#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
SETDB1	9869	broad.mit.edu	37	1	150923443	150923443	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr1:150923443T>C	ENST00000271640.5	+	13	2280	c.2090T>C	c.(2089-2091)aTt>aCt	p.I697T	SETDB1_ENST00000368969.4_Missense_Mutation_p.I697T|SETDB1_ENST00000459773.1_Intron	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	697					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.I697T(1)		NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			GTCAATGAGATTGACACAACC	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											96.0	97.0	96.0					1																	150923443		2203	4300	6503	149190067	SO:0001583	missense	9869			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.2090T>C	1.37:g.150923443T>C	ENSP00000271640:p.Ile697Thr		149190067	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	ENST00000271640.5	37	CCDS44217.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	16.62	3.174576	0.57692	.	.	ENSG00000143379	ENST00000271640;ENST00000368969;ENST00000498193	D;D;D	0.89810	-2.57;-2.57;-2.57	5.66	5.66	0.87406	Pre-SET zinc-binding sub-group (1);Pre-SET domain (1);	0.046577	0.85682	D	0.000000	D	0.90930	0.7149	M	0.84846	2.72	0.80722	D	1	P;B;B	0.38745	0.645;0.241;0.284	P;B;B	0.47118	0.538;0.094;0.152	D	0.92525	0.6028	10	0.87932	D	0	.	15.0838	0.72135	0.0:0.0:0.0:1.0	.	697;697;697	E9PRF4;Q15047-3;Q15047	.;.;SETB1_HUMAN	T	697	ENSP00000271640:I697T;ENSP00000357965:I697T;ENSP00000432348:I697T	ENSP00000271640:I697T	I	+	2	0	SETDB1	149190067	1.000000	0.71417	1.000000	0.80357	0.328000	0.28507	6.198000	0.72106	2.146000	0.66826	0.533000	0.62120	ATT		0.478	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2			Missense_Mutation
OR2B11	127623	broad.mit.edu	37	1	247614505	247614505	+	Silent	SNP	A	A	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr1:247614505A>T	ENST00000318749.6	-	1	803	c.780T>A	c.(778-780)atT>atA	p.I260I		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I260I(1)		endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GATACATGTAAATCGCAGGTA	0.522																																																1	Substitution - coding silent(1)	ovary(1)	1											154.0	155.0	155.0					1																	247614505		2203	4300	6503	245681128	SO:0001819	synonymous_variant	127623				CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.780T>A	1.37:g.247614505A>T			245681128	B2RP03	Silent	SNP	ENST00000318749.6	37	CCDS31090.1	SNP	1	Broad																																																																																				0.522	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492		Silent
KCNK18	338567	broad.mit.edu	37	10	118960736	118960736	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr10:118960736G>T	ENST00000334549.1	+	2	290	c.290G>T	c.(289-291)aGg>aTg	p.R97M		NM_181840.1	NP_862823.1	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	97					cellular response to pH (GO:0071467)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)	p.R97M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	41		Colorectal(252;0.19)		all cancers(201;0.0211)		TGGTTTAACAGGACCACACAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	10											175.0	149.0	158.0					10																	118960736		2203	4300	6503	118950726	SO:0001583	missense	338567			AB087138	CCDS7598.1	10q26.11	2012-03-07			ENSG00000186795	ENSG00000186795		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	19439	protein-coding gene	gene with protein product	"""TWIK related spinal cord K+ channel"""	613655				16382106	Standard	NM_181840		Approved	K2p18.1, TRESK-2, TRESK2, TRESK, TRIK	uc010qsr.2	Q7Z418	OTTHUMG00000019120	ENST00000334549.1:c.290G>T	10.37:g.118960736G>T	ENSP00000334650:p.Arg97Met		118950726	Q5SQQ8	Missense_Mutation	SNP	ENST00000334549.1	37	CCDS7598.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	13.34	2.206763	0.39003	.	.	ENSG00000186795	ENST00000334549	T	0.24350	1.86	4.34	-2.12	0.07165	.	1.076820	0.07068	N	0.835009	T	0.27169	0.0666	L	0.41356	1.27	0.09310	N	1	D	0.53151	0.958	P	0.51453	0.67	T	0.30504	-0.9976	10	0.45353	T	0.12	.	6.4476	0.21885	0.3093:0.4794:0.2113:0.0	.	97	Q7Z418	KCNKI_HUMAN	M	97	ENSP00000334650:R97M	ENSP00000334650:R97M	R	+	2	0	KCNK18	118950726	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.008000	0.12788	-0.380000	0.07894	-0.175000	0.13238	AGG		0.537	KCNK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050562.2	NM_181840		Missense_Mutation
AP2A2	161	broad.mit.edu	37	11	994220	994220	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr11:994220C>G	ENST00000448903.2	+	14	2072	c.1931C>G	c.(1930-1932)cCt>cGt	p.P644R	AP2A2_ENST00000534328.1_Intron|AP2A2_ENST00000332231.5_Missense_Mutation_p.P645R	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	644					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)	p.P645R(1)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		GGTCCTGAGCCTGCCCCAGCC	0.622																																																1	Substitution - Missense(1)	ovary(1)	11											54.0	70.0	64.0					11																	994220		2099	4200	6299	984220	SO:0001583	missense	161			AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1931C>G	11.37:g.994220C>G	ENSP00000413234:p.Pro644Arg		984220	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	ENST00000448903.2	37	CCDS44512.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	1.455	-0.563863	0.03939	.	.	ENSG00000183020	ENST00000448903;ENST00000332231;ENST00000448757;ENST00000529125;ENST00000452310	T;T	0.17854	2.25;2.25	3.16	3.16	0.36331	.	0.132901	0.51477	D	0.000092	T	0.13372	0.0324	L	0.45051	1.395	0.43084	D	0.994743	B;B	0.14805	0.011;0.006	B;B	0.13407	0.009;0.004	T	0.07009	-1.0795	10	0.15952	T	0.53	-71.0709	10.9308	0.47217	0.1878:0.8122:0.0:0.0	.	645;644	O94973-2;O94973	.;AP2A2_HUMAN	R	644;645;645;381;384	ENSP00000413234:P644R;ENSP00000327694:P645R	ENSP00000327694:P645R	P	+	2	0	AP2A2	984220	0.933000	0.31639	0.668000	0.29813	0.005000	0.04900	2.456000	0.44997	2.080000	0.62538	0.561000	0.74099	CCT		0.622	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385431.2	NM_012305		Missense_Mutation
PAX6	5080	broad.mit.edu	37	11	31815586	31815586	+	Silent	SNP	T	T	C			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr11:31815586T>C	ENST00000379132.3	-	8	1039	c.759A>G	c.(757-759)agA>agG	p.R253R	PAX6_ENST00000419022.1_Silent_p.R267R|PAX6_ENST00000379129.2_Silent_p.R267R|PAX6_ENST00000379111.2_Silent_p.R253R|PAX6_ENST00000241001.8_Silent_p.R253R|PAX6_ENST00000379123.5_Silent_p.R253R|PAX6_ENST00000379115.4_Silent_p.R267R|PAX6_ENST00000379107.2_Silent_p.R267R			P26367	PAX6_HUMAN	paired box 6	253					astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)	p.R267R(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					GTACCTGTATTCTTGCTTCAG	0.393									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																																							1	Substitution - coding silent(1)	ovary(1)	11											218.0	215.0	216.0					11																	31815586		2202	4299	6501	31772162	SO:0001819	synonymous_variant	5080	Familial Cancer Database	WAGR syndrome	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.759A>G	11.37:g.31815586T>C			31772162	Q6N006|Q99413	Silent	SNP	ENST00000379132.3	37	CCDS31451.1	SNP	62	Broad																																																																																				0.393	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4	NM_001604		Silent
TRAF6	7189	broad.mit.edu	37	11	36511516	36511516	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr11:36511516C>T	ENST00000526995.1	-	7	1687	c.1441G>A	c.(1441-1443)Gcc>Acc	p.A481T	TRAF6_ENST00000529150.1_5'Flank|TRAF6_ENST00000348124.5_Missense_Mutation_p.A481T	NM_004620.3	NP_004611.1	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6, E3 ubiquitin protein ligase	481	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of protein kinase activity (GO:0032147)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic signaling pathway (GO:0097190)|bone resorption (GO:0045453)|cell development (GO:0048468)|cellular response to lipopolysaccharide (GO:0071222)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein autoubiquitination (GO:0051865)|protein complex assembly (GO:0006461)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of immunoglobulin secretion (GO:0051023)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	histone deacetylase binding (GO:0042826)|ligase activity (GO:0016874)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A481T(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)	27	all_lung(20;0.211)	all_hematologic(20;0.107)				TGTCTTAGGGCTTCCAGATGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	11											101.0	101.0	101.0					11																	36511516		2202	4296	6498	36468092	SO:0001583	missense	7189				CCDS7901.1	11p12	2013-01-09	2012-02-23		ENSG00000175104	ENSG00000175104		"""RING-type (C3HC4) zinc fingers"""	12036	protein-coding gene	gene with protein product		602355	"""TNF receptor-associated factor 6"""			8837778	Standard	NM_004620		Approved	RNF85	uc001mws.2	Q9Y4K3	OTTHUMG00000166391	ENST00000526995.1:c.1441G>A	11.37:g.36511516C>T	ENSP00000433623:p.Ala481Thr		36468092	A6NKI7|A8KAB3|D3DR16|Q8NEH5	Missense_Mutation	SNP	ENST00000526995.1	37	CCDS7901.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	11.59	1.685400	0.29872	.	.	ENSG00000175104	ENST00000526995;ENST00000348124	T;T	0.40225	1.04;1.04	5.46	5.46	0.80206	TRAF-type (1);TRAF-like (1);MATH (3);	0.343217	0.34652	N	0.003791	T	0.18759	0.0450	N	0.03608	-0.345	0.45272	D	0.998272	B	0.14805	0.011	B	0.17722	0.019	T	0.17107	-1.0380	10	0.10377	T	0.69	-16.6557	10.8288	0.46649	0.0:0.8843:0.0:0.1157	.	481	Q9Y4K3	TRAF6_HUMAN	T	481	ENSP00000433623:A481T;ENSP00000337853:A481T	ENSP00000337853:A481T	A	-	1	0	TRAF6	36468092	0.982000	0.34865	0.990000	0.47175	0.979000	0.70002	2.278000	0.43426	2.739000	0.93911	0.555000	0.69702	GCC		0.473	TRAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389530.1	NM_145803		Missense_Mutation
AHNAK	79026	broad.mit.edu	37	11	62289131	62289131	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr11:62289131T>C	ENST00000378024.4	-	5	13032	c.12758A>G	c.(12757-12759)aAa>aGa	p.K4253R	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4253					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.K4253R(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTTGGGGGCTTTGATGTTCAT	0.473																																																1	Substitution - Missense(1)	ovary(1)	11											213.0	222.0	219.0					11																	62289131		2202	4299	6501	62045707	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.12758A>G	11.37:g.62289131T>C	ENSP00000367263:p.Lys4253Arg		62045707	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	t	9.014	0.983270	0.18889	.	.	ENSG00000124942	ENST00000378024	T	0.00882	5.58	4.88	4.88	0.63580	.	0.000000	0.43110	D	0.000603	T	0.02455	0.0075	M	0.85945	2.785	0.25829	N	0.984199	B	0.21753	0.06	B	0.27715	0.082	T	0.12243	-1.0555	10	0.41790	T	0.15	.	12.8094	0.57631	0.0:0.0:0.0:1.0	.	4253	Q09666	AHNK_HUMAN	R	4253	ENSP00000367263:K4253R	ENSP00000367263:K4253R	K	-	2	0	AHNAK	62045707	.	.	0.958000	0.39756	0.005000	0.04900	.	.	1.847000	0.53656	0.444000	0.29173	AAA		0.473	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		Missense_Mutation
NRXN2	9379	broad.mit.edu	37	11	64453370	64453370	+	Silent	SNP	G	G	A	rs540195301	byFrequency	TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr11:64453370G>A	ENST00000377551.1	-	5	1111	c.900C>T	c.(898-900)taC>taT	p.Y300Y	NRXN2_ENST00000265459.6_Silent_p.Y300Y|NRXN2_ENST00000377559.3_Silent_p.Y276Y|NRXN2_ENST00000409571.1_Silent_p.Y300Y			Q9P2S2	NRX2A_HUMAN	neurexin 2	300	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.Y300Y(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						GTGACAGGTCGTAGCAGAAGA	0.577													G|||	2	0.000399361	0.0	0.0	5008	,	,		21060	0.002		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	11											358.0	282.0	308.0					11																	64453370		2201	4297	6498	64209946	SO:0001819	synonymous_variant	9379				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.900C>T	11.37:g.64453370G>A			64209946	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1	SNP	40	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.615|8.615	0.890058|0.890058	0.17540|0.17540	.|.	.|.	ENSG00000110076|ENSG00000110076	ENST00000437746|ENST00000417749	.|.	.|.	.|.	4.17|4.17	-1.32|-1.32	0.09201|0.09201	.|.	.|.	.|.	.|.	.|.	.|T	.|0.54791	.|0.1880	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.49890	.|-0.8891	.|4	.|.	.|.	.|.	.|.	9.3456|9.3456	0.38107|0.38107	0.4506:0.0:0.5494:0.0|0.4506:0.0:0.5494:0.0	.|.	.|.	.|.	.|.	X|M	90|61	.|.	.|.	R|T	-|-	1|2	2|0	NRXN2|NRXN2	64209946|64209946	0.999000|0.999000	0.42202|0.42202	0.996000|0.996000	0.52242|0.52242	0.995000|0.995000	0.86356|0.86356	0.533000|0.533000	0.23082|0.23082	-0.194000|-0.194000	0.10399|0.10399	0.467000|0.467000	0.42956|0.42956	CGA|ACG		0.577	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080		Silent
WSCD2	9671	broad.mit.edu	37	12	108642000	108642000	+	Silent	SNP	C	C	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr12:108642000C>T	ENST00000332082.4	+	10	2396	c.1578C>T	c.(1576-1578)ctC>ctT	p.L526L	WSCD2_ENST00000547525.1_Silent_p.L526L|WSCD2_ENST00000549903.1_Silent_p.L546L|WSCD2_ENST00000261400.3_Silent_p.L546L			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	526						integral component of membrane (GO:0016021)		p.L526L(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						TCCGGAAGCTCGAGTATGACC	0.602																																																1	Substitution - coding silent(1)	ovary(1)	12											59.0	66.0	64.0					12																	108642000		2026	4197	6223	107166130	SO:0001819	synonymous_variant	9671				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.1578C>T	12.37:g.108642000C>T			107166130	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Silent	SNP	ENST00000332082.4	37	CCDS41828.1	SNP	31	Broad																																																																																				0.602	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653		Silent
TUBA3C	7278	broad.mit.edu	37	13	19751364	19751364	+	Silent	SNP	C	C	T	rs527372781	byFrequency	TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr13:19751364C>T	ENST00000400113.3	-	4	863	c.759G>A	c.(757-759)acG>acA	p.T253T		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	253					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.T253T(2)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TCTGGAATTCCGTCAAGTCCA	0.612													C|||	4	0.000798722	0.0	0.0	5008	,	,		18879	0.0		0.0	False		,,,				2504	0.0041															2	Substitution - coding silent(2)	ovary(2)	13											148.0	131.0	137.0					13																	19751364		2203	4300	6503	18649364	SO:0001819	synonymous_variant	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.759G>A	13.37:g.19751364C>T			18649364	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1	SNP	23	Broad																																																																																				0.612	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001		Silent
OR11G2	390439	broad.mit.edu	37	14	20666089	20666089	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr14:20666089G>A	ENST00000357366.3	+	1	595	c.595G>A	c.(595-597)Gtc>Atc	p.V199I		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V199I(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		GATTCCTATCGTCAACATCTC	0.458																																																1	Substitution - Missense(1)	ovary(1)	14											117.0	100.0	106.0					14																	20666089		2203	4300	6503	19735929	SO:0001583	missense	390439				CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.595G>A	14.37:g.20666089G>A	ENSP00000349930:p.Val199Ile		19735929	Q6IF09|Q96R33	Missense_Mutation	SNP	ENST00000357366.3	37	CCDS32032.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	g	0.001	-2.889112	0.00060	.	.	ENSG00000196832	ENST00000357366	T	0.37058	1.22	4.93	1.09	0.20402	GPCR, rhodopsin-like superfamily (1);	0.648115	0.13478	N	0.384946	T	0.15176	0.0366	N	0.13168	0.305	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.30909	-0.9962	10	0.07030	T	0.85	.	3.9912	0.09538	0.6032:0.0:0.2511:0.1457	.	199	Q8NGC1	O11G2_HUMAN	I	199	ENSP00000349930:V199I	ENSP00000349930:V199I	V	+	1	0	OR11G2	19735929	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-1.008000	0.03663	0.064000	0.16427	-0.300000	0.09419	GTC		0.458	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395722.1			Missense_Mutation
TEP1	7011	broad.mit.edu	37	14	20869265	20869265	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr14:20869265C>T	ENST00000262715.5	-	9	1467	c.1427G>A	c.(1426-1428)cGc>cAc	p.R476H	TEP1_ENST00000556935.1_Missense_Mutation_p.R368H	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	476	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)	p.R476H(1)		NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CCCAGGAAGGCGACTTCGAGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	14											79.0	76.0	77.0					14																	20869265		2203	4300	6503	19939105	SO:0001583	missense	7011				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.1427G>A	14.37:g.20869265C>T	ENSP00000262715:p.Arg476His		19939105	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	CCDS9548.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	14.21	2.467332	0.43839	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.16196	2.36;2.36	5.71	1.83	0.25207	TROVE (2);	0.222920	0.46758	N	0.000277	T	0.14013	0.0339	L	0.46157	1.445	0.80722	D	1	B;B	0.25719	0.045;0.132	B;B	0.22386	0.019;0.039	T	0.07635	-1.0762	10	0.34782	T	0.22	-5.6602	9.4383	0.38653	0.0:0.6969:0.0:0.3031	.	368;476	G3V5X7;Q99973	.;TEP1_HUMAN	H	476;476;368	ENSP00000262715:R476H;ENSP00000452574:R368H	ENSP00000262715:R476H	R	-	2	0	TEP1	19939105	0.472000	0.25870	1.000000	0.80357	0.636000	0.38137	-0.438000	0.06905	0.343000	0.23821	0.555000	0.69702	CGC		0.512	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110		Missense_Mutation
ERO1L	30001	broad.mit.edu	37	14	53119983	53119983	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr14:53119983G>A	ENST00000395686.3	-	12	1082	c.859C>T	c.(859-861)Cga>Tga	p.R287*		NM_014584.1	NP_055399.1	Q96HE7	ERO1A_HUMAN	ERO1-like (S. cerevisiae)	287					4-hydroxyproline metabolic process (GO:0019471)|brown fat cell differentiation (GO:0050873)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum unfolded protein response (GO:0030968)|extracellular matrix organization (GO:0030198)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to temperature stimulus (GO:0009266)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)	p.R287*(1)	ERO1L/FERMT2(2)	breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12	Breast(41;0.226)					CCATCAAATCGCTGTTGAAAT	0.328																																																1	Substitution - Nonsense(1)	ovary(1)	14											104.0	116.0	112.0					14																	53119983		2203	4300	6503	52189733	SO:0001587	stop_gained	30001			AF081886	CCDS9709.1	14q22.1	2010-10-06	2001-11-28		ENSG00000197930	ENSG00000197930			13280	protein-coding gene	gene with protein product		615435	"""ERO1 (S. cerevisiae)-like"""			10671517	Standard	NM_014584		Approved	ERO1A, ERO1-alpha	uc001wzv.3	Q96HE7	OTTHUMG00000140301	ENST00000395686.3:c.859C>T	14.37:g.53119983G>A	ENSP00000379042:p.Arg287*		52189733	A8K9X4|A8MYW1|Q7LD45|Q9P1Q9|Q9UKV6	Nonsense_Mutation	SNP	ENST00000395686.3	37	CCDS9709.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	37	6.315174	0.97467	.	.	ENSG00000197930	ENST00000395686	.	.	.	5.67	2.32	0.28847	.	0.096101	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.5491	14.7988	0.69898	0.0:0.0:0.5069:0.4931	.	.	.	.	X	287	.	ENSP00000379042:R287X	R	-	1	2	ERO1L	52189733	0.999000	0.42202	1.000000	0.80357	0.860000	0.49131	1.404000	0.34623	1.224000	0.43551	0.585000	0.79938	CGA		0.328	ERO1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276892.1	NM_014584		Nonsense_Mutation
TP53	7157	broad.mit.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr17:7578265A>G	ENST00000269305.4	-	6	773	c.584T>C	c.(583-585)aTc>aCc	p.I195T	TP53_ENST00000359597.4_Missense_Mutation_p.I195T|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.I195T|TP53_ENST00000413465.2_Missense_Mutation_p.I195T|TP53_ENST00000445888.2_Missense_Mutation_p.I195T|TP53_ENST00000455263.2_Missense_Mutation_p.I195T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)	17											100.0	89.0	93.0					17																	7578265		2203	4300	6503	7518990	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>C	17.37:g.7578265A>G	ENSP00000269305:p.Ile195Thr		7518990	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324656	0.41197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	N	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.52099	D	0.999943	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.991;0.989;0.998;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.995;0.953;0.979;0.995;0.993;0.996	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195T;ENSP00000352610:I195T;ENSP00000269305:I195T;ENSP00000398846:I195T;ENSP00000391127:I195T;ENSP00000391478:I195T;ENSP00000425104:I63T;ENSP00000423862:I102T	ENSP00000269305:I195T	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
AP2B1	163	broad.mit.edu	37	17	33968965	33968965	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr17:33968965G>A	ENST00000262325.7	+	12	2060	c.1507G>A	c.(1507-1509)Gtc>Atc	p.V503I	AP2B1_ENST00000545922.2_3'UTR|AP2B1_ENST00000312678.8_Missense_Mutation_p.V503I|AP2B1_ENST00000592545.1_Missense_Mutation_p.V465I|AP2B1_ENST00000538556.1_Missense_Mutation_p.V446I|AP2B1_ENST00000589344.1_Missense_Mutation_p.V503I|AP2B1_ENST00000537622.2_Missense_Mutation_p.V503I	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	503					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)	p.V503I(1)		NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		ACAGGAGCTAGTCCAGCAGGT	0.393																																																1	Substitution - Missense(1)	ovary(1)	17											89.0	82.0	84.0					17																	33968965		2203	4300	6503	30993078	SO:0001583	missense	163			M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.1507G>A	17.37:g.33968965G>A	ENSP00000262325:p.Val503Ile		30993078	A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	37	CCDS32622.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663270	0.67700	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622;ENST00000545922	T;T;T;T	0.11821	2.74;2.74;2.74;2.74	5.52	5.52	0.82312	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.25717	0.0626	N	0.26130	0.795	0.80722	D	1	D;B;B;B	0.59357	0.985;0.048;0.022;0.051	D;B;B;B	0.68483	0.958;0.129;0.036;0.026	T	0.00998	-1.1486	10	0.33141	T	0.24	-5.9443	18.7923	0.91978	0.0:0.0:1.0:0.0	.	240;465;503;503	F5GYG9;B4DWG4;P63010;P63010-2	.;.;AP2B1_HUMAN;.	I	503;503;446;503;240	ENSP00000262325:V503I;ENSP00000314414:V503I;ENSP00000440563:V446I;ENSP00000437413:V503I	ENSP00000262325:V503I	V	+	1	0	AP2B1	30993078	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.545000	0.98095	2.754000	0.94517	0.650000	0.86243	GTC		0.393	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1			Missense_Mutation
ZNF407	55628	broad.mit.edu	37	18	72346771	72346771	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr18:72346771G>A	ENST00000299687.5	+	1	3796	c.3796G>A	c.(3796-3798)Gtt>Att	p.V1266I	ZNF407_ENST00000577538.1_Missense_Mutation_p.V1266I|ZNF407_ENST00000309902.6_Missense_Mutation_p.V1266I|ZNF407_ENST00000582337.1_Missense_Mutation_p.V1266I	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1266					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.V1266I(1)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		CCCTGTGCTCGTTGTGACAAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	18											34.0	38.0	37.0					18																	72346771		1940	4140	6080	70475759	SO:0001583	missense	55628			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.3796G>A	18.37:g.72346771G>A	ENSP00000299687:p.Val1266Ile		70475759	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	CCDS45885.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	10.89	1.479050	0.26511	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.10192	2.9;3.34	4.69	-4.73	0.03259	.	1.384680	0.04533	N	0.386651	T	0.04861	0.0131	N	0.14661	0.345	0.09310	N	1	B;B;B	0.14438	0.002;0.002;0.01	B;B;B	0.06405	0.001;0.002;0.002	T	0.40608	-0.9554	10	0.27785	T	0.31	.	1.4333	0.02338	0.4396:0.2524:0.1818:0.1262	.	1266;1266;1266	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	I	1266	ENSP00000299687:V1266I;ENSP00000310359:V1266I	ENSP00000299687:V1266I	V	+	1	0	ZNF407	70475759	.	.	0.000000	0.03702	0.002000	0.02628	.	.	0.003000	0.14656	-0.408000	0.06270	GTT		0.562	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757		Missense_Mutation
SLC25A23	79085	broad.mit.edu	37	19	6456446	6456446	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr19:6456446G>C	ENST00000301454.4	-	4	574	c.468C>G	c.(466-468)ttC>ttG	p.F156L	SLC25A23_ENST00000414491.2_5'Flank|SLC25A23_ENST00000334510.5_Missense_Mutation_p.F156L	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	156					adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)	p.F156L(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						AATGCTTCCAGAAATACAGCA	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											147.0	109.0	122.0					19																	6456446		2203	4300	6503	6407446	SO:0001583	missense	79085			AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.468C>G	19.37:g.6456446G>C	ENSP00000301454:p.Phe156Leu		6407446	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	ENST00000301454.4	37	CCDS32882.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	29.8	5.036557	0.93630	.	.	ENSG00000125648	ENST00000264088;ENST00000301454;ENST00000334510	T;T;T	0.36157	1.27;1.27;1.27	4.86	4.86	0.63082	EF-hand-like domain (1);	0.118609	0.64402	D	0.000013	T	0.40222	0.1108	M	0.68317	2.08	0.46609	D	0.999124	P	0.37423	0.594	B	0.35607	0.206	T	0.47598	-0.9105	10	0.66056	D	0.02	-31.282	16.7336	0.85442	0.0:0.0:1.0:0.0	.	156	Q9BV35	SCMC3_HUMAN	L	156	ENSP00000264088:F156L;ENSP00000301454:F156L;ENSP00000334537:F156L	ENSP00000264088:F156L	F	-	3	2	SLC25A23	6407446	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.295000	0.65692	2.251000	0.74343	0.491000	0.48974	TTC		0.592	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453325.1	NM_024103		Missense_Mutation
ZC3H4	23211	broad.mit.edu	37	19	47593269	47593269	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr19:47593269G>C	ENST00000253048.5	-	5	707	c.670C>G	c.(670-672)Ctg>Gtg	p.L224V	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	224							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.L224V(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		TACTGGTTCAGCTCTTTGGTG	0.607																																																1	Substitution - Missense(1)	ovary(1)	19											118.0	120.0	119.0					19																	47593269		2147	4236	6383	52285109	SO:0001583	missense	23211			AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.670C>G	19.37:g.47593269G>C	ENSP00000253048:p.Leu224Val		52285109	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	CCDS42582.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284992	0.40394	.	.	ENSG00000130749	ENST00000253048	T	0.24538	1.85	5.74	4.7	0.59300	.	0.000000	0.64402	D	0.000011	T	0.48205	0.1487	M	0.67397	2.05	0.58432	D	0.999998	D	0.69078	0.997	D	0.78314	0.991	T	0.45571	-0.9252	10	0.66056	D	0.02	.	14.027	0.64592	0.0751:0.0:0.9249:0.0	.	224	Q9UPT8	ZC3H4_HUMAN	V	224	ENSP00000253048:L224V	ENSP00000253048:L224V	L	-	1	2	ZC3H4	52285109	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	6.283000	0.72646	2.710000	0.92621	0.655000	0.94253	CTG		0.607	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1			Missense_Mutation
EHD3	30845	broad.mit.edu	37	2	31483500	31483500	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr2:31483500C>A	ENST00000322054.5	+	4	912	c.627C>A	c.(625-627)aaC>aaA	p.N209K	EHD3_ENST00000541626.1_Intron	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	209	Dynamin-type G.				blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)	p.N209K(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					CCCTCAAGAACCACGAGGACA	0.547																																																1	Substitution - Missense(1)	ovary(1)	2											90.0	81.0	84.0					2																	31483500		2203	4300	6503	31337004	SO:0001583	missense	30845			AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.627C>A	2.37:g.31483500C>A	ENSP00000327116:p.Asn209Lys		31337004	B4DFR5|D6W574|Q8N514|Q9NZB3	Missense_Mutation	SNP	ENST00000322054.5	37	CCDS1774.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899003	0.52227	.	.	ENSG00000013016	ENST00000322054	D	0.95238	-3.65	5.15	4.24	0.50183	Dynamin, GTPase domain (1);	0.118865	0.85682	N	0.000000	D	0.86781	0.6015	N	0.01817	-0.705	0.80722	D	1	B	0.23249	0.082	B	0.33121	0.158	D	0.83786	0.0228	10	0.54805	T	0.06	-47.7151	14.844	0.70246	0.1448:0.8552:0.0:0.0	.	209	Q9NZN3	EHD3_HUMAN	K	209	ENSP00000327116:N209K	ENSP00000327116:N209K	N	+	3	2	EHD3	31337004	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.651000	0.83577	1.336000	0.45506	0.561000	0.74099	AAC		0.547	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216810.1	NM_014600		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179516832	179516832	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr2:179516832G>C	ENST00000591111.1	-	159	34989	c.34765C>G	c.(34765-34767)Ccc>Gcc	p.P11589A	TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P10662A|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.P13096A|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11589	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P10662A(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTCAGGGGGAGGACTTTCC	0.343																																																1	Substitution - Missense(1)	ovary(1)	2											85.0	82.0	83.0					2																	179516832		1814	4074	5888	179225077	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34765C>G	2.37:g.179516832G>C	ENSP00000465570:p.Pro11589Ala		179225077	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	11.13	1.549235	0.27652	.	.	ENSG00000155657	ENST00000342992	T	0.65178	-0.14	5.0	5.0	0.66597	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.58694	0.2140	M	0.63843	1.955	0.80722	D	1	B	0.22003	0.063	B	0.22386	0.039	T	0.61192	-0.7112	9	0.87932	D	0	.	10.0267	0.42076	0.1266:0.0:0.8734:0.0	.	11589	Q8WZ42	TITIN_HUMAN	A	10662	ENSP00000343764:P10662A	ENSP00000343764:P10662A	P	-	1	0	TTN	179225077	0.232000	0.23762	1.000000	0.80357	0.721000	0.41392	1.299000	0.33424	2.490000	0.84030	0.650000	0.86243	CCC		0.343	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
RFPL2	10739	broad.mit.edu	37	22	32586896	32586896	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr22:32586896C>T	ENST00000400237.1	-	5	1935	c.1000G>A	c.(1000-1002)Gta>Ata	p.V334I	RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000248980.4_Missense_Mutation_p.V273I|RFPL2_ENST00000400236.3_Missense_Mutation_p.V244I|RFPL2_ENST00000248983.4_Missense_Mutation_p.V244I			O75678	RFPL2_HUMAN	ret finger protein-like 2	334	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)	p.V244I(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						TCAGCAGATACGCTCCTGAAT	0.478																																																1	Substitution - Missense(1)	ovary(1)	22											65.0	79.0	74.0					22																	32586896		2203	4300	6503	30916896	SO:0001583	missense	10739			AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.1000G>A	22.37:g.32586896C>T	ENSP00000383096:p.Val334Ile		30916896		Missense_Mutation	SNP	ENST00000400237.1	37	CCDS43009.2	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.841971	0.00573	.	.	ENSG00000128253	ENST00000248980;ENST00000248983;ENST00000400236;ENST00000400237	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	0.582	-1.16	0.09678	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.30572	0.0769	N	0.01535	-0.81	0.09310	N	1	B;B	0.32653	0.379;0.069	B;B	0.31495	0.131;0.08	T	0.28618	-1.0038	9	0.02654	T	1	.	2.61	0.04888	0.0:0.2552:0.2726:0.4723	.	334;273	O75678;O75678-3	RFPL2_HUMAN;.	I	273;244;244;334	ENSP00000248980:V273I;ENSP00000248983:V244I;ENSP00000383095:V244I;ENSP00000383096:V334I	ENSP00000248980:V273I	V	-	1	0	RFPL2	30916896	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.701000	0.05075	-1.214000	0.02614	-0.714000	0.03626	GTA		0.478	RFPL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075262.2	NM_006605		Missense_Mutation
TRIOBP	11078	broad.mit.edu	37	22	38121862	38121862	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr22:38121862C>T	ENST00000406386.3	+	7	3554	c.3299C>T	c.(3298-3300)tCc>tTc	p.S1100F		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1100					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.S1100F(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CAGTGTCAGTCCCCCCAACAC	0.667																																																1	Substitution - Missense(1)	ovary(1)	22											86.0	96.0	93.0					22																	38121862		1980	4131	6111	36451808	SO:0001583	missense	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3299C>T	22.37:g.38121862C>T	ENSP00000384312:p.Ser1100Phe		36451808	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	6.084	0.383722	0.11524	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.24151	1.87	4.57	4.57	0.56435	.	.	.	.	.	T	0.32675	0.0837	L	0.32530	0.975	0.80722	D	1	D	0.61697	0.99	P	0.58577	0.841	T	0.01516	-1.1335	9	0.33940	T	0.23	.	12.7723	0.57427	0.0:1.0:0.0:0.0	.	1100	Q9H2D6	TARA_HUMAN	F	1100	ENSP00000384312:S1100F	ENSP00000384312:S1100F	S	+	2	0	TRIOBP	36451808	0.219000	0.23619	0.641000	0.29422	0.050000	0.14768	1.181000	0.32017	2.369000	0.80426	0.449000	0.29647	TCC		0.667	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			Missense_Mutation
MAPK12	6300	broad.mit.edu	37	22	50693771	50693771	+	Silent	SNP	C	C	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr22:50693771C>T	ENST00000215659.8	-	11	1194	c.879G>A	c.(877-879)gtG>gtA	p.V293V	MAPK12_ENST00000497036.1_5'UTR|MAPK12_ENST00000395780.1_Silent_p.V203V	NM_002969.3	NP_002960.2	P53778	MK12_HUMAN	mitogen-activated protein kinase 12	293	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle arrest (GO:0007050)|DNA damage induced protein phosphorylation (GO:0006975)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of peptidase activity (GO:0010952)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)	p.V283V(1)|p.V293V(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCGCGTCCAGCACCAGCATCT	0.662																																																2	Substitution - coding silent(2)	ovary(2)	22											87.0	86.0	86.0					22																	50693771		2203	4299	6502	49035898	SO:0001819	synonymous_variant	6300			U66243	CCDS14089.1	22q13.3	2012-05-08			ENSG00000188130	ENSG00000188130	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6874	protein-coding gene	gene with protein product		602399		SAPK3		9169156	Standard	NM_002969		Approved	ERK6, PRKM12, p38gamma, SAPK-3	uc003bkm.1	P53778	OTTHUMG00000030145	ENST00000215659.8:c.879G>A	22.37:g.50693771C>T			49035898	Q14260|Q6IC53|Q99588|Q99672	Silent	SNP	ENST00000215659.8	37	CCDS14089.1	SNP	25	Broad																																																																																				0.662	MAPK12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074999.2	NM_002969		Silent
ARSJ	79642	broad.mit.edu	37	4	114824057	114824057	+	Silent	SNP	C	C	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr4:114824057C>T	ENST00000315366.7	-	2	2039	c.1173G>A	c.(1171-1173)caG>caA	p.Q391Q	ARSJ_ENST00000541197.1_Silent_p.Q391Q	NM_024590.3	NP_078866.3	Q5FYB0	ARSJ_HUMAN	arylsulfatase family, member J	391					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.Q391Q(1)		endometrium(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	21		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		CCTCATCAATCTGTCCTTCAG	0.458																																																1	Substitution - coding silent(1)	ovary(1)	4											163.0	159.0	160.0					4																	114824057		1984	4172	6156	115043506	SO:0001819	synonymous_variant	79642				CCDS43264.1	4q26	2013-02-14	2006-03-07		ENSG00000180801	ENSG00000180801		"""Arylsulfatase family"""	26286	protein-coding gene	gene with protein product		610010	"""arylsulfatase J"""			12975309, 16174644	Standard	NM_024590		Approved	FLJ23548	uc003ibq.1	Q5FYB0	OTTHUMG00000161067	ENST00000315366.7:c.1173G>A	4.37:g.114824057C>T			115043506	A2RUG0|B7ZM45|Q1HA39|Q5FWE4|Q6UWT9	Silent	SNP	ENST00000315366.7	37	CCDS43264.1	SNP	32	Broad																																																																																				0.458	ARSJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363650.1	NM_024590		Silent
STOX2	56977	broad.mit.edu	37	4	184931081	184931081	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr4:184931081C>T	ENST00000308497.4	+	3	2525	c.1090C>T	c.(1090-1092)Cgg>Tgg	p.R364W	STOX2_ENST00000438269.1_Missense_Mutation_p.R364W	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	364					embryo development (GO:0009790)|maternal placenta development (GO:0001893)			p.R364W(1)		breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		TAGGACTCATCGGAAGTCCCA	0.522																																																1	Substitution - Missense(1)	ovary(1)	4											32.0	31.0	31.0					4																	184931081		1897	4123	6020	185168075	SO:0001583	missense	56977			AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.1090C>T	4.37:g.184931081C>T	ENSP00000311257:p.Arg364Trp		185168075	A6H8U4|Q9NPS8	Missense_Mutation	SNP	ENST00000308497.4	37	CCDS47167.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048329	0.55110	.	.	ENSG00000173320	ENST00000308497;ENST00000438269	T;T	0.81415	-0.5;-1.49	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.84275	0.5436	L	0.32530	0.975	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.76575	0.967;0.988	D	0.84935	0.0862	10	0.87932	D	0	-14.2328	13.6865	0.62520	0.2506:0.7494:0.0:0.0	.	364;364	Q9P2F5-2;Q9P2F5	.;STOX2_HUMAN	W	364	ENSP00000311257:R364W;ENSP00000390127:R364W	ENSP00000311257:R364W	R	+	1	2	STOX2	185168075	0.958000	0.32768	0.782000	0.31804	0.798000	0.45092	1.847000	0.39299	2.941000	0.99782	0.655000	0.94253	CGG		0.522	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361433.3	NM_020225		Missense_Mutation
PAPD7	11044	broad.mit.edu	37	5	6751185	6751185	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr5:6751185G>A	ENST00000230859.6	+	11	1273	c.1144G>A	c.(1144-1146)Gtt>Att	p.V382I		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	612					double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)	p.V382I(1)		cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						AACGCCCAGTGTTTACCAGTT	0.537																																					NSCLC(7;212 333 5667 23379 46547)											1	Substitution - Missense(1)	ovary(1)	5											146.0	144.0	145.0					5																	6751185		2203	4300	6503	6804185	SO:0001583	missense	11044			AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.1144G>A	5.37:g.6751185G>A	ENSP00000230859:p.Val382Ile		6804185	A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Missense_Mutation	SNP	ENST00000230859.6	37	CCDS3871.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611907	0.46631	.	.	ENSG00000112941	ENST00000230859	T	0.32023	1.47	5.8	5.8	0.92144	.	0.218924	0.39615	N	0.001313	T	0.28797	0.0714	L	0.47716	1.5	0.33773	D	0.623325	B;B	0.09022	0.002;0.002	B;B	0.10450	0.003;0.005	T	0.27971	-1.0058	10	0.45353	T	0.12	-11.3349	12.5404	0.56167	0.076:0.0:0.924:0.0	.	382;382	B7ZLL4;Q5XG87	.;PAPD7_HUMAN	I	382	ENSP00000230859:V382I	ENSP00000230859:V382I	V	+	1	0	PAPD7	6804185	1.000000	0.71417	0.333000	0.25482	0.829000	0.46940	3.819000	0.55686	2.741000	0.93983	0.650000	0.86243	GTT		0.537	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206904.1	NM_006999		Missense_Mutation
RASGRF2	5924	broad.mit.edu	37	5	80363981	80363981	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr5:80363981G>A	ENST00000265080.4	+	3	593	c.526G>A	c.(526-528)Gaa>Aaa	p.E176K		NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	176					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E176K(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		CACAGAAATCGAAAGGCTTAA	0.383																																																1	Substitution - Missense(1)	ovary(1)	5											123.0	117.0	119.0					5																	80363981		2203	4300	6503	80399737	SO:0001583	missense	5924			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.526G>A	5.37:g.80363981G>A	ENSP00000265080:p.Glu176Lys		80399737	B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	CCDS4052.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271995	0.59649	.	.	ENSG00000113319	ENST00000265080	T	0.41065	1.01	5.91	5.91	0.95273	.	0.088972	0.85682	D	0.000000	T	0.31857	0.0810	N	0.20986	0.625	0.52099	D	0.999947	B	0.22800	0.075	B	0.11329	0.006	T	0.11470	-1.0586	10	0.13470	T	0.59	.	20.2896	0.98541	0.0:0.0:1.0:0.0	.	176	O14827	RGRF2_HUMAN	K	176	ENSP00000265080:E176K	ENSP00000265080:E176K	E	+	1	0	RASGRF2	80399737	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	8.058000	0.89460	2.794000	0.96219	0.655000	0.94253	GAA		0.383	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		Missense_Mutation
APC	324	broad.mit.edu	37	5	112176937	112176937	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr5:112176937A>T	ENST00000457016.1	+	16	6026	c.5646A>T	c.(5644-5646)agA>agT	p.R1882S	APC_ENST00000508376.2_Missense_Mutation_p.R1882S|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.R1882S			P25054	APC_HUMAN	adenomatous polyposis coli	1882	Highly charged.|Ser-rich.		R -> T (in dbSNP:rs34157245).		anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1882S(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTGAATTAAGAAAGGCAAAAG	0.378		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	3	Substitution - Missense(1)|Unknown(1)|Deletion - Frameshift(1)	ovary(1)|soft_tissue(1)|skin(1)	5											82.0	80.0	80.0					5																	112176937		2202	4300	6502	112204836	SO:0001583	missense	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.5646A>T	5.37:g.112176937A>T	ENSP00000413133:p.Arg1882Ser		112204836	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	12.03	1.815716	0.32145	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.90732	-2.72;-2.72;-2.72	5.34	1.81	0.25067	.	0.123358	0.56097	D	0.000033	T	0.81973	0.4936	L	0.32530	0.975	0.49582	D	0.999804	B;B	0.27853	0.191;0.061	B;B	0.23275	0.045;0.045	T	0.72500	-0.4274	9	.	.	.	-16.5365	9.1034	0.36683	0.7874:0.0:0.2126:0.0	.	1884;1882	Q4LE70;P25054	.;APC_HUMAN	S	1882	ENSP00000413133:R1882S;ENSP00000257430:R1882S;ENSP00000427089:R1882S	.	R	+	3	2	APC	112204836	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.276000	0.43408	0.555000	0.29079	0.528000	0.53228	AGA		0.378	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		Missense_Mutation
PCDHB11	56125	broad.mit.edu	37	5	140580729	140580729	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr5:140580729G>A	ENST00000354757.3	+	1	1382	c.1382G>A	c.(1381-1383)cGc>cAc	p.R461H	PCDHB11_ENST00000536699.1_Missense_Mutation_p.R96H	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	461	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R461H(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTTCGTCCGCGAGAACAAC	0.587																																																1	Substitution - Missense(1)	ovary(1)	5											129.0	121.0	124.0					5																	140580729		2203	4296	6499	140560913	SO:0001583	missense	56125			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1382G>A	5.37:g.140580729G>A	ENSP00000346802:p.Arg461His		140560913	B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	CCDS4253.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	11.91	1.778183	0.31502	.	.	ENSG00000197479	ENST00000536699;ENST00000354757	T;T	0.01767	4.65;4.65	2.52	0.444	0.16592	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01870	0.0059	L	0.34521	1.04	0.09310	N	1	B	0.27416	0.178	B	0.29716	0.106	T	0.46871	-0.9160	9	0.37606	T	0.19	.	8.0089	0.30342	0.0:0.466:0.3745:0.1594	.	461	Q9Y5F2	PCDBB_HUMAN	H	96;461	ENSP00000440344:R96H;ENSP00000346802:R461H	ENSP00000346802:R461H	R	+	2	0	PCDHB11	140560913	0.000000	0.05858	0.062000	0.19696	0.538000	0.34931	-4.828000	0.00181	-0.044000	0.13491	0.306000	0.20318	CGC		0.587	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		Missense_Mutation
PKHD1	5314	broad.mit.edu	37	6	51941121	51941121	+	Missense_Mutation	SNP	G	G	A	rs374645464		TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr6:51941121G>A	ENST00000371117.3	-	6	676	c.401C>T	c.(400-402)gCg>gTg	p.A134V	PKHD1_ENST00000340994.4_Missense_Mutation_p.A134V	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	134					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.A134V(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GGGTGTCTGCGCCTTGGAAAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	6						G	VAL/ALA,VAL/ALA	0,4406		0,0,2203	95.0	98.0	97.0		401,401	0.7	0.9	6		97	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	PKHD1	NM_170724.2,NM_138694.3	64,64	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign	134/3397,134/4075	51941121	2,13004	2203	4300	6503	52049080	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.401C>T	6.37:g.51941121G>A	ENSP00000360158:p.Ala134Val		52049080	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	9.132	1.011727	0.19277	0.0	2.33E-4	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87256	-2.03;-2.23	5.74	0.699	0.18093	.	0.596054	0.16585	N	0.208034	T	0.59636	0.2208	L	0.34521	1.04	0.18873	N	0.999988	B;B	0.23650	0.055;0.089	B;B	0.15870	0.014;0.006	T	0.50056	-0.8872	10	0.23302	T	0.38	.	7.6693	0.28449	0.1295:0.0:0.3003:0.5702	.	134;134	P08F94-2;P08F94	.;PKHD1_HUMAN	V	134	ENSP00000360158:A134V;ENSP00000341097:A134V	ENSP00000341097:A134V	A	-	2	0	PKHD1	52049080	0.006000	0.16342	0.885000	0.34714	0.616000	0.37450	0.023000	0.13533	-0.088000	0.12506	-0.822000	0.03109	GCG		0.393	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		Missense_Mutation
LTV1	84946	broad.mit.edu	37	6	144167244	144167244	+	Silent	SNP	C	C	T	rs199523396	byFrequency	TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr6:144167244C>T	ENST00000367576.5	+	3	326	c.192C>T	c.(190-192)gaC>gaT	p.D64D		NM_032860.3	NP_116249.2	Q96GA3	LTV1_HUMAN	LTV1 ribosome biogenesis factor	64						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.D64D(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		TCTTTGATGACGACTATGACT	0.428													C|||	5	0.000998403	0.0	0.0	5008	,	,		20958	0.004		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	6											132.0	115.0	121.0					6																	144167244		2203	4300	6503	144208937	SO:0001819	synonymous_variant	84946			BC009855	CCDS5201.1	6q24.2	2014-02-03	2014-02-03	2006-02-06	ENSG00000135521	ENSG00000135521			21173	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 93"", ""LTV1 homolog (S. cerevisiae)"""	C6orf93			Standard	NM_032860		Approved	FLJ14909, dJ468K18.4	uc003qjs.3	Q96GA3	OTTHUMG00000015733	ENST00000367576.5:c.192C>T	6.37:g.144167244C>T			144208937	Q96JX8	Silent	SNP	ENST00000367576.5	37	CCDS5201.1	SNP	19	Broad																																																																																				0.428	LTV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042532.1	NM_032860		Silent
LAMB1	3912	broad.mit.edu	37	7	107616272	107616272	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr7:107616272A>G	ENST00000222399.6	-	10	1281	c.1051T>C	c.(1051-1053)Tac>Cac	p.Y351H	LAMB1_ENST00000393560.1_Missense_Mutation_p.Y351H|LAMB1_ENST00000393561.1_Missense_Mutation_p.Y375H	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	351	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.Y351H(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GTGGCCAGGTAAACAGCCATG	0.488																																																1	Substitution - Missense(1)	ovary(1)	7											98.0	82.0	87.0					7																	107616272		2203	4300	6503	107403508	SO:0001583	missense	3912			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.1051T>C	7.37:g.107616272A>G	ENSP00000222399:p.Tyr351His		107403508	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	26.8	4.770928	0.90108	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.41065	1.25;1.25;1.01	5.31	5.31	0.75309	EGF-like, laminin (3);	.	.	.	.	T	0.68063	0.2960	M	0.87456	2.885	0.48762	D	0.999704	P;D;D	0.71674	0.852;0.998;0.98	P;D;P	0.67725	0.451;0.953;0.872	T	0.75042	-0.3457	9	0.87932	D	0	.	15.4343	0.75133	1.0:0.0:0.0:0.0	.	351;351;375	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	H	375;351;351	ENSP00000377191:Y375H;ENSP00000222399:Y351H;ENSP00000377190:Y351H	ENSP00000222399:Y351H	Y	-	1	0	LAMB1	107403508	0.970000	0.33590	0.864000	0.33941	0.994000	0.84299	9.033000	0.93741	2.231000	0.72958	0.533000	0.62120	TAC		0.488	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		Missense_Mutation
CFTR	1080	broad.mit.edu	37	7	117182111	117182111	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr7:117182111C>G	ENST00000003084.6	+	9	1290	c.1158C>G	c.(1156-1158)aaC>aaG	p.N386K	CFTR_ENST00000454343.1_Missense_Mutation_p.N386K	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	386					cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)	p.N386K(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	TGGAATATAACTTAACGACTA	0.299									Cystic Fibrosis																																							1	Substitution - Missense(1)	ovary(1)	7											45.0	46.0	46.0					7																	117182111		2203	4298	6501	116969347	SO:0001583	missense	1080	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.1158C>G	7.37:g.117182111C>G	ENSP00000003084:p.Asn386Lys		116969347	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	17.75	3.467220	0.63625	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.92545	-3.01;-2.78;-3.06	5.62	3.82	0.43975	ABC transporter, transmembrane domain, type 1 (1);	0.080873	0.85682	D	0.000000	D	0.91099	0.7198	L	0.52011	1.625	0.38810	D	0.9554	P	0.48230	0.907	P	0.53266	0.722	D	0.88474	0.3064	10	0.33940	T	0.23	-23.3924	7.262	0.26209	0.0:0.6333:0.0:0.3667	.	386	P13569	CFTR_HUMAN	K	386;386;356	ENSP00000003084:N386K;ENSP00000403677:N386K;ENSP00000389119:N356K	ENSP00000003084:N386K	N	+	3	2	CFTR	116969347	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.859000	0.27858	0.843000	0.35070	-0.143000	0.13931	AAC		0.299	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492		Missense_Mutation
NUP205	23165	broad.mit.edu	37	7	135287718	135287718	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr7:135287718C>T	ENST00000285968.6	+	18	2704	c.2678C>T	c.(2677-2679)gCa>gTa	p.A893V		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	893					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.A893V(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						ACTAAGAAGGCAGATAATGTG	0.368																																																1	Substitution - Missense(1)	ovary(1)	7											61.0	58.0	59.0					7																	135287718		2203	4300	6503	134938258	SO:0001583	missense	23165			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.2678C>T	7.37:g.135287718C>T	ENSP00000285968:p.Ala893Val		134938258	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	29.9	5.049338	0.93740	.	.	ENSG00000155561	ENST00000285968	T	0.29917	1.55	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.53222	0.1783	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.46992	-0.9151	10	0.30854	T	0.27	-9.5812	18.4551	0.90717	0.0:1.0:0.0:0.0	.	893	Q92621	NU205_HUMAN	V	893	ENSP00000285968:A893V	ENSP00000285968:A893V	A	+	2	0	NUP205	134938258	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.740000	0.84986	2.333000	0.79357	0.591000	0.81541	GCA		0.368	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1			Missense_Mutation
TMEM139	135932	broad.mit.edu	37	7	142983749	142983749	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr7:142983749C>G	ENST00000359333.3	+	3	991	c.478C>G	c.(478-480)Cca>Gca	p.P160A	TMEM139_ENST00000410004.1_Missense_Mutation_p.P160A|CASP2_ENST00000310447.5_5'Flank|CASP2_ENST00000392925.2_5'Flank|TMEM139_ENST00000409244.1_Missense_Mutation_p.P160A|TMEM139_ENST00000409102.1_Missense_Mutation_p.P160A|TMEM139_ENST00000471161.1_3'UTR|AC073342.12_ENST00000427392.1_RNA|AC073342.12_ENST00000446192.1_RNA|TMEM139_ENST00000409541.1_Missense_Mutation_p.P160A	NM_001242775.2|NM_001282876.1|NM_001282877.1	NP_001229704.1|NP_001269805.1|NP_001269806.1	Q8IV31	TM139_HUMAN	transmembrane protein 139	160						integral component of membrane (GO:0016021)		p.P160A(1)		endometrium(1)|lung(4)|ovary(1)|prostate(1)	7	Melanoma(164;0.059)					TGGAAGAGCTCCAATCAACCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	7											85.0	81.0	82.0					7																	142983749		2203	4300	6503	142693871	SO:0001583	missense	135932			AK075067	CCDS5878.1	7q34	2006-03-17			ENSG00000178826	ENSG00000178826			22058	protein-coding gene	gene with protein product							Standard	NM_153345		Approved	FLJ90586	uc003wck.4	Q8IV31	OTTHUMG00000152652	ENST00000359333.3:c.478C>G	7.37:g.142983749C>G	ENSP00000352284:p.Pro160Ala		142693871	B2RCL5|D3DXD4|Q6ZME2|Q8NC22|Q96AU8	Missense_Mutation	SNP	ENST00000359333.3	37	CCDS5878.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	13.98	2.400024	0.42613	.	.	ENSG00000178826	ENST00000409102;ENST00000359333;ENST00000409244;ENST00000409541;ENST00000410004	.	.	.	5.0	5.0	0.66597	.	0.718657	0.12630	N	0.452269	T	0.37758	0.1015	L	0.47716	1.5	0.09310	N	1	P	0.40731	0.728	B	0.36666	0.23	T	0.27839	-1.0062	9	0.39692	T	0.17	0.0593	14.2052	0.65730	0.0:1.0:0.0:0.0	.	160	Q8IV31	TM139_HUMAN	A	160	.	ENSP00000352284:P160A	P	+	1	0	TMEM139	142693871	0.005000	0.15991	0.020000	0.16555	0.237000	0.25408	1.962000	0.40442	2.510000	0.84645	0.558000	0.71614	CCA		0.612	TMEM139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327145.1	NM_153345		Missense_Mutation
EPHA1	2041	broad.mit.edu	37	7	143098564	143098564	+	Silent	SNP	G	G	A			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chr7:143098564G>A	ENST00000275815.3	-	3	371	c.285C>T	c.(283-285)gtC>gtT	p.V95V		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	95	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)	p.V95V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GCTCCACGTGGACGCGGGAAG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	7											126.0	123.0	124.0					7																	143098564		2203	4300	6503	142808686	SO:0001819	synonymous_variant	2041			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.285C>T	7.37:g.143098564G>A			142808686	A1L3V3|B5A966|B5A967|Q15405	Silent	SNP	ENST00000275815.3	37	CCDS5884.1	SNP	41	Broad																																																																																				0.607	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1			Silent
GPR173	54328	broad.mit.edu	37	X	53106090	53106090	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chrX:53106090G>T	ENST00000332582.4	+	2	778	c.287G>T	c.(286-288)tGc>tTc	p.C96F		NM_018969.5	NP_061842.1	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	96					negative regulation of neuron migration (GO:2001223)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|gonadotropin-releasing hormone receptor activity (GO:0004968)	p.C96F(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)	16						GCACTCAGCTGCAAGATTGTG	0.597																																																1	Substitution - Missense(1)	ovary(1)	X											113.0	94.0	100.0					X																	53106090		2203	4300	6503	53122815	SO:0001583	missense	54328			AB040801	CCDS14349.1	Xp11	2012-08-21	2006-02-15		ENSG00000184194	ENSG00000184194		"""GPCR / Class A : Orphans"""	18186	protein-coding gene	gene with protein product		300253	"""G-protein coupled receptor 173"", ""G protein coupled receptor 173"""			10833454	Standard	NM_018969		Approved	SREB3	uc004dru.3	Q9NS66	OTTHUMG00000021596	ENST00000332582.4:c.287G>T	X.37:g.53106090G>T	ENSP00000331600:p.Cys96Phe		53122815	B1B0A5	Missense_Mutation	SNP	ENST00000332582.4	37	CCDS14349.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222332	0.58560	.	.	ENSG00000184194	ENST00000332582	T	0.62105	0.05	4.25	4.25	0.50352	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.81640	0.4865	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85731	0.1331	10	0.87932	D	0	-10.9164	13.2145	0.59851	0.0:0.0:1.0:0.0	.	96	Q9NS66	GP173_HUMAN	F	96	ENSP00000331600:C96F	ENSP00000331600:C96F	C	+	2	0	GPR173	53122815	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.657000	0.98554	1.974000	0.57490	0.529000	0.55759	TGC		0.597	GPR173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056717.2	NM_018969		Missense_Mutation
ABCB7	22	broad.mit.edu	37	X	74295252	74295252	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	x	x	---			x	TCGA-61-1919-01	TCGA-61-1919-11	g.chrX:74295252A>G	ENST00000373394.3	-	6	807	c.800T>C	c.(799-801)tTg>tCg	p.L267S	ABCB7_ENST00000339447.4_Missense_Mutation_p.L227S|ABCB7_ENST00000534570.1_5'Flank|ABCB7_ENST00000253577.3_Missense_Mutation_p.L268S			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	267	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)	p.L268S(1)		breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						ATTAAATACCAAAGCACTCAG	0.393																																																1	Substitution - Missense(1)	ovary(1)	X											108.0	92.0	97.0					X																	74295252		2203	4300	6503	74211977	SO:0001583	missense	22			AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.800T>C	X.37:g.74295252A>G	ENSP00000362492:p.Leu267Ser		74211977	G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Missense_Mutation	SNP	ENST00000373394.3	37		SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	22.0	4.227566	0.79576	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949	D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46	5.56	5.56	0.83823	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.92622	0.7656	L	0.58302	1.8	0.80722	D	1	P;D;D;P;D	0.76494	0.938;0.999;0.999;0.95;0.999	P;D;D;P;D	0.83275	0.804;0.991;0.996;0.876;0.994	D	0.91745	0.5407	10	0.35671	T	0.21	-22.3271	13.8405	0.63435	1.0:0.0:0.0:0.0	.	241;227;268;267;268	G3V1J3;G3XAC4;B3KM98;O75027;O75027-2	.;.;.;ABCB7_HUMAN;.	S	241;268;227;267;241	ENSP00000253577:L268S;ENSP00000343849:L227S;ENSP00000362492:L267S;ENSP00000436586:L241S	ENSP00000253577:L268S	L	-	2	0	ABCB7	74211977	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	8.962000	0.93254	1.865000	0.54081	0.417000	0.27973	TTG		0.393	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000057274.1	NM_004299		Missense_Mutation
KNTC1	9735	broad.mit.edu	37	12	123089592	123089595	+	Frame_Shift_Del	DEL	ATCA	ATCA	-			TCGA-61-1919-01	TCGA-61-1919-11							Unknown	Unknown	Unknown	Phase_I	Capture	---			Illumina GAIIx	TCGA-61-1919-01	TCGA-61-1919-11	g.chr12:123089592_123089595delATCA	ENST00000333479.7	+	50	5521_5524	c.5344_5347delATCA	c.(5344-5349)atcaatfs	p.IN1782fs	KNTC1_ENST00000537348.1_Frame_Shift_Del_p.IN207fs|KNTC1_ENST00000450485.2_Intron|KNTC1_ENST00000436959.3_5'UTR	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1782					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.N1783H(1)|p.N1783fs*21(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ACATCCTAGCATCAATCAAAGAAT	0.377																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|lung(1)	12																																								121655548	SO:0001589	frameshift_variant	9735				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.5344_5347delATCA	12.37:g.123089596_123089599delATCA	ENSP00000328236:p.Ile1782fs		121655545	A7E2C4|B3KSG2	Frame_Shift_Del	DEL	ENST00000333479.7	37	CCDS45002.1	DEL	8	Broad																																																																																				0.377	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2			Frame_Shift_Del
