#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
LRRC47	57470	broad.mit.edu	37	1	3697886	3697886	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:3697886C>G	ENST00000378251.1	-	7	1545	c.1518G>C	c.(1516-1518)atG>atC	p.M506I	RN7SL574P_ENST00000581512.1_RNA	NM_020710.2	NP_065761.1	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	506							phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)	p.M506I(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		TGTACTTTTTCATTTCTGCCA	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											56.0	60.0	59.0					1																	3697886		2203	4300	6503	3687746	SO:0001583	missense	57470			AB033011	CCDS51.1	1p36.32	2008-02-05			ENSG00000130764	ENSG00000130764			29207	protein-coding gene	gene with protein product						10574461	Standard	NM_020710		Approved	KIAA1185, RP1-286D6.3	uc001akx.1	Q8N1G4	OTTHUMG00000003506	ENST00000378251.1:c.1518G>C	1.37:g.3697886C>G	ENSP00000367498:p.Met506Ile		3687746	Q9ULN5	Missense_Mutation	SNP	ENST00000378251.1	37	CCDS51.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	4.855	0.158847	0.09236	.	.	ENSG00000130764	ENST00000378251	T	0.38887	1.11	4.91	0.682	0.17992	B3/B4 tRNA-binding domain (1);	0.463679	0.22576	N	0.058272	T	0.22085	0.0532	N	0.08118	0	0.25321	N	0.989117	B	0.02656	0.0	B	0.01281	0.0	T	0.14699	-1.0463	10	0.34782	T	0.22	-16.0691	12.9136	0.58192	0.0:0.6452:0.2585:0.0963	.	506	Q8N1G4	LRC47_HUMAN	I	506	ENSP00000367498:M506I	ENSP00000367498:M506I	M	-	3	0	LRRC47	3687746	1.000000	0.71417	0.807000	0.32361	0.527000	0.34593	0.960000	0.29253	-0.052000	0.13311	0.591000	0.81541	ATG		0.423	LRRC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009744.1	NM_020710		Missense_Mutation
NPPB	4879	broad.mit.edu	37	1	11918364	11918364	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:11918364G>A	ENST00000376468.3	-	2	392	c.295C>T	c.(295-297)Cgg>Tgg	p.R99W		NM_002521.2	NP_002512.1	P16860	ANFB_HUMAN	natriuretic peptide B	99					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|protein complex (GO:0043234)	diuretic hormone activity (GO:0008613)|hormone activity (GO:0005179)|receptor binding (GO:0005102)	p.R99W(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	Carvedilol(DB01136)	CGTGGTGCCCGCAGGGTGTAG	0.642																																																1	Substitution - Missense(1)	ovary(1)	1											47.0	43.0	44.0					1																	11918364		2203	4300	6503	11840951	SO:0001583	missense	4879			BC025785	CCDS140.1	1p36.2	2014-01-30	2010-11-09		ENSG00000120937	ENSG00000120937		"""Endogenous ligands"""	7940	protein-coding gene	gene with protein product		600295	"""natriuretic peptide precursor B"""			2597152	Standard	NM_002521		Approved		uc001atj.3	P16860	OTTHUMG00000002389	ENST00000376468.3:c.295C>T	1.37:g.11918364G>A	ENSP00000365651:p.Arg99Trp		11840951	B0ZBE9|Q6FGY0|Q9P2Q7	Missense_Mutation	SNP	ENST00000376468.3	37	CCDS140.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883455	0.51908	.	.	ENSG00000120937	ENST00000376468	T	0.28895	1.59	4.47	-3.04	0.05412	.	.	.	.	.	T	0.27278	0.0669	M	0.85945	2.785	0.09310	N	1	P	0.42584	0.784	B	0.32805	0.153	T	0.15235	-1.0444	9	0.87932	D	0	.	3.1407	0.06455	0.0813:0.2474:0.2621:0.4093	.	99	P16860	ANFB_HUMAN	W	99	ENSP00000365651:R99W	ENSP00000365651:R99W	R	-	1	2	NPPB	11840951	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.633000	0.05483	-0.894000	0.03925	-0.219000	0.12488	CGG		0.642	NPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006854.1	NM_002521		Missense_Mutation
ATP13A2	23400	broad.mit.edu	37	1	17330855	17330855	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:17330855C>T	ENST00000326735.8	-	6	562	c.529G>A	c.(529-531)Gag>Aag	p.E177K	ATP13A2_ENST00000452699.1_Missense_Mutation_p.E172K|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000341676.5_Missense_Mutation_p.E172K			Q9NQ11	AT132_HUMAN	ATPase type 13A2	177					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.E177K(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		TGCTGGGTCTCGATCCAGATA	0.617																																																1	Substitution - Missense(1)	ovary(1)	1											74.0	61.0	65.0					1																	17330855		2203	4300	6503	17203442	SO:0001583	missense	23400			AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.529G>A	1.37:g.17330855C>T	ENSP00000327214:p.Glu177Lys		17203442	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	37	CCDS175.1	SNP	31	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.32|13.32	2.200710|2.200710	0.38905|0.38905	.|.	.|.	ENSG00000159363|ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000511957|ENST00000510069;ENST00000508222;ENST00000509619	D;D;D;T|.	0.93189|.	-2.92;-3.18;-2.93;-0.16|.	5.09|5.09	4.18|4.18	0.49190|0.49190	.|.	0.426156|.	0.27327|.	N|.	0.019867|.	T|T	0.48995|0.48995	0.1531|0.1531	L|L	0.41710|0.41710	1.295|1.295	0.37129|0.37129	D|D	0.901182|0.901182	P;D;P|.	0.60160|.	0.729;0.987;0.491|.	B;P;B|.	0.45538|.	0.034;0.484;0.034|.	T|T	0.52124|0.52124	-0.8617|-0.8617	10|5	0.11794|.	T|.	0.64|.	-25.1399|-25.1399	9.0816|9.0816	0.36556|0.36556	0.0:0.8291:0.0:0.1709|0.0:0.8291:0.0:0.1709	.|.	172;172;177|.	Q5JXY1;Q6S9Z9;Q9NQ11|.	.;.;AT132_HUMAN|.	K|Q	177;172;172;81|151;83;163	ENSP00000327214:E177K;ENSP00000341115:E172K;ENSP00000413307:E172K;ENSP00000427241:E81K|.	ENSP00000327214:E177K|.	E|R	-|-	1|2	0|0	ATP13A2|ATP13A2	17203442|17203442	0.993000|0.993000	0.37304|0.37304	0.838000|0.838000	0.33150|0.33150	0.771000|0.771000	0.43674|0.43674	3.182000|3.182000	0.50910|0.50910	1.276000|1.276000	0.44395|0.44395	0.655000|0.655000	0.94253|0.94253	GAG|CGA		0.617	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089		Missense_Mutation
COL16A1	1307	broad.mit.edu	37	1	32126233	32126233	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:32126233G>A	ENST00000373672.3	-	62	4348	c.3832C>T	c.(3832-3834)Cct>Tct	p.P1278S	RP11-73M7.6_ENST00000608246.1_RNA|RP11-73M7.6_ENST00000608332.1_RNA|COL16A1_ENST00000271069.6_Missense_Mutation_p.P1278S|RP11-73M7.6_ENST00000588288.1_RNA|RP11-73M7.6_ENST00000608888.1_RNA|RP11-73M7.6_ENST00000593188.1_RNA|RP11-73M7.6_ENST00000609625.1_RNA|RP11-73M7.6_ENST00000610216.1_RNA|RP11-73M7.6_ENST00000610043.1_RNA|RP11-73M7.6_ENST00000607926.1_RNA|RP11-73M7.6_ENST00000609373.1_RNA|RP11-73M7.6_ENST00000609338.1_RNA|RP11-73M7.6_ENST00000609033.1_RNA|RP11-73M7.6_ENST00000591929.1_RNA|RP11-73M7.6_ENST00000609549.1_RNA|RP11-73M7.6_ENST00000445166.1_RNA|RP11-73M7.6_ENST00000585660.1_RNA|RP11-73M7.6_ENST00000585413.1_RNA|RP11-73M7.6_ENST00000587445.1_RNA|RP11-73M7.6_ENST00000591592.1_RNA|RP11-73M7.6_ENST00000589462.1_RNA	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1278	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.P1278S(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		ATGGCACCAGGTTCACCCTGC	0.547																																					Colon(143;498 1786 21362 25193 36625)											1	Substitution - Missense(1)	ovary(1)	1											60.0	63.0	62.0					1																	32126233		1910	4128	6038	31898820	SO:0001583	missense	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3832C>T	1.37:g.32126233G>A	ENSP00000362776:p.Pro1278Ser		31898820	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058924	0.76074	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000440437	D;D;D	0.96011	-3.88;-3.88;-3.88	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.97288	0.9113	M	0.67700	2.07	0.49213	D	0.999766	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.96452	0.9335	10	0.38643	T	0.18	.	18.7085	0.91648	0.0:0.0:1.0:0.0	.	1278;1276	Q07092;Q07092-2	COGA1_HUMAN;.	S	1278;1278;135	ENSP00000362776:P1278S;ENSP00000271069:P1278S;ENSP00000390281:P135S	ENSP00000271069:P1278S	P	-	1	0	COL16A1	31898820	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.721000	0.91446	2.793000	0.96121	0.591000	0.81541	CCT		0.547	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856		Missense_Mutation
GRIK3	2899	broad.mit.edu	37	1	37356529	37356529	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:37356529G>C	ENST00000373091.3	-	2	300	c.284C>G	c.(283-285)aCc>aGc	p.T95S	GRIK3_ENST00000373093.4_Missense_Mutation_p.T95S	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	95					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.T95S(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				ACCCTTTTTGGTCGCCTCGAA	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											208.0	156.0	174.0					1																	37356529		2203	4300	6503	37129116	SO:0001583	missense	2899			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.284C>G	1.37:g.37356529G>C	ENSP00000362183:p.Thr95Ser		37129116	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	7.385	0.629654	0.14257	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.22945	1.93;1.93	5.83	5.83	0.93111	Extracellular ligand-binding receptor (1);	0.061178	0.64402	D	0.000002	T	0.08088	0.0202	N	0.00788	-1.185	0.43593	D	0.995946	B;B	0.06786	0.001;0.001	B;B	0.12837	0.008;0.008	T	0.26883	-1.0090	10	0.02654	T	1	.	14.9063	0.70721	0.0:0.0:0.8568:0.1432	.	95;95	A9Z1Z8;Q13003	.;GRIK3_HUMAN	S	95	ENSP00000362183:T95S;ENSP00000362185:T95S	ENSP00000362183:T95S	T	-	2	0	GRIK3	37129116	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.862000	0.87013	2.749000	0.94314	0.650000	0.86243	ACC		0.537	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831		Missense_Mutation
CCDC30	728621	broad.mit.edu	37	1	43110467	43110467	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:43110467C>T	ENST00000340612.4	+	12	1879	c.1879C>T	c.(1879-1881)Cgc>Tgc	p.R627C	CCDC30_ENST00000428554.2_Missense_Mutation_p.R627C|CCDC30_ENST00000507855.1_Missense_Mutation_p.R416C|CCDC30_ENST00000390640.4_Missense_Mutation_p.R416C|CCDC30_ENST00000342022.4_Missense_Mutation_p.R627C			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	627						extracellular vesicular exosome (GO:0070062)		p.R627C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						CATCCATATTCGCAGAGGAGA	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											112.0	97.0	102.0					1																	43110467		2203	4300	6503	42883054	SO:0001583	missense	728621			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.1879C>T	1.37:g.43110467C>T	ENSP00000340378:p.Arg627Cys		42883054	Q14F06|Q5VVM5	Missense_Mutation	SNP	ENST00000340612.4	37	CCDS30690.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	10.56	1.384182	0.25031	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	5.5	1.56	0.23342	.	0.487207	0.16489	N	0.212182	T	0.31327	0.0793	L	0.46157	1.445	0.09310	N	1	B;B	0.26147	0.022;0.143	B;B	0.20184	0.011;0.028	T	0.16808	-1.0390	10	0.39692	T	0.17	.	7.1535	0.25624	0.0:0.646:0.0:0.354	.	627;416	Q5VVM6;Q5VVM6-2	CCD30_HUMAN;.	C	627;416;627;627;416	ENSP00000397035:R627C;ENSP00000426711:R416C;ENSP00000340378:R627C;ENSP00000339280:R627C;ENSP00000375051:R416C	ENSP00000340378:R627C	R	+	1	0	CCDC30	42883054	0.005000	0.15991	0.001000	0.08648	0.880000	0.50808	0.754000	0.26390	0.387000	0.25024	-0.136000	0.14681	CGC		0.423	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019524.3	NM_025030		Missense_Mutation
GBP3	2635	broad.mit.edu	37	1	89478949	89478949	+	Nonsense_Mutation	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:89478949G>A	ENST00000370481.4	-	6	1007	c.787C>T	c.(787-789)Caa>Taa	p.Q263*	GBP3_ENST00000475853.2_5'Flank	NM_018284.2	NP_060754.2	Q8WXF7	ATLA1_HUMAN	guanylate binding protein 3	296	GB1/RHD3-type G.				axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.Q263*(1)		breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		TCTGCTACTTGTTGCACAAAT	0.438																																																1	Substitution - Nonsense(1)	ovary(1)	1											152.0	152.0	152.0					1																	89478949		2203	4300	6503	89251537	SO:0001587	stop_gained	2635			BC063819	CCDS717.2	1p22.2	2008-02-05			ENSG00000117226	ENSG00000117226			4184	protein-coding gene	gene with protein product		600413				7518790	Standard	NM_018284		Approved	FLJ10961	uc001dmt.3	Q9H0R5	OTTHUMG00000010616	ENST00000370481.4:c.787C>T	1.37:g.89478949G>A	ENSP00000359512:p.Gln263*		89251537	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Nonsense_Mutation	SNP	ENST00000370481.4	37	CCDS717.2	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	31	5.078484	0.94000	.	.	ENSG00000117226	ENST00000370482;ENST00000370481;ENST00000445969;ENST00000235878	.	.	.	3.85	3.85	0.44370	.	0.062155	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	8.9878	0.36005	0.0:0.0:0.7791:0.2209	.	.	.	.	X	231;263;12;263	.	ENSP00000235878:Q263X	Q	-	1	0	GBP3	89251537	1.000000	0.71417	0.768000	0.31515	0.153000	0.21895	3.649000	0.54417	2.154000	0.67381	0.514000	0.50259	CAA		0.438	GBP3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313541.3	NM_018284		Nonsense_Mutation
LRRC8B	23507	broad.mit.edu	37	1	90048317	90048317	+	Silent	SNP	G	G	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:90048317G>T	ENST00000330947.2	+	5	468	c.108G>T	c.(106-108)ctG>ctT	p.L36L	RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000439853.1_Silent_p.L36L|LRRC8B_ENST00000358200.4_Silent_p.L36L	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	36					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L36L(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TGATCATGCTGCTGGTGGCCG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	1											144.0	128.0	134.0					1																	90048317		2203	4300	6503	89820905	SO:0001819	synonymous_variant	23507			AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.108G>T	1.37:g.90048317G>T			89820905	D3DT28|Q6UY21|Q8N106|Q92627	Silent	SNP	ENST00000330947.2	37	CCDS724.1	SNP	46	Broad																																																																																				0.502	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028008.1	NM_015350		Silent
SCAMP3	10067	broad.mit.edu	37	1	155231519	155231519	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:155231519C>G	ENST00000302631.3	-	2	180	c.73G>C	c.(73-75)Gct>Cct	p.A25P	SCAMP3_ENST00000472397.1_5'Flank|CLK2_ENST00000497188.1_5'Flank|SCAMP3_ENST00000355379.3_Intron	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	25					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)	p.A25P(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGGATCACAGCTGGGTCCTGA	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											77.0	75.0	76.0					1																	155231519		2203	4300	6503	153498143	SO:0001583	missense	10067			AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.73G>C	1.37:g.155231519C>G	ENSP00000307275:p.Ala25Pro		153498143	A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Missense_Mutation	SNP	ENST00000302631.3	37	CCDS1105.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	.	33	5.217009	0.95104	.	.	ENSG00000116521	ENST00000302631	T	0.18174	2.23	5.33	5.33	0.75918	.	0.066613	0.64402	D	0.000015	T	0.18964	0.0455	L	0.38175	1.15	0.80722	D	1	D;D	0.63880	0.978;0.993	P;P	0.58721	0.836;0.844	T	0.00342	-1.1803	10	0.72032	D	0.01	-7.5742	14.4067	0.67088	0.0:1.0:0.0:0.0	.	25;25	Q6FHJ5;O14828	.;SCAM3_HUMAN	P	25	ENSP00000307275:A25P	ENSP00000307275:A25P	A	-	1	0	SCAMP3	153498143	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.448000	0.44926	2.771000	0.95319	0.563000	0.77884	GCT		0.597	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087399.1	NM_005698		Missense_Mutation
C1orf116	79098	broad.mit.edu	37	1	207196403	207196403	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:207196403A>G	ENST00000359470.5	-	4	955	c.706T>C	c.(706-708)Tcc>Ccc	p.S236P	C1orf116_ENST00000461135.2_5'UTR	NM_023938.5	NP_076427.2	Q9BW04	SARG_HUMAN	chromosome 1 open reading frame 116	236						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.S236P(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(4)|stomach(1)	29	Prostate(682;0.19)					CTTTCCTGGGAGCTGGATGGT	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											182.0	183.0	183.0					1																	207196403		2203	4300	6503	205263026	SO:0001583	missense	79098				CCDS1475.1, CCDS44306.1	1q32.1	2012-06-26			ENSG00000182795	ENSG00000182795			28667	protein-coding gene	gene with protein product	"""specifically androgen-regulated gene"""	611680				15525603, 9389513	Standard	NM_023938		Approved	SARG, FLJ36507, MGC2742, MGC4309	uc001hfd.2	Q9BW04	OTTHUMG00000036580	ENST00000359470.5:c.706T>C	1.37:g.207196403A>G	ENSP00000352447:p.Ser236Pro		205263026	C9JV41|Q658X3	Missense_Mutation	SNP	ENST00000359470.5	37	CCDS1475.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	8.930	0.963133	0.18583	.	.	ENSG00000182795	ENST00000359470	T	0.08984	3.03	5.03	-6.82	0.01698	.	1.195680	0.06276	N	0.696552	T	0.04048	0.0113	N	0.19112	0.55	0.09310	N	0.999994	B	0.02656	0.0	B	0.04013	0.001	T	0.43097	-0.9412	10	0.30854	T	0.27	2.6199	3.0472	0.06158	0.4839:0.1058:0.2938:0.1166	.	236	Q9BW04	SARG_HUMAN	P	236	ENSP00000352447:S236P	ENSP00000352447:S236P	S	-	1	0	C1orf116	205263026	0.001000	0.12720	0.001000	0.08648	0.013000	0.08279	-0.444000	0.06854	-0.988000	0.03489	-0.912000	0.02778	TCC		0.602	C1orf116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088973.1	NM_024115		Missense_Mutation
CHML	1122	broad.mit.edu	37	1	241798044	241798044	+	Nonsense_Mutation	SNP	G	G	T	rs374726700		TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:241798044G>T	ENST00000366553.1	-	1	1188	c.1025C>A	c.(1024-1026)tCa>tAa	p.S342*	OPN3_ENST00000366554.2_Intron|OPN3_ENST00000469376.1_Intron|OPN3_ENST00000331838.5_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	342					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)	p.S342*(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			CATTGCAATTGAGTGCAGTAC	0.388																																																1	Substitution - Nonsense(1)	ovary(1)	1											138.0	138.0	138.0					1																	241798044		2203	4299	6502	239864667	SO:0001587	stop_gained	1122			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.1025C>A	1.37:g.241798044G>T	ENSP00000355511:p.Ser342*		239864667	B2RAB9|Q17RE0|Q9H1Y4	Nonsense_Mutation	SNP	ENST00000366553.1	37	CCDS31073.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	38	6.971382	0.97971	.	.	ENSG00000203668	ENST00000366553	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-8.5334	16.126	0.81395	0.0:0.0:1.0:0.0	.	.	.	.	X	342	.	ENSP00000355511:S342X	S	-	2	0	CHML	239864667	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.467000	0.90390	2.752000	0.94435	0.655000	0.94253	TCA		0.388	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095712.1	NM_001821		Nonsense_Mutation
OR2M5	127059	broad.mit.edu	37	1	248308552	248308552	+	Missense_Mutation	SNP	T	T	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr1:248308552T>A	ENST00000366476.1	+	1	103	c.103T>A	c.(103-105)Ttt>Att	p.F35I		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	35						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F35I(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			CCTGGCCATCTTTTCAGTGGC	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											239.0	237.0	237.0					1																	248308552		2203	4296	6499	246375175	SO:0001583	missense	127059				CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.103T>A	1.37:g.248308552T>A	ENSP00000355432:p.Phe35Ile		246375175		Missense_Mutation	SNP	ENST00000366476.1	37	CCDS31105.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	t	10.68	1.419420	0.25552	.	.	ENSG00000162727	ENST00000366476	T	0.00583	6.41	3.28	3.28	0.37604	.	0.250947	0.20653	U	0.088177	T	0.01661	0.0053	M	0.90198	3.095	0.09310	N	1	P	0.48764	0.915	P	0.45577	0.486	T	0.24799	-1.0150	10	0.87932	D	0	.	11.5465	0.50696	0.0:0.0:0.0:1.0	.	35	A3KFT3	OR2M5_HUMAN	I	35	ENSP00000355432:F35I	ENSP00000355432:F35I	F	+	1	0	OR2M5	246375175	0.022000	0.18835	0.140000	0.22221	0.115000	0.19883	2.033000	0.41136	1.250000	0.43966	0.403000	0.27427	TTT		0.522	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		Missense_Mutation
SFMBT2	57713	broad.mit.edu	37	10	7412274	7412274	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr10:7412274G>A	ENST00000361972.4	-	3	254	c.164C>T	c.(163-165)gCa>gTa	p.A55V	SFMBT2_ENST00000379713.3_Missense_Mutation_p.A55V|SFMBT2_ENST00000379711.2_Missense_Mutation_p.A55V|SFMBT2_ENST00000397167.1_Missense_Mutation_p.A55V|SFMBT2_ENST00000397160.3_Missense_Mutation_p.A55V	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	55					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.A55V(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						AGCAGCACTTGCTCCTGTCTC	0.433																																																1	Substitution - Missense(1)	ovary(1)	10											138.0	127.0	131.0					10																	7412274		2203	4300	6503	7452280	SO:0001583	missense	57713			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.164C>T	10.37:g.7412274G>A	ENSP00000355109:p.Ala55Val		7452280	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	37	CCDS31138.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	11.12	1.546303	0.27652	.	.	ENSG00000198879	ENST00000361972;ENST00000397167;ENST00000379713;ENST00000379711;ENST00000397160	T;T;T;T;T	0.37235	2.32;2.32;1.68;1.21;1.21	5.54	5.54	0.83059	.	0.177037	0.48767	D	0.000161	T	0.42832	0.1220	M	0.67397	2.05	0.34946	D	0.750785	P;B	0.35226	0.491;0.27	B;B	0.37047	0.24;0.101	T	0.52510	-0.8566	10	0.30078	T	0.28	.	19.4925	0.95056	0.0:0.0:1.0:0.0	.	55;55	Q5T981;Q5VUG0	.;SMBT2_HUMAN	V	55	ENSP00000355109:A55V;ENSP00000380353:A55V;ENSP00000369035:A55V;ENSP00000369033:A55V;ENSP00000380346:A55V	ENSP00000355109:A55V	A	-	2	0	SFMBT2	7452280	1.000000	0.71417	0.243000	0.24186	0.020000	0.10135	8.934000	0.92915	2.599000	0.87857	0.655000	0.94253	GCA		0.433	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880		Missense_Mutation
ZEB1	6935	broad.mit.edu	37	10	31809186	31809186	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr10:31809186C>T	ENST00000320985.10	+	7	1033	c.923C>T	c.(922-924)aCa>aTa	p.T308I	ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000361642.5_Missense_Mutation_p.T309I|ZEB1_ENST00000446923.2_Missense_Mutation_p.T292I|ZEB1_ENST00000560721.2_Missense_Mutation_p.T288I|ZEB1_ENST00000542815.3_Missense_Mutation_p.T241I			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	308					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.T308I(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				GGACTCAAGACATCTCAGTGT	0.453																																					Ovarian(40;423 959 14296 36701 49589)											1	Substitution - Missense(1)	ovary(1)	10											131.0	127.0	128.0					10																	31809186		2203	4300	6503	31849192	SO:0001583	missense	6935			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.923C>T	10.37:g.31809186C>T	ENSP00000319248:p.Thr308Ile		31849192	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	CCDS7169.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303926	0.40795	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000543514;ENST00000446923	T;T;T;T;T	0.14516	2.82;2.5;2.56;2.5;2.55	5.62	5.62	0.85841	.	0.091101	0.47852	D	0.000209	T	0.15739	0.0379	L	0.46157	1.445	0.41295	D	0.987002	P;B;B;P;B;B;P;P	0.39737	0.685;0.161;0.112;0.558;0.265;0.032;0.558;0.558	B;B;B;B;B;B;B;B	0.39876	0.312;0.107;0.08;0.232;0.068;0.041;0.232;0.232	T	0.00934	-1.1509	10	0.56958	D	0.05	-14.4569	13.3648	0.60678	0.0:0.9185:0.0:0.0815	.	241;308;292;308;308;288;309;308	F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275	.;.;.;.;.;.;.;ZEB1_HUMAN	I	90;308;309;308;241;308;288;167;199;292	ENSP00000444282:T90I;ENSP00000354487:T309I;ENSP00000444891:T241I;ENSP00000319248:T308I;ENSP00000391612:T292I	ENSP00000319248:T308I	T	+	2	0	ZEB1	31849192	0.991000	0.36638	0.968000	0.41197	0.989000	0.77384	2.947000	0.49058	2.645000	0.89757	0.655000	0.94253	ACA		0.453	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751		Missense_Mutation
A1CF	29974	broad.mit.edu	37	10	52587996	52587996	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr10:52587996C>G	ENST00000373993.1	-	5	708	c.664G>C	c.(664-666)Gtt>Ctt	p.V222L	A1CF_ENST00000282641.2_Missense_Mutation_p.V222L|A1CF_ENST00000493415.1_5'UTR|A1CF_ENST00000395495.1_Intron|A1CF_ENST00000395489.2_Missense_Mutation_p.V215L|A1CF_ENST00000373997.3_Missense_Mutation_p.V222L|A1CF_ENST00000373995.3_Missense_Mutation_p.V230L|A1CF_ENST00000374001.2_Missense_Mutation_p.V222L			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	222					cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						TCTTCATCAACTTCTACTTCT	0.348																																																0			10											152.0	147.0	149.0					10																	52587996		2203	4299	6502	52258002	SO:0001583	missense	29974			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.664G>C	10.37:g.52587996C>G	ENSP00000363105:p.Val222Leu		52258002	A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	ENST00000373993.1	37	CCDS7242.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909319	0.72868	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395488;ENST00000395489	T;T;T;T;T;T	0.11930	2.73;2.73;2.73;2.74;2.73;2.74	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.34106	0.0886	L	0.60012	1.86	0.80722	D	1	B;B;P;B	0.47106	0.007;0.046;0.89;0.017	B;B;D;B	0.66847	0.052;0.128;0.947;0.032	T	0.00419	-1.1751	10	0.38643	T	0.18	.	16.8465	0.85982	0.0:1.0:0.0:0.0	.	215;222;222;230	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	L	222;222;222;230;222;205;215	ENSP00000363113:V222L;ENSP00000363105:V222L;ENSP00000363109:V222L;ENSP00000363107:V230L;ENSP00000282641:V222L;ENSP00000378868:V215L	ENSP00000282641:V222L	V	-	1	0	A1CF	52258002	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.567000	0.86603	0.563000	0.77884	GTT		0.348	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048086.2	NM_014576		Missense_Mutation
PCDH15	65217	broad.mit.edu	37	10	55568462	55568462	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr10:55568462G>C	ENST00000395445.1	-	36	5742	c.5348C>G	c.(5347-5349)aCa>aGa	p.T1783R	PCDH15_ENST00000409834.1_3'UTR|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395442.1_Missense_Mutation_p.T648R|PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000395440.1_Missense_Mutation_p.T717R|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395446.1_Missense_Mutation_p.T979R	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TCAAAGTGCTGTGTTGTAACC	0.483										HNSCC(58;0.16)																																						0			10											58.0	50.0	52.0					10																	55568462		1568	3582	5150	55238468	SO:0001583	missense	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.5348C>G	10.37:g.55568462G>C	ENSP00000378832:p.Thr1783Arg		55238468	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000395445.1	37		SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.60	2.582422	0.46006	.	.	ENSG00000150275	ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440	T;T;T;T	0.62498	0.02;0.1;0.38;0.27	5.16	5.16	0.70880	.	.	.	.	.	T	0.47783	0.1464	N	0.14661	0.345	0.80722	D	1	P;P	0.43024	0.798;0.798	B;B	0.42062	0.374;0.374	T	0.56123	-0.8031	9	0.87932	D	0	.	12.5247	0.56079	0.0:0.0:0.833:0.167	.	1781;1783	C6ZEF5;A2A3E2	.;.	R	1783;979;648;717	ENSP00000378832:T1783R;ENSP00000378833:T979R;ENSP00000378829:T648R;ENSP00000378827:T717R	ENSP00000378827:T717R	T	-	2	0	PCDH15	55238468	1.000000	0.71417	0.997000	0.53966	0.943000	0.58893	4.267000	0.58877	2.411000	0.81874	0.563000	0.77884	ACA		0.483	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000291335.1	NM_033056		Missense_Mutation
CCDC6	8030	broad.mit.edu	37	10	61574420	61574420	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr10:61574420C>A	ENST00000263102.6	-	4	907	c.676G>T	c.(676-678)Gct>Tct	p.A226S		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	226	5 X 29 AA tandem repeats.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)	p.A226S(1)	CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		CGCTTTTCAGCTTCAAGCTTA	0.443			T	RET	NSCLC																																		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	1	Substitution - Missense(1)	ovary(1)	10											360.0	245.0	284.0					10																	61574420		2203	4299	6502	61244426	SO:0001583	missense	8030			S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.676G>T	10.37:g.61574420C>A	ENSP00000263102:p.Ala226Ser		61244426	Q15250|Q6GSG7	Missense_Mutation	SNP	ENST00000263102.6	37	CCDS7257.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	24.6	4.545911	0.86022	.	.	ENSG00000108091	ENST00000263102	T	0.80738	-1.41	5.83	5.83	0.93111	.	0.093423	0.64402	D	0.000001	T	0.79522	0.4460	L	0.34521	1.04	0.80722	D	1	P	0.36909	0.573	P	0.44772	0.46	T	0.74737	-0.3564	10	0.26408	T	0.33	-9.7787	20.1152	0.97926	0.0:1.0:0.0:0.0	.	226	Q16204	CCDC6_HUMAN	S	226	ENSP00000263102:A226S	ENSP00000263102:A226S	A	-	1	0	CCDC6	61244426	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.463000	0.80869	2.750000	0.94351	0.655000	0.94253	GCT		0.443	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436		Missense_Mutation
PLAC9	219348	broad.mit.edu	37	10	81904018	81904018	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr10:81904018A>G	ENST00000372263.3	+	3	244	c.202A>G	c.(202-204)Aaa>Gaa	p.K68E	PLAC9_ENST00000372270.2_Missense_Mutation_p.K26E|PLAC9_ENST00000372267.2_Intron	NM_001012973.1	NP_001012991.1	Q5JTB6	PLAC9_HUMAN	placenta-specific 9	68						extracellular region (GO:0005576)		p.K68E(1)		kidney(1)|ovary(1)	2	Prostate(51;0.0095)|all_epithelial(25;0.175)		Colorectal(32;0.109)			GACAGAGGTGAAAGGCCTGCT	0.622											OREG0020321	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	10											79.0	70.0	73.0					10																	81904018		2203	4300	6503	81893998	SO:0001583	missense	219348				CCDS31232.1	10q23.2	2008-02-04			ENSG00000189129	ENSG00000189129			19255	protein-coding gene	gene with protein product		612857					Standard	NM_001012973		Approved		uc001kbp.1	Q5JTB6	OTTHUMG00000018596	ENST00000372263.3:c.202A>G	10.37:g.81904018A>G	ENSP00000361337:p.Lys68Glu	1209	81893998		Missense_Mutation	SNP	ENST00000372263.3	37	CCDS31232.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	12.03	1.816257	0.32145	.	.	ENSG00000189129	ENST00000372270;ENST00000372263	.	.	.	3.78	2.58	0.30949	.	0.369201	0.20052	N	0.100264	T	0.27098	0.0664	.	.	.	0.09310	N	1	P	0.44139	0.827	B	0.40982	0.345	T	0.08411	-1.0723	8	0.45353	T	0.12	.	7.01	0.24857	0.766:0.234:0.0:0.0	.	68	Q5JTB6	PLAC9_HUMAN	E	26;68	.	ENSP00000361337:K68E	K	+	1	0	PLAC9	81893998	1.000000	0.71417	0.082000	0.20525	0.073000	0.16967	3.672000	0.54583	0.591000	0.29711	0.381000	0.24937	AAA		0.622	PLAC9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049019.1	NM_001012973		Missense_Mutation
PKD2L1	9033	broad.mit.edu	37	10	102051059	102051059	+	Splice_Site	SNP	C	C	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr10:102051059C>G	ENST00000318222.3	-	12	2388	c.2006G>C	c.(2005-2007)aGg>aCg	p.R669T	PKD2L1_ENST00000338519.3_Splice_Site_p.R594T|PKD2L1_ENST00000353274.3_Splice_Site_p.R669T	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	669					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)	p.R669T(1)		NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		CCAGCTCACCCTCTCTTCCTC	0.517																																																1	Substitution - Missense(1)	ovary(1)	10											245.0	200.0	216.0					10																	102051059		2203	4300	6503	102041049	SO:0001630	splice_region_variant	9033			AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.2007+1G>C	10.37:g.102051059C>G			102041049	O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	ENST00000318222.3	37	CCDS7492.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051354	0.36181	.	.	ENSG00000107593	ENST00000338519;ENST00000353274;ENST00000318222;ENST00000339977	T;T;T	0.76709	-1.04;-1.04;-1.04	5.73	2.86	0.33363	.	0.130848	0.64402	D	0.000002	T	0.77665	0.4164	L	0.58428	1.81	0.36580	D	0.873497	P;B	0.52577	0.954;0.075	P;B	0.50136	0.632;0.066	T	0.80195	-0.1483	10	0.45353	T	0.12	-13.0524	10.6726	0.45768	0.0:0.7892:0.0:0.2108	.	622;669	Q1L4F0;Q9P0L9	.;PK2L1_HUMAN	T	594;669;669;667	ENSP00000345068:R594T;ENSP00000266049:R669T;ENSP00000325296:R669T	ENSP00000325296:R669T	R	-	2	0	PKD2L1	102041049	1.000000	0.71417	0.992000	0.48379	0.046000	0.14306	1.704000	0.37857	0.787000	0.33731	-0.150000	0.13652	AGG		0.517	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	NM_016112	Missense_Mutation	Missense_Mutation
ADD3	120	broad.mit.edu	37	10	111879033	111879033	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr10:111879033C>T	ENST00000356080.4	+	7	1149	c.782C>T	c.(781-783)gCc>gTc	p.A261V	ADD3_ENST00000360162.3_Missense_Mutation_p.A261V|ADD3_ENST00000277900.8_Missense_Mutation_p.A261V	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	261						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.A261V(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		GGAGATGTTGCCTATTATGAC	0.423																																																1	Substitution - Missense(1)	ovary(1)	10											87.0	83.0	84.0					10																	111879033		2203	4300	6503	111869023	SO:0001583	missense	120			U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.782C>T	10.37:g.111879033C>T	ENSP00000348381:p.Ala261Val		111869023	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	ENST00000356080.4	37	CCDS7561.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617572	0.87359	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.23754	1.89;1.89;1.89	6.17	6.17	0.99709	Class II aldolase/adducin, N-terminal (3);	0.185816	0.56097	D	0.000023	T	0.53045	0.1772	M	0.80982	2.52	0.50467	D	0.999879	D;P	0.71674	0.998;0.889	D;P	0.76575	0.988;0.749	T	0.53450	-0.8437	10	0.62326	D	0.03	-7.7017	13.9957	0.64397	0.0:0.9315:0.0:0.0685	.	261;261	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	V	261	ENSP00000353286:A261V;ENSP00000348381:A261V;ENSP00000277900:A261V	ENSP00000277900:A261V	A	+	2	0	ADD3	111869023	0.998000	0.40836	0.990000	0.47175	0.976000	0.68499	2.599000	0.46231	2.941000	0.99782	0.655000	0.94253	GCC		0.423	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903		Missense_Mutation
CDHR5	53841	broad.mit.edu	37	11	621393	621393	+	Silent	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr11:621393G>A	ENST00000358353.3	-	7	892	c.570C>T	c.(568-570)ccC>ccT	p.P190P	CDHR5_ENST00000529337.1_5'Flank|CDHR5_ENST00000349570.7_Silent_p.P190P|CDHR5_ENST00000397542.2_Silent_p.P190P			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	190	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043, ECO:0000305}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)	p.P190P(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						AGAAGTCCAGGGGCCGGTCCA	0.662																																																1	Substitution - coding silent(1)	ovary(1)	11											43.0	48.0	46.0					11																	621393		2203	4300	6503	611393	SO:0001819	synonymous_variant	53841			AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.570C>T	11.37:g.621393G>A			611393	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Silent	SNP	ENST00000358353.3	37	CCDS7707.1	SNP	43	Broad																																																																																				0.662	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924		Silent
OR52A4	390053	broad.mit.edu	37	11	5141963	5141963	+	RNA	SNP	G	G	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr11:5141963G>C	ENST00000498233.1	-	0	1014							A6NMU1	O52A4_HUMAN	olfactory receptor, family 52, subfamily A, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V282V(1)		breast(1)|endometrium(2)|kidney(1)|lung(12)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		GTAAAGACTGGACAAGGTGAT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	11											104.0	106.0	105.0					11																	5141963		2201	4298	6499	5098539			390053					11p15.4	2012-10-03	2012-10-03	2012-10-03	ENSG00000205494	ENSG00000205494		"""GPCR / Class A : Olfactory receptors"""	19579	pseudogene	pseudogene							Standard	NG_029079		Approved			A6NMU1	OTTHUMG00000066610		11.37:g.5141963G>C			5098539		Silent	SNP	ENST00000498233.1	37		SNP	41	Broad																																																																																				0.348	OR52A4-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000268565.1	NG_029079		Silent
RBM7	10179	broad.mit.edu	37	11	114273569	114273569	+	Silent	SNP	A	A	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr11:114273569A>G	ENST00000540163.1	+	3	921	c.279A>G	c.(277-279)caA>caG	p.Q93Q	RBM7_ENST00000545678.1_Intron|RP11-212D19.4_ENST00000544347.1_Missense_Mutation_p.K90R|RBM7_ENST00000375490.5_Silent_p.Q93Q|RBM7_ENST00000544582.1_Silent_p.Q93Q|RBM7_ENST00000541475.1_Silent_p.Q93Q|C11orf71_ENST00000325636.4_5'Flank			Q9Y580	RBM7_HUMAN	RNA binding motif protein 7	93					meiotic nuclear division (GO:0007126)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q93Q(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.56e-06)|Epithelial(105;4.17e-05)|all cancers(92;0.000348)		ATGCCCCACAAGATGTCAGTT	0.343																																																1	Substitution - coding silent(1)	ovary(1)	11											153.0	140.0	144.0					11																	114273569		2201	4296	6497	113778779	SO:0001819	synonymous_variant	10179			AF156098	CCDS8370.1, CCDS66233.1, CCDS73395.1	11q23.1-q23.2	2013-02-12			ENSG00000076053	ENSG00000076053		"""RNA binding motif (RRM) containing"""	9904	protein-coding gene	gene with protein product		612413				12477932	Standard	NM_001286045		Approved		uc001pov.3	Q9Y580		ENST00000540163.1:c.279A>G	11.37:g.114273569A>G			113778779	B2R6K8|Q9NUT4	Silent	SNP	ENST00000540163.1	37	CCDS8370.1	SNP	3	Broad																																																																																				0.343	RBM7-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399010.1	NM_016090		Silent
CDON	50937	broad.mit.edu	37	11	125875870	125875870	+	Silent	SNP	A	A	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr11:125875870A>C	ENST00000392693.3	-	9	1762	c.1635T>G	c.(1633-1635)ggT>ggG	p.G545G	CDON_ENST00000263577.7_Silent_p.G545G|CDON_ENST00000531738.1_5'Flank	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	545					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G545G(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		CAGTTTCTGAACCATCTCTCT	0.478																																																1	Substitution - coding silent(1)	ovary(1)	11											93.0	80.0	84.0					11																	125875870		2201	4299	6500	125381080	SO:0001819	synonymous_variant	50937			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.1635T>G	11.37:g.125875870A>C			125381080	O14631	Silent	SNP	ENST00000392693.3	37	CCDS58192.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	6.416	0.444789	0.12164	.	.	ENSG00000064309	ENST00000534661	.	.	.	6.03	-2.22	0.06952	.	.	.	.	.	T	0.30916	0.0780	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35351	-0.9792	4	.	.	.	-0.9926	8.075	0.30712	0.3936:0.1312:0.4751:0.0	.	.	.	.	V	521	.	.	F	-	1	0	CDON	125381080	0.000000	0.05858	0.000000	0.03702	0.200000	0.23975	0.573000	0.23699	-0.291000	0.09012	-0.290000	0.09829	TTC		0.478	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952		Silent
LMNTD1	160492	broad.mit.edu	37	12	25672891	25672891	+	Missense_Mutation	SNP	C	C	G	rs540094880		TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr12:25672891C>G	ENST00000282881.6	-	6	1003	c.854G>C	c.(853-855)tGg>tCg	p.W285S	IFLTD1_ENST00000458174.2_Missense_Mutation_p.W306S|IFLTD1_ENST00000445693.1_Missense_Mutation_p.W222S|IFLTD1_ENST00000413632.2_Missense_Mutation_p.W266S|IFLTD1_ENST00000539744.1_Missense_Mutation_p.W188S	NM_152590.3	NP_689803.2	Q8N9Z9	LMTD1_HUMAN		285					cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)	structural molecule activity (GO:0005198)	p.W285L(1)|p.W285S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22	all_lung(3;2.75e-22)|Lung NSC(3;1.77e-21)|all_hematologic(7;0.00656)|Colorectal(261;0.0847)					AGATGCTGTCCACTGAAACAC	0.388																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	12											200.0	177.0	185.0					12																	25672891		2203	4300	6503	25564158	SO:0001583	missense	160492																														ENST00000282881.6:c.854G>C	12.37:g.25672891C>G	ENSP00000282881:p.Trp285Ser		25564158	B4DL27|B4DY70|Q8IY38	Missense_Mutation	SNP	ENST00000282881.6	37	CCDS8704.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298314	0.40694	.	.	ENSG00000152936	ENST00000282881;ENST00000539744;ENST00000458174;ENST00000445693;ENST00000413632;ENST00000539523;ENST00000545543	T;T;T;T;T;T;T	0.26373	2.74;2.79;2.73;2.76;2.45;1.74;2.54	5.05	4.09	0.47781	.	.	.	.	.	T	0.27663	0.0680	L	0.29908	0.895	0.24216	N	0.995455	P;P;P;P	0.51933	0.949;0.949;0.949;0.915	P;P;P;P	0.56343	0.57;0.738;0.796;0.63	T	0.06991	-1.0796	9	0.20046	T	0.44	-16.4466	7.5685	0.27894	0.0:0.8834:0.0:0.1166	.	222;306;266;285	Q8N9Z9-3;Q8N9Z9-5;Q8N9Z9-4;Q8N9Z9	.;.;.;ILFT1_HUMAN	S	285;188;306;222;266;2;115	ENSP00000282881:W285S;ENSP00000443132:W188S;ENSP00000407353:W306S;ENSP00000407043:W222S;ENSP00000393150:W266S;ENSP00000438160:W2S;ENSP00000443596:W115S	ENSP00000282881:W285S	W	-	2	0	IFLTD1	25564158	0.000000	0.05858	0.725000	0.30721	0.015000	0.08874	0.369000	0.20416	2.641000	0.89580	0.585000	0.79938	TGG		0.388	IFLTD1-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402279.1			Missense_Mutation
LRRK2	120892	broad.mit.edu	37	12	40704252	40704252	+	Missense_Mutation	SNP	C	C	T	rs74681492	byFrequency	TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr12:40704252C>T	ENST00000298910.7	+	31	4395	c.4337C>T	c.(4336-4338)cCt>cTt	p.P1446L		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1446	Roc. {ECO:0000255|PROSITE- ProRule:PRU00758}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.P1446L(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TCTTCTTCCCCTGTGATTCTC	0.473													C|||	5	0.000998403	0.0	0.0	5008	,	,		19032	0.005		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(2)	12											107.0	101.0	103.0					12																	40704252		2203	4300	6503	38990519	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.4337C>T	12.37:g.40704252C>T	ENSP00000298910:p.Pro1446Leu		38990519	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	SNP	24	Broad	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	C	24.8	4.576007	0.86645	.	.	ENSG00000188906	ENST00000298910	T	0.77229	-1.08	5.63	5.63	0.86233	ROC GTPase (1);Small GTP-binding protein domain (1);Mitochondrial Rho-like (1);	0.000000	0.85682	D	0.000000	D	0.85234	0.5650	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87342	0.2332	10	0.72032	D	0.01	.	19.6788	0.95950	0.0:1.0:0.0:0.0	.	1446;1446	Q17RV3;Q5S007	.;LRRK2_HUMAN	L	1446	ENSP00000298910:P1446L	ENSP00000298910:P1446L	P	+	2	0	LRRK2	38990519	1.000000	0.71417	0.986000	0.45419	0.792000	0.44763	7.052000	0.76634	2.653000	0.90120	0.650000	0.86243	CCT		0.473	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513		Missense_Mutation
PTPRR	5801	broad.mit.edu	37	12	71029645	71029645	+	IGR	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr12:71029645C>T	ENST00000283228.2	-	0	3529				PTPRB_ENST00000550358.1_Missense_Mutation_p.R86H|PTPRB_ENST00000334414.6_Missense_Mutation_p.R86H|PTPRB_ENST00000551525.1_Missense_Mutation_p.R85H|PTPRR_ENST00000537619.2_5'Flank|PTPRB_ENST00000538174.2_5'UTR	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R						ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R86H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		CTGGGAACAGCGGTCCAAGAT	0.542																																																1	Substitution - Missense(1)	ovary(1)	12											56.0	56.0	56.0					12																	71029645		1978	4148	6126	69315912	SO:0001628	intergenic_variant	5787			D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502		12.37:g.71029645C>T			69315912	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	ENST00000283228.2	37	CCDS8998.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	7.054	0.565022	0.13498	.	.	ENSG00000127329	ENST00000334414;ENST00000550358;ENST00000544694;ENST00000551525	T;T;T	0.27256	1.68;1.68;1.68	6.04	-12.1	0.00011	.	.	.	.	.	T	0.09555	0.0235	N	0.08118	0	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.36890	-0.9729	9	0.34782	T	0.22	.	9.1718	0.37086	0.1342:0.1217:0.5786:0.1655	.	86;85;86;86	Q6ZTX7;F8VSD5;P23467-3;F8VU56	.;.;.;.	H	86;86;86;85	ENSP00000334928:R86H;ENSP00000448058:R86H;ENSP00000448349:R85H	ENSP00000334928:R86H	R	-	2	0	PTPRB	69315912	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.291000	0.02775	-3.698000	0.00119	-0.217000	0.12591	CGC		0.542	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1	NM_002849		Missense_Mutation
LIN7A	8825	broad.mit.edu	37	12	81205398	81205398	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr12:81205398T>C	ENST00000552864.1	-	5	750	c.548A>G	c.(547-549)aAg>aGg	p.K183R		NM_004664.2	NP_004655.1	O14910	LIN7A_HUMAN	lin-7 homolog A (C. elegans)	183	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				exocytosis (GO:0006887)|inner ear development (GO:0048839)|neurotransmitter secretion (GO:0007269)|protein complex assembly (GO:0006461)|protein transport (GO:0015031)|synaptic vesicle transport (GO:0048489)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	L27 domain binding (GO:0097016)	p.K183R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(2)	15						CACCACCAGCTTGACGCTGTC	0.483																																																1	Substitution - Missense(1)	ovary(1)	12											133.0	115.0	121.0					12																	81205398		2203	4300	6503	79729529	SO:0001583	missense	8825			AF028826	CCDS9021.1	12q21.31	2014-09-04			ENSG00000111052	ENSG00000111052			17787	protein-coding gene	gene with protein product	"""mammalian LIN-7 1"""	603380				10341223, 17237226	Standard	NM_004664		Approved	MALS-1, TIP-33, LIN-7A, VELI1	uc001szj.1	O14910	OTTHUMG00000170168	ENST00000552864.1:c.548A>G	12.37:g.81205398T>C	ENSP00000447488:p.Lys183Arg		79729529	A4FTY3|Q147W1|Q6LES3|Q7LDS4	Missense_Mutation	SNP	ENST00000552864.1	37	CCDS9021.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	18.61	3.660901	0.67700	.	.	ENSG00000111052	ENST00000552864	T	0.27720	1.65	5.13	5.13	0.70059	PDZ/DHR/GLGF (4);	0.090328	0.85682	D	0.000000	T	0.21347	0.0514	N	0.11698	0.16	0.80722	D	1	B	0.20052	0.041	B	0.25405	0.06	T	0.05178	-1.0901	10	0.52906	T	0.07	-14.2348	14.9425	0.71006	0.0:0.0:0.0:1.0	.	183	O14910	LIN7A_HUMAN	R	183	ENSP00000447488:K183R	ENSP00000447488:K183R	K	-	2	0	LIN7A	79729529	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.040000	0.89188	1.942000	0.56320	0.482000	0.46254	AAG		0.483	LIN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407760.1			Missense_Mutation
TMEM132B	114795	broad.mit.edu	37	12	126138808	126138808	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr12:126138808G>C	ENST00000299308.3	+	9	2797	c.2789G>C	c.(2788-2790)aGg>aCg	p.R930T	TMEM132B_ENST00000535886.1_Missense_Mutation_p.R442T	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	930						integral component of membrane (GO:0016021)		p.R930M(1)|p.R930T(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AGACACAAAAGGTTTGCTGTG	0.502																																																2	Substitution - Missense(2)	ovary(1)|skin(1)	12											106.0	105.0	105.0					12																	126138808		2033	4202	6235	124704761	SO:0001583	missense	114795			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.2789G>C	12.37:g.126138808G>C	ENSP00000299308:p.Arg930Thr		124704761	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	CCDS41859.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307786	0.60305	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.10668	3.64;2.85	5.54	4.64	0.57946	.	0.000000	0.64402	D	0.000001	T	0.12263	0.0298	L	0.56199	1.76	0.44201	D	0.99702	B	0.20052	0.041	B	0.14578	0.011	T	0.03148	-1.1067	10	0.44086	T	0.13	.	11.4873	0.50361	0.069:0.1263:0.8047:0.0	.	930	Q14DG7	T132B_HUMAN	T	930;442	ENSP00000299308:R930T;ENSP00000440436:R442T	ENSP00000299308:R930T	R	+	2	0	TMEM132B	124704761	1.000000	0.71417	0.935000	0.37517	0.986000	0.74619	5.874000	0.69652	1.314000	0.45095	0.655000	0.94253	AGG		0.502	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907		Missense_Mutation
ARHGAP5	394	broad.mit.edu	37	14	32562906	32562906	+	Silent	SNP	A	A	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr14:32562906A>C	ENST00000345122.3	+	2	3346	c.3031A>C	c.(3031-3033)Aga>Cga	p.R1011R	ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000539826.2_Silent_p.R1011R|ARHGAP5_ENST00000432921.1_Silent_p.R1011R|ARHGAP5_ENST00000556611.1_Silent_p.R1011R|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1011					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.R1011R(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TTCCAGATATAGATTAGATTT	0.428																																					NSCLC(9;77 350 3443 29227 41353)											1	Substitution - coding silent(1)	ovary(1)	14											115.0	112.0	113.0					14																	32562906		2203	4300	6503	31632657	SO:0001819	synonymous_variant	394			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.3031A>C	14.37:g.32562906A>C			31632657	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Silent	SNP	ENST00000345122.3	37	CCDS32062.1	SNP	15	Broad																																																																																				0.428	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055		Silent
CLEC14A	161198	broad.mit.edu	37	14	38724322	38724322	+	Silent	SNP	G	G	C	rs371729454		TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr14:38724322G>C	ENST00000342213.2	-	1	1252	c.906C>G	c.(904-906)ccC>ccG	p.P302P		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	302						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.P302P(1)		breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		GGCGCCTGGTGGGCACCCCGG	0.662																																																1	Substitution - coding silent(1)	ovary(1)	14											42.0	47.0	46.0					14																	38724322		2202	4295	6497	37794073	SO:0001819	synonymous_variant	161198				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.906C>G	14.37:g.38724322G>C			37794073	Q695G9|Q6PWT6|Q8N5V5	Silent	SNP	ENST00000342213.2	37	CCDS9667.1	SNP	47	Broad																																																																																				0.662	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060		Silent
MIA2	117153	broad.mit.edu	37	14	39722339	39722339	+	Missense_Mutation	SNP	T	T	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr14:39722339T>A	ENST00000280082.3	+	6	2050	c.1851T>A	c.(1849-1851)aaT>aaA	p.N617K	RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.N544K	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	0					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)		p.N617K(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		ATTTCATGAATTCTGCATTTT	0.274																																																1	Substitution - Missense(1)	ovary(1)	14											79.0	86.0	84.0					14																	39722339		2201	4291	6492	38792090	SO:0001583	missense	117153			BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.1851T>A	14.37:g.39722339T>A	ENSP00000280082:p.Asn617Lys		38792090	A1L4H0|Q9H6C1	Missense_Mutation	SNP	ENST00000280082.3	37	CCDS9672.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	11.65	1.700431	0.30142	.	.	ENSG00000150526;ENSG00000258941	ENST00000280082;ENST00000553728	T;T	0.52754	0.65;3.23	5.09	-1.78	0.07957	.	1.370910	0.05175	N	0.500184	T	0.25121	0.0610	.	.	.	0.21861	N	0.999502	B	0.06786	0.001	B	0.09377	0.004	T	0.08764	-1.0706	8	.	.	.	.	0.3062	0.00280	0.2654:0.2378:0.1369:0.3599	.	617	Q96PC5-2	.	K	617;544	ENSP00000280082:N617K;ENSP00000452252:N544K	.	N	+	3	2	MIA2;RP11-407N17.3	38792090	0.000000	0.05858	0.850000	0.33497	0.847000	0.48162	-0.196000	0.09532	-0.483000	0.06772	-0.334000	0.08254	AAT		0.274	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276768.3	NM_054024		Missense_Mutation
SIX1	6495	broad.mit.edu	37	14	61113058	61113058	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr14:61113058C>A	ENST00000247182.6	-	2	1070	c.798G>T	c.(796-798)caG>caT	p.Q266H	SIX1_ENST00000554986.1_Missense_Mutation_p.Q93H	NM_005982.3	NP_005973.1	Q15475	SIX1_HUMAN	SIX homeobox 1	266					aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|branching involved in ureteric bud morphogenesis (GO:0001658)|cochlea morphogenesis (GO:0090103)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial cell differentiation (GO:0030855)|facial nerve morphogenesis (GO:0021610)|generation of neurons (GO:0048699)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesonephric tubule formation (GO:0072172)|metanephric mesenchyme development (GO:0072075)|middle ear morphogenesis (GO:0042474)|myoblast migration (GO:0051451)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|organ induction (GO:0001759)|otic vesicle development (GO:0071599)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|protein localization to nucleus (GO:0034504)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of neuron differentiation (GO:0045664)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q266H(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0201)		AGTCTTGGAGCTGATGCTGGT	0.622																																																1	Substitution - Missense(1)	ovary(1)	14											54.0	60.0	58.0					14																	61113058		2203	4300	6503	60182811	SO:0001583	missense	6495			X91868	CCDS9748.1	14q23.1	2011-06-20	2007-07-13		ENSG00000126778	ENSG00000126778		"""Homeoboxes / SINE class"""	10887	protein-coding gene	gene with protein product		601205	"""sine oculis homeobox (Drosophila) homolog 1"", ""sine oculis homeobox homolog 1 (Drosophila)"", ""deafness, autosomal dominant 23"""	DFNA23		8617500, 15141091	Standard	NM_005982		Approved		uc001xfb.4	Q15475	OTTHUMG00000140334	ENST00000247182.6:c.798G>T	14.37:g.61113058C>A	ENSP00000247182:p.Gln266His		60182811	Q53Y16|Q96H64	Missense_Mutation	SNP	ENST00000247182.6	37	CCDS9748.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	18.25	3.583410	0.65992	.	.	ENSG00000126778	ENST00000247182;ENST00000555955;ENST00000553535	D;D;D	0.87650	-2.28;-2.14;-2.14	5.08	3.26	0.37387	.	0.000000	0.85682	D	0.000000	T	0.79992	0.4542	L	0.27053	0.805	0.58432	D	0.999992	D	0.53151	0.958	B	0.44044	0.439	T	0.77900	-0.2415	10	0.44086	T	0.13	-20.3916	11.2843	0.49214	0.0:0.8525:0.0:0.1475	.	266	Q15475	SIX1_HUMAN	H	266;82;82	ENSP00000247182:Q266H;ENSP00000450952:Q82H;ENSP00000450739:Q82H	ENSP00000247182:Q266H	Q	-	3	2	SIX1	60182811	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.809000	0.27168	0.730000	0.32425	0.655000	0.94253	CAG		0.622	SIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276951.3			Missense_Mutation
SLC10A1	6554	broad.mit.edu	37	14	70245211	70245211	+	Missense_Mutation	SNP	T	T	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr14:70245211T>G	ENST00000216540.4	-	4	915	c.782A>C	c.(781-783)cAa>cCa	p.Q261P		NM_003049.3	NP_003040.1	Q14973	NTCP_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 1	261					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)	p.Q261P(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)	14				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)	Bumetanide(DB00887)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Ethinyl Estradiol(DB00977)|Indomethacin(DB00328)|Liothyronine(DB00279)|Liotrix(DB01583)|Pitavastatin(DB08860)|Probenecid(DB01032)|Progesterone(DB00396)|Testosterone(DB00624)|Ursodeoxycholic acid(DB01586)	TTGGACATTTTGGCATCCAGT	0.502																																																1	Substitution - Missense(1)	ovary(1)	14											156.0	127.0	137.0					14																	70245211		2203	4300	6503	69314964	SO:0001583	missense	6554			L21893	CCDS9797.1	14q24.2	2013-07-18	2013-07-18		ENSG00000100652	ENSG00000100652		"""Solute carriers"""	10905	protein-coding gene	gene with protein product		182396				8132774	Standard	NM_003049		Approved	NTCP	uc001xlr.2	Q14973	OTTHUMG00000171236	ENST00000216540.4:c.782A>C	14.37:g.70245211T>G	ENSP00000216540:p.Gln261Pro		69314964	B9EGB6|Q2TU29	Missense_Mutation	SNP	ENST00000216540.4	37	CCDS9797.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	19.78	3.890598	0.72524	.	.	ENSG00000100652	ENST00000216540	T	0.75477	-0.94	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.89996	0.6877	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	D	0.93110	0.6516	10	0.87932	D	0	-3.9152	14.5117	0.67791	0.0:0.0:0.0:1.0	.	261	Q14973	NTCP_HUMAN	P	261	ENSP00000216540:Q261P	ENSP00000216540:Q261P	Q	-	2	0	SLC10A1	69314964	1.000000	0.71417	0.999000	0.59377	0.682000	0.39822	7.732000	0.84908	2.020000	0.59435	0.459000	0.35465	CAA		0.502	SLC10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412464.1			Missense_Mutation
PPP1R13B	23368	broad.mit.edu	37	14	104219373	104219373	+	Silent	SNP	C	C	T	rs368023622		TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr14:104219373C>T	ENST00000202556.9	-	7	1074	c.792G>A	c.(790-792)gcG>gcA	p.A264A		NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	264	Gln-rich.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A264A(1)		endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				ACTCCACCGCCGCTGGTCCCG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	14						C		0,3676		0,0,1838	106.0	98.0	101.0		792	-11.5	0.0	14		101	1,8197		0,1,4098	no	coding-synonymous	PPP1R13B	NM_015316.2		0,1,5936	TT,TC,CC		0.0122,0.0,0.0084		264/1091	104219373	1,11873	1838	4099	5937	103289126	SO:0001819	synonymous_variant	23368			AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.792G>A	14.37:g.104219373C>T			103289126	B2RMX5|O94870	Silent	SNP	ENST00000202556.9	37	CCDS41997.1	SNP	23	Broad																																																																																				0.398	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1	NM_015316		Silent
TP53BP1	7158	broad.mit.edu	37	15	43724582	43724582	+	Missense_Mutation	SNP	A	A	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr15:43724582A>C	ENST00000263801.3	-	17	3722	c.3470T>G	c.(3469-3471)aTg>aGg	p.M1157R	TP53BP1_ENST00000450115.2_Missense_Mutation_p.M1162R|TP53BP1_ENST00000382039.3_Missense_Mutation_p.M1162R|TP53BP1_ENST00000382044.4_Missense_Mutation_p.M1162R	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1157					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)	p.M1157R(1)		breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GGAACACTCCATGGTTTGGAT	0.458								Other conserved DNA damage response genes																																								1	Substitution - Missense(1)	ovary(1)	15											125.0	114.0	118.0					15																	43724582		2201	4298	6499	41511874	SO:0001583	missense	7158			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.3470T>G	15.37:g.43724582A>C	ENSP00000263801:p.Met1157Arg		41511874	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	37	CCDS10096.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	7.644	0.681420	0.14907	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	T;T;T;T	0.03920	3.77;3.77;3.76;3.77	4.79	2.51	0.30379	.	0.802256	0.11660	N	0.541929	T	0.03477	0.0100	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.28971	0.229;0.105;0.168;0.168	B;B;B;B	0.28139	0.063;0.04;0.086;0.086	T	0.45279	-0.9272	10	0.21014	T	0.42	1.0777	3.406	0.07341	0.5473:0.2025:0.2502:0.0	.	1162;1157;1162;1162	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	R	1157;1162;1162;1162	ENSP00000263801:M1157R;ENSP00000371475:M1162R;ENSP00000371470:M1162R;ENSP00000393497:M1162R	ENSP00000263801:M1157R	M	-	2	0	TP53BP1	41511874	0.734000	0.28142	0.122000	0.21767	0.492000	0.33523	1.889000	0.39718	0.966000	0.38159	0.528000	0.53228	ATG		0.458	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3			Missense_Mutation
TEKT5	146279	broad.mit.edu	37	16	10721464	10721464	+	Silent	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr16:10721464G>A	ENST00000283025.2	-	7	1505	c.1434C>T	c.(1432-1434)acC>acT	p.T478T	TEKT5_ENST00000574923.1_5'UTR	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	478						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.T478T(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						CCAGGCGCGGGGTGCAGGGGA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	16											63.0	62.0	62.0					16																	10721464		2197	4300	6497	10628965	SO:0001819	synonymous_variant	146279				CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.1434C>T	16.37:g.10721464G>A			10628965	A1L3Z3	Silent	SNP	ENST00000283025.2	37	CCDS10542.1	SNP	43	Broad																																																																																				0.577	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251963.1	NM_144674		Silent
LOC81691	81691	broad.mit.edu	37	16	20833199	20833199	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr16:20833199G>C	ENST00000261377.6	+	6	800	c.591G>C	c.(589-591)atG>atC	p.M197I	AC004381.6_ENST00000567297.1_3'UTR|AC004381.6_ENST00000348433.6_Missense_Mutation_p.M197I|AC004381.6_ENST00000564274.1_Missense_Mutation_p.M197I|ERI2_ENST00000564349.1_Intron	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2												p.M197I(1)									AGGAGGAAATGAGAACGTTTC	0.393																																																1	Substitution - Missense(1)	ovary(1)	16											115.0	107.0	110.0					16																	20833199		2201	4300	6501	20740700	SO:0001583	missense	81691																														ENST00000261377.6:c.591G>C	16.37:g.20833199G>C	ENSP00000261377:p.Met197Ile		20740700		Missense_Mutation	SNP	ENST00000261377.6	37	CCDS10591.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760173	0.89932	.	.	ENSG00000005189	ENST00000348433;ENST00000261377	T;T	0.34275	1.37;1.75	5.27	5.27	0.74061	.	0.040960	0.85682	D	0.000000	T	0.50137	0.1598	M	0.63843	1.955	0.43628	D	0.996011	D;P	0.53745	0.962;0.692	P;B	0.53006	0.715;0.186	T	0.54050	-0.8351	10	0.87932	D	0	-22.4422	16.3781	0.83412	0.0:0.0:1.0:0.0	.	197;197	Q96IC2-2;Q96IC2	.;REXON_HUMAN	I	197	ENSP00000261378:M197I;ENSP00000261377:M197I	ENSP00000261377:M197I	M	+	3	0	AC004381.6	20740700	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	6.183000	0.72002	2.460000	0.83146	0.561000	0.74099	ATG		0.393	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254418.2			Missense_Mutation
GPR97	222487	broad.mit.edu	37	16	57718105	57718105	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr16:57718105G>T	ENST00000333493.4	+	9	1304	c.1143G>T	c.(1141-1143)aaG>aaT	p.K381N	GPR97_ENST00000327655.6_Missense_Mutation_p.K171N|RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000450388.3_Missense_Mutation_p.K261N	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	381					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.K381N(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						ACTTCCTGAAGCTGAGCCTGG	0.597																																																1	Substitution - Missense(1)	ovary(1)	16											75.0	73.0	74.0					16																	57718105		2198	4300	6498	56275606	SO:0001583	missense	222487			AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.1143G>T	16.37:g.57718105G>T	ENSP00000332900:p.Lys381Asn		56275606	Q6ZMF4|Q86SL9|Q8IZF1	Missense_Mutation	SNP	ENST00000333493.4	37	CCDS10786.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	19.76	3.888144	0.72524	.	.	ENSG00000182885	ENST00000333493;ENST00000327655;ENST00000450388	T;T;T	0.45668	0.89;1.15;0.89	5.15	5.15	0.70609	GPCR, family 2-like (1);	0.093442	0.46442	D	0.000285	T	0.66076	0.2753	M	0.84683	2.71	0.45452	D	0.998428	D	0.89917	1.0	D	0.91635	0.999	T	0.70949	-0.4733	10	0.72032	D	0.01	.	11.142	0.48408	0.0846:0.0:0.9154:0.0	.	381	Q86Y34	GPR97_HUMAN	N	381;171;261	ENSP00000332900:K381N;ENSP00000331199:K171N;ENSP00000404803:K261N	ENSP00000331199:K171N	K	+	3	2	GPR97	56275606	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.674000	0.54598	2.400000	0.81607	0.591000	0.81541	AAG		0.597	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2	NM_170776		Missense_Mutation
ZNF594	84622	broad.mit.edu	37	17	5086301	5086301	+	Silent	SNP	T	T	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr17:5086301T>A	ENST00000399604.4	-	1	1391	c.1251A>T	c.(1249-1251)tcA>tcT	p.S417S	ZNF594_ENST00000575779.1_Silent_p.S417S			Q96JF6	ZN594_HUMAN	zinc finger protein 594	417					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S417S(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TCAGAAGGTCTGAGCTCTGAT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	17											155.0	157.0	157.0					17																	5086301		2020	4205	6225	5027025	SO:0001819	synonymous_variant	84622			AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.1251A>T	17.37:g.5086301T>A			5027025	Q6RFS0	Silent	SNP	ENST00000399604.4	37	CCDS42241.1	SNP	55	Broad																																																																																				0.413	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438996.1	XM_290737		Silent
DLG4	1742	broad.mit.edu	37	17	7100125	7100125	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr17:7100125C>T	ENST00000399506.2	-	9	1225	c.1034G>A	c.(1033-1035)gGc>gAc	p.G345D	DLG4_ENST00000399510.2_Missense_Mutation_p.G388D|DLG4_ENST00000302955.6_Missense_Mutation_p.G342D			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	345	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)	p.G388D(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	GTCTGCAGGGCCCCCGGCCAG	0.657																																																1	Substitution - Missense(1)	ovary(1)	17											17.0	22.0	21.0					17																	7100125		2053	4215	6268	7040849	SO:0001583	missense	1742			U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.1034G>A	17.37:g.7100125C>T	ENSP00000382425:p.Gly345Asp		7040849	B7Z1S1|G5E939|Q92941|Q9UKK8	Missense_Mutation	SNP	ENST00000399506.2	37		SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934166	0.92458	.	.	ENSG00000132535	ENST00000399506;ENST00000302955;ENST00000399510;ENST00000293813;ENST00000380912;ENST00000539674	T;T;T	0.57107	0.42;0.42;0.42	5.28	5.28	0.74379	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.79851	0.4517	M	0.93638	3.44	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.97110	0.999;1.0;0.99;1.0	D	0.85380	0.1119	9	0.87932	D	0	.	16.4332	0.83860	0.0:1.0:0.0:0.0	.	385;345;342;388	B9EGL1;P78352;G5E939;P78352-2	.;DLG4_HUMAN;.;.	D	345;342;388;388;285;388	ENSP00000382425:G345D;ENSP00000307471:G342D;ENSP00000382428:G388D	ENSP00000293813:G388D	G	-	2	0	DLG4	7040849	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.481000	0.81124	2.455000	0.83008	0.655000	0.94253	GGC		0.657	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000259419.2	NM_001365		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577141	7577141	+	Missense_Mutation	SNP	C	C	A	rs193920774		TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr17:7577141C>A	ENST00000269305.4	-	8	986	c.797G>T	c.(796-798)gGa>gTa	p.G266V	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.G266V|TP53_ENST00000420246.2_Missense_Mutation_p.G266V|TP53_ENST00000359597.4_Missense_Mutation_p.G266V|TP53_ENST00000455263.2_Missense_Mutation_p.G266V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	266	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G266E(50)|p.G266V(42)|p.0?(8)|p.?(3)|p.G266fs*79(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTGTTCCGTCCCAGTAGATT	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	121	Substitution - Missense(95)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(3)	lung(23)|oesophagus(10)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(9)|breast(9)|upper_aerodigestive_tract(8)|ovary(8)|urinary_tract(7)|pancreas(6)|skin(5)|central_nervous_system(4)|stomach(4)|bone(4)|liver(4)|endometrium(3)|vulva(1)|kidney(1)|thyroid(1)|cervix(1)|eye(1)|genital_tract(1)|biliary_tract(1)	17											50.0	44.0	46.0					17																	7577141		2203	4300	6503	7517866	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.797G>T	17.37:g.7577141C>A	ENSP00000269305:p.Gly266Val		7517866	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388215	0.82902	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	M	0.92367	3.3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	D	0.96190	0.9137	10	0.87932	D	0	-13.0798	16.1198	0.81342	0.0:1.0:0.0:0.0	.	266;266;266;266	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	266;266;266;266;266;255;134	ENSP00000352610:G266V;ENSP00000269305:G266V;ENSP00000398846:G266V;ENSP00000391127:G266V;ENSP00000391478:G266V;ENSP00000425104:G134V	ENSP00000269305:G266V	G	-	2	0	TP53	7517866	1.000000	0.71417	0.996000	0.52242	0.744000	0.42396	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GGA		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
KRT25	147183	broad.mit.edu	37	17	38906696	38906696	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr17:38906696C>T	ENST00000312150.4	-	6	1171	c.1111G>A	c.(1111-1113)Gac>Aac	p.D371N		NM_181534.3	NP_853512.1			keratin 25									p.D371N(1)		endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				AGCTTGATGTCCAGGAGCTGC	0.527																																																1	Substitution - Missense(1)	ovary(1)	17											150.0	150.0	150.0					17																	38906696		2203	4300	6503	36160222	SO:0001583	missense	147183			AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.1111G>A	17.37:g.38906696C>T	ENSP00000310573:p.Asp371Asn		36160222		Missense_Mutation	SNP	ENST00000312150.4	37	CCDS11373.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	15.04	2.716041	0.48622	.	.	ENSG00000204897	ENST00000394042;ENST00000312150	D	0.89810	-2.57	5.52	0.809	0.18725	Filament (1);	0.302373	0.28062	N	0.016749	T	0.80808	0.4694	L	0.27053	0.805	0.28621	N	0.90819	B	0.17038	0.02	B	0.27170	0.077	T	0.72097	-0.4393	10	0.51188	T	0.08	.	8.8692	0.35305	0.0:0.6719:0.1182:0.2098	.	371	Q7Z3Z0	K1C25_HUMAN	N	300;371	ENSP00000310573:D371N	ENSP00000310573:D371N	D	-	1	0	KRT25	36160222	1.000000	0.71417	0.876000	0.34364	0.901000	0.52897	3.067000	0.50010	0.274000	0.22072	-0.136000	0.14681	GAC		0.527	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257218.1	NM_181534		Missense_Mutation
GOSR2	9570	broad.mit.edu	37	17	45012463	45012463	+	Silent	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr17:45012463C>T	ENST00000393456.2	+	5	462	c.405C>T	c.(403-405)aaC>aaT	p.N135N	GOSR2_ENST00000576910.2_Intron|RP11-156P1.2_ENST00000571841.1_Silent_p.N135N|GOSR2_ENST00000439730.2_Silent_p.N135N|GOSR2_ENST00000225567.4_Silent_p.N135N|GOSR2_ENST00000415811.2_Silent_p.N135N	NM_004287.3	NP_004278.2	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2	135					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)	p.N135N(1)		kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|skin(1)	7			BRCA - Breast invasive adenocarcinoma(9;0.102)			AAGTTCACAACGGCATGGATG	0.483																																																1	Substitution - coding silent(1)	ovary(1)	17											158.0	142.0	148.0					17																	45012463		2203	4300	6503	42367462	SO:0001819	synonymous_variant	9570			AF007548	CCDS11507.1, CCDS42355.1, CCDS45719.1	17q21	2006-02-10				ENSG00000108433			4431	protein-coding gene	gene with protein product		604027				9349823, 10198168	Standard	XM_005257843		Approved	GS27, Bos1	uc002ikz.3	O14653		ENST00000393456.2:c.405C>T	17.37:g.45012463C>T			42367462	D3DXJ5|D3DXJ6|Q8N4B8|Q96DA5|Q9BZZ4	Silent	SNP	ENST00000393456.2	37	CCDS42355.1	SNP	19	Broad																																																																																				0.483	GOSR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440438.1			Silent
MIB1	57534	broad.mit.edu	37	18	19321695	19321695	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr18:19321695G>C	ENST00000261537.6	+	1	415	c.151G>C	c.(151-153)Gtg>Ctg	p.V51L	MIB1_ENST00000578646.1_Intron	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	51	MIB/HERC2 1. {ECO:0000255|PROSITE- ProRule:PRU00749}.				blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V51L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			GGTGGTGGTAGTGTGGGACAA	0.701																																																1	Substitution - Missense(1)	ovary(1)	18											31.0	26.0	28.0					18																	19321695		2200	4299	6499	17575693	SO:0001583	missense	57534			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.151G>C	18.37:g.19321695G>C	ENSP00000261537:p.Val51Leu		17575693	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Missense_Mutation	SNP	ENST00000261537.6	37	CCDS11871.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	19.49	3.836575	0.71373	.	.	ENSG00000101752	ENST00000261537	T	0.37584	1.19	4.19	4.19	0.49359	Mib-herc2 (2);	0.000000	0.85682	D	0.000000	T	0.51856	0.1699	L	0.43598	1.365	0.80722	D	1	P	0.51653	0.947	D	0.66716	0.946	T	0.56347	-0.7994	10	0.66056	D	0.02	-5.2758	16.4977	0.84249	0.0:0.0:1.0:0.0	.	51	Q86YT6	MIB1_HUMAN	L	51	ENSP00000261537:V51L	ENSP00000261537:V51L	V	+	1	0	MIB1	17575693	1.000000	0.71417	1.000000	0.80357	0.145000	0.21501	7.630000	0.83225	1.870000	0.54199	0.313000	0.20887	GTG		0.701	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774		Missense_Mutation
RTTN	25914	broad.mit.edu	37	18	67759398	67759398	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr18:67759398G>C	ENST00000255674.6	-	30	4377	c.4091C>G	c.(4090-4092)aCt>aGt	p.T1364S	RTTN_ENST00000437017.1_Missense_Mutation_p.T1364S|RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1364					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.T1364S(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				TCCTTGTTGAGTAGGAATATG	0.393																																																1	Substitution - Missense(1)	ovary(1)	18											83.0	75.0	78.0					18																	67759398		1890	4111	6001	65910378	SO:0001583	missense	25914			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.4091C>G	18.37:g.67759398G>C	ENSP00000255674:p.Thr1364Ser		65910378	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	ENST00000255674.6	37	CCDS42443.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.962798	0.00461	.	.	ENSG00000176225	ENST00000255674;ENST00000437017	T;T	0.66099	-0.19;-0.19	5.08	1.14	0.20703	.	0.680915	0.14712	N	0.302916	T	0.44030	0.1274	L	0.36672	1.1	0.20403	N	0.999908	B	0.06786	0.001	B	0.06405	0.002	T	0.27839	-1.0062	10	0.06494	T	0.89	.	9.1353	0.36870	0.3089:0.0:0.6911:0.0	.	1364	Q86VV8	RTTN_HUMAN	S	1364	ENSP00000255674:T1364S;ENSP00000399520:T1364S	ENSP00000255674:T1364S	T	-	2	0	RTTN	65910378	0.059000	0.20769	0.000000	0.03702	0.121000	0.20230	1.877000	0.39598	0.233000	0.21120	-0.218000	0.12543	ACT		0.393	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630		Missense_Mutation
COL5A3	50509	broad.mit.edu	37	19	10084882	10084882	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr19:10084882C>T	ENST00000264828.3	-	47	3554	c.3469G>A	c.(3469-3471)Gga>Aga	p.G1157R		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1157	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.G1157R(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CCTTTCTCTCCCGGAGGGCCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											68.0	63.0	65.0					19																	10084882		2203	4300	6503	9945882	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3469G>A	19.37:g.10084882C>T	ENSP00000264828:p.Gly1157Arg		9945882	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	24.8	4.568955	0.86439	.	.	ENSG00000080573	ENST00000264828	D	0.99429	-5.89	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000001	D	0.99687	0.9882	H	0.96175	3.78	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97382	0.9983	10	0.87932	D	0	.	15.891	0.79299	0.0:1.0:0.0:0.0	.	1157	P25940	CO5A3_HUMAN	R	1157	ENSP00000264828:G1157R	ENSP00000264828:G1157R	G	-	1	0	COL5A3	9945882	1.000000	0.71417	0.996000	0.52242	0.892000	0.51952	6.798000	0.75155	2.332000	0.79248	0.491000	0.48974	GGA		0.612	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719		Missense_Mutation
ZNF468	90333	broad.mit.edu	37	19	53344346	53344346	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr19:53344346G>C	ENST00000595646.1	-	4	1321	c.1201C>G	c.(1201-1203)Cat>Gat	p.H401D	ZNF468_ENST00000396409.4_Missense_Mutation_p.H348D|ZNF468_ENST00000390651.4_Missense_Mutation_p.H348D|ZNF468_ENST00000243639.4_3'UTR|ZNF28_ENST00000594602.1_Intron			Q5VIY5	ZN468_HUMAN	zinc finger protein 468	401					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H401D(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(3)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(134;0.0358)		ATCCTCCTATGTCTTTCAAGG	0.403																																																1	Substitution - Missense(1)	ovary(1)	19											104.0	104.0	104.0					19																	53344346		2203	4300	6503	58036158	SO:0001583	missense	90333			AK023558	CCDS33094.1, CCDS62781.1	19q13.41	2013-01-08				ENSG00000204604		"""Zinc fingers, C2H2-type"", ""-"""	33105	protein-coding gene	gene with protein product						16144304	Standard	NM_001277120		Approved		uc002qaf.3	Q5VIY5		ENST00000595646.1:c.1201C>G	19.37:g.53344346G>C	ENSP00000470381:p.His401Asp		58036158	A8MV20|Q5CZB8|Q5VIY4|Q68DI7	Missense_Mutation	SNP	ENST00000595646.1	37	CCDS33094.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	-	15.58	2.874292	0.51695	.	.	ENSG00000204604	ENST00000243639;ENST00000396409;ENST00000390651;ENST00000393865	D;D	0.86769	-2.17;-2.17	1.88	1.88	0.25563	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94883	0.8346	H	0.95982	3.75	0.31669	N	0.644599	D	0.89917	1.0	D	0.91635	0.999	D	0.92822	0.6273	9	0.87932	D	0	.	10.8024	0.46495	0.0:0.0:1.0:0.0	.	401	Q5VIY5	ZN468_HUMAN	D	401;348;348;151	ENSP00000379690:H348D;ENSP00000445669:H348D	ENSP00000243639:H401D	H	-	1	0	ZNF468	58036158	1.000000	0.71417	0.006000	0.13384	0.040000	0.13550	5.905000	0.69893	1.043000	0.40175	0.409000	0.27619	CAT		0.403	ZNF468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463098.1	NM_001008801		Missense_Mutation
ZNF321P	399669	broad.mit.edu	37	19	53432565	53432565	+	Missense_Mutation	SNP	A	A	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr19:53432565A>T	ENST00000391777.3	-	4	414	c.293T>A	c.(292-294)aTt>aAt	p.I98N	ZNF816-ZNF321P_ENST00000313956.4_RNA|ZNF816_ENST00000434371.2_Missense_Mutation_p.I98N|ZNF816_ENST00000549216.1_Missense_Mutation_p.I29N			Q8N8H1	ZN321_HUMAN	zinc finger protein 321, pseudogene	29								p.I29N(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						AAAATCTCTAATGTGATGACT	0.413																																																1	Substitution - Missense(1)	ovary(1)	19											132.0	140.0	137.0					19																	53432565		2203	4300	6503	58124377	SO:0001583	missense	399669			AK096828		19q13.4	2013-01-08	2011-04-19	2011-04-19	ENSG00000221874	ENSG00000221874			13827	pseudogene	pseudogene			"""zinc finger protein 321"""	ZNF321			Standard	NR_037805		Approved	MGC35402		Q8N8H1	OTTHUMG00000167760	ENST00000391777.3:c.293T>A	19.37:g.53432565A>T	ENSP00000375656:p.Ile98Asn		58124377	B7ZB38|Q68DZ0|Q86SS5	Missense_Mutation	SNP	ENST00000391777.3	37	CCDS56101.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	a	5.687	0.311287	0.10789	.	.	ENSG00000180257;ENSG00000180257;ENSG00000221874	ENST00000549216;ENST00000434371;ENST00000391777	T;T;T	0.02446	4.29;5.63;5.63	1.23	0.157	0.14915	.	.	.	.	.	T	0.02929	0.0087	L	0.38838	1.175	0.09310	N	1	B	0.23058	0.079	B	0.29176	0.099	T	0.44345	-0.9334	9	0.54805	T	0.06	.	4.5594	0.12152	0.7934:0.0:0.2066:0.0	.	29	Q8N8H1	ZN321_HUMAN	N	29;98;98	ENSP00000449832:I29N;ENSP00000438519:I98N;ENSP00000375656:I98N	ENSP00000375656:I98N	I	-	2	0	ZNF321P;ZNF816	58124377	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.209000	0.17435	0.010000	0.14839	0.113000	0.15668	ATT		0.413	ZNF321P-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000396130.1	NR_037805		Missense_Mutation
BIRC6	57448	broad.mit.edu	37	2	32640420	32640420	+	Nonsense_Mutation	SNP	C	C	G	rs3769599	byFrequency	TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr2:32640420C>G	ENST00000421745.2	+	10	2195	c.2061C>G	c.(2059-2061)taC>taG	p.Y687*		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	687					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.Y659*(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CTGTGACTTACATTCAGCAAT	0.448																																					Pancreas(94;175 1509 16028 18060 45422)											1	Substitution - Nonsense(1)	ovary(1)	2											104.0	94.0	97.0					2																	32640420		2203	4300	6503	32493924	SO:0001587	stop_gained	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.2061C>G	2.37:g.32640420C>G	ENSP00000393596:p.Tyr687*		32493924	Q9ULD1	Nonsense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	38	6.981454	0.97979	.	.	ENSG00000115760	ENST00000421745	.	.	.	5.56	1.82	0.25136	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2258	0.43225	0.0:0.7408:0.0:0.2592	.	.	.	.	X	687	.	ENSP00000393596:Y687X	Y	+	3	2	BIRC6	32493924	0.505000	0.26131	0.999000	0.59377	0.956000	0.61745	-0.143000	0.10296	0.125000	0.18397	0.650000	0.86243	TAC		0.448	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		Nonsense_Mutation
GLI2	2736	broad.mit.edu	37	2	121736046	121736046	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr2:121736046G>C	ENST00000452319.1	+	10	1465	c.1405G>C	c.(1405-1407)Gag>Cag	p.E469Q	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000361492.4_Missense_Mutation_p.E469Q|GLI2_ENST00000314490.11_Missense_Mutation_p.E141Q					GLI family zinc finger 2									p.E469Q(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				GGAGAAGAAGGAGTTTGTGTG	0.637																																																1	Substitution - Missense(1)	ovary(1)	2											153.0	149.0	150.0					2																	121736046		2203	4300	6503	121452516	SO:0001583	missense	2736				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1405G>C	2.37:g.121736046G>C	ENSP00000390436:p.Glu469Gln		121452516		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	20.6	4.017567	0.75161	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	D;D;D	0.91351	-2.83;-2.83;-2.83	4.03	4.03	0.46877	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.114584	0.64402	D	0.000017	D	0.95098	0.8412	M	0.82823	2.61	0.58432	D	0.999997	P;D;P;P;B	0.64830	0.457;0.994;0.533;0.867;0.035	B;D;B;B;B	0.65684	0.038;0.937;0.041;0.284;0.013	D	0.95980	0.8977	10	0.87932	D	0	.	16.6998	0.85346	0.0:0.0:1.0:0.0	.	469;452;124;124;141	P10070;Q0VGA0;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.;.	Q	469;469;141	ENSP00000390436:E469Q;ENSP00000354586:E469Q;ENSP00000312694:E141Q	ENSP00000312694:E141Q	E	+	1	0	GLI2	121452516	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.547000	0.98100	2.249000	0.74217	0.491000	0.48974	GAG		0.637	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270		Missense_Mutation
ZEB2	9839	broad.mit.edu	37	2	145161613	145161613	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr2:145161613A>G	ENST00000558170.2	-	6	1861	c.677T>C	c.(676-678)cTg>cCg	p.L226P	ZEB2_ENST00000409487.3_Missense_Mutation_p.L226P|ZEB2_ENST00000303660.4_Missense_Mutation_p.L226P|ZEB2_ENST00000539609.3_Missense_Mutation_p.L202P	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	226					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.L226P(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		GTGCTCCTTCAGTGATGTCAA	0.562																																					Melanoma(33;1235 1264 5755 16332)											1	Substitution - Missense(1)	ovary(1)	2											195.0	180.0	185.0					2																	145161613		2203	4300	6503	144878083	SO:0001583	missense	9839			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.677T>C	2.37:g.145161613A>G	ENSP00000454157:p.Leu226Pro		144878083	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	SNP	7	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.74|18.74	3.689532|3.689532	0.68271|0.68271	.|.	.|.	ENSG00000169554|ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861|ENST00000419938;ENST00000431672	T;T;T;T;T|.	0.42513|.	0.97;0.97;0.97;0.97;0.97|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	D|.	0.84638|.	0.5516|.	M|M	0.91510|0.91510	3.215|3.215	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.999;0.999|.	D;D;D;D;D|.	0.97110|.	1.0;0.999;0.999;0.999;0.999|.	D|.	0.88107|.	0.2823|.	10|.	0.87932|.	D|.	0|.	-5.2988|-5.2988	15.8828|15.8828	0.79216|0.79216	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	202;91;202;225;226|.	F5H814;Q53TD9;B7Z2P2;A0JP08;O60315|.	.;.;.;.;ZEB2_HUMAN|.	P|R	221;202;226;226;226;226|115;192	ENSP00000443792:L202P;ENSP00000302501:L226P;ENSP00000386854:L226P;ENSP00000395496:L226P;ENSP00000376601:L226P|.	ENSP00000302501:L226P|.	L|X	-|-	2|1	0|0	ZEB2|ZEB2	144878083|144878083	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.339000|9.339000	0.96797|0.96797	2.152000|2.152000	0.67230|0.67230	0.533000|0.533000	0.62120|0.62120	CTG|TGA		0.562	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795		Missense_Mutation
NCAM2	4685	broad.mit.edu	37	21	22656721	22656721	+	Splice_Site	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr21:22656721G>A	ENST00000400546.1	+	3	586		c.e3+1		NCAM2_ENST00000486367.1_Splice_Site|NCAM2_ENST00000284894.7_Intron|NCAM2_ENST00000535285.1_Splice_Site	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2						axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GAAATTTACCGTAAGTAATGT	0.294																																																1	Unknown(1)	ovary(1)	21											41.0	39.0	40.0					21																	22656721		1821	4076	5897	21578592	SO:0001630	splice_region_variant	4685				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.337+1G>A	21.37:g.22656721G>A			21578592	A8MQ06|B7Z841|Q7Z7F2	Splice_Site_SNP	SNP	ENST00000400546.1	37	CCDS42910.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876114	0.72180	.	.	ENSG00000154654	ENST00000400546;ENST00000535285	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.134	0.89612	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NCAM2	21578592	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	8.804000	0.91921	2.632000	0.89209	0.591000	0.81541	.		0.294	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	Intron	Splice_Site_SNP
SLC5A3	6526	broad.mit.edu	37	21	35469095	35469095	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr21:35469095C>A	ENST00000381151.3	+	2	2110	c.1598C>A	c.(1597-1599)aCa>aAa	p.T533K	SLC5A3_ENST00000608209.1_Missense_Mutation_p.T533K|MRPS6_ENST00000399312.2_Intron|AP000320.7_ENST00000362077.4_RNA			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	533					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)	p.T533K(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						AGCCTTCTCACACCACCTCCC	0.468																																																1	Substitution - Missense(1)	ovary(1)	21											80.0	69.0	73.0					21																	35469095		2203	4300	6503	34390965	SO:0001583	missense	6526				CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.1598C>A	21.37:g.35469095C>A	ENSP00000370543:p.Thr533Lys		34390965	O43489	Missense_Mutation	SNP	ENST00000381151.3	37	CCDS33549.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695770	0.68386	.	.	ENSG00000198743	ENST00000381151	T	0.66099	-0.19	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.80864	0.4705	M	0.80422	2.495	0.54753	D	0.999987	D	0.71674	0.998	D	0.70935	0.971	T	0.82544	-0.0404	10	0.87932	D	0	.	18.8323	0.92145	0.0:1.0:0.0:0.0	.	533	P53794	SC5A3_HUMAN	K	533	ENSP00000370543:T533K	ENSP00000370543:T533K	T	+	2	0	SLC5A3	34390965	1.000000	0.71417	0.965000	0.40720	0.951000	0.60555	7.461000	0.80834	2.755000	0.94549	0.655000	0.94253	ACA		0.468	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1			Missense_Mutation
TNRC6B	23112	broad.mit.edu	37	22	40661483	40661483	+	Missense_Mutation	SNP	C	C	G	rs201621003		TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr22:40661483C>G	ENST00000454349.2	+	5	1460	c.1249C>G	c.(1249-1251)Cga>Gga	p.R417G	TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000335727.9_Missense_Mutation_p.R417G|TNRC6B_ENST00000301923.9_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	417	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R431G(1)		breast(1)	1						CACTGGAGATCGAAAGACTGG	0.517													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18342	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	22						C	,GLY/ARG,GLY/ARG	4,3796		0,4,1896	63.0	62.0	62.0		,1249,1249	4.5	1.0	22		62	0,8234		0,0,4117	yes	intron,missense,missense	TNRC6B	NM_001024843.1,NM_001162501.1,NM_015088.2	,125,125	0,4,6013	GG,GC,CC		0.0,0.1053,0.0332	,probably-damaging,probably-damaging	,417/1834,417/1724	40661483	4,12030	1900	4117	6017	38991429	SO:0001583	missense	23112			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.1249C>G	22.37:g.40661483C>G	ENSP00000401946:p.Arg417Gly		38991429	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	SNP	31	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.190|5.190	0.220633|0.220633	0.09863|0.09863	0.001053|0.001053	0.0|0.0	ENSG00000100354|ENSG00000100354	ENST00000446273|ENST00000454349;ENST00000400140;ENST00000335727	.|T;T	.|0.55052	.|0.54;0.54	5.52|5.52	4.47|4.47	0.54385|0.54385	.|.	.|0.187300	.|0.46758	.|D	.|0.000261	T|T	0.34890|0.34890	0.0913|0.0913	N|N	0.22421|0.22421	0.69|0.69	0.33162|0.33162	D|D	0.547167|0.547167	.|P;B;B	.|0.44090	.|0.826;0.005;0.008	.|B;B;B	.|0.40602	.|0.334;0.002;0.004	T|T	0.37337|0.37337	-0.9710|-0.9710	5|10	.|0.13853	.|T	.|0.58	-3.9835|-3.9835	11.0688|11.0688	0.47991|0.47991	0.4107:0.5893:0.0:0.0|0.4107:0.5893:0.0:0.0	.|.	.|417;417;417	.|Q9UPQ9;A8MYY3;Q9UPQ9-1	.|TNR6B_HUMAN;.;.	M|G	159|417	.|ENSP00000401946:R417G;ENSP00000338371:R417G	.|ENSP00000338371:R417G	I|R	+|+	3|1	3|2	TNRC6B|TNRC6B	38991429|38991429	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.535000|1.535000	0.36061|0.36061	2.601000|2.601000	0.87937|0.87937	0.650000|0.650000	0.86243|0.86243	ATC|CGA		0.517	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding				Missense_Mutation
ACO2	50	broad.mit.edu	37	22	41922335	41922335	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr22:41922335G>A	ENST00000216254.4	+	15	1853	c.1831G>A	c.(1831-1833)Gat>Aat	p.D611N	ACO2_ENST00000396512.3_Missense_Mutation_p.D636N|POLR3H_ENST00000355209.4_3'UTR|POLR3H_ENST00000396504.2_3'UTR	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial	611					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)	p.D611N(1)		breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						TGGGCACTTGGATAACATCTC	0.552											OREG0026589	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	22											136.0	114.0	121.0					22																	41922335		2203	4300	6503	40252281	SO:0001583	missense	50			AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.1831G>A	22.37:g.41922335G>A	ENSP00000216254:p.Asp611Asn	904	40252281	O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Missense_Mutation	SNP	ENST00000216254.4	37	CCDS14017.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	27.6	4.844261	0.91197	.	.	ENSG00000100412	ENST00000541439;ENST00000544234;ENST00000216254;ENST00000396512	T;T	0.44482	0.92;0.92	5.51	5.51	0.81932	Aconitase/3-isopropylmalate dehydratase, swivel (2);Aconitase A/isopropylmalate dehydratase small subunit, swivel (1);	0.087842	0.85682	D	0.000000	T	0.60130	0.2245	M	0.83852	2.665	0.80722	D	1	P;B	0.36712	0.566;0.371	P;B	0.46208	0.507;0.242	T	0.64597	-0.6370	10	0.87932	D	0	.	17.9747	0.89123	0.0:0.0:1.0:0.0	.	636;611	A2A274;Q99798	.;ACON_HUMAN	N	332;592;611;636	ENSP00000216254:D611N;ENSP00000379769:D636N	ENSP00000216254:D611N	D	+	1	0	ACO2	40252281	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.746000	0.94184	0.591000	0.81541	GAT		0.552	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259151.1	NM_001098		Missense_Mutation
SETD5	55209	broad.mit.edu	37	3	9512490	9512490	+	Silent	SNP	A	A	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr3:9512490A>G	ENST00000406341.1	+	18	3262	c.3072A>G	c.(3070-3072)ggA>ggG	p.G1024G	SETD5_ENST00000402466.1_Silent_p.G926G|SETD5_ENST00000407969.1_Silent_p.G1043G|SETD5_ENST00000402198.1_Silent_p.G1024G|SETD5_ENST00000302463.6_Silent_p.G926G			Q9C0A6	SETD5_HUMAN	SET domain containing 5	1024								p.G926G(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		CTGCAGAAGGATTTTCCAGCA	0.512																																																1	Substitution - coding silent(1)	ovary(1)	3											39.0	37.0	38.0					3																	9512490		1869	4108	5977	9487490	SO:0001819	synonymous_variant	55209			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.3072A>G	3.37:g.9512490A>G			9487490	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Silent	SNP	ENST00000406341.1	37	CCDS46741.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	9.182	1.023809	0.19433	.	.	ENSG00000168137	ENST00000399686;ENST00000421188	.	.	.	5.51	-3.75	0.04372	.	.	.	.	.	T	0.51890	0.1701	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50039	-0.8874	4	.	.	.	-7.7214	9.171	0.37081	0.3359:0.4754:0.1886:0.0	.	.	.	.	V	692;355	.	.	I	+	1	0	SETD5	9487490	0.193000	0.23313	0.968000	0.41197	0.996000	0.88848	-0.584000	0.05800	-0.700000	0.05070	0.482000	0.46254	ATT		0.512	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614		Silent
EPM2AIP1	9852	broad.mit.edu	37	3	37034557	37034557	+	Silent	SNP	C	C	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr3:37034557C>G	ENST00000322716.5	-	1	238	c.12G>C	c.(10-12)acG>acC	p.T4T	MLH1_ENST00000458205.2_5'Flank|MLH1_ENST00000435176.1_5'Flank|MLH1_ENST00000231790.2_5'Flank|MLH1_ENST00000539477.1_5'Flank|MLH1_ENST00000455445.2_5'Flank|MLH1_ENST00000536378.1_5'Flank	NM_014805.3	NP_055620.1	Q7L775	EPMIP_HUMAN	EPM2A (laforin) interacting protein 1	4					positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)		p.T4T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(12)|ovary(2)	27						TTCTTTTGGGCGTCATCCACA	0.617																																																1	Substitution - coding silent(1)	ovary(1)	3											58.0	63.0	62.0					3																	37034557		1960	4128	6088	37009561	SO:0001819	synonymous_variant	9852			AB018309	CCDS46790.1	3p22.1	2003-03-26							19735	protein-coding gene	gene with protein product		607911					Standard	NM_014805		Approved	KIAA0766, FLJ11207	uc003cgk.3	Q7L775		ENST00000322716.5:c.12G>C	3.37:g.37034557C>G			37009561	O94866|Q9H3L3	Silent	SNP	ENST00000322716.5	37	CCDS46790.1	SNP	27	Broad																																																																																				0.617	EPM2AIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470593.1	NM_014805		Silent
TGM4	7047	broad.mit.edu	37	3	44952866	44952866	+	Silent	SNP	G	G	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr3:44952866G>T	ENST00000296125.4	+	13	1949	c.1881G>T	c.(1879-1881)ctG>ctT	p.L627L		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	627					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.L627L(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	TGGAAAGCCTGGGCATCTCCT	0.458																																																1	Substitution - coding silent(1)	ovary(1)	3											134.0	127.0	129.0					3																	44952866		2203	4300	6503	44927870	SO:0001819	synonymous_variant	7047			BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.1881G>T	3.37:g.44952866G>T			44927870	Q16707|Q96QN4	Silent	SNP	ENST00000296125.4	37	CCDS2723.1	SNP	47	Broad																																																																																				0.458	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241		Silent
CD200R1	131450	broad.mit.edu	37	3	112648325	112648325	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr3:112648325T>C	ENST00000471858.1	-	3	395	c.163A>G	c.(163-165)Aca>Gca	p.T55A	CD200R1_ENST00000440122.2_Missense_Mutation_p.T78A|CD200R1_ENST00000295863.4_Missense_Mutation_p.T33A|CD200R1_ENST00000490004.1_Missense_Mutation_p.T55A|CD200R1_ENST00000308611.3_Missense_Mutation_p.T78A	NM_170780.2	NP_740750.1	Q8TD46	MO2R1_HUMAN	CD200 receptor 1	55	Ig-like V-type.				regulation of immune response (GO:0050776)|viral process (GO:0016032)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.T78A(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	26						ACAGCATTTGTAGCCATCTTT	0.378																																																1	Substitution - Missense(1)	ovary(1)	3											83.0	80.0	81.0					3																	112648325		2203	4300	6503	114131015	SO:0001583	missense	131450			AK126349	CCDS2969.1, CCDS2970.1, CCDS46889.1, CCDS54623.1	3q13	2014-05-15	2004-08-31	2004-09-01	ENSG00000163606	ENSG00000163606		"""Immunoglobulin superfamily / C2-set domain containing"""	24235	protein-coding gene	gene with protein product		607546	"""MOX2 receptor"""	MOX2R		10981966, 11133863	Standard	NM_138806		Approved	OX2R, HCRTR2, CD200R	uc003dzj.1	Q8TD46	OTTHUMG00000159298	ENST00000471858.1:c.163A>G	3.37:g.112648325T>C	ENSP00000418928:p.Thr55Ala		114131015	B3KWZ9|E9PCM9|Q52LJ7|Q6IS95|Q6UW94|Q6WHB8|Q8TD44|Q8TD45|Q8TD52	Missense_Mutation	SNP	ENST00000471858.1	37	CCDS2970.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	12.14	1.847826	0.32606	.	.	ENSG00000163606	ENST00000471858;ENST00000308611;ENST00000295863;ENST00000440122;ENST00000490004	T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59	5.5	-1.56	0.08532	Immunoglobulin subtype (1);	0.685163	0.14450	N	0.318866	T	0.28532	0.0706	M	0.71581	2.175	0.09310	N	1	B;B;B;B;B	0.33120	0.398;0.012;0.012;0.016;0.028	B;B;B;B;B	0.37144	0.242;0.011;0.011;0.008;0.019	T	0.29852	-0.9998	10	0.62326	D	0.03	.	3.1769	0.06571	0.2783:0.2427:0.0:0.4789	.	33;55;78;55;78	B4E2U2;Q8TD46-3;Q8TD46-2;Q8TD46;Q8TD46-4	.;.;.;MO2R1_HUMAN;.	A	55;78;33;78;55	ENSP00000418928:T55A;ENSP00000311035:T78A;ENSP00000295863:T33A;ENSP00000405733:T78A;ENSP00000418801:T55A	ENSP00000295863:T33A	T	-	1	0	CD200R1	114131015	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.407000	0.07178	-0.168000	0.10853	0.455000	0.32223	ACA		0.378	CD200R1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354467.1	NM_138806		Missense_Mutation
DCUN1D1	54165	broad.mit.edu	37	3	182681755	182681755	+	Missense_Mutation	SNP	A	A	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr3:182681755A>C	ENST00000292782.4	-	3	456	c.303T>G	c.(301-303)agT>agG	p.S101R	DCUN1D1_ENST00000469954.1_Missense_Mutation_p.S86R	NM_020640.2	NP_065691.2	Q96GG9	DCNL1_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 1	101	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					ubiquitin ligase complex (GO:0000151)		p.S101R(1)		endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TAATCAACACACTAATGCTGG	0.418																																																1	Substitution - Missense(1)	ovary(1)	3											152.0	125.0	134.0					3																	182681755		2203	4300	6503	184164449	SO:0001583	missense	54165			AF292100, AK056335	CCDS3240.1	3q26.3	2013-06-10	2013-06-10		ENSG00000043093	ENSG00000043093			18184	protein-coding gene	gene with protein product	"""squamous cell carcinoma related oncogene"""	605905	"""DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)"""			10777668, 15988528	Standard	NM_020640		Approved	RP42, SCRO, DCUN1L1, Tes3, SCCRO	uc003fld.1	Q96GG9	OTTHUMG00000158314	ENST00000292782.4:c.303T>G	3.37:g.182681755A>C	ENSP00000292782:p.Ser101Arg		184164449	B2RB37|Q7L3G9|Q8TEX7|Q9H6M1|Q9HCT3	Missense_Mutation	SNP	ENST00000292782.4	37	CCDS3240.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	13.78	2.339431	0.41398	.	.	ENSG00000043093	ENST00000292782;ENST00000469954;ENST00000497606;ENST00000460412;ENST00000487822	.	.	.	5.94	0.982	0.19762	Domain of unknown function DUF298 (1);	0.037659	0.85682	D	0.000000	T	0.28699	0.0711	N	0.20445	0.575	0.53688	D	0.999976	D	0.53885	0.963	B	0.43950	0.437	T	0.06881	-1.0802	9	0.12430	T	0.62	-33.1485	9.5185	0.39120	0.7388:0.0:0.2612:0.0	.	101	Q96GG9	DCNL1_HUMAN	R	101;86;86;86;86	.	ENSP00000292782:S101R	S	-	3	2	DCUN1D1	184164449	0.995000	0.38212	0.997000	0.53966	0.995000	0.86356	0.654000	0.24918	-0.050000	0.13356	0.482000	0.46254	AGT		0.418	DCUN1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350658.1	NM_020640		Missense_Mutation
PI4K2B	55300	broad.mit.edu	37	4	25262149	25262149	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr4:25262149G>C	ENST00000264864.6	+	6	1103	c.914G>C	c.(913-915)aGg>aCg	p.R305T	PI4K2B_ENST00000512921.1_Missense_Mutation_p.R209T	NM_018323.3	NP_060793.2	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	305	PI3K/PI4K.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.R305T(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|skin(3)	15		Breast(46;0.173)				TTGAAAGACAGGGGCAATGAT	0.299																																																1	Substitution - Missense(1)	ovary(1)	4											115.0	124.0	121.0					4																	25262149		2203	4299	6502	24871247	SO:0001583	missense	55300			AK001967	CCDS3433.1	4p15.31	2009-05-07			ENSG00000038210	ENSG00000038210			18215	protein-coding gene	gene with protein product		612101				11923287	Standard	NM_018323		Approved	PI4KIIB, FLJ11105, PIK42B	uc003grk.2	Q8TCG2	OTTHUMG00000128564	ENST00000264864.6:c.914G>C	4.37:g.25262149G>C	ENSP00000264864:p.Arg305Thr		24871247	Q9NUW2	Missense_Mutation	SNP	ENST00000264864.6	37	CCDS3433.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	28.1	4.890372	0.91889	.	.	ENSG00000038210	ENST00000512921;ENST00000264864;ENST00000537420	D;D	0.98914	-5.23;-5.23	5.76	5.76	0.90799	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.046975	0.85682	D	0.000000	D	0.99468	0.9811	H	0.97806	4.08	0.80722	D	1	D	0.54207	0.965	P	0.59221	0.854	D	0.98335	1.0535	10	0.87932	D	0	-8.3356	20.3239	0.98686	0.0:0.0:1.0:0.0	.	305	Q8TCG2	P4K2B_HUMAN	T	209;305;274	ENSP00000423373:R209T;ENSP00000264864:R305T	ENSP00000264864:R305T	R	+	2	0	PI4K2B	24871247	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	8.192000	0.89718	2.881000	0.98747	0.650000	0.86243	AGG		0.299	PI4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250415.1	NM_018323		Missense_Mutation
FAM114A1	92689	broad.mit.edu	37	4	38907438	38907438	+	Missense_Mutation	SNP	T	T	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr4:38907438T>G	ENST00000358869.2	+	6	789	c.613T>G	c.(613-615)Tct>Gct	p.S205A	FAM114A1_ENST00000515037.1_5'UTR	NM_138389.2	NP_612398.2	Q8IWE2	NXP20_HUMAN	family with sequence similarity 114, member A1	205						cytoplasm (GO:0005737)		p.S205A(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	20						TTCATCAGCCTCTCGGGGTAT	0.502																																																1	Substitution - Missense(1)	ovary(1)	4											53.0	48.0	50.0					4																	38907438		2203	4300	6503	38583833	SO:0001583	missense	92689				CCDS3447.1	4p14	2006-09-21			ENSG00000197712	ENSG00000197712			25087	protein-coding gene	gene with protein product							Standard	NM_138389		Approved	Noxp20	uc003gtn.3	Q8IWE2	OTTHUMG00000128583	ENST00000358869.2:c.613T>G	4.37:g.38907438T>G	ENSP00000351740:p.Ser205Ala		38583833	A8K9W6|Q6MZV4|Q9BVL6	Missense_Mutation	SNP	ENST00000358869.2	37	CCDS3447.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	0.816	-0.750357	0.03041	.	.	ENSG00000197712	ENST00000358869	T	0.38887	1.11	5.38	2.97	0.34412	.	0.404826	0.28754	N	0.014242	T	0.33469	0.0864	N	0.20685	0.6	0.09310	N	0.999995	D	0.53885	0.963	P	0.54889	0.763	T	0.12218	-1.0556	10	0.12430	T	0.62	-4.4632	7.3777	0.26837	0.0:0.2375:0.0:0.7625	.	205	Q8IWE2	NXP20_HUMAN	A	205	ENSP00000351740:S205A	ENSP00000351740:S205A	S	+	1	0	FAM114A1	38583833	1.000000	0.71417	0.072000	0.20136	0.047000	0.14425	2.158000	0.42329	1.000000	0.39049	-0.250000	0.11733	TCT		0.502	FAM114A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250436.1	NM_138389		Missense_Mutation
CCNI	10983	broad.mit.edu	37	4	77976394	77976394	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr4:77976394G>C	ENST00000237654.4	-	6	1175	c.599C>G	c.(598-600)tCc>tGc	p.S200C	CCNI_ENST00000537948.1_Missense_Mutation_p.S186C|CCNI_ENST00000504697.1_5'Flank	NM_006835.2	NP_006826.1	Q14094	CCNI_HUMAN	cyclin I	200					regulation of cell cycle (GO:0051726)|spermatogenesis (GO:0007283)			p.S200C(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	9						AGCAAGCATGGATCCTCTGAA	0.453																																																1	Substitution - Missense(1)	ovary(1)	4											130.0	113.0	119.0					4																	77976394		2203	4300	6503	78195418	SO:0001583	missense	10983			D50310	CCDS3580.1	4q21.1	2014-07-03			ENSG00000118816	ENSG00000118816			1595	protein-coding gene	gene with protein product						7493655	Standard	NM_006835		Approved	CCNI1	uc003hkm.3	Q14094	OTTHUMG00000130106	ENST00000237654.4:c.599C>G	4.37:g.77976394G>C	ENSP00000237654:p.Ser200Cys		78195418	B2R6M0|B7Z6X4	Missense_Mutation	SNP	ENST00000237654.4	37	CCDS3580.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	28.5	4.921672	0.92319	.	.	ENSG00000118816	ENST00000237654;ENST00000537948	T;T	0.25749	1.78;1.78	5.86	5.86	0.93980	Cyclin-like (1);	0.045975	0.85682	D	0.000000	T	0.55529	0.1926	M	0.78049	2.395	0.80722	D	1	P;D	0.89917	0.941;1.0	P;D	0.70016	0.728;0.967	T	0.55573	-0.8120	10	0.87932	D	0	-1.0767	20.5632	0.99335	0.0:0.0:1.0:0.0	.	186;200	B7Z6X4;Q14094	.;CCNI_HUMAN	C	200;186	ENSP00000237654:S200C;ENSP00000441001:S186C	ENSP00000237654:S200C	S	-	2	0	CCNI	78195418	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.332000	0.96446	2.937000	0.99478	0.650000	0.86243	TCC		0.453	CCNI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252412.2	NM_006835		Missense_Mutation
NAA11	84779	broad.mit.edu	37	4	80246442	80246442	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr4:80246442G>A	ENST00000286794.4	-	1	762	c.590C>T	c.(589-591)cCg>cTg	p.P197L	NAA11_ENST00000513733.1_5'UTR	NM_032693.2	NP_116082.1	Q9BSU3	NAA11_HUMAN	N(alpha)-acetyltransferase 11, NatA catalytic subunit	197					N-terminal protein amino acid acetylation (GO:0006474)	NatA complex (GO:0031415)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)	p.P197L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|skin(2)	23						TTCGGTAGCCGGGTTCTTTTG	0.557																																																1	Substitution - Missense(1)	ovary(1)	4											48.0	51.0	50.0					4																	80246442		2001	4181	6182	80465466	SO:0001583	missense	84779				CCDS47084.1	4q21.23	2010-05-07	2010-01-14	2010-01-14		ENSG00000156269	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	28125	protein-coding gene	gene with protein product			"""ARD1 homolog B (S. cerevisiae)"""	ARD1B		16638120, 19660095	Standard	NM_032693		Approved	ARD2, hARD2	uc003hlt.4	Q9BSU3		ENST00000286794.4:c.590C>T	4.37:g.80246442G>A	ENSP00000286794:p.Pro197Leu		80465466	Q66K19|Q6P479	Missense_Mutation	SNP	ENST00000286794.4	37	CCDS47084.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	5.896	0.349473	0.11182	.	.	ENSG00000156269	ENST00000286794	T	0.54071	0.59	5.17	1.37	0.22104	.	0.639758	0.13938	U	0.352433	T	0.24967	0.0606	N	0.04090	-0.28	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.17930	-1.0353	10	0.22706	T	0.39	-1.7313	6.0799	0.19935	0.2289:0.1373:0.6338:0.0	.	197	Q9BSU3	NAA11_HUMAN	L	197	ENSP00000286794:P197L	ENSP00000286794:P197L	P	-	2	0	NAA11	80465466	0.007000	0.16637	0.000000	0.03702	0.007000	0.05969	0.454000	0.21827	0.112000	0.17975	-0.302000	0.09304	CCG		0.557	NAA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362922.1			Missense_Mutation
HSD17B11	51170	broad.mit.edu	37	4	88278431	88278431	+	Splice_Site	SNP	C	C	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr4:88278431C>A	ENST00000358290.4	-	5	1010	c.695G>T	c.(694-696)aGt>aTt	p.S232I	HSD17B11_ENST00000507518.1_5'UTR|HSD17B11_ENST00000507286.1_Splice_Site_p.S188I	NM_016245.3	NP_057329.2	Q8NBQ5	DHB11_HUMAN	hydroxysteroid (17-beta) dehydrogenase 11	232					androgen catabolic process (GO:0006710)|steroid biosynthetic process (GO:0006694)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|lipid particle (GO:0005811)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|steroid dehydrogenase activity (GO:0016229)	p.S232I(1)		cervix(1)|endometrium(4)|kidney(2)|lung(2)|ovary(2)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		CTCAACTTACCTTGTACTTGG	0.378																																																1	Substitution - Missense(1)	ovary(1)	4											130.0	108.0	115.0					4																	88278431		2202	4300	6502	88497455	SO:0001630	splice_region_variant	51170			AF126780	CCDS3619.1	4q22.1	2011-09-20	2006-11-22	2006-11-22	ENSG00000198189	ENSG00000198189	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	22960	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 2"", ""short chain dehydrogenase/reductase family 16C, member 2"""	612831	"""dehydrogenase/reductase (SDR family) member 8"""	DHRS8		11165019, 12697717, 19027726	Standard	XM_006714232		Approved	RetSDR2, 17-BETA-HSD11, 17-BETA-HSDXI, PAN1B, SDR16C2	uc003hqp.2	Q8NBQ5	OTTHUMG00000130594	ENST00000358290.4:c.695+1G>T	4.37:g.88278431C>A			88497455	Q96HF6|Q9UKU4	Missense_Mutation	SNP	ENST00000358290.4	37	CCDS3619.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	11.88	1.772071	0.31320	.	.	ENSG00000198189	ENST00000358290;ENST00000507286	D;T	0.89415	-2.51;0.72	5.66	-1.24	0.09435	NAD(P)-binding domain (1);	0.405503	0.27362	N	0.019716	T	0.79563	0.4467	L	0.43923	1.385	0.30964	N	0.723362	P	0.36647	0.563	B	0.33960	0.173	T	0.71276	-0.4641	9	.	.	.	.	6.6355	0.22881	0.0:0.5003:0.117:0.3827	.	232	Q8NBQ5	DHB11_HUMAN	I	232;188	ENSP00000351035:S232I;ENSP00000423775:S188I	.	S	-	2	0	HSD17B11	88497455	0.999000	0.42202	0.705000	0.30386	0.638000	0.38207	0.366000	0.20365	-0.676000	0.05238	0.561000	0.74099	AGT		0.378	HSD17B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253041.1	NM_016245	Missense_Mutation	Missense_Mutation
ALPK1	80216	broad.mit.edu	37	4	113352995	113352995	+	Silent	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr4:113352995G>A	ENST00000458497.1	+	11	2571	c.2292G>A	c.(2290-2292)gaG>gaA	p.E764E	ALPK1_ENST00000504176.2_Silent_p.E686E|ALPK1_ENST00000177648.9_Silent_p.E764E	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	764							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E764E(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		AGGGGAAAGAGCAGGGAGAAG	0.458																																																1	Substitution - coding silent(1)	ovary(1)	4											60.0	65.0	63.0					4																	113352995		2203	4300	6503	113572444	SO:0001819	synonymous_variant	80216			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.2292G>A	4.37:g.113352995G>A			113572444	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Silent	SNP	ENST00000458497.1	37	CCDS3697.1	SNP	34	Broad																																																																																				0.458	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144		Silent
CDH9	1007	broad.mit.edu	37	5	26988417	26988417	+	Silent	SNP	T	T	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr5:26988417T>C	ENST00000231021.4	-	2	196	c.24A>G	c.(22-24)ccA>ccG	p.P8P		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	8					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P8P(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AGATGAATAATGGTATATAAT	0.338																																					Melanoma(8;187 585 15745 40864 52829)											1	Substitution - coding silent(1)	ovary(1)	5											127.0	133.0	131.0					5																	26988417		2203	4300	6503	27024174	SO:0001819	synonymous_variant	1007			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.24A>G	5.37:g.26988417T>C			27024174	Q3B7I5	Silent	SNP	ENST00000231021.4	37	CCDS3893.1	SNP	51	Broad																																																																																				0.338	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		Silent
DHX29	54505	broad.mit.edu	37	5	54593190	54593190	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr5:54593190C>G	ENST00000251636.5	-	3	446	c.298G>C	c.(298-300)Gga>Cga	p.G100R	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	100						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)	p.G100R(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TTGATCACTCCAATAATTCTT	0.294																																																1	Substitution - Missense(1)	ovary(1)	5											143.0	133.0	136.0					5																	54593190		2201	4300	6501	54628947	SO:0001583	missense	54505			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.298G>C	5.37:g.54593190C>G	ENSP00000251636:p.Gly100Arg		54628947	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	ENST00000251636.5	37	CCDS34158.1	SNP	21	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.80|18.80	3.700676|3.700676	0.68501|0.68501	.|.	.|.	ENSG00000067248|ENSG00000067248	ENST00000251636|ENST00000508346	T|.	0.41065|.	1.01|.	5.62|5.62	3.82|3.82	0.43975|0.43975	.|.	0.286641|.	0.40302|.	N|.	0.001140|.	T|T	0.30198|0.30198	0.0757|0.0757	N|N	0.25647|0.25647	0.755|0.755	0.30824|0.30824	N|N	0.737411|0.737411	P|.	0.35077|.	0.483|.	B|.	0.27887|.	0.084|.	T|T	0.28170|0.28170	-1.0052|-1.0052	10|5	0.12430|.	T|.	0.62|.	.|.	6.1937|6.1937	0.20538|0.20538	0.1385:0.6564:0.1336:0.0715|0.1385:0.6564:0.1336:0.0715	.|.	100|.	Q7Z478|.	DHX29_HUMAN|.	R|S	100|64	ENSP00000251636:G100R|.	ENSP00000251636:G100R|.	G|W	-|-	1|2	0|0	DHX29|DHX29	54628947|54628947	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	1.420000|1.420000	0.34804|0.34804	0.712000|0.712000	0.32039|0.32039	0.591000|0.591000	0.81541|0.81541	GGA|TGG		0.294	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030		Missense_Mutation
ANKRD32	84250	broad.mit.edu	37	5	94022410	94022410	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr5:94022410C>G	ENST00000265140.5	+	16	2527	c.2108C>G	c.(2107-2109)tCt>tGt	p.S703C		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	703						centrosome (GO:0005813)|nucleus (GO:0005634)		p.S67C(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		GAGCCACTCTCTCTTCAGAAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	5											100.0	101.0	101.0					5																	94022410		2203	4300	6503	94048166	SO:0001583	missense	84250			AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.2108C>G	5.37:g.94022410C>G	ENSP00000265140:p.Ser703Cys		94048166	B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	ENST00000265140.5	37	CCDS4071.2	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	19.36	3.813109	0.70912	.	.	ENSG00000133302	ENST00000265140	T	0.65732	-0.17	5.63	5.63	0.86233	.	0.077565	0.64402	D	0.000008	T	0.65863	0.2732	L	0.34521	1.04	0.38129	D	0.938108	D	0.69078	0.997	P	0.57371	0.819	T	0.70960	-0.4730	10	0.87932	D	0	.	14.4887	0.67634	0.147:0.853:0.0:0.0	.	703	Q9BQI6	ANR32_HUMAN	C	703	ENSP00000265140:S703C	ENSP00000265140:S703C	S	+	2	0	ANKRD32	94048166	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.166000	0.71896	2.798000	0.96311	0.655000	0.94253	TCT		0.358	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241610.1	NM_032290		Missense_Mutation
LECT2	3950	broad.mit.edu	37	5	135273113	135273113	+	Intron	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr5:135273113G>A	ENST00000522943.1	-	3	418				FBXL21_ENST00000297158.9_RNA|LECT2_ENST00000471827.1_5'Flank|FBXL21_ENST00000467490.1_RNA			O14960	LECT2_HUMAN	leukocyte cell-derived chemotaxin 2						chemotaxis (GO:0006935)|negative regulation of Wnt signaling pathway (GO:0030178)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	identical protein binding (GO:0042802)	p.?(1)		large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGTCTGTCTAGGTTGACAGTA	0.368																																																1	Unknown(1)	ovary(1)	5											58.0	57.0	57.0					5																	135273113		1856	4105	5961	135301012	SO:0001627	intron_variant	26223			AB007546	CCDS4190.1	5q31.1	2008-05-15			ENSG00000145826	ENSG00000145826			6550	protein-coding gene	gene with protein product		602882				9545637	Standard	NM_002302		Approved	chm-II, chm2	uc003lbe.1	O14960	OTTHUMG00000129146	ENST00000522943.1:c.289+13798C>T	5.37:g.135273113G>A			135301012	B2RA90|O14565|Q52M49	Splice_Site_SNP	SNP	ENST00000522943.1	37		SNP	35	Broad																																																																																				0.368	LECT2-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000381629.1	NM_002302		Splice_Site_SNP
PCDHA2	56146	broad.mit.edu	37	5	140176193	140176193	+	Silent	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr5:140176193C>T	ENST00000526136.1	+	1	1644	c.1644C>T	c.(1642-1644)aaC>aaT	p.N548N	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Silent_p.N548N|PCDHA2_ENST00000378132.1_Silent_p.N548N	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	548	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGCAGCAACGTGACGCTGC	0.682																																																0			5											68.0	70.0	69.0					5																	140176193		2203	4294	6497	140156377	SO:0001819	synonymous_variant	56146			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1644C>T	5.37:g.140176193C>T			140156377	O75287|Q9BTV3	Silent	SNP	ENST00000526136.1	37	CCDS54914.1	SNP	19	Broad																																																																																				0.682	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		Silent
PCDHA9	9752	broad.mit.edu	37	5	140229031	140229031	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr5:140229031G>T	ENST00000532602.1	+	1	1984	c.951G>T	c.(949-951)aaG>aaT	p.K317N	PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.K317N|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	317	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K317N(1)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCACACAAGATCCCAGTCG	0.448																																					Melanoma(55;1800 1972 14909)											1	Substitution - Missense(1)	ovary(1)	5											59.0	55.0	56.0					5																	140229031		2195	4260	6455	140209215	SO:0001583	missense	9752			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.951G>T	5.37:g.140229031G>T	ENSP00000436042:p.Lys317Asn		140209215	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	CCDS54920.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.13	1.846203	0.32606	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.51325	0.71;0.71	3.79	-4.33	0.03677	Cadherin (4);Cadherin-like (1);	0.562209	0.12831	U	0.435615	T	0.40272	0.1110	N	0.26092	0.79	0.09310	N	1	B;D	0.58268	0.007;0.982	B;P	0.58970	0.067;0.849	T	0.32666	-0.9898	10	0.87932	D	0	.	2.8774	0.05635	0.4008:0.1135:0.3732:0.1125	.	317;317	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	N	317	ENSP00000436042:K317N;ENSP00000367362:K317N	ENSP00000367362:K317N	K	+	3	2	PCDHA9	140209215	0.000000	0.05858	0.000000	0.03702	0.231000	0.25187	-1.147000	0.03188	-0.920000	0.03799	0.313000	0.20887	AAG		0.448	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857		Missense_Mutation
PCDHB13	56123	broad.mit.edu	37	5	140595953	140595954	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr5:140595953_140595954TG>CT	ENST00000341948.4	+	1	2445_2446	c.2258_2259TG>CT	c.(2257-2259)gTG>gCT	p.V753A		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	753					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V753A(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGTATGAGGTGTGTCTGGCAG	0.579																																																1	Substitution - Missense(1)	ovary(1)	5																																								140576138	SO:0001583	missense	56123			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	Exception_encountered	5.37:g.140595953_140595954delinsCT	ENSP00000345491:p.Val753Ala		140576137	A8K9V6	Missense_Mutation	DNP	ENST00000341948.4	37	CCDS4255.1	DNP	59	Broad																																																																																				0.579	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		Missense_Mutation
RARS	5917	broad.mit.edu	37	5	167929031	167929031	+	Silent	SNP	G	G	A			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr5:167929031G>A	ENST00000231572.3	+	9	1032	c.978G>A	c.(976-978)ttG>ttA	p.L326L	RARS_ENST00000538719.1_Silent_p.L120L|RARS_ENST00000520421.1_3'UTR	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	326					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)	p.L326L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		ATGATGCATTGGACGTCTCTT	0.313																																																1	Substitution - coding silent(1)	ovary(1)	5											92.0	99.0	97.0					5																	167929031		2202	4294	6496	167861609	SO:0001819	synonymous_variant	5917			BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.978G>A	5.37:g.167929031G>A			167861609	B2RBS9|Q53GY4|Q9BWA1	Silent	SNP	ENST00000231572.3	37	CCDS4367.1	SNP	47	Broad																																																																																				0.313	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252794.2	NM_002887		Silent
CUL9	23113	broad.mit.edu	37	6	43174143	43174143	+	Missense_Mutation	SNP	C	C	T	rs199801229		TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr6:43174143C>T	ENST00000252050.4	+	26	5191	c.5107C>T	c.(5107-5109)Cgc>Tgc	p.R1703C	CUL9_ENST00000354495.3_Missense_Mutation_p.R1593C|CUL9_ENST00000372647.2_Missense_Mutation_p.R1703C|CUL9_ENST00000502937.1_3'UTR	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1703					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)	p.R1703C(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CCTGTCACCACGCTGCTGGCC	0.507													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20085	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	6											119.0	118.0	118.0					6																	43174143		2203	4300	6503	43282121	SO:0001583	missense	23113			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5107C>T	6.37:g.43174143C>T	ENSP00000252050:p.Arg1703Cys		43282121	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	SNP	19	Broad	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	25.3	4.628807	0.87560	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.74315	-0.83;-0.83;-0.83	5.36	5.36	0.76844	Cullin, N-terminal (1);Cullin homology (2);	0.000000	0.85682	D	0.000000	D	0.82453	0.5040	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.84050	0.0369	10	0.87932	D	0	-24.5937	19.0923	0.93231	0.0:1.0:0.0:0.0	.	1593;1703;1703	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	C	1703;1593;1703	ENSP00000252050:R1703C;ENSP00000346490:R1593C;ENSP00000361730:R1703C	ENSP00000252050:R1703C	R	+	1	0	CUL9	43282121	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.343000	0.65976	2.507000	0.84556	0.591000	0.81541	CGC		0.507	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		Missense_Mutation
CUL9	23113	broad.mit.edu	37	6	43174215	43174215	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr6:43174215G>T	ENST00000252050.4	+	26	5263	c.5179G>T	c.(5179-5181)Gcc>Tcc	p.A1727S	CUL9_ENST00000354495.3_Missense_Mutation_p.A1617S|CUL9_ENST00000372647.2_Missense_Mutation_p.A1727S|CUL9_ENST00000502937.1_3'UTR	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1727					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)	p.A1727S(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						ATTCTGTGATGCCCTTGACCG	0.542																																																1	Substitution - Missense(1)	ovary(1)	6											107.0	104.0	105.0					6																	43174215		2203	4300	6503	43282193	SO:0001583	missense	23113			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5179G>T	6.37:g.43174215G>T	ENSP00000252050:p.Ala1727Ser		43282193	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	10.75	1.438999	0.25900	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.74632	-0.86;-0.86;-0.86	5.36	3.3	0.37823	Cullin, N-terminal (1);Cullin homology (2);	0.605711	0.18317	N	0.144916	T	0.32071	0.0817	N	0.22421	0.69	0.28811	N	0.898217	P;B;B	0.38370	0.628;0.023;0.023	B;B;B	0.31869	0.137;0.033;0.033	T	0.05131	-1.0904	10	0.22109	T	0.4	-21.2764	3.416	0.07376	0.0999:0.3278:0.4338:0.1384	.	1617;1727;1727	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	S	1727;1617;1727	ENSP00000252050:A1727S;ENSP00000346490:A1617S;ENSP00000361730:A1727S	ENSP00000252050:A1727S	A	+	1	0	CUL9	43282193	0.989000	0.36119	1.000000	0.80357	0.991000	0.79684	1.487000	0.35540	2.507000	0.84556	0.591000	0.81541	GCC		0.542	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		Missense_Mutation
BAI3	577	broad.mit.edu	37	6	69723982	69723982	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr6:69723982G>T	ENST00000370598.1	+	12	2803	c.1982G>T	c.(1981-1983)tGg>tTg	p.W661L		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	661					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.W661L(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				AAGGAAAAATGGGAAGATGCA	0.289																																																1	Substitution - Missense(1)	ovary(1)	6											64.0	67.0	66.0					6																	69723982		2203	4299	6502	69780703	SO:0001583	missense	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1982G>T	6.37:g.69723982G>T	ENSP00000359630:p.Trp661Leu		69780703	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725729	0.89298	.	.	ENSG00000135298	ENST00000370598	T	0.81078	-1.45	5.76	5.76	0.90799	Domain of unknown function DUF3497 (1);	0.132166	0.53938	D	0.000042	D	0.88153	0.6360	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88313	0.2957	10	0.87932	D	0	.	19.952	0.97200	0.0:0.0:1.0:0.0	.	661	O60242	BAI3_HUMAN	L	661	ENSP00000359630:W661L	ENSP00000359630:W661L	W	+	2	0	BAI3	69780703	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.781000	0.91805	2.728000	0.93425	0.655000	0.94253	TGG		0.289	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			Missense_Mutation
PRDM1	639	broad.mit.edu	37	6	106553119	106553119	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr6:106553119C>T	ENST00000369096.4	+	5	1318	c.1084C>T	c.(1084-1086)Cct>Tct	p.P362S	PRDM1_ENST00000369091.2_Missense_Mutation_p.P326S|PRDM1_ENST00000369089.3_Missense_Mutation_p.P228S	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	362					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P326S(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		TACGGTGTCCCCTGTGGGCCC	0.627			"""D, N, Mis, F, S"""		DLBCL																																		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	1	Substitution - Missense(1)	ovary(1)	6											64.0	57.0	59.0					6																	106553119		2203	4300	6503	106659812	SO:0001583	missense	639				CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1084C>T	6.37:g.106553119C>T	ENSP00000358092:p.Pro362Ser		106659812	B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	ENST00000369096.4	37	CCDS5054.2	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	12.03	1.816724	0.32145	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000369089	T;T;T	0.46451	0.87;0.87;0.87	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.53562	0.1804	L	0.55481	1.735	0.53688	D	0.99997	P;D	0.89917	0.533;1.0	B;D	0.69479	0.083;0.964	T	0.50516	-0.8819	10	0.48119	T	0.1	-17.9135	19.427	0.94746	0.0:1.0:0.0:0.0	.	228;362	Q86WM7;O75626	.;PRDM1_HUMAN	S	326;362;326;228	ENSP00000358087:P326S;ENSP00000358092:P362S;ENSP00000358085:P228S	ENSP00000358085:P228S	P	+	1	0	PRDM1	106659812	1.000000	0.71417	0.296000	0.24974	0.327000	0.28475	4.268000	0.58883	2.603000	0.88011	0.655000	0.94253	CCT		0.627	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3			Missense_Mutation
ARHGAP18	93663	broad.mit.edu	37	6	129905237	129905237	+	Silent	SNP	C	C	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr6:129905237C>G	ENST00000368149.2	-	13	1822	c.1734G>C	c.(1732-1734)gtG>gtC	p.V578V	ARHGAP18_ENST00000463225.1_5'UTR	NM_033515.2	NP_277050.2			Rho GTPase activating protein 18									p.V578V(1)		NS(2)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(3)	18				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		GCACTCGAATCACTCCCTGAG	0.453																																																1	Substitution - coding silent(1)	ovary(1)	6											127.0	110.0	116.0					6																	129905237		2203	4300	6503	129946930	SO:0001819	synonymous_variant	93663			AB053293	CCDS34535.1	6q23.1	2011-06-29			ENSG00000146376	ENSG00000146376		"""Rho GTPase activating proteins"""	21035	protein-coding gene	gene with protein product		613351					Standard	NM_033515		Approved	MacGAP, bA307O14.2	uc003qbr.3	Q8N392	OTTHUMG00000015547	ENST00000368149.2:c.1734G>C	6.37:g.129905237C>G			129946930		Silent	SNP	ENST00000368149.2	37	CCDS34535.1	SNP	29	Broad																																																																																				0.453	ARHGAP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042185.2	NM_033515		Silent
IL20RA	53832	broad.mit.edu	37	6	137322974	137322974	+	Silent	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr6:137322974C>T	ENST00000316649.5	-	7	1618	c.1383G>A	c.(1381-1383)gcG>gcA	p.A461A	RP11-204P2.3_ENST00000458017.1_RNA|IL20RA_ENST00000367748.1_Silent_p.A350A|IL20RA_ENST00000541547.1_Silent_p.A412A|IL20RA_ENST00000468393.1_5'Flank	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	461					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)		p.A461A(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		TGTGCTCCTGCGCCAGGGGGT	0.587																																																1	Substitution - coding silent(1)	ovary(1)	6											71.0	70.0	70.0					6																	137322974		2203	4300	6503	137364667	SO:0001819	synonymous_variant	53832			AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.1383G>A	6.37:g.137322974C>T			137364667	B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Silent	SNP	ENST00000316649.5	37	CCDS5181.1	SNP	27	Broad																																																																																				0.587	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042393.1	NM_014432		Silent
CNTNAP2	26047	broad.mit.edu	37	7	146829419	146829419	+	Missense_Mutation	SNP	G	G	A	rs548409884		TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr7:146829419G>A	ENST00000361727.3	+	8	1682	c.1166G>A	c.(1165-1167)cGg>cAg	p.R389Q		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	389					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.R389Q(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GTGCCCGGACGGCTTAACCAG	0.468										HNSCC(39;0.1)			G|||	1	0.000199681	0.0	0.0	5008	,	,		19716	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	7											130.0	121.0	124.0					7																	146829419		2203	4300	6503	146460352	SO:0001583	missense	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1166G>A	7.37:g.146829419G>A	ENSP00000354778:p.Arg389Gln		146460352	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	12.29	1.894153	0.33442	.	.	ENSG00000174469	ENST00000361727	T	0.79352	-1.26	5.7	4.73	0.59995	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.101290	0.39083	N	0.001476	T	0.67757	0.2927	L	0.36672	1.1	0.80722	D	1	B	0.24186	0.099	B	0.17433	0.018	T	0.62407	-0.6861	10	0.30078	T	0.28	.	13.011	0.58731	0.0848:0.0:0.9152:0.0	.	389	Q9UHC6	CNTP2_HUMAN	Q	389	ENSP00000354778:R389Q	ENSP00000354778:R389Q	R	+	2	0	CNTNAP2	146460352	1.000000	0.71417	0.336000	0.25522	0.986000	0.74619	5.337000	0.65941	1.246000	0.43901	0.591000	0.81541	CGG		0.468	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			Missense_Mutation
CSMD3	114788	broad.mit.edu	37	8	114186094	114186094	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr8:114186094A>G	ENST00000297405.5	-	4	810	c.566T>C	c.(565-567)tTa>tCa	p.L189S	CSMD3_ENST00000519485.1_5'Flank|CSMD3_ENST00000455883.2_Missense_Mutation_p.L189S|CSMD3_ENST00000352409.3_Missense_Mutation_p.L189S|CSMD3_ENST00000343508.3_Missense_Mutation_p.L149S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	189	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L189S(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGTGCCATATAATACACCTTT	0.443										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - Missense(1)	ovary(1)	8											98.0	91.0	93.0					8																	114186094		2203	4300	6503	114255270	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.566T>C	8.37:g.114186094A>G	ENSP00000297405:p.Leu189Ser		114255270	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	15.07	2.723500	0.48728	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.1	5.1	0.69264	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.45126	D	0.000384	T	0.70020	0.3176	N	0.26042	0.785	0.33980	D	0.647835	D;D;B;B	0.76494	0.999;0.999;0.01;0.051	D;D;B;B	0.87578	0.996;0.998;0.005;0.025	T	0.72795	-0.4185	10	0.20046	T	0.44	.	14.3781	0.66892	1.0:0.0:0.0:0.0	.	189;189;189;149	Q7Z407-3;Q7Z407-4;Q7Z407;Q7Z407-2	.;.;CSMD3_HUMAN;.	S	149;189;189;189	ENSP00000345799:L149S;ENSP00000297405:L189S;ENSP00000412263:L189S;ENSP00000343124:L189S	ENSP00000297405:L189S	L	-	2	0	CSMD3	114255270	0.992000	0.36948	0.992000	0.48379	0.800000	0.45204	9.221000	0.95188	2.053000	0.61076	0.533000	0.62120	TTA		0.443	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		Missense_Mutation
KLHL9	55958	broad.mit.edu	37	9	21333629	21333629	+	Silent	SNP	A	A	G			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chr9:21333629A>G	ENST00000359039.4	-	1	1750	c.1230T>C	c.(1228-1230)gcT>gcC	p.A410A	KLHL9_ENST00000537938.1_Silent_p.A342A			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	410					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)		p.A410A(1)		endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		CCAGTTCACCAGCTGCACTGC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	9											112.0	101.0	105.0					9																	21333629		2203	4300	6503	21323629	SO:0001819	synonymous_variant	55958			AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.1230T>C	9.37:g.21333629A>G			21323629	Q8TCQ2	Silent	SNP	ENST00000359039.4	37	CCDS6503.1	SNP	7	Broad																																																																																				0.443	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847		Silent
KIAA2022	340533	broad.mit.edu	37	X	73960335	73960335	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chrX:73960335T>C	ENST00000055682.6	-	3	4668	c.4057A>G	c.(4057-4059)Ata>Gta	p.I1353V		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1353					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.I1353V(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GAGTAGAATATGTTGGGATCC	0.473																																																1	Substitution - Missense(1)	ovary(1)	X											68.0	63.0	65.0					X																	73960335		2203	4300	6503	73877060	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.4057A>G	X.37:g.73960335T>C	ENSP00000055682:p.Ile1353Val		73877060	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	2.261	-0.369213	0.05069	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.29917	1.55;1.55	5.55	1.84	0.25277	.	0.534254	0.21838	N	0.068374	T	0.16938	0.0407	L	0.27053	0.805	0.09310	N	0.999998	B	0.06786	0.001	B	0.08055	0.003	T	0.23297	-1.0192	10	0.22109	T	0.4	0.0104	5.5779	0.17233	0.0:0.2189:0.1312:0.6498	.	1353	Q5QGS0	K2022_HUMAN	V	1353	ENSP00000362567:I1353V;ENSP00000055682:I1353V	ENSP00000055682:I1353V	I	-	1	0	KIAA2022	73877060	0.959000	0.32827	0.013000	0.15412	0.668000	0.39293	0.877000	0.28106	-0.018000	0.14079	0.441000	0.28932	ATA		0.473	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		Missense_Mutation
OCRL	4952	broad.mit.edu	37	X	128724128	128724128	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2352-01	TCGA-59-2352-10							Unknown	Unknown	Unknown	x	x	---			x	TCGA-59-2352-01	TCGA-59-2352-10	g.chrX:128724128C>T	ENST00000371113.4	+	24	2752	c.2587C>T	c.(2587-2589)Ctc>Ttc	p.L863F	OCRL_ENST00000357121.5_Missense_Mutation_p.L855F	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	863	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)	p.L863F(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						TGTAGCTACTCTCTTCACTAG	0.512																																																1	Substitution - Missense(1)	ovary(1)	X											208.0	191.0	196.0					X																	128724128		2203	4300	6503	128551809	SO:0001583	missense	4952			U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.2587C>T	X.37:g.128724128C>T	ENSP00000360154:p.Leu863Phe		128551809	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000371113.4	37	CCDS35393.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	17.87	3.494353	0.64186	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	T;T	0.19669	2.13;2.13	5.5	5.5	0.81552	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.41696	0.1170	M	0.74881	2.28	0.52099	D	0.999943	D;D	0.67145	0.996;0.99	P;D	0.65573	0.9;0.936	T	0.37267	-0.9713	10	0.72032	D	0.01	.	8.5602	0.33505	0.0:0.7642:0.1509:0.0849	.	855;863	Q01968-2;Q01968	.;OCRL_HUMAN	F	863;855	ENSP00000360154:L863F;ENSP00000349635:L855F	ENSP00000349635:L855F	L	+	1	0	OCRL	128551809	0.989000	0.36119	1.000000	0.80357	0.986000	0.74619	2.703000	0.47110	2.305000	0.77605	0.600000	0.82982	CTC		0.512	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276		Missense_Mutation
