A>G	10.37:g.127424275A>G			127414265	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Silent	SNP	ENST00000356792.4	37	CCDS55733.1	SNP	3	Broad																																																																																				0.343	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1			Silent
MICALCL	84953	broad.mit.edu	37	11	12315154	12315154	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr11:12315154G>T	ENST00000256186.2	+	3	467	c.176G>T	c.(175-177)aGt>aTt	p.S59I		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	59					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)	p.S59I(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		GGTCATCCAAGTCCTCCCACC	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											126.0	128.0	127.0					11																	12315154		1896	4112	6008	12271730	SO:0001583	missense	84953			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.176G>T	11.37:g.12315154G>T	ENSP00000256186:p.Ser59Ile		12271730	Q7RTP7|Q96JU6	Missense_Mutation	SNP	ENST00000256186.2	37	CCDS41620.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	12.57	1.977425	0.34848	.	.	ENSG00000133808	ENST00000256186	T	0.08546	3.08	5.71	1.11	0.20524	.	0.624448	0.14595	N	0.310022	T	0.05410	0.0143	L	0.32530	0.975	0.09310	N	1	B	0.25048	0.117	B	0.20184	0.028	T	0.36432	-0.9748	10	0.72032	D	0.01	.	1.4107	0.02291	0.194:0.1699:0.4605:0.1756	.	59	Q6ZW33	MICLK_HUMAN	I	59	ENSP00000256186:S59I	ENSP00000256186:S59I	S	+	2	0	MICALCL	12271730	0.001000	0.12720	0.028000	0.17463	0.019000	0.09904	0.623000	0.24447	0.715000	0.32103	0.655000	0.94253	AGT		0.498	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867		Missense_Mutation
MICALCL	84953	broad.mit.edu	37	11	12316364	12316364	+	Silent	SNP	T	T	C	rs200708492		TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr11:12316364T>C	ENST00000256186.2	+	3	1677	c.1386T>C	c.(1384-1386)ccT>ccC	p.P462P		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	462	Poly-Pro.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)	p.P462P(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		ctcctcctcctcctcctcctc	0.582																																																2	Substitution - coding silent(2)	ovary(2)	11											9.0	10.0	9.0					11																	12316364		1919	4019	5938	12272940	SO:0001819	synonymous_variant	84953			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1386T>C	11.37:g.12316364T>C			12272940	Q7RTP7|Q96JU6	Silent	SNP	ENST00000256186.2	37	CCDS41620.1	SNP	54	Broad																																																																																				0.582	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867		Silent
OR8K3	219473	broad.mit.edu	37	11	56086642	56086642	+	Missense_Mutation	SNP	T	T	G			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr11:56086642T>G	ENST00000312711.1	+	1	860	c.860T>G	c.(859-861)tTg>tGg	p.L287W		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L287*(1)|p.L287W(1)		central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TTGAATCCCTTGATCTATAGT	0.353																																																2	Substitution - Nonsense(1)|Substitution - Missense(1)	ovary(1)|lung(1)	11											74.0	66.0	69.0					11																	56086642		2201	4296	6497	55843218	SO:0001583	missense	219473			AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.860T>G	11.37:g.56086642T>G	ENSP00000323555:p.Leu287Trp		55843218	Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	37	CCDS31527.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	11.27	1.589615	0.28357	.	.	ENSG00000181689	ENST00000312711	T	0.45276	0.9	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45361	D	0.000376	T	0.62648	0.2445	H	0.98466	4.24	0.35668	D	0.813101	P	0.34587	0.458	B	0.36567	0.228	T	0.79266	-0.1874	10	0.87932	D	0	.	12.487	0.55879	0.0:0.0:0.0:1.0	.	287	Q8NH51	OR8K3_HUMAN	W	287	ENSP00000323555:L287W	ENSP00000323555:L287W	L	+	2	0	OR8K3	55843218	0.935000	0.31712	0.987000	0.45799	0.010000	0.07245	7.009000	0.76347	1.888000	0.54679	0.386000	0.25728	TTG		0.353	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202		Missense_Mutation
ME3	10873	broad.mit.edu	37	11	86152477	86152477	+	Silent	SNP	G	G	A			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr11:86152477G>A	ENST00000393324.3	-	14	1912	c.1659C>T	c.(1657-1659)ctC>ctT	p.L553L	ME3_ENST00000359636.2_Silent_p.L553L|ME3_ENST00000543262.1_Silent_p.L553L|RP11-317J19.1_ENST00000524610.1_RNA	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	553					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)	p.L553L(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				ACGCGTAGTCGAGAACCTAGA	0.493																																																1	Substitution - coding silent(1)	ovary(1)	11											159.0	149.0	152.0					11																	86152477		2202	4299	6501	85830125	SO:0001819	synonymous_variant	10873			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1659C>T	11.37:g.86152477G>A			85830125	B7Z6V0|Q8TBJ0	Silent	SNP	ENST00000393324.3	37	CCDS8277.1	SNP	37	Broad																																																																																				0.493	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2			Silent
ARHGEF12	23365	broad.mit.edu	37	11	120322316	120322316	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr11:120322316C>T	ENST00000397843.2	+	22	2105	c.1939C>T	c.(1939-1941)Cgc>Tgc	p.R647C	ARHGEF12_ENST00000356641.3_Missense_Mutation_p.R628C|ARHGEF12_ENST00000532993.1_Missense_Mutation_p.R544C	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	647					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R647C(1)		NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TGCCAAGTTGCGCCAGAGTGG	0.537			T	MLL	AML																																		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	1	Substitution - Missense(1)	ovary(1)	11											75.0	77.0	76.0					11																	120322316		1954	4157	6111	119827526	SO:0001583	missense	23365			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1939C>T	11.37:g.120322316C>T	ENSP00000380942:p.Arg647Cys		119827526	O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	37	CCDS41727.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072857	0.76415	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.69926	-0.33;-0.44;-0.32	5.07	5.07	0.68467	.	0.000000	0.48286	D	0.000193	T	0.78799	0.4340	M	0.71581	2.175	0.80722	D	1	D;D;D	0.76494	0.992;0.999;0.998	B;P;P	0.58873	0.386;0.847;0.708	T	0.80578	-0.1320	10	0.52906	T	0.07	-1.9085	18.0341	0.89293	0.0:1.0:0.0:0.0	.	544;628;647	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	C	647;628;544	ENSP00000380942:R647C;ENSP00000349056:R628C;ENSP00000432984:R544C	ENSP00000349056:R628C	R	+	1	0	ARHGEF12	119827526	1.000000	0.71417	1.000000	0.80357	0.307000	0.27823	4.220000	0.58567	2.352000	0.79861	0.491000	0.48974	CGC		0.537	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313		Missense_Mutation
MYF5	4617	broad.mit.edu	37	12	81111036	81111036	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr12:81111036G>T	ENST00000228644.3	+	1	346	c.194G>T	c.(193-195)gGt>gTt	p.G65V		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	65					camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)	p.G65V(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						CACCAGGCTGGTCACTGCCTC	0.642																																																1	Substitution - Missense(1)	ovary(1)	12											38.0	34.0	35.0					12																	81111036		2203	4300	6503	79635167	SO:0001583	missense	4617				CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.194G>T	12.37:g.81111036G>T	ENSP00000228644:p.Gly65Val		79635167	Q6ISR9	Missense_Mutation	SNP	ENST00000228644.3	37	CCDS9020.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852449	0.91355	.	.	ENSG00000111049	ENST00000228644	D	0.91407	-2.84	6.17	6.17	0.99709	Myogenic basic muscle-specific protein (2);	0.000000	0.85682	D	0.000000	D	0.96586	0.8886	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96293	0.9215	10	0.87932	D	0	-14.0091	20.8794	0.99867	0.0:0.0:1.0:0.0	.	65	P13349	MYF5_HUMAN	V	65	ENSP00000228644:G65V	ENSP00000228644:G65V	G	+	2	0	MYF5	79635167	1.000000	0.71417	0.955000	0.39395	0.891000	0.51852	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GGT		0.642	MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407757.1	NM_005593		Missense_Mutation
LIG4	3981	broad.mit.edu	37	13	108861828	108861828	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr13:108861828C>A	ENST00000356922.4	-	2	2061	c.1789G>T	c.(1789-1791)Gac>Tac	p.D597Y	LIG4_ENST00000405925.1_Missense_Mutation_p.D597Y|LIG4_ENST00000442234.1_Missense_Mutation_p.D597Y	NM_002312.3|NM_206937.1	NP_002303.2|NP_996820.1	P49917	DNLI4_HUMAN	ligase IV, DNA, ATP-dependent	597					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|chromosome organization (GO:0051276)|DNA biosynthetic process (GO:0071897)|DNA ligation (GO:0006266)|DNA ligation involved in DNA recombination (GO:0051102)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|lagging strand elongation (GO:0006273)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|single strand break repair (GO:0000012)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|focal adhesion (GO:0005925)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.D597Y(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TCTAGGTCGTCCAGGGTCATG	0.448								Non-homologous end-joining																																								1	Substitution - Missense(1)	ovary(1)	13											92.0	90.0	91.0					13																	108861828		2203	4300	6503	107659829	SO:0001583	missense	3981			X83441	CCDS9508.1	13q33-q34	2014-09-17			ENSG00000174405	ENSG00000174405	6.5.1.1		6601	protein-coding gene	gene with protein product	"""polydeoxyribonucleotide synthase [ATP] 4"", ""polynucleotide ligase"", ""sealase"", ""DNA repair enzyme"", ""DNA joinase"""	601837				7760816	Standard	NM_001098268		Approved		uc001vqo.3	P49917	OTTHUMG00000017328	ENST00000356922.4:c.1789G>T	13.37:g.108861828C>A	ENSP00000349393:p.Asp597Tyr		107659829	Q8IY66|Q8TEU5	Missense_Mutation	SNP	ENST00000356922.4	37	CCDS9508.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	13.82	2.351194	0.41700	.	.	ENSG00000174405	ENST00000405925;ENST00000442234;ENST00000356922	T;T;T	0.65178	-0.14;-0.14;-0.14	5.74	5.74	0.90152	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.266045	0.41500	D	0.000868	T	0.66799	0.2826	M	0.67953	2.075	0.58432	D	0.999995	P	0.35944	0.529	B	0.39068	0.289	T	0.69383	-0.5160	10	0.66056	D	0.02	.	18.907	0.92466	0.0:1.0:0.0:0.0	.	597	P49917	DNLI4_HUMAN	Y	597	ENSP00000385955:D597Y;ENSP00000402030:D597Y;ENSP00000349393:D597Y	ENSP00000349393:D597Y	D	-	1	0	LIG4	107659829	0.944000	0.32072	0.895000	0.35142	0.499000	0.33736	2.065000	0.41442	2.697000	0.92050	0.551000	0.68910	GAC		0.448	LIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045738.4	NM_002312		Missense_Mutation
TCF25	22980	broad.mit.edu	37	16	89977504	89977504	+	Missense_Mutation	SNP	A	A	C			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr16:89977504A>C	ENST00000263346.8	+	18	1945	c.1889A>C	c.(1888-1890)gAa>gCa	p.E630A	RP11-566K11.7_ENST00000570217.1_RNA|TCF25_ENST00000263347.7_Silent_p.G434G|MC1R_ENST00000555427.1_5'Flank	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	630					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E630A(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		AGGCCCGAGGAAGGAGTGGCT	0.657																																																1	Substitution - Missense(1)	ovary(1)	16											35.0	37.0	36.0					16																	89977504		2192	4288	6480	88505005	SO:0001583	missense	22980			AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.1889A>C	16.37:g.89977504A>C	ENSP00000263346:p.Glu630Ala		88505005	Q2MK75|Q9UPV3	Missense_Mutation	SNP	ENST00000263346.8	37	CCDS10987.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	7.915	0.737396	0.15574	.	.	ENSG00000141002	ENST00000263346	.	.	.	5.18	4.08	0.47627	.	0.665053	0.16543	N	0.209825	T	0.34221	0.0890	N	0.24115	0.695	0.80722	D	1	B	0.33000	0.393	B	0.24006	0.05	T	0.07654	-1.0761	9	0.31617	T	0.26	.	10.5087	0.44849	0.6884:0.3116:0.0:0.0	.	630	Q9BQ70	TCF25_HUMAN	A	630	.	ENSP00000263346:E630A	E	+	2	0	TCF25	88505005	0.993000	0.37304	0.077000	0.20336	0.213000	0.24496	3.058000	0.49939	0.896000	0.36366	0.459000	0.35465	GAA		0.657	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272875.2	NM_014972		Missense_Mutation
GEMIN4	50628	broad.mit.edu	37	17	650583	650583	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr17:650583C>A	ENST00000319004.5	-	2	818	c.700G>T	c.(700-702)Ggg>Tgg	p.G234W	GEMIN4_ENST00000437269.1_Intron|GEMIN4_ENST00000576778.1_Missense_Mutation_p.G223W	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	234					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)		p.G234W(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		CACTTCCTCCCCGGGCCCAGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	17											60.0	68.0	65.0					17																	650583		2160	4258	6418	597333	SO:0001583	missense	50628			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.700G>T	17.37:g.650583C>A	ENSP00000321706:p.Gly234Trp		597333	Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	ENST00000319004.5	37	CCDS45559.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	8.822	0.937860	0.18206	.	.	ENSG00000179409	ENST00000319004	T	0.16073	2.37	5.6	3.28	0.37604	.	0.555420	0.20281	N	0.095446	T	0.28732	0.0712	L	0.51422	1.61	0.09310	N	1	D	0.55800	0.973	P	0.59115	0.852	T	0.02632	-1.1131	10	0.72032	D	0.01	-14.9861	10.0632	0.42288	0.0:0.8128:0.0:0.1872	.	234	P57678	GEMI4_HUMAN	W	234	ENSP00000321706:G234W	ENSP00000321706:G234W	G	-	1	0	GEMIN4	597333	0.001000	0.12720	0.757000	0.31301	0.005000	0.04900	1.193000	0.32162	1.376000	0.46267	0.650000	0.86243	GGG		0.627	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437181.1	NM_015721		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000413465.2_Missense_Mutation_p.Y220C|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C|TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	17	GRCh37	CM015378|CM951227	TP53	M	rs121912666						102.0	94.0	97.0					17																	7578190		2203	4300	6503	7518915	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	17.37:g.7578190T>C	ENSP00000269305:p.Tyr220Cys		7518915	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
CYP4F12	66002	broad.mit.edu	37	19	15794418	15794418	+	Missense_Mutation	SNP	C	C	T	rs200246876		TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr19:15794418C>T	ENST00000550308.1	+	7	1143	c.763C>T	c.(763-765)Cgc>Tgc	p.R255C	CYP4F12_ENST00000324632.10_Missense_Mutation_p.R255C	NM_023944.3	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 12	255					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|leukotriene B4 catabolic process (GO:0036101)|long-chain fatty acid metabolic process (GO:0001676)|negative regulation of blood coagulation (GO:0030195)|oxidation-reduction process (GO:0055114)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|very long-chain fatty acid metabolic process (GO:0000038)|vitamin E metabolic process (GO:0042360)|vitamin K biosynthetic process (GO:0042371)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)	p.R255C(1)		NS(1)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	41	Acute lymphoblastic leukemia(2;0.0367)				Fingolimod(DB08868)	TGACGGGCGGCGCTTCCACAG	0.552													.|||	1	0.000199681	0.0	0.0	5008	,	,		20854	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19						C	CYS/ARG	0,4396		0,0,2198	76.0	78.0	77.0		763	2.5	0.8	19		77	8,8582		0,8,4287	yes	missense	CYP4F12	NM_023944.3	180	0,8,6485	TT,TC,CC		0.0931,0.0,0.0616	possibly-damaging	255/525	15794418	8,12978	2198	4295	6493	15655418	SO:0001583	missense	66002			AB035130	CCDS42517.1	19p13.1	2008-02-05	2003-01-14		ENSG00000186204	ENSG00000186204		"""Cytochrome P450s"""	18857	protein-coding gene	gene with protein product		611485	"""cytochrome P450, subfamily IVF, polypeptide 12"""			11162607	Standard	NM_023944		Approved		uc002nbl.3	Q9HCS2	OTTHUMG00000164477	ENST00000550308.1:c.763C>T	19.37:g.15794418C>T	ENSP00000448998:p.Arg255Cys		15655418	E7ET51|O60389|Q5JPJ7|Q9HCS1	Missense_Mutation	SNP	ENST00000550308.1	37	CCDS42517.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	.	6.061	0.379552	0.11466	0.0	9.31E-4	ENSG00000186204	ENST00000550308;ENST00000324632	T;T	0.69926	-0.44;-0.44	2.47	2.47	0.30058	.	0.215616	0.29410	U	0.012226	T	0.62478	0.2431	M	0.69523	2.12	0.48571	D	0.999673	B	0.32717	0.381	B	0.36186	0.219	T	0.65582	-0.6133	10	0.56958	D	0.05	.	6.6001	0.22695	0.2847:0.7153:0.0:0.0	.	255	Q9HCS2	CP4FC_HUMAN	C	255	ENSP00000448998:R255C;ENSP00000321821:R255C	ENSP00000321821:R255C	R	+	1	0	CYP4F12	15655418	0.841000	0.29509	0.776000	0.31678	0.020000	0.10135	1.440000	0.35024	1.686000	0.51046	0.491000	0.48974	CGC		0.552	CYP4F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378938.9			Missense_Mutation
OR10H1	26539	broad.mit.edu	37	19	15918448	15918448	+	Missense_Mutation	SNP	C	C	T	rs141400861		TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr19:15918448C>T	ENST00000334920.2	-	1	488	c.400G>A	c.(400-402)Gtg>Atg	p.V134M		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V134M(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						CTCATGAGCACGTTGTAGCGC	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											75.0	61.0	66.0					19																	15918448		2203	4300	6503	15779448	SO:0001583	missense	26539			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.400G>A	19.37:g.15918448C>T	ENSP00000335596:p.Val134Met		15779448	Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	37	CCDS12335.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	.	10.34	1.323277	0.24080	.	.	ENSG00000186723	ENST00000334920	T	0.03607	3.87	4.62	4.62	0.57501	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	D	0.000407	T	0.06096	0.0158	M	0.62016	1.91	0.09310	N	1	P	0.42827	0.791	B	0.40038	0.317	T	0.23084	-1.0198	10	0.56958	D	0.05	.	10.9328	0.47228	0.0:0.8092:0.1908:0.0	.	134	Q9Y4A9	O10H1_HUMAN	M	134	ENSP00000335596:V134M	ENSP00000335596:V134M	V	-	1	0	OR10H1	15779448	0.000000	0.05858	0.780000	0.31762	0.584000	0.36387	-0.104000	0.10923	2.111000	0.64477	0.643000	0.83706	GTG		0.642	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1			Missense_Mutation
PSG1	5669	broad.mit.edu	37	19	43375953	43375953	+	Silent	SNP	G	G	T			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr19:43375953G>T	ENST00000436291.2	-	3	791	c.675C>A	c.(673-675)gcC>gcA	p.A225A	PSG1_ENST00000595124.1_Intron|PSG1_ENST00000595356.1_Silent_p.A225A|PSG1_ENST00000312439.6_Silent_p.A225A|PSG1_ENST00000244296.2_Silent_p.A225A|PSG1_ENST00000403380.3_Intron	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	225	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.A225A(3)		breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				CACTGCGGCTGGCACTCACTG	0.537																																																3	Substitution - coding silent(3)	ovary(3)	19											188.0	200.0	196.0					19																	43375953		2201	4296	6497	48067793	SO:0001819	synonymous_variant	5669				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.675C>A	19.37:g.43375953G>T			48067793	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Silent	SNP	ENST00000436291.2	37	CCDS54275.1	SNP	47	Broad																																																																																				0.537	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1			Silent
POLD1	5424	broad.mit.edu	37	19	50919065	50919065	+	Silent	SNP	C	C	T			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr19:50919065C>T	ENST00000440232.2	+	22	2855	c.2802C>T	c.(2800-2802)gcC>gcT	p.A934A	POLD1_ENST00000595904.1_Silent_p.A960A|POLD1_ENST00000599857.1_Silent_p.A934A|CTD-2545M3.6_ENST00000599632.1_Missense_Mutation_p.R4C	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	934					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.A934A(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		AGGGTGTGGCCGCCTACATGA	0.692								DNA polymerases (catalytic subunits)																																								1	Substitution - coding silent(1)	ovary(1)	19											22.0	22.0	22.0					19																	50919065		2187	4273	6460	55610877	SO:0001819	synonymous_variant	5424				CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.2802C>T	19.37:g.50919065C>T			55610877	Q8NER3|Q96H98	Silent	SNP	ENST00000440232.2	37	CCDS12795.1	SNP	23	Broad																																																																																				0.692	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464732.1			Silent
KLF11	8462	broad.mit.edu	37	2	10186423	10186423	+	Missense_Mutation	SNP	A	A	T			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr2:10186423A>T	ENST00000305883.1	+	2	351	c.189A>T	c.(187-189)aaA>aaT	p.K63N	KLF11_ENST00000540845.1_Missense_Mutation_p.K46N|KLF11_ENST00000535335.1_Missense_Mutation_p.K46N	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	63					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.K63N(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		GATCCCAGAAAGGTGACCTGT	0.522																																					Melanoma(56;431 1507 23687 50789)											1	Substitution - Missense(1)	ovary(1)	2											104.0	98.0	100.0					2																	10186423		2203	4300	6503	10103874	SO:0001583	missense	8462			AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.189A>T	2.37:g.10186423A>T	ENSP00000307023:p.Lys63Asn		10103874	B4DZE7|Q9EPF4	Missense_Mutation	SNP	ENST00000305883.1	37	CCDS1668.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	12.49	1.954644	0.34471	.	.	ENSG00000172059	ENST00000401510;ENST00000305883;ENST00000448523;ENST00000540845;ENST00000440320;ENST00000535335	T;T;T;T;T;T	0.67698	-0.26;2.33;-0.28;2.33;-0.25;2.33	5.03	-0.00332	0.14026	.	0.268767	0.40302	N	0.001121	T	0.55862	0.1947	M	0.72894	2.215	0.37123	D	0.900918	P	0.49635	0.926	P	0.44597	0.454	T	0.65269	-0.6209	10	0.02654	T	1	.	6.0769	0.19921	0.567:0.1385:0.2945:0.0	.	63	O14901	KLF11_HUMAN	N	46;63;46;46;46;46	ENSP00000386058:K46N;ENSP00000307023:K63N;ENSP00000387866:K46N;ENSP00000444690:K46N;ENSP00000388263:K46N;ENSP00000442722:K46N	ENSP00000307023:K63N	K	+	3	2	KLF11	10103874	0.176000	0.23096	0.086000	0.20670	0.660000	0.38997	-0.007000	0.12810	-0.018000	0.14079	0.379000	0.24179	AAA		0.522	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000239202.3	NM_003597		Missense_Mutation
POLR1A	25885	broad.mit.edu	37	2	86255075	86255075	+	Silent	SNP	G	G	A			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr2:86255075G>A	ENST00000263857.6	-	33	5373	c.4995C>T	c.(4993-4995)aaC>aaT	p.N1665N	POLR1A_ENST00000409681.1_Silent_p.N1604N			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1665					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)	p.N1665N(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GCGGGGAAGAGTTTGACCGGA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	2											96.0	106.0	103.0					2																	86255075		2010	4178	6188	86108586	SO:0001819	synonymous_variant	25885			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.4995C>T	2.37:g.86255075G>A			86108586	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Silent	SNP	ENST00000263857.6	37	CCDS42706.1	SNP	36	Broad																																																																																				0.557	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425		Silent
POTED	317754	broad.mit.edu	37	21	15000772	15000772	+	Splice_Site	SNP	A	A	G			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr21:15000772A>G	ENST00000299443.5	+	7	1248	c.1196A>G	c.(1195-1197)gAg>gGg	p.E399G		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	399						plasma membrane (GO:0005886)		p.E399G(1)		central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						AGCCAGCCAGAGGCATGGaaa	0.308																																																1	Substitution - Missense(1)	ovary(1)	21											0.0	1.0	1.0					21																	15000772		0	3	3	13922643	SO:0001630	splice_region_variant	317754			AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.1197+1A>G	21.37:g.15000772A>G			13922643	C9JCF7	Missense_Mutation	SNP	ENST00000299443.5	37	CCDS13562.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	7.129	0.579514	0.13686	.	.	ENSG00000166351	ENST00000299443	T	0.17528	2.27	1.13	1.13	0.20643	.	.	.	.	.	T	0.06690	0.0171	N	0.24115	0.695	0.09310	N	1	P	0.36222	0.544	B	0.23150	0.044	T	0.25950	-1.0117	9	0.09084	T	0.74	.	4.5705	0.12207	1.0:0.0:0.0:0.0	.	399	Q86YR6	POTED_HUMAN	G	399	ENSP00000299443:E399G	ENSP00000299443:E399G	E	+	2	0	POTED	13922643	0.081000	0.21417	0.014000	0.15608	0.019000	0.09904	-0.133000	0.10451	0.791000	0.33826	0.113000	0.15668	GAG		0.308	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1	NM_174981	Missense_Mutation	Missense_Mutation
OTOL1	131149	broad.mit.edu	37	3	161221249	161221249	+	Missense_Mutation	SNP	T	T	C	rs563420853		TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr3:161221249T>C	ENST00000327928.4	+	4	953	c.953T>C	c.(952-954)gTc>gCc	p.V318A		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	318	Collagen-like 3.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)		p.V318A(1)		central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						AACAAAGGGGTCCGAGGCCCC	0.572													T|||	1	0.000199681	0.0	0.0014	5008	,	,		13434	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3											30.0	31.0	31.0					3																	161221249		1877	4099	5976	162703943	SO:0001583	missense	131149				CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.953T>C	3.37:g.161221249T>C	ENSP00000330808:p.Val318Ala		162703943		Missense_Mutation	SNP	ENST00000327928.4	37	CCDS46948.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	4.969	0.179954	0.09443	.	.	ENSG00000182447	ENST00000327928	D	0.94897	-3.55	5.23	-4.45	0.03546	.	1.161870	0.06076	N	0.660913	T	0.77308	0.4111	N	0.01515	-0.825	0.09310	N	1	B	0.26258	0.145	B	0.23150	0.044	T	0.74237	-0.3730	10	0.08837	T	0.75	.	2.3083	0.04180	0.1101:0.279:0.3359:0.2751	.	318	A6NHN0	OTOL1_HUMAN	A	318	ENSP00000330808:V318A	ENSP00000330808:V318A	V	+	2	0	OTOL1	162703943	0.000000	0.05858	0.367000	0.25926	0.042000	0.13812	-0.388000	0.07352	-0.271000	0.09272	0.455000	0.32223	GTC		0.572	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1	NM_001080440		Missense_Mutation
POLK	51426	broad.mit.edu	37	5	74848304	74848304	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr5:74848304G>T	ENST00000241436.4	+	3	315	c.143G>T	c.(142-144)aGa>aTa	p.R48I	POLK_ENST00000515295.1_Missense_Mutation_p.R48I|POLK_ENST00000352007.5_Missense_Mutation_p.R48I|POLK_ENST00000508526.1_Missense_Mutation_p.R48I|POLK_ENST00000504026.1_Missense_Mutation_p.R48I|POLK_ENST00000380481.3_5'UTR|POLK_ENST00000506928.1_3'UTR	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	48					DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.R48I(1)		endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		TAGGGGTCCAGATTTTATGGA	0.378								DNA polymerases (catalytic subunits)																																								1	Substitution - Missense(1)	ovary(1)	5											59.0	59.0	59.0					5																	74848304		2203	4300	6503	74884060	SO:0001583	missense	51426			AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.143G>T	5.37:g.74848304G>T	ENSP00000241436:p.Arg48Ile		74884060	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Missense_Mutation	SNP	ENST00000241436.4	37	CCDS4030.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	14.55	2.567527	0.45694	.	.	ENSG00000122008	ENST00000241436;ENST00000352007;ENST00000514296;ENST00000515295;ENST00000504026;ENST00000508526	T;T;T;T;T	0.56275	1.17;0.47;0.64;0.64;0.47	6.07	1.39	0.22231	.	0.364017	0.37095	N	0.002254	T	0.66346	0.2780	M	0.72894	2.215	0.80722	D	1	D;P;D;P	0.76494	0.999;0.7;0.987;0.837	D;B;D;P	0.68483	0.958;0.197;0.943;0.633	T	0.65590	-0.6131	10	0.87932	D	0	-12.1417	10.361	0.43994	0.4422:0.0:0.5578:0.0	.	48;48;48;48	Q9UBT6-3;Q5Q9G5;Q9UBT6-2;Q9UBT6	.;.;.;POLK_HUMAN	I	48	ENSP00000241436:R48I;ENSP00000342256:R48I;ENSP00000424174:R48I;ENSP00000425075:R48I;ENSP00000426853:R48I	ENSP00000241436:R48I	R	+	2	0	POLK	74884060	1.000000	0.71417	0.997000	0.53966	0.078000	0.17371	0.987000	0.29603	-0.028000	0.13850	-0.143000	0.13931	AGA		0.378	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	NM_016218		Missense_Mutation
REEP5	7905	broad.mit.edu	37	5	112238202	112238202	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr5:112238202C>T	ENST00000379638.4	-	3	574	c.226G>A	c.(226-228)Gag>Aag	p.E76K	REEP5_ENST00000545426.1_Missense_Mutation_p.E76K|REEP5_ENST00000504247.1_Intron|REEP5_ENST00000513339.1_Missense_Mutation_p.E76K|REEP5_ENST00000474542.2_5'UTR	NM_005669.4	NP_005660.4	Q00765	REEP5_HUMAN	receptor accessory protein 5	76						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.E76K(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		TTGGGACTCTCTATAGCTTTA	0.373																																																1	Substitution - Missense(1)	ovary(1)	5											136.0	137.0	136.0					5																	112238202		2202	4300	6502	112266101	SO:0001583	missense	7905			BC000232	CCDS4109.2	5q22-q23	2008-02-05	2006-02-07	2006-02-07	ENSG00000129625	ENSG00000129625		"""Receptor accessory proteins"""	30077	protein-coding gene	gene with protein product	"""deleted in polyposis 1"", ""polyposis locus protein 1"", ""polyposis coli region hypothetical protein DP1"""	125265	"""chromosome 5 open reading frame 18"""	C5orf18		16271481, 15550249	Standard	NM_005669		Approved	DP1, TB2, D5S346	uc003kqe.1	Q00765	OTTHUMG00000128807	ENST00000379638.4:c.226G>A	5.37:g.112238202C>T	ENSP00000368959:p.Glu76Lys		112266101	B7Z681|D3DT04|Q04198|Q5QGT0|Q9BWH9	Missense_Mutation	SNP	ENST00000379638.4	37	CCDS4109.2	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.665055	0.96745	.	.	ENSG00000129625	ENST00000379638;ENST00000513339;ENST00000545426;ENST00000261482	D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.95290	0.8472	L	0.59967	1.855	0.80722	D	1	D;D;B	0.64830	0.994;0.994;0.443	D;D;P	0.71414	0.96;0.973;0.639	D	0.94741	0.7919	10	0.52906	T	0.07	-17.1842	19.9036	0.96999	0.0:1.0:0.0:0.0	.	76;49;76	B7Z510;B7Z2A3;Q00765	.;.;REEP5_HUMAN	K	76;76;76;67	ENSP00000368959:E76K;ENSP00000425901:E76K;ENSP00000442940:E76K;ENSP00000261482:E67K	ENSP00000261482:E67K	E	-	1	0	REEP5	112266101	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	7.794000	0.85869	2.706000	0.92434	0.655000	0.94253	GAG		0.373	REEP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250739.2	NM_005669		Missense_Mutation
TGFBI	7045	broad.mit.edu	37	5	135389657	135389657	+	Silent	SNP	A	A	C			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr5:135389657A>C	ENST00000442011.2	+	9	1313	c.1152A>C	c.(1150-1152)gcA>gcC	p.A384A	TGFBI_ENST00000305126.8_Silent_p.A384A	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	384	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)	p.A384A(1)		breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AATTGGCTGCAGAGTCTGATG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	5											85.0	86.0	85.0					5																	135389657		1918	4147	6065	135417556	SO:0001819	synonymous_variant	7045			M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.1152A>C	5.37:g.135389657A>C			135417556	D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Silent	SNP	ENST00000442011.2	37	CCDS47266.1	SNP	7	Broad																																																																																				0.488	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372108.1			Silent
DST	667	broad.mit.edu	37	6	56397227	56397227	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr6:56397227C>G	ENST00000361203.3	-	60	16397	c.16390G>C	c.(16390-16392)Gag>Cag	p.E5464Q	DST_ENST00000340834.4_5'UTR|DST_ENST00000370788.2_Missense_Mutation_p.E3378Q|DST_ENST00000370769.4_Missense_Mutation_p.E5466Q|DST_ENST00000370754.5_Missense_Mutation_p.E5644Q|DST_ENST00000446842.2_Missense_Mutation_p.E5140Q|DST_ENST00000244364.6_Missense_Mutation_p.E3052Q|DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Missense_Mutation_p.E3378Q			Q03001	DYST_HUMAN	dystonin	5464					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.E5466Q(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCTGCGGGCTCTGCTGTTGTA	0.393																																																1	Substitution - Missense(1)	ovary(1)	6											104.0	90.0	94.0					6																	56397227		1842	4097	5939	56505186	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.16390G>C	6.37:g.56397227C>G	ENSP00000354508:p.Glu5464Gln		56505186	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972090	0.74246	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.34	5.34	0.76211	.	0.000000	0.50627	D	0.000106	T	0.52435	0.1734	L	0.44542	1.39	0.25474	N	0.987798	D;D;D;D;P	0.89917	0.98;1.0;0.999;0.977;0.843	P;D;D;P;P	0.79108	0.815;0.992;0.968;0.856;0.647	T	0.32903	-0.9889	9	0.21014	T	0.42	.	19.3926	0.94590	0.0:1.0:0.0:0.0	.	3378;5466;5644;5464;3052	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	Q	3052;5644;5466;3378;5140;3378;5464	ENSP00000244364:E3052Q;ENSP00000359790:E5644Q;ENSP00000359805:E5466Q;ENSP00000400883:E3378Q;ENSP00000393645:E5140Q;ENSP00000359824:E3378Q;ENSP00000354508:E5464Q	ENSP00000244364:E3052Q	E	-	1	0	DST	56505186	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	7.741000	0.84997	2.653000	0.90120	0.591000	0.81541	GAG		0.393	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		Missense_Mutation
EEPD1	80820	broad.mit.edu	37	7	36194635	36194635	+	Silent	SNP	G	G	T			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr7:36194635G>T	ENST00000242108.4	+	2	1420	c.702G>T	c.(700-702)ccG>ccT	p.P234P	EEPD1_ENST00000534978.1_Silent_p.P234P	NM_030636.2	NP_085139.2	Q7L9B9	EEPD1_HUMAN	endonuclease/exonuclease/phosphatase family domain containing 1	234					DNA repair (GO:0006281)		DNA binding (GO:0003677)	p.P234P(1)		endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|skin(1)	18						TGGACCTGCCGCCAGGGGGGC	0.672																																																1	Substitution - coding silent(1)	ovary(1)	7											37.0	41.0	39.0					7																	36194635		2203	4300	6503	36161160	SO:0001819	synonymous_variant	80820			AK027386	CCDS34619.1	7p14.2	2007-12-07	2007-12-07		ENSG00000122547	ENSG00000122547			22223	protein-coding gene	gene with protein product							Standard	NM_030636		Approved	KIAA1706	uc003tfa.3	Q7L9B9	OTTHUMG00000154904	ENST00000242108.4:c.702G>T	7.37:g.36194635G>T			36161160	Q96K64|Q9C0F7	Silent	SNP	ENST00000242108.4	37	CCDS34619.1	SNP	38	Broad																																																																																				0.672	EEPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337602.1	NM_030636		Silent
Unknown	0	broad.mit.edu	37	7	75124501	75124501	+	IGR	SNP	T	T	C			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr7:75124501T>C								POM121C (8953 upstream) : PMS2P3 (12573 downstream)																							CAGCCCCCCATGTAGGTCCCT	0.577																																																0			7											5.0	5.0	5.0					7																	75124501		1174	2165	3339	74962437	SO:0001628	intergenic_variant	442590																															7.37:g.75124501T>C			74962437		Missense_Mutation	SNP		37		SNP	51	Broad																																																																																			0	0.577									Missense_Mutation
LURAP1L	286343	broad.mit.edu	37	9	12775880	12775880	+	Missense_Mutation	SNP	T	T	G	rs201963967		TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr9:12775880T>G	ENST00000319264.3	+	1	861	c.166T>G	c.(166-168)Tgc>Ggc	p.C56G	RP11-3L8.3_ENST00000417638.1_RNA|LURAP1L_ENST00000489107.1_3'UTR	NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	59	Gly-rich.							p.C56G(1)									cggcggcggctgcagtagcag	0.687																																																1	Substitution - Missense(1)	ovary(1)	9											4.0	4.0	4.0					9																	12775880		1740	3236	4976	12765880	SO:0001583	missense	286343			AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.166T>G	9.37:g.12775880T>G	ENSP00000321026:p.Cys56Gly		12765880	Q5VZX7|Q8N923|Q8NCG2	Missense_Mutation	SNP	ENST00000319264.3	37	CCDS6473.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	6.415	0.444604	0.12164	.	.	ENSG00000153714	ENST00000319264	T	0.42900	0.96	4.66	0.578	0.17391	.	1.586600	0.03312	N	0.190713	T	0.18087	0.0434	.	.	.	0.51482	P	7.500000000004725E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.20009	-1.0288	8	0.08837	T	0.75	.	1.2788	0.02036	0.1736:0.1011:0.2715:0.4538	.	59	Q8IV03	CI150_HUMAN	G	56	ENSP00000321026:C56G	ENSP00000321026:C56G	C	+	1	0	C9orf150	12765880	0.074000	0.21230	0.846000	0.33378	0.825000	0.46686	-0.127000	0.10547	0.663000	0.31027	0.454000	0.30748	TGC		0.687	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403		Missense_Mutation
ZCCHC6	79670	broad.mit.edu	37	9	88924132	88924132	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr9:88924132C>T	ENST00000375963.3	-	21	3827	c.3655G>A	c.(3655-3657)Gaa>Aaa	p.E1219K	ZCCHC6_ENST00000375960.2_Missense_Mutation_p.E983K|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.E1181K|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.E508K|ZCCHC6_ENST00000375957.1_Missense_Mutation_p.E119K	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	1219					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.E1219K(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						CGTACCAGTTCATCTATTTGA	0.259																																																1	Substitution - Missense(1)	ovary(1)	9											32.0	36.0	35.0					9																	88924132		2176	4260	6436	88113952	SO:0001583	missense	79670			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.3655G>A	9.37:g.88924132C>T	ENSP00000365130:p.Glu1219Lys		88113952	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	17.39	3.376422	0.61735	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375961;ENST00000375957;ENST00000375963	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.53	5.53	0.82687	.	0.221122	0.46442	D	0.000298	T	0.60996	0.2312	M	0.64997	1.995	0.43342	D	0.995395	P;P;B	0.49559	0.925;0.508;0.02	P;B;B	0.49597	0.616;0.372;0.032	T	0.54241	-0.8323	10	0.23891	T	0.37	.	19.6556	0.95837	0.0:1.0:0.0:0.0	.	1181;983;1219	Q5VYS8-6;Q5VYS8-4;Q5VYS8	.;.;TUT7_HUMAN	K	508;983;1181;119;1219	ENSP00000277141:E508K;ENSP00000365127:E983K;ENSP00000365128:E1181K;ENSP00000365124:E119K;ENSP00000365130:E1219K	ENSP00000277141:E508K	E	-	1	0	ZCCHC6	88113952	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.398000	0.59697	2.882000	0.98803	0.655000	0.94253	GAA		0.259	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617		Missense_Mutation
CTSL	1514	broad.mit.edu	37	9	90343677	90343677	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2350-01	TCGA-59-2350-11	g.chr9:90343677G>A	ENST00000343150.5	+	5	1464	c.574G>A	c.(574-576)Gat>Aat	p.D192N	CTSL_ENST00000340342.6_Missense_Mutation_p.D192N|CTSL_ENST00000342020.5_Missense_Mutation_p.D192N|CTSL_ENST00000495822.1_3'UTR			P07711	CATL1_HUMAN	cathepsin L	192					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)	p.D192N(1)									GTATGTTCAGGATAATGGAGG	0.483																																																1	Substitution - Missense(1)	ovary(1)	9											104.0	94.0	97.0					9																	90343677		2203	4300	6503	89533497	SO:0001583	missense	1514			X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.574G>A	9.37:g.90343677G>A	ENSP00000345344:p.Asp192Asn		89533497	Q6IAV1|Q96QJ0	Missense_Mutation	SNP	ENST00000343150.5	37	CCDS6675.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	13.53	2.264078	0.39995	.	.	ENSG00000135047	ENST00000343150;ENST00000340342;ENST00000342020	T;T;T	0.21734	1.99;1.99;1.99	4.51	1.21	0.21127	Peptidase C1A, papain C-terminal (2);	0.141383	0.64402	D	0.000008	T	0.16811	0.0404	L	0.52206	1.635	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.06006	-1.0851	10	0.59425	D	0.04	.	6.2618	0.20903	0.1766:0.0:0.6819:0.1414	.	192	P07711	CATL1_HUMAN	N	192	ENSP00000345344:D192N;ENSP00000365061:D192N;ENSP00000340470:D192N	ENSP00000365061:D192N	D	+	1	0	CTSL1	89533497	1.000000	0.71417	0.001000	0.08648	0.013000	0.08279	2.199000	0.42715	0.381000	0.24851	0.655000	0.94253	GAT		0.483	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052936.1	NM_001912		Missense_Mutation
DSE	29940	broad.mit.edu	37	6	116756869	116756873	+	Frame_Shift_Del	DEL	CTTTC	CTTTC	-			TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-59-2350-01	TCGA-59-2350-11	g.chr6:116756869_116756873delCTTTC	ENST00000331677.3	+	7	1682_1686	c.1238_1242delCTTTC	c.(1237-1242)tctttcfs	p.SF413fs	DSE_ENST00000359564.2_Frame_Shift_Del_p.SF413fs|DSE_ENST00000537543.1_Frame_Shift_Del_p.SF432fs|DSE_ENST00000452085.3_Frame_Shift_Del_p.SF413fs			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	413					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)	p.S416fs*12(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		ATCAATAGATCTTTCCTTTCCTTCA	0.424																																																1	Deletion - Frameshift(1)	ovary(1)	6																																								116863566	SO:0001589	frameshift_variant	29940			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.1238_1242delCTTTC	6.37:g.116756874_116756878delCTTTC	ENSP00000332151:p.Ser413fs		116863562	Q5R3K6	Frame_Shift_Del	DEL	ENST00000331677.3	37	CCDS5107.1	DEL	32	Broad																																																																																				0.424	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2	NM_013352		Frame_Shift_Del
TBP	6908	broad.mit.edu	37	6	170871013	170871014	+	In_Frame_Ins	INS	-	-	CAG	rs201732168|rs113202486|rs574714675|rs71010672	byFrequency	TCGA-59-2350-01	TCGA-59-2350-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-59-2350-01	TCGA-59-2350-11	g.chr6:170871013_170871014insCAG	ENST00000392092.2	+	3	468_469	c.189_190insCAG	c.(190-192)cag>CAGcag	p.64_64Q>QQ	TBP_ENST00000230354.6_In_Frame_Ins_p.64_64Q>QQ|TBP_ENST00000540980.1_In_Frame_Ins_p.44_44Q>QQ	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q63_Q64insQ(1)|p.Q63Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacaacaacagcagcagca	0.55																																																2	Insertion - In frame(1)|Substitution - coding silent(1)	prostate(1)|breast(1)	6																																								170712939	SO:0001652	inframe_insertion	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.211_213dupCAG	6.37:g.170871020_170871022dupCAG	ENSP00000375942:p.Gln95dup		170712938	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Ins	INS	ENST00000392092.2	37	CCDS5315.1	INS	2	Broad																																																																																				0.550	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194		In_Frame_Ins
