#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
FLG	2312	broad.mit.edu	37	1	152278623	152278623	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr1:152278623T>G	ENST00000368799.1	-	3	8774	c.8739A>C	c.(8737-8739)agA>agC	p.R2913S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2913	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R2913S(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGATGGTTTCTGGAAGCAG	0.567									Ichthyosis																																							1	Substitution - Missense(1)	ovary(1)	1											98.0	156.0	138.0					1																	152278623		2016	4296	6312	150545247	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8739A>C	1.37:g.152278623T>G	ENSP00000357789:p.Arg2913Ser		150545247	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	9.281	1.048221	0.19827	.	.	ENSG00000143631	ENST00000368799	T	0.01548	4.78	2.49	-2.1	0.07210	.	.	.	.	.	T	0.00524	0.0017	M	0.70595	2.14	0.09310	N	1	B	0.24258	0.1	B	0.18263	0.021	T	0.50110	-0.8866	9	0.06494	T	0.89	.	3.1441	0.06466	0.0:0.2882:0.224:0.4878	.	2913	P20930	FILA_HUMAN	S	2913	ENSP00000357789:R2913S	ENSP00000357789:R2913S	R	-	3	2	FLG	150545247	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.967000	0.03821	-0.459000	0.07013	0.254000	0.18369	AGA		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		Missense_Mutation
ATP1A4	480	broad.mit.edu	37	1	160144384	160144384	+	Missense_Mutation	SNP	G	G	A	rs150078418		TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr1:160144384G>A	ENST00000368081.4	+	15	2629	c.2158G>A	c.(2158-2160)Gtg>Atg	p.V720M	ATP1A4_ENST00000470705.1_5'Flank|ATP1A4_ENST00000418334.1_3'UTR	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	720					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.V720L(1)|p.V720M(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CGTTGTGGCCGTGACAGGTGA	0.542													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20959	0.0		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|lung(1)	1						G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	102.0	81.0	88.0		2158	4.2	0.9	1	dbSNP_134	88	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ATP1A4	NM_144699.3	21	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	720/1030	160144384	2,13004	2203	4300	6503	158411008	SO:0001583	missense	480			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2158G>A	1.37:g.160144384G>A	ENSP00000357060:p.Val720Met		158411008	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	CCDS1197.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159371	0.78226	2.27E-4	1.16E-4	ENSG00000132681	ENST00000368081	D	0.93488	-3.23	4.2	4.2	0.49525	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.061993	0.64402	D	0.000006	D	0.92681	0.7674	L	0.28274	0.84	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94100	0.7361	10	0.87932	D	0	.	14.4423	0.67325	0.0:0.0:1.0:0.0	.	720	Q13733	AT1A4_HUMAN	M	720	ENSP00000357060:V720M	ENSP00000357060:V720M	V	+	1	0	ATP1A4	158411008	1.000000	0.71417	0.929000	0.37066	0.791000	0.44710	9.619000	0.98369	2.336000	0.79503	0.609000	0.83330	GTG		0.542	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699		Missense_Mutation
C1orf111	284680	broad.mit.edu	37	1	162344302	162344302	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr1:162344302C>T	ENST00000367935.5	-	3	401	c.322G>A	c.(322-324)Gag>Aag	p.E108K	RP11-565P22.6_ENST00000431696.1_Intron	NM_182581.3	NP_872387.2	Q5T0L3	CA111_HUMAN	chromosome 1 open reading frame 111	108								p.E108K(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11	all_hematologic(112;0.15)		BRCA - Breast invasive adenocarcinoma(70;0.0938)			AGCTGGCTCTCTTTGTCTGCA	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											127.0	125.0	125.0					1																	162344302		2203	4300	6503	160610926	SO:0001583	missense	284680			BC032957	CCDS1238.1	1q23.3	2008-02-05			ENSG00000171722	ENSG00000171722			27648	protein-coding gene	gene with protein product						12477932	Standard	NM_182581		Approved		uc001gbx.2	Q5T0L3	OTTHUMG00000031375	ENST00000367935.5:c.322G>A	1.37:g.162344302C>T	ENSP00000356912:p.Glu108Lys		160610926	Q6X961|Q8NEC3	Missense_Mutation	SNP	ENST00000367935.5	37	CCDS1238.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	9.760	1.169943	0.21621	.	.	ENSG00000171722	ENST00000367935	T	0.35048	1.33	4.83	2.83	0.33086	.	0.368235	0.22278	N	0.062174	T	0.15912	0.0383	M	0.65975	2.015	0.27888	N	0.939445	B	0.16802	0.019	B	0.20767	0.031	T	0.05971	-1.0853	9	0.48119	T	0.1	-10.1859	3.8509	0.08954	0.1917:0.6104:0.0:0.1978	.	108	Q5T0L3	CA111_HUMAN	K	108	ENSP00000356912:E108K	ENSP00000356912:E108K	E	-	1	0	C1orf111	160610926	0.013000	0.17824	0.796000	0.32109	0.013000	0.08279	1.349000	0.33998	1.030000	0.39839	0.655000	0.94253	GAG		0.572	C1orf111-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076791.2	NM_182581		Missense_Mutation
KIAA1614	57710	broad.mit.edu	37	1	180910290	180910290	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr1:180910290T>A	ENST00000367588.4	+	7	3083	c.3028T>A	c.(3028-3030)Ttc>Atc	p.F1010I	KIAA1614_ENST00000367587.1_Missense_Mutation_p.F631I|RP11-46A10.5_ENST00000358073.2_RNA	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	1010	Ser-rich.							p.F1010I(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						GAAAAAGCTCTTCTCAGCCCT	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											36.0	43.0	41.0					1																	180910290		1915	4115	6030	179176913	SO:0001583	missense	57710			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.3028T>A	1.37:g.180910290T>A	ENSP00000356560:p.Phe1010Ile		179176913	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	CCDS41442.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	12.28	1.890400	0.33348	.	.	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.38722	1.66;1.12	5.21	2.82	0.32997	.	0.382184	0.26574	N	0.023604	T	0.52240	0.1722	L	0.58101	1.795	0.37513	D	0.917227	P;D	0.63880	0.705;0.993	B;P	0.62491	0.439;0.903	T	0.60255	-0.7299	9	0.36615	T	0.2	-9.1821	9.0567	0.36410	0.0:0.1537:0.0:0.8463	.	631;1010	Q5VZ46-2;Q5VZ46	.;K1614_HUMAN	I	1010;631	ENSP00000356560:F1010I;ENSP00000356559:F631I	ENSP00000356559:F631I	F	+	1	0	KIAA1614	179176913	1.000000	0.71417	0.029000	0.17559	0.296000	0.27459	0.788000	0.26872	0.277000	0.22141	0.459000	0.35465	TTC		0.647	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531		Missense_Mutation
CAPN9	10753	broad.mit.edu	37	1	230925911	230925911	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr1:230925911G>A	ENST00000271971.2	+	14	1746	c.1633G>A	c.(1633-1635)Gtt>Att	p.V545I	RP11-99J16__A.2_ENST00000452640.1_RNA|RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000366666.2_Missense_Mutation_p.V482I|CAPN9_ENST00000354537.1_Missense_Mutation_p.V519I|RP11-99J16__A.2_ENST00000428480.1_RNA	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	545	Domain IV.|EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.V519I(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				ACTTGAGTATGTTTTAAATGC	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											116.0	101.0	106.0					1																	230925911		2203	4300	6503	228992534	SO:0001583	missense	10753			AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.1633G>A	1.37:g.230925911G>A	ENSP00000271971:p.Val545Ile		228992534	B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	ENST00000271971.2	37	CCDS1586.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	1.380	-0.583622	0.03827	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	D;D;D	0.94537	-3.45;-3.45;-3.45	5.37	-2.25	0.06888	EF-hand-like domain (1);	0.330452	0.36200	N	0.002738	T	0.82121	0.4968	N	0.05351	-0.065	0.33831	D	0.630194	B;B;B	0.11235	0.002;0.004;0.002	B;B;B	0.13407	0.004;0.009;0.004	T	0.72701	-0.4214	10	0.02654	T	1	.	11.1073	0.48210	0.4545:0.0:0.5455:0.0	.	482;519;545	E7ESS6;O14815-2;O14815	.;.;CAN9_HUMAN	I	545;519;482	ENSP00000271971:V545I;ENSP00000346538:V519I;ENSP00000355626:V482I	ENSP00000271971:V545I	V	+	1	0	CAPN9	228992534	0.808000	0.29022	0.025000	0.17156	0.807000	0.45602	0.724000	0.25954	-0.204000	0.10235	-0.218000	0.12543	GTT		0.483	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615		Missense_Mutation
UBE2L6	9246	broad.mit.edu	37	11	57327836	57327836	+	Silent	SNP	G	G	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr11:57327836G>A	ENST00000287156.4	-	2	292	c.97C>T	c.(97-99)Ctg>Ttg	p.L33L	UBE2L6_ENST00000340573.4_5'UTR	NM_004223.4	NP_004214.1	O14933	UB2L6_HUMAN	ubiquitin-conjugating enzyme E2L 6	33					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)	p.L33L(1)		large_intestine(1)|lung(3)|ovary(1)	5						TGCCACACCAGGACATTGGCA	0.587																																																1	Substitution - coding silent(1)	ovary(1)	11											223.0	182.0	196.0					11																	57327836		2201	4296	6497	57084412	SO:0001819	synonymous_variant	9246			AF031141, AK093462, BC032491	CCDS7960.1, CCDS7961.1	11q12.1	2008-02-01			ENSG00000156587	ENSG00000156587		"""Ubiquitin-conjugating enzymes E2"""	12490	protein-coding gene	gene with protein product		603890				9153201	Standard	NM_004223		Approved	UBCH8	uc001nkn.2	O14933	OTTHUMG00000167047	ENST00000287156.4:c.97C>T	11.37:g.57327836G>A			57084412	A6NDM6|A8MY53|Q8N5D8|Q9UEZ0	Silent	SNP	ENST00000287156.4	37	CCDS7960.1	SNP	35	Broad																																																																																				0.587	UBE2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392657.1	NM_004223		Silent
TBX10	347853	broad.mit.edu	37	11	67401659	67401659	+	Splice_Site	SNP	C	C	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr11:67401659C>A	ENST00000335385.3	-	4	637		c.e4+1			NM_005995.4	NP_005986.2	O75333	TBX10_HUMAN	T-box 10						anatomical structure morphogenesis (GO:0009653)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		endometrium(2)|lung(4)|ovary(1)	7						CCCGGCCTCACGTGGCCATTG	0.637																																																1	Unknown(1)	ovary(1)	11											93.0	96.0	95.0					11																	67401659		2200	4294	6494	67158235	SO:0001630	splice_region_variant	347853			AH006177	CCDS31621.1	11q13.2	2005-10-11	2004-10-05		ENSG00000167800	ENSG00000167800		"""T-boxes"""	11593	protein-coding gene	gene with protein product		604648	"""T-box 7"""	TBX7		9545502	Standard	NM_005995		Approved	TBX13	uc001omp.3	O75333	OTTHUMG00000167291	ENST00000335385.3:c.549+1G>T	11.37:g.67401659C>A			67158235	Q14D64|Q86XS3	Splice_Site_SNP	SNP	ENST00000335385.3	37	CCDS31621.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	18.25	3.581388	0.65992	.	.	ENSG00000167800	ENST00000335385	.	.	.	3.54	3.54	0.40534	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0424	0.64684	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TBX10	67158235	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.552000	0.82192	1.822000	0.53115	0.455000	0.32223	.		0.637	TBX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394034.1	NM_005995	Intron	Splice_Site_SNP
ATG101	60673	broad.mit.edu	37	12	52467645	52467645	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr12:52467645G>A	ENST00000336854.4	+	3	689	c.211G>A	c.(211-213)Gaa>Aaa	p.E71K	RP11-1100L3.7_ENST00000550301.1_RNA	NM_001098673.1|NM_021934.4	NP_001092143.1|NP_068753.2	Q9BSB4	ATGA1_HUMAN		71					autophagic vacuole assembly (GO:0000045)	pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein complex binding (GO:0032403)	p.E71K(1)		endometrium(1)|lung(2)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(357;0.0978)		CTCTTCTGAGGAACTGGATCG	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											196.0	142.0	160.0					12																	52467645		2203	4300	6503	50753912	SO:0001583	missense	60673																														ENST00000336854.4:c.211G>A	12.37:g.52467645G>A	ENSP00000338990:p.Glu71Lys		50753912	Q9HAE2|Q9HBN1	Missense_Mutation	SNP	ENST00000336854.4	37	CCDS8820.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	20.6	4.014279	0.75161	.	.	ENSG00000123395	ENST00000336854;ENST00000553049;ENST00000548915;ENST00000550984	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.50922	0.1644	L	0.46157	1.445	0.80722	D	1	P	0.36944	0.574	B	0.34873	0.191	T	0.51228	-0.8732	9	0.34782	T	0.22	-31.2935	15.8709	0.79119	0.0:0.0:1.0:0.0	.	71	Q9BSB4	ATGA1_HUMAN	K	71	.	ENSP00000338990:E71K	E	+	1	0	C12orf44	50753912	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.051000	0.93849	2.550000	0.86006	0.462000	0.41574	GAA		0.562	C12orf44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405063.1			Missense_Mutation
PPFIA2	8499	broad.mit.edu	37	12	81671100	81671100	+	Silent	SNP	T	T	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr12:81671100T>A	ENST00000549396.1	-	28	3466	c.3306A>T	c.(3304-3306)atA>atT	p.I1102I	PPFIA2_ENST00000333447.7_Silent_p.I1090I|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000550584.2_Silent_p.I1102I|PPFIA2_ENST00000443686.3_Silent_p.I997I|PPFIA2_ENST00000552948.1_Silent_p.I1081I|PPFIA2_ENST00000550359.2_Silent_p.I949I|PPFIA2_ENST00000541017.1_Silent_p.I288I|PPFIA2_ENST00000548586.1_Silent_p.I1096I|RP11-121G22.3_ENST00000549161.1_lincRNA|PPFIA2_ENST00000541570.2_Silent_p.I638I|PPFIA2_ENST00000407050.4_Silent_p.I1001I|PPFIA2_ENST00000549325.1_Silent_p.I1087I	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	1102					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)		p.I1102I(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TATTACCTTTTATTTCATGTT	0.303																																																1	Substitution - coding silent(1)	ovary(1)	12											119.0	110.0	113.0					12																	81671100		1804	4051	5855	80195231	SO:0001819	synonymous_variant	8499			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.3306A>T	12.37:g.81671100T>A			80195231	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Silent	SNP	ENST00000549396.1	37	CCDS55857.1	SNP	61	Broad																																																																																				0.303	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1			Silent
RPGRIP1	57096	broad.mit.edu	37	14	21811363	21811363	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr14:21811363G>A	ENST00000400017.2	+	21	3508	c.3508G>A	c.(3508-3510)Gaa>Aaa	p.E1170K	RPGRIP1_ENST00000206660.6_Missense_Mutation_p.E1170K|RPGRIP1_ENST00000307974.4_Missense_Mutation_p.E529K|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.E827K|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.E1132K|RPGRIP1_ENST00000382933.4_Missense_Mutation_p.E496K	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	1170	Interaction with RPGR. {ECO:0000269|PubMed:24981858}.				eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)		p.E786K(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		GGCAGGAGAAGAAATCCACTT	0.473																																																1	Substitution - Missense(1)	ovary(1)	14											100.0	99.0	100.0					14																	21811363		1937	4154	6091	20881203	SO:0001583	missense	57096			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.3508G>A	14.37:g.21811363G>A	ENSP00000382895:p.Glu1170Lys		20881203	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	37	CCDS45080.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	22.0	4.225673	0.79576	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933;ENST00000555587;ENST00000307974	T;T;T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05;-1.05;-1.05	5.06	5.06	0.68205	.	0.113446	0.64402	D	0.000018	D	0.85792	0.5779	M	0.77103	2.36	0.40135	D	0.976768	D;D;D;D;D;P	0.76494	0.998;0.999;0.998;0.998;0.998;0.892	D;D;D;D;D;P	0.73380	0.928;0.948;0.928;0.98;0.928;0.565	T	0.82458	-0.0447	10	0.09843	T	0.71	-11.8217	15.4369	0.75155	0.0:0.0:1.0:0.0	.	553;529;645;496;786;1170	Q96KN7-2;Q96KN7-3;G3V3I7;Q96KN7-4;Q96KN7-5;Q96KN7	.;.;.;.;.;RPGR1_HUMAN	K	827;1132;1170;1170;496;645;529	ENSP00000450445:E827K;ENSP00000451219:E1132K;ENSP00000382895:E1170K;ENSP00000206660:E1170K;ENSP00000372391:E496K;ENSP00000451262:E645K;ENSP00000309721:E529K	ENSP00000206660:E1170K	E	+	1	0	RPGRIP1	20881203	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.697000	0.54764	2.641000	0.89580	0.591000	0.81541	GAA		0.473	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366		Missense_Mutation
CDC42BPB	9578	broad.mit.edu	37	14	103411999	103411999	+	Splice_Site	SNP	C	C	G			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr14:103411999C>G	ENST00000361246.2	-	29	4099	c.3811G>C	c.(3811-3813)Gtg>Ctg	p.V1271L		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)									p.V1271L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		GCTCACTCACCATCTCGGGTG	0.542																																																1	Substitution - Missense(1)	ovary(1)	14											117.0	94.0	102.0					14																	103411999		2200	4299	6499	102481752	SO:0001630	splice_region_variant	9578			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.3811+1G>C	14.37:g.103411999C>G			102481752		Missense_Mutation	SNP	ENST00000361246.2	37	CCDS9978.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154393	0.78114	.	.	ENSG00000198752	ENST00000361246;ENST00000541396	T	0.04706	3.57	5.3	5.3	0.74995	Citron-like (3);	0.000000	0.85682	D	0.000000	T	0.15478	0.0373	M	0.61703	1.905	0.80722	D	1	P;B	0.41947	0.766;0.132	P;B	0.52343	0.696;0.159	T	0.00398	-1.1764	9	.	.	.	.	19.3235	0.94252	0.0:1.0:0.0:0.0	.	1271;1271	A9JR72;Q9Y5S2	.;MRCKB_HUMAN	L	1271;382	ENSP00000355237:V1271L	.	V	-	1	0	CDC42BPB	102481752	1.000000	0.71417	0.969000	0.41365	0.918000	0.54935	7.034000	0.76511	2.649000	0.89929	0.655000	0.94253	GTG		0.542	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035	Missense_Mutation	Missense_Mutation
AGBL1	123624	broad.mit.edu	37	15	87097704	87097704	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr15:87097704T>C	ENST00000441037.2	+	20	2887	c.2792T>C	c.(2791-2793)aTg>aCg	p.M931T	AGBL1_ENST00000389298.3_Missense_Mutation_p.M662T|AGBL1_ENST00000421325.2_Missense_Mutation_p.M931T	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	931					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.M931T(1)		NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TGGAGAGAGATGGGGGTGTCC	0.547																																																1	Substitution - Missense(1)	ovary(1)	15											30.0	31.0	31.0					15																	87097704		1912	4124	6036	84898708	SO:0001583	missense	123624			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2792T>C	15.37:g.87097704T>C	ENSP00000413001:p.Met931Thr		84898708	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	CCDS58398.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	14.66	2.601734	0.46423	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.09073	3.02;3.02	4.97	4.97	0.65823	Peptidase M14, carboxypeptidase A (1);	0.130133	0.31922	U	0.006856	T	0.08044	0.0201	N	0.16833	0.445	0.36894	D	0.890046	B	0.31459	0.324	B	0.37198	0.243	T	0.32161	-0.9917	10	0.72032	D	0.01	-13.8832	13.9859	0.64334	0.0:0.0:0.0:1.0	.	931	Q96MI9	CBPC4_HUMAN	T	966;931;662	ENSP00000397173:M931T;ENSP00000373949:M662T	ENSP00000373949:M662T	M	+	2	0	AGBL1	84898708	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.725000	0.84808	2.098000	0.63641	0.528000	0.53228	ATG		0.547	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336		Missense_Mutation
PRPF8	10594	broad.mit.edu	37	17	1563792	1563792	+	Silent	SNP	G	G	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr17:1563792G>A	ENST00000572621.1	-	29	4984	c.4719C>T	c.(4717-4719)ctC>ctT	p.L1573L	PRPF8_ENST00000304992.6_Silent_p.L1573L			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1573	Linker.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)	p.L1573L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		AGATCTGGATGAGAGAGATCT	0.507																																																1	Substitution - coding silent(1)	ovary(1)	17											215.0	213.0	214.0					17																	1563792		2203	4300	6503	1510542	SO:0001819	synonymous_variant	10594			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.4719C>T	17.37:g.1563792G>A			1510542	O14547|O75965	Silent	SNP	ENST00000572621.1	37	CCDS11010.1	SNP	45	Broad																																																																																				0.507	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2			Silent
G6PC3	92579	broad.mit.edu	37	17	42152691	42152691	+	Silent	SNP	C	C	T			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr17:42152691C>T	ENST00000269097.4	+	5	780	c.549C>T	c.(547-549)ggC>ggT	p.G183G		NM_138387.3	NP_612396.1	Q9BUM1	G6PC3_HUMAN	glucose 6 phosphatase, catalytic, 3	183					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphatase activity (GO:0004346)	p.G183G(1)		endometrium(2)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	11		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CTGTCCTGGGCTGGCTGATGA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	17											100.0	91.0	94.0					17																	42152691		2203	4300	6503	39508217	SO:0001819	synonymous_variant	92579			BC021574	CCDS11476.1	17q21.31	2014-09-17				ENSG00000141349			24861	protein-coding gene	gene with protein product		611045				12370122, 12965222	Standard	NM_138387		Approved	UGRP	uc002iex.3	Q9BUM1		ENST00000269097.4:c.549C>T	17.37:g.42152691C>T			39508217	Q8WU15	Silent	SNP	ENST00000269097.4	37	CCDS11476.1	SNP	28	Broad																																																																																				0.602	G6PC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457675.1	NM_138387		Silent
RPRD1A	55197	broad.mit.edu	37	18	33606959	33606959	+	Silent	SNP	C	C	T			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr18:33606959C>T	ENST00000399022.4	-	6	864	c.693G>A	c.(691-693)gcG>gcA	p.A231A	RPRD1A_ENST00000319040.6_Silent_p.A231A|RPRD1A_ENST00000337059.5_Silent_p.A195A|RPRD1A_ENST00000588737.1_Silent_p.A195A|RPRD1A_ENST00000590898.1_Silent_p.A195A|RPRD1A_ENST00000357384.4_Silent_p.A231A	NM_018170.3	NP_060640.2	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing 1A	231					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)		p.A231A(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(2)	12						CTATTTCTGCCGCCAATCTGC	0.413																																																1	Substitution - coding silent(1)	ovary(1)	18											83.0	79.0	80.0					18																	33606959		2203	4299	6502	31860957	SO:0001819	synonymous_variant	55197			AF419845	CCDS11917.1	18q12.2	2012-02-09	2008-08-15		ENSG00000141425	ENSG00000141425			25560	protein-coding gene	gene with protein product	"""cyclin-dependent kinase 2B-inhibitor-related protein"", ""Cyclin-dependent kinase inhibitor 2B-related protein (p15INK4B-related protein)"""	610347				12470661, 22231121	Standard	NM_018170		Approved	P15RS, FLJ10656, HsT3101	uc002kzg.3	Q96P16	OTTHUMG00000132591	ENST00000399022.4:c.693G>A	18.37:g.33606959C>T			31860957	A8KA42|B2RBA3|Q7Z5G8|Q96FY9|Q9NVL4	Silent	SNP	ENST00000399022.4	37	CCDS11917.1	SNP	23	Broad																																																																																				0.413	RPRD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255802.1	NM_018170		Silent
OR10H1	26539	broad.mit.edu	37	19	15918819	15918819	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr19:15918819G>C	ENST00000334920.2	-	1	117	c.29C>G	c.(28-30)aCc>aGc	p.T10S		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	10						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T10S(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						GATGAATTGGGTCACTGTGGA	0.547																																																1	Substitution - Missense(1)	ovary(1)	19											128.0	127.0	127.0					19																	15918819		2203	4300	6503	15779819	SO:0001583	missense	26539			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.29C>G	19.37:g.15918819G>C	ENSP00000335596:p.Thr10Ser		15779819	Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	37	CCDS12335.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	g	1.780	-0.482288	0.04383	.	.	ENSG00000186723	ENST00000334920	T	0.02085	4.46	4.21	3.15	0.36227	.	0.667629	0.13014	N	0.420613	T	0.02193	0.0068	L	0.33624	1.015	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45527	-0.9255	10	0.30078	T	0.28	.	7.2769	0.26290	0.0:0.1881:0.6179:0.194	.	10	Q9Y4A9	O10H1_HUMAN	S	10	ENSP00000335596:T10S	ENSP00000335596:T10S	T	-	2	0	OR10H1	15779819	0.009000	0.17119	0.002000	0.10522	0.022000	0.10575	1.142000	0.31540	0.757000	0.33036	0.632000	0.83419	ACC		0.547	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1			Missense_Mutation
NUMBL	9253	broad.mit.edu	37	19	41183323	41183323	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr19:41183323C>T	ENST00000252891.4	-	7	711	c.544G>A	c.(544-546)Gag>Aag	p.E182K	NUMBL_ENST00000598779.1_Missense_Mutation_p.E141K|NUMBL_ENST00000540131.1_Missense_Mutation_p.E141K	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	182	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)		p.E182K(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			CTCAGCCTCTCGCCCTATGGG	0.667																																																1	Substitution - Missense(1)	ovary(1)	19											20.0	20.0	20.0					19																	41183323		2200	4296	6496	45875163	SO:0001583	missense	9253			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.544G>A	19.37:g.41183323C>T	ENSP00000252891:p.Glu182Lys		45875163	Q7Z4J9	Missense_Mutation	SNP	ENST00000252891.4	37	CCDS12561.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.450401	0.96205	.	.	ENSG00000105245	ENST00000252891;ENST00000540131	T;T	0.19669	2.13;2.13	5.31	5.31	0.75309	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.44138	0.1279	M	0.88241	2.94	0.80722	D	1	D;D	0.56968	0.978;0.978	P;P	0.50049	0.629;0.629	T	0.57283	-0.7838	10	0.87932	D	0	-27.0671	17.7425	0.88411	0.0:1.0:0.0:0.0	.	182;182	A8K033;Q9Y6R0	.;NUMBL_HUMAN	K	182;141	ENSP00000252891:E182K;ENSP00000442759:E141K	ENSP00000252891:E182K	E	-	1	0	NUMBL	45875163	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	7.716000	0.84723	2.464000	0.83262	0.655000	0.94253	GAG		0.667	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756		Missense_Mutation
SP3	6670	broad.mit.edu	37	2	174820592	174820592	+	Silent	SNP	G	G	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr2:174820592G>A	ENST00000310015.6	-	4	1178	c.648C>T	c.(646-648)gcC>gcT	p.A216A	SP3_ENST00000455789.2_Silent_p.A163A|SP3_ENST00000483084.1_5'Flank|SP3_ENST00000418194.2_Silent_p.A148A	NM_001172712.1|NM_003111.4	NP_001166183.1|NP_003102.1	Q02447	SP3_HUMAN	Sp3 transcription factor	216	Transactivation domain (Gln-rich).				B cell differentiation (GO:0030183)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|granulocyte differentiation (GO:0030851)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|monocyte differentiation (GO:0030224)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|T cell differentiation (GO:0030217)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.A216A(1)	EWSR1/SP3(3)	NS(2)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.185)			GTGTTCCAGAGGCAAGTAAGG	0.428																																																1	Substitution - coding silent(1)	ovary(1)	2											172.0	178.0	176.0					2																	174820592		2203	4300	6503	174528838	SO:0001819	synonymous_variant	6670			M97191	CCDS2254.1, CCDS46452.1	2q31	2013-01-08			ENSG00000172845	ENSG00000172845		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11208	protein-coding gene	gene with protein product		601804				1341900, 1454515	Standard	NM_003111		Approved	SPR-2	uc002uig.3	Q02447	OTTHUMG00000132333	ENST00000310015.6:c.648C>T	2.37:g.174820592G>A			174528838	A0AVL9|B4E2B7|Q69B26|Q69B27|Q8TD56|Q8WWU4|Q9BQR1	Silent	SNP	ENST00000310015.6	37	CCDS2254.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	4.393	0.072594	0.08436	.	.	ENSG00000172845	ENST00000416195	.	.	.	5.95	3.54	0.40534	.	.	.	.	.	T	0.62829	0.2460	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61332	-0.7084	4	.	.	.	.	12.1029	0.53794	0.1872:0.0:0.8128:0.0	.	.	.	.	L	173	.	.	P	-	2	0	SP3	174528838	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	0.243000	0.18106	1.263000	0.44181	0.563000	0.77884	CCT		0.428	SP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255452.1	NM_003111		Silent
ALS2	57679	broad.mit.edu	37	2	202598095	202598095	+	Silent	SNP	C	C	T			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr2:202598095C>T	ENST00000264276.6	-	13	2856	c.2484G>A	c.(2482-2484)caG>caA	p.Q828Q	ALS2_ENST00000457679.2_Silent_p.Q140Q	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	828	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.Q828Q(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TTTCCATCAACTGAGTGTTTT	0.333																																																1	Substitution - coding silent(1)	ovary(1)	2											104.0	90.0	94.0					2																	202598095		1816	4084	5900	202306340	SO:0001819	synonymous_variant	57679			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.2484G>A	2.37:g.202598095C>T			202306340	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Silent	SNP	ENST00000264276.6	37	CCDS42800.1	SNP	20	Broad																																																																																				0.333	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919		Silent
THBD	7056	broad.mit.edu	37	20	23028780	23028780	+	Silent	SNP	C	C	T			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr20:23028780C>T	ENST00000377103.2	-	1	1598	c.1362G>A	c.(1360-1362)gtG>gtA	p.V454V		NM_000361.2	NP_000352.1	P07204	TRBM_HUMAN	thrombomodulin	454	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|female pregnancy (GO:0007565)|leukocyte migration (GO:0050900)|negative regulation of blood coagulation (GO:0030195)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|response to cAMP (GO:0051591)|response to lipopolysaccharide (GO:0032496)|response to X-ray (GO:0010165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.V454V(1)		endometrium(2)|large_intestine(3)|ovary(1)|skin(1)	7	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)|Ibuprofen(DB01050)	GGTTGTGGCACACCCCGGAGC	0.642																																																1	Substitution - coding silent(1)	ovary(1)	20											40.0	40.0	40.0					20																	23028780		2203	4300	6503	22976780	SO:0001819	synonymous_variant	7056				CCDS13148.1	20p11.21	2014-09-17			ENSG00000178726	ENSG00000178726		"""CD molecules"""	11784	protein-coding gene	gene with protein product		188040					Standard	NM_000361		Approved	CD141	uc002wss.3	P07204	OTTHUMG00000032053	ENST00000377103.2:c.1362G>A	20.37:g.23028780C>T			22976780	Q8IV29|Q9UC32	Silent	SNP	ENST00000377103.2	37	CCDS13148.1	SNP	17	Broad																																																																																				0.642	THBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078307.2			Silent
CASS4	57091	broad.mit.edu	37	20	55027724	55027724	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr20:55027724C>T	ENST00000360314.3	+	6	1717	c.1492C>T	c.(1492-1494)Cga>Tga	p.R498*	CASS4_ENST00000434344.1_Intron|CASS4_ENST00000371336.3_Nonsense_Mutation_p.R498*	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	498					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.R498*(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						GGATTTTGCCCGAGGAGTCCA	0.488																																																1	Substitution - Nonsense(1)	ovary(1)	20											62.0	62.0	62.0					20																	55027724		2203	4300	6503	54461131	SO:0001587	stop_gained	57091			AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.1492C>T	20.37:g.55027724C>T	ENSP00000353462:p.Arg498*		54461131	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Nonsense_Mutation	SNP	ENST00000360314.3	37	CCDS33492.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598139	0.87055	.	.	ENSG00000087589	ENST00000360314;ENST00000371336	.	.	.	5.87	0.409	0.16382	.	0.482521	0.21764	N	0.069472	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.1451	7.6342	0.28257	0.3348:0.5462:0.0:0.119	.	.	.	.	X	498	.	ENSP00000353462:R498X	R	+	1	2	CASS4	54461131	0.150000	0.22732	0.059000	0.19551	0.184000	0.23303	1.139000	0.31504	-0.054000	0.13266	-0.169000	0.13324	CGA		0.488	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356		Nonsense_Mutation
TTC14	151613	broad.mit.edu	37	3	180327617	180327617	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr3:180327617G>C	ENST00000296015.4	+	12	1732	c.1600G>C	c.(1600-1602)Gat>Cat	p.D534H	TTC14_ENST00000412756.2_3'UTR|TTC14_ENST00000382584.4_Missense_Mutation_p.D534H|TTC14_ENST00000465625.1_3'UTR	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	534							RNA binding (GO:0003723)	p.D534H(1)		endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GAATAGGAAAGATGAGTGCTA	0.418																																																1	Substitution - Missense(1)	ovary(1)	3											117.0	116.0	116.0					3																	180327617		2203	4300	6503	181810311	SO:0001583	missense	151613			AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.1600G>C	3.37:g.180327617G>C	ENSP00000296015:p.Asp534His		181810311	G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	37	CCDS3237.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632370	0.46944	.	.	ENSG00000163728	ENST00000296015;ENST00000382584	T;T	0.49139	0.79;0.79	5.92	5.92	0.95590	.	0.449021	0.26234	N	0.025553	T	0.58308	0.2113	N	0.22421	0.69	0.80722	D	1	P;D	0.89917	0.846;1.0	P;D	0.70716	0.568;0.97	T	0.60687	-0.7214	10	0.66056	D	0.02	-9.8531	20.3081	0.98638	0.0:0.0:1.0:0.0	.	534;534	Q96N46-2;Q96N46	.;TTC14_HUMAN	H	534	ENSP00000296015:D534H;ENSP00000372027:D534H	ENSP00000296015:D534H	D	+	1	0	TTC14	181810311	1.000000	0.71417	0.891000	0.34965	0.988000	0.76386	6.397000	0.73239	2.795000	0.96236	0.655000	0.94253	GAT		0.418	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462		Missense_Mutation
RAB28	9364	broad.mit.edu	37	4	13370264	13370264	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr4:13370264T>G	ENST00000330852.5	-	7	798	c.584A>C	c.(583-585)aAg>aCg	p.K195T	RAB28_ENST00000338176.4_3'UTR|RAB28_ENST00000288723.4_3'UTR	NM_001017979.2	NP_001017979.1	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family	195					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.K195T(1)		endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	8						AATATCTGCCTTCACCACCCT	0.368																																																1	Substitution - Missense(1)	ovary(1)	4											132.0	119.0	123.0					4																	13370264		2203	4300	6503	12979362	SO:0001583	missense	9364			X94703	CCDS3409.1, CCDS33961.1, CCDS54741.1	4p16.1	2014-04-24			ENSG00000157869	ENSG00000157869		"""RAB, member RAS oncogene"""	9768	protein-coding gene	gene with protein product		612994				8647132	Standard	NM_004249		Approved		uc003gmu.2	P51157	OTTHUMG00000090543	ENST00000330852.5:c.584A>C	4.37:g.13370264T>G	ENSP00000328551:p.Lys195Thr		12979362	G8JLC5|Q8IYR8|Q8NI05	Missense_Mutation	SNP	ENST00000330852.5	37	CCDS33961.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	16.72	3.200223	0.58126	.	.	ENSG00000157869	ENST00000330852	T	0.70164	-0.46	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.58061	0.2096	L	0.34521	1.04	0.80722	D	1	B	0.19706	0.038	B	0.17098	0.017	T	0.53592	-0.8417	10	0.40728	T	0.16	.	16.1668	0.81768	0.0:0.0:0.0:1.0	.	195	P51157	RAB28_HUMAN	T	195	ENSP00000328551:K195T	ENSP00000328551:K195T	K	-	2	0	RAB28	12979362	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.121000	0.77160	2.210000	0.71456	0.533000	0.62120	AAG		0.368	RAB28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207068.2	NM_001017979		Missense_Mutation
COL25A1	84570	broad.mit.edu	37	4	109780842	109780842	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr4:109780842G>C	ENST00000399132.1	-	24	1820	c.1290C>G	c.(1288-1290)gaC>gaG	p.D430E	COL25A1_ENST00000399126.1_Missense_Mutation_p.D430E|COL25A1_ENST00000399127.1_Missense_Mutation_p.D411E	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1									p.D430E(1)		NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		TGCCGTTGTAGTCTATGATCT	0.498																																																1	Substitution - Missense(1)	ovary(1)	4											194.0	193.0	193.0					4																	109780842		1999	4161	6160	110000291	SO:0001583	missense	84570			AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.1290C>G	4.37:g.109780842G>C	ENSP00000382083:p.Asp430Glu		110000291		Missense_Mutation	SNP	ENST00000399132.1	37	CCDS43258.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	15.50	2.851661	0.51270	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	D;D;D	0.94138	-3.36;-2.66;-3.36	5.82	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.93572	0.7948	L	0.37697	1.125	0.29781	N	0.834	D;D	0.67145	0.996;0.984	D;D	0.77557	0.99;0.967	D	0.89445	0.3726	9	.	.	.	-11.6297	9.053	0.36387	0.2326:0.0:0.7674:0.0	.	430;430	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	E	430;432;411;411;430;360	ENSP00000382083:D430E;ENSP00000382078:D411E;ENSP00000382077:D430E	.	D	-	3	2	COL25A1	110000291	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.697000	0.47060	1.455000	0.47813	0.650000	0.86243	GAC		0.498	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518		Missense_Mutation
MAST4	375449	broad.mit.edu	37	5	66459554	66459554	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr5:66459554G>A	ENST00000403625.2	+	29	4842	c.4547G>A	c.(4546-4548)cGg>cAg	p.R1516Q	MAST4_ENST00000261569.7_Missense_Mutation_p.R1322Q|MAST4_ENST00000405643.1_Missense_Mutation_p.R1337Q|MAST4_ENST00000404260.3_Missense_Mutation_p.R1519Q|MAST4_ENST00000403666.1_Missense_Mutation_p.R1327Q	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	1519						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.R1519Q(1)		breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CCAGTCTCCCGGAAGGTGGGC	0.657																																																1	Substitution - Missense(1)	ovary(1)	5											10.0	13.0	12.0					5																	66459554		2022	4179	6201	66495310	SO:0001583	missense	375449			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.4547G>A	5.37:g.66459554G>A	ENSP00000385727:p.Arg1516Gln		66495310	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	CCDS54861.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.624903	0.96660	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569	T;T;T;T;T	0.79749	-1.3;-1.3;-1.29;-1.3;-1.27	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000001	D	0.90714	0.7086	M	0.82323	2.585	0.40748	D	0.982897	D;D	0.89917	1.0;1.0	D;D	0.91635	0.992;0.999	D	0.91807	0.5456	10	0.72032	D	0.01	-19.7607	19.0472	0.93027	0.0:0.0:1.0:0.0	.	1519;1327	O15021;O15021-3	MAST4_HUMAN;.	Q	1519;1516;1327;1337;1337;1322	ENSP00000385048:R1519Q;ENSP00000385727:R1516Q;ENSP00000384313:R1327Q;ENSP00000384099:R1337Q;ENSP00000261569:R1322Q	ENSP00000261569:R1322Q	R	+	2	0	MAST4	66495310	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	9.869000	0.99810	2.749000	0.94314	0.655000	0.94253	CGG		0.657	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2			Missense_Mutation
PRSS16	10279	broad.mit.edu	37	6	27222621	27222621	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr6:27222621C>G	ENST00000230582.3	+	10	1315	c.1300C>G	c.(1300-1302)Cct>Gct	p.P434A	PRSS16_ENST00000377456.2_Intron|PRSS16_ENST00000421826.2_Missense_Mutation_p.P177A	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	434					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)	p.P434A(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						TGGCCAGACCCCTGGGGCTAA	0.557																																					NSCLC(178;1118 2105 17078 23587 44429)											1	Substitution - Missense(1)	ovary(1)	6											95.0	90.0	92.0					6																	27222621		2203	4300	6503	27330600	SO:0001583	missense	10279			AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.1300C>G	6.37:g.27222621C>G	ENSP00000230582:p.Pro434Ala		27330600	O75416	Missense_Mutation	SNP	ENST00000230582.3	37	CCDS4623.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	12.33	1.905671	0.33628	.	.	ENSG00000112812	ENST00000421826;ENST00000230582	T;T	0.15017	2.46;2.46	4.5	4.5	0.54988	.	0.370207	0.29321	N	0.012485	T	0.27798	0.0684	M	0.84683	2.71	0.09310	N	0.999991	D;D	0.71674	0.998;0.996	D;D	0.70016	0.967;0.91	T	0.21655	-1.0239	10	0.16896	T	0.51	-18.6148	12.9053	0.58149	0.0:1.0:0.0:0.0	.	177;434	F2Z2N5;Q9NQE7	.;TSSP_HUMAN	A	177;434	ENSP00000404349:P177A;ENSP00000230582:P434A	ENSP00000230582:P434A	P	+	1	0	PRSS16	27330600	0.972000	0.33761	0.047000	0.18901	0.128000	0.20619	2.141000	0.42168	2.505000	0.84491	0.557000	0.71058	CCT		0.557	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2			Missense_Mutation
FUT9	10690	broad.mit.edu	37	6	96651664	96651664	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr6:96651664A>C	ENST00000302103.5	+	3	959	c.633A>C	c.(631-633)aaA>aaC	p.K211N		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	211					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)	p.K211N(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		AGCTAAGCAAAAGCATTGAAA	0.383																																					Melanoma(98;1369 1476 6592 22940 26587)											1	Substitution - Missense(1)	ovary(1)	6											64.0	61.0	62.0					6																	96651664		2203	4300	6503	96758385	SO:0001583	missense	10690			AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.633A>C	6.37:g.96651664A>C	ENSP00000302599:p.Lys211Asn		96758385	Q5T0W4	Missense_Mutation	SNP	ENST00000302103.5	37	CCDS5033.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	14.53	2.562600	0.45694	.	.	ENSG00000172461	ENST00000302103	T	0.32023	1.47	5.75	4.39	0.52855	.	0.000000	0.85682	D	0.000000	T	0.37865	0.1019	M	0.76727	2.345	0.54753	D	0.999985	P	0.50617	0.937	D	0.63877	0.919	T	0.34551	-0.9824	10	0.62326	D	0.03	-15.6356	7.6997	0.28615	0.7854:0.0:0.2146:0.0	.	211	Q9Y231	FUT9_HUMAN	N	211	ENSP00000302599:K211N	ENSP00000302599:K211N	K	+	3	2	FUT9	96758385	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.160000	0.42348	0.806000	0.34183	0.533000	0.62120	AAA		0.383	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2	NM_006581		Missense_Mutation
KIAA1919	91749	broad.mit.edu	37	6	111587424	111587424	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr6:111587424C>T	ENST00000368847.4	+	4	1012	c.659C>T	c.(658-660)aCa>aTa	p.T220I		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	220					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.T220I(1)		large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		TCTGCTGAGACATTTCGAAGA	0.353																																																1	Substitution - Missense(1)	ovary(1)	6											100.0	93.0	95.0					6																	111587424		2203	4300	6503	111694117	SO:0001583	missense	91749			BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.659C>T	6.37:g.111587424C>T	ENSP00000357840:p.Thr220Ile		111694117	A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Missense_Mutation	SNP	ENST00000368847.4	37	CCDS5090.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	5.471	0.271893	0.10349	.	.	ENSG00000173214	ENST00000368847	T	0.58210	0.35	5.85	-2.75	0.05914	Major facilitator superfamily domain, general substrate transporter (1);	0.315093	0.37809	N	0.001937	T	0.14442	0.0349	N	0.24115	0.695	0.09310	N	1	B	0.18013	0.025	B	0.23852	0.049	T	0.28808	-1.0032	10	0.40728	T	0.16	0.0603	7.4839	0.27421	0.3567:0.3462:0.2971:0.0	.	220	Q5TF39	NAGT1_HUMAN	I	220	ENSP00000357840:T220I	ENSP00000357840:T220I	T	+	2	0	KIAA1919	111694117	0.010000	0.17322	0.000000	0.03702	0.125000	0.20455	0.222000	0.17699	-0.317000	0.08677	0.643000	0.83706	ACA		0.353	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041827.1	NM_153369		Missense_Mutation
ADCY1	107	broad.mit.edu	37	7	45697429	45697429	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr7:45697429G>A	ENST00000297323.7	+	6	1274	c.1252G>A	c.(1252-1254)Gtg>Atg	p.V418M	ADCY1_ENST00000432715.1_Missense_Mutation_p.V193M	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	418					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.V418M(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GCAGTACGACGTGTGGTCCAA	0.627																																																1	Substitution - Missense(1)	ovary(1)	7											114.0	82.0	93.0					7																	45697429		2203	4300	6503	45663954	SO:0001583	missense	107			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1252G>A	7.37:g.45697429G>A	ENSP00000297323:p.Val418Met		45663954	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	CCDS34631.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	23.1	4.374545	0.82573	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	D;D	0.83673	-1.75;-1.75	4.44	4.44	0.53790	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.91707	0.7378	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.93063	0.6476	10	0.87932	D	0	.	14.9371	0.70964	0.0:0.0:1.0:0.0	.	418;193	Q08828;C9J1J0	ADCY1_HUMAN;.	M	193;418;418	ENSP00000392721:V193M;ENSP00000297323:V418M	ENSP00000297323:V418M	V	+	1	0	ADCY1	45663954	1.000000	0.71417	0.943000	0.38184	0.817000	0.46193	8.926000	0.92839	2.446000	0.82766	0.655000	0.94253	GTG		0.627	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116		Missense_Mutation
VSTM2A	222008	broad.mit.edu	37	7	54612358	54612358	+	Silent	SNP	G	G	T			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr7:54612358G>T	ENST00000407838.3	+	2	529	c.123G>T	c.(121-123)ggG>ggT	p.G41G	VSTM2A_ENST00000404951.1_Silent_p.G41G|VSTM2A_ENST00000302287.3_Silent_p.G41G|VSTM2A_ENST00000402613.3_Silent_p.G41G|VSTM2A_ENST00000402026.2_Silent_p.G40G	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	41	Ig-like V-type.					extracellular region (GO:0005576)		p.G40G(1)		endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			CGACCGAGGGGCAGAATGTGG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	7											61.0	61.0	61.0					7																	54612358		2203	4300	6503	54579852	SO:0001819	synonymous_variant	222008			BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.123G>T	7.37:g.54612358G>T			54579852	A4D2E9|B5MC94	Silent	SNP	ENST00000407838.3	37	CCDS5512.2	SNP	42	Broad																																																																																				0.587	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318694.1	NM_182546		Silent
CCDC132	55610	broad.mit.edu	37	7	92970856	92970856	+	Silent	SNP	T	T	C			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr7:92970856T>C	ENST00000305866.5	+	23	2304	c.2176T>C	c.(2176-2178)Ttg>Ctg	p.L726L	CCDC132_ENST00000535481.1_Silent_p.L446L|CCDC132_ENST00000544910.1_Silent_p.L696L|CCDC132_ENST00000474412.1_3'UTR|CCDC132_ENST00000541136.1_Silent_p.L537L	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	726						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.L726L(1)		endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			GCTGTATGGGTTGGCAGAAAG	0.423																																																1	Substitution - coding silent(1)	ovary(1)	7											130.0	137.0	135.0					7																	92970856		1948	4153	6101	92808792	SO:0001819	synonymous_variant	55610			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.2176T>C	7.37:g.92970856T>C			92808792	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Silent	SNP	ENST00000305866.5	37	CCDS43617.1	SNP	60	Broad																																																																																				0.423	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667		Silent
SHARPIN	81858	broad.mit.edu	37	8	145153890	145153890	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr8:145153890C>T	ENST00000398712.2	-	8	1491	c.1055G>A	c.(1054-1056)tGg>tAg	p.W352*	SHARPIN_ENST00000533948.1_5'Flank	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	352					apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)	p.W352*(1)		breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGGACAGGACCAGCTGGGCTG	0.627																																																1	Substitution - Nonsense(1)	ovary(1)	8											51.0	57.0	55.0					8																	145153890		2064	4203	6267	145225878	SO:0001587	stop_gained	81858			AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.1055G>A	8.37:g.145153890C>T	ENSP00000381698:p.Trp352*		145225878	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Nonsense_Mutation	SNP	ENST00000398712.2	37	CCDS43777.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	c	34	5.303934	0.95601	.	.	ENSG00000179526	ENST00000532536;ENST00000398712	.	.	.	4.62	3.69	0.42338	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1107	0.42561	0.1984:0.8016:0.0:0.0	.	.	.	.	X	60;352	.	ENSP00000381698:W352X	W	-	2	0	SHARPIN	145225878	1.000000	0.71417	0.998000	0.56505	0.099000	0.18886	4.431000	0.59915	2.420000	0.82092	0.550000	0.68814	TGG		0.627	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382901.1	NM_030974		Nonsense_Mutation
DNAJB5	25822	broad.mit.edu	37	9	34997056	34997056	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chr9:34997056A>C	ENST00000541010.1	+	3	3859	c.847A>C	c.(847-849)Atc>Ctc	p.I283L	DNAJB5_ENST00000453597.3_Missense_Mutation_p.I397L|DNAJB5_ENST00000312316.5_Missense_Mutation_p.I283L|DNAJB5_ENST00000454002.2_Missense_Mutation_p.I355L|DNAJB5_ENST00000545841.1_Missense_Mutation_p.I283L|DNAJB5_ENST00000335998.3_Missense_Mutation_p.I317L			O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	283					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)	p.I283L(1)		kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(32;0.00575)			CATTCCCACTATCGACGGCCG	0.557																																																1	Substitution - Missense(1)	ovary(1)	9											187.0	176.0	180.0					9																	34997056		2203	4300	6503	34987056	SO:0001583	missense	25822			AF088982	CCDS35007.1, CCDS47959.1, CCDS47960.1, CCDS47960.2	9p	2011-09-02			ENSG00000137094	ENSG00000137094		"""Heat shock proteins / DNAJ (HSP40)"""	14887	protein-coding gene	gene with protein product		611328				10570961, 11147971	Standard	NM_001135004		Approved	Hsc40	uc003zvs.4	O75953	OTTHUMG00000019840	ENST00000541010.1:c.847A>C	9.37:g.34997056A>C	ENSP00000443151:p.Ile283Leu		34987056	B3KN14|B4DSA6|J3KQM9|J3KR08|Q5T656|Q8TDR7|Q96EM4	Missense_Mutation	SNP	ENST00000541010.1	37	CCDS35007.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	5.024	0.190201	0.09547	.	.	ENSG00000137094	ENST00000453597;ENST00000335998;ENST00000378751;ENST00000312316;ENST00000541010;ENST00000454002;ENST00000545841	T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31	5.51	4.36	0.52297	Chaperone DnaJ, C-terminal (1);HSP40/DnaJ peptide-binding (1);	0.105831	0.64402	N	0.000006	T	0.09335	0.0230	N	0.00450	-1.49	0.46927	D	0.999255	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.002	T	0.27673	-1.0067	10	0.02654	T	1	.	11.2953	0.49274	0.8636:0.0:0.0:0.1364	.	355;283	B4DSA6;O75953	.;DNJB5_HUMAN	L	397;317;283;283;283;355;283	ENSP00000404079:I397L;ENSP00000337626:I317L;ENSP00000312517:I283L;ENSP00000443151:I283L;ENSP00000413684:I355L;ENSP00000441999:I283L	ENSP00000312517:I283L	I	+	1	0	DNAJB5	34987056	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.112000	0.50368	1.090000	0.41315	0.459000	0.35465	ATC		0.557	DNAJB5-008	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401397.1			Missense_Mutation
GPR119	139760	broad.mit.edu	37	X	129518566	129518566	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1728-01	TCGA-61-1728-11	g.chrX:129518566C>A	ENST00000276218.2	-	1	945	c.856G>T	c.(856-858)Gtg>Ttg	p.V286L		NM_178471.2	NP_848566.1	Q8TDV5	GP119_HUMAN	G protein-coupled receptor 119	286					insulin secretion (GO:0030073)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)	p.V286L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(1)	11						TGCAGTCGCACCTCCTTCTGC	0.582																																																1	Substitution - Missense(1)	ovary(1)	X											75.0	69.0	71.0					X																	129518566		2203	4300	6503	129346247	SO:0001583	missense	139760			AY288416	CCDS14625.1	Xq26.1	2014-01-30			ENSG00000147262	ENSG00000147262		"""GPCR / Class A : Orphans"""	19060	protein-coding gene	gene with protein product		300513				12044878, 14623098	Standard	NM_178471		Approved	hGPCR2, GPCR2	uc011muv.2	Q8TDV5	OTTHUMG00000022397	ENST00000276218.2:c.856G>T	X.37:g.129518566C>A	ENSP00000276218:p.Val286Leu		129346247	Q495H7|Q4VBN3	Missense_Mutation	SNP	ENST00000276218.2	37	CCDS14625.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	10.63	1.405118	0.25378	.	.	ENSG00000147262	ENST00000276218	T	0.37584	1.19	5.25	4.38	0.52667	.	0.141960	0.47455	D	0.000222	T	0.24236	0.0587	L	0.29908	0.895	0.37372	D	0.911663	P	0.42409	0.779	B	0.36766	0.232	T	0.20042	-1.0287	10	0.87932	D	0	-6.0597	8.705	0.34349	0.0:0.8195:0.0:0.1805	.	286	Q8TDV5	GP119_HUMAN	L	286	ENSP00000276218:V286L	ENSP00000276218:V286L	V	-	1	0	GPR119	129346247	1.000000	0.71417	0.971000	0.41717	0.711000	0.40976	2.120000	0.41968	1.186000	0.42985	0.600000	0.82982	GTG		0.582	GPR119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058270.1	NM_178471		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-61-1728-01	TCGA-61-1728-11	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000413465.2_Missense_Mutation_p.Y220C|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C|TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	17	GRCh37	CM015378|CM951227	TP53	M	rs121912666						102.0	94.0	97.0					17																	7578190		2203	4300	6503	7518915	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	17.37:g.7578190T>C	ENSP00000269305:p.Tyr220Cys		7518915	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
NNT	23530	broad.mit.edu	37	5	43616078	43616078	+	Frame_Shift_Del	DEL	A	A	-			TCGA-61-1728-01	TCGA-61-1728-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-61-1728-01	TCGA-61-1728-11	g.chr5:43616078delA	ENST00000264663.5	+	4	731	c.510delA	c.(508-510)agafs	p.R170fs	NNT_ENST00000512996.2_Frame_Shift_Del_p.R39fs|NNT_ENST00000344920.4_Frame_Shift_Del_p.R170fs	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	170					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					TTTCCCAAAGAAAAACTACAG	0.428																																																0			5											90.0	95.0	93.0					5																	43616078		2203	4300	6503	43651835	SO:0001589	frameshift_variant	23530			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.510delA	5.37:g.43616078delA	ENSP00000264663:p.Arg170fs		43651835	Q16796|Q2TB60|Q8N3V4	Frame_Shift_Del	DEL	ENST00000264663.5	37	CCDS3949.1	DEL	9	Broad																																																																																				0.428	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977		Frame_Shift_Del
